#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVarCov_SOL	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CHD7	55636	hgsc.bcm.edu;bcgsc.ca	37	8	61728947	61728951	+	Splice_Site	DEL	TCTTA	TCTTA	-	rs121434344		TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	TCTTA	TCTTA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr8:61728947_61728951delTCTTA	ENST00000423902.2	+	8	2979_2983	c.2500_2504delTCTTA	c.(2500-2505)tcttat>t	p.SY834fs	CHD7_ENST00000524602.1_Intron|CHD7_ENST00000525508.1_Splice_Site_p.SY834fs	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	834	Chromo 1. {ECO:0000255|PROSITE- ProRule:PRU00053}.		S -> F (in HH5; phenotype consistent with normosmic idiopathic hypogonadotropic hypogonadism). {ECO:0000269|PubMed:18834967}.		adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.556_871dup(1)		NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			TTCTTTCAGCTCTTATCTTCATTGT	0.298																																					p.833_835del		.											.	.	.	1	Insertion - In frame(1)	lung(1)	c.2499_2503del	GRCh37	CD061379|CM072950	CHD7	D|M	rs121434344	.																																			SO:0001630	splice_region_variant	55636	exon8			TTCAGCTCTTATC	AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.2499-1TCTTA>-	8.37:g.61728947_61728951delTCTTA		Somatic	132	0		WXS	Illumina HiSeq	.	90	34	NM_017780	D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Frame_Shift_Del	DEL	ENST00000423902.2	37	CCDS47865.1																																																																																			.		0.298	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2	XM_098762	Frame_Shift_Del
GFM1	85476	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	158362500	158362511	+	Splice_Site	DEL	AGCAGGTACCGG	AGCAGGTACCGG	-	rs574200635|rs555757931	byFrequency	TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	AGCAGGTACCGG	AGCAGGTACCGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr3:158362500_158362511delAGCAGGTACCGG	ENST00000486715.1	+	1	434_438	c.77_81delAGCAGGTACCGG	c.(76-81)aagcag>a	p.KQ26del	GFM1_ENST00000264263.5_Splice_Site_p.KQ26del|GFM1_ENST00000478576.1_Splice_Site_p.KQ26del	NM_024996.5	NP_079272.4			G elongation factor, mitochondrial 1											breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|urinary_tract(2)	22			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)			TGGCAGAGGAAGCAGGTACCGGAGCATAGAGA	0.637											OREG0015898	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.26_27del		.											.	.	.	0			c.76_81del						.																																			SO:0001630	splice_region_variant	85476	exon1			AGAGGAAGCAGGT	AF309777	CCDS33885.1	3q25	2008-02-05			ENSG00000168827	ENSG00000168827			13780	protein-coding gene	gene with protein product		606639	"""G translation elongation factor, mitochondrial"""			11374907, 11735030	Standard	NM_024996		Approved	EFGM, GFM, EGF1	uc003fce.3	Q96RP9	OTTHUMG00000158804	ENST00000486715.1:c.81+1AGCAGGTACCGG>-	3.37:g.158362500_158362511delAGCAGGTACCGG		Somatic	77	0	1793	WXS	Illumina HiSeq	.	46	11	NM_024996		In_Frame_Del	DEL	ENST00000486715.1	37	CCDS33885.1																																																																																			.		0.637	GFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352271.1	NM_024996	In_Frame_Del
THAP5	168451	hgsc.bcm.edu	37	7	108210000	108210001	+	Frame_Shift_Ins	INS	-	-	A			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr7:108210000_108210001insA	ENST00000415914.3	-	1	166_167	c.13_14insT	c.(13-15)tgcfs	p.C5fs	THAP5_ENST00000438865.1_Frame_Shift_Ins_p.C5fs|DNAJB9_ENST00000249356.3_5'Flank|THAP5_ENST00000313516.5_5'Flank|THAP5_ENST00000493722.1_5'UTR	NM_001130475.1	NP_001123947.1	Q7Z6K1	THAP5_HUMAN	THAP domain containing 5	5					cell cycle (GO:0007049)|negative regulation of cell cycle (GO:0045786)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protease binding (GO:0002020)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)	8						AATCGCTGCGCAATAGCGGGGC	0.604																																					p.C5fs		.											.	.	.	0			c.14_15insT						.																																			SO:0001589	frameshift_variant	168451	exon1			GCTGCGCAATAGC	AL833137	CCDS34734.2, CCDS47687.1	7q22.3	2013-01-25			ENSG00000177683	ENSG00000177683		"""THAP (C2CH-type zinc finger) domain containing"""	23188	protein-coding gene	gene with protein product		612534				12575992	Standard	NM_001287598		Approved	DKFZp313O1132	uc003vfm.3	Q7Z6K1	OTTHUMG00000154951	ENST00000415914.3:c.14dupT	7.37:g.108210002_108210002dupA	ENSP00000400500:p.Cys5fs	Somatic	70	0		WXS	Illumina HiSeq	.	52	18	NM_001130475		Frame_Shift_Ins	INS	ENST00000415914.3	37	CCDS47687.1																																																																																			.		0.604	THAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337777.2	NM_182529	
ZNF727	442319	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	63538216	63538216	+	Missense_Mutation	SNP	A	A	C			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr7:63538216A>C	ENST00000550760.3	+	4	968	c.789A>C	c.(787-789)aaA>aaC	p.K263N	RP11-3N2.13_ENST00000445978.1_RNA	NM_001159522.1	NP_001152994.1	A8MUV8	ZN727_HUMAN	zinc finger protein 727	263					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|skin(1)|stomach(1)|urinary_tract(1)	8						AATGTCACAAAGCCTTTAGGT	0.398																																					p.K263N		.											.	.	.	0			c.A789C						.						53.0	58.0	56.0					7																	63538216		692	1591	2283	SO:0001583	missense	442319	exon4			TCACAAAGCCTTT			7q11.21	2014-09-09	2014-09-09	2014-09-09	ENSG00000214652	ENSG00000214652		"""Zinc fingers, C2H2-type"", ""-"""	22785	pseudogene	pseudogene			"""zinc finger protein 727, pseudogene"""	ZNF727P			Standard	NM_001159522		Approved		uc011kdm.2	A8MUV8	OTTHUMG00000156536	ENST00000550760.3:c.789A>C	7.37:g.63538216A>C	ENSP00000447987:p.Lys263Asn	Somatic	55	0		WXS	Illumina HiSeq	.	46	9	NM_001159522		Missense_Mutation	SNP	ENST00000550760.3	37	CCDS55113.1	.	.	.	.	.	.	.	.	.	.	A	11.77	1.737681	0.30774	.	.	ENSG00000257482	ENST00000550760	T	0.00995	5.46	1.02	-0.215	0.13157	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04588	0.0125	M	0.86805	2.84	0.18873	N	0.999981	D	0.89917	1.0	D	0.85130	0.997	T	0.27673	-1.0067	8	.	.	.	.	3.978	0.09483	0.7198:0.0:0.2802:0.0	.	263	A8MUV8	ZN727_HUMAN	N	263	ENSP00000447987:K263N	.	K	+	3	2	ZNF727	63175651	0.002000	0.14202	0.027000	0.17364	0.025000	0.11179	-0.011000	0.12721	0.369000	0.24510	0.358000	0.22013	AAA	.		0.398	ZNF727-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001159522	
KLK6	5653	hgsc.bcm.edu	37	19	51470530	51470530	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr19:51470530G>T	ENST00000376851.3	-	3	531	c.92C>A	c.(91-93)aCa>aAa	p.T31K	CTB-147C22.9_ENST00000594512.1_RNA|KLK6_ENST00000594641.1_Missense_Mutation_p.T31K|KLK6_ENST00000310157.2_Missense_Mutation_p.T31K|KLK6_ENST00000391808.1_5'UTR|KLK6_ENST00000424910.2_Intron|KLK6_ENST00000376853.4_Missense_Mutation_p.T31K	NM_001012964.1	NP_001012982.1	Q92876	KLK6_HUMAN	kallikrein-related peptidase 6	31	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				amyloid precursor protein metabolic process (GO:0042982)|central nervous system development (GO:0007417)|collagen catabolic process (GO:0030574)|hormone metabolic process (GO:0042445)|myelination (GO:0042552)|neuron death (GO:0070997)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|protein autoprocessing (GO:0016540)|regulation of cell differentiation (GO:0045595)|regulation of neuron projection development (GO:0010975)|response to wounding (GO:0009611)|tissue regeneration (GO:0042246)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|skin(4)	13		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00372)|GBM - Glioblastoma multiforme(134;0.00871)		GGGGTGAGATGTCTTGTCGCA	0.572																																					p.T31K		.											KLK6,colon,carcinoma,0,1	KLK6	0	0			c.C92A						.						143.0	127.0	132.0					19																	51470530		2203	4300	6503	SO:0001583	missense	5653	exon3			TGAGATGTCTTGT	U62801	CCDS12811.1, CCDS42599.1	19q13.3	2011-09-07	2006-10-27			ENSG00000167755		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6367	protein-coding gene	gene with protein product		602652	"""protease, serine, 18"", ""kallikrein 6 (neurosin, zyme)"""	PRSS9, PRSS18		9003450, 16800724, 16800723	Standard	NM_002774		Approved	Bssp, Klk7, neurosin	uc002pui.3	Q92876		ENST00000376851.3:c.92C>A	19.37:g.51470530G>T	ENSP00000366047:p.Thr31Lys	Somatic	47	0		WXS	Illumina HiSeq	.	43	2	NM_001012964	A6NJA1|A8MW09|Q6H301	Missense_Mutation	SNP	ENST00000376851.3	37	CCDS12811.1	.	.	.	.	.	.	.	.	.	.	G	12.17	1.856418	0.32791	.	.	ENSG00000167755	ENST00000310157;ENST00000376851;ENST00000376853	D;D;T	0.92805	-3.11;-3.11;-1.49	4.18	-7.56	0.01322	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	1.606870	0.04212	N	0.331990	T	0.81555	0.4847	N	0.14661	0.345	0.09310	N	1	P;B	0.34462	0.454;0.094	B;B	0.37780	0.258;0.006	T	0.73014	-0.4116	10	0.72032	D	0.01	.	1.2877	0.02054	0.17:0.3087:0.1598:0.3615	.	31;31	E7ETY0;Q92876	.;KLK6_HUMAN	K	31	ENSP00000309148:T31K;ENSP00000366047:T31K;ENSP00000366049:T31K	ENSP00000309148:T31K	T	-	2	0	KLK6	56162342	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.559000	0.02162	-0.946000	0.03677	0.455000	0.32223	ACA	.		0.572	KLK6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465060.1	NM_002774	
XRCC6	2547	hgsc.bcm.edu;bcgsc.ca	37	22	42046801	42046801	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr22:42046801G>T	ENST00000359308.4	+	7	1690	c.1035G>T	c.(1033-1035)ttG>ttT	p.L345F	XRCC6_ENST00000405878.1_Missense_Mutation_p.L345F|XRCC6_ENST00000405506.1_Missense_Mutation_p.L295F|XRCC6_ENST00000402580.3_Missense_Mutation_p.L304F|XRCC6_ENST00000428575.2_Missense_Mutation_p.L212F|Y_RNA_ENST00000363462.1_RNA|XRCC6_ENST00000360079.3_Missense_Mutation_p.L345F			P12956	XRCC6_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 6	345	Ku.				brain development (GO:0007420)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA ligation (GO:0006266)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear telomere cap complex (GO:0000783)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	5'-deoxyribose-5-phosphate lyase activity (GO:0051575)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	31						ATCCAGGTTTGATGCTCATGG	0.473								Non-homologous end-joining																													p.L345F		.											.	.	.	0			c.G1035T						.						121.0	98.0	106.0					22																	42046801		2203	4300	6503	SO:0001583	missense	2547	exon8			AGGTTTGATGCTC	J04607	CCDS14021.1, CCDS74870.1, CCDS74871.1	22q13.2	2011-09-12	2008-07-31	2005-05-06	ENSG00000196419	ENSG00000196419			4055	protein-coding gene	gene with protein product	"""Ku autoantigen, 70kDa"""	152690	"""thyroid autoantigen 70kD (Ku antigen)"", ""thyroid autoantigen 70kDa (Ku antigen)"""	G22P1		9200330, 9223317	Standard	NM_001469		Approved	D22S731, D22S671, KU70, ML8	uc003bao.1	P12956	OTTHUMG00000151190	ENST00000359308.4:c.1035G>T	22.37:g.42046801G>T	ENSP00000352257:p.Leu345Phe	Somatic	85	0		WXS	Illumina HiSeq	.	63	4	NM_001469	B1AHC8|Q6FG89|Q9UCQ2|Q9UCQ3	Missense_Mutation	SNP	ENST00000359308.4	37	CCDS14021.1	.	.	.	.	.	.	.	.	.	.	G	15.72	2.915921	0.52546	.	.	ENSG00000196419	ENST00000360079;ENST00000402580;ENST00000428575;ENST00000359308;ENST00000405878;ENST00000402409;ENST00000405506	.	.	.	4.97	3.94	0.45596	Spen Paralogue and Orthologue SPOC, C-terminal-like (2);DNA helicase, ATP-dependent, Ku type (2);	0.133138	0.52532	N	0.000070	T	0.57227	0.2039	M	0.68952	2.095	0.80722	D	1	P;B;B;B	0.35481	0.504;0.363;0.372;0.363	B;B;B;B	0.43990	0.323;0.323;0.358;0.438	T	0.51896	-0.8647	9	0.22706	T	0.39	-4.6536	6.6862	0.23146	0.1521:0.1509:0.697:0.0	.	295;345;304;345	B1AHC9;B1AHC7;B1AHC8;P12956	.;.;.;XRCC6_HUMAN	F	345;304;212;345;345;345;295	.	ENSP00000352257:L345F	L	+	3	2	XRCC6	40376747	0.997000	0.39634	0.986000	0.45419	0.911000	0.54048	2.447000	0.44917	1.192000	0.43071	0.650000	0.86243	TTG	.		0.473	XRCC6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321688.1	NM_001469	
BAP1	8314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	52440307	52440307	+	Nonsense_Mutation	SNP	T	T	A			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr3:52440307T>A	ENST00000460680.1	-	9	1216	c.745A>T	c.(745-747)Aag>Tag	p.K249*	BAP1_ENST00000296288.5_Nonsense_Mutation_p.K231*	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		CGGTTCACCTTCAGCACATGC	0.607			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.K249X	GBM(101;493 1458 7992 21037 25532)	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	.	.	.	0			c.A745T						.						133.0	97.0	109.0					3																	52440307		2203	4300	6503	SO:0001587	stop_gained	8314	exon9			TCACCTTCAGCAC	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.745A>T	3.37:g.52440307T>A	ENSP00000417132:p.Lys249*	Somatic	24	0		WXS	Illumina HiSeq	.	11	8	NM_004656	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Nonsense_Mutation	SNP	ENST00000460680.1	37	CCDS2853.1	.	.	.	.	.	.	.	.	.	.	T	41	8.800411	0.98958	.	.	ENSG00000163930	ENST00000460680;ENST00000296288	.	.	.	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.643	16.4054	0.83662	0.0:0.0:0.0:1.0	.	.	.	.	X	249;231	.	ENSP00000296288:K231X	K	-	1	0	BAP1	52415347	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	8.005000	0.88553	2.282000	0.76494	0.528000	0.53228	AAG	.		0.607	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		
TTN	7273	hgsc.bcm.edu	37	2	179452261	179452261	+	Missense_Mutation	SNP	C	C	T	rs371286595		TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr2:179452261C>T	ENST00000591111.1	-	256	59076	c.58852G>A	c.(58852-58854)Gta>Ata	p.V19618I	TTN_ENST00000342992.6_Missense_Mutation_p.V18691I|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.V12319I|TTN_ENST00000460472.2_Missense_Mutation_p.V12194I|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.V21259I|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.V12386I|TTN-AS1_ENST00000590743.1_RNA			Q8WZ42	TITIN_HUMAN	titin	19618					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.V12194L(1)|p.V12386L(1)|p.V12319L(1)|p.V18691L(1)|p.V18689L(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGACATTTACGAATACAGCC	0.408																																					p.V21259I		.											TTN_ENST00000359218,NS,carcinoma,0,5	TTN_ENST00000359218	0	5	Substitution - Missense(5)	breast(5)	c.G63775A						.	C	ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL	2,3736		0,2,1867	79.0	69.0	73.0		36580,56071,36955,37156	6.0	1.0	2		73	0,8186		0,0,4093	no	missense,missense,missense,missense	TTN	NM_003319.4,NM_133378.4,NM_133432.3,NM_133437.3	29,29,29,29	0,2,5960	TT,TC,CC		0.0,0.0535,0.0168	probably-damaging,probably-damaging,probably-damaging,probably-damaging	12194/26927,18691/33424,12319/27052,12386/27119	179452261	2,11922	1869	4093	5962	SO:0001583	missense	7273	exon306			CATTTACGAATAC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.58852G>A	2.37:g.179452261C>T	ENSP00000465570:p.Val19618Ile	Somatic	30	0		WXS	Illumina HiSeq	.	18	2	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	15.45	2.837077	0.50951	5.35E-4	0.0	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29	5.98	5.98	0.97165	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Fibronectin, type III (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.74329	0.3702	N	0.21282	0.65	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.81914	0.995;0.995;0.995;0.995	T	0.76672	-0.2873	9	0.87932	D	0	.	20.4581	0.99154	0.0:1.0:0.0:0.0	.	12194;12319;12386;19618	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	I	18691;12194;12386;12319;12192	ENSP00000343764:V18691I;ENSP00000434586:V12194I;ENSP00000340554:V12386I;ENSP00000352154:V12319I	ENSP00000340554:V12386I	V	-	1	0	TTN	179160507	1.000000	0.71417	0.971000	0.41717	0.973000	0.67179	7.770000	0.85390	2.835000	0.97688	0.650000	0.86243	GTA	.		0.408	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
KRTAP12-2	353323	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	46086661	46086661	+	Missense_Mutation	SNP	A	A	G			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr21:46086661A>G	ENST00000360770.3	-	1	183	c.143T>C	c.(142-144)gTg>gCg	p.V48A	TSPEAR_ENST00000323084.4_Intron	NM_181684.2	NP_859012.1	P59991	KR122_HUMAN	keratin associated protein 12-2	48	23 X 5 AA approximate repeats.					keratin filament (GO:0045095)				central_nervous_system(1)|endometrium(1)|lung(3)	5						CTTGAAGCTCACGGGCACACA	0.657																																					p.V48A		.											.	.	.	0			c.T143C						.						63.0	71.0	68.0					21																	46086661		2188	4281	6469	SO:0001583	missense	353323	exon1			AAGCTCACGGGCA	AJ566389	CCDS42965.1	21q22.3	2006-03-13			ENSG00000221864	ENSG00000221864		"""Keratin associated proteins"""	20530	protein-coding gene	gene with protein product							Standard	NM_181684		Approved	KRTAP12.2, KAP12.2	uc002zfu.3	P59991	OTTHUMG00000057636	ENST00000360770.3:c.143T>C	21.37:g.46086661A>G	ENSP00000354001:p.Val48Ala	Somatic	53	0		WXS	Illumina HiSeq	.	18	11	NM_181684	A6NIS1|A6NMS9|Q0VAS4	Missense_Mutation	SNP	ENST00000360770.3	37	CCDS42965.1	.	.	.	.	.	.	.	.	.	.	a	9.156	1.017495	0.19355	.	.	ENSG00000221864	ENST00000360770	T	0.02606	4.23	2.57	-1.53	0.08611	.	.	.	.	.	T	0.03739	0.0106	M	0.69248	2.105	0.09310	N	1	B	0.06786	0.001	B	0.12837	0.008	T	0.39251	-0.9623	9	0.49607	T	0.09	.	3.9094	0.09196	0.3792:0.2178:0.403:0.0	.	48	P59991	KR122_HUMAN	A	48	ENSP00000354001:V48A	ENSP00000354001:V48A	V	-	2	0	KRTAP12-2	44911089	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.167000	0.09940	-0.331000	0.08501	0.379000	0.24179	GTG	.		0.657	KRTAP12-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128039.1	NM_181684	
B4GALT5	9334	hgsc.bcm.edu	37	20	48256337	48256337	+	Splice_Site	SNP	C	C	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr20:48256337C>T	ENST00000371711.4	-	7	982	c.795G>A	c.(793-795)ctG>ctA	p.L265L		NM_004776.3	NP_004767.1	O43286	B4GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5	265					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20			BRCA - Breast invasive adenocarcinoma(9;2.51e-06)			TATAAGGAAGCCTAGGAGGAG	0.458																																					p.L265L		.											.	.	.	0			c.G795A						.						107.0	101.0	103.0					20																	48256337		2203	4300	6503	SO:0001630	splice_region_variant	9334	exon7			AGGAAGCCTAGGA	AB004550	CCDS13420.1	20q13.1-q13.2	2013-02-19			ENSG00000158470	ENSG00000158470		"""Beta 4-glycosyltransferases"""	928	protein-coding gene	gene with protein product	"""beta4-GalT IV"""	604016				9597550, 9435216	Standard	NM_004776		Approved	beta4GalT-V	uc002xuu.4	O43286	OTTHUMG00000033086	ENST00000371711.4:c.795-1G>A	20.37:g.48256337C>T		Somatic	108	0		WXS	Illumina HiSeq	.	73	4	NM_004776	E1P625|Q2M394|Q9UJQ8	Silent	SNP	ENST00000371711.4	37	CCDS13420.1																																																																																			.		0.458	B4GALT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080543.3	NM_004776	Silent
KLK10	5655	hgsc.bcm.edu	37	19	51518101	51518101	+	Silent	SNP	G	G	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr19:51518101G>T	ENST00000309958.3	-	6	1004	c.786C>A	c.(784-786)atC>atA	p.I262I	CTB-147C22.9_ENST00000594512.1_RNA|CTC-518B2.12_ENST00000596286.1_RNA|KLK10_ENST00000391805.1_Silent_p.I262I|KLK10_ENST00000358789.3_Silent_p.I262I	NM_002776.4	NP_002767.2	O43240	KLK10_HUMAN	kallikrein-related peptidase 10	262	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cell cycle (GO:0007049)	extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	13		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00885)		TGTATTTGCAGATCTGGGTGT	0.547																																					p.I262I		.											KLK10,NS,carcinoma,0,1	KLK10	0	0			c.C786A						.						133.0	122.0	126.0					19																	51518101		2203	4300	6503	SO:0001819	synonymous_variant	5655	exon6			TTTGCAGATCTGG	AF024605	CCDS12817.1	19q13	2011-03-07	2006-10-27			ENSG00000129451		"""Kallikreins"""	6358	protein-coding gene	gene with protein product		602673	"""kallikrein 10"""	PRSSL1		8764136, 9533035, 16800724, 16800723, 10675891	Standard	NM_145888		Approved	NES1	uc002pva.3	O43240		ENST00000309958.3:c.786C>A	19.37:g.51518101G>T		Somatic	50	0		WXS	Illumina HiSeq	.	46	2	NM_145888	A6NC12|Q53YL3|Q99920|Q9GZW9	Silent	SNP	ENST00000309958.3	37	CCDS12817.1																																																																																			.		0.547	KLK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464337.2	NM_002776	
SIX1	6495	hgsc.bcm.edu	37	14	61115903	61115903	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr14:61115903G>A	ENST00000247182.6	-	1	277	c.5C>T	c.(4-6)tCg>tTg	p.S2L	SIX1_ENST00000554986.1_Intron	NM_005982.3	NP_005973.1	Q15475	SIX1_HUMAN	SIX homeobox 1	2					aorta morphogenesis (GO:0035909)|apoptotic process (GO:0006915)|branching involved in ureteric bud morphogenesis (GO:0001658)|cochlea morphogenesis (GO:0090103)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic skeletal system morphogenesis (GO:0048704)|epithelial cell differentiation (GO:0030855)|facial nerve morphogenesis (GO:0021610)|generation of neurons (GO:0048699)|inner ear development (GO:0048839)|inner ear morphogenesis (GO:0042472)|kidney development (GO:0001822)|mesonephric tubule formation (GO:0072172)|metanephric mesenchyme development (GO:0072075)|middle ear morphogenesis (GO:0042474)|myoblast migration (GO:0051451)|negative regulation of branching involved in ureteric bud morphogenesis (GO:0090191)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|organ induction (GO:0001759)|otic vesicle development (GO:0071599)|outflow tract morphogenesis (GO:0003151)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of mesenchymal cell proliferation involved in ureter development (GO:2000729)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|protein localization to nucleus (GO:0034504)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of neuron differentiation (GO:0045664)|regulation of protein localization (GO:0032880)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|skeletal muscle tissue development (GO:0007519)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.S2*(1)		breast(2)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)	13				OV - Ovarian serous cystadenocarcinoma(108;0.0201)		CGGCAGCATCGACATGGCTGG	0.726																																					p.S2L		.											SIX1,NS,carcinoma,0,1	SIX1	0	1	Substitution - Nonsense(1)	lung(1)	c.C5T						.						15.0	15.0	15.0					14																	61115903		2164	4227	6391	SO:0001583	missense	6495	exon1			AGCATCGACATGG	X91868	CCDS9748.1	14q23.1	2011-06-20	2007-07-13		ENSG00000126778	ENSG00000126778		"""Homeoboxes / SINE class"""	10887	protein-coding gene	gene with protein product		601205	"""sine oculis homeobox (Drosophila) homolog 1"", ""sine oculis homeobox homolog 1 (Drosophila)"", ""deafness, autosomal dominant 23"""	DFNA23		8617500, 15141091	Standard	NM_005982		Approved		uc001xfb.4	Q15475	OTTHUMG00000140334	ENST00000247182.6:c.5C>T	14.37:g.61115903G>A	ENSP00000247182:p.Ser2Leu	Somatic	17	0		WXS	Illumina HiSeq	.	16	2	NM_005982	Q53Y16|Q96H64	Missense_Mutation	SNP	ENST00000247182.6	37	CCDS9748.1	.	.	.	.	.	.	.	.	.	.	G	19.03	3.748027	0.69533	.	.	ENSG00000126778	ENST00000247182	D	0.88046	-2.33	5.5	4.59	0.56863	.	0.000000	0.85682	D	0.000000	T	0.73410	0.3583	N	0.04508	-0.205	0.80722	D	1	B	0.24618	0.107	B	0.14023	0.01	T	0.69781	-0.5052	10	0.44086	T	0.13	-8.6498	14.4259	0.67215	0.0:0.0:0.8511:0.1489	.	2	Q15475	SIX1_HUMAN	L	2	ENSP00000247182:S2L	ENSP00000247182:S2L	S	-	2	0	SIX1	60185656	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.862000	0.62976	1.273000	0.44346	0.561000	0.74099	TCG	.		0.726	SIX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276951.3		
PALMD	54873	hgsc.bcm.edu	37	1	100152323	100152323	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr1:100152323C>T	ENST00000263174.4	+	4	718	c.343C>T	c.(343-345)Cgg>Tgg	p.R115W	PALMD_ENST00000605497.1_Missense_Mutation_p.R115W	NM_017734.4	NP_060204.1	Q9NP74	PALMD_HUMAN	palmdelphin	115					regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|membrane (GO:0016020)		p.R115W(2)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(8)|ovary(6)|pancreas(1)|prostate(2)	31		all_epithelial(167;0.000813)|all_lung(203;0.0214)|Lung NSC(277;0.0216)		Epithelial(280;0.067)|all cancers(265;0.117)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)		GTCAATTGAGCGGACAACAGA	0.333																																					p.R115W		.											PALMD,NS,carcinoma,0,2	PALMD	0	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.C343T						.						83.0	91.0	88.0					1																	100152323		2203	4300	6503	SO:0001583	missense	54873	exon4			ATTGAGCGGACAA	AJ312214	CCDS758.1	1p22-p21	2008-07-18			ENSG00000099260	ENSG00000099260			15846	protein-coding gene	gene with protein product		610182		C1orf11		11478809	Standard	NM_017734		Approved	FLJ20271, PALML	uc001dsg.3	Q9NP74	OTTHUMG00000010764	ENST00000263174.4:c.343C>T	1.37:g.100152323C>T	ENSP00000263174:p.Arg115Trp	Somatic	133	0		WXS	Illumina HiSeq	.	35	2	NM_017734	Q9H7E6|Q9NPM5|Q9NPM6|Q9NPS0	Missense_Mutation	SNP	ENST00000263174.4	37	CCDS758.1	.	.	.	.	.	.	.	.	.	.	C	19.15	3.772301	0.69992	.	.	ENSG00000099260	ENST00000263174	T	0.17370	2.28	5.87	3.52	0.40303	.	0.191850	0.56097	D	0.000039	T	0.24547	0.0595	L	0.56769	1.78	0.34706	D	0.727288	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.984	T	0.08743	-1.0707	10	0.87932	D	0	-9.4698	13.0487	0.58942	0.735:0.2649:0.0:0.0	.	115;35	Q9NP74;Q9NP74-2	PALMD_HUMAN;.	W	115	ENSP00000263174:R115W	ENSP00000263174:R115W	R	+	1	2	PALMD	99924911	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.301000	0.51842	0.545000	0.28902	-0.262000	0.10625	CGG	.		0.333	PALMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029672.1	NM_017734	
TRIOBP	11078	hgsc.bcm.edu	37	22	38121037	38121037	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr22:38121037G>T	ENST00000406386.3	+	7	2729	c.2474G>T	c.(2473-2475)aGa>aTa	p.R825I		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	825					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					AACATCCCCAGATCATCTTCT	0.512																																					p.R825I		.											TRIOBP_ENST00000344404,colon,carcinoma,0,1	TRIOBP_ENST00000344404	0	0			c.G2474T						.						151.0	160.0	157.0					22																	38121037		1997	4160	6157	SO:0001583	missense	11078	exon7			TCCCCAGATCATC	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.2474G>T	22.37:g.38121037G>T	ENSP00000384312:p.Arg825Ile	Somatic	86	0		WXS	Illumina HiSeq	.	44	2	NM_001039141	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	37	CCDS43015.1	.	.	.	.	.	.	.	.	.	.	G	19.82	3.898362	0.72639	.	.	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.29655	1.56	4.07	1.81	0.25067	.	.	.	.	.	T	0.26340	0.0643	L	0.54323	1.7	0.18873	N	0.999982	P	0.48911	0.917	B	0.44278	0.445	T	0.10086	-1.0645	9	0.16896	T	0.51	.	5.4789	0.16713	0.1157:0.2038:0.6805:0.0	.	825	Q9H2D6	TARA_HUMAN	I	825	ENSP00000384312:R825I	ENSP00000384312:R825I	R	+	2	0	TRIOBP	36450983	0.055000	0.20627	0.244000	0.24202	0.709000	0.40893	1.067000	0.30616	0.915000	0.36847	0.460000	0.39030	AGA	.		0.512	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
LBR	3930	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	225607439	225607439	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr1:225607439T>C	ENST00000338179.2	-	4	553	c.428A>G	c.(427-429)gAc>gGc	p.D143G	LBR_ENST00000487054.1_5'Flank|LBR_ENST00000272163.4_Missense_Mutation_p.D143G	NM_194442.2	NP_919424.1	Q14739	LBR_HUMAN	lamin B receptor	143					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|lamin binding (GO:0005521)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)|poly(A) RNA binding (GO:0044822)	p.D143G(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22	Breast(184;0.165)			GBM - Glioblastoma multiforme(131;0.117)		ATGAGGTGCGTCATTTCTCTC	0.348																																					p.D143G		.											LBR,NS,carcinoma,0,1	LBR	0	1	Substitution - Missense(1)	prostate(1)	c.A428G						.						140.0	144.0	143.0					1																	225607439		2203	4299	6502	SO:0001583	missense	3930	exon4			GGTGCGTCATTTC	L25931	CCDS1545.1	1q42.1	2013-01-23			ENSG00000143815	ENSG00000143815		"""Tudor domain containing"""	6518	protein-coding gene	gene with protein product	"""tudor domain containing 18"""	600024				8157663, 9878250	Standard	NM_194442		Approved	DHCR14B, TDRD18	uc001hoy.3	Q14739	OTTHUMG00000037520	ENST00000338179.2:c.428A>G	1.37:g.225607439T>C	ENSP00000339883:p.Asp143Gly	Somatic	63	1		WXS	Illumina HiSeq	.	99	5	NM_194442	B2R5P3|Q14740|Q53GU7|Q59FE6	Missense_Mutation	SNP	ENST00000338179.2	37	CCDS1545.1	.	.	.	.	.	.	.	.	.	.	T	7.985	0.751990	0.15778	.	.	ENSG00000143815	ENST00000272163;ENST00000338179;ENST00000425080	D;D;T	0.97066	-4.23;-4.23;0.49	5.78	0.451	0.16629	.	0.771571	0.13241	N	0.402844	D	0.91415	0.7291	L	0.27053	0.805	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.81837	-0.0749	10	0.25106	T	0.35	-10.4898	5.1942	0.15227	0.0:0.1625:0.2978:0.5397	.	143;143	C9JXK0;Q14739	.;LBR_HUMAN	G	143	ENSP00000272163:D143G;ENSP00000339883:D143G;ENSP00000388059:D143G	ENSP00000272163:D143G	D	-	2	0	LBR	223674062	0.017000	0.18338	0.001000	0.08648	0.004000	0.04260	0.395000	0.20850	0.104000	0.17725	0.459000	0.35465	GAC	.		0.348	LBR-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091398.1	NM_002296	
FTH1	2495	hgsc.bcm.edu	37	11	61734852	61734852	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr11:61734852C>A	ENST00000273550.7	-	1	280	c.46G>T	c.(46-48)Gac>Tac	p.D16Y	FTH1_ENST00000529631.1_Missense_Mutation_p.D16Y|FTH1_ENST00000532601.1_5'Flank|FTH1_ENST00000529191.1_Missense_Mutation_p.D16Y|FTH1_ENST00000526640.1_Intron|AP003733.1_ENST00000601917.1_5'Flank	NM_002032.2	NP_002023.2	P02794	FRIH_HUMAN	ferritin, heavy polypeptide 1	16	Ferritin-like diiron. {ECO:0000255|PROSITE-ProRule:PRU00085}.				cellular iron ion homeostasis (GO:0006879)|immune response (GO:0006955)|intracellular sequestering of iron ion (GO:0006880)|iron ion transport (GO:0006826)|membrane organization (GO:0061024)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fibroblast proliferation (GO:0048147)|post-Golgi vesicle-mediated transport (GO:0006892)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular ferritin complex (GO:0008043)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ferric iron binding (GO:0008199)|ferroxidase activity (GO:0004322)|iron ion binding (GO:0005506)	p.D16Y(1)		NS(2)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8					Iron Dextran(DB00893)	GCCTCTGAGTCCTGGTGGTAG	0.697																																					p.D16Y		.											FTH1,NS,malignant_melanoma,0,1	FTH1	0	1	Substitution - Missense(1)	NS(1)	c.G46T						.						10.0	11.0	11.0					11																	61734852		1923	4038	5961	SO:0001583	missense	2495	exon1			CTGAGTCCTGGTG		CCDS41655.1	11q13	2012-10-02			ENSG00000167996	ENSG00000167996			3976	protein-coding gene	gene with protein product	"""apoferritin"", ""placenta immunoregulatory factor"", ""proliferation-inducing protein 15"""	134770		FTHL6		3020541	Standard	NM_002032		Approved	FTH, PLIF, PIG15, FHC	uc001nsu.3	P02794		ENST00000273550.7:c.46G>T	11.37:g.61734852C>A	ENSP00000273550:p.Asp16Tyr	Somatic	49	0		WXS	Illumina HiSeq	.	26	3	NM_002032	B3KNR5|Q3KRA8|Q3SWW1	Missense_Mutation	SNP	ENST00000273550.7	37	CCDS41655.1	.	.	.	.	.	.	.	.	.	.	.	36	5.640479	0.96693	.	.	ENSG00000167996	ENST00000529191;ENST00000529631;ENST00000530019;ENST00000273550;ENST00000406545	T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38	4.76	4.76	0.60689	Ferritin/ribonucleotide reductase-like (1);Ferritin-related (1);Ferritin-like (1);	0.141911	0.64402	D	0.000007	D	0.84097	0.5397	H	0.96142	3.775	0.80722	D	1	P	0.49447	0.924	P	0.52309	0.695	D	0.89969	0.4092	10	0.87932	D	0	.	17.7341	0.88387	0.0:1.0:0.0:0.0	.	16	P02794	FRIH_HUMAN	Y	16;16;16;16;65	ENSP00000431659:D16Y;ENSP00000431575:D16Y;ENSP00000433470:D16Y;ENSP00000273550:D16Y	ENSP00000273550:D16Y	D	-	1	0	FTH1	61491428	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.164000	0.77533	2.319000	0.78375	0.484000	0.47621	GAC	.		0.697	FTH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388444.1	NM_002032	
ANKIB1	54467	hgsc.bcm.edu	37	7	92027127	92027127	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr7:92027127G>T	ENST00000265742.3	+	19	2862	c.2486G>T	c.(2485-2487)cGt>cTt	p.R829L		NM_019004.1	NP_061877.1	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1	829							zinc ion binding (GO:0008270)			cervix(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(19)|skin(1)	41	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TCTTCCCTGCGTGACTACACC	0.527																																					p.R829L		.											ANKIB1,NS,carcinoma,0,1	ANKIB1	0	0			c.G2486T						.						164.0	174.0	171.0					7																	92027127		2000	4176	6176	SO:0001583	missense	54467	exon19			CCCTGCGTGACTA	AB037807	CCDS47639.1	7q21.3	2013-01-10			ENSG00000001629	ENSG00000001629		"""Ankyrin repeat domain containing"""	22215	protein-coding gene	gene with protein product							Standard	NM_019004		Approved	DKFZP434A0225, KIAA1386	uc003ulw.2	Q9P2G1	OTTHUMG00000155859	ENST00000265742.3:c.2486G>T	7.37:g.92027127G>T	ENSP00000265742:p.Arg829Leu	Somatic	37	0		WXS	Illumina HiSeq	.	27	2	NM_019004	Q6GMS4|Q6P3S9|Q9NTD7|Q9NW49	Missense_Mutation	SNP	ENST00000265742.3	37	CCDS47639.1	.	.	.	.	.	.	.	.	.	.	G	14.92	2.678448	0.47886	.	.	ENSG00000001629	ENST00000265742	T	0.09163	3.01	5.87	2.6	0.31112	.	0.530450	0.22326	N	0.061531	T	0.05227	0.0139	N	0.14661	0.345	0.32962	D	0.521113	P;B	0.35272	0.493;0.0	B;B	0.34536	0.185;0.0	T	0.21930	-1.0231	10	0.39692	T	0.17	.	3.5794	0.07946	0.3711:0.1886:0.4403:0.0	.	181;829	Q4VBX8;Q9P2G1	.;AKIB1_HUMAN	L	829	ENSP00000265742:R829L	ENSP00000265742:R829L	R	+	2	0	ANKIB1	91865063	0.997000	0.39634	0.858000	0.33744	0.994000	0.84299	2.458000	0.45014	0.926000	0.37118	0.655000	0.94253	CGT	.		0.527	ANKIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342018.1		
MAP1A	4130	hgsc.bcm.edu	37	15	43818597	43818597	+	Missense_Mutation	SNP	G	G	T	rs372656438		TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr15:43818597G>T	ENST00000300231.5	+	4	5376	c.4926G>T	c.(4924-4926)agG>agT	p.R1642S	MAP1A_ENST00000399453.1_Missense_Mutation_p.R1642S|MAP1A_ENST00000382031.1_Missense_Mutation_p.R1880S			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	1642					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	AGTACTGGAGGGGGCAGGATG	0.567																																					p.R1642S		.											.	.	.	0			c.G4926T						.	G	SER/ARG	0,3920		0,0,1960	46.0	59.0	55.0		4926	3.6	1.0	15		55	4,8280		0,4,4138	no	missense	MAP1A	NM_002373.5	110	0,4,6098	TT,TG,GG		0.0483,0.0,0.0328	benign	1642/2804	43818597	4,12200	1960	4142	6102	SO:0001583	missense	4130	exon4			CTGGAGGGGGCAG	U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.4926G>T	15.37:g.43818597G>T	ENSP00000300231:p.Arg1642Ser	Somatic	62	0		WXS	Illumina HiSeq	.	78	3	NM_002373	O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	ENST00000300231.5	37	CCDS42031.1	.	.	.	.	.	.	.	.	.	.	G	2.252	-0.371383	0.05034	0.0	4.83E-4	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231	T;T;T	0.01430	4.9;4.9;4.9	4.55	3.64	0.41730	.	.	.	.	.	T	0.01124	0.0037	N	0.14661	0.345	0.20873	N	0.999834	B	0.09022	0.002	B	0.09377	0.004	T	0.48603	-0.9021	9	0.26408	T	0.33	-10.3934	7.8974	0.29715	0.1899:0.0:0.8101:0.0	.	1642	P78559	MAP1A_HUMAN	S	1880;1642;1642	ENSP00000371462:R1880S;ENSP00000382380:R1642S;ENSP00000300231:R1642S	ENSP00000300231:R1642S	R	+	3	2	MAP1A	41605889	0.779000	0.28652	0.966000	0.40874	0.393000	0.30537	1.654000	0.37334	1.132000	0.42129	0.563000	0.77884	AGG	.		0.567	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132894.5	NM_002373	
RBFOX1	54715	hgsc.bcm.edu	37	16	7629838	7629838	+	Silent	SNP	G	G	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr16:7629838G>T	ENST00000550418.1	+	6	1318	c.330G>T	c.(328-330)acG>acT	p.T110T	RBFOX1_ENST00000422070.4_Silent_p.T153T|RBFOX1_ENST00000547338.1_Silent_p.T110T|RBFOX1_ENST00000547372.1_Silent_p.T153T|RBFOX1_ENST00000311745.5_Silent_p.T130T|RBFOX1_ENST00000552089.1_Silent_p.T145T|RBFOX1_ENST00000355637.4_Silent_p.T130T|RBFOX1_ENST00000535565.2_Intron|RBFOX1_ENST00000436368.2_Silent_p.T130T|RBFOX1_ENST00000553186.1_Silent_p.T110T|RBFOX1_ENST00000340209.4_Silent_p.T115T	NM_018723.3	NP_061193.2	Q9NWB1	RFOX1_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 1	110					mRNA processing (GO:0006397)|neuromuscular process controlling balance (GO:0050885)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	nucleotide binding (GO:0000166)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|lung(17)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)	55						CTGAAAACACGGAAAACAAGT	0.512																																					p.T130T	Ovarian(157;934 2567 15163 39509)	.											RBFOX1_ENST00000550418,NS,carcinoma,0,3	RBFOX1_ENST00000550418	0	0			c.G390T						.						149.0	136.0	140.0					16																	7629838		2197	4300	6497	SO:0001819	synonymous_variant	54715	exon3			AAACACGGAAAAC	AF107203	CCDS10531.1, CCDS10532.1, CCDS45405.1, CCDS55983.1, CCDS55984.1	16p13.3	2013-02-12			ENSG00000078328	ENSG00000078328		"""RNA binding motif (RRM) containing"""	18222	protein-coding gene	gene with protein product	"""ataxin 2-binding protein 1"", ""hexaribonucleotide binding protein 1"""	605104				10814712, 16260614	Standard	NM_018723		Approved	A2BP1, FOX-1, HRNBP1	uc002cyy.2	Q9NWB1	OTTHUMG00000129551	ENST00000550418.1:c.330G>T	16.37:g.7629838G>T		Somatic	54	0		WXS	Illumina HiSeq	.	20	2	NM_145891	Q7Z7I7|Q8TAE3|Q8TAF2|Q8WYB2|Q9NS20	Silent	SNP	ENST00000550418.1	37	CCDS55983.1																																																																																			.		0.512	RBFOX1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409492.2	NM_145891	
PSTK	118672	hgsc.bcm.edu	37	10	124742803	124742803	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr10:124742803G>A	ENST00000368887.3	+	3	964	c.524G>A	c.(523-525)tGc>tAc	p.C175Y	PSTK_ENST00000405485.1_Missense_Mutation_p.C175Y|PSTK_ENST00000497219.1_3'UTR	NM_153336.2	NP_699167.2	Q8IV42	PSTK_HUMAN	phosphoseryl-tRNA kinase	175					selenocysteine incorporation (GO:0001514)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|tRNA binding (GO:0000049)	p.C175Y(1)		endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|skin(1)|stomach(2)	13		all_neural(114;0.169)|Glioma(114;0.222)		Colorectal(40;0.0686)|COAD - Colon adenocarcinoma(40;0.0725)		TTGGGCTTTTGCCAGCTCTTT	0.388																																					p.C175Y		.											PSTK,rectum,carcinoma,0,1	PSTK	0	1	Substitution - Missense(1)	large_intestine(1)	c.G524A						.						55.0	54.0	54.0					10																	124742803		2203	4300	6503	SO:0001583	missense	118672	exon3			GCTTTTGCCAGCT	AK127173	CCDS7633.1	10q26.13	2007-04-17	2007-04-17	2007-04-17	ENSG00000179988	ENSG00000179988			28578	protein-coding gene	gene with protein product		611310	"""chromosome 10 open reading frame 89"""	C10orf89		15317934	Standard	NM_153336		Approved	MGC35392	uc001lgy.1	Q8IV42	OTTHUMG00000019191	ENST00000368887.3:c.524G>A	10.37:g.124742803G>A	ENSP00000357882:p.Cys175Tyr	Somatic	52	0		WXS	Illumina HiSeq	.	39	2	NM_153336	Q6ZSS9	Missense_Mutation	SNP	ENST00000368887.3	37	CCDS7633.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.49|18.49	3.635700|3.635700	0.67130|0.67130	.|.	.|.	ENSG00000179988|ENSG00000179988	ENST00000406217|ENST00000368887;ENST00000405485	.|T;T	.|0.37058	.|1.22;1.22	5.86|5.86	4.96|4.96	0.65561|0.65561	.|.	.|0.094648	.|0.85682	.|D	.|0.000000	T|T	0.63248|0.63248	0.2495|0.2495	M|M	0.85859|0.85859	2.78|2.78	0.46874|0.46874	D|D	0.999238|0.999238	.|D	.|0.89917	.|1.0	.|D	.|0.81914	.|0.995	T|T	0.69057|0.69057	-0.5246|-0.5246	5|10	.|0.59425	.|D	.|0.04	-16.7884|-16.7884	13.6725|13.6725	0.62434|0.62434	0.0748:0.0:0.9252:0.0|0.0748:0.0:0.9252:0.0	.|.	.|175	.|Q8IV42	.|PSTK_HUMAN	T|Y	176|175	.|ENSP00000357882:C175Y;ENSP00000384764:C175Y	.|ENSP00000357882:C175Y	A|C	+|+	1|2	0|0	PSTK|PSTK	124732793|124732793	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	7.838000|7.838000	0.86804|0.86804	1.485000|1.485000	0.48380|0.48380	0.563000|0.563000	0.77884|0.77884	GCC|TGC	.		0.388	PSTK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050811.1	NM_153336	
CYP2F1	1572	hgsc.bcm.edu	37	19	41628798	41628798	+	Silent	SNP	C	C	T	rs374776224		TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr19:41628798C>T	ENST00000331105.2	+	7	966	c.894C>T	c.(892-894)ggC>ggT	p.G298G		NM_000774.3	NP_000765.2	P24903	CP2F1_HUMAN	cytochrome P450, family 2, subfamily F, polypeptide 1	298					naphthalene metabolic process (GO:0018931)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|trichloroethylene metabolic process (GO:0018979)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)			central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|liver(2)|lung(11)|ovary(2)|skin(2)	29						TGCTCTTTGGCGGCACCAAGA	0.582																																					p.G298G		.											.	.	.	0			c.C894T						.	C		0,4406		0,0,2203	236.0	167.0	190.0		894	-2.6	0.4	19		190	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CYP2F1	NM_000774.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		298/492	41628798	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	1572	exon7			CTTTGGCGGCACC	J02906	CCDS12572.1	19q13.1-q13.2	2008-02-05	2003-01-14		ENSG00000197446	ENSG00000197446		"""Cytochrome P450s"""	2632	protein-coding gene	gene with protein product		124070	"""cytochrome P450, subfamily IIF, polypeptide 1"""	CYP2F			Standard	NM_000774		Approved		uc002opu.1	P24903	OTTHUMG00000167412	ENST00000331105.2:c.894C>T	19.37:g.41628798C>T		Somatic	45	0		WXS	Illumina HiSeq	.	46	4	NM_000774	A7KAU6|A7KAU7|A7KAU8|A7KAU9|A7KAV0|Q32MN5|Q8WWJ2	Silent	SNP	ENST00000331105.2	37	CCDS12572.1																																																																																			.		0.582	CYP2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394527.2		
JAKMIP2	9832	hgsc.bcm.edu	37	5	146970683	146970683	+	3'UTR	SNP	C	C	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr5:146970683C>T	ENST00000265272.5	-	0	3446				JAKMIP2_ENST00000507386.1_3'UTR	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2							Golgi apparatus (GO:0005794)				NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACAGAAAAGCAAATCCCTGT	0.383																																					.		.											.	.	.	0			.						.																																			SO:0001624	3_prime_UTR_variant	9832	.			GAAAAGCAAATCC	AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.*546G>A	5.37:g.146970683C>T		Somatic	74	0		WXS	Illumina HiSeq	.	65	4	.	A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	RNA	SNP	ENST00000265272.5	37	CCDS4285.1																																																																																			.		0.383	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251941.1	NM_014790	
CFAP46	54777	hgsc.bcm.edu	37	10	134646882	134646882	+	Missense_Mutation	SNP	C	C	T	rs138288778		TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr10:134646882C>T	ENST00000368586.5	-	50	7197	c.7097G>A	c.(7096-7098)cGc>cAc	p.R2366H	TTC40_ENST00000263170.5_Missense_Mutation_p.R527H	NM_001200049.2	NP_001186978.2												p.R2366H(1)|p.R527H(1)		breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						TTTATGGAGGCGATTCCACAG	0.398																																					p.R2366H		.											C10orf92,NS,carcinoma,0,1	C10orf92	0	2	Substitution - Missense(2)	endometrium(2)	c.G7097A						.	C	HIS/ARG	0,4406		0,0,2203	102.0	104.0	103.0		2033	3.4	0.7	10	dbSNP_134	103	1,8599	1.2+/-3.3	0,1,4299	no	missense	C10orf92	NM_001200049.1	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	678/1028	134646882	1,13005	2203	4300	6503	SO:0001583	missense	54777	exon50			TGGAGGCGATTCC																												ENST00000368586.5:c.7097G>A	10.37:g.134646882C>T	ENSP00000357575:p.Arg2366His	Somatic	52	0		WXS	Illumina HiSeq	.	31	2	NM_001200049		Missense_Mutation	SNP	ENST00000368586.5	37	CCDS58101.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.192|9.192	1.026286|1.026286	0.19512|0.19512	0.0|0.0	1.16E-4|1.16E-4	ENSG00000171811|ENSG00000171811	ENST00000448925|ENST00000368586;ENST00000263170	.|T;T	.|0.38560	.|1.13;1.13	4.32|4.32	3.41|3.41	0.39046|0.39046	.|.	.|0.093973	.|0.39341	.|N	.|0.001391	T|T	0.37461|0.37461	0.1004|0.1004	M|M	0.71581|0.71581	2.175|2.175	0.80722|0.80722	D|D	1|1	.|P	.|0.44195	.|0.828	.|B	.|0.35353	.|0.201	T|T	0.36432|0.36432	-0.9748|-0.9748	5|10	.|0.87932	.|D	.|0	.|.	9.3947|9.3947	0.38394|0.38394	0.0:0.897:0.0:0.103|0.0:0.897:0.0:0.103	.|.	.|527	.|Q8IYW2	.|CJ092_HUMAN	T|H	135|2366;527	.|ENSP00000357575:R2366H;ENSP00000263170:R527H	.|ENSP00000263170:R527H	A|R	-|-	1|2	0|0	C10orf93|C10orf93	134496872|134496872	0.972000|0.972000	0.33761|0.33761	0.730000|0.730000	0.30809|0.30809	0.082000|0.082000	0.17680|0.17680	2.284000|2.284000	0.43478|0.43478	0.815000|0.815000	0.34398|0.34398	0.650000|0.650000	0.86243|0.86243	GCC|CGC	0.000		0.398	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051095.3		
LRRFIP1	9208	hgsc.bcm.edu	37	2	238672115	238672115	+	Missense_Mutation	SNP	A	A	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr2:238672115A>T	ENST00000392000.4	+	11	1876	c.1759A>T	c.(1759-1761)Acc>Tcc	p.T587S	LRRFIP1_ENST00000289175.6_Missense_Mutation_p.T531S|LRRFIP1_ENST00000308482.9_Intron|LRRFIP1_ENST00000244815.5_Missense_Mutation_p.T563S	NM_001137552.1	NP_001131024.1	Q32MZ4	LRRF1_HUMAN	leucine rich repeat (in FLII) interacting protein 1	587	Lys-rich.				innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|protein homodimerization activity (GO:0042803)			NS(1)|breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	29		Breast(86;0.00257)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;9.75e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.01e-10)|Kidney(56;4.85e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.31e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000151)|Lung(119;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0325)|COAD - Colon adenocarcinoma(134;0.228)		ACCCGTAGAAACCCTTAAAGA	0.378																																					p.T587S		.											LRRFIP1_ENST00000392000,NS,carcinoma,0,2	LRRFIP1_ENST00000392000	0	0			c.A1759T						.						43.0	46.0	45.0					2																	238672115		2201	4295	6496	SO:0001583	missense	9208	exon11			GTAGAAACCCTTA	AJ223075	CCDS2521.1, CCDS46551.1, CCDS46552.1, CCDS46553.1	2q37.3	2010-09-30			ENSG00000124831	ENSG00000124831			6702	protein-coding gene	gene with protein product	"""GC-binding factor 2"""	603256				9705290, 9525888, 16199883	Standard	NM_004735		Approved	FLAP-1, FLIIAP1, TRIP, GCF-2, HUFI-1	uc002vxe.3	Q32MZ4	OTTHUMG00000133339	ENST00000392000.4:c.1759A>T	2.37:g.238672115A>T	ENSP00000375857:p.Thr587Ser	Somatic	72	0		WXS	Illumina HiSeq	.	44	2	NM_001137552	E9PGZ2|O75766|O75799|Q32MZ5|Q53T49|Q6PKG2|Q9Y607	Missense_Mutation	SNP	ENST00000392000.4	37	CCDS46552.1	.	.	.	.	.	.	.	.	.	.	A	9.922	1.212350	0.22289	.	.	ENSG00000124831	ENST00000289175;ENST00000244815;ENST00000392000	T;T;T	0.12774	2.66;2.65;2.68	5.86	-7.64	0.01286	.	0.878379	0.10106	N	0.715379	T	0.06735	0.0172	L	0.32530	0.975	0.09310	N	1	B;B;B	0.25667	0.131;0.013;0.063	B;B;B	0.21151	0.033;0.009;0.019	T	0.37731	-0.9693	10	0.48119	T	0.1	-13.8144	2.86	0.05584	0.252:0.2674:0.0614:0.4192	.	531;587;563	Q32MZ4-3;Q32MZ4;Q32MZ4-2	.;LRRF1_HUMAN;.	S	531;563;587	ENSP00000289175:T531S;ENSP00000244815:T563S;ENSP00000375857:T587S	ENSP00000244815:T563S	T	+	1	0	LRRFIP1	238336854	0.000000	0.05858	0.000000	0.03702	0.240000	0.25518	-0.688000	0.05150	-0.474000	0.06862	0.533000	0.62120	ACC	.		0.378	LRRFIP1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000317198.1	NM_004735	
ELMSAN1	91748	hgsc.bcm.edu;bcgsc.ca	37	14	74205859	74205859	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr14:74205859G>T	ENST00000286523.5	-	2	1635	c.853C>A	c.(853-855)Ccc>Acc	p.P285T	ELMSAN1_ENST00000394071.2_Missense_Mutation_p.P285T|ELMSAN1_ENST00000486739.1_5'Flank	NM_194278.3	NP_919254.2	Q6PJG2	EMSA1_HUMAN	ELM2 and Myb/SANT-like domain containing 1	285	Gln-rich.|Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)										AAGTCCTGGGGTTGCTGCGAG	0.622																																					p.P285T		.											.	.	.	0			c.C853A						.						29.0	30.0	30.0					14																	74205859		2203	4300	6503	SO:0001583	missense	91748	exon2			CCTGGGGTTGCTG	BF971739	CCDS9819.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000156030	ENSG00000156030			19853	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 117"", ""chromosome 14 open reading frame 43"""	C14orf117, C14orf43			Standard	NM_194278		Approved	LSR68	uc001xou.3	Q6PJG2	OTTHUMG00000150359	ENST00000286523.5:c.853C>A	14.37:g.74205859G>T	ENSP00000286523:p.Pro285Thr	Somatic	67	0		WXS	Illumina HiSeq	.	46	4	NM_194278	Q6PK13|Q6PK59|Q6ZS23	Missense_Mutation	SNP	ENST00000286523.5	37	CCDS9819.1	.	.	.	.	.	.	.	.	.	.	G	7.939	0.742308	0.15642	.	.	ENSG00000156030	ENST00000394071;ENST00000286523;ENST00000423556;ENST00000435371	T;T;T;T	0.12984	2.63;2.63;2.63;2.63	5.02	5.02	0.67125	.	0.283609	0.30492	N	0.009506	T	0.09862	0.0242	N	0.19112	0.55	0.25084	N	0.990901	B;B	0.32245	0.361;0.361	B;B	0.29785	0.107;0.107	T	0.23868	-1.0176	10	0.12766	T	0.61	-7.6198	18.3491	0.90331	0.0:0.0:1.0:0.0	.	285;285	A0PJD3;Q6PJG2	.;CN043_HUMAN	T	285	ENSP00000377634:P285T;ENSP00000286523:P285T;ENSP00000407767:P285T;ENSP00000402380:P285T	ENSP00000286523:P285T	P	-	1	0	C14orf43	73275612	1.000000	0.71417	1.000000	0.80357	0.658000	0.38924	5.597000	0.67577	2.329000	0.79093	0.561000	0.74099	CCC	.		0.622	ELMSAN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317793.1	NM_194278	
DNAH2	146754	hgsc.bcm.edu;broad.mit.edu	37	17	7644290	7644290	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr17:7644290C>T	ENST00000572933.1	+	11	3129	c.1669C>T	c.(1669-1671)Cgc>Tgc	p.R557C	DNAH2_ENST00000389173.2_Missense_Mutation_p.R557C|DNAH2_ENST00000570791.1_Missense_Mutation_p.R639C|DNAH2_ENST00000082259.3_Missense_Mutation_p.R639C			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	557	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CCTCCGGCGTCGCATCGACAG	0.612																																					p.R557C		.											.	.	.	0			c.C1669T						.						79.0	75.0	76.0					17																	7644290		2203	4300	6503	SO:0001583	missense	146754	exon10			CGGCGTCGCATCG	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.1669C>T	17.37:g.7644290C>T	ENSP00000458355:p.Arg557Cys	Somatic	9	0		WXS	Illumina HiSeq	.	10	7	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	37	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	C	17.06	3.292608	0.59976	.	.	ENSG00000183914	ENST00000360606;ENST00000389173;ENST00000082259	T;T	0.66460	-0.21;-0.21	5.23	5.23	0.72850	Dynein heavy chain, domain-1 (1);	0.204155	0.42821	D	0.000652	D	0.83945	0.5364	M	0.84846	2.72	0.53005	D	0.999961	D;D	0.89917	1.0;1.0	D;D	0.83275	0.993;0.996	D	0.86688	0.1921	10	0.87932	D	0	.	17.5708	0.87933	0.0:1.0:0.0:0.0	.	557;639	Q9P225;Q9P225-3	DYH2_HUMAN;.	C	557;557;639	ENSP00000373825:R557C;ENSP00000082259:R639C	ENSP00000082259:R639C	R	+	1	0	DNAH2	7585015	1.000000	0.71417	0.893000	0.35052	0.028000	0.11728	6.153000	0.71819	2.461000	0.83175	0.557000	0.71058	CGC	.		0.612	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
GTF3C3	9330	hgsc.bcm.edu	37	2	197657764	197657764	+	Missense_Mutation	SNP	C	C	A	rs372304935|rs555178972		TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr2:197657764C>A	ENST00000263956.3	-	3	416	c.327G>T	c.(325-327)gaG>gaT	p.E109D	GTF3C3_ENST00000470386.1_5'Flank|GTF3C3_ENST00000409364.3_Missense_Mutation_p.E109D	NM_012086.4	NP_036218.1	Q9Y5Q9	TF3C3_HUMAN	general transcription factor IIIC, polypeptide 3, 102kDa	109	Glu-rich.				5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)	p.E109E(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(9)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						GTGTTtcttcctcctcctcct	0.438																																					p.E109D		.											GTF3C3,colon,carcinoma,0,1	GTF3C3	0	1	Substitution - coding silent(1)	large_intestine(1)	c.G327T						.						64.0	62.0	63.0					2																	197657764		2203	4300	6503	SO:0001583	missense	9330	exon3			TTCTTCCTCCTCC	AF133123	CCDS2316.1, CCDS56153.1	2q33.1	2013-01-10	2002-08-29		ENSG00000119041	ENSG00000119041		"""General transcription factors"", ""Tetratricopeptide (TTC) repeat domain containing"""	4666	protein-coding gene	gene with protein product		604888	"""general transcription factor IIIC, polypeptide 3 (102kD)"""			10373544	Standard	NM_001206774		Approved	TFiiiC2-102, TFIIIC102	uc002uts.3	Q9Y5Q9	OTTHUMG00000154633	ENST00000263956.3:c.327G>T	2.37:g.197657764C>A	ENSP00000263956:p.Glu109Asp	Somatic	27	0		WXS	Illumina HiSeq	.	17	2	NM_001206774	Q4ZG48|Q86XJ8|Q8WX84|Q96B44|Q9H5I8|Q9NT97	Missense_Mutation	SNP	ENST00000263956.3	37	CCDS2316.1	.	.	.	.	.	.	.	.	.	.	C	10.54	1.379229	0.24944	.	.	ENSG00000119041	ENST00000263956;ENST00000409364	T;T	0.47177	0.9;0.85	2.47	-4.35	0.03656	.	0.192036	0.42821	D	0.000652	T	0.21761	0.0524	N	0.22421	0.69	0.26297	N	0.978037	B;B	0.19200	0.0;0.034	B;B	0.17098	0.001;0.017	T	0.23797	-1.0178	10	0.12430	T	0.62	-8.3787	5.0221	0.14367	0.1366:0.464:0.0:0.3994	.	109;109	Q9Y5Q9-2;Q9Y5Q9	.;TF3C3_HUMAN	D	109	ENSP00000263956:E109D;ENSP00000386465:E109D	ENSP00000263956:E109D	E	-	3	2	GTF3C3	197366009	0.746000	0.28272	0.929000	0.37066	0.971000	0.66376	-0.334000	0.07883	-0.987000	0.03494	0.484000	0.47621	GAG	.		0.438	GTF3C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256104.1		
COL11A1	1301	hgsc.bcm.edu;bcgsc.ca	37	1	103455077	103455077	+	Silent	SNP	G	G	A			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr1:103455077G>A	ENST00000370096.3	-	29	2703	c.2391C>T	c.(2389-2391)gaC>gaT	p.D797D	COL11A1_ENST00000358392.2_Silent_p.D809D|COL11A1_ENST00000512756.1_Silent_p.D681D|COL11A1_ENST00000353414.4_Silent_p.D758D	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	797	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TACTTACTCTGTCACCTTTTA	0.289																																					p.D809D		.											.	.	.	0			c.C2427T						.						70.0	71.0	71.0					1																	103455077		2203	4298	6501	SO:0001819	synonymous_variant	1301	exon29			TACTCTGTCACCT	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.2391C>T	1.37:g.103455077G>A		Somatic	225	0		WXS	Illumina HiSeq	.	79	4	NM_080629	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Silent	SNP	ENST00000370096.3	37	CCDS778.1																																																																																			.		0.289	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
RAB3IP	117177	hgsc.bcm.edu	37	12	70178544	70178544	+	Silent	SNP	G	G	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr12:70178544G>T	ENST00000247833.7	+	4	931	c.555G>T	c.(553-555)gtG>gtT	p.V185V	RAB3IP_ENST00000483530.2_Silent_p.V185V|RAB3IP_ENST00000362025.5_Silent_p.V201V|RAB3IP_ENST00000551641.1_5'UTR|RAB3IP_ENST00000553099.1_5'UTR|RAB3IP_ENST00000550536.1_Silent_p.V201V|RAB3IP_ENST00000325555.9_5'UTR|RAB3IP_ENST00000378815.6_Silent_p.V185V					RAB3A interacting protein											NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	22	Esophageal squamous(21;0.187)		Lung(24;0.000381)|OV - Ovarian serous cystadenocarcinoma(12;0.00168)|STAD - Stomach adenocarcinoma(21;0.00694)			TTTCAAAAGTGCGAGATCAAC	0.353																																					p.V201V		.											.	.	.	0			c.G603T						.						127.0	120.0	122.0					12																	70178544		2203	4300	6503	SO:0001819	synonymous_variant	117177	exon4			AAAAGTGCGAGAT		CCDS8993.1, CCDS8995.1, CCDS8996.1, CCDS41811.1, CCDS44942.1	12q15	2013-01-22	2013-01-22		ENSG00000127328	ENSG00000127328			16508	protein-coding gene	gene with protein product	"""rabin3"""	608686					Standard	NM_175623		Approved	RABIN3	uc001svm.3	Q96QF0	OTTHUMG00000169437	ENST00000247833.7:c.555G>T	12.37:g.70178544G>T		Somatic	120	0		WXS	Illumina HiSeq	.	78	3	NM_175623		Silent	SNP	ENST00000247833.7	37	CCDS8995.1	.	.	.	.	.	.	.	.	.	.	G	9.750	1.167298	0.21621	.	.	ENSG00000127328	ENST00000550647	.	.	.	5.87	-9.98	0.00438	.	.	.	.	.	T	0.47154	0.1430	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57751	-0.7757	4	.	.	.	.	9.0892	0.36601	0.0961:0.0814:0.66:0.1624	.	.	.	.	S	75	.	.	A	+	1	0	RAB3IP	68464811	0.306000	0.24490	0.808000	0.32385	0.997000	0.91878	-0.627000	0.05521	-1.294000	0.02360	0.591000	0.81541	GCG	.		0.353	RAB3IP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280671.2	NM_022456	
GJA1	2697	hgsc.bcm.edu;bcgsc.ca	37	6	121768335	121768335	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr6:121768335G>T	ENST00000282561.3	+	2	499	c.342G>T	c.(340-342)aaG>aaT	p.K114N		NM_000165.3	NP_000156.1	P17302	CXA1_HUMAN	gap junction protein, alpha 1, 43kDa	114					adult heart development (GO:0007512)|apoptotic process (GO:0006915)|ATP transport (GO:0015867)|atrial cardiac muscle cell action potential (GO:0086014)|atrial ventricular junction remodeling (GO:0003294)|blood vessel morphogenesis (GO:0048514)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|cell-cell signaling (GO:0007267)|cellular response to mechanical stimulus (GO:0071260)|chronic inflammatory response (GO:0002544)|embryonic digit morphogenesis (GO:0042733)|endothelium development (GO:0003158)|epithelial cell maturation (GO:0002070)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lens development in camera-type eye (GO:0002088)|membrane organization (GO:0061024)|milk ejection (GO:0060156)|muscle contraction (GO:0006936)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of gene expression (GO:0010629)|neuron migration (GO:0001764)|neuron projection morphogenesis (GO:0048812)|osteoblast differentiation (GO:0001649)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of cell communication by chemical coupling (GO:0010652)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of gene expression (GO:0010628)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein oligomerization (GO:0051259)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of bone mineralization (GO:0030500)|regulation of bone remodeling (GO:0046850)|regulation of calcium ion transport (GO:0051924)|regulation of tight junction assembly (GO:2000810)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to fluid shear stress (GO:0034405)|response to peptide hormone (GO:0043434)|response to pH (GO:0009268)|signal transduction (GO:0007165)|skeletal muscle tissue regeneration (GO:0043403)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vascular transport (GO:0010232)	apical plasma membrane (GO:0016324)|connexon complex (GO:0005922)|contractile fiber (GO:0043292)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gap junction (GO:0005921)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial outer membrane (GO:0005741)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)|ion transmembrane transporter activity (GO:0015075)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(2)|large_intestine(10)|liver(2)|lung(13)|ovary(2)	33				GBM - Glioblastoma multiforme(226;0.00252)	Carvedilol(DB01136)	AAGAACTCAAGGTTGCCCAAA	0.418																																					p.K114N		.											GJA1,NS,carcinoma,0,1	GJA1	0	0			c.G342T						.						115.0	104.0	108.0					6																	121768335		2203	4300	6503	SO:0001583	missense	2697	exon2			ACTCAAGGTTGCC	BC026329	CCDS5123.1	6q22.31	2013-05-10	2007-01-16		ENSG00000152661	ENSG00000152661		"""Ion channels / Gap junction proteins (connexins)"""	4274	protein-coding gene	gene with protein product	"""oculodentodigital dysplasia (syndactyly type III)"", ""connexin 43"""	121014	"""gap junction protein, alpha-like"", ""gap junction protein, alpha 1, 43kDa (connexin 43)"""	ODDD, GJAL		10331943, 1646158	Standard	NM_000165		Approved	CX43, ODD, ODOD, SDTY3	uc003pyr.3	P17302	OTTHUMG00000015479	ENST00000282561.3:c.342G>T	6.37:g.121768335G>T	ENSP00000282561:p.Lys114Asn	Somatic	60	0		WXS	Illumina HiSeq	.	18	3	NM_000165	B2R5U9|Q6FHU1|Q9Y5I8	Missense_Mutation	SNP	ENST00000282561.3	37	CCDS5123.1	.	.	.	.	.	.	.	.	.	.	G	11.58	1.680668	0.29872	.	.	ENSG00000152661	ENST00000440608;ENST00000282561	D	0.97529	-4.42	5.09	1.42	0.22433	.	2.607710	0.02499	N	0.090260	D	0.93093	0.7801	M	0.67953	2.075	0.49798	D	0.999829	B	0.27229	0.172	B	0.18871	0.023	D	0.85425	0.1145	10	0.51188	T	0.08	.	9.0847	0.36574	0.6004:0.0:0.3996:0.0	.	114	P17302	CXA1_HUMAN	N	98;114	ENSP00000282561:K114N	ENSP00000282561:K114N	K	+	3	2	GJA1	121810034	0.980000	0.34600	0.998000	0.56505	0.090000	0.18270	0.416000	0.21198	0.279000	0.22186	0.460000	0.39030	AAG	.		0.418	GJA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042023.1	NM_000165	
KCNK10	54207	hgsc.bcm.edu	37	14	88693857	88693857	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr14:88693857G>T	ENST00000340700.5	-	4	979	c.528C>A	c.(526-528)agC>agA	p.S176R	KCNK10_ENST00000319231.5_Missense_Mutation_p.S181R|KCNK10_ENST00000312350.5_Missense_Mutation_p.S181R	NM_021161.4	NP_066984.1	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	176					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)	p.S176R(1)|p.S181R(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	47						CTCCTTCAGTGCTCGGAGCAA	0.393																																					p.S181R		.											KCNK10_ENST00000312350,brain,glioma,0,2	KCNK10_ENST00000312350	0	2	Substitution - Missense(2)	central_nervous_system(2)	c.C543A						.						96.0	102.0	100.0					14																	88693857		2203	4300	6503	SO:0001583	missense	54207	exon4			TTCAGTGCTCGGA	AF279890	CCDS9880.1, CCDS9881.1, CCDS9882.1	14q31	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6273	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 97"""	605873				10880510, 16382106	Standard	NM_021161		Approved	K2p10.1, TREK-2, TREK2, PPP1R97	uc001xwn.3	P57789		ENST00000340700.5:c.528C>A	14.37:g.88693857G>T	ENSP00000343104:p.Ser176Arg	Somatic	70	1		WXS	Illumina HiSeq	.	46	2	NM_138318	B2R8T4|B2RCT3|B5TJL4|Q6B014|Q8TDK7|Q8TDK8|Q9HB59	Missense_Mutation	SNP	ENST00000340700.5	37	CCDS9880.1	.	.	.	.	.	.	.	.	.	.	G	11.88	1.769825	0.31320	.	.	ENSG00000100433	ENST00000340700;ENST00000312350;ENST00000319231	T;T;T	0.22945	1.93;1.93;1.93	6.17	5.28	0.74379	Ion transport 2 (1);	0.035132	0.85682	D	0.000000	T	0.11922	0.0290	N	0.01824	-0.7	0.80722	D	1	B;B;B	0.17852	0.024;0.011;0.006	B;B;B	0.24006	0.05;0.05;0.017	T	0.15263	-1.0443	10	0.18276	T	0.48	.	15.9715	0.80025	0.0648:0.0:0.9352:0.0	.	176;181;181	P57789;B2R8T4;Q6B014	KCNKA_HUMAN;.;.	R	176;181;181	ENSP00000343104:S176R;ENSP00000310568:S181R;ENSP00000312811:S181R	ENSP00000310568:S181R	S	-	3	2	KCNK10	87763610	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.426000	0.52778	1.599000	0.50093	0.655000	0.94253	AGC	.		0.393	KCNK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410167.1	NM_021161	
ZNF839	55778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	102800960	102800960	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr14:102800960G>A	ENST00000558850.1	+	4	1488	c.1138G>A	c.(1138-1140)Gtg>Atg	p.V380M	ZNF839_ENST00000442396.2_Missense_Mutation_p.V496M|ZNF839_ENST00000262236.5_Missense_Mutation_p.V380M|ZNF839_ENST00000559185.1_Missense_Mutation_p.V380M	NM_001267827.1	NP_001254756.1	A8K0R7	ZN839_HUMAN	zinc finger protein 839	380							metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19						GGTTGTGACCGTGTATGAGTT	0.403																																					p.V496M		.											.	.	.	0			c.G1486A						.						111.0	109.0	110.0					14																	102800960		1945	4145	6090	SO:0001583	missense	55778	exon4			GTGACCGTGTATG	AK093342	CCDS45164.1, CCDS58336.1	14q32.32	2010-05-06	2008-06-23	2008-06-23	ENSG00000022976	ENSG00000022976			20345	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 131"""	C14orf131			Standard	NM_018335		Approved		uc010awk.2	A8K0R7		ENST00000558850.1:c.1138G>A	14.37:g.102800960G>A	ENSP00000453363:p.Val380Met	Somatic	100	0		WXS	Illumina HiSeq	.	44	24	NM_018335	B3KSD2|Q53FH5|Q6GPI5|Q86TU1|Q9BQ86|Q9NUU3	Missense_Mutation	SNP	ENST00000558850.1	37	CCDS58336.1	.	.	.	.	.	.	.	.	.	.	G	13.54	2.266389	0.40095	.	.	ENSG00000022976	ENST00000442396;ENST00000262236;ENST00000398436	T;T	0.22945	1.93;1.93	5.16	2.23	0.28157	.	0.511935	0.15192	U	0.275483	T	0.37544	0.1007	M	0.62723	1.935	0.24539	N	0.994075	D;D;D;D	0.71674	0.998;0.996;0.996;0.996	P;P;P;P	0.54460	0.753;0.668;0.492;0.668	T	0.17653	-1.0362	10	0.72032	D	0.01	.	10.2343	0.43273	0.0724:0.2837:0.6439:0.0	.	496;380;259;380	A8K0R7-5;A8K0R7-2;Q9NT83;A8K0R7	.;.;.;ZN839_HUMAN	M	496;380;48	ENSP00000399863:V496M;ENSP00000262236:V380M	ENSP00000262236:V380M	V	+	1	0	ZNF839	101870713	0.998000	0.40836	0.076000	0.20297	0.177000	0.22998	2.689000	0.46993	0.247000	0.21414	0.561000	0.74099	GTG	.		0.403	ZNF839-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000415492.2	NM_018335	
LIM2	3982	hgsc.bcm.edu	37	19	51883801	51883801	+	Missense_Mutation	SNP	A	A	G			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr19:51883801A>G	ENST00000596399.1	-	4	465	c.418T>C	c.(418-420)Tac>Cac	p.Y140H	LIM2_ENST00000221973.3_Missense_Mutation_p.Y182H	NM_001161748.1	NP_001155220.1	P55344	LMIP_HUMAN	lens intrinsic membrane protein 2, 19kDa	140					cell-cell junction assembly (GO:0007043)|lens development in camera-type eye (GO:0002088)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	structural constituent of eye lens (GO:0005212)			endometrium(1)|large_intestine(3)|lung(2)|skin(1)	7		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000214)|OV - Ovarian serous cystadenocarcinoma(262;0.00985)		CCCAGGATGTAGGACCAGGAA	0.622																																					p.Y182H		.											.	.	.	0			c.T544C						.						143.0	143.0	143.0					19																	51883801		2203	4300	6503	SO:0001583	missense	3982	exon4			GGATGTAGGACCA		CCDS12831.1, CCDS59415.1	19q13.4	2008-07-17	2002-08-29			ENSG00000105370			6610	protein-coding gene	gene with protein product		154045	"""lens intrinsic membrane protein 2 (19kD)"""			1606837	Standard	NM_030657		Approved	MP19, MP17	uc002pwl.2	P55344		ENST00000596399.1:c.418T>C	19.37:g.51883801A>G	ENSP00000472090:p.Tyr140His	Somatic	41	0		WXS	Illumina HiSeq	.	55	4	NM_030657	Q6B083|Q9BXD0|Q9HAR5	Missense_Mutation	SNP	ENST00000596399.1	37	CCDS59415.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.371793	0.82573	.	.	ENSG00000105370	ENST00000221973	D	0.90261	-2.64	4.73	4.73	0.59995	.	0.000000	0.85682	D	0.000000	D	0.95030	0.8391	M	0.82630	2.6	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.85130	0.996;0.997	D	0.95449	0.8532	10	0.87932	D	0	0.7713	12.201	0.54326	1.0:0.0:0.0:0.0	.	140;182	P55344;P55344-2	LMIP_HUMAN;.	H	182	ENSP00000221973:Y182H	ENSP00000221973:Y182H	Y	-	1	0	LIM2	56575613	1.000000	0.71417	0.993000	0.49108	0.977000	0.68977	8.199000	0.89731	1.769000	0.52152	0.533000	0.62120	TAC	.		0.622	LIM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464247.1	NM_030657	
MYO9A	4649	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	72226035	72226035	+	Missense_Mutation	SNP	G	G	C			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr15:72226035G>C	ENST00000356056.5	-	18	3010	c.2538C>G	c.(2536-2538)ttC>ttG	p.F846L	MYO9A_ENST00000566885.1_Missense_Mutation_p.F466L|MYO9A_ENST00000563542.1_5'UTR|MYO9A_ENST00000444904.1_Missense_Mutation_p.F827L|MYO9A_ENST00000564571.1_Missense_Mutation_p.F846L|MYO9A_ENST00000424560.1_Missense_Mutation_p.F846L	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	846	Myosin motor.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						GCTTGGATTTGAAATTTTTGT	0.289																																					p.F846L		.											.	.	.	0			c.C2538G						.						78.0	85.0	83.0					15																	72226035		2199	4291	6490	SO:0001583	missense	4649	exon18			GGATTTGAAATTT	AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.2538C>G	15.37:g.72226035G>C	ENSP00000348349:p.Phe846Leu	Somatic	183	0		WXS	Illumina HiSeq	.	180	101	NM_006901	B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	ENST00000356056.5	37	CCDS10239.1	.	.	.	.	.	.	.	.	.	.	G	14.25	2.480778	0.44044	.	.	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904;ENST00000261864	D;D;D	0.84070	-1.8;-1.8;-1.79	4.53	0.644	0.17776	Myosin head, motor domain (1);	.	.	.	.	T	0.68403	0.2997	N	0.21324	0.655	0.30634	N	0.75723	B;B;B	0.31274	0.317;0.0;0.027	B;B;B	0.29785	0.107;0.002;0.017	T	0.62955	-0.6744	9	0.49607	T	0.09	.	5.7769	0.18283	0.1651:0.3289:0.5061:0.0	.	827;827;846	B2RTY4-2;B7WP69;B2RTY4	.;.;MYO9A_HUMAN	L	846;846;827;827	ENSP00000348349:F846L;ENSP00000399162:F846L;ENSP00000398250:F827L	ENSP00000261864:F827L	F	-	3	2	MYO9A	70013089	1.000000	0.71417	0.368000	0.25939	0.874000	0.50279	1.258000	0.32944	0.180000	0.19960	0.460000	0.39030	TTC	.		0.289	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257308.1	NM_006901	
KIF24	347240	hgsc.bcm.edu;bcgsc.ca	37	9	34259675	34259675	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr9:34259675G>A	ENST00000402558.2	-	9	1568	c.1544C>T	c.(1543-1545)gCc>gTc	p.A515V	KIF24_ENST00000379166.2_Missense_Mutation_p.A515V|KIF24_ENST00000379174.3_Missense_Mutation_p.A381V|KIF24_ENST00000345050.2_Missense_Mutation_p.A381V			Q5T7B8	KIF24_HUMAN	kinesin family member 24	515	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)	centriole (GO:0005814)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(13)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	32			LUSC - Lung squamous cell carcinoma(29;0.0107)			GCAGGTTTTGGCATTGCCGAT	0.493																																					p.A515V		.											.	.	.	0			c.C1544T						.						356.0	270.0	299.0					9																	34259675		2203	4300	6503	SO:0001583	missense	347240	exon10			GTTTTGGCATTGC	AK001795	CCDS6551.2	9p13.3	2013-01-10			ENSG00000186638	ENSG00000186638		"""Kinesins"", ""Sterile alpha motif (SAM) domain containing"""	19916	protein-coding gene	gene with protein product		613747	"""chromosome 9 open reading frame 48"""	C9orf48		12477932	Standard	NM_194313		Approved	bA571F15.4, FLJ10933, FLJ43884	uc003zua.4	Q5T7B8	OTTHUMG00000019810	ENST00000402558.2:c.1544C>T	9.37:g.34259675G>A	ENSP00000384433:p.Ala515Val	Somatic	41	0		WXS	Illumina HiSeq	.	46	4	NM_194313	Q2TB93|Q5T7B5|Q5T7B7|Q6ZU97|Q6ZUZ2|Q86XZ0|Q9NV43	Missense_Mutation	SNP	ENST00000402558.2	37	CCDS6551.2	.	.	.	.	.	.	.	.	.	.	G	36	5.902324	0.97087	.	.	ENSG00000186638	ENST00000402558;ENST00000379174;ENST00000379166;ENST00000345050;ENST00000420188	T;T;T;T	0.18810	2.19;2.19;2.19;2.19	5.71	5.71	0.89125	Kinesin, motor domain (4);	0.000000	0.46758	D	0.000280	T	0.46073	0.1374	M	0.85099	2.735	0.49915	D	0.999837	D;D	0.55800	0.967;0.973	P;P	0.53401	0.604;0.725	T	0.49011	-0.8983	10	0.52906	T	0.07	.	19.8579	0.96771	0.0:0.0:1.0:0.0	.	515;515	Q5T7B8-4;Q5T7B8	.;KIF24_HUMAN	V	515;381;515;381;515	ENSP00000384433:A515V;ENSP00000368472:A381V;ENSP00000368464:A515V;ENSP00000340179:A381V	ENSP00000340179:A381V	A	-	2	0	KIF24	34249675	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.640000	0.91028	2.687000	0.91594	0.655000	0.94253	GCC	.		0.493	KIF24-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052150.5		
NOX4	50507	hgsc.bcm.edu;broad.mit.edu	37	11	89106611	89106611	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr11:89106611C>T	ENST00000263317.4	-	12	1362	c.1124G>A	c.(1123-1125)gGa>gAa	p.G375E	NOX4_ENST00000375979.3_Missense_Mutation_p.G68E|NOX4_ENST00000413594.2_Missense_Mutation_p.G396E|NOX4_ENST00000343727.5_Missense_Mutation_p.G351E|NOX4_ENST00000531342.1_Missense_Mutation_p.G68E|NOX4_ENST00000528341.1_Missense_Mutation_p.G350E|NOX4_ENST00000527956.1_Missense_Mutation_p.G351E|NOX4_ENST00000534731.1_Missense_Mutation_p.G375E|NOX4_ENST00000532825.1_Missense_Mutation_p.G351E|NOX4_ENST00000542487.1_Missense_Mutation_p.G351E|NOX4_ENST00000424319.1_Missense_Mutation_p.G351E|NOX4_ENST00000535633.1_Missense_Mutation_p.G351E|NOX4_ENST00000525196.1_Intron|NOX4_ENST00000527626.1_Missense_Mutation_p.G209E			Q9NPH5	NOX4_HUMAN	NADPH oxidase 4	375	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.|Mediates interaction with TLR4.				bone resorption (GO:0045453)|cardiac muscle cell differentiation (GO:0055007)|cell aging (GO:0007569)|cell morphogenesis (GO:0000902)|cellular response to cAMP (GO:0071320)|cellular response to gamma radiation (GO:0071480)|cellular response to glucose stimulus (GO:0071333)|cellular response to transforming growth factor beta stimulus (GO:0071560)|homocysteine metabolic process (GO:0050667)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|response to hypoxia (GO:0001666)|superoxide anion generation (GO:0042554)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|modified amino acid binding (GO:0072341)|NAD(P)H oxidase activity (GO:0016174)|nucleotide binding (GO:0000166)|oxygen sensor activity (GO:0019826)|superoxide-generating NADPH oxidase activity (GO:0016175)	p.G375E(1)		NS(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(20)|ovary(2)|prostate(3)|skin(2)	44		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				TGTCCAGTCTCCTACTATTTT	0.279																																					p.G375E		.											NOX4,colon,carcinoma,0,2	NOX4	0	1	Substitution - Missense(1)	large_intestine(1)	c.G1124A						.						100.0	110.0	107.0					11																	89106611		2201	4283	6484	SO:0001583	missense	50507	exon12			CAGTCTCCTACTA	AF254621	CCDS8285.1, CCDS44695.1, CCDS44696.1, CCDS73361.1, CCDS73362.1	11q14.2-q21	2008-02-05			ENSG00000086991	ENSG00000086991			7891	protein-coding gene	gene with protein product		605261					Standard	NM_001143837		Approved	KOX-1, KOX	uc001pct.3	Q9NPH5	OTTHUMG00000167298	ENST00000263317.4:c.1124G>A	11.37:g.89106611C>T	ENSP00000263317:p.Gly375Glu	Somatic	90	0		WXS	Illumina HiSeq	.	53	4	NM_001143836	A8K715|B7Z520|E7EMD7|Q5K3R4|Q5K3R5|Q5K3R6|Q5K3R8|Q7Z7G3|Q86V92	Missense_Mutation	SNP	ENST00000263317.4	37	CCDS8285.1	.	.	.	.	.	.	.	.	.	.	C	16.20	3.057366	0.55325	.	.	ENSG00000086991	ENST00000424319;ENST00000535633;ENST00000343727;ENST00000534731;ENST00000263317;ENST00000532825;ENST00000527956;ENST00000542487;ENST00000527626;ENST00000528341;ENST00000413594;ENST00000531342;ENST00000375979	T;T;T;T;T;T;T;T;T;T;T;D;D	0.98012	1.82;1.82;1.82;1.82;1.82;1.82;1.82;1.82;1.82;1.82;1.82;-4.05;-4.66	5.12	5.12	0.69794	Riboflavin synthase-like beta-barrel (1);FAD-binding 8 (1);Ferredoxin reductase-type FAD-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.98757	0.9582	M	0.87971	2.92	0.52501	D	0.999951	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.998;0.992;0.998;1.0;0.999;1.0	D	0.99505	1.0954	9	.	.	.	-12.7557	15.4797	0.75514	0.0:1.0:0.0:0.0	.	351;209;350;68;68;375;375	E9PMY6;E9PR43;E9PPP2;Q9NPH5-3;Q9NPH5-4;Q9NPH5-6;Q9NPH5	.;.;.;.;.;.;NOX4_HUMAN	E	351;351;351;375;375;351;351;351;209;350;396;68;68	ENSP00000412446:G351E;ENSP00000440172:G351E;ENSP00000344747:G351E;ENSP00000436892:G375E;ENSP00000263317:G375E;ENSP00000434924:G351E;ENSP00000433797:G351E;ENSP00000439373:G351E;ENSP00000436093:G209E;ENSP00000436970:G350E;ENSP00000405705:G396E;ENSP00000435039:G68E;ENSP00000365146:G68E	.	G	-	2	0	NOX4	88746259	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.868000	0.63021	2.382000	0.81193	0.563000	0.77884	GGA	.		0.279	NOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394054.1	NM_016931	
COL22A1	169044	hgsc.bcm.edu	37	8	139729078	139729078	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr8:139729078G>T	ENST00000303045.6	-	28	2836	c.2390C>A	c.(2389-2391)cCt>cAt	p.P797H	COL22A1_ENST00000435777.1_Missense_Mutation_p.P797H|COL22A1_ENST00000341807.4_5'UTR	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	797	Collagen-like 6.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.P797H(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CTTCTCTCCAGGTCGGCCTGC	0.388										HNSCC(7;0.00092)																											p.P797H		.											COL22A1,NS,carcinoma,0,1	COL22A1	0	1	Substitution - Missense(1)	lung(1)	c.C2390A						.						69.0	68.0	68.0					8																	139729078		2203	4300	6503	SO:0001583	missense	169044	exon28			TCTCCAGGTCGGC	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.2390C>A	8.37:g.139729078G>T	ENSP00000303153:p.Pro797His	Somatic	34	0		WXS	Illumina HiSeq	.	27	2	NM_152888	B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	37	CCDS6376.1	.	.	.	.	.	.	.	.	.	.	G	14.33	2.504315	0.44558	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.97114	-4.25;-4.25	4.74	4.74	0.60224	.	0.284831	0.24954	N	0.034279	D	0.98194	0.9403	M	0.80508	2.5	0.49687	D	0.999819	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.98296	1.0516	10	0.62326	D	0.03	.	13.4436	0.61127	0.0:0.0:1.0:0.0	.	797;797	Q8NFW1-2;Q8NFW1	.;COMA1_HUMAN	H	797;797;510	ENSP00000303153:P797H;ENSP00000387655:P797H	ENSP00000303153:P797H	P	-	2	0	COL22A1	139798260	1.000000	0.71417	0.999000	0.59377	0.962000	0.63368	2.677000	0.46892	2.615000	0.88500	0.655000	0.94253	CCT	.		0.388	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
AKAP13	11214	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	86125248	86125248	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr15:86125248G>A	ENST00000394518.2	+	7	4044	c.3949G>A	c.(3949-3951)Gaa>Aaa	p.E1317K	RP11-815J21.2_ENST00000561409.1_RNA|AKAP13_ENST00000361243.2_Missense_Mutation_p.E1317K	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	1317					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						TACTCCTGAGGAAGCCACGGG	0.522																																					p.E1317K	Melanoma(94;603 1453 3280 32295 32951)	.											.	.	.	0			c.G3949A						.						56.0	54.0	55.0					15																	86125248		2202	4299	6501	SO:0001583	missense	11214	exon7			CCTGAGGAAGCCA	M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.3949G>A	15.37:g.86125248G>A	ENSP00000378026:p.Glu1317Lys	Somatic	44	0		WXS	Illumina HiSeq	.	40	14	NM_007200	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	ENST00000394518.2	37	CCDS32319.1	.	.	.	.	.	.	.	.	.	.	G	15.93	2.978874	0.53720	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540	T;T	0.19806	2.12;2.12	4.87	4.87	0.63330	.	.	.	.	.	T	0.29093	0.0723	M	0.65975	2.015	0.58432	D	0.999999	P;P	0.45531	0.78;0.86	B;P	0.44561	0.265;0.453	T	0.08086	-1.0739	9	0.66056	D	0.02	.	13.5193	0.61559	0.0:0.0:1.0:0.0	.	1317;1317	Q12802;Q12802-2	AKP13_HUMAN;.	K	1317;1317;1316;1316	ENSP00000354718:E1317K;ENSP00000378026:E1317K	ENSP00000354718:E1317K	E	+	1	0	AKAP13	83926252	0.978000	0.34361	0.031000	0.17742	0.006000	0.05464	4.329000	0.59260	2.240000	0.73641	0.655000	0.94253	GAA	.		0.522	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1	NM_007200	
C1orf186	440712	hgsc.bcm.edu	37	1	206243207	206243207	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr1:206243207G>T	ENST00000331555.5	-	3	693	c.55C>A	c.(55-57)Ctc>Atc	p.L19I		NM_001007544.1	NP_001007545.1	Q6ZWK4	CA186_HUMAN	chromosome 1 open reading frame 186	19						integral component of membrane (GO:0016021)		p.L19V(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	9			BRCA - Breast invasive adenocarcinoma(75;0.0754)			TGCAGGAAGAGGGACACCACC	0.532																																					p.L19I		.											C1orf186,NS,carcinoma,0,1	C1orf186	0	1	Substitution - Missense(1)	breast(1)	c.C55A						.						128.0	112.0	117.0					1																	206243207		2203	4300	6503	SO:0001583	missense	440712	exon3			GGAAGAGGGACAC	AK122631	CCDS73014.1	1q32.1	2014-05-06			ENSG00000196533	ENSG00000263961			25341	protein-coding gene	gene with protein product							Standard	XM_005272738		Approved	FLJ16052	uc001hdt.2	Q6ZWK4	OTTHUMG00000184376	ENST00000331555.5:c.55C>A	1.37:g.206243207G>T	ENSP00000356093:p.Leu19Ile	Somatic	28	0		WXS	Illumina HiSeq	.	46	2	NM_001007544		Missense_Mutation	SNP	ENST00000331555.5	37	CCDS30995.1	.	.	.	.	.	.	.	.	.	.	G	9.618	1.133162	0.21041	.	.	ENSG00000196533	ENST00000331555	.	.	.	3.06	-1.12	0.09808	.	0.743246	0.11085	N	0.601405	T	0.20941	0.0504	L	0.32530	0.975	0.09310	N	1	B	0.25563	0.129	B	0.23419	0.046	T	0.27191	-1.0081	9	0.56958	D	0.05	-31.2944	0.5558	0.00670	0.2469:0.1923:0.3645:0.1963	.	19	Q6ZWK4	CA186_HUMAN	I	19	.	ENSP00000356093:L19I	L	-	1	0	C1orf186	204409830	0.002000	0.14202	0.001000	0.08648	0.152000	0.21847	0.031000	0.13710	-0.228000	0.09869	0.561000	0.74099	CTC	.		0.532	C1orf186-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088002.1	NM_001007544	
LAMB3	3914	hgsc.bcm.edu	37	1	209791986	209791986	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr1:209791986G>A	ENST00000356082.4	-	19	2854	c.2720C>T	c.(2719-2721)gCc>gTc	p.A907V	LAMB3_ENST00000391911.1_Missense_Mutation_p.A907V|LAMB3_ENST00000367030.3_Missense_Mutation_p.A907V	NM_000228.2	NP_000219.2	Q13751	LAMB3_HUMAN	laminin, beta 3	907	Domain I.				brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	extracellular region (GO:0005576)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		CTGGATAGTGGCTGCATCAGT	0.577																																					p.A907V		.											LAMB3,NS,malignant_melanoma,0,1	LAMB3	0	0			c.C2720T						.						59.0	56.0	57.0					1																	209791986		2203	4300	6503	SO:0001583	missense	3914	exon19			ATAGTGGCTGCAT	D37766	CCDS1487.1	1q32	2013-03-01	2002-08-29		ENSG00000196878	ENSG00000196878		"""Laminins"""	6490	protein-coding gene	gene with protein product		150310	"""laminin, beta 3 (nicein (125kD), kalinin (140kD), BM600 (125kD))"""	LAMNB1		8088808, 7774918	Standard	NM_001127641		Approved	nicein-125kDa, kalinin-140kDa, BM600-125kDa	uc001hhh.3	Q13751	OTTHUMG00000036360	ENST00000356082.4:c.2720C>T	1.37:g.209791986G>A	ENSP00000348384:p.Ala907Val	Somatic	16	0		WXS	Illumina HiSeq	.	26	2	NM_000228	D3DT88|O14947|Q14733|Q9UJK4|Q9UJL1	Missense_Mutation	SNP	ENST00000356082.4	37	CCDS1487.1	.	.	.	.	.	.	.	.	.	.	G	16.40	3.113945	0.56398	.	.	ENSG00000196878	ENST00000391911;ENST00000356082;ENST00000367030	T;T;T	0.22945	1.93;1.93;1.93	5.12	4.17	0.49024	.	0.117788	0.56097	D	0.000021	T	0.42607	0.1210	M	0.75447	2.3	0.43835	D	0.996418	P	0.52577	0.954	P	0.52710	0.707	T	0.42632	-0.9440	10	0.48119	T	0.1	.	14.8971	0.70651	0.0:0.1445:0.8555:0.0	.	907	Q13751	LAMB3_HUMAN	V	907	ENSP00000375778:A907V;ENSP00000348384:A907V;ENSP00000355997:A907V	ENSP00000348384:A907V	A	-	2	0	LAMB3	207858609	0.993000	0.37304	0.948000	0.38648	0.178000	0.23041	2.975000	0.49281	1.103000	0.41568	0.555000	0.69702	GCC	.		0.577	LAMB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088525.2	NM_000228	
CASK	8573	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	41469246	41469246	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chrX:41469246C>T	ENST00000378163.1	-	12	1540	c.1066G>A	c.(1066-1068)Gag>Aag	p.E356K	CASK_ENST00000378158.1_Missense_Mutation_p.E356K|CASK_ENST00000361962.4_Missense_Mutation_p.E356K|CASK_ENST00000421587.2_Missense_Mutation_p.E350K|CASK_ENST00000318588.9_Missense_Mutation_p.E356K|CASK_ENST00000442742.2_Missense_Mutation_p.E356K|CASK_ENST00000378154.1_Missense_Mutation_p.E356K|CASK_ENST00000378166.4_Missense_Mutation_p.E356K			O14936	CSKP_HUMAN	calcium/calmodulin-dependent serine protein kinase (MAGUK family)	356	L27 1. {ECO:0000255|PROSITE- ProRule:PRU00365}.				calcium ion import (GO:0070509)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of wound healing (GO:0061045)|nucleotide phosphorylation (GO:0046939)|positive regulation of calcium ion import (GO:0090280)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	actin cytoskeleton (GO:0015629)|basement membrane (GO:0005604)|basolateral plasma membrane (GO:0016323)|cell-cell junction (GO:0005911)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nuclear lamina (GO:0005652)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(5)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|ovary(3)|prostate(1)|stomach(1)	32						GCATGAATCTCTTCCAGGCTG	0.428																																					p.E356K	NSCLC(42;104 1086 3090 27189 35040)	.											.	.	.	0			c.G1066A						.						79.0	65.0	70.0					X																	41469246		2203	4300	6503	SO:0001583	missense	8573	exon12			GAATCTCTTCCAG	AF035582	CCDS14257.1, CCDS48094.1, CCDS48095.1	Xp11.4	2010-02-09			ENSG00000147044	ENSG00000147044			1497	protein-coding gene	gene with protein product		300172	"""trinucleotide repeat containing 8"""	TNRC8		9722958	Standard	NM_003688		Approved	LIN2, CAGH39, FGS4	uc004dfl.4	O14936	OTTHUMG00000021378	ENST00000378163.1:c.1066G>A	X.37:g.41469246C>T	ENSP00000367405:p.Glu356Lys	Somatic	108	0		WXS	Illumina HiSeq	.	75	24	NM_001126054	A6NES1|B7ZKY0|O43215|Q17RI4|Q59HA0|Q5VT16|Q5VT17|Q5VT18|Q5VT19|Q66T42|Q9BYH6|Q9NYB2|Q9NYB3	Missense_Mutation	SNP	ENST00000378163.1	37		.	.	.	.	.	.	.	.	.	.	C	25.8	4.671783	0.88348	.	.	ENSG00000147044	ENST00000421587;ENST00000318588;ENST00000361962;ENST00000378163;ENST00000378158;ENST00000378166;ENST00000442742;ENST00000378154	T;T;T;T;T;T;T;T	0.69306	-0.35;-0.36;-0.37;-0.36;-0.36;-0.37;-0.36;-0.39	5.28	5.28	0.74379	L27, C-terminal (1);L27 (2);	0.000000	0.51477	D	0.000083	T	0.71584	0.3357	M	0.64997	1.995	0.80722	D	1	P;P;P;P	0.48998	0.557;0.512;0.696;0.918	B;B;B;P	0.47299	0.295;0.142;0.205;0.543	T	0.76307	-0.3007	10	0.72032	D	0.01	.	18.044	0.89327	0.0:1.0:0.0:0.0	.	350;356;356;356	O14936-3;O14936-4;O14936-2;O14936	.;.;.;CSKP_HUMAN	K	350;356;356;356;356;356;356;356	ENSP00000400526:E350K;ENSP00000322727:E356K;ENSP00000354641:E356K;ENSP00000367405:E356K;ENSP00000367400:E356K;ENSP00000367408:E356K;ENSP00000398007:E356K;ENSP00000367396:E356K	ENSP00000322727:E356K	E	-	1	0	CASK	41354190	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.445000	0.80570	2.196000	0.70406	0.600000	0.82982	GAG	.		0.428	CASK-007	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000056285.1	NM_003688	
OTUD5	55593	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	48801512	48801512	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chrX:48801512G>T	ENST00000156084.4	-	2	687	c.627C>A	c.(625-627)gaC>gaA	p.D209E	OTUD5_ENST00000396743.3_Missense_Mutation_p.D209E|OTUD5_ENST00000376488.3_Missense_Mutation_p.D209E|OTUD5_ENST00000428668.2_5'UTR|OTUD5_ENST00000484499.1_5'UTR	NM_017602.3	NP_060072.1	Q96G74	OTUD5_HUMAN	OTU deubiquitinase 5	209					innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)	ubiquitin-specific protease activity (GO:0004843)			endometrium(2)|large_intestine(3)|lung(6)|pancreas(2)	13						AGCCCTTCTTGTCTCGTAGGG	0.577																																					p.D209E		.											.	.	.	0			c.C627A						.						83.0	57.0	66.0					X																	48801512		2203	4300	6503	SO:0001583	missense	55593	exon2			CTTCTTGTCTCGT		CCDS14313.1, CCDS48104.1, CCDS48105.1	Xp11.23	2014-06-09	2014-02-24		ENSG00000068308	ENSG00000068308		"""OTU domain containing"""	25402	protein-coding gene	gene with protein product		300713	"""OTU domain containing 5"""			24143256	Standard	NM_001136157		Approved	DKFZp761A052, DUBA	uc004dlu.3	Q96G74	OTTHUMG00000024130	ENST00000156084.4:c.627C>A	X.37:g.48801512G>T	ENSP00000156084:p.Asp209Glu	Somatic	58	0		WXS	Illumina HiSeq	.	33	13	NM_001136157	B4DGG7|G5E9D7|Q4KMN9|Q8N6T5|Q9H650|Q9H9U0|Q9NT65	Missense_Mutation	SNP	ENST00000156084.4	37	CCDS14313.1	.	.	.	.	.	.	.	.	.	.	G	4.597	0.110968	0.08831	.	.	ENSG00000068308	ENST00000396743;ENST00000453548;ENST00000455452;ENST00000156084;ENST00000376488	T;T;T;T	0.38722	1.12;1.12;1.12;1.12	5.87	5.87	0.94306	.	0.125623	0.51477	D	0.000084	T	0.10852	0.0265	N	0.00246	-1.78	0.37453	D	0.914884	B;B	0.11235	0.004;0.001	B;B	0.04013	0.001;0.001	T	0.35871	-0.9771	10	0.02654	T	1	-26.6075	12.3585	0.55188	0.0:0.1648:0.8352:0.0	.	209;209	Q96G74;G5E9D7	OTUD5_HUMAN;.	E	209;185;82;209;209	ENSP00000379969:D209E;ENSP00000390767:D82E;ENSP00000156084:D209E;ENSP00000365671:D209E	ENSP00000156084:D209E	D	-	3	2	OTUD5	48686456	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.682000	0.37628	2.618000	0.88619	0.600000	0.82982	GAC	.		0.577	OTUD5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000060799.1	NM_017602	
MAML2	84441	hgsc.bcm.edu	37	11	95825221	95825221	+	Silent	SNP	C	C	T	rs571656416	byFrequency	TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr11:95825221C>T	ENST00000524717.1	-	2	3258	c.1974G>A	c.(1972-1974)caG>caA	p.Q658Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	658					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgctgctgctgttgttgct	0.527			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid								C|||	4	0.000798722	0.0015	0.0	5008	,	,		17889	0.002		0.0	False		,,,				2504	0.0				p.Q658Q		.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	MAML2,NS,carcinoma,0,1	MAML2	0	0			c.G1974A						.																																			SO:0001819	synonymous_variant	84441	exon2			CTGCTGCTGTTGT	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1974G>A	11.37:g.95825221C>T		Somatic	48	2		WXS	Illumina HiSeq	.	27	2	NM_032427	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																			.		0.527	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
ZNF100	163227	hgsc.bcm.edu;bcgsc.ca	37	19	21910398	21910398	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr19:21910398C>T	ENST00000358296.6	-	5	914	c.716G>A	c.(715-717)gGc>gAc	p.G239D	ZNF100_ENST00000305570.6_Missense_Mutation_p.G175D	NM_173531.3	NP_775802.2	Q8IYN0	ZN100_HUMAN	zinc finger protein 100	239					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(11)|skin(1)|upper_aerodigestive_tract(1)	21						GAAGGCTTTGCCACAATCTTT	0.353																																					p.G239D		.											.	.	.	0			c.G716A						.						62.0	67.0	65.0					19																	21910398		2129	4267	6396	SO:0001583	missense	163227	exon5			GCTTTGCCACAAT	BC035579	CCDS42538.1	19p13.1	2013-01-08	2003-12-19		ENSG00000197020	ENSG00000197020		"""Zinc fingers, C2H2-type"", ""-"""	12880	protein-coding gene	gene with protein product		603982	"""zinc finger protein 100 (Y1)"""			12477932	Standard	NM_173531		Approved		uc002nqi.3	Q8IYN0		ENST00000358296.6:c.716G>A	19.37:g.21910398C>T	ENSP00000351042:p.Gly239Asp	Somatic	97	0		WXS	Illumina HiSeq	.	84	4	NM_173531	Q7M4M0	Missense_Mutation	SNP	ENST00000358296.6	37	CCDS42538.1	.	.	.	.	.	.	.	.	.	.	.	5.114	0.206607	0.09704	.	.	ENSG00000197020	ENST00000358296	T	0.01430	4.9	0.832	0.832	0.18867	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01320	0.0043	L	0.41124	1.26	0.22701	N	0.99884	P;B	0.39551	0.678;0.372	B;B	0.33254	0.157;0.16	T	0.49331	-0.8951	9	0.59425	D	0.04	.	5.1103	0.14806	0.3432:0.6568:0.0:0.0	.	239;293	Q8IYN0;Q4G131	ZN100_HUMAN;.	D	239	ENSP00000351042:G239D	ENSP00000351042:G239D	G	-	2	0	ZNF100	21702238	.	.	0.533000	0.28001	0.803000	0.45373	.	.	0.171000	0.19730	0.174000	0.16983	GGC	.		0.353	ZNF100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464087.1	NM_173531	
OR2L13	284521	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	248263072	248263072	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr1:248263072C>T	ENST00000358120.2	+	2	540	c.395C>T	c.(394-396)cCt>cTt	p.P132L	OR2L13_ENST00000366478.2_Missense_Mutation_p.P132L			Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L, member 13	132						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(32)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	59	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			CTCTATTATCCTATCCGCATG	0.483																																					p.P132L		.											.	.	.	0			c.C395T						.						229.0	214.0	219.0					1																	248263072		2203	4300	6503	SO:0001583	missense	284521	exon3			ATTATCCTATCCG	BC028158	CCDS1637.1	1q44	2012-08-09			ENSG00000196071	ENSG00000196071		"""GPCR / Class A : Olfactory receptors"""	19578	protein-coding gene	gene with protein product				OR2L14			Standard	NM_175911		Approved		uc001ids.3	Q8N349	OTTHUMG00000040446	ENST00000358120.2:c.395C>T	1.37:g.248263072C>T	ENSP00000350836:p.Pro132Leu	Somatic	37	0		WXS	Illumina HiSeq	.	69	11	NM_175911	Q5VUR5	Missense_Mutation	SNP	ENST00000358120.2	37	CCDS1637.1	.	.	.	.	.	.	.	.	.	.	C	3.223	-0.159117	0.06544	.	.	ENSG00000196071	ENST00000366478;ENST00000358120	T;T	0.19532	2.14;2.14	4.31	2.41	0.29592	GPCR, rhodopsin-like superfamily (1);	0.450109	0.18915	N	0.127633	T	0.18593	0.0446	L	0.60845	1.875	0.09310	N	1	P	0.44139	0.827	B	0.40199	0.322	T	0.14980	-1.0453	10	0.59425	D	0.04	.	4.6335	0.12513	0.1354:0.4811:0.2984:0.0851	.	132	Q8N349	OR2LD_HUMAN	L	132	ENSP00000355434:P132L;ENSP00000350836:P132L	ENSP00000350836:P132L	P	+	2	0	OR2L13	246329695	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.835000	0.00741	0.420000	0.25954	-0.142000	0.14014	CCT	.		0.483	OR2L13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097342.1	NM_175911	
ZNF557	79230	hgsc.bcm.edu	37	19	7083328	7083328	+	Missense_Mutation	SNP	A	A	G			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr19:7083328A>G	ENST00000439035.2	+	8	1085	c.845A>G	c.(844-846)gAg>gGg	p.E282G	ZNF557_ENST00000414706.1_Missense_Mutation_p.E289G|ZNF557_ENST00000252840.6_Missense_Mutation_p.E289G			Q8N988	ZN557_HUMAN	zinc finger protein 557	282					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(6)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17				Lung(535;0.179)		CATACGGGGGAGGGTCATTAT	0.453																																					p.E289G		.											ZNF557,right_lower_lobe,carcinoma,0,1	ZNF557	0	0			c.A866G						.						124.0	135.0	132.0					19																	7083328		2160	4275	6435	SO:0001583	missense	79230	exon8			CGGGGGAGGGTCA	AK095524	CCDS42485.1, CCDS45945.1	19p13.2	2013-09-20			ENSG00000130544	ENSG00000130544		"""Zinc fingers, C2H2-type"", ""-"""	28632	protein-coding gene	gene with protein product						12477932	Standard	NM_024341		Approved	MGC4054	uc002mgc.3	Q8N988	OTTHUMG00000181977	ENST00000439035.2:c.845A>G	19.37:g.7083328A>G	ENSP00000398965:p.Glu282Gly	Somatic	52	0		WXS	Illumina HiSeq	.	50	2	NM_001044387	Q6PEJ3|Q9BTZ1	Missense_Mutation	SNP	ENST00000439035.2	37	CCDS45945.1	.	.	.	.	.	.	.	.	.	.	A	13.36	2.213451	0.39102	.	.	ENSG00000130544	ENST00000252840;ENST00000414706;ENST00000439035	T;T;T	0.27557	1.66;1.66;1.66	1.32	0.0813	0.14424	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.34221	0.0890	M	0.83118	2.625	0.18873	N	0.999986	B;B	0.33448	0.412;0.359	B;B	0.35655	0.207;0.131	T	0.37888	-0.9686	9	0.87932	D	0	.	4.3989	0.11376	0.7061:0.0:0.0:0.2939	.	282;289	Q8N988;Q8N988-2	ZN557_HUMAN;.	G	289;289;282	ENSP00000252840:E289G;ENSP00000404065:E289G;ENSP00000398965:E282G	ENSP00000252840:E289G	E	+	2	0	ZNF557	7034328	1.000000	0.71417	0.001000	0.08648	0.085000	0.17905	3.467000	0.53078	-0.026000	0.13895	0.260000	0.18958	GAG	.		0.453	ZNF557-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458502.1	NM_024341	
ANKHD1	54882	hgsc.bcm.edu	37	5	139885404	139885404	+	Nonsense_Mutation	SNP	C	C	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr5:139885404C>T	ENST00000360839.2	+	18	3512	c.3358C>T	c.(3358-3360)Cga>Tga	p.R1120*	ANKHD1_ENST00000297183.6_Nonsense_Mutation_p.R1120*|ANKHD1-EIF4EBP3_ENST00000532219.1_Nonsense_Mutation_p.R1120*	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	1120						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACAGTCTGAACGAACTAAGGA	0.388																																					p.R1120X		.											.	.	.	0			c.C3358T						.						245.0	225.0	232.0					5																	139885404		2203	4300	6503	SO:0001587	stop_gained	54882	exon18			TCTGAACGAACTA	AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.3358C>T	5.37:g.139885404C>T	ENSP00000354085:p.Arg1120*	Somatic	59	0		WXS	Illumina HiSeq	.	43	4	NM_017747	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Nonsense_Mutation	SNP	ENST00000360839.2	37	CCDS4225.1	.	.	.	.	.	.	.	.	.	.	C	43	10.177067	0.99353	.	.	ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000254996	ENST00000360839;ENST00000422011;ENST00000297183;ENST00000253810;ENST00000310356;ENST00000235510;ENST00000421134;ENST00000412116;ENST00000532219	.	.	.	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.4529	0.94875	0.0:1.0:0.0:0.0	.	.	.	.	X	1120;1153;1120;1120;654;331;1139;273;1120	.	ENSP00000432016:R1120X	R	+	1	2	ANKHD1-EIF4EBP3;ANKHD1	139865588	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.198000	0.42705	2.595000	0.87683	0.655000	0.94253	CGA	.		0.388	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251672.1	NM_017747	
ZNF583	147949	hgsc.bcm.edu	37	19	56935118	56935118	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr19:56935118G>A	ENST00000333201.9	+	5	1301	c.1091G>A	c.(1090-1092)cGt>cAt	p.R364H	ZNF583_ENST00000585612.1_3'UTR|ZNF583_ENST00000291598.7_Missense_Mutation_p.R364H	NM_001159861.1|NM_152478.2	NP_001153333.1|NP_689691.2	Q96ND8	ZN583_HUMAN	zinc finger protein 583	364					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(2)|prostate(1)|skin(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0564)		TTTAGCCATCGTGGATACCTA	0.423																																					p.R364H		.											ZNF583,right_upper_lobe,carcinoma,0,1	ZNF583	0	0			c.G1091A						.						117.0	119.0	118.0					19																	56935118		2203	4300	6503	SO:0001583	missense	147949	exon5			GCCATCGTGGATA	AK055592	CCDS12943.1	19q13.43	2013-09-20			ENSG00000198440	ENSG00000198440		"""Zinc fingers, C2H2-type"", ""-"""	26427	protein-coding gene	gene with protein product							Standard	NM_152478		Approved	FLJ31030	uc010ygl.1	Q96ND8	OTTHUMG00000168874	ENST00000333201.9:c.1091G>A	19.37:g.56935118G>A	ENSP00000388502:p.Arg364His	Somatic	42	0		WXS	Illumina HiSeq	.	45	2	NM_001159861	O14850|Q2NKK3	Missense_Mutation	SNP	ENST00000333201.9	37	CCDS12943.1	.	.	.	.	.	.	.	.	.	.	G	13.76	2.331851	0.41297	.	.	ENSG00000198440	ENST00000291598;ENST00000333201	T;T	0.08370	3.1;3.1	3.96	2.89	0.33648	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.45361	D	0.000373	T	0.09423	0.0232	N	0.16656	0.425	0.09310	N	1	D	0.89917	1.0	D	0.63192	0.912	T	0.16188	-1.0411	9	.	.	.	.	3.5396	0.07806	0.1963:0.0:0.591:0.2127	.	364	Q96ND8	ZN583_HUMAN	H	364	ENSP00000291598:R364H;ENSP00000388502:R364H	.	R	+	2	0	ZNF583	61626930	0.001000	0.12720	0.001000	0.08648	0.918000	0.54935	0.000000	0.12993	0.972000	0.38314	0.462000	0.41574	CGT	.		0.423	ZNF583-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401453.1	NM_152478	
FBXO10	26267	hgsc.bcm.edu;bcgsc.ca	37	9	37537628	37537628	+	Silent	SNP	G	G	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr9:37537628G>T	ENST00000432825.2	-	3	946	c.898C>A	c.(898-900)Cgg>Agg	p.R300R	FBXO10_ENST00000541829.1_Intron|RP11-613M10.8_ENST00000544475.1_5'UTR|FBXO10_ENST00000543968.1_5'Flank	NM_012166.2	NP_036298.2	Q9UK96	FBX10_HUMAN	F-box protein 10	300					apoptotic process (GO:0006915)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(5)|large_intestine(11)|lung(15)|prostate(1)|upper_aerodigestive_tract(1)	34				GBM - Glioblastoma multiforme(29;0.0107)		GCCTGGTCCCGGCTCTCTAGG	0.562																																					p.R300R		.											.	.	.	0			c.C898A						.						39.0	41.0	40.0					9																	37537628		1885	4110	5995	SO:0001819	synonymous_variant	26267	exon3			GGTCCCGGCTCTC	AF174598	CCDS47966.1	9p13.1	2014-01-29	2004-06-15		ENSG00000147912	ENSG00000147912		"""F-boxes /  ""other"""""	13589	protein-coding gene	gene with protein product		609092	"""F-box only protein 10"""			10531035, 10531037, 19300908	Standard	NM_012166		Approved	FBX10	uc004aab.3	Q9UK96	OTTHUMG00000019926	ENST00000432825.2:c.898C>A	9.37:g.37537628G>T		Somatic	55	0		WXS	Illumina HiSeq	.	65	4	NM_012166	Q08AL3|Q08AL4|Q5JRT8|Q9UKC3	Silent	SNP	ENST00000432825.2	37	CCDS47966.1																																																																																			.		0.562	FBXO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052472.3		
LYPLAL1	127018	hgsc.bcm.edu	37	1	219384997	219384997	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr1:219384997G>T	ENST00000366928.5	+	5	688	c.641G>T	c.(640-642)aGc>aTc	p.S214I	LYPLAL1_ENST00000366927.3_Missense_Mutation_p.S198I|LYPLAL1_ENST00000483635.1_3'UTR	NM_138794.3	NP_620149	Q5VWZ2	LYPL1_HUMAN	lysophospholipase-like 1	214					negative regulation of Golgi to plasma membrane protein transport (GO:0042997)|protein depalmitoylation (GO:0002084)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	lysophospholipase activity (GO:0004622)			large_intestine(1)|lung(5)	6				GBM - Glioblastoma multiforme(131;0.055)|all cancers(67;0.105)|OV - Ovarian serous cystadenocarcinoma(81;0.116)		CATGAGCTAAGCAAAACTGAG	0.338																																					p.S214I		.											.	.	.	0			c.G641T						.						109.0	109.0	109.0					1																	219384997		2203	4300	6503	SO:0001583	missense	127018	exon5			AGCTAAGCAAAAC	BC016711	CCDS1522.1, CCDS73032.1	1q41	2008-02-05			ENSG00000143353	ENSG00000143353			20440	protein-coding gene	gene with protein product							Standard	XM_005273046		Approved	Q96AV0	uc001hlq.4	Q5VWZ2	OTTHUMG00000037141	ENST00000366928.5:c.641G>T	1.37:g.219384997G>T	ENSP00000355895:p.Ser214Ile	Somatic	70	0		WXS	Illumina HiSeq	.	94	4	NM_138794	A8K677|Q5VWZ3|Q7Z4A3|Q96AV0	Missense_Mutation	SNP	ENST00000366928.5	37	CCDS1522.1	.	.	.	.	.	.	.	.	.	.	G	15.73	2.918798	0.52546	.	.	ENSG00000143353	ENST00000366928;ENST00000366927	T;T	0.22134	1.97;1.97	6.16	0.96	0.19631	Phospholipase/carboxylesterase/thioesterase (1);	0.487974	0.26075	N	0.026484	T	0.17492	0.0420	L	0.38649	1.16	0.09310	N	0.999994	D;P;P	0.58970	0.984;0.95;0.913	P;B;P	0.46299	0.484;0.377;0.511	T	0.11690	-1.0577	10	0.41790	T	0.15	.	8.6803	0.34205	0.6177:0.0:0.3823:0.0	.	90;198;214	B3KVW3;Q5VWZ2-2;Q5VWZ2	.;.;LYPL1_HUMAN	I	214;198	ENSP00000355895:S214I;ENSP00000355894:S198I	ENSP00000355894:S198I	S	+	2	0	LYPLAL1	217451620	0.792000	0.28813	0.435000	0.26784	0.804000	0.45430	0.333000	0.19768	0.130000	0.18549	0.650000	0.86243	AGC	.		0.338	LYPLAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090208.1	NM_138794	
OR4B1	119765	hgsc.bcm.edu	37	11	48238420	48238420	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr11:48238420C>T	ENST00000309562.2	+	1	77	c.59C>T	c.(58-60)gCt>gTt	p.A20V		NM_001005470.1	NP_001005470.1	Q8NGF8	OR4B1_HUMAN	olfactory receptor, family 4, subfamily B, member 1	20						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	28						CAGGATCCAGCTGTGCAGAGT	0.507																																					p.A20V		.											OR4B1,right_upper_lobe,carcinoma,0,1	OR4B1	0	0			c.C59T						.						241.0	196.0	211.0					11																	48238420		2201	4298	6499	SO:0001583	missense	119765	exon1			ATCCAGCTGTGCA	AB065848	CCDS31485.1	11p11.2	2012-08-09			ENSG00000175619	ENSG00000175619		"""GPCR / Class A : Olfactory receptors"""	8290	protein-coding gene	gene with protein product							Standard	NM_001005470		Approved	OST208	uc010rhs.2	Q8NGF8	OTTHUMG00000166576	ENST00000309562.2:c.59C>T	11.37:g.48238420C>T	ENSP00000311605:p.Ala20Val	Somatic	52	0		WXS	Illumina HiSeq	.	28	2	NM_001005470	Q6IF75|Q96R64	Missense_Mutation	SNP	ENST00000309562.2	37	CCDS31485.1	.	.	.	.	.	.	.	.	.	.	C	5.296	0.240067	0.10023	.	.	ENSG00000175619	ENST00000309562	T	0.03094	4.05	5.4	1.6	0.23607	.	0.691121	0.12907	N	0.429284	T	0.01627	0.0052	N	0.04090	-0.28	0.09310	N	1	B	0.13594	0.008	B	0.06405	0.002	T	0.46484	-0.9188	10	0.46703	T	0.11	.	0.7877	0.01051	0.4878:0.1733:0.1787:0.1602	.	20	Q8NGF8	OR4B1_HUMAN	V	20	ENSP00000311605:A20V	ENSP00000311605:A20V	A	+	2	0	OR4B1	48194996	0.000000	0.05858	0.399000	0.26333	0.011000	0.07611	-0.271000	0.08572	0.359000	0.24239	-0.750000	0.03501	GCT	.		0.507	OR4B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390554.1	NM_001005470	
WBP11P1	441818	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	30092638	30092638	+	RNA	SNP	G	G	A	rs568013144		TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr18:30092638G>A	ENST00000567636.1	+	0	1013					NR_003558.1				WW domain binding protein 11 pseudogene 1																		CAGTGACACCGACGGATCAGA	0.453													G|||	1	0.000199681	0.0	0.0	5008	,	,		21450	0.001		0.0	False		,,,				2504	0.0				.		.											.	.	.	0			.						.																																					441818	.			GACACCGACGGAT	BC059403		18q12.1	2007-05-15				ENSG00000260389			26250	pseudogene	pseudogene							Standard	NR_003558		Approved	HsT3017	uc010dmc.3				18.37:g.30092638G>A		Somatic	22	0		WXS	Illumina HiSeq	.	16	8	.		RNA	SNP	ENST00000567636.1	37																																																																																				.		0.453	WBP11P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000435119.1		
OSGIN2	734	hgsc.bcm.edu	37	8	90937735	90937735	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr8:90937735G>T	ENST00000297438.2	+	6	1848	c.1493G>T	c.(1492-1494)aGa>aTa	p.R498I	OSGIN2_ENST00000451899.2_Missense_Mutation_p.R542I	NM_004337.2	NP_004328.1	Q9Y236	OSGI2_HUMAN	oxidative stress induced growth inhibitor family member 2	498					meiotic nuclear division (GO:0007126)					breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|urinary_tract(1)	17			BRCA - Breast invasive adenocarcinoma(11;0.0344)			TTTGTTGAAAGAGGAGGAGGA	0.383																																					p.R542I		.											.,2	.	73	0			c.G1625T						.						52.0	50.0	50.0					8																	90937735		2203	4300	6503	SO:0001583	missense	734	exon6			TTGAAAGAGGAGG	AF061326	CCDS6248.1, CCDS47888.1	8q21	2006-10-05	2006-10-05	2006-10-05	ENSG00000164823	ENSG00000164823			1355	protein-coding gene	gene with protein product		604598	"""chromosome 8 open reading frame 1"""	C8orf1		9933573	Standard	NM_004337		Approved	hT41	uc003yeh.3	Q9Y236	OTTHUMG00000163811	ENST00000297438.2:c.1493G>T	8.37:g.90937735G>T	ENSP00000297438:p.Arg498Ile	Somatic	77	0		WXS	Illumina HiSeq	.	48	2	NM_001126111		Missense_Mutation	SNP	ENST00000297438.2	37	CCDS6248.1	.	.	.	.	.	.	.	.	.	.	G	16.35	3.099184	0.56183	.	.	ENSG00000164823	ENST00000297438;ENST00000451899	T;T	0.23552	1.92;1.9	5.68	4.81	0.61882	.	0.374781	0.34628	N	0.003818	T	0.21674	0.0522	L	0.36672	1.1	0.80722	D	1	P;B	0.34977	0.478;0.171	B;B	0.31812	0.136;0.044	T	0.03728	-1.1009	10	0.72032	D	0.01	-14.0957	13.6584	0.62352	0.0744:0.0:0.9256:0.0	.	542;498	Q9Y236-2;Q9Y236	.;OSGI2_HUMAN	I	498;542	ENSP00000297438:R498I;ENSP00000396445:R542I	ENSP00000297438:R498I	R	+	2	0	OSGIN2	91006910	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.381000	0.44336	1.396000	0.46663	0.563000	0.77884	AGA	.		0.383	OSGIN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000375691.1	NM_004337	
STEAP1B	256227	hgsc.bcm.edu;bcgsc.ca	37	7	22533072	22533072	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr7:22533072C>A	ENST00000406890.2	-	3	505	c.411G>T	c.(409-411)aaG>aaT	p.K137N	STEAP1B_ENST00000404369.4_Missense_Mutation_p.K156N	NM_207342.2	NP_997225.1	Q6NZ63	STEAL_HUMAN	STEAP family member 1B	137						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|lung(2)	4						TTAACATCCACTTATCCAACC	0.403																																					p.K156N		.											.	.	.	0			c.G468T						.						145.0	127.0	133.0					7																	22533072		692	1591	2283	SO:0001583	missense	256227	exon3			CATCCACTTATCC		CCDS55094.1, CCDS56469.1	7p15.3	2011-05-19			ENSG00000105889	ENSG00000105889			41907	protein-coding gene	gene with protein product							Standard	NM_207342		Approved		uc010kum.2	Q6NZ63	OTTHUMG00000152529	ENST00000406890.2:c.411G>T	7.37:g.22533072C>A	ENSP00000385239:p.Lys137Asn	Somatic	117	0		WXS	Illumina HiSeq	.	97	4	NM_001164460	B5MCI2	Missense_Mutation	SNP	ENST00000406890.2	37	CCDS55094.1	.	.	.	.	.	.	.	.	.	.	t	0.826	-0.746879	0.03065	.	.	ENSG00000105889	ENST00000406890;ENST00000404369;ENST00000424363;ENST00000439708	D;D;D;D	0.90385	-2.66;-2.66;-2.66;-2.66	1.06	-1.24	0.09435	Flavoprotein transmembrane component (1);	0.608641	0.12947	U	0.426091	D	0.83285	0.5221	L	0.38838	1.175	0.23003	N	0.998446	P;B	0.35124	0.485;0.081	B;B	0.40038	0.317;0.084	T	0.72899	-0.4152	10	0.42905	T	0.14	-2.2763	2.0088	0.03483	0.2575:0.3526:0.0:0.3899	.	156;137	B5MCI2;Q6NZ63	.;STEAL_HUMAN	N	137;156;156;156	ENSP00000385239:K137N;ENSP00000384370:K156N;ENSP00000416608:K156N;ENSP00000408954:K156N	ENSP00000384370:K156N	K	-	3	2	STEAP1B	22499597	0.150000	0.22732	0.941000	0.38009	0.088000	0.18126	-0.081000	0.11321	-0.371000	0.08004	-1.709000	0.00716	AAG	.		0.403	STEAP1B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326617.2		
MEF2A	4205	hgsc.bcm.edu	37	15	100211761	100211761	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr15:100211761C>T	ENST00000354410.5	+	5	924	c.295C>T	c.(295-297)Cca>Tca	p.P99S	MEF2A_ENST00000453228.2_Intron|MEF2A_ENST00000557785.1_Intron|MEF2A_ENST00000449277.2_Intron|MEF2A_ENST00000558812.1_Intron|MEF2A_ENST00000338042.6_Intron|MEF2A_ENST00000557942.1_Intron	NM_005587.2	NP_005578.2	Q02078	MEF2A_HUMAN	myocyte enhancer factor 2A	99					apoptotic process (GO:0006915)|cardiac conduction (GO:0061337)|cellular response to calcium ion (GO:0071277)|dendrite morphogenesis (GO:0048813)|ERK5 cascade (GO:0070375)|heart development (GO:0007507)|innate immune response (GO:0045087)|MAPK cascade (GO:0000165)|mitochondrial genome maintenance (GO:0000002)|mitochondrion distribution (GO:0048311)|muscle cell differentiation (GO:0042692)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac myofibril assembly (GO:0055005)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)	p.P99S(3)		endometrium(2)|large_intestine(2)|lung(7)|ovary(1)	12	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00085)			GTGCGACAGCCCAGACCCTGA	0.333																																					p.P99S		.											MEF2A_ENST00000354410,NS,carcinoma,0,3	MEF2A_ENST00000354410	0	3	Substitution - Missense(3)	lung(1)|kidney(1)|central_nervous_system(1)	c.C295T						.						82.0	69.0	73.0					15																	100211761		1843	4079	5922	SO:0001583	missense	4205	exon5			GACAGCCCAGACC		CCDS45362.1, CCDS45363.1, CCDS53978.1, CCDS58401.1	15q26	2008-02-05	2007-04-24			ENSG00000068305		"""Myocyte enhancer factors"""	6993	protein-coding gene	gene with protein product		600660				1516833	Standard	NM_005587		Approved	RSRFC4, RSRFC9	uc002bvf.3	Q02078		ENST00000354410.5:c.295C>T	15.37:g.100211761C>T	ENSP00000346389:p.Pro99Ser	Somatic	93	1		WXS	Illumina HiSeq	.	123	5	NM_005587	B4DFQ7|F6XG23|O43814|Q14223|Q14224|Q59GX4|Q7Z6C9|Q96D14	Missense_Mutation	SNP	ENST00000354410.5	37	CCDS45362.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.814941	0.90790	.	.	ENSG00000068305	ENST00000354410	T	0.63255	-0.03	5.42	5.42	0.78866	Holliday junction regulator protein family C-terminal repeat (1);	0.000000	0.85682	D	0.000000	D	0.82866	0.5130	M	0.87456	2.885	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.85220	0.1026	10	0.72032	D	0.01	-16.5447	19.5673	0.95398	0.0:1.0:0.0:0.0	.	99;99	Q02078;Q02078-5	MEF2A_HUMAN;.	S	99	ENSP00000346389:P99S	ENSP00000346389:P99S	P	+	1	0	MEF2A	98029284	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.445000	0.80570	2.706000	0.92434	0.462000	0.41574	CCA	.		0.333	MEF2A-001	KNOWN	overlapping_uORF|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000415980.1		
ATP1A2	477	hgsc.bcm.edu	37	1	160097563	160097563	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr1:160097563G>A	ENST00000361216.3	+	8	1059	c.970G>A	c.(970-972)Ggc>Agc	p.G324S	ATP1A2_ENST00000392233.3_Missense_Mutation_p.G324S	NM_000702.3	NP_000693.1	P50993	AT1A2_HUMAN	ATPase, Na+/K+ transporting, alpha 2 polypeptide	324					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|locomotion (GO:0040011)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of heart contraction (GO:0045822)|negative regulation of striated muscle contraction (GO:0045988)|neurotransmitter uptake (GO:0001504)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of smooth muscle contraction (GO:0006940)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|regulation of vasoconstriction (GO:0019229)|relaxation of cardiac muscle (GO:0055119)|response to nicotine (GO:0035094)|sodium ion export from cell (GO:0036376)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	caveola (GO:0005901)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|endosome (GO:0005768)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(30)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	69	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			CTTCCTCATCGGCATCATAGT	0.597																																					p.G324S		.											ATP1A2,NS,carcinoma,0,2	ATP1A2	0	0			c.G970A						.						106.0	102.0	103.0					1																	160097563		2203	4300	6503	SO:0001583	missense	477	exon8			CTCATCGGCATCA	AB018321	CCDS1196.1	1q23.2	2014-09-17	2010-04-20		ENSG00000018625	ENSG00000018625	3.6.3.9	"""ATPases / P-type"""	800	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-2"", ""sodium pump subunit alpha-2"", ""sodium-potassium ATPase catalytic subunit alpha-2"""	182340	"""migraine, hemiplegic 2"", ""ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide"""	MHP2		9403481	Standard	NM_000702		Approved	FHM2	uc001fvc.3	P50993	OTTHUMG00000024080	ENST00000361216.3:c.970G>A	1.37:g.160097563G>A	ENSP00000354490:p.Gly324Ser	Somatic	22	0		WXS	Illumina HiSeq	.	37	2	NM_000702	D3DVE4|Q07059|Q5JW74|Q86UZ5|Q9UQ25	Missense_Mutation	SNP	ENST00000361216.3	37	CCDS1196.1	.	.	.	.	.	.	.	.	.	.	G	33	5.288490	0.95517	.	.	ENSG00000018625	ENST00000538123;ENST00000361216;ENST00000392233	D;D	0.89617	-2.54;-2.54	4.65	4.65	0.58169	ATPase, P-type, ATPase-associated domain (1);	0.000000	0.85682	D	0.000000	D	0.90490	0.7021	L	0.39326	1.205	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.91803	0.5453	10	0.66056	D	0.02	.	16.6527	0.85220	0.0:0.0:1.0:0.0	.	169;224;324	B4DHD7;F5GXJ7;P50993	.;.;AT1A2_HUMAN	S	169;324;324	ENSP00000354490:G324S;ENSP00000376066:G324S	ENSP00000354490:G324S	G	+	1	0	ATP1A2	158364187	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.779000	0.99018	2.293000	0.77203	0.561000	0.74099	GGC	.		0.597	ATP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060642.2	NM_000702	
PAXIP1	22976	hgsc.bcm.edu	37	7	154767932	154767932	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr7:154767932G>T	ENST00000404141.1	-	6	702	c.548C>A	c.(547-549)cCt>cAt	p.P183H	PAXIP1_ENST00000473219.1_5'UTR|PAXIP1_ENST00000397192.1_Missense_Mutation_p.P183H			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	183	BRCT 2. {ECO:0000255|PROSITE- ProRule:PRU00033}.|Interaction with PAGR1. {ECO:0000250}.				adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)		p.P149H(1)|p.P183H(1)		NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		AATCAGACGAGGATGATAAAA	0.403																																					p.P183H		.											PAXIP1,NS,carcinoma,0,1	PAXIP1	0	2	Substitution - Missense(2)	endometrium(2)	c.C548A						.						87.0	78.0	81.0					7																	154767932		1918	4155	6073	SO:0001583	missense	22976	exon6			AGACGAGGATGAT	U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.548C>A	7.37:g.154767932G>T	ENSP00000384048:p.Pro183His	Somatic	67	0		WXS	Illumina HiSeq	.	36	2	NM_007349	O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	Missense_Mutation	SNP	ENST00000404141.1	37	CCDS47753.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.091239	0.76756	.	.	ENSG00000157212	ENST00000404141;ENST00000397192;ENST00000357094;ENST00000323199;ENST00000419436	T;T;T	0.11604	2.76;2.76;2.76	4.98	4.98	0.66077	BRCT (2);	0.000000	0.56097	U	0.000035	T	0.41811	0.1175	M	0.89353	3.025	0.58432	D	0.999995	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.999;0.999;0.999	T	0.52631	-0.8550	10	0.87932	D	0	-19.4316	18.2489	0.89996	0.0:0.0:1.0:0.0	.	136;92;149;183	B4DEQ6;Q6ZW49-3;Q6ZW49-1;Q6ZW49	.;.;.;PAXI1_HUMAN	H	183;183;131;136;141	ENSP00000384048:P183H;ENSP00000380376:P183H;ENSP00000389849:P141H	ENSP00000319149:P136H	P	-	2	0	PAXIP1	154398865	1.000000	0.71417	0.710000	0.30468	0.643000	0.38383	9.028000	0.93712	2.301000	0.77427	0.305000	0.20034	CCT	.		0.403	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322223.1	NM_007349	
ASIC4	55515	hgsc.bcm.edu	37	2	220397179	220397179	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr2:220397179G>A	ENST00000347842.3	+	4	1393	c.1379G>A	c.(1378-1380)tGc>tAc	p.C460Y	ASIC4_ENST00000358078.4_Missense_Mutation_p.C460Y|ASIC4_ENST00000473709.1_3'UTR	NM_182847.2	NP_878267.2	Q96FT7	ASIC4_HUMAN	acid-sensing (proton-gated) ion channel family member 4	460					ion transmembrane transport (GO:0034220)|sodium ion transmembrane transport (GO:0035725)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)	ion channel activity (GO:0005216)|sodium channel activity (GO:0005272)|sodium ion transmembrane transporter activity (GO:0015081)	p.C460Y(1)									CGCTGCCACTGCCGGATGGTG	0.662																																					p.C460Y		.											ACCN4,NS,carcinoma,0,1	ACCN4	0	1	Substitution - Missense(1)	endometrium(1)	c.G1379A						.						39.0	37.0	38.0					2																	220397179		2203	4300	6503	SO:0001583	missense	55515	exon4			GCCACTGCCGGAT	AJ271643	CCDS2442.1	2q36.1	2012-02-22	2012-02-22	2012-02-22	ENSG00000072182	ENSG00000072182		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	21263	protein-coding gene	gene with protein product		606715	"""amiloride-sensitive cation channel 4, pituitary"", ""amiloride-sensitive cation channel family member 4, pituitary"""	ACCN4		10852210	Standard	NM_182847		Approved	BNAC4	uc002vma.3	Q96FT7	OTTHUMG00000058928	ENST00000347842.3:c.1379G>A	2.37:g.220397179G>A	ENSP00000326627:p.Cys460Tyr	Somatic	21	0		WXS	Illumina HiSeq	.	18	2	NM_182847	Q53SB7|Q6GMS1|Q6PIN9|Q9NQA4	Missense_Mutation	SNP	ENST00000347842.3	37	CCDS2442.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.185991	0.78789	.	.	ENSG00000072182	ENST00000347842;ENST00000358078	D;D	0.90563	-2.69;-2.69	4.1	4.1	0.47936	Na+ channel, amiloride-sensitive, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.96166	0.8750	M	0.91612	3.225	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.87578	0.967;0.998	D	0.97208	0.9869	10	0.87932	D	0	-17.8674	16.5064	0.84273	0.0:0.0:1.0:0.0	.	460;460	Q96FT7;Q96FT7-4	ACCN4_HUMAN;.	Y	460	ENSP00000326627:C460Y;ENSP00000350786:C460Y	ENSP00000326627:C460Y	C	+	2	0	ACCN4	220105423	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.473000	0.97714	2.305000	0.77605	0.561000	0.74099	TGC	.		0.662	ASIC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130263.1	NM_018674	
MPZL3	196264	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	118106178	118106178	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr11:118106178C>T	ENST00000278949.4	-	4	633	c.578G>A	c.(577-579)aGg>aAg	p.R193K	MPZL3_ENST00000527472.1_Missense_Mutation_p.R181K|MPZL3_ENST00000525386.1_Intron			Q6UWV2	MPZL3_HUMAN	myelin protein zero-like 3	193					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|hair cycle (GO:0042633)	integral component of membrane (GO:0016021)				autonomic_ganglia(1)|endometrium(1)|large_intestine(1)|lung(2)|stomach(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.046)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		ATAGCCAGACCTGCTCCTCTT	0.557																																					p.R193K		.											.	.	.	0			c.G578A						.						213.0	209.0	210.0					11																	118106178		2200	4296	6496	SO:0001583	missense	196264	exon4			CCAGACCTGCTCC	AK095399	CCDS8392.1, CCDS66241.1	11q23.3	2013-01-11			ENSG00000160588	ENSG00000160588		"""Immunoglobulin superfamily / V-set domain containing"""	27279	protein-coding gene	gene with protein product		611707				17273165	Standard	NM_198275		Approved		uc001psm.3	Q6UWV2	OTTHUMG00000166966	ENST00000278949.4:c.578G>A	11.37:g.118106178C>T	ENSP00000278949:p.Arg193Lys	Somatic	50	0		WXS	Illumina HiSeq	.	28	10	NM_198275	A8K025|B4DLD5|B4E2I8	Missense_Mutation	SNP	ENST00000278949.4	37	CCDS8392.1	.	.	.	.	.	.	.	.	.	.	C	5.590	0.293593	0.10567	.	.	ENSG00000160588	ENST00000278949;ENST00000527472	D;D	0.95272	-3.49;-3.66	5.87	2.36	0.29203	.	0.345181	0.31612	N	0.007351	D	0.82651	0.5083	N	0.04880	-0.145	0.30845	N	0.735254	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.70583	-0.4832	10	0.02654	T	1	.	9.5304	0.39191	0.0:0.3626:0.0:0.6374	.	181;193	B4E2I8;Q6UWV2	.;MPZL3_HUMAN	K	193;181	ENSP00000278949:R193K;ENSP00000432106:R181K	ENSP00000278949:R193K	R	-	2	0	MPZL3	117611388	0.998000	0.40836	1.000000	0.80357	0.989000	0.77384	1.042000	0.30303	0.223000	0.20920	-0.302000	0.09304	AGG	.		0.557	MPZL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392109.1	NM_198275	
TRIM40	135644	hgsc.bcm.edu	37	6	30113806	30113806	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr6:30113806G>T	ENST00000396581.1	+	3	767	c.381G>T	c.(379-381)aaG>aaT	p.K127N	TRIM40_ENST00000376724.2_Missense_Mutation_p.K127N|TRIM40_ENST00000307859.4_Missense_Mutation_p.K127N			Q6P9F5	TRI40_HUMAN	tripartite motif containing 40	127					negative regulation of cell growth (GO:0030308)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein localization to nucleus (GO:1900181)|protein neddylation (GO:0045116)	IkappaB kinase complex (GO:0008385)	zinc ion binding (GO:0008270)			ovary(1)	1						AGCTCAGAAAGGACATTGCAG	0.567																																					p.K127N		.											.	.	.	0			c.G381T						.						71.0	60.0	64.0					6																	30113806		1511	2709	4220	SO:0001583	missense	135644	exon2			CAGAAAGGACATT	AF489517	CCDS4675.1, CCDS69069.1	6p21.31	2013-01-09	2011-01-25		ENSG00000204614	ENSG00000204614		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	18736	protein-coding gene	gene with protein product			"""tripartite motif-containing 40"""				Standard	NM_138700		Approved	RNF35	uc003npm.2	Q6P9F5	OTTHUMG00000031083	ENST00000396581.1:c.381G>T	6.37:g.30113806G>T	ENSP00000379826:p.Lys127Asn	Somatic	50	0		WXS	Illumina HiSeq	.	40	3	NM_138700	Q5SRJ6|Q5SS36|Q8TD96	Missense_Mutation	SNP	ENST00000396581.1	37		.	.	.	.	.	.	.	.	.	.	G	8.242	0.807095	0.16467	.	.	ENSG00000204614	ENST00000396581;ENST00000376724;ENST00000307859	T;T;T	0.69435	-0.28;-0.28;-0.4	4.71	0.283	0.15696	.	0.000000	0.50627	D	0.000114	T	0.32466	0.0830	L	0.39245	1.2	0.09310	N	0.999997	B;B	0.15473	0.013;0.013	B;B	0.14023	0.01;0.01	T	0.36163	-0.9759	10	0.66056	D	0.02	.	7.3875	0.26891	0.4529:0.0:0.5471:0.0	.	127;127	Q5SRJ6;Q6P9F5	.;TRI40_HUMAN	N	127	ENSP00000379826:K127N;ENSP00000365914:K127N;ENSP00000308310:K127N	ENSP00000308310:K127N	K	+	3	2	TRIM40	30221785	0.466000	0.25823	0.054000	0.19295	0.461000	0.32589	0.344000	0.19962	-0.212000	0.10109	-0.262000	0.10625	AAG	.		0.567	TRIM40-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000076117.2		
ZNF16	7564	hgsc.bcm.edu	37	8	146156248	146156248	+	Nonsense_Mutation	SNP	G	G	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr8:146156248G>T	ENST00000276816.4	-	4	2111	c.1925C>A	c.(1924-1926)tCg>tAg	p.S642*	ZNF16_ENST00000394909.2_Nonsense_Mutation_p.S642*	NM_001029976.2	NP_001025147.2	P17020	ZNF16_HUMAN	zinc finger protein 16	642					cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to sodium dodecyl sulfate (GO:0072707)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell cycle phase transition (GO:1901989)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of kinase activity (GO:0033674)|positive regulation of megakaryocyte differentiation (GO:0045654)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|lung(9)|ovary(5)|prostate(1)|skin(1)|urinary_tract(1)	29	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.136)	Epithelial(56;3.45e-38)|all cancers(56;3.04e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0424)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.02)|KIRC - Kidney renal clear cell carcinoma(644;0.0486)		GATGAGGACCGAACGCTGACT	0.542																																					p.S642X		.											ZNF16,colon,carcinoma,0,1	ZNF16	0	0			c.C1925A						.						131.0	126.0	127.0					8																	146156248		2203	4300	6503	SO:0001587	stop_gained	7564	exon3			AGGACCGAACGCT	X52340	CCDS6437.1	8q24	2013-01-08	2006-05-10		ENSG00000170631	ENSG00000170631		"""Zinc fingers, C2H2-type"""	12947	protein-coding gene	gene with protein product		601262	"""zinc finger protein 16 (KOX 9)"""				Standard	NM_006958		Approved	KOX9	uc003zeu.3	P17020	OTTHUMG00000165253	ENST00000276816.4:c.1925C>A	8.37:g.146156248G>T	ENSP00000276816:p.Ser642*	Somatic	57	0		WXS	Illumina HiSeq	.	41	3	NM_006958	B3KXM4|D3DWP2|Q45SH7|Q96FG0|Q9NRA4	Nonsense_Mutation	SNP	ENST00000276816.4	37	CCDS6437.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.731939	0.89390	.	.	ENSG00000170631	ENST00000276816;ENST00000394909	.	.	.	4.0	4.0	0.46444	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999996	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.0179	0.71600	0.0:0.0:1.0:0.0	.	.	.	.	X	642	.	ENSP00000276816:S642X	S	-	2	0	ZNF16	146127052	0.000000	0.05858	0.777000	0.31699	0.466000	0.32739	0.036000	0.13819	2.058000	0.61347	0.462000	0.41574	TCG	.		0.542	ZNF16-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000382978.1	NM_006958	
SSC5D	284297	hgsc.bcm.edu	37	19	56015484	56015484	+	Intron	SNP	G	G	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr19:56015484G>T	ENST00000389623.6	+	12	2808				SSC5D_ENST00000587166.1_Splice_Site_p.E929D	NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains						defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						cgtttccagagccggaagcgg	0.652																																					p.E929D		.											.	.	.	0			c.G2787T						.																																			SO:0001627	intron_variant	284297	exon13			TCCAGAGCCGGAA		CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.2785+2916G>T	19.37:g.56015484G>T		Somatic	72	0		WXS	Illumina HiSeq	.	78	4	NM_001195267	B5MDQ5|C7S7T9|C7S7U0|K7EP70	Missense_Mutation	SNP	ENST00000389623.6	37	CCDS46196.1	.	.	.	.	.	.	.	.	.	.	G	2.468	-0.322494	0.05350	.	.	ENSG00000179954	ENST00000541230	.	.	.	1.61	-3.22	0.05125	.	.	.	.	.	T	0.08492	0.0211	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.25537	-1.0129	5	0.02654	T	1	.	3.0246	0.06086	0.4421:0.0:0.3603:0.1976	.	.	.	.	D	929	.	ENSP00000444330:E929D	E	+	3	2	SSC5D	60707296	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.526000	0.06207	-1.492000	0.01838	-0.404000	0.06349	GAG	.		0.652	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453345.2	XM_001718392	
CATSPERB	79820	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	92105595	92105595	+	Splice_Site	SNP	C	C	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr14:92105595C>T	ENST00000256343.3	-	16	1589		c.e16-1			NM_024764.2	NP_079040.2	Q9H7T0	CTSRB_HUMAN	catsper channel auxiliary subunit beta						cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|cilium (GO:0005929)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|kidney(3)|large_intestine(15)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(2)	54		all_cancers(154;0.0663)|all_epithelial(191;0.236)				CTTCCCATTCCTATTAGGAAA	0.368																																					.		.											.	.	.	0			c.1433-1G>A						.						75.0	71.0	72.0					14																	92105595		2203	4300	6503	SO:0001630	splice_region_variant	79820	exon17			CCATTCCTATTAG	AK024360	CCDS32142.1	14q32.12	2012-02-22	2012-02-22	2007-10-18	ENSG00000133962	ENSG00000133962			20500	protein-coding gene	gene with protein product		611169	"""chromosome 14 open reading frame 161"", ""cation channel, sperm-associated, beta"""	C14orf161		17478420	Standard	NM_024764		Approved	FLJ14298	uc001xzs.1	Q9H7T0	OTTHUMG00000171118	ENST00000256343.3:c.1433-1G>A	14.37:g.92105595C>T		Somatic	70	0		WXS	Illumina HiSeq	.	46	19	NM_024764	A0AV51	Splice_Site	SNP	ENST00000256343.3	37	CCDS32142.1	.	.	.	.	.	.	.	.	.	.	C	10.31	1.314038	0.23908	.	.	ENSG00000133962	ENST00000256343	.	.	.	3.79	3.79	0.43588	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.4642	0.50227	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CATSPERB	91175348	0.959000	0.32827	0.912000	0.35992	0.335000	0.28730	2.922000	0.48860	2.409000	0.81822	0.561000	0.74099	.	.		0.368	CATSPERB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411769.1	NM_024764	Intron
TNS3	64759	hgsc.bcm.edu	37	7	47384537	47384537	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr7:47384537G>T	ENST00000398879.1	-	19	2917	c.2551C>A	c.(2551-2553)Cca>Aca	p.P851T	TNS3_ENST00000355730.3_Missense_Mutation_p.P611T|TNS3_ENST00000311160.9_Missense_Mutation_p.P851T			Q68CZ2	TENS3_HUMAN	tensin 3	851					cell migration (GO:0016477)|lung alveolus development (GO:0048286)|positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64						GGTGTCTCTGGAGACACAGGA	0.498																																					p.P851T		.											TNS3,NS,carcinoma,0,1	TNS3	0	0			c.C2551A						.						95.0	94.0	95.0					7																	47384537		2036	4208	6244	SO:0001583	missense	64759	exon19			TCTCTGGAGACAC	AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205		"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1		11559528	Standard	NM_022748		Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.2551C>A	7.37:g.47384537G>T	ENSP00000381854:p.Pro851Thr	Somatic	48	0		WXS	Illumina HiSeq	.	33	2	NM_022748	B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	Missense_Mutation	SNP	ENST00000398879.1	37	CCDS5506.2	.	.	.	.	.	.	.	.	.	.	G	11.53	1.664961	0.29604	.	.	ENSG00000136205	ENST00000311160;ENST00000538633;ENST00000398879;ENST00000355730;ENST00000545849;ENST00000457718	D;D;D;D	0.95756	-3.2;-3.2;-3.8;-3.49	5.68	4.8	0.61643	.	1.688650	0.02869	N	0.131263	D	0.94991	0.8379	L	0.36672	1.1	0.80722	D	1	D	0.55605	0.972	P	0.48304	0.573	D	0.85316	0.1081	10	0.66056	D	0.02	-6.4828	12.752	0.57314	0.0:0.1648:0.8352:0.0	.	851	Q68CZ2	TENS3_HUMAN	T	851;961;851;611;307;954	ENSP00000312143:P851T;ENSP00000381854:P851T;ENSP00000347968:P611T;ENSP00000414358:P954T	ENSP00000312143:P851T	P	-	1	0	TNS3	47351062	1.000000	0.71417	0.999000	0.59377	0.343000	0.28985	2.068000	0.41471	1.373000	0.46208	0.563000	0.77884	CCA	.		0.498	TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157253.1	NM_022748	
MYO3A	53904	hgsc.bcm.edu	37	10	26310439	26310439	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr10:26310439C>T	ENST00000265944.5	+	8	759	c.593C>T	c.(592-594)gCa>gTa	p.A198V	MYO3A_ENST00000376302.1_Missense_Mutation_p.A198V|MYO3A_ENST00000543632.1_Missense_Mutation_p.A198V	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	198	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.A198V(1)		NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						TAGGTGATTGCATGTGAACAG	0.408																																					p.A198V		.											MYO3A,NS,carcinoma,0,1	MYO3A	0	1	Substitution - Missense(1)	lung(1)	c.C593T						.						173.0	150.0	158.0					10																	26310439		2203	4300	6503	SO:0001583	missense	53904	exon8			TGATTGCATGTGA	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.593C>T	10.37:g.26310439C>T	ENSP00000265944:p.Ala198Val	Somatic	48	0		WXS	Illumina HiSeq	.	37	3	NM_017433	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	37	CCDS7148.1	.	.	.	.	.	.	.	.	.	.	C	35	5.490870	0.96339	.	.	ENSG00000095777	ENST00000265944;ENST00000376302;ENST00000543632	T;T;T	0.65732	-0.17;-0.17;-0.17	6.03	6.03	0.97812	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.094242	0.64402	D	0.000001	T	0.73289	0.3568	L	0.33137	0.985	0.80722	D	1	P;P;D;P	0.89917	0.794;0.829;1.0;0.9	B;B;D;B	0.80764	0.164;0.236;0.994;0.409	T	0.74241	-0.3729	10	0.87932	D	0	.	20.5568	0.99304	0.0:1.0:0.0:0.0	.	198;198;198;198	F5H0U9;Q0VD65;Q8NEV4;Q4G0X2	.;.;MYO3A_HUMAN;.	V	198	ENSP00000265944:A198V;ENSP00000365479:A198V;ENSP00000445909:A198V	ENSP00000265944:A198V	A	+	2	0	MYO3A	26350445	1.000000	0.71417	0.997000	0.53966	0.839000	0.47603	7.818000	0.86416	2.861000	0.98227	0.655000	0.94253	GCA	.		0.408	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433	
GCN1L1	10985	hgsc.bcm.edu	37	12	120622662	120622662	+	Silent	SNP	G	G	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr12:120622662G>T	ENST00000300648.6	-	3	162	c.150C>A	c.(148-150)ctC>ctA	p.L50L		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	50					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)	p.L50L(1)		NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ACAATTTGCAGAGCCCCTTCA	0.488																																					p.L50L		.											GCN1L1,NS,carcinoma,0,1	GCN1L1	0	1	Substitution - coding silent(1)	kidney(1)	c.C150A						.						84.0	83.0	83.0					12																	120622662		1958	4151	6109	SO:0001819	synonymous_variant	10985	exon3			TTTGCAGAGCCCC	U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.150C>A	12.37:g.120622662G>T		Somatic	33	0		WXS	Illumina HiSeq	.	17	2	NM_006836	A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Silent	SNP	ENST00000300648.6	37	CCDS41847.1																																																																																			.		0.488	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1		
BAD	572	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	64051695	64051695	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr11:64051695C>T	ENST00000394532.3	-	1	416	c.146G>A	c.(145-147)aGt>aAt	p.S49N	GPR137_ENST00000539851.1_5'Flank|GPR137_ENST00000438980.2_5'Flank|BAD_ENST00000394531.3_Missense_Mutation_p.S49N|BAD_ENST00000544785.1_Missense_Mutation_p.S49N|GPR137_ENST00000411458.1_5'Flank|GPR137_ENST00000313074.3_5'Flank|GPR137_ENST00000377702.4_5'Flank|BAD_ENST00000309032.3_Missense_Mutation_p.S49N	NM_004322.3	NP_004313.1	Q92934	BAD_HUMAN	BCL2-associated agonist of cell death	49					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|ADP metabolic process (GO:0046031)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|ATP metabolic process (GO:0046034)|cellular process regulating host cell cycle in response to virus (GO:0060154)|cellular response to chromate (GO:0071247)|cellular response to hypoxia (GO:0071456)|cellular response to lipid (GO:0071396)|cellular response to mechanical stimulus (GO:0071260)|cellular response to nicotine (GO:0071316)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose catabolic process (GO:0006007)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|pore complex assembly (GO:0046931)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic process by virus (GO:0060139)|positive regulation of autophagy (GO:0010508)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of glucokinase activity (GO:0033133)|positive regulation of insulin secretion (GO:0032024)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane potential (GO:0010918)|positive regulation of neuron death (GO:1901216)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of proteolysis (GO:0045862)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of type B pancreatic cell development (GO:2000078)|regulation of mitochondrial membrane permeability (GO:0046902)|release of cytochrome c from mitochondria (GO:0001836)|response to amino acid (GO:0043200)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hydrogen peroxide (GO:0042542)|response to oleic acid (GO:0034201)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|suppression by virus of host apoptotic process (GO:0019050)|type B pancreatic cell proliferation (GO:0044342)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|lipid binding (GO:0008289)|phospholipid binding (GO:0005543)|protein kinase binding (GO:0019901)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(1)	4						CTGCTGGTGACTGGCGTCCCA	0.697																																					p.S49N		.											.	.	.	0			c.G146A						.						62.0	52.0	55.0					11																	64051695		2201	4294	6495	SO:0001583	missense	572	exon2			TGGTGACTGGCGT	AF021792	CCDS8065.1	11q13.1	2014-03-07	2008-08-19		ENSG00000002330	ENSG00000002330			936	protein-coding gene	gene with protein product		603167				8929532	Standard	NM_004322		Approved	BCL2L8, BBC2	uc001nzd.3	Q92934	OTTHUMG00000134302	ENST00000394532.3:c.146G>A	11.37:g.64051695C>T	ENSP00000378040:p.Ser49Asn	Somatic	27	0		WXS	Illumina HiSeq	.	23	6	NM_032989	O14803|Q6FH21	Missense_Mutation	SNP	ENST00000394532.3	37	CCDS8065.1	.	.	.	.	.	.	.	.	.	.	C	19.68	3.872336	0.72180	.	.	ENSG00000002330	ENST00000394532;ENST00000540152;ENST00000309032;ENST00000544785;ENST00000394531	T;T;T;T	0.47528	0.84;0.84;0.84;0.84	4.39	3.45	0.39498	.	0.701705	0.13768	N	0.364081	T	0.42944	0.1225	L	0.29908	0.895	0.27367	N	0.955805	P;B	0.47191	0.891;0.273	P;B	0.48677	0.586;0.122	T	0.22347	-1.0219	10	0.51188	T	0.08	0.0035	9.3699	0.38248	0.2231:0.7769:0.0:0.0	.	49;49	A8MXU7;Q92934	.;BAD_HUMAN	N	49	ENSP00000378040:S49N;ENSP00000309103:S49N;ENSP00000440575:S49N;ENSP00000378039:S49N	ENSP00000309103:S49N	S	-	2	0	BAD	63808271	0.068000	0.21057	0.722000	0.30670	0.842000	0.47809	0.258000	0.18387	1.124000	0.41980	0.561000	0.74099	AGT	.		0.697	BAD-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259180.2	NM_032989	
SPOCD1	90853	hgsc.bcm.edu	37	1	32280314	32280314	+	Silent	SNP	C	C	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr1:32280314C>T	ENST00000360482.2	-	2	750	c.621G>A	c.(619-621)aaG>aaA	p.K207K	SPOCD1_ENST00000257100.3_Intron|SPOCD1_ENST00000533231.1_Silent_p.K207K|SPOCD1_ENST00000373648.2_Silent_p.K207K	NM_144569.4	NP_653170.3	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1	207					negative regulation of phosphatase activity (GO:0010923)|transcription, DNA-templated (GO:0006351)			p.K207N(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(1)|lung(7)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	37		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		TCCTCCATTTCTTTCTTACCC	0.587																																					p.K207K		.											SPOCD1,colon,carcinoma,0,1	SPOCD1	0	1	Substitution - Missense(1)	large_intestine(1)	c.G621A						.						107.0	103.0	104.0					1																	32280314		2203	4300	6503	SO:0001819	synonymous_variant	90853	exon2			CCATTTCTTTCTT	AK058077	CCDS347.1, CCDS60066.1, CCDS72748.1	1p35.1	2014-06-13			ENSG00000134668	ENSG00000134668			26338	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 146"""					12477932	Standard	NM_144569		Approved	FLJ25348, PPP1R146	uc001bts.1	Q6ZMY3	OTTHUMG00000003879	ENST00000360482.2:c.621G>A	1.37:g.32280314C>T		Somatic	53	0		WXS	Illumina HiSeq	.	21	2	NM_144569	Q24JU3|Q6PI90|Q8N869|Q8N8U0|Q8NBC6|Q96LN6	Silent	SNP	ENST00000360482.2	37	CCDS347.1																																																																																			.		0.587	SPOCD1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000381912.1	NM_144569	
LINC00959	387723	hgsc.bcm.edu;bcgsc.ca	37	10	131905462	131905462	+	lincRNA	SNP	G	G	A			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr10:131905462G>A	ENST00000456581.1	-	0	114									long intergenic non-protein coding RNA 959																		AGTAATGACTGAATTATATCA	0.318																																					.		.											.	.	.	0			.						.																																					119437	.			ATGACTGAATTAT			10q26.3	2013-06-06			ENSG00000237489	ENSG00000237489		"""Long non-coding RNAs"""	48677	non-coding RNA	RNA, long non-coding							Standard	NR_034125		Approved				OTTHUMG00000019268		10.37:g.131905462G>A		Somatic	219	0		WXS	Illumina HiSeq	.	155	16	.		RNA	SNP	ENST00000456581.1	37																																																																																				.		0.318	LINC00959-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000051025.1		
ZNF268	10795	hgsc.bcm.edu	37	12	133764550	133764550	+	Silent	SNP	G	G	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr12:133764550G>T	ENST00000536435.2	+	3	456	c.126G>T	c.(124-126)ctG>ctT	p.L42L	ZNF268_ENST00000539248.2_Silent_p.L42L|ZNF268_ENST00000541009.2_Silent_p.L42L|CTD-2140B24.4_ENST00000540096.2_Silent_p.L207L|ZNF268_ENST00000416488.1_Silent_p.L207L|ZNF268_ENST00000537565.1_Intron|ZNF268_ENST00000536899.2_Intron|ZNF268_ENST00000228289.5_Silent_p.L42L|ZNF268_ENST00000541211.2_Silent_p.L42L|ZNF268_ENST00000542986.2_Silent_p.L42L|ZNF268_ENST00000542711.2_Intron|ZNF268_ENST00000592241.1_Intron	NM_001165885.1|NM_003415.2	NP_001159357.1|NP_003406.1	Q14587	ZN268_HUMAN	zinc finger protein 268	42					cell differentiation (GO:0030154)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein heterodimerization activity (GO:0043497)|regulation of transcription, DNA-templated (GO:0006355)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(3)|endometrium(4)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(1)|skin(1)	24	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.000215)|all_epithelial(31;0.096)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		CTCCTGGTCTGCAACCTCTCC	0.512																																					p.L42L		.											ZNF268,rectum,carcinoma,0,1	ZNF268	0	0			c.G126T						.						42.0	43.0	43.0					12																	133764550		1864	4117	5981	SO:0001819	synonymous_variant	10795	exon3			TGGTCTGCAACCT	X78926	CCDS45012.1, CCDS53851.1, CCDS53852.1, CCDS53853.1, CCDS53854.1, CCDS59239.1, CCDS59240.1	12q24.33	2013-01-08				ENSG00000090612		"""Zinc fingers, C2H2-type"", ""-"""	13061	protein-coding gene	gene with protein product		604753				7865130	Standard	NM_003415		Approved	HZF3	uc010tcf.2	Q14587	OTTHUMG00000167946	ENST00000536435.2:c.126G>T	12.37:g.133764550G>T		Somatic	72	0		WXS	Illumina HiSeq	.	45	2	NM_152943	Q8TDG8|Q96RH4|Q9BZJ9	Silent	SNP	ENST00000536435.2	37	CCDS45012.1																																																																																			.		0.512	ZNF268-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397191.2	NM_152943	
MYH8	4626	hgsc.bcm.edu	37	17	10303865	10303865	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr17:10303865C>T	ENST00000403437.2	-	27	3671	c.3577G>A	c.(3577-3579)Gct>Act	p.A1193T	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	1193					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)	p.A1193S(1)		NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						CGAAGAGCAGCCACCATAGCT	0.542									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																												p.A1193T		.											MYH8,NS,carcinoma,0,1	MYH8	0	1	Substitution - Missense(1)	lung(1)	c.G3577A						.						79.0	77.0	77.0					17																	10303865		2203	4300	6503	SO:0001583	missense	4626	exon27	Familial Cancer Database	Carney Complex Variant	GAGCAGCCACCAT		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.3577G>A	17.37:g.10303865C>T	ENSP00000384330:p.Ala1193Thr	Somatic	38	1		WXS	Illumina HiSeq	.	37	2	NM_002472	Q14910	Missense_Mutation	SNP	ENST00000403437.2	37	CCDS11153.1	.	.	.	.	.	.	.	.	.	.	C	11.70	1.717788	0.30413	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	T	0.79033	-1.23	5.35	5.35	0.76521	Myosin tail (1);	0.000000	0.41396	U	0.000883	T	0.78761	0.4334	M	0.76328	2.33	0.49483	D	0.99979	B	0.15141	0.012	B	0.26693	0.072	T	0.76176	-0.3055	10	0.59425	D	0.04	.	14.131	0.65253	0.1499:0.8501:0.0:0.0	.	1193	P13535	MYH8_HUMAN	T	1193	ENSP00000384330:A1193T	ENSP00000252173:A1193T	A	-	1	0	MYH8	10244590	0.997000	0.39634	0.176000	0.23000	0.005000	0.04900	3.534000	0.53568	2.785000	0.95823	0.655000	0.94253	GCT	.		0.542	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2	NM_002472	
PIP4K2B	8396	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	17	36934618	36934618	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr17:36934618G>A	ENST00000269554.3	-	6	1142	c.662C>T	c.(661-663)aCg>aTg	p.T221M	PIP4K2B_ENST00000311500.6_5'UTR	NM_003559.4	NP_003550.1	P78356	PI42B_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type II, beta	221	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				cell surface receptor signaling pathway (GO:0007166)|intracellular signal transduction (GO:0035556)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|1-phosphatidylinositol-5-phosphate 4-kinase activity (GO:0016309)|ATP binding (GO:0005524)|receptor signaling protein activity (GO:0005057)			endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(8)|ovary(1)	19						TCTGGCAACCGTAGAACCCTG	0.537																																					p.T221M		.											.	.	.	0			c.C662T						.						165.0	160.0	162.0					17																	36934618		2203	4300	6503	SO:0001583	missense	8396	exon6			GCAACCGTAGAAC	U85245	CCDS11329.1	17q21.2	2007-08-14	2007-08-14	2007-08-14		ENSG00000276293	2.7.1.149		8998	protein-coding gene	gene with protein product		603261	"""phosphatidylinositol-4-phosphate 5-kinase, type II, beta"""	PIP5K2B		9038203, 14691457, 9367159	Standard	NM_003559		Approved	PIP5KIIB, PIP5KIIbeta	uc002hqs.3	P78356		ENST00000269554.3:c.662C>T	17.37:g.36934618G>A	ENSP00000269554:p.Thr221Met	Somatic	37	0		WXS	Illumina HiSeq	.	25	4	NM_003559	Q5U0E8|Q8TBP2	Missense_Mutation	SNP	ENST00000269554.3	37	CCDS11329.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.678311	0.88542	.	.	ENSG00000141720	ENST00000269554;ENST00000311500	T	0.33216	1.42	4.82	4.82	0.62117	Phosphatidylinositol-4-phosphate 5-kinase, core (2);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	0.051143	0.85682	D	0.000000	T	0.53286	0.1787	M	0.74881	2.28	0.80722	D	1	D;D;D	0.69078	0.997;0.997;0.991	P;P;P	0.61477	0.809;0.774;0.889	T	0.58160	-0.7685	10	0.66056	D	0.02	-11.1767	16.6288	0.85011	0.0:0.0:1.0:0.0	.	221;221;221	C9JMM2;P78356-2;P78356	.;.;PI42B_HUMAN	M	221	ENSP00000269554:T221M	ENSP00000269554:T221M	T	-	2	0	PIP4K2B	34188144	1.000000	0.71417	0.991000	0.47740	0.985000	0.73830	7.191000	0.77763	2.516000	0.84829	0.561000	0.74099	ACG	.		0.537	PIP4K2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256791.1	NM_003559	
VPS33B	26276	hgsc.bcm.edu	37	15	91557064	91557064	+	Silent	SNP	G	G	A			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr15:91557064G>A	ENST00000333371.3	-	5	680	c.327C>T	c.(325-327)cgC>cgT	p.R109R	VPS33B_ENST00000535906.1_Silent_p.R82R|VPS33B_ENST00000557358.1_5'UTR|VPS33B_ENST00000535843.1_Silent_p.R18R	NM_018668.3	NP_061138.3	Q9H267	VP33B_HUMAN	vacuolar protein sorting 33 homolog B (yeast)	109					lysosome localization (GO:0032418)|melanosome localization (GO:0032400)|membrane fusion (GO:0061025)|platelet alpha granule organization (GO:0070889)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule (GO:0031091)				central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|stomach(2)	16	Lung NSC(78;0.0987)|all_lung(78;0.175)					CTTTGTATTTGCGAGTTCGGC	0.512																																					p.R109R		.											VPS33B,NS,carcinoma,0,1	VPS33B	0	0			c.C327T						.						160.0	140.0	147.0					15																	91557064		2198	4298	6496	SO:0001819	synonymous_variant	26276	exon5			GTATTTGCGAGTT	AF201694	CCDS10369.1, CCDS73783.1	15q26.1	2006-12-19	2006-12-19		ENSG00000184056	ENSG00000184056			12712	protein-coding gene	gene with protein product		608552	"""vacuolar protein sorting 33B (yeast homolog)"""			8996080	Standard	XM_005254887		Approved	FLJ14848	uc002bqp.1	Q9H267	OTTHUMG00000149835	ENST00000333371.3:c.327C>T	15.37:g.91557064G>A		Somatic	57	0		WXS	Illumina HiSeq	.	66	4	NM_018668	B3KQF6|Q96K14|Q9NRP6|Q9NSF3	Silent	SNP	ENST00000333371.3	37	CCDS10369.1																																																																																			.		0.512	VPS33B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313496.1	NM_018668	
SVOP	55530	hgsc.bcm.edu	37	12	109334559	109334559	+	Splice_Site	SNP	C	C	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr12:109334559C>T	ENST00000299134.5	-	6	572		c.e6+1			NM_018711.2	NP_061181.1	Q8N4V2	SVOP_HUMAN	SV2 related protein homolog (rat)							cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	ion transmembrane transporter activity (GO:0015075)	p.?(2)		breast(2)|lung(4)	6						AGGATACCTACGAAACACAGC	0.537																																					.		.											SVOP_ENST00000299134,NS,carcinoma,0,2	SVOP_ENST00000299134	0	2	Unknown(2)	breast(2)	c.609+1G>A						.						105.0	95.0	98.0					12																	109334559		692	1591	2283	SO:0001630	splice_region_variant	55530	exon8			TACCTACGAAACA	BC033587	CCDS73520.1	12q24.11	2011-07-12				ENSG00000166111			25417	protein-coding gene	gene with protein product		611699					Standard	NM_018711		Approved	DKFZp761H039	uc010sxh.1	Q8N4V2		ENST00000299134.5:c.572+1G>A	12.37:g.109334559C>T		Somatic	31	0		WXS	Illumina HiSeq	.	27	2	NM_018711	Q9NPW5	Splice_Site	SNP	ENST00000299134.5	37		.	.	.	.	.	.	.	.	.	.	.	24.3	4.514300	0.85389	.	.	ENSG00000166111	ENST00000299134	.	.	.	5.48	5.48	0.80851	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8883	0.86081	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SVOP	.	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.128000	0.77217	2.580000	0.87095	0.556000	0.70494	.	.		0.537	SVOP-001	KNOWN	mRNA_start_NF|cds_start_NF|basic	protein_coding	protein_coding	OTTHUMT00000403982.1	NM_018711	Intron
COL6A3	1293	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	238280843	238280843	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr2:238280843C>T	ENST00000295550.4	-	9	4269	c.3817G>A	c.(3817-3819)Gtc>Atc	p.V1273I	COL6A3_ENST00000353578.4_Missense_Mutation_p.V1067I|COL6A3_ENST00000392004.3_Missense_Mutation_p.V1067I|COL6A3_ENST00000346358.4_Missense_Mutation_p.V1073I|COL6A3_ENST00000409809.1_Missense_Mutation_p.V1067I|COL6A3_ENST00000347401.3_Missense_Mutation_p.V1072I|COL6A3_ENST00000472056.1_Missense_Mutation_p.V666I|COL6A3_ENST00000392003.2_Missense_Mutation_p.V866I	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1273	Nonhelical region.|VWFA 7. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		AACTGGATGACAGCCACCCGG	0.607																																					p.V1273I		.											.	.	.	0			c.G3817A						.						51.0	46.0	48.0					2																	238280843		2203	4300	6503	SO:0001583	missense	1293	exon9			GGATGACAGCCAC	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.3817G>A	2.37:g.238280843C>T	ENSP00000295550:p.Val1273Ile	Somatic	30	0		WXS	Illumina HiSeq	.	20	4	NM_004369	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.397739	0.83120	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358;ENST00000392004;ENST00000392003	T;T;T;T;T;T;T;T	0.39229	1.09;1.09;1.09;1.09;1.09;1.09;1.09;1.09	5.73	5.73	0.89815	von Willebrand factor, type A (3);	0.000000	0.49305	D	0.000154	T	0.64649	0.2617	M	0.62016	1.91	0.58432	D	0.999999	D;D;D;D;D	0.89917	0.999;0.989;0.999;1.0;0.998	D;D;D;D;D	0.91635	0.999;0.951;0.999;0.998;0.951	T	0.62656	-0.6808	10	0.51188	T	0.08	.	19.8991	0.96978	0.0:1.0:0.0:0.0	.	666;866;1067;1067;1273	E9PFQ6;A8MT30;E9PGQ9;P12111-2;P12111	.;.;.;.;CO6A3_HUMAN	I	1273;1072;1067;666;1067;1073;1067;866	ENSP00000295550:V1273I;ENSP00000315609:V1072I;ENSP00000315873:V1067I;ENSP00000418285:V666I;ENSP00000386844:V1067I;ENSP00000295546:V1073I;ENSP00000375861:V1067I;ENSP00000375860:V866I	ENSP00000295550:V1273I	V	-	1	0	COL6A3	237945582	1.000000	0.71417	0.942000	0.38095	0.720000	0.41350	5.721000	0.68477	2.708000	0.92522	0.655000	0.94253	GTC	.		0.607	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
BTN2A3P	54718	hgsc.bcm.edu	37	6	26422353	26422353	+	RNA	SNP	C	C	T	rs571530750	byFrequency	TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr6:26422353C>T	ENST00000466808.2	+	0	7							Q96KV6	BT2A3_HUMAN	butyrophilin, subfamily 2, member A3, pseudogene							integral component of membrane (GO:0016021)		p.P3S(2)									GCTCATGGAACCAGCTGCTGC	0.622													C|||	7	0.00139776	0.0023	0.0	5008	,	,		16376	0.001		0.0	False		,,,				2504	0.0031				.		.											BTN2A3,NS,carcinoma,0,9	BTN2A3	0	2	Substitution - Missense(2)	endometrium(1)|kidney(1)	.						.																																					54718	.			ATGGAACCAGCTG	AL021917		6p22.1	2014-01-14	2011-09-06	2011-09-06	ENSG00000124549	ENSG00000124549		"""Butyrophilins"""	13229	pseudogene	pseudogene		613592	"""butyrophilin, subfamily 2, member A3"""	BTN2A3			Standard	NR_027795		Approved	BTN2.3	uc011dkl.1	Q96KV6	OTTHUMG00000014453		6.37:g.26422353C>T		Somatic	43	1		WXS	Illumina HiSeq	.	34	2	.	A6NEF4	RNA	SNP	ENST00000466808.2	37																																																																																				.		0.622	BTN2A3P-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000040118.4	NR_027795	
ARMC12	221481	hgsc.bcm.edu	37	6	35716414	35716414	+	Missense_Mutation	SNP	G	G	A	rs200490512		TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr6:35716414G>A	ENST00000373866.3	+	6	812	c.790G>A	c.(790-792)Gca>Aca	p.A264T	ARMC12_ENST00000288065.2_Missense_Mutation_p.A291T|ARMC12_ENST00000373869.3_Missense_Mutation_p.A254T			Q5T9G4	ARM12_HUMAN	armadillo repeat containing 12	264						nucleus (GO:0005634)											GGGCCGGAACGCACCCCACTA	0.557																																					p.A291T		.											C6orf81,colon,carcinoma,0,1	C6orf81	0	0			c.G871A						.	G	THR/ALA	0,4406		0,0,2203	103.0	92.0	96.0		871	-2.1	0.0	6		96	3,8597	3.0+/-9.4	0,3,4297	yes	missense	C6orf81	NM_145028.3	58	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	benign	291/368	35716414	3,13003	2203	4300	6503	SO:0001583	missense	221481	exon6			CGGAACGCACCCC	AK058119	CCDS4809.1, CCDS69093.1, CCDS69094.1	6p21.31	2013-02-14	2011-12-14	2011-12-14	ENSG00000157343	ENSG00000157343		"""Armadillo repeat containing"""	21099	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 81"""	C6orf81			Standard	XM_005248920		Approved	FLJ25390	uc003ola.3	Q5T9G4	OTTHUMG00000014577	ENST00000373866.3:c.790G>A	6.37:g.35716414G>A	ENSP00000362973:p.Ala264Thr	Somatic	22	0		WXS	Illumina HiSeq	.	23	2	NM_145028	Q8NEB2|Q96LL8	Missense_Mutation	SNP	ENST00000373866.3	37		.	.	.	.	.	.	.	.	.	.	G	4.970	0.180128	0.09443	0.0	3.49E-4	ENSG00000157343	ENST00000373869;ENST00000288065;ENST00000373866	T;T;T	0.63096	1.56;-0.02;-0.02	4.89	-2.14	0.07123	.	0.748593	0.11839	N	0.524513	T	0.16171	0.0389	N	0.19112	0.55	0.09310	N	1	B;B	0.15141	0.005;0.012	B;B	0.06405	0.001;0.002	T	0.24083	-1.0170	10	0.17832	T	0.49	.	5.2849	0.15696	0.2301:0.0:0.3279:0.442	.	254;291	Q5T9G4-3;Q5T9G4-2	.;.	T	254;291;264	ENSP00000362976:A254T;ENSP00000288065:A291T;ENSP00000362973:A264T	ENSP00000288065:A291T	A	+	1	0	C6orf81	35824392	0.000000	0.05858	0.000000	0.03702	0.075000	0.17131	-0.563000	0.05943	-0.735000	0.04837	0.650000	0.86243	GCA	.		0.557	ARMC12-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000040311.2	NM_145028	
THRAP3	9967	hgsc.bcm.edu	37	1	36766611	36766611	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr1:36766611G>T	ENST00000354618.5	+	10	2652	c.2428G>T	c.(2428-2430)Gac>Tac	p.D810Y	THRAP3_ENST00000469141.2_Missense_Mutation_p.D810Y	NM_005119.3	NP_005110.2	Q9Y2W1	TR150_HUMAN	thyroid hormone receptor associated protein 3	810	Required for mRNA decay activity.				androgen receptor signaling pathway (GO:0030521)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|phosphoprotein binding (GO:0051219)|poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(5)|stomach(1)	37		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CACGGGCTTTGACAAATCAAG	0.522			T	USP6	aneurysmal bone cysts																																p.D810Y	Pancreas(129;785 1795 20938 23278 32581)	.		Dom	yes		1	1p34.3	9967	thyroid hormone receptor associated protein 3 (TRAP150)		M	THRAP3,NS,carcinoma,0,1	THRAP3	0	0			c.G2428T						.						83.0	77.0	79.0					1																	36766611		2203	4300	6503	SO:0001583	missense	9967	exon10			GGCTTTGACAAAT	AF117756	CCDS405.1	1p34.3	2008-02-05			ENSG00000054118	ENSG00000054118			22964	protein-coding gene	gene with protein product		603809					Standard	NM_005119		Approved	TRAP150	uc001cae.4	Q9Y2W1	OTTHUMG00000007866	ENST00000354618.5:c.2428G>T	1.37:g.36766611G>T	ENSP00000346634:p.Asp810Tyr	Somatic	54	0		WXS	Illumina HiSeq	.	27	3	NM_005119	D3DPS5|Q5VTK6	Missense_Mutation	SNP	ENST00000354618.5	37	CCDS405.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.079581	0.76528	.	.	ENSG00000054118	ENST00000354618;ENST00000469141	T;T	0.15952	2.38;2.38	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.36358	0.0964	L	0.44542	1.39	0.49915	D	0.999832	D	0.89917	1.0	D	0.70935	0.971	T	0.01945	-1.1242	10	0.72032	D	0.01	-13.6249	19.0254	0.92930	0.0:0.0:1.0:0.0	.	810	Q9Y2W1	TR150_HUMAN	Y	810	ENSP00000346634:D810Y;ENSP00000433825:D810Y	ENSP00000346634:D810Y	D	+	1	0	THRAP3	36539198	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.310000	0.51911	2.822000	0.97130	0.650000	0.86243	GAC	.		0.522	THRAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021688.2	NM_005119	
TMPO	7112	hgsc.bcm.edu	37	12	98927571	98927571	+	Intron	SNP	G	G	A			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr12:98927571G>A	ENST00000556029.1	+	3	921				TMPO_ENST00000261210.5_Intron|TMPO_ENST00000343315.5_Intron|TMPO_ENST00000266732.4_Silent_p.Q512Q|TMPO_ENST00000393053.2_Intron	NM_001032283.2	NP_001027454.1	P42167	LAP2B_HUMAN	thymopoietin							cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)|lamin binding (GO:0005521)			breast(2)|endometrium(1)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						TTGACAGGCAGCTGCCTTCAC	0.383																																					p.Q512Q		.											TMPO_ENST00000266732,NS,carcinoma,0,1	TMPO_ENST00000266732	0	0			c.G1536A						.						51.0	54.0	53.0					12																	98927571		2203	4300	6503	SO:0001627	intron_variant	7112	exon4			CAGGCAGCTGCCT		CCDS9064.1, CCDS31879.1, CCDS31880.1	12q22	2014-09-17			ENSG00000120802	ENSG00000120802			11875	protein-coding gene	gene with protein product	"""LEM domain containing 4"""	188380				7517549	Standard	NM_003276		Approved	TP, LAP2, LEMD4	uc001tfh.2	P42166	OTTHUMG00000170210	ENST00000556029.1:c.565+1955G>A	12.37:g.98927571G>A		Somatic	38	0		WXS	Illumina HiSeq	.	45	3	NM_003276	A2T926|Q14861	Silent	SNP	ENST00000556029.1	37	CCDS31879.1																																																																																			.		0.383	TMPO-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407973.2	NM_003276	
PIP5KL1	138429	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	130688240	130688240	+	Silent	SNP	G	G	A			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr9:130688240G>A	ENST00000388747.4	-	8	713	c.669C>T	c.(667-669)tgC>tgT	p.C223C	PIP5KL1_ENST00000300432.3_Silent_p.C20C|PIP5KL1_ENST00000490773.1_Intron	NM_001135219.1	NP_001128691.1	Q5T9C9	PI5L1_HUMAN	phosphatidylinositol-4-phosphate 5-kinase-like 1	223	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.					cell projection (GO:0042995)|cytoplasm (GO:0005737)|membrane (GO:0016020)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)			endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|skin(1)	8						GGCTCACCTCGCAGCCTTTGA	0.542																																					p.C223C		.											.	.	.	0			c.C669T						.						36.0	38.0	37.0					9																	130688240		2203	4300	6503	SO:0001819	synonymous_variant	138429	exon8			CACCTCGCAGCCT	BC042184	CCDS6885.1, CCDS48030.1	9q34.13	2008-02-05			ENSG00000167103	ENSG00000167103			28711	protein-coding gene	gene with protein product		612865				12477932	Standard	NM_001135219		Approved	bA203J24.5, MGC46424	uc011mao.2	Q5T9C9	OTTHUMG00000020719	ENST00000388747.4:c.669C>T	9.37:g.130688240G>A		Somatic	105	0		WXS	Illumina HiSeq	.	55	20	NM_001135219	Q8IVS3	Silent	SNP	ENST00000388747.4	37	CCDS48030.1																																																																																			.		0.542	PIP5KL1-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054289.2	NM_173492	
RAB3B	5865	broad.mit.edu	37	1	52385603	52385603	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr1:52385603C>A	ENST00000371655.3	-	5	868	c.656G>T	c.(655-657)tGc>tTc	p.C219F		NM_002867.3	NP_002858.2	P20337	RAB3B_HUMAN	RAB3B, member RAS oncogene family	219					antigen processing and presentation (GO:0019882)|GTP catabolic process (GO:0006184)|peptidyl-cysteine methylation (GO:0018125)|positive regulation of dopamine uptake involved in synaptic transmission (GO:0051586)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|regulation of vesicle size (GO:0097494)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|synaptic vesicle (GO:0008021)|vesicle (GO:0031982)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)			large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	9						CCTTGCCTAGCATGAGCAGTT	0.602																																					p.C219F													.	RAB3B	22	0			c.G656T						.						80.0	66.0	71.0					1																	52385603		2203	4300	6503	SO:0001583	missense	5865	exon5			GCCTAGCATGAGC	BC005035	CCDS560.1	1p32-p31	2008-02-05			ENSG00000169213	ENSG00000169213		"""RAB, member RAS oncogene"""	9778	protein-coding gene	gene with protein product		179510					Standard	NM_002867		Approved		uc001cth.3	P20337	OTTHUMG00000008627	ENST00000371655.3:c.656G>T	1.37:g.52385603C>A	ENSP00000360718:p.Cys219Phe	Somatic	13	0		WXS	Illumina GAIIx	Phase_I	3	2	NM_002867	Q5VUL2|Q9BSI1	Missense_Mutation	SNP	ENST00000371655.3	37	CCDS560.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.876503	0.91664	.	.	ENSG00000169213	ENST00000371655;ENST00000537650	T	0.71934	-0.61	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.81088	0.4750	L	0.52011	1.625	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81784	-0.0774	10	0.87932	D	0	.	17.0076	0.86397	0.0:1.0:0.0:0.0	.	219	P20337	RAB3B_HUMAN	F	219	ENSP00000360718:C219F	ENSP00000360718:C219F	C	-	2	0	RAB3B	52158191	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	7.359000	0.79477	2.880000	0.98712	0.650000	0.86243	TGC	.		0.602	RAB3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023816.1	NM_002867	
ZC3H11A	9877	broad.mit.edu	37	1	203821424	203821424	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr1:203821424T>C	ENST00000545588.1	+	17	6157	c.2330T>C	c.(2329-2331)aTa>aCa	p.I777T	ZC3H11A_ENST00000332127.4_Missense_Mutation_p.I777T|ZC3H11A_ENST00000367214.1_Missense_Mutation_p.I777T|ZC3H11A_ENST00000367212.3_Missense_Mutation_p.I777T|ZC3H11A_ENST00000367210.1_Missense_Mutation_p.I777T	NM_001271675.1	NP_001258604.1	O75152	ZC11A_HUMAN	zinc finger CCCH-type containing 11A	777					poly(A)+ mRNA export from nucleus (GO:0016973)		metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)			GAGAAACTAATATGGGAGATT	0.473																																					p.I777T													.	ZC3H11A	71	0			c.T2330C						.						55.0	56.0	56.0					1																	203821424		2203	4300	6503	SO:0001583	missense	9877	exon20			AACTAATATGGGA		CCDS30978.1	1q32.1	2012-07-05	2005-06-02	2005-06-02	ENSG00000058673	ENSG00000058673		"""Zinc fingers, CCCH-type domain containing"""	29093	protein-coding gene	gene with protein product		613513	"""zinc finger CCCH-type domain containing 11A"""	ZC3HDC11A		9734811	Standard	NM_014827		Approved	KIAA0663	uc001hac.3	O75152	OTTHUMG00000035909	ENST00000545588.1:c.2330T>C	1.37:g.203821424T>C	ENSP00000438527:p.Ile777Thr	Somatic	283	1		WXS	Illumina GAIIx	Phase_I	394	6	NM_014827	Q6AHY4|Q6AHY9|Q6AW79|Q6AWA1|Q6PJK4|Q86XZ7	Missense_Mutation	SNP	ENST00000545588.1	37	CCDS30978.1	.	.	.	.	.	.	.	.	.	.	T	11.48	1.650267	0.29336	.	.	ENSG00000058673	ENST00000367214;ENST00000537080;ENST00000367212;ENST00000332127;ENST00000545588;ENST00000367210	T;T;T;T;T	0.60040	0.22;0.22;0.22;0.22;0.22	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.61540	0.2355	M	0.77103	2.36	0.50467	D	0.999873	B	0.18461	0.028	B	0.24269	0.052	T	0.60454	-0.7260	10	0.46703	T	0.11	-25.6355	14.9374	0.70967	0.0:0.0:0.0:1.0	.	777	O75152	ZC11A_HUMAN	T	777;723;777;777;777;777	ENSP00000356183:I777T;ENSP00000356181:I777T;ENSP00000333253:I777T;ENSP00000438527:I777T;ENSP00000356179:I777T	ENSP00000333253:I777T	I	+	2	0	ZC3H11A	202088047	1.000000	0.71417	1.000000	0.80357	0.753000	0.42808	6.379000	0.73154	2.171000	0.68590	0.528000	0.53228	ATA	.		0.473	ZC3H11A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087471.3	NM_014827	
NAV3	89795	broad.mit.edu;bcgsc.ca	37	12	78362376	78362378	+	In_Frame_Del	DEL	CAA	CAA	-			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr12:78362376_78362378delCAA	ENST00000397909.2	+	5	738_740	c.565_567delCAA	c.(565-567)caadel	p.Q191del	NAV3_ENST00000266692.7_In_Frame_Del_p.Q191del|NAV3_ENST00000536525.2_In_Frame_Del_p.Q191del|NAV3_ENST00000228327.6_In_Frame_Del_p.Q191del			Q8IVL0	NAV3_HUMAN	neuron navigator 3	191						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						ACAACACCATCAACAACAGTACT	0.429										HNSCC(70;0.22)																											p.189_189del													NAV3,NS,carcinoma,-2,1	NAV3	506	0			c.565_567del						.																																			SO:0001651	inframe_deletion	89795	exon5			CACCATCAACAAC	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.565_567delCAA	12.37:g.78362379_78362381delCAA	ENSP00000381007:p.Gln191del	Somatic	41	0		WXS	Illumina GAIIx	Phase_I	37	8	NM_014903	Q8NFW7|Q9Y2E7	In_Frame_Del	DEL	ENST00000397909.2	37																																																																																				.		0.429	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383	
TRAV13-2	28670	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	22386639	22386639	+	RNA	SNP	A	A	C	rs372093887		TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr14:22386639A>C	ENST00000390439.2	+	0	119									T cell receptor alpha variable 13-2																		CTTTCTGCACAGGGGTGAGCA	0.428																																					.													.	.	.	0			.						.						49.0	49.0	49.0					14																	22386639		1871	4109	5980			0	.			CTGCACAGGGGTG	AE000659		14q11.2	2012-02-07			ENSG00000211791	ENSG00000211791		"""T cell receptors / TRA locus"""	12109	other	T cell receptor gene						8188290	Standard	NG_001332		Approved				OTTHUMG00000168997		14.37:g.22386639A>C		Somatic	41	0		WXS	Illumina GAIIx	Phase_I	29	12	.		RNA	SNP	ENST00000390439.2	37																																																																																				.		0.428	TRAV13-2-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TR_V_gene	OTTHUMT00000401895.1	NG_001332	
TMEM87A	25963	broad.mit.edu	37	15	42519937	42519937	+	Missense_Mutation	SNP	A	A	G			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr15:42519937A>G	ENST00000389834.4	-	14	1535	c.1271T>C	c.(1270-1272)aTg>aCg	p.M424T	RP11-546B15.1_ENST00000563846.1_RNA|TMEM87A_ENST00000448392.1_Missense_Mutation_p.M363T	NM_015497.3	NP_056312.2	Q8NBN3	TM87A_HUMAN	transmembrane protein 87A	424				MK -> KG (in Ref. 4; CAB43218). {ECO:0000305}.		integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(4)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	24		all_cancers(109;4.28e-16)|all_epithelial(112;1.04e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;1.03e-06)		TCTGAACTTCATGGTTGTCCA	0.373																																					p.M424T													.	TMEM87A	56	0			c.T1271C						.						124.0	113.0	116.0					15																	42519937		2203	4299	6502	SO:0001583	missense	25963	exon14			AACTTCATGGTTG	AF132733	CCDS32205.1, CCDS45243.1, CCDS66742.1	15q15.1	2005-10-30				ENSG00000103978			24522	protein-coding gene	gene with protein product						12477932	Standard	XM_005254287		Approved	DKFZP564G2022	uc021sjr.1	Q8NBN3		ENST00000389834.4:c.1271T>C	15.37:g.42519937A>G	ENSP00000374484:p.Met424Thr	Somatic	39	0		WXS	Illumina GAIIx	Phase_I	38	3	NM_015497	Q6NT77|Q8NCA4|Q9BS46|Q9P103|Q9Y3Y7	Missense_Mutation	SNP	ENST00000389834.4	37	CCDS32205.1	.	.	.	.	.	.	.	.	.	.	A	13.33	2.203570	0.38905	.	.	ENSG00000103978	ENST00000389834;ENST00000448392;ENST00000535305	.	.	.	5.45	4.26	0.50523	.	0.149442	0.64402	D	0.000011	T	0.46092	0.1375	L	0.36672	1.1	0.37597	D	0.92041	P	0.47545	0.897	P	0.48488	0.579	T	0.43621	-0.9380	9	0.22706	T	0.39	-18.0816	9.3909	0.38372	0.8414:0.0:0.0:0.1586	.	424	Q8NBN3	TM87A_HUMAN	T	424;363;400	.	ENSP00000374484:M424T	M	-	2	0	TMEM87A	40307229	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.082000	0.41605	2.072000	0.62099	0.533000	0.62120	ATG	.		0.373	TMEM87A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420482.2	NM_015497	
BLM	641	broad.mit.edu;bcgsc.ca	37	15	91310162	91310162	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr15:91310162G>T	ENST00000355112.3	+	10	2334	c.2216G>T	c.(2215-2217)gGt>gTt	p.G739V	BLM_ENST00000560509.1_Missense_Mutation_p.G739V|BLM_ENST00000560136.1_3'UTR	NM_000057.2	NP_000048.1	P54132	BLM_HUMAN	Bloom syndrome, RecQ helicase-like	739	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				alpha-beta T cell differentiation (GO:0046632)|ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell division (GO:0051782)|negative regulation of DNA recombination (GO:0045910)|negative regulation of mitotic recombination (GO:0045950)|negative regulation of thymocyte apoptotic process (GO:0070244)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of transcription, DNA-templated (GO:0045893)|protein oligomerization (GO:0051259)|regulation of binding (GO:0051098)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to X-ray (GO:0010165)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nuclear chromosome (GO:0000228)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|pronucleus (GO:0045120)|replication fork (GO:0005657)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent helicase activity (GO:0008026)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|p53 binding (GO:0002039)|single-stranded DNA binding (GO:0003697)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(11)|liver(4)|lung(9)|ovary(6)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			TATCTGACAGGTGATAAGACT	0.294			"""Mis, N, F"""			"""leukemia, lymphoma, skin squamous cell , other cancers"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Bloom syndrome																												p.G739V			yes	Rec		Bloom Syndrome	15	15q26.1	641	Bloom Syndrome		"""L, E"""	.	BLM	122	0			c.G2216T						.						53.0	57.0	55.0					15																	91310162		2196	4279	6475	SO:0001583	missense	641	exon10	Familial Cancer Database		TGACAGGTGATAA	U39817	CCDS10363.1, CCDS73782.1	15q26.1	2014-09-17	2009-03-19		ENSG00000197299	ENSG00000197299			1058	protein-coding gene	gene with protein product		604610	"""Bloom syndrome"""			9388193	Standard	NM_000057		Approved	BS, RECQL3, RECQ2	uc002bpr.3	P54132	OTTHUMG00000149834	ENST00000355112.3:c.2216G>T	15.37:g.91310162G>T	ENSP00000347232:p.Gly739Val	Somatic	178	1		WXS	Illumina GAIIx	Phase_I	178	7	NM_000057	Q52M96	Missense_Mutation	SNP	ENST00000355112.3	37	CCDS10363.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.557502	0.86231	.	.	ENSG00000197299	ENST00000355112;ENST00000536925	D	0.83250	-1.7	5.74	5.74	0.90152	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.93700	0.7987	H	0.94462	3.54	0.80722	D	1	D;D;D	0.89917	1.0;0.996;1.0	D;D;D	0.79784	0.989;0.985;0.993	D	0.94967	0.8113	10	0.87932	D	0	-10.6591	17.4221	0.87517	0.0:0.0:1.0:0.0	.	739;364;739	B2RAN0;B7ZKN7;P54132	.;.;BLM_HUMAN	V	739;392	ENSP00000347232:G739V	ENSP00000347232:G739V	G	+	2	0	BLM	89111166	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.977000	0.93446	2.708000	0.92522	0.585000	0.79938	GGT	.		0.294	BLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313495.1		
RSAD1	55316	broad.mit.edu	37	17	48560713	48560713	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr17:48560713G>T	ENST00000258955.2	+	6	1002	c.917G>T	c.(916-918)cGa>cTa	p.R306L		NM_018346.1	NP_060816.1	Q9HA92	RSAD1_HUMAN	radical S-adenosyl methionine domain containing 1	306					porphyrin-containing compound biosynthetic process (GO:0006779)	mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|coproporphyrinogen oxidase activity (GO:0004109)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	16	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			GCCCATGGACGATTTATGCCC	0.532																																					p.R306L													RSAD1,colon,carcinoma,+1,1	RSAD1	36	0			c.G917T						.						37.0	39.0	38.0					17																	48560713		2203	4300	6503	SO:0001583	missense	55316	exon6			ATGGACGATTTAT	AK002026	CCDS11569.1	17q21.33	2004-11-08			ENSG00000136444	ENSG00000136444			25634	protein-coding gene	gene with protein product						12477932	Standard	NM_018346		Approved	FLJ11164	uc002iqw.1	Q9HA92	OTTHUMG00000162126	ENST00000258955.2:c.917G>T	17.37:g.48560713G>T	ENSP00000258955:p.Arg306Leu	Somatic	47	0		WXS	Illumina GAIIx	Phase_I	32	3	NM_018346	B4DMW0|Q53HV8|Q86VC4|Q9BRY7|Q9NUS7	Missense_Mutation	SNP	ENST00000258955.2	37	CCDS11569.1	.	.	.	.	.	.	.	.	.	.	G	15.44	2.833420	0.50951	.	.	ENSG00000136444	ENST00000258955	T	0.22134	1.97	5.28	3.29	0.37713	HemN, C-terminal (1);	0.229060	0.36200	N	0.002733	T	0.35770	0.0943	L	0.58510	1.815	0.43678	D	0.99611	D	0.71674	0.998	P	0.59357	0.856	T	0.10567	-1.0624	10	0.87932	D	0	-1.9491	11.3751	0.49724	0.1492:0.0:0.8508:0.0	.	306	Q9HA92	RSAD1_HUMAN	L	306	ENSP00000258955:R306L	ENSP00000258955:R306L	R	+	2	0	RSAD1	45915712	1.000000	0.71417	0.958000	0.39756	0.076000	0.17211	5.505000	0.66981	0.733000	0.32492	-0.136000	0.14681	CGA	.		0.532	RSAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367413.1	NM_018346	
HMHA1	23526	broad.mit.edu	37	19	1068619	1068619	+	Silent	SNP	C	C	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr19:1068619C>T	ENST00000313093.2	+	2	528	c.297C>T	c.(295-297)agC>agT	p.S99S	HMHA1_ENST00000590214.1_Silent_p.S126S|HMHA1_ENST00000536472.1_Intron|HMHA1_ENST00000543365.1_5'Flank|HMHA1_ENST00000586866.1_Silent_p.S103S|HMHA1_ENST00000592335.1_5'Flank|HMHA1_ENST00000539243.2_Silent_p.S115S	NM_012292.3	NP_036424.2	Q92619	HMHA1_HUMAN	histocompatibility (minor) HA-1	99					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(7)|ovary(1)|prostate(2)	16		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGCCGCCAGCCCGGGCGAGC	0.731																																					p.S115S													.	HMHA1	78	0			c.C345T						.						13.0	15.0	14.0					19																	1068619		2089	4104	6193	SO:0001819	synonymous_variant	23526	exon2			CGCCAGCCCGGGC	D86976	CCDS32863.1, CCDS58637.1, CCDS74242.1, CCDS74243.1	19p13.3	2011-09-07				ENSG00000180448		"""Rho GTPase activating proteins"""	17102	protein-coding gene	gene with protein product		601155				9820596, 9039502	Standard	NM_012292		Approved	KIAA0223, HA-1, ARHGAP45	uc010xgd.2	Q92619		ENST00000313093.2:c.297C>T	19.37:g.1068619C>T		Somatic	10	0		WXS	Illumina GAIIx	Phase_I	8	3	NM_001258328	B4DTS4|F6QP70|Q6P189|Q7LE26|Q86WS1|Q8HX84|Q9GJN9|Q9GJP0|Q9GJP1|Q9MY24	Silent	SNP	ENST00000313093.2	37	CCDS32863.1																																																																																			.		0.731	HMHA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458026.1		
ZNF181	339318	broad.mit.edu	37	19	35232200	35232200	+	Missense_Mutation	SNP	T	T	G	rs143797666	byFrequency	TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr19:35232200T>G	ENST00000492450.1	+	4	1003	c.914T>G	c.(913-915)gTc>gGc	p.V305G	ZNF181_ENST00000459757.2_Missense_Mutation_p.V304G|ZNF181_ENST00000392232.3_Missense_Mutation_p.V349G			Q2M3W8	ZN181_HUMAN	zinc finger protein 181	305					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V241G(4)		endometrium(6)|kidney(2)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|skin(1)	22	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			TTTAGCCATGTCTCATCACTT	0.413													T|||	3	0.000599042	0.0	0.0	5008	,	,		22105	0.002		0.0	False		,,,				2504	0.001				p.V305G													ZNF181,NS,carcinoma,0,5	ZNF181	65	4	Substitution - Missense(4)	lung(2)|endometrium(2)	c.T914G						.						91.0	88.0	89.0					19																	35232200		2203	4300	6503	SO:0001583	missense	339318	exon4			GCCATGTCTCATC	BC104759, H54888	CCDS32990.2, CCDS46043.1	19q13.13	2013-01-08	2006-04-27		ENSG00000197841	ENSG00000197841		"""Zinc fingers, C2H2-type"", ""-"""	12971	protein-coding gene	gene with protein product		606741	"""zinc finger protein 181 (HHZ181)"""				Standard	NM_001029997		Approved	HHZ181, MGC44316	uc002nvu.3	Q2M3W8	OTTHUMG00000157508	ENST00000492450.1:c.914T>G	19.37:g.35232200T>G	ENSP00000420727:p.Val305Gly	Somatic	88	1		WXS	Illumina GAIIx	Phase_I	79	3	NM_001029997	B7ZKX3|Q49A75	Missense_Mutation	SNP	ENST00000492450.1	37	CCDS32990.2	.	.	.	.	.	.	.	.	.	.	T	1.102	-0.660828	0.03454	.	.	ENSG00000197841	ENST00000392232;ENST00000425140;ENST00000492450;ENST00000459757	T;T;T	0.38560	2.43;1.13;1.13	2.89	2.89	0.33648	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.16642	0.0400	N	0.10733	0.035	0.09310	N	0.999999	P;B	0.38978	0.652;0.0	B;B	0.30179	0.112;0.001	T	0.04017	-1.0984	9	0.22109	T	0.4	.	5.4169	0.16378	0.2509:0.0:0.0:0.749	.	304;305	B7ZKX3;Q2M3W8	.;ZN181_HUMAN	G	349;304;305;304	ENSP00000376065:V349G;ENSP00000420727:V305G;ENSP00000419435:V304G	ENSP00000376065:V349G	V	+	2	0	ZNF181	39924040	0.000000	0.05858	0.880000	0.34516	0.765000	0.43378	-0.861000	0.04268	1.565000	0.49641	0.402000	0.26972	GTC	.		0.413	ZNF181-002	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349005.3	NM_001029997	
AP2S1	1175	broad.mit.edu	37	19	47349293	47349293	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr19:47349293G>T	ENST00000263270.6	-	2	335	c.110C>A	c.(109-111)gCc>gAc	p.A37D	AP2S1_ENST00000599990.1_Missense_Mutation_p.A39D|AP2S1_ENST00000601498.1_Missense_Mutation_p.A53D|AP2S1_ENST00000597020.1_Missense_Mutation_p.A17D|AP2S1_ENST00000601649.1_Missense_Mutation_p.A37D|AP2S1_ENST00000352203.4_Missense_Mutation_p.A37D|AP2S1_ENST00000593442.1_Intron	NM_004069.3	NP_004060.2	P53680	AP2S1_HUMAN	adaptor-related protein complex 2, sigma 1 subunit	37					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|regulation of endocytosis (GO:0030100)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	AP-2 adaptor complex (GO:0030122)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			central_nervous_system(1)|lung(1)|urinary_tract(1)	3		all_cancers(25;1.24e-06)|all_epithelial(76;1.09e-05)|all_lung(116;0.00019)|Lung NSC(112;0.000601)|Ovarian(192;0.0221)|all_neural(266;0.0459)|Breast(70;0.128)		OV - Ovarian serous cystadenocarcinoma(262;3.86e-05)|all cancers(93;0.000107)|Epithelial(262;0.00325)|GBM - Glioblastoma multiforme(486;0.0336)		GGTGACCACGGCATGCACCTC	0.582																																					p.A37D													.	AP2S1	12	0			c.C110A						.						182.0	129.0	147.0					19																	47349293		2203	4300	6503	SO:0001583	missense	1175	exon2			ACCACGGCATGCA	AJ010148	CCDS12693.1, CCDS33062.1	19q13.2-q13.3	2014-02-04				ENSG00000042753			565	protein-coding gene	gene with protein product		602242	"""hypocalciuric hypercalcemia 3 (Oklahoma type)"""	CLAPS2, HHC3		9040778, 9767099, 23222959	Standard	XM_005258500		Approved	FBHOk, FBH3	uc002pft.1	P53680		ENST00000263270.6:c.110C>A	19.37:g.47349293G>T	ENSP00000263270:p.Ala37Asp	Somatic	21	0		WXS	Illumina GAIIx	Phase_I	17	3	NM_004069	B2R4Z4|O75977|Q6PK67	Missense_Mutation	SNP	ENST00000263270.6	37	CCDS33062.1	.	.	.	.	.	.	.	.	.	.	G	31	5.079471	0.94050	.	.	ENSG00000042753	ENST00000263270;ENST00000352203	.	.	.	4.87	4.87	0.63330	Longin-like (1);AP complex, mu/sigma subunit (1);	0.000000	0.85682	D	0.000000	T	0.61198	0.2328	L	0.48642	1.525	0.80722	D	1	P;D	0.55800	0.906;0.973	P;P	0.50378	0.471;0.639	T	0.63382	-0.6650	9	0.49607	T	0.09	.	16.9222	0.86166	0.0:0.0:1.0:0.0	.	37;37	P53680-2;P53680	.;AP2S1_HUMAN	D	37	.	ENSP00000263270:A37D	A	-	2	0	AP2S1	52041133	1.000000	0.71417	0.920000	0.36463	0.865000	0.49528	9.023000	0.93683	2.536000	0.85505	0.467000	0.42956	GCC	.		0.582	AP2S1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466643.1		
GON4L	54856	ucsc.edu	37	1	155733245	155733245	+	Silent	SNP	C	C	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr1:155733245C>T	ENST00000368331.1	-	22	4632	c.4584G>A	c.(4582-4584)gaG>gaA	p.E1528E	GON4L_ENST00000271883.5_Silent_p.E1528E|GON4L_ENST00000471341.1_5'Flank|GON4L_ENST00000437809.1_Silent_p.E1528E	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	1528	Glu-rich.				regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.E1528E(2)		NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					cttcttcttcctcctcttctt	0.488																																					p.E1528E													GON4L_ENST00000368331,NS,carcinoma,0,1	GON4L	392	2	Substitution - coding silent(2)	endometrium(2)	c.G4584A						.						35.0	35.0	35.0					1																	155733245		1944	4157	6101	SO:0001819	synonymous_variant	54856	exon22			TTCTTCCTCCTCT	AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.4584G>A	1.37:g.155733245C>T		Somatic	50	5		WXS	Illumina HiSeq		59	13	NM_001037533	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Silent	SNP	ENST00000368331.1	37																																																																																				.		0.488	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_032292	
CACNA1E	777	ucsc.edu	37	1	181765857	181765857	+	Nonsense_Mutation	SNP	G	G	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr1:181765857G>T	ENST00000367573.2	+	47	6262	c.6262G>T	c.(6262-6264)Gag>Tag	p.E2088*	CACNA1E_ENST00000367570.1_Nonsense_Mutation_p.E2045*|CACNA1E_ENST00000526775.1_Nonsense_Mutation_p.E2026*|CACNA1E_ENST00000358338.5_Nonsense_Mutation_p.E1977*|CACNA1E_ENST00000367567.4_Nonsense_Mutation_p.E1652*|CACNA1E_ENST00000357570.5_Nonsense_Mutation_p.E2039*|CACNA1E_ENST00000360108.3_Nonsense_Mutation_p.E2069*	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	2088					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						ACGATCAAAAGAGCGAAAGCA	0.567																																					p.E2088X													.	CACNA1E	778	0			c.G6262T						.						48.0	51.0	50.0					1																	181765857		1981	4167	6148	SO:0001587	stop_gained	777	exon47			TCAAAAGAGCGAA	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.6262G>T	1.37:g.181765857G>T	ENSP00000356545:p.Glu2088*	Somatic	18	0		WXS	Illumina HiSeq		27	4	NM_001205293	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Nonsense_Mutation	SNP	ENST00000367573.2	37	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	G	49	15.075631	0.99821	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	.	.	.	5.91	5.91	0.95273	.	0.592140	0.17525	N	0.171086	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	19.8936	0.96942	0.0:0.0:1.0:0.0	.	.	.	.	X	2045;2026;2039;1977;1652;2069;2088	.	ENSP00000350183:E2039X	E	+	1	0	CACNA1E	180032480	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.004000	0.93583	2.793000	0.96121	0.655000	0.94253	GAG	.		0.567	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
MUC4	4585	ucsc.edu	37	3	195509287	195509287	+	Missense_Mutation	SNP	T	T	G	rs71291872|rs201610800		TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr3:195509287T>G	ENST00000463781.3	-	2	9623	c.9164A>C	c.(9163-9165)aAc>aCc	p.N3055T	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.N3055T	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	996					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ATGAAGAGGGTTGGCGTGACC	0.627																																					p.N3055T													.	MUC4	1505	0			c.A9164C						.						29.0	15.0	19.0					3																	195509287		628	1560	2188	SO:0001583	missense	4585	exon2			AGAGGGTTGGCGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9164A>C	3.37:g.195509287T>G	ENSP00000417498:p.Asn3055Thr	Somatic	85	8		WXS	Illumina HiSeq		81	16	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	5.093	0.202865	0.09704	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.29655	1.56;1.56	.	.	.	.	.	.	.	.	T	0.12263	0.0298	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.30794	-0.9966	7	.	.	.	.	3.2933	0.06957	0.0:0.0:0.4408:0.5592	.	2927	E7ESK3	.	T	3055	ENSP00000417498:N3055T;ENSP00000420243:N3055T	.	N	-	2	0	MUC4	196994066	0.000000	0.05858	0.006000	0.13384	0.000000	0.00434	-2.273000	0.01164	0.415000	0.25817	0.000000	0.15137	AAC	.		0.627	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
SPATS1	221409	ucsc.edu	37	6	44310855	44310855	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr6:44310855G>T	ENST00000288390.2	+	1	370	c.23G>T	c.(22-24)gGa>gTa	p.G8V	SPATS1_ENST00000323108.8_Missense_Mutation_p.G8V|RP11-444E17.6_ENST00000505802.1_Intron			Q496A3	SPAS1_HUMAN	spermatogenesis associated, serine-rich 1	8			G -> R (in dbSNP:rs10948132). {ECO:0000269|PubMed:15489334}.							NS(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(2)|lung(5)|skin(1)|urinary_tract(1)	14	all_lung(25;0.00469)|Ovarian(13;0.0273)|all_hematologic(164;0.208)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			ATGCTCACTGGAAACAGTCCA	0.502																																					p.G8V													.	SPATS1	61	0			c.G23T						.						63.0	59.0	60.0					6																	44310855		2203	4300	6503	SO:0001583	missense	221409	exon2			TCACTGGAAACAG	AK058171	CCDS4911.1	6p21.1	2003-08-08			ENSG00000249481	ENSG00000249481			22957	protein-coding gene	gene with protein product							Standard	NM_145026		Approved	SPATA8, FLJ25442, SRSP1	uc021yzz.1	Q496A3	OTTHUMG00000014764	ENST00000288390.2:c.23G>T	6.37:g.44310855G>T	ENSP00000424400:p.Gly8Val	Somatic	35	0		WXS	Illumina HiSeq		35	4	NM_145026	Q496A2|Q496A5|Q96LJ0	Missense_Mutation	SNP	ENST00000288390.2	37	CCDS4911.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.41|14.41	2.527821|2.527821	0.44969|0.44969	.|.	.|.	ENSG00000249481|ENSG00000249481	ENST00000515220|ENST00000323108;ENST00000288390	.|T;T	.|0.55234	.|0.53;0.53	3.43|3.43	3.43|3.43	0.39272|0.39272	.|.	.|0.233763	.|0.22137	.|N	.|0.064107	.|T	.|0.55784	.|0.1942	L|L	0.57536|0.57536	1.79|1.79	0.19575|0.19575	N|N	0.999961|0.999961	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	.|T	.|0.41840	.|-0.9486	.|10	.|0.87932	.|D	.|0	.|.	10.6724|10.6724	0.45766|0.45766	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|8	.|Q496A3	.|SPAS1_HUMAN	X|V	42|8	.|ENSP00000437552:G8V;ENSP00000424400:G8V	.|ENSP00000424400:G8V	E|G	+|+	1|2	0|0	SPATS1|SPATS1	44418833|44418833	0.010000|0.010000	0.17322|0.17322	0.015000|0.015000	0.15790|0.15790	0.016000|0.016000	0.09150|0.09150	1.278000|1.278000	0.33179|0.33179	2.229000|2.229000	0.72834|0.72834	0.563000|0.563000	0.77884|0.77884	GAA|GGA	.		0.502	SPATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040738.2	NM_145026	
CDC27	996	ucsc.edu;bcgsc.ca	37	17	45232055	45232055	+	Missense_Mutation	SNP	C	C	T	rs200268612		TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr17:45232055C>T	ENST00000066544.3	-	8	1033	c.940G>A	c.(940-942)Gga>Aga	p.G314R	CDC27_ENST00000528748.1_5'Flank|CDC27_ENST00000531206.1_Missense_Mutation_p.G314R|CDC27_ENST00000446365.2_Missense_Mutation_p.G253R|CDC27_ENST00000527547.1_Missense_Mutation_p.G314R	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	314					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						GAAGGGGCTCCGGTGGATGGC	0.373																																					p.G314R													.	CDC27	337	0			c.G940A						.						42.0	42.0	42.0					17																	45232055		2203	4300	6503	SO:0001583	missense	996	exon8			GGGCTCCGGTGGA	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.940G>A	17.37:g.45232055C>T	ENSP00000066544:p.Gly314Arg	Somatic	54	2		WXS	Illumina HiSeq		45	22	NM_001114091	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	C	12.27	1.887899	0.33348	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.66638	-0.2;-0.22;0.08;-0.2;0.98	5.92	5.92	0.95590	.	0.186621	0.46442	D	0.000293	T	0.42245	0.1194	N	0.02539	-0.55	0.52501	D	0.999951	B;B;B;B	0.14012	0.009;0.001;0.002;0.0	B;B;B;B	0.08055	0.003;0.002;0.002;0.001	T	0.41305	-0.9516	10	0.13853	T	0.58	-4.7594	17.8238	0.88658	0.0:1.0:0.0:0.0	.	253;314;314;314	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	R	314;314;253;314;314	ENSP00000066544:G314R;ENSP00000434614:G314R;ENSP00000392802:G253R;ENSP00000437339:G314R;ENSP00000432105:G314R	ENSP00000066544:G314R	G	-	1	0	CDC27	42587054	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.650000	0.67944	2.810000	0.96702	0.585000	0.79938	GGA	.		0.373	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
KCNJ14	3770	ucsc.edu	37	19	48967988	48967988	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr19:48967988G>A	ENST00000391884.1	+	2	1741	c.1265G>A	c.(1264-1266)aGc>aAc	p.S422N	KCNJ14_ENST00000342291.2_Missense_Mutation_p.S422N|CTC-273B12.5_ENST00000600650.1_RNA|CTC-273B12.5_ENST00000596497.1_RNA|CTC-273B12.6_ENST00000597574.1_lincRNA|CTC-273B12.5_ENST00000600529.1_RNA|CTC-273B12.7_ENST00000595676.1_5'Flank|CTC-273B12.5_ENST00000593476.1_RNA			Q9UNX9	KCJ14_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 14	422					potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)			cervix(1)|endometrium(2)|large_intestine(2)|lung(2)|skin(2)|urinary_tract(1)	10		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000109)|all cancers(93;0.000129)|Epithelial(262;0.0081)|GBM - Glioblastoma multiforme(486;0.0222)	Yohimbine(DB01392)	GGGGCTGCTAGCCCCCGAGTT	0.557																																					p.P422Q	NSCLC(148;170 3504 35216)												.	KCNJ14	28	0			c.C1265A						.						60.0	61.0	61.0					19																	48967988		2203	4300	6503	SO:0001583	missense	3770	exon3			CTGCTAGCCCCCG	BC042033	CCDS12721.1	19q13	2011-07-05				ENSG00000182324		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6260	protein-coding gene	gene with protein product		603953				9592090, 10723734, 16382105	Standard	NM_013348		Approved	Kir2.4, IRK4	uc002pje.2	Q9UNX9		ENST00000391884.1:c.1265G>A	19.37:g.48967988G>A	ENSP00000375756:p.Ser422Asn	Somatic	33	0		WXS	Illumina HiSeq		41	4	NM_013348		Missense_Mutation	SNP	ENST00000391884.1	37	CCDS12721.1	.	.	.	.	.	.	.	.	.	.	G	13.09	2.134534	0.37630	.	.	ENSG00000182324	ENST00000342291;ENST00000391884	D;D	0.89196	-2.48;-2.48	5.24	3.14	0.36123	.	1.263970	0.05234	N	0.510937	T	0.79028	0.4377	N	0.19112	0.55	0.24966	N	0.991693	B	0.02656	0.0	B	0.01281	0.0	T	0.65154	-0.6237	10	0.14252	T	0.57	.	4.2996	0.10918	0.1825:0.0:0.635:0.1824	.	422	Q9UNX9	IRK14_HUMAN	N	422	ENSP00000341479:S422N;ENSP00000375756:S422N	ENSP00000341479:S422N	S	+	2	0	KCNJ14	53659800	0.956000	0.32656	1.000000	0.80357	0.905000	0.53344	0.143000	0.16115	1.542000	0.49330	-0.140000	0.14226	AGC	.		0.557	KCNJ14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466127.1	NM_013348	
POLR3H	171568	ucsc.edu;bcgsc.ca	37	22	41928664	41928664	+	Splice_Site	SNP	G	G	A	rs369041845		TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr22:41928664G>A	ENST00000355209.4	-	3	637	c.294C>T	c.(292-294)caC>caT	p.H98H	POLR3H_ENST00000396504.2_Splice_Site_p.H98H|POLR3H_ENST00000337566.5_Intron|POLR3H_ENST00000407461.1_Splice_Site_p.H98H|POLR3H_ENST00000420561.1_5'UTR	NM_001018050.2	NP_001018060.1	Q9Y535	RPC8_HUMAN	polymerase (RNA) III (DNA directed) polypeptide H (22.9kD)	98					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|nucleobase-containing compound metabolic process (GO:0006139)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase III promoter (GO:0006384)	centrosome (GO:0005813)|cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			breast(1)|lung(5)|skin(1)|urinary_tract(1)	8						CACTGTTACCGTGCACTCCTT	0.547											OREG0026590	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.H98H													.	POLR3H	30	0			c.C294T						.	G	,,	0,4406		0,0,2203	154.0	126.0	136.0		294,,294	-2.3	1.0	22		136	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous-near-splice,intron,coding-synonymous-near-splice	POLR3H	NM_001018050.2,NM_001018052.2,NM_138338.3	,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,	98/205,,98/205	41928664	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	171568	exon3			GTTACCGTGCACT	AB051452	CCDS14018.1, CCDS33651.1	22q13	2013-01-21			ENSG00000100413	ENSG00000100413		"""RNA polymerase subunits"""	30349	protein-coding gene	gene with protein product						11258795, 12391170	Standard	XR_244356		Approved	RPC8, KIAA1665	uc003baf.3	Q9Y535	OTTHUMG00000150971	ENST00000355209.4:c.295+1C>T	22.37:g.41928664G>A		Somatic	28	0	904	WXS	Illumina HiSeq		27	4	NM_001018050	B0QYH9|Q5M7Y8|Q96AE3|Q9BY95	Silent	SNP	ENST00000355209.4	37	CCDS14018.1																																																																																			.		0.547	POLR3H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320701.1	NM_138338	Silent
CHD5	26038	bcgsc.ca	37	1	6188616	6188616	+	Missense_Mutation	SNP	A	A	G			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr1:6188616A>G	ENST00000262450.3	-	24	3772	c.3673T>C	c.(3673-3675)Tcc>Ccc	p.S1225P	CHD5_ENST00000378021.1_Missense_Mutation_p.S82P	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		CCCCCTTTGGAGGACTGGACA	0.627																																					p.S1225P													.	CHD5	267	0			c.T3673C						.						56.0	57.0	57.0					1																	6188616		2203	4300	6503	SO:0001583	missense	26038	exon24			CTTTGGAGGACTG	AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.3673T>C	1.37:g.6188616A>G	ENSP00000262450:p.Ser1225Pro	Somatic	53	0		WXS	Illumina HiSeq	Phase_1	14	3	NM_015557	A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	ENST00000262450.3	37	CCDS57.1	.	.	.	.	.	.	.	.	.	.	A	14.82	2.648564	0.47258	.	.	ENSG00000116254	ENST00000262450;ENST00000378006;ENST00000378021;ENST00000536802;ENST00000538279;ENST00000377999	D;T	0.90844	-2.74;2.2	4.48	1.85	0.25348	.	0.600127	0.13979	N	0.349636	T	0.81216	0.4776	N	0.24115	0.695	0.26820	N	0.968819	B;B	0.28439	0.212;0.149	B;B	0.28784	0.094;0.026	T	0.71807	-0.4481	10	0.54805	T	0.06	-16.4781	4.2904	0.10876	0.4419:0.1648:0.0:0.3933	.	1225;82	Q8TDI0;Q5TG85	CHD5_HUMAN;.	P	1225;741;82;633;633;82	ENSP00000262450:S1225P;ENSP00000367260:S82P	ENSP00000262450:S1225P	S	-	1	0	CHD5	6111203	1.000000	0.71417	0.996000	0.52242	0.775000	0.43874	1.406000	0.34646	0.537000	0.28751	0.260000	0.18958	TCC	.		0.627	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002823.2	NM_015557	
DNAJC16	23341	bcgsc.ca	37	1	15886125	15886125	+	Silent	SNP	T	T	C			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr1:15886125T>C	ENST00000375847.3	+	8	1292	c.1128T>C	c.(1126-1128)ccT>ccC	p.P376P	DNAJC16_ENST00000375838.1_Silent_p.P376P|DNAJC16_ENST00000375849.1_Silent_p.P376P|DNAJC16_ENST00000483270.1_3'UTR	NM_015291.2	NP_056106.1	Q9Y2G8	DJC16_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 16	376					cell redox homeostasis (GO:0045454)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(7)|urinary_tract(1)	18		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00173)|all_lung(284;0.00459)|Lung NSC(340;0.00499)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		AACTCTGCCCTGTGAAACGGT	0.438																																					p.P376P													.	DNAJC16	59	0			c.T1128C						.						123.0	117.0	119.0					1																	15886125		2203	4300	6503	SO:0001819	synonymous_variant	23341	exon8			CTGCCCTGTGAAA	AB023179	CCDS30606.1, CCDS72710.1	1p36.1	2011-09-02			ENSG00000116138	ENSG00000116138		"""Heat shock proteins / DNAJ (HSP40)"""	29157	protein-coding gene	gene with protein product							Standard	NM_015291		Approved	KIAA0962	uc001aws.3	Q9Y2G8	OTTHUMG00000002358	ENST00000375847.3:c.1128T>C	1.37:g.15886125T>C		Somatic	50	0		WXS	Illumina HiSeq	Phase_1	23	3	NM_015291	Q68D57|Q86X32|Q8N5P4	Silent	SNP	ENST00000375847.3	37	CCDS30606.1																																																																																			.		0.438	DNAJC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006764.1	NM_015291	
ZNF697	90874	bcgsc.ca	37	1	120166656	120166656	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr1:120166656G>A	ENST00000421812.2	-	3	429	c.310C>T	c.(310-312)Cca>Tca	p.P104S		NM_001080470.1	NP_001073939.1	Q5TEC3	ZN697_HUMAN	zinc finger protein 697	104					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			ovary(2)	2	all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0266)		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0577)		GACAGTCCTGGGAACATCGCC	0.597																																					p.P104S													.	ZNF697	26	0			c.C310T						.						53.0	61.0	59.0					1																	120166656		2113	4233	6346	SO:0001583	missense	90874	exon3			GTCCTGGGAACAT	AK027019, BC033126	CCDS44202.1	1p12	2013-01-08			ENSG00000143067	ENSG00000143067		"""Zinc fingers, C2H2-type"""	32034	protein-coding gene	gene with protein product							Standard	NM_001080470		Approved	MGC45731	uc001ehy.1	Q5TEC3	OTTHUMG00000012962	ENST00000421812.2:c.310C>T	1.37:g.120166656G>A	ENSP00000396857:p.Pro104Ser	Somatic	33	0		WXS	Illumina HiSeq	Phase_1	14	3	NM_001080470	Q96IT2	Missense_Mutation	SNP	ENST00000421812.2	37	CCDS44202.1	.	.	.	.	.	.	.	.	.	.	G	0.063	-1.219566	0.01542	.	.	ENSG00000143067	ENST00000421812	T	0.08546	3.08	4.61	0.316	0.15857	.	.	.	.	.	T	0.01092	0.0036	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.48269	-0.9050	9	0.11182	T	0.66	.	6.8635	0.24079	0.1701:0.2722:0.5578:0.0	.	104	Q5TEC3	ZN697_HUMAN	S	104	ENSP00000396857:P104S	ENSP00000396857:P104S	P	-	1	0	ZNF697	119968179	0.000000	0.05858	0.026000	0.17262	0.032000	0.12392	-0.686000	0.05161	0.116000	0.18110	0.563000	0.77884	CCA	.		0.597	ZNF697-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036349.3	XM_371286	
FAM117B	150864	bcgsc.ca	37	2	203630387	203630387	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr2:203630387C>T	ENST00000392238.2	+	8	1670	c.1670C>T	c.(1669-1671)aCa>aTa	p.T557I	FAM117B_ENST00000303116.6_Missense_Mutation_p.T313I			Q6P1L5	F117B_HUMAN	family with sequence similarity 117, member B	557										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)	17						TCCCTGTCTACAAACACAGAG	0.537																																					p.T557I													.	FAM117B	73	0			c.C1670T						.						129.0	118.0	122.0					2																	203630387		2203	4300	6503	SO:0001583	missense	150864	exon8			TGTCTACAAACAC	AB053315	CCDS33362.1, CCDS33362.2	2q33	2008-08-18	2008-08-18	2008-08-18	ENSG00000138439	ENSG00000138439			14440	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 13"""	ALS2CR13		11586298	Standard	NM_173511		Approved	FLJ38771	uc010zhx.2	Q6P1L5	OTTHUMG00000154550	ENST00000392238.2:c.1670C>T	2.37:g.203630387C>T	ENSP00000376071:p.Thr557Ile	Somatic	45	0		WXS	Illumina HiSeq	Phase_1	22	3	NM_173511	Q53QZ5|Q585T9|Q8N8W1|Q96Q34	Missense_Mutation	SNP	ENST00000392238.2	37	CCDS33362.2	.	.	.	.	.	.	.	.	.	.	C	13.72	2.322591	0.41096	.	.	ENSG00000138439	ENST00000303116;ENST00000392238	.	.	.	5.61	4.73	0.59995	.	0.351400	0.28026	N	0.016881	T	0.28433	0.0703	N	0.22421	0.69	0.28779	N	0.89993	B	0.19583	0.037	B	0.15484	0.013	T	0.15896	-1.0421	9	0.41790	T	0.15	-20.6095	10.2332	0.43266	0.0:0.7934:0.1352:0.0714	.	557	Q6P1L5	F117B_HUMAN	I	313;557	.	ENSP00000306299:T313I	T	+	2	0	FAM117B	203338632	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.669000	0.61575	1.357000	0.45904	0.561000	0.74099	ACA	.		0.537	FAM117B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335888.3	NM_173511	
ATG16L1	55054	bcgsc.ca	37	2	234164841	234164841	+	Splice_Site	SNP	G	G	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr2:234164841G>T	ENST00000392017.4	+	2	466	c.209G>T	c.(208-210)aGt>aTt	p.S70I	ATG16L1_ENST00000392018.1_Splice_Site_p.S70I|ATG16L1_ENST00000373525.5_Splice_Site_p.R70M|ATG16L1_ENST00000347464.5_Splice_Site_p.R70M|ATG16L1_ENST00000392020.4_Splice_Site_p.S70I	NM_001190266.1|NM_001190267.1|NM_030803.6	NP_001177195.1|NP_001177196.1|NP_110430.5	Q676U5	A16L1_HUMAN	autophagy related 16-like 1 (S. cerevisiae)	70					autophagic vacuole assembly (GO:0000045)|negative stranded viral RNA replication (GO:0039689)|protein homooligomerization (GO:0051260)|protein transport (GO:0015031)	autophagic vacuole (GO:0005776)|autophagic vacuole membrane (GO:0000421)|axoneme (GO:0005930)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(7)|prostate(3)|skin(1)	25		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0539)		Epithelial(121;1.53e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000379)|LUSC - Lung squamous cell carcinoma(224;0.00619)|Lung(119;0.00732)|GBM - Glioblastoma multiforme(43;0.11)		CACGAGATAAGGTATTTTGAA	0.338																																					p.R70M													.	ATG16L1	83	0			c.G209T						.						62.0	62.0	62.0					2																	234164841		1850	4083	5933	SO:0001630	splice_region_variant	55054	exon2			AGATAAGGTATTT	AK000897	CCDS2502.2, CCDS2503.2, CCDS54438.1	2q37.1	2014-02-12	2012-06-06	2005-09-13	ENSG00000085978	ENSG00000085978		"""WD repeat domain containing"""	21498	protein-coding gene	gene with protein product		610767	"""APG16 autophagy 16-like (S. cerevisiae)"", ""ATG16 autophagy related 16-like (S. cerevisiae)"", ""ATG16 autophagy related 16-like 1 (S. cerevisiae)"""	APG16L, ATG16L			Standard	NM_017974		Approved	WDR30, FLJ10035, ATG16A	uc002vty.3	Q676U5	OTTHUMG00000133619	ENST00000392017.4:c.209+1G>T	2.37:g.234164841G>T		Somatic	63	0		WXS	Illumina HiSeq	Phase_1	46	4	NM_198890	A3EXK9|A3EXL0|B6ZDH0|Q6IPN1|Q6UXW4|Q6ZVZ5|Q8NCY2|Q96JV5|Q9H619	Missense_Mutation	SNP	ENST00000392017.4	37	CCDS2503.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.3|23.3	4.394221|4.394221	0.83011|0.83011	.|.	.|.	ENSG00000085978|ENSG00000085978	ENST00000347464;ENST00000444735;ENST00000373525;ENST00000419681|ENST00000392017;ENST00000417017;ENST00000392020;ENST00000392018	T;T;T;T|T;T;T	0.52295|0.53423	0.76;0.67;0.7;1.32|0.63;0.63;0.62	5.7|5.7	4.81|4.81	0.61882|0.61882	.|Autophagy-related protein 16 (1);	.|0.000000	.|0.85682	.|U	.|0.000000	T|T	0.70290|0.70290	0.3207|0.3207	M|M	0.78049|0.78049	2.395|2.395	0.80722|0.80722	D|D	1|1	D;D|D;D	0.76494|0.89917	0.998;0.999|1.0;1.0	D;D|D;D	0.70227|0.91635	0.959;0.968|0.999;0.999	T|T	0.75725|0.75725	-0.3217|-0.3217	9|10	0.87932|0.87932	D|D	0|0	.|.	16.7652|16.7652	0.85522|0.85522	0.0:0.129:0.871:0.0|0.0:0.129:0.871:0.0	.|.	70;70|70;70	Q676U5-4;A3EXL0|Q676U5-2;Q676U5	.;.|.;A16L1_HUMAN	M|I	70|70	ENSP00000318259:R70M;ENSP00000409215:R70M;ENSP00000362625:R70M;ENSP00000398773:R70M|ENSP00000375872:S70I;ENSP00000375875:S70I;ENSP00000375873:S70I	ENSP00000318259:R70M|ENSP00000375872:S70I	R|S	+|+	2|2	0|0	ATG16L1|ATG16L1	233829580|233829580	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	7.201000|7.201000	0.77847|0.77847	1.384000|1.384000	0.46424|0.46424	0.655000|0.655000	0.94253|0.94253	AGG|AGT	.		0.338	ATG16L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257069.2	NM_017974	Missense_Mutation
ACSL6	23305	bcgsc.ca	37	5	131329781	131329781	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr5:131329781G>T	ENST00000379240.1	-	2	291	c.138C>A	c.(136-138)caC>caA	p.H46Q	ACSL6_ENST00000379246.1_Missense_Mutation_p.H57Q|ACSL6_ENST00000379249.3_Missense_Mutation_p.H46Q|ACSL6_ENST00000379264.2_Missense_Mutation_p.H71Q|ACSL6_ENST00000357096.1_Intron|ACSL6_ENST00000543479.1_Missense_Mutation_p.H46Q|ACSL6_ENST00000544770.1_5'UTR|ACSL6_ENST00000379272.2_Missense_Mutation_p.H46Q|ACSL6_ENST00000431707.1_Intron|ACSL6_ENST00000477640.1_5'UTR|ACSL6_ENST00000379255.1_Intron|ACSL6_ENST00000296869.4_Missense_Mutation_p.H71Q|ACSL6_ENST00000379244.1_Missense_Mutation_p.H46Q			Q9UKU0	ACSL6_HUMAN	acyl-CoA synthetase long-chain family member 6	46				H -> Q (in Ref. 1; AAD47199). {ECO:0000305}.	acyl-CoA metabolic process (GO:0006637)|cellular lipid metabolic process (GO:0044255)|cellular response to insulin stimulus (GO:0032869)|fatty acid transport (GO:0015908)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|neuroblast proliferation (GO:0007405)|neuron development (GO:0048666)|phospholipid biosynthetic process (GO:0008654)|positive regulation of neuron projection development (GO:0010976)|positive regulation of plasma membrane long-chain fatty acid transport (GO:0010747)|positive regulation of triglyceride biosynthetic process (GO:0010867)|response to gravity (GO:0009629)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|long-chain fatty acid-CoA ligase activity (GO:0004467)|protein homodimerization activity (GO:0042803)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	35		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CCTTTGGCCGGTGAGTGAACC	0.587																																					p.H71Q													.	ACSL6	169	0			c.C213A						.						66.0	58.0	60.0					5																	131329781		2203	4300	6503	SO:0001583	missense	23305	exon2			TGGCCGGTGAGTG	AB020644	CCDS34228.1, CCDS34229.1, CCDS56381.1, CCDS56382.1, CCDS56383.1	5q31	2008-02-05	2004-02-19	2004-02-20	ENSG00000164398	ENSG00000164398		"""Acyl-CoA synthetase family"""	16496	protein-coding gene	gene with protein product		604443	"""fatty-acid-Coenzyme A ligase, long-chain 6"""	FACL6		10502316, 10548543	Standard	NM_015256		Approved	KIAA0837, ACS2, LACS5, LACS2	uc003kvy.2	Q9UKU0	OTTHUMG00000150692	ENST00000379240.1:c.138C>A	5.37:g.131329781G>T	ENSP00000368542:p.His46Gln	Somatic	31	0		WXS	Illumina HiSeq	Phase_1	15	3	NM_001009185	J3KPG3|O94924|O95829|Q108M9|Q108N0|Q4G191|Q86TN7	Missense_Mutation	SNP	ENST00000379240.1	37		.	.	.	.	.	.	.	.	.	.	G	14.58	2.578265	0.45902	.	.	ENSG00000164398	ENST00000379249;ENST00000379264;ENST00000379272;ENST00000296869;ENST00000379246;ENST00000379244;ENST00000379240;ENST00000543479;ENST00000430403;ENST00000419502;ENST00000416557;ENST00000414078	T;T;T;T;T;T;T;T;T	0.39787	2.04;2.78;2.63;2.78;2.78;2.78;2.78;2.78;1.06	5.6	1.78	0.24846	.	0.332604	0.37304	N	0.002158	T	0.29061	0.0722	N	0.19112	0.55	0.80722	D	1	B;B;B;B;B	0.19445	0.036;0.016;0.021;0.036;0.016	B;B;B;B;B	0.30251	0.113;0.02;0.053;0.033;0.02	T	0.06643	-1.0815	10	0.36615	T	0.2	.	11.5673	0.50813	0.2888:0.0:0.7112:0.0	.	46;46;46;71;71	Q9UKU0-3;Q9UKU0-6;Q9UKU0;Q9UKU0-1;Q9UKU0-8	.;.;ACSL6_HUMAN;.;.	Q	46;71;46;71;57;46;46;46;46;46;46;46	ENSP00000368551:H46Q;ENSP00000368566:H71Q;ENSP00000368574:H46Q;ENSP00000296869:H71Q;ENSP00000368548:H57Q;ENSP00000368546:H46Q;ENSP00000368542:H46Q;ENSP00000442124:H46Q;ENSP00000398423:H46Q	ENSP00000296869:H71Q	H	-	3	2	ACSL6	131357680	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.102000	0.41796	0.326000	0.23384	0.591000	0.81541	CAC	.		0.587	ACSL6-004	NOVEL	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000132622.1	NM_015256	
CTGF	1490	bcgsc.ca	37	6	132270556	132270556	+	Missense_Mutation	SNP	T	T	G			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr6:132270556T>G	ENST00000367976.3	-	5	1098	c.898A>C	c.(898-900)Acc>Ccc	p.T300P	RP11-69I8.3_ENST00000435287.1_RNA	NM_001901.2	NP_001892	P29279	CTGF_HUMAN	connective tissue growth factor	300	CTCK. {ECO:0000255|PROSITE- ProRule:PRU00039}.|Heparin-binding.				angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|chondrocyte proliferation (GO:0035988)|cytosolic calcium ion transport (GO:0060401)|DNA replication (GO:0006260)|epidermis development (GO:0008544)|extracellular matrix constituent secretion (GO:0070278)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|organ senescence (GO:0010260)|ossification (GO:0001503)|positive regulation of cardiac muscle contraction (GO:0060452)|positive regulation of cell activation (GO:0050867)|positive regulation of cell death (GO:0010942)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G0 to G1 transition (GO:0070318)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|regulation of cell growth (GO:0001558)|regulation of chondrocyte differentiation (GO:0032330)|response to amino acid (GO:0043200)|response to anoxia (GO:0034059)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to glucose (GO:0009749)|response to mineralocorticoid (GO:0051385)|response to peptide hormone (GO:0043434)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell cortex (GO:0005938)|cis-Golgi network (GO:0005801)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|insulin-like growth factor binding (GO:0005520)			breast(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	13	Breast(56;0.0602)			GBM - Glioblastoma multiforme(226;0.015)|OV - Ovarian serous cystadenocarcinoma(155;0.0169)		ACCGGCAGGGTGGTGGTTCTG	0.537																																					p.T300P	Esophageal Squamous(127;510 1660 12817 24400 38449)												.	CTGF	36	0			c.A898C						.						159.0	156.0	157.0					6																	132270556		2203	4300	6503	SO:0001583	missense	1490	exon5			GCAGGGTGGTGGT	X78947	CCDS5151.1	6q23.2	2008-02-05			ENSG00000118523	ENSG00000118523			2500	protein-coding gene	gene with protein product		121009				1654338	Standard	NM_001901		Approved	IGFBP8, CCN2	uc003qcz.3	P29279	OTTHUMG00000015573	ENST00000367976.3:c.898A>C	6.37:g.132270556T>G	ENSP00000356954:p.Thr300Pro	Somatic	77	3		WXS	Illumina HiSeq	Phase_1	35	9	NM_001901	E1P578|Q6LCY0|Q96A79|Q96QX2|Q9UDL6	Missense_Mutation	SNP	ENST00000367976.3	37	CCDS5151.1	.	.	.	.	.	.	.	.	.	.	T	19.30	3.800569	0.70567	.	.	ENSG00000118523	ENST00000367976	T	0.41065	1.01	5.55	4.4	0.53042	Cystine knot (1);Cystine knot, C-terminal (3);	0.051143	0.85682	D	0.000000	T	0.58750	0.2144	M	0.87381	2.88	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67461	-0.5665	10	0.87932	D	0	.	11.4058	0.49898	0.0:0.0707:0.0:0.9293	.	300	P29279	CTGF_HUMAN	P	300	ENSP00000356954:T300P	ENSP00000356954:T300P	T	-	1	0	CTGF	132312249	1.000000	0.71417	0.981000	0.43875	0.988000	0.76386	7.997000	0.88414	1.055000	0.40461	0.477000	0.44152	ACC	.		0.537	CTGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042239.2	NM_001901	
RP11-557H15.5	0	bcgsc.ca	37	6	134924992	134924992	+	lincRNA	SNP	C	C	T	rs112695384		TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr6:134924992C>T	ENST00000412602.1	-	0	958																											TAGAAACAAACTAATAATCTG	0.408																																					.													.	.	.	0			.						.																																					114182	.			AACAAACTAATAA																													6.37:g.134924992C>T		Somatic	34	1		WXS	Illumina HiSeq	Phase_1	13	7	.		RNA	SNP	ENST00000412602.1	37																																																																																				C|0.500;T|0.500		0.408	RP11-557H15.5-001	KNOWN	basic|exp_conf	lincRNA	lincRNA	OTTHUMT00000042327.1		
RP11-557H15.5	0	bcgsc.ca	37	6	134925007	134925007	+	lincRNA	SNP	T	T	A	rs202151939		TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr6:134925007T>A	ENST00000412602.1	-	0	958																											AATCTGTATATAAGAGCCACA	0.413																																					.													.	.	.	0			.						.																																					114182	.			TGTATATAAGAGC																													6.37:g.134925007T>A		Somatic	33	1		WXS	Illumina HiSeq	Phase_1	13	7	.		RNA	SNP	ENST00000412602.1	37																																																																																				.		0.413	RP11-557H15.5-001	KNOWN	basic|exp_conf	lincRNA	lincRNA	OTTHUMT00000042327.1		
CICP20	100129050	bcgsc.ca	37	7	45856067	45856067	+	lincRNA	SNP	C	C	A			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr7:45856067C>A	ENST00000609439.1	+	0	1324																											TCATGCTGCCCCAGCAGCTTC	0.622																																					.													.	.	.	0			.						.																																					0	.			GCTGCCCCAGCAG																													7.37:g.45856067C>A		Somatic	20	0		WXS	Illumina HiSeq	Phase_1	10	3	.		RNA	SNP	ENST00000609439.1	37																																																																																				.		0.622	RP11-638I8.1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000472497.1		
ADAMTSL2	9719	bcgsc.ca	37	9	136405777	136405777	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr9:136405777G>A	ENST00000354484.4	+	6	1027	c.470G>A	c.(469-471)gGc>gAc	p.G157D	ADAMTSL2_ENST00000393061.3_Missense_Mutation_p.G266D|ADAMTSL2_ENST00000393060.1_Missense_Mutation_p.G157D	NM_001145320.1	NP_001138792.1	Q86TH1	ATL2_HUMAN	ADAMTS-like 2	157					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			kidney(2)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(145;9.31e-08)|Epithelial(140;6.62e-07)|all cancers(34;7.74e-06)		ACCGTGGACGGCCAGCGGCAG	0.582																																					p.G157D													.	ADAMTSL2	40	0			c.G470A						.						55.0	44.0	48.0					9																	136405777		2203	4300	6503	SO:0001583	missense	9719	exon6			TGGACGGCCAGCG	AB011177	CCDS6976.1	9q34.3	2005-01-12			ENSG00000197859	ENSG00000197859			14631	protein-coding gene	gene with protein product		612277				9628581, 14667842	Standard	NM_014694		Approved	KIAA0605	uc004cei.3	Q86TH1	OTTHUMG00000131706	ENST00000354484.4:c.470G>A	9.37:g.136405777G>A	ENSP00000346478:p.Gly157Asp	Somatic	51	0		WXS	Illumina HiSeq	Phase_1	48	4	NM_014694	B1B0D5|O60345	Missense_Mutation	SNP	ENST00000354484.4	37	CCDS6976.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.681495	0.88542	.	.	ENSG00000197859	ENST00000354484;ENST00000393061;ENST00000393060	D;D;D	0.85955	-2.05;-2.05;-2.05	4.58	4.58	0.56647	.	0.000000	0.64402	U	0.000004	D	0.89904	0.6850	L	0.53671	1.685	0.58432	D	0.999998	D	0.89917	1.0	D	0.85130	0.997	D	0.87649	0.2527	10	0.22706	T	0.39	.	17.3768	0.87394	0.0:0.0:1.0:0.0	.	157	Q86TH1	ATL2_HUMAN	D	157;266;157	ENSP00000346478:G157D;ENSP00000376781:G266D;ENSP00000376780:G157D	ENSP00000346478:G157D	G	+	2	0	ADAMTSL2	135395598	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	9.401000	0.97294	2.093000	0.63338	0.462000	0.41574	GGC	.		0.582	ADAMTSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254619.1	NM_014694	
OR7E117P	399857	bcgsc.ca	37	11	3621201	3621201	+	IGR	SNP	T	T	C			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr11:3621201T>C								RP13-726E6.2 (18760 upstream) : TRPC2 (26512 downstream)																							ATAGGATCCCTGAAATGGGAA	0.413																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	399857	.			GATCCCTGAAATG																													11.37:g.3621201T>C		Somatic	101	0		WXS	Illumina HiSeq	Phase_1	57	4	.		RNA	SNP		37																																																																																				.	0	0.413								
TENM4	26011	bcgsc.ca	37	11	78449511	78449511	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr11:78449511C>T	ENST00000278550.7	-	20	3323	c.2861G>A	c.(2860-2862)aGc>aAc	p.S954N		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	954					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										ATCTTGCCTGCTGATTGTATA	0.483																																					p.S954N													.	.	.	0			c.G2861A						.						80.0	75.0	77.0					11																	78449511		1922	4130	6052	SO:0001583	missense	26011	exon20			TGCCTGCTGATTG	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.2861G>A	11.37:g.78449511C>T	ENSP00000278550:p.Ser954Asn	Somatic	85	0		WXS	Illumina HiSeq	Phase_1	57	4	NM_001098816	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	ENST00000278550.7	37	CCDS44688.1	.	.	.	.	.	.	.	.	.	.	C	17.75	3.467203	0.63625	.	.	ENSG00000149256	ENST00000278550	T	0.17213	2.29	5.08	5.08	0.68730	Carboxypeptidase-like, regulatory domain (1);	0.047879	0.85682	D	0.000000	T	0.22205	0.0535	M	0.66939	2.045	0.45261	D	0.998265	B	0.31125	0.309	B	0.27608	0.081	T	0.02728	-1.1118	9	.	.	.	.	19.0333	0.92967	0.0:1.0:0.0:0.0	.	954	Q6N022	TEN4_HUMAN	N	954	ENSP00000278550:S954N	.	S	-	2	0	ODZ4	78127159	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.399000	0.52586	2.793000	0.96121	0.655000	0.94253	AGC	.		0.483	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2		
ARHGAP5	394	bcgsc.ca	37	14	32563150	32563150	+	Missense_Mutation	SNP	C	C	T	rs373639217		TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr14:32563150C>T	ENST00000345122.3	+	2	3590	c.3275C>T	c.(3274-3276)gCg>gTg	p.A1092V	ARHGAP5_ENST00000432921.1_Missense_Mutation_p.A1092V|ARHGAP5_ENST00000556611.1_Missense_Mutation_p.A1092V|ARHGAP5_ENST00000396582.2_Intron|ARHGAP5_ENST00000539826.2_Missense_Mutation_p.A1092V|ARHGAP5_ENST00000433497.1_Intron	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	1092					cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		GATAACTATGCGGAACCCATT	0.368																																					p.A1092V	NSCLC(9;77 350 3443 29227 41353)												.	ARHGAP5	166	0			c.C3275T						.	C	VAL/ALA,VAL/ALA	1,4405		0,1,2202	49.0	53.0	51.0		3275,3275	4.4	1.0	14		51	0,8584		0,0,4292	no	missense,missense	ARHGAP5	NM_001030055.1,NM_001173.2	64,64	0,1,6494	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	1092/1503,1092/1502	32563150	1,12989	2203	4292	6495	SO:0001583	missense	394	exon2			ACTATGCGGAACC	U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.3275C>T	14.37:g.32563150C>T	ENSP00000371897:p.Ala1092Val	Somatic	92	0		WXS	Illumina HiSeq	Phase_1	66	4	NM_001173	A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Missense_Mutation	SNP	ENST00000345122.3	37	CCDS32062.1	.	.	.	.	.	.	.	.	.	.	C	17.10	3.304284	0.60305	2.27E-4	0.0	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000345122;ENST00000432921	T;T;T;T	0.11712	2.75;2.75;2.75;2.75	5.33	4.43	0.53597	.	0.141713	0.64402	N	0.000005	T	0.31167	0.0788	M	0.66939	2.045	0.54753	D	0.999985	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.03863	-1.0997	10	0.59425	D	0.04	.	14.7342	0.69404	0.0:0.9287:0.0:0.0713	.	1092;1092	Q13017-2;Q13017	.;RHG05_HUMAN	V	1092	ENSP00000452222:A1092V;ENSP00000441692:A1092V;ENSP00000371897:A1092V;ENSP00000393307:A1092V	ENSP00000371897:A1092V	A	+	2	0	ARHGAP5	31632901	1.000000	0.71417	0.996000	0.52242	0.986000	0.74619	4.806000	0.62569	1.359000	0.45940	0.591000	0.81541	GCG	.		0.368	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409735.1	NM_001030055	
HSP90AA1	3320	bcgsc.ca	37	14	102548746	102548746	+	Silent	SNP	G	G	A			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr14:102548746G>A	ENST00000216281.8	-	10	1996	c.1791C>T	c.(1789-1791)tgC>tgT	p.C597C	HSP90AA1_ENST00000334701.7_Silent_p.C719C	NM_005348.3	NP_005339.3	P07900	HS90A_HUMAN	heat shock protein 90kDa alpha (cytosolic), class A member 1	597					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|chaperone-mediated protein complex assembly (GO:0051131)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|mitochondrial transport (GO:0006839)|mitotic cell cycle (GO:0000278)|nitric oxide metabolic process (GO:0046209)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|protein import into mitochondrial outer membrane (GO:0045040)|protein refolding (GO:0042026)|regulation of nitric-oxide synthase activity (GO:0050999)|response to unfolded protein (GO:0006986)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|identical protein binding (GO:0042802)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|TPR domain binding (GO:0030911)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(6)|large_intestine(3)|liver(1)|lung(10)|ovary(2)|prostate(1)	28					Nedocromil(DB00716)|Rifabutin(DB00615)	TGACAATACAGCATGGAGATG	0.408																																					p.C719C													.	HSP90AA1	65	0			c.C2157T						.						64.0	60.0	62.0					14																	102548746		2203	4300	6503	SO:0001819	synonymous_variant	3320	exon11			AATACAGCATGGA	M27024	CCDS9967.1, CCDS32160.1	14q32.33	2011-09-02	2006-02-24	2006-02-24	ENSG00000080824	ENSG00000080824		"""Heat shock proteins / HSPC"""	5253	protein-coding gene	gene with protein product		140571	"""heat shock 90kD protein 1, alpha"", ""heat shock 90kDa protein 1, alpha"""	HSPC1, HSPCA		2527334, 16269234	Standard	NM_001017963		Approved	Hsp89, Hsp90, FLJ31884, HSP90N	uc001ykv.4	P07900		ENST00000216281.8:c.1791C>T	14.37:g.102548746G>A		Somatic	73	0		WXS	Illumina HiSeq	Phase_1	44	4	NM_001017963	A8K500|B3KPJ9|Q2PP14|Q5CAQ6|Q5CAQ7|Q9BVQ5	Silent	SNP	ENST00000216281.8	37	CCDS9967.1																																																																																			.		0.408	HSP90AA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414952.2	NM_005348	
GPS1	2873	bcgsc.ca	37	17	80013654	80013654	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr17:80013654G>A	ENST00000306823.6	+	7	822	c.799G>A	c.(799-801)Gcc>Acc	p.A267T	GPS1_ENST00000355130.2_Missense_Mutation_p.A303T|GPS1_ENST00000320548.4_Missense_Mutation_p.A247T|GPS1_ENST00000392358.2_Missense_Mutation_p.A303T|GPS1_ENST00000578552.1_Missense_Mutation_p.A263T			Q13098	CSN1_HUMAN	G protein pathway suppressor 1	267					cell cycle (GO:0007049)|cullin deneddylation (GO:0010388)|inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)			breast(1)|central_nervous_system(1)|endometrium(3)|liver(1)|lung(4)|prostate(1)|skin(2)	13	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0211)			CAAGCAGGCTGCCAAGTGCCT	0.647																																					p.A303T													.	GPS1	30	0			c.G907A						.						22.0	18.0	19.0					17																	80013654		2170	4270	6440	SO:0001583	missense	2873	exon7			CAGGCTGCCAAGT		CCDS11800.1, CCDS32774.1	17q25.3	2013-03-14				ENSG00000169727			4549	protein-coding gene	gene with protein product	"""COP9 signalosome subunit 1"""	601934				9535219	Standard	NM_212492		Approved	COPS1, CSN1	uc002kdl.1	Q13098		ENST00000306823.6:c.799G>A	17.37:g.80013654G>A	ENSP00000302873:p.Ala267Thr	Somatic	27	0		WXS	Illumina HiSeq	Phase_1	15	3	NM_212492	Q8NA10|Q9BWL1	Missense_Mutation	SNP	ENST00000306823.6	37	CCDS32774.1	.	.	.	.	.	.	.	.	.	.	G	35	5.447111	0.96205	.	.	ENSG00000169727	ENST00000392358;ENST00000320548;ENST00000306823;ENST00000355130	T;T;T	0.81415	-0.83;-1.49;-0.83	4.82	4.82	0.62117	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	D	0.92632	0.7659	H	0.94503	3.545	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.87578	0.998;0.993;0.996;0.997;0.995;0.988	D	0.94580	0.7778	10	0.62326	D	0.03	-34.7319	17.8979	0.88895	0.0:0.0:1.0:0.0	.	259;302;252;263;267;303	B4DND6;A8K070;Q13098-6;Q13098-5;Q13098;Q13098-7	.;.;.;.;CSN1_HUMAN;.	T	303;253;267;303	ENSP00000376167:A303T;ENSP00000313569:A253T;ENSP00000347251:A303T	ENSP00000302873:A267T	A	+	1	0	GPS1	77606943	1.000000	0.71417	0.994000	0.49952	0.906000	0.53458	7.303000	0.78871	2.234000	0.73211	0.557000	0.71058	GCC	.		0.647	GPS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442176.1	NM_212492	
HSH2D	84941	bcgsc.ca	37	19	16268483	16268483	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2W-01A-11D-A417-09	TCGA-W5-AA2W-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61c59381-50b9-4496-9009-b4232c3000bf	174984c1-38b2-4073-9373-9e603d987161	g.chr19:16268483G>T	ENST00000253680.6	+	9	1468	c.937G>T	c.(937-939)Gta>Tta	p.V313L	HSH2D_ENST00000588246.1_3'UTR|HSH2D_ENST00000593154.2_3'UTR|HSH2D_ENST00000397372.4_Missense_Mutation_p.V223L			Q96JZ2	HSH2D_HUMAN	hematopoietic SH2 domain containing	313					negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of mitochondrial depolarization (GO:0051902)|positive regulation of signal transduction (GO:0009967)|T cell activation (GO:0042110)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				central_nervous_system(1)|kidney(1)|large_intestine(2)	4						GCACCAAATGGTAGTGAGAGC	0.617																																					p.V313L													.	HSH2D	16	0			c.G937T						.						43.0	50.0	48.0					19																	16268483		2035	4194	6229	SO:0001583	missense	84941	exon9			CAAATGGTAGTGA	AK027792	CCDS74304.1	19p13.12	2013-02-14				ENSG00000196684		"""SH2 domain containing"""	24920	protein-coding gene	gene with protein product		608349				11700021	Standard	NM_032855		Approved	ALX, HSH2, FLJ14886	uc002ndp.4	Q96JZ2		ENST00000253680.6:c.937G>T	19.37:g.16268483G>T	ENSP00000253680:p.Val313Leu	Somatic	58	0		WXS	Illumina HiSeq	Phase_1	45	4	NM_032855	B5ME72|Q6ZNG7	Missense_Mutation	SNP	ENST00000253680.6	37		.	.	.	.	.	.	.	.	.	.	G	11.56	1.675202	0.29783	.	.	ENSG00000196684	ENST00000397372;ENST00000253680	T	0.52754	0.65	3.35	-4.37	0.03633	.	1.612380	0.04031	N	0.301508	T	0.28830	0.0715	.	.	.	0.09310	N	1	B	0.29378	0.243	B	0.22601	0.04	T	0.15607	-1.0431	9	0.72032	D	0.01	.	1.0103	0.01495	0.4096:0.1562:0.2753:0.1589	.	313	Q96JZ2	HSH2D_HUMAN	L	223;313	ENSP00000253680:V313L	ENSP00000253680:V313L	V	+	1	0	HSH2D	16129483	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.683000	0.05179	-0.831000	0.04256	0.561000	0.74099	GTA	.		0.617	HSH2D-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_032855	
