#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVarCov_SOL	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CMBL	134147	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	10290721	10290724	+	Frame_Shift_Del	DEL	ATAT	ATAT	-			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	ATAT	ATAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr5:10290721_10290724delATAT	ENST00000296658.3	-	2	571_574	c.151_154delATAT	c.(151-156)atatttfs	p.IF51fs	Y_RNA_ENST00000516532.1_RNA|CMBL_ENST00000510532.1_5'UTR	NM_138809.3	NP_620164.1	Q96DG6	CMBL_HUMAN	carboxymethylenebutenolidase homolog (Pseudomonas)	51						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(1)|lung(9)|skin(1)|stomach(1)	13						TGCCAGCCAAATATATCTTGAATG	0.417																																					p.51_52del		.											.	.	.	0			c.152_155del						.																																			SO:0001589	frameshift_variant	134147	exon2			AGCCAAATATATC		CCDS3878.1	5p15.2	2010-06-25	2006-09-12		ENSG00000164237	ENSG00000164237	3.1.-.-		25090	protein-coding gene	gene with protein product		613379	"""carboxymethylenebutenolidase-like (Pseudomonas)"""			3804974, 20177059	Standard	NM_138809		Approved	FLJ23617	uc003jes.3	Q96DG6	OTTHUMG00000131043	ENST00000296658.3:c.151_154delATAT	5.37:g.10290721_10290724delATAT	ENSP00000296658:p.Ile51fs	Somatic	37	0		WXS	Illumina HiSeq	.	60	16	NM_138809	D3DTC7|Q8TED6	Frame_Shift_Del	DEL	ENST00000296658.3	37	CCDS3878.1																																																																																			.		0.417	CMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253689.1	NM_138809	
APC	324	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	112175530	112175530	+	Frame_Shift_Del	DEL	G	G	-			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr5:112175530delG	ENST00000457016.1	+	16	4619	c.4239delG	c.(4237-4239)atgfs	p.M1413fs	APC_ENST00000257430.4_Frame_Shift_Del_p.M1413fs|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Frame_Shift_Del_p.M1413fs			P25054	APC_HUMAN	adenomatous polyposis coli	1413	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.V1414fs*9(6)|p.V1414fs*1(6)|p.Y1376fs*41(1)|p.?(1)|p.S1411fs*41(1)|p.M1413fs*5(1)|p.P1409fs*6(1)|p.K1192fs*3(1)|p.V1414fs*3(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GCAGTGGAATGGTAAGTGGCA	0.483		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.M1413fs	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	.	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.,1	.	4158	19	Deletion - Frameshift(12)|Insertion - Frameshift(6)|Unknown(1)	large_intestine(16)|soft_tissue(1)|breast(1)|skin(1)	c.4238delT						.						117.0	107.0	110.0					5																	112175530		2202	4300	6502	SO:0001589	frameshift_variant	324	exon17	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	TGGAATGGTAAGT	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4239delG	5.37:g.112175530delG	ENSP00000413133:p.Met1413fs	Somatic	35	0		WXS	Illumina HiSeq	.	29	18	NM_001127510	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Del	DEL	ENST00000457016.1	37	CCDS4107.1																																																																																			.		0.483	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
STK11	6794	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	1207097	1207098	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr19:1207097_1207098delAG	ENST00000326873.7	+	1	1358_1359	c.185_186delAG	c.(184-186)aagfs	p.K62fs	STK11_ENST00000585748.1_Intron	NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11	62	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.|Sufficient for interaction with SIRT1.				activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.?(3)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		TCTTACGGCAAGGTGAAGGAGG	0.614		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																											p.62_62del		.	yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	serine/threonine kinase 11 gene (LKB1)		"""E, M, O"""	STK11,right_upper_lobe,carcinoma,0,2	STK11	0	23	Whole gene deletion(20)|Unknown(2)|Deletion - Frameshift(1)	cervix(15)|lung(3)|skin(1)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	c.184_185del						.																																			SO:0001589	frameshift_variant	6794	exon1	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	ACGGCAAGGTGAA	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.185_186delAG	19.37:g.1207097_1207098delAG	ENSP00000324856:p.Lys62fs	Somatic	50	0		WXS	Illumina HiSeq	.	39	19	NM_000455	B2RBX7|E7EW76	Frame_Shift_Del	DEL	ENST00000326873.7	37	CCDS45896.1																																																																																			.		0.614	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449839.3	NM_000455	
PSMD2	5708	hgsc.bcm.edu	37	3	184023829	184023846	+	Splice_Site	DEL	ATCTGTCCTGTAGGGAAG	ATCTGTCCTGTAGGGAAG	-			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	ATCTGTCCTGTAGGGAAG	ATCTGTCCTGTAGGGAAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr3:184023829_184023846delATCTGTCCTGTAGGGAAG	ENST00000310118.4	+	14	2260_2265	c.1702_1707delATCTGTCCTGTAGGGAAG	c.(1702-1707)atctgtdel	p.IC568del	EIF2B5_ENST00000444495.1_Intron|PSMD2_ENST00000439383.1_Splice_Site_p.IC438del|PSMD2_ENST00000435761.1_Splice_Site_p.IC409del	NM_002808.3	NP_002799.3	Q13200	PSMD2_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 2	568					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|liver(1)|lung(12)|prostate(3)|upper_aerodigestive_tract(2)	27	all_cancers(143;1.54e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Bortezomib(DB00188)	GACCCCTTGAATCTGTCCTGTAGGGAAGGGTGAGGCCA	0.523											OREG0015947	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.568_569del	Colon(24;313 636 6917 9932 15554)	.											.	.	.	0			c.1703_1706del						.																																			SO:0001630	splice_region_variant	5708	exon14			CCTTGAATCTGTC	AK095245	CCDS3258.1, CCDS63853.1, CCDS63854.1	3q27.3	2008-05-22			ENSG00000175166	ENSG00000175166		"""Proteasome (prosome, macropain) subunits"""	9559	protein-coding gene	gene with protein product		606223				8774743	Standard	NM_002808		Approved	S2, P97, TRAP2, MGC14274, Rpn1	uc003fnn.1	Q13200	OTTHUMG00000156796	ENST00000310118.4:c.1703-1ATCTGTCCTGTAGGGAAG>-	3.37:g.184023829_184023846delATCTGTCCTGTAGGGAAG		Somatic	51	0	1988	WXS	Illumina HiSeq	.	45	6	NM_002808	B4DX07|B4DXY1|E7EW34|E9PCS3|Q12932|Q15321|Q53XQ4|Q96I12	Frame_Shift_Del	DEL	ENST00000310118.4	37	CCDS3258.1																																																																																			.		0.523	PSMD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345843.1	NM_002808	In_Frame_Del
KRTAP4-7	100132476	hgsc.bcm.edu	37	17	39240908	39240908	+	Silent	SNP	T	T	C			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr17:39240908T>C	ENST00000391417.4	+	1	450	c.450T>C	c.(448-450)tgT>tgC	p.C150C		NM_033061.3	NP_149050.3	Q9BYR0	KRA47_HUMAN	keratin associated protein 4-7	205	31 X 5 AA repeats of C-C-[GIKRQVHEML]- [SPTRV]-[STVQRCP].		Missing. {ECO:0000269|PubMed:15955084}.		aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.C150C(1)		NS(1)|endometrium(3)|kidney(1)|lung(1)|prostate(2)|urinary_tract(1)	9						CCTTGTGCTGTGCCTCCTCTT	0.607																																					p.C150C		.											KRTAP4-7,NS,carcinoma,0,2	KRTAP4-7	0	1	Substitution - coding silent(1)	lung(1)	c.T450C						.						90.0	87.0	88.0					17																	39240908		692	1591	2283	SO:0001819	synonymous_variant	100132476	exon1			GTGCTGTGCCTCC	AJ406939	CCDS45673.1	17q21.2	2013-06-25			ENSG00000240871	ENSG00000240871		"""Keratin associated proteins"""	18898	protein-coding gene	gene with protein product						11279113	Standard	NM_033061		Approved	KAP4.7	uc010wfn.2	Q9BYR0	OTTHUMG00000133582	ENST00000391417.4:c.450T>C	17.37:g.39240908T>C		Somatic	58	1		WXS	Illumina HiSeq	.	76	5	NM_033061	A0AVM6|A8MQ08|A8MTL4	Silent	SNP	ENST00000391417.4	37	CCDS45673.1																																																																																			.		0.607	KRTAP4-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257686.1		
HMCN1	83872	hgsc.bcm.edu;bcgsc.ca	37	1	186088384	186088384	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr1:186088384G>T	ENST00000271588.4	+	78	12139	c.11910G>T	c.(11908-11910)agG>agT	p.R3970S	HMCN1_ENST00000367492.2_Missense_Mutation_p.R3970S	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3970	Ig-like C2-type 38.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GTGTCGCTAGGAATGCGGCTG	0.403																																					p.R3970S		.											.	.	.	0			c.G11910T						.						121.0	114.0	117.0					1																	186088384		2203	4300	6503	SO:0001583	missense	83872	exon78			CGCTAGGAATGCG	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.11910G>T	1.37:g.186088384G>T	ENSP00000271588:p.Arg3970Ser	Somatic	61	0		WXS	Illumina HiSeq	.	78	4	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	G	17.34	3.365894	0.61513	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.65732	-0.17;-0.17	5.59	3.7	0.42460	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.207947	0.50627	D	0.000120	T	0.53769	0.1817	N	0.12471	0.22	0.35577	D	0.805973	D	0.65815	0.995	D	0.77004	0.989	T	0.57516	-0.7798	10	0.08381	T	0.77	.	5.7627	0.18209	0.0703:0.251:0.5474:0.1313	.	3970	Q96RW7	HMCN1_HUMAN	S	3970	ENSP00000271588:R3970S;ENSP00000356462:R3970S	ENSP00000271588:R3970S	R	+	3	2	HMCN1	184355007	0.992000	0.36948	0.995000	0.50966	0.850000	0.48378	0.354000	0.20146	0.706000	0.31912	0.585000	0.79938	AGG	.		0.403	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
DCP1B	196513	hgsc.bcm.edu	37	12	2062323	2062323	+	Silent	SNP	T	T	C	rs149912567|rs71057810|rs111543431|rs373461041		TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr12:2062323T>C	ENST00000280665.6	-	7	862	c.783A>G	c.(781-783)caA>caG	p.Q261Q	DCP1B_ENST00000541700.1_5'UTR|DCP1B_ENST00000397173.4_Silent_p.Q159Q|DCP1B_ENST00000540622.1_Silent_p.Q135Q	NM_152640.3	NP_689853.3	Q8IZD4	DCP1B_HUMAN	decapping mRNA 1B	261	Poly-Gln.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)	p.Q261_E262insQ(2)		NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(10)|skin(1)	24			OV - Ovarian serous cystadenocarcinoma(31;0.00193)			GAAGCTTCTCTtgctgctgct	0.557																																					p.Q261Q		.											.,4	.	63	2	Insertion - In frame(2)	breast(1)|kidney(1)	c.A783G						.						38.0	43.0	42.0					12																	2062323		2203	4300	6503	SO:0001819	synonymous_variant	196513	exon7			CTTCTCTTGCTGC	AY146652	CCDS31727.1	12p13.33	2013-05-02	2013-05-02		ENSG00000151065	ENSG00000151065			24451	protein-coding gene	gene with protein product		609843	"""DCP1 decapping enzyme homolog B (S. cerevisiae)"""			12417715, 15067023	Standard	NM_152640		Approved	FLJ31638	uc001qjx.1	Q8IZD4	OTTHUMG00000168113	ENST00000280665.6:c.783A>G	12.37:g.2062323T>C		Somatic	41	0		WXS	Illumina HiSeq	.	35	3	NM_152640	B4DRD1|Q86XH9|Q96BP8|Q96MZ8	Silent	SNP	ENST00000280665.6	37	CCDS31727.1																																																																																			.		0.557	DCP1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398244.1	NM_152640	
TANC1	85461	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	160035180	160035180	+	Silent	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr2:160035180G>A	ENST00000263635.6	+	14	2253	c.2016G>A	c.(2014-2016)caG>caA	p.Q672Q	TANC1_ENST00000454300.1_Silent_p.Q566Q	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	672					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						ACAGCAGCCAGGACATCCTCA	0.562																																					p.Q672Q		.											.	.	.	0			c.G2016A						.						56.0	58.0	58.0					2																	160035180		2173	4259	6432	SO:0001819	synonymous_variant	85461	exon14			CAGCCAGGACATC	AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.2016G>A	2.37:g.160035180G>A		Somatic	36	0		WXS	Illumina HiSeq	.	34	9	NM_033394	C9JD88|Q49AI8	Silent	SNP	ENST00000263635.6	37	CCDS42766.1																																																																																			.		0.562	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333135.1		
AK2	204	hgsc.bcm.edu	37	1	33476435	33476435	+	Splice_Site	SNP	C	C	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr1:33476435C>A	ENST00000373449.2	-	7	736		c.e7-1		AK2_ENST00000491241.1_Splice_Site|AK2_ENST00000467905.1_Splice_Site|AK2_ENST00000548033.1_Splice_Site|RP1-117O3.2_ENST00000427524.1_RNA	NM_001199199.1|NM_013411.4	NP_001186128.1|NP_037543.1			adenylate kinase 2											kidney(1)|large_intestine(2)|lung(4)|skin(1)	8		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				TGATACTAGGCTGAAATAGAG	0.507																																					.		.											.	.	.	0			c.695-1G>T						.						88.0	81.0	83.0					1																	33476435		2203	4300	6503	SO:0001630	splice_region_variant	204	exon8			ACTAGGCTGAAAT	U84371	CCDS373.1, CCDS374.1	1p35.1	2014-09-17			ENSG00000004455	ENSG00000004455	2.7.4.3	"""Adenylate kinases"""	362	protein-coding gene	gene with protein product		103020				8843353, 6961883	Standard	NM_013411		Approved		uc001bwp.2	P54819	OTTHUMG00000004131	ENST00000373449.2:c.695-1G>T	1.37:g.33476435C>A		Somatic	74	0		WXS	Illumina HiSeq	.	70	8	NM_013411		Splice_Site	SNP	ENST00000373449.2	37	CCDS373.1	.	.	.	.	.	.	.	.	.	.	C	19.29	3.798466	0.70567	.	.	ENSG00000004455	ENST00000373449;ENST00000548033	.	.	.	5.15	5.15	0.70609	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8504	0.70292	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	AK2	33249022	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.652000	0.54439	2.780000	0.95670	0.655000	0.94253	.	.		0.507	AK2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011884.1	NM_001625	Intron
ZNF280D	54816	hgsc.bcm.edu	37	15	56959057	56959057	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr15:56959057G>A	ENST00000267807.7	-	15	1889	c.1673C>T	c.(1672-1674)gCa>gTa	p.A558V	ZNF280D_ENST00000559000.1_Missense_Mutation_p.A545V|ZNF280D_ENST00000396245.1_Missense_Mutation_p.A262V|ZNF280D_ENST00000559237.1_Missense_Mutation_p.A545V	NM_017661.2	NP_060131.2	Q6N043	Z280D_HUMAN	zinc finger protein 280D	558					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(4)|large_intestine(7)|lung(12)|ovary(1)|skin(1)	30				all cancers(107;0.0399)|GBM - Glioblastoma multiforme(80;0.0787)		ATTAGATTTTGCAGGATTTTT	0.368																																					p.A558V		.											.	.	.	0			c.C1673T						.						115.0	120.0	119.0					15																	56959057		2191	4292	6483	SO:0001583	missense	54816	exon15			GATTTTGCAGGAT	AB046804	CCDS32245.1, CCDS42041.1, CCDS58364.1	15q21.2	2008-05-02	2007-09-20	2007-09-20					25953	protein-coding gene	gene with protein product			"""suppressor of hairy wing homolog 4 (Drosophila)"""	SUHW4		10997877	Standard	XM_005254481		Approved	FLJ20086, ZNF634	uc002adu.3	Q6N043		ENST00000267807.7:c.1673C>T	15.37:g.56959057G>A	ENSP00000267807:p.Ala558Val	Somatic	44	0		WXS	Illumina HiSeq	.	46	2	NM_017661	A1L495|B2RMT6|Q6MZM6|Q6N085|Q6P2R6|Q7Z6J5|Q9H0U5|Q9HCI8|Q9NXS0	Missense_Mutation	SNP	ENST00000267807.7	37	CCDS32245.1	.	.	.	.	.	.	.	.	.	.	G	2.932	-0.220904	0.06061	.	.	ENSG00000137871	ENST00000267807;ENST00000455329;ENST00000396245	T;T	0.03094	4.05;4.46	5.1	1.85	0.25348	.	9.061880	0.01209	N	0.007794	T	0.01254	0.0041	N	0.00436	-1.5	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.09377	0.004;0.001	T	0.40590	-0.9555	10	0.23891	T	0.37	0.0358	0.8374	0.01142	0.2625:0.1233:0.378:0.2363	.	621;558	B4DHL1;Q6N043	.;Z280D_HUMAN	V	558;545;262	ENSP00000267807:A558V;ENSP00000379545:A262V	ENSP00000267807:A558V	A	-	2	0	ZNF280D	54746349	0.970000	0.33590	0.005000	0.12908	0.196000	0.23810	0.688000	0.25422	0.160000	0.19432	0.591000	0.81541	GCA	.		0.368	ZNF280D-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418891.2	XM_370867	
PER2	8864	hgsc.bcm.edu	37	2	239166978	239166978	+	Silent	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr2:239166978G>T	ENST00000254657.3	-	16	2118	c.1839C>A	c.(1837-1839)gtC>gtA	p.V613V	PER2_ENST00000254658.3_3'UTR|AC096574.4_ENST00000456601.1_RNA	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	613	CSNK1E binding domain. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		TTAGCGCTGGGACGTTTGCTG	0.532																																					p.V613V		.											.	.	.	0			c.C1839A						.						121.0	93.0	102.0					2																	239166978		2203	4300	6503	SO:0001819	synonymous_variant	8864	exon16			CGCTGGGACGTTT	AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.1839C>A	2.37:g.239166978G>T		Somatic	36	0		WXS	Illumina HiSeq	.	50	4	NM_022817	A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Silent	SNP	ENST00000254657.3	37	CCDS2528.1																																																																																			.		0.532	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257167.1	NM_022817	
UBOX5	22888	hgsc.bcm.edu	37	20	3102954	3102954	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr20:3102954C>T	ENST00000217173.2	-	3	802	c.331G>A	c.(331-333)Gac>Aac	p.D111N	UBOX5-AS1_ENST00000446537.1_RNA|UBOX5_ENST00000348031.2_Missense_Mutation_p.D111N	NM_001267584.1|NM_014948.3	NP_001254513.1|NP_055763.1			U-box domain containing 5											endometrium(1)|kidney(2)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)|skin(1)	20						GCCTCCTTGTCTGGGACAGAT	0.572																																					p.D111N		.											UBOX5,right_upper_lobe,carcinoma,0,1	UBOX5	0	0			c.G331A						.						56.0	55.0	55.0					20																	3102954		2203	4300	6503	SO:0001583	missense	22888	exon3			CCTTGTCTGGGAC	AB020667	CCDS13046.1, CCDS13047.1	20p13	2013-01-28			ENSG00000185019	ENSG00000185019		"""RING-type (C3HC4) zinc fingers"", ""U-box domain containing"""	17777	protein-coding gene	gene with protein product						11274149	Standard	NM_014948		Approved	UIP5, KIAA0860, Ubce7ip5, RNF37	uc002whw.4	O94941	OTTHUMG00000031731	ENST00000217173.2:c.331G>A	20.37:g.3102954C>T	ENSP00000217173:p.Asp111Asn	Somatic	29	0		WXS	Illumina HiSeq	.	46	2	NM_014948		Missense_Mutation	SNP	ENST00000217173.2	37	CCDS13046.1	.	.	.	.	.	.	.	.	.	.	C	15.83	2.949873	0.53186	.	.	ENSG00000185019	ENST00000217173;ENST00000348031	T;T	0.35605	1.3;1.3	5.32	4.38	0.52667	.	0.660669	0.14915	U	0.291000	T	0.36220	0.0959	L	0.50919	1.6	0.36742	D	0.882288	B;B;B	0.16802	0.01;0.019;0.01	B;B;B	0.16289	0.011;0.015;0.011	T	0.37911	-0.9685	10	0.87932	D	0	-2.6511	14.1524	0.65395	0.0:0.9274:0.0:0.0726	.	111;111;111	Q53GQ5;Q86X87;O94941	.;.;RNF37_HUMAN	N	111	ENSP00000217173:D111N;ENSP00000311726:D111N	ENSP00000217173:D111N	D	-	1	0	UBOX5	3050954	0.828000	0.29307	0.913000	0.36048	0.906000	0.53458	1.474000	0.35398	1.232000	0.43678	0.563000	0.77884	GAC	.		0.572	UBOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077706.2	NM_014948	
NCOA3	8202	hgsc.bcm.edu	37	20	46279833	46279833	+	Silent	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr20:46279833G>A	ENST00000371998.3	+	20	3950	c.3759G>A	c.(3757-3759)caG>caA	p.Q1253Q	NCOA3_ENST00000341724.6_Silent_p.Q1179Q|NCOA3_ENST00000372004.3_Silent_p.Q1249Q|NCOA3_ENST00000371997.3_Silent_p.Q1244Q			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	1253	Acetyltransferase.|Poly-Gln.				androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						agcagcagcagcaacagcagc	0.547																																					p.Q1253Q		.											NCOA3,NS,carcinoma,0,3	NCOA3	0	0			c.G3759A						.						46.0	53.0	50.0					20																	46279833		2202	4300	6502	SO:0001819	synonymous_variant	8202	exon20			GCAGCAGCAACAG	AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.3759G>A	20.37:g.46279833G>A		Somatic	31	1		WXS	Illumina HiSeq	.	31	2	NM_181659	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Silent	SNP	ENST00000371998.3	37	CCDS13407.1																																																																																			.		0.547	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080405.1	NM_006534	
TRO	7216	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	X	54950954	54950954	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chrX:54950954C>T	ENST00000173898.7	+	4	1419	c.1307C>T	c.(1306-1308)gCa>gTa	p.A436V	TRO_ENST00000420798.2_5'UTR|TRO_ENST00000375022.4_Missense_Mutation_p.A436V|TRO_ENST00000375041.2_Missense_Mutation_p.A39V|TRO_ENST00000399736.1_Missense_Mutation_p.A39V|SNORA11_ENST00000408823.1_RNA|TRO_ENST00000484031.1_3'UTR|TRO_ENST00000319167.8_Missense_Mutation_p.A436V	NM_001039705.2	NP_001034794.1	Q12816	TROP_HUMAN	trophinin	436					embryo implantation (GO:0007566)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|skin(2)|urinary_tract(1)	37						CGGAGGCCTGCACCACCGCGA	0.512																																					p.A436V		.											.	.	.	0			c.C1307T						.						53.0	50.0	51.0					X																	54950954		2011	4164	6175	SO:0001583	missense	7216	exon4			GGCCTGCACCACC	U04811	CCDS43958.1, CCDS43959.1, CCDS59527.1, CCDS59528.1, CCDS59529.1	Xp11.22-p11.21	2008-02-05			ENSG00000067445	ENSG00000067445			12326	protein-coding gene	gene with protein product		300132				9533028, 11454705	Standard	NM_001039705		Approved	MAGE-D3, KIAA1114, MAGED3	uc004dtq.4	Q12816	OTTHUMG00000021640	ENST00000173898.7:c.1307C>T	X.37:g.54950954C>T	ENSP00000173898:p.Ala436Val	Somatic	27	0		WXS	Illumina HiSeq	.	42	4	NM_016157	B1AKE9|B1AKF1|F5GY27|Q96SX2|Q9NU89|Q9UPN8	Missense_Mutation	SNP	ENST00000173898.7	37	CCDS43959.1	.	.	.	.	.	.	.	.	.	.	C	0.597	-0.830626	0.02734	.	.	ENSG00000067445	ENST00000173898;ENST00000319167;ENST00000375022;ENST00000399736;ENST00000319179;ENST00000431115;ENST00000375041	T;T;T;T;T;T	0.16597	4.06;3.76;3.76;3.48;2.33;3.66	2.65	0.829	0.18847	.	.	.	.	.	T	0.06554	0.0168	N	0.03608	-0.345	0.09310	N	0.999995	B;B;B;B	0.17268	0.012;0.001;0.021;0.021	B;B;B;B	0.17979	0.005;0.002;0.02;0.005	T	0.33675	-0.9859	9	0.62326	D	0.03	.	2.346	0.04271	0.2396:0.4607:0.0:0.2997	.	39;39;436;436	B1AKE9;B1AKF1;Q96SX2;Q12816	.;.;.;TROP_HUMAN	V	436;436;436;39;39;39;39	ENSP00000173898:A436V;ENSP00000318278:A436V;ENSP00000364162:A436V;ENSP00000382641:A39V;ENSP00000407996:A39V;ENSP00000364181:A39V	ENSP00000173898:A436V	A	+	2	0	TRO	54967679	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.102000	0.10956	0.091000	0.17302	0.422000	0.28245	GCA	.		0.512	TRO-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056837.3	NM_016157	
DNAH8	1769	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	38816516	38816516	+	Missense_Mutation	SNP	A	A	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr6:38816516A>T	ENST00000359357.3	+	35	4741	c.4487A>T	c.(4486-4488)aAc>aTc	p.N1496I	DNAH8_ENST00000441566.1_Missense_Mutation_p.N1496I|DNAH8_ENST00000449981.2_Missense_Mutation_p.N1713I			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	1496					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						GTAGTACAGAACCTTTGGGTT	0.358																																					p.N1713I		.											.	.	.	0			c.A5138T						.						81.0	88.0	86.0					6																	38816516		2203	4300	6503	SO:0001583	missense	1769	exon37			TACAGAACCTTTG	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.4487A>T	6.37:g.38816516A>T	ENSP00000352312:p.Asn1496Ile	Somatic	63	0		WXS	Illumina HiSeq	.	65	30	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	37		.	.	.	.	.	.	.	.	.	.	A	27.6	4.845616	0.91197	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.61392	0.11;0.11;0.11	5.78	5.78	0.91487	Dynein heavy chain, domain-2 (1);	0.105827	0.64402	D	0.000012	T	0.77751	0.4177	M	0.91406	3.205	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82808	-0.0274	10	0.59425	D	0.04	.	16.1138	0.81283	1.0:0.0:0.0:0.0	.	1496	Q96JB1	DYH8_HUMAN	I	1701;1701;1496;1496	ENSP00000333363:N1701I;ENSP00000352312:N1496I;ENSP00000402294:N1496I	ENSP00000333363:N1701I	N	+	2	0	DNAH8	38924494	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	9.122000	0.94380	2.220000	0.72140	0.533000	0.62120	AAC	.		0.358	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
DENND5A	23258	hgsc.bcm.edu;bcgsc.ca	37	11	9192183	9192183	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr11:9192183G>A	ENST00000328194.3	-	9	2368	c.2048C>T	c.(2047-2049)gCc>gTc	p.A683V	DENND5A_ENST00000527700.1_Missense_Mutation_p.A26V|DENND5A_ENST00000530044.1_Missense_Mutation_p.A683V	NM_001243254.1|NM_015213.3	NP_001230183.1|NP_056028.2	Q6IQ26	DEN5A_HUMAN	DENN/MADD domain containing 5A	683					positive regulation of Rab GTPase activity (GO:0032851)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(7)|kidney(2)|large_intestine(8)|liver(1)|lung(16)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						CTTGTTGCTGGCTGGCCCAGT	0.493																																					p.A683V		.											.	.	.	0			c.C2048T						.						139.0	136.0	137.0					11																	9192183		2201	4296	6497	SO:0001583	missense	23258	exon9			TTGCTGGCTGGCC	AB029014	CCDS31423.1, CCDS58119.1	11p15.3	2012-10-03	2008-08-14	2008-08-14	ENSG00000184014	ENSG00000184014		"""DENN/MADD domain containing"""	19344	protein-coding gene	gene with protein product			"""RAB6 interacting protein 1"""	RAB6IP1		10470851	Standard	NM_015213		Approved	KIAA1091, FLJ22354, FLJ33829, FLJ43455	uc001mhl.3	Q6IQ26	OTTHUMG00000165716	ENST00000328194.3:c.2048C>T	11.37:g.9192183G>A	ENSP00000328524:p.Ala683Val	Somatic	53	0		WXS	Illumina HiSeq	.	66	4	NM_015213	B4DJ15|E9PS91|Q96GN3|Q9H6U7|Q9UFV0|Q9UPR1	Missense_Mutation	SNP	ENST00000328194.3	37	CCDS31423.1	.	.	.	.	.	.	.	.	.	.	G	15.85	2.955197	0.53293	.	.	ENSG00000184014	ENST00000328194;ENST00000530044;ENST00000527700	T;T;T	0.17528	3.76;3.75;2.27	5.7	3.28	0.37604	.	0.267047	0.42964	N	0.000629	T	0.09202	0.0227	N	0.08118	0	0.49798	D	0.999825	B;B	0.20164	0.012;0.042	B;B	0.29524	0.011;0.103	T	0.19257	-1.0311	10	0.15499	T	0.54	.	11.8719	0.52525	0.136:0.0:0.864:0.0	.	683;683	E9PS91;Q6IQ26	.;DEN5A_HUMAN	V	683;683;26	ENSP00000328524:A683V;ENSP00000435866:A683V;ENSP00000432549:A26V	ENSP00000328524:A683V	A	-	2	0	DENND5A	9148759	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.431000	0.59915	1.269000	0.44280	0.561000	0.74099	GCC	.		0.493	DENND5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385910.2	NM_015213	
IVL	3713	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	152883128	152883128	+	Nonsense_Mutation	SNP	C	C	G			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr1:152883128C>G	ENST00000368764.3	+	2	919	c.855C>G	c.(853-855)taC>taG	p.Y285*	IVL_ENST00000392667.2_Nonsense_Mutation_p.Y139*			P07476	INVO_HUMAN	involucrin	285	39 X 10 AA approximate tandem repeats of [LP]-[EKG]-[LHVYQEK]-[PLSQE]-[EQDV]- [QHEKRGA]-Q-[EMVQLP]-[GKLE]-[QHVNLD].				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			AGCTGAAGTACCTGGAACAGC	0.632																																					p.Y285X		.											IVL,NS,carcinoma,0,1	IVL	0	0			c.C855G						.						18.0	17.0	18.0					1																	152883128		2050	4008	6058	SO:0001587	stop_gained	3713	exon2			GAAGTACCTGGAA	BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.855C>G	1.37:g.152883128C>G	ENSP00000357753:p.Tyr285*	Somatic	61	0		WXS	Illumina HiSeq	.	65	19	NM_005547	Q5T7P4	Nonsense_Mutation	SNP	ENST00000368764.3	37	CCDS1030.1	.	.	.	.	.	.	.	.	.	.	c	11.58	1.680819	0.29872	.	.	ENSG00000163207	ENST00000368764;ENST00000392667	.	.	.	3.4	-6.8	0.01709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	.	5.1268	0.14888	0.0834:0.4886:0.1325:0.2955	.	.	.	.	X	285;139	.	ENSP00000357753:Y285X	Y	+	3	2	IVL	151149752	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-2.797000	0.00763	-3.674000	0.00123	-1.050000	0.02344	TAC	.		0.632	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034664.1	NM_005547	
DPP3	10072	hgsc.bcm.edu;broad.mit.edu	37	11	66258758	66258758	+	Silent	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr11:66258758G>A	ENST00000360510.2	+	7	767	c.702G>A	c.(700-702)ctG>ctA	p.L234L	DPP3_ENST00000532677.1_Silent_p.L253L|DPP3_ENST00000541961.1_Silent_p.L234L|DPP3_ENST00000453114.1_Silent_p.L234L|DPP3_ENST00000530165.1_Silent_p.L204L|DPP3_ENST00000531863.1_Silent_p.L254L			Q9NY33	DPP3_HUMAN	dipeptidyl-peptidase 3	234					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)	23						CTTCCAAGCTGAAGAGCTATG	0.562											OREG0021109	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L234L		.											.	.	.	0			c.G702A						.						72.0	78.0	76.0					11																	66258758		2200	4295	6495	SO:0001819	synonymous_variant	10072	exon7			CAAGCTGAAGAGC	AB017970	CCDS8141.1, CCDS58147.1	11q12-q13.1	2008-02-05	2006-01-12		ENSG00000254986	ENSG00000254986	3.4.14.4		3008	protein-coding gene	gene with protein product		606818	"""dipeptidylpeptidase III"", ""dipeptidylpeptidase 3"""			10773679	Standard	NM_005700		Approved		uc001oif.2	Q9NY33	OTTHUMG00000167143	ENST00000360510.2:c.702G>A	11.37:g.66258758G>A		Somatic	17	0	1090	WXS	Illumina HiSeq	.	80	8	NM_130443	B2RDB5|B4DLX4|F5H8L6|O95748|Q969H2|Q9BV67|Q9HAL6	Silent	SNP	ENST00000360510.2	37	CCDS8141.1																																																																																			.		0.562	DPP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393424.2		
SYNJ1	8867	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	34060664	34060664	+	Missense_Mutation	SNP	C	C	T	rs201796096		TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr21:34060664C>T	ENST00000322229.7	-	6	802	c.803G>A	c.(802-804)cGt>cAt	p.R268H	SYNJ1_ENST00000357345.3_Missense_Mutation_p.R268H|SYNJ1_ENST00000433931.2_Missense_Mutation_p.R307H|SYNJ1_ENST00000382499.2_Missense_Mutation_p.R307H|SYNJ1_ENST00000382491.3_Missense_Mutation_p.R268H			O43426	SYNJ1_HUMAN	synaptojanin 1	268	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				cell death (GO:0008219)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of synaptic vesicle uncoating (GO:1903390)|regulation of synaptic vesicle membrane organization (GO:1901632)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)	cytosol (GO:0005829)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|lung(11)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	57						CATACGGACACGATGAGATCC	0.348																																					p.R307H		.											.	.	.	0			c.G920A						.						79.0	66.0	70.0					21																	34060664		2203	4300	6503	SO:0001583	missense	8867	exon7			CGGACACGATGAG	AF009040	CCDS33539.1, CCDS33540.1, CCDS33539.2, CCDS33540.2, CCDS54483.1	21q22.2	2008-06-23			ENSG00000159082	ENSG00000159082			11503	protein-coding gene	gene with protein product		604297				9428629, 10773674	Standard	NM_203446		Approved	INPP5G	uc002yqh.2	O43426	OTTHUMG00000064926	ENST00000322229.7:c.803G>A	21.37:g.34060664C>T	ENSP00000322234:p.Arg268His	Somatic	39	0		WXS	Illumina HiSeq	.	36	24	NM_203446	O43425|O94984|Q4KMR1	Missense_Mutation	SNP	ENST00000322229.7	37	CCDS54484.1	.	.	.	.	.	.	.	.	.	.	C	18.67	3.674236	0.67928	.	.	ENSG00000159082	ENST00000382491;ENST00000357345;ENST00000382499;ENST00000433931;ENST00000322229;ENST00000429236	T;T;T;T;T;T	0.57752	0.38;0.38;0.38;0.38;0.38;0.38	6.16	6.16	0.99307	Synaptojanin, N-terminal (2);	0.089655	0.85682	D	0.000000	T	0.63827	0.2544	L	0.37897	1.145	0.80722	D	1	D;P;D;P;D	0.89917	1.0;0.555;1.0;0.796;1.0	D;B;D;B;D	0.76071	0.98;0.252;0.984;0.362;0.987	T	0.51180	-0.8738	10	0.11794	T	0.64	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	268;307;268;268;268	B9EGN3;C9JFZ1;O43426-2;O43426;O43426-4	.;.;.;SYNJ1_HUMAN;.	H	268;268;307;307;268;268	ENSP00000371931:R268H;ENSP00000349903:R268H;ENSP00000371939:R307H;ENSP00000409667:R307H;ENSP00000322234:R268H;ENSP00000413649:R268H	ENSP00000322234:R268H	R	-	2	0	SYNJ1	32982535	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.193000	0.77780	2.937000	0.99478	0.650000	0.86243	CGT	0.001		0.348	SYNJ1-201	KNOWN	basic|CCDS	protein_coding	protein_coding			
ST6GALNAC5	81849	hgsc.bcm.edu	37	1	77334298	77334298	+	Silent	SNP	G	G	A	rs554217920	byFrequency	TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr1:77334298G>A	ENST00000477717.1	+	2	367	c.132G>A	c.(130-132)caG>caA	p.Q44Q	ST6GALNAC5_ENST00000496845.1_3'UTR	NM_030965.1	NP_112227.1	Q9BVH7	SIA7E_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5	44	Poly-Gln.				glycosphingolipid biosynthetic process (GO:0006688)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	18						agcagcagcagcaacagcagc	0.711													G|||	2	0.000399361	0.0	0.0	5008	,	,		11676	0.002		0.0	False		,,,				2504	0.0				p.Q44Q		.											ST6GALNAC5,rectum,carcinoma,0,1	ST6GALNAC5	0	0			c.G132A						.						12.0	12.0	12.0					1																	77334298		2054	3972	6026	SO:0001819	synonymous_variant	81849	exon2			GCAGCAGCAACAG		CCDS673.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000117069	ENSG00000117069		"""Sialyltransferases"""	19342	protein-coding gene	gene with protein product		610134	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) E"""	SIAT7E		10521438, 10601645	Standard	NM_030965		Approved	MGC3184, ST6GalNAcV	uc001dhi.3	Q9BVH7	OTTHUMG00000009687	ENST00000477717.1:c.132G>A	1.37:g.77334298G>A		Somatic	39	2		WXS	Illumina HiSeq	.	31	6	NM_030965	B1AK82	Silent	SNP	ENST00000477717.1	37	CCDS673.1																																																																																			.		0.711	ST6GALNAC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026692.2	NM_030965	
NUFIP2	57532	hgsc.bcm.edu;bcgsc.ca	37	17	27614321	27614321	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr17:27614321C>T	ENST00000225388.4	-	2	749	c.691G>A	c.(691-693)Gcc>Acc	p.A231T	NUFIP2_ENST00000579665.1_Intron	NM_020772.2	NP_065823.1	Q7Z417	NUFP2_HUMAN	nuclear fragile X mental retardation protein interacting protein 2	231						cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|prostate(2)|skin(4)|urinary_tract(1)	24			BRCA - Breast invasive adenocarcinoma(11;0.000457)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)			CAACCCTTGGCACTATTGCGC	0.398																																					p.A231T		.											.	.	.	0			c.G691A						.						146.0	145.0	145.0					17																	27614321		2203	4300	6503	SO:0001583	missense	57532	exon2			CCTTGGCACTATT	AB037742	CCDS32600.1	17q11.1	2006-03-01				ENSG00000108256			17634	protein-coding gene	gene with protein product		609356				12837692, 16407062	Standard	NM_020772		Approved	KIAA1321, MGC117262, PIG1, 182-FIP, FIP-82, 82-FIP	uc002hdy.4	Q7Z417		ENST00000225388.4:c.691G>A	17.37:g.27614321C>T	ENSP00000225388:p.Ala231Thr	Somatic	36	0		WXS	Illumina HiSeq	.	35	4	NM_020772	A1L3A6|Q9P2M5	Missense_Mutation	SNP	ENST00000225388.4	37	CCDS32600.1	.	.	.	.	.	.	.	.	.	.	C	16.16	3.043888	0.55110	.	.	ENSG00000108256	ENST00000225388	.	.	.	6.17	4.16	0.48862	.	0.068189	0.64402	N	0.000010	T	0.42988	0.1227	L	0.29908	0.895	0.80722	D	1	B	0.09022	0.002	B	0.10450	0.005	T	0.27191	-1.0081	9	0.45353	T	0.12	-1.0097	8.3518	0.32307	0.1287:0.7399:0.0:0.1315	.	231	Q7Z417	NUFP2_HUMAN	T	231	.	ENSP00000225388:A231T	A	-	1	0	NUFIP2	24638447	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.627000	0.37050	0.895000	0.36342	0.655000	0.94253	GCC	.		0.398	NUFIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447015.2	NM_020772	
NPR2	4882	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	35802530	35802530	+	Missense_Mutation	SNP	C	C	T	rs374250772		TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr9:35802530C>T	ENST00000342694.2	+	11	1996	c.1741C>T	c.(1741-1743)Cgc>Tgc	p.R581C		NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2	581	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	CCATCTCACTCGCTTCATTGG	0.413																																					p.R581C		.											.	.	.	0			c.C1741T						.	C	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	118.0	108.0	111.0		1741	5.5	1.0	9		111	0,8600		0,0,4300	no	missense	NPR2	NM_003995.3	180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	581/1048	35802530	1,13005	2203	4300	6503	SO:0001583	missense	4882	exon11			CTCACTCGCTTCA	AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871	ENST00000342694.2:c.1741C>T	9.37:g.35802530C>T	ENSP00000341083:p.Arg581Cys	Somatic	15	0		WXS	Illumina HiSeq	.	15	5	NM_003995	B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Missense_Mutation	SNP	ENST00000342694.2	37	CCDS6590.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.265059	0.80358	2.27E-4	0.0	ENSG00000159899	ENST00000342694	T	0.65364	-0.15	5.54	5.54	0.83059	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.44688	D	0.000421	D	0.82549	0.5061	M	0.86953	2.85	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.985	D	0.84847	0.0811	10	0.72032	D	0.01	.	18.4185	0.90579	0.0:1.0:0.0:0.0	.	581;581	P20594-2;P20594	.;ANPRB_HUMAN	C	581	ENSP00000341083:R581C	ENSP00000341083:R581C	R	+	1	0	NPR2	35792530	0.940000	0.31905	1.000000	0.80357	0.997000	0.91878	1.227000	0.32576	2.779000	0.95612	0.655000	0.94253	CGC	.		0.413	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052345.1		
FAM208A	23272	hgsc.bcm.edu	37	3	56695042	56695042	+	Silent	SNP	A	A	G			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr3:56695042A>G	ENST00000493960.2	-	10	1174	c.1164T>C	c.(1162-1164)ccT>ccC	p.P388P	FAM208A_ENST00000355628.5_Silent_p.P388P|FAM208A_ENST00000431842.2_5'UTR	NM_001112736.1	NP_001106207.1	Q9UK61	F208A_HUMAN	family with sequence similarity 208, member A	388							poly(A) RNA binding (GO:0044822)	p.P388P(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(11)|prostate(3)|skin(1)	32						CTAATTTCTCAGGTCTGAAAG	0.313																																					p.P388P		.											FAM208A,NS,carcinoma,0,1	FAM208A	0	1	Substitution - coding silent(1)	lung(1)	c.T1164C						.						70.0	69.0	69.0					3																	56695042		2202	4294	6496	SO:0001819	synonymous_variant	23272	exon10			TTTCTCAGGTCTG	AF180425	CCDS2877.1, CCDS46853.1	3p14.3	2011-09-14	2011-09-14	2011-09-14	ENSG00000163946	ENSG00000163946			30314	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 63"""	C3orf63		10470851, 11149944	Standard	NM_015224		Approved	se89-1, RAP140, KIAA1105	uc003die.4	Q9UK61	OTTHUMG00000158827	ENST00000493960.2:c.1164T>C	3.37:g.56695042A>G		Somatic	16	0		WXS	Illumina HiSeq	.	38	2	NM_001112736	A1L3A4|B5ME28|Q9H2F7|Q9UPP7	Silent	SNP	ENST00000493960.2	37	CCDS46853.1																																																																																			.		0.313	FAM208A-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352352.2	NM_015224	
ESR2	2100	hgsc.bcm.edu	37	14	64749427	64749427	+	Missense_Mutation	SNP	G	G	T	rs147382781		TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr14:64749427G>T	ENST00000341099.4	-	2	694	c.277C>A	c.(277-279)Cgc>Agc	p.R93S	ESR2_ENST00000267525.6_Missense_Mutation_p.R93S|ESR2_ENST00000553796.1_Missense_Mutation_p.R93S|ESR2_ENST00000557772.1_Missense_Mutation_p.R93S|ESR2_ENST00000357782.2_Missense_Mutation_p.R93S|ESR2_ENST00000358599.5_Missense_Mutation_p.R93S|ESR2_ENST00000353772.3_Missense_Mutation_p.R93S|ESR2_ENST00000555483.1_5'UTR|ESR2_ENST00000554572.1_Missense_Mutation_p.R93S|ESR2_ENST00000555278.1_Missense_Mutation_p.R93S|ESR2_ENST00000542956.1_Missense_Mutation_p.R93S	NM_001437.2	NP_001428.1	Q92731	ESR2_HUMAN	estrogen receptor 2 (ER beta)	93	Modulating.				brain development (GO:0007420)|cell-cell signaling (GO:0007267)|epithelial cell maturation involved in prostate gland development (GO:0060743)|extracellular negative regulation of signal transduction (GO:1900116)|gene expression (GO:0010467)|hormone-mediated apoptotic signaling pathway (GO:0008628)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|ovarian follicle development (GO:0001541)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|uterus development (GO:0060065)|vagina development (GO:0060068)	extracellular region (GO:0005576)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|estrogen receptor activity (GO:0030284)|estrogen response element binding (GO:0034056)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor antagonist activity (GO:0048019)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	23				all cancers(60;0.00916)|OV - Ovarian serous cystadenocarcinoma(108;0.0111)|BRCA - Breast invasive adenocarcinoma(234;0.0437)	Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estropipate(DB04574)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Trilostane(DB01108)	GATAACTGGCGATGGACCACT	0.507																																					p.R93S		.											ESR2_ENST00000554572,mucosal,malignant_melanoma,0,2	ESR2_ENST00000554572	0	0			c.C277A						.						101.0	96.0	98.0					14																	64749427		2203	4300	6503	SO:0001583	missense	2100	exon1			ACTGGCGATGGAC	X99101	CCDS9762.1, CCDS32096.1, CCDS55920.1, CCDS61469.1, CCDS61470.1	14q21-q22	2013-01-16			ENSG00000140009	ENSG00000140009		"""Nuclear hormone receptors"""	3468	protein-coding gene	gene with protein product		601663				8769313	Standard	NM_001214902		Approved	NR3A2, Erb	uc001xha.1	Q92731	OTTHUMG00000141306	ENST00000341099.4:c.277C>A	14.37:g.64749427G>T	ENSP00000343925:p.Arg93Ser	Somatic	32	0		WXS	Illumina HiSeq	.	35	2	NM_001214902	A8K8K5|G3V5M5|O60608|O60685|O60702|O60703|O75583|O75584|Q0MWT5|Q0MWT6|Q86Z31|Q9UEV6|Q9UHD3|Q9UQK9	Missense_Mutation	SNP	ENST00000341099.4	37	CCDS9762.1	.	.	.	.	.	.	.	.	.	.	G	2.354	-0.348106	0.05208	.	.	ENSG00000140009	ENST00000556275;ENST00000542956;ENST00000554572;ENST00000353772;ENST00000358599;ENST00000555278;ENST00000553796;ENST00000357782;ENST00000557772;ENST00000341099;ENST00000267525	D;D;D;D;D;D;D;D;D;D;D	0.89939	-2.58;-2.53;-2.52;-2.52;-2.52;-2.59;-2.59;-2.59;-2.59;-2.42;-2.13	5.56	3.24	0.37175	Estrogen receptor beta, N-terminal (1);	0.372430	0.32386	N	0.006163	T	0.80171	0.4574	L	0.29908	0.895	0.22701	N	0.998833	B;B;B;B;B	0.32693	0.38;0.001;0.035;0.011;0.012	B;B;B;B;B	0.32533	0.147;0.008;0.029;0.068;0.049	T	0.64931	-0.6291	10	0.20046	T	0.44	.	9.3477	0.38118	0.8518:0.0:0.1482:0.0	.	93;93;93;93;93	Q92731-7;Q92731;Q92731-6;Q92731-5;F1D8N3	.;ESR2_HUMAN;.;.;.	S	93	ENSP00000452485:R93S;ENSP00000441792:R93S;ENSP00000450699:R93S;ENSP00000335551:R93S;ENSP00000351412:R93S;ENSP00000450488:R93S;ENSP00000452426:R93S;ENSP00000350427:R93S;ENSP00000451582:R93S;ENSP00000343925:R93S;ENSP00000267525:R93S	ENSP00000267525:R93S	R	-	1	0	ESR2	63819180	1.000000	0.71417	0.152000	0.22495	0.011000	0.07611	2.814000	0.48010	0.413000	0.25759	-0.471000	0.05019	CGC	.		0.507	ESR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280621.1		
CTNNA2	1496	hgsc.bcm.edu	37	2	80874884	80874884	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr2:80874884G>T	ENST00000402739.4	+	18	2754	c.2749G>T	c.(2749-2751)Gtg>Ttg	p.V917L	CTNNA2_ENST00000343114.3_Missense_Mutation_p.V548L|CTNNA2_ENST00000540488.1_Missense_Mutation_p.V824L|CTNNA2_ENST00000496558.1_Missense_Mutation_p.V869L|CTNNA2_ENST00000361291.4_Missense_Mutation_p.V903L|CTNNA2_ENST00000541047.1_Missense_Mutation_p.V869L|CTNNA2_ENST00000466387.1_Missense_Mutation_p.V869L	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	917					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)	p.V869L(1)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						GAAGCCCCTTGTGAAGAGAGA	0.463																																					p.V869L		.											CTNNA2_ENST00000466387,NS,carcinoma,0,1	CTNNA2_ENST00000466387	0	1	Substitution - Missense(1)	endometrium(1)	c.G2605T						.						150.0	150.0	150.0					2																	80874884		1870	4115	5985	SO:0001583	missense	1496	exon18			CCCCTTGTGAAGA		CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.2749G>T	2.37:g.80874884G>T	ENSP00000384638:p.Val917Leu	Somatic	40	0		WXS	Illumina HiSeq	.	49	2	NM_004389	B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	ENST00000402739.4	37		.	.	.	.	.	.	.	.	.	.	G	29.1	4.975047	0.92919	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488;ENST00000343114	T;T;T;T;T;T;T	0.54675	0.94;0.94;0.9;0.56;0.94;0.61;2.12	5.94	5.94	0.96194	.	0.000000	0.64402	D	0.000001	T	0.66167	0.2762	M	0.69823	2.125	0.80722	D	1	D;D;P;P	0.56968	0.964;0.978;0.866;0.92	P;P;P;P	0.52189	0.692;0.53;0.461;0.615	T	0.64266	-0.6448	9	.	.	.	.	20.3658	0.98878	0.0:0.0:1.0:0.0	.	501;917;824;869	F6KRI5;P26232;P26232-3;P26232-2	.;CTNA2_HUMAN;.;.	L	869;869;903;917;869;824;548	ENSP00000418191:V869L;ENSP00000419295:V869L;ENSP00000355398:V903L;ENSP00000384638:V917L;ENSP00000444675:V869L;ENSP00000441705:V824L;ENSP00000341500:V548L	.	V	+	1	0	CTNNA2	80728395	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.869000	0.99810	2.820000	0.97059	0.650000	0.86243	GTG	.		0.463	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000328511.4	NM_004389	
NOM1	64434	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	156743095	156743095	+	Missense_Mutation	SNP	G	G	C			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr7:156743095G>C	ENST00000275820.3	+	1	679	c.664G>C	c.(664-666)Gcc>Ccc	p.A222P		NM_138400.1	NP_612409.1	Q5C9Z4	NOM1_HUMAN	nucleolar protein with MIF4G domain 1	222	Necessary for nucleolar localization and for targeting PPP1CA to the nucleolus.					nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(4)|large_intestine(9)|lung(7)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	31	Ovarian(565;0.218)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		TATTCTGGGAGCCCTGGAGTC	0.562																																					p.A222P		.											.	.	.	0			c.G664C						.						89.0	99.0	95.0					7																	156743095		2203	4300	6503	SO:0001583	missense	64434	exon1			CTGGGAGCCCTGG	AF107455	CCDS34787.1	7q36.3	2014-06-13	2005-03-30	2005-03-30	ENSG00000146909	ENSG00000146909			13244	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 113"""	611269	"""chromosome 7 open reading frame 3"""	C7orf3		10329000	Standard	XM_005249560		Approved	SGD1, PPP1R113	uc003wmy.3	Q5C9Z4	OTTHUMG00000152639	ENST00000275820.3:c.664G>C	7.37:g.156743095G>C	ENSP00000275820:p.Ala222Pro	Somatic	48	0		WXS	Illumina HiSeq	.	48	27	NM_138400	Q96I08	Missense_Mutation	SNP	ENST00000275820.3	37	CCDS34787.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.327321	0.81690	.	.	ENSG00000146909	ENST00000275820	T	0.12465	2.68	4.19	4.19	0.49359	.	0.411925	0.22451	N	0.059889	T	0.25494	0.0620	L	0.48642	1.525	0.32178	N	0.580673	D	0.71674	0.998	P	0.62014	0.897	T	0.09143	-1.0688	10	0.36615	T	0.2	-13.6968	12.6477	0.56744	0.0:0.1664:0.8336:0.0	.	222	Q5C9Z4	NOM1_HUMAN	P	222	ENSP00000275820:A222P	ENSP00000275820:A222P	A	+	1	0	NOM1	156435856	1.000000	0.71417	0.890000	0.34922	0.986000	0.74619	4.235000	0.58666	2.154000	0.67381	0.650000	0.86243	GCC	.		0.562	NOM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327098.1	NM_138400	
OR10G9	219870	hgsc.bcm.edu	37	11	123893737	123893737	+	Silent	SNP	C	C	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr11:123893737C>A	ENST00000375024.1	+	1	18	c.18C>A	c.(16-18)ctC>ctA	p.L6L		NM_001001953.1	NP_001001953.1	Q8NGN4	O10G9_HUMAN	olfactory receptor, family 10, subfamily G, member 9	6						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L6L(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(33)|prostate(2)|skin(4)|stomach(8)|urinary_tract(1)	61		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		AGACCAGCCTCGTGACAGCGT	0.532																																					p.L6L		.											OR10G9,NS,carcinoma,0,1	OR10G9	0	1	Substitution - coding silent(1)	lung(1)	c.C18A						.						154.0	147.0	150.0					11																	123893737		2201	4299	6500	SO:0001819	synonymous_variant	219870	exon1			CAGCCTCGTGACA	AB065756	CCDS31703.1	11q24.1	2012-08-09			ENSG00000236981	ENSG00000236981		"""GPCR / Class A : Olfactory receptors"""	15129	protein-coding gene	gene with protein product				OR10G10P			Standard	NM_001001953		Approved		uc010sad.2	Q8NGN4	OTTHUMG00000165967	ENST00000375024.1:c.18C>A	11.37:g.123893737C>A		Somatic	64	1		WXS	Illumina HiSeq	.	40	4	NM_001001953		Silent	SNP	ENST00000375024.1	37	CCDS31703.1																																																																																			.		0.532	OR10G9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387269.1	NM_001001953	
GNAO1	2775	hgsc.bcm.edu;bcgsc.ca	37	16	56377816	56377816	+	Intron	SNP	C	C	T	rs200947037		TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr16:56377816C>T	ENST00000262493.6	+	6	1569				GNAO1_ENST00000262494.7_Missense_Mutation_p.T340M	NM_020988.2	NP_066268.1	P09471	GNAO_HUMAN	guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O						adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|dopamine receptor signaling pathway (GO:0007212)|forebrain development (GO:0030900)|locomotory behavior (GO:0007626)|muscle contraction (GO:0006936)|negative regulation of calcium ion transport (GO:0051926)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|regulation of heart contraction (GO:0008016)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to morphine (GO:0043278)	heterotrimeric G-protein complex (GO:0005834)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	corticotropin-releasing hormone receptor 1 binding (GO:0051430)|G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|mu-type opioid receptor binding (GO:0031852)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(4)|prostate(1)	17		all_neural(199;0.159)				GATGCTGTGACGGACGTCATC	0.612																																					p.T340M		.											GNAO1_ENST00000262494,lower_third,carcinoma,0,1	GNAO1_ENST00000262494	0	0			c.C1019T						.						178.0	121.0	140.0					16																	56377816		2198	4300	6498	SO:0001627	intron_variant	2775	exon8			CTGTGACGGACGT		CCDS10756.1, CCDS10757.1	16q13	2008-08-01			ENSG00000087258	ENSG00000087258			4389	protein-coding gene	gene with protein product		139311				1899283, 11395521	Standard	NM_020988		Approved	G-ALPHA-o	uc002eit.4	P09471	OTTHUMG00000133241	ENST00000262493.6:c.723+7044C>T	16.37:g.56377816C>T		Somatic	21	0		WXS	Illumina HiSeq	.	15	3	NM_138736	P29777|Q8TD72|Q9UMV4	Missense_Mutation	SNP	ENST00000262493.6	37	CCDS10756.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.815013	0.90790	.	.	ENSG00000087258	ENST00000262494	D	0.88354	-2.37	4.58	4.58	0.56647	.	.	.	.	.	D	0.95156	0.8430	M	0.86953	2.85	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96089	0.9060	9	0.87932	D	0	.	17.7684	0.88485	0.0:1.0:0.0:0.0	.	340	P09471-2	.	M	340	ENSP00000262494:T340M	ENSP00000262494:T340M	T	+	2	0	GNAO1	54935317	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.713000	0.84693	2.278000	0.76064	0.561000	0.74099	ACG	.		0.612	GNAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256981.2	NM_020988	
LILRA1	11024	hgsc.bcm.edu	37	19	55106239	55106239	+	Silent	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr19:55106239G>A	ENST00000251372.3	+	4	362	c.180G>A	c.(178-180)ctG>ctA	p.L60L	LILRB1_ENST00000448689.1_Intron|LILRB1_ENST00000418536.2_Intron|LILRA1_ENST00000453777.1_Silent_p.L60L|LILRB1_ENST00000396321.2_Intron|LILRA1_ENST00000473156.1_3'UTR	NM_006863.2	NP_006854.1	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1	60	Ig-like C2-type 1.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)	p.L60L(3)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	47				GBM - Glioblastoma multiforme(193;0.0348)		AGTACCGTCTGTATAGAGAAA	0.572																																					p.L60L		.											LILRA1,NS,carcinoma,0,3	LILRA1	0	3	Substitution - coding silent(3)	kidney(3)	c.G180A						.						124.0	119.0	121.0					19																	55106239		2203	4300	6503	SO:0001819	synonymous_variant	11024	exon4			CCGTCTGTATAGA	AF025530	CCDS12901.1, CCDS62802.1	19q13.4	2013-01-11			ENSG00000104974	ENSG00000104974		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6602	protein-coding gene	gene with protein product		604810				9548455	Standard	NM_006863		Approved	LIR-6, CD85i, LIR6	uc002qgh.2	O75019	OTTHUMG00000065701	ENST00000251372.3:c.180G>A	19.37:g.55106239G>A		Somatic	41	0		WXS	Illumina HiSeq	.	36	2	NM_006863	O75018|Q3MJA6	Silent	SNP	ENST00000251372.3	37	CCDS12901.1																																																																																			.		0.572	LILRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140807.2	NM_006863	
LDB3	11155	hgsc.bcm.edu	37	10	88477868	88477868	+	Silent	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr10:88477868G>T	ENST00000361373.4	+	10	1845	c.1824G>T	c.(1822-1824)ccG>ccT	p.P608P	LDB3_ENST00000429277.2_Silent_p.P613P|LDB3_ENST00000352360.5_Silent_p.P351P|LDB3_ENST00000458213.2_Silent_p.P498P|LDB3_ENST00000263066.6_Silent_p.P498P	NM_007078.2	NP_009009.1			LIM domain binding 3											breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|soft_tissue(1)	25						TCTTTGCCCCGCTGTGTGCCA	0.522																																					p.P613P		.											LDB3_ENST00000429277,NS,carcinoma,0,2	LDB3_ENST00000429277	0	0			c.G1839T						.						147.0	134.0	138.0					10																	88477868		2203	4300	6503	SO:0001819	synonymous_variant	11155	exon11			TGCCCCGCTGTGT	AB014513	CCDS7377.1, CCDS41544.1, CCDS41545.1, CCDS53549.1, CCDS53550.1	10q22.3-q23.2	2014-09-17			ENSG00000122367	ENSG00000122367			15710	protein-coding gene	gene with protein product	"""cypher"", ""oracle"", ""Z-band alternatively spliced PDZ motif protein"""	605906	"""cardiomyopathy, dilated 1C (autosomal dominant)"""	CMD1C		10427098, 23271734, 23996002, 14662268	Standard	NM_001080114		Approved	PDLIM6, KIAA0613, ZASP	uc001kdv.3	O75112	OTTHUMG00000018655	ENST00000361373.4:c.1824G>T	10.37:g.88477868G>T		Somatic	21	0		WXS	Illumina HiSeq	.	32	2	NM_001171610		Silent	SNP	ENST00000361373.4	37	CCDS7377.1																																																																																			.		0.522	LDB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000049160.2		
ITGAX	3687	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	16	31384573	31384573	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr16:31384573G>T	ENST00000268296.4	+	20	2491	c.2370G>T	c.(2368-2370)ttG>ttT	p.L790F	ITGAX_ENST00000562522.1_Missense_Mutation_p.L790F	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	790					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						TACCCAGCTTGAAGTCCCTGC	0.527																																					p.L790F		.											.	.	.	0			c.G2370T						.						104.0	86.0	92.0					16																	31384573		2197	4300	6497	SO:0001583	missense	3687	exon20			CAGCTTGAAGTCC	BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.2370G>T	16.37:g.31384573G>T	ENSP00000268296:p.Leu790Phe	Somatic	22	0		WXS	Illumina HiSeq	.	30	4	NM_000887	Q8IVA6	Missense_Mutation	SNP	ENST00000268296.4	37	CCDS10711.1	.	.	.	.	.	.	.	.	.	.	G	13.77	2.336296	0.41398	.	.	ENSG00000140678	ENST00000268296	T	0.47177	0.85	4.89	3.92	0.45320	Integrin alpha-2 (1);	.	.	.	.	T	0.68118	0.2966	M	0.81112	2.525	0.19775	N	0.999952	D	0.89917	1.0	D	0.97110	1.0	T	0.57837	-0.7742	9	0.59425	D	0.04	.	10.6532	0.45659	0.0913:0.0:0.9087:0.0	.	790	P20702	ITAX_HUMAN	F	790	ENSP00000268296:L790F	ENSP00000268296:L790F	L	+	3	2	ITGAX	31292074	0.996000	0.38824	0.367000	0.25926	0.413000	0.31143	4.038000	0.57318	1.416000	0.47057	0.591000	0.81541	TTG	.		0.527	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255628.2	NM_000887	
C6orf136	221545	hgsc.bcm.edu	37	6	30619191	30619191	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr6:30619191G>T	ENST00000376473.5	+	4	871	c.712G>T	c.(712-714)Gtc>Ttc	p.V238F	C6orf136_ENST00000293604.6_Missense_Mutation_p.V419F|C6orf136_ENST00000528347.2_Missense_Mutation_p.V95F|AL662800.2_ENST00000583820.1_RNA|C6orf136_ENST00000376471.4_Missense_Mutation_p.V104F	NM_001109938.2	NP_001103408.1	Q5SQH8	CF136_HUMAN	chromosome 6 open reading frame 136	238						mitochondrion (GO:0005739)				endometrium(1)|large_intestine(2)|lung(6)|ovary(1)	10						GGGGCTGCCCGTCCACTTGCT	0.502																																					p.V419F		.											C6orf136_ENST00000293604,NS,carcinoma,0,2	C6orf136_ENST00000293604	0	0			c.G1255T						.						127.0	144.0	138.0					6																	30619191		2203	4300	6503	SO:0001583	missense	221545	exon4			CTGCCCGTCCACT	BC016167	CCDS4684.1, CCDS43443.1, CCDS4684.2, CCDS54979.1	6p21.32	2012-02-06			ENSG00000204564	ENSG00000204564			21301	protein-coding gene	gene with protein product							Standard	NM_001109938		Approved	Em:AB023049.8	uc003nqx.4	Q5SQH8	OTTHUMG00000031221	ENST00000376473.5:c.712G>T	6.37:g.30619191G>T	ENSP00000365656:p.Val238Phe	Somatic	14	0		WXS	Illumina HiSeq	.	24	3	NM_001161376	A9R9P9|F8VX15|Q5SU01|Q6ZSB7|Q8TB84	Missense_Mutation	SNP	ENST00000376473.5	37	CCDS43443.1	.	.	.	.	.	.	.	.	.	.	G	1.608	-0.524669	0.04141	.	.	ENSG00000204564	ENST00000293604;ENST00000376473;ENST00000376471;ENST00000446773;ENST00000528347;ENST00000465699;ENST00000467801;ENST00000468785	.	.	.	5.26	2.67	0.31697	.	0.353806	0.32314	N	0.006280	T	0.04048	0.0113	N	0.03608	-0.345	0.09310	N	1	B;B;B	0.17667	0.002;0.023;0.014	B;B;B	0.18871	0.003;0.023;0.01	T	0.40251	-0.9573	9	0.21540	T	0.41	-4.1947	3.7695	0.08636	0.6689:0.0:0.1738:0.1573	.	104;419;238	A9R9P9;F8VX15;Q5SQH8	.;.;CF136_HUMAN	F	419;238;104;356;95;60;51;11	.	ENSP00000293604:V419F	V	+	1	0	C6orf136	30727170	0.331000	0.24713	0.296000	0.24974	0.262000	0.26303	0.303000	0.19210	0.422000	0.26005	-0.290000	0.09829	GTC	.		0.502	C6orf136-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076457.4	NM_145029	
NAP1L1	4673	hgsc.bcm.edu	37	12	76449901	76449901	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr12:76449901T>C	ENST00000261182.8	-	7	956	c.470A>G	c.(469-471)aAa>aGa	p.K157R	NAP1L1_ENST00000393263.3_Missense_Mutation_p.K157R|NAP1L1_ENST00000431879.3_Missense_Mutation_p.K89R|NAP1L1_ENST00000552342.1_Missense_Mutation_p.K168R|NAP1L1_ENST00000549596.1_Missense_Mutation_p.K157R|NAP1L1_ENST00000547993.1_5'UTR|NAP1L1_ENST00000535020.2_Missense_Mutation_p.K157R|NAP1L1_ENST00000548044.1_Missense_Mutation_p.K116R|NAP1L1_ENST00000542344.1_Missense_Mutation_p.K115R|NAP1L1_ENST00000547773.1_Missense_Mutation_p.K94R|NAP1L1_ENST00000544816.1_5'UTR	NM_004537.4|NM_139207.2	NP_004528.1|NP_631946.1	P55209	NP1L1_HUMAN	nucleosome assembly protein 1-like 1	157					DNA replication (GO:0006260)|nucleosome assembly (GO:0006334)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|skin(1)	9		Colorectal(145;0.09)				TTCTTCATCTTTTTTCTCATC	0.323																																					p.K157R		.											NAP1L1,NS,carcinoma,0,1	NAP1L1	0	0			c.A470G						.						66.0	62.0	63.0					12																	76449901		2202	4299	6501	SO:0001583	missense	4673	exon7			TCATCTTTTTTCT		CCDS9013.1	12q21.1	2010-03-17			ENSG00000187109	ENSG00000187109			7637	protein-coding gene	gene with protein product		164060				8297347	Standard	NM_004537		Approved	NRP, NAP1, NAP1L, MGC8688, MGC23410	uc001sxx.2	P55209		ENST00000261182.8:c.470A>G	12.37:g.76449901T>C	ENSP00000261182:p.Lys157Arg	Somatic	16	0		WXS	Illumina HiSeq	.	36	3	NM_004537	B3KNT8	Missense_Mutation	SNP	ENST00000261182.8	37	CCDS9013.1	.	.	.	.	.	.	.	.	.	.	T	18.36	3.606596	0.66445	.	.	ENSG00000187109	ENST00000261182;ENST00000552056;ENST00000393263;ENST00000431879;ENST00000547773;ENST00000542344;ENST00000535020;ENST00000549596;ENST00000552342;ENST00000548044;ENST00000550934;ENST00000551992;ENST00000548273;ENST00000551600;ENST00000547704	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.26067	1.76;1.76;1.76;1.76;1.76;1.76;1.76;1.76;1.76;1.76;1.76;1.76;1.76;1.76;1.76	6.05	4.91	0.64330	.	0.041854	0.85682	D	0.000000	T	0.35008	0.0917	M	0.66939	2.045	0.54753	D	0.999985	P;P;P;P;B;B;B	0.41188	0.696;0.741;0.523;0.578;0.221;0.066;0.061	B;P;B;P;B;B;B	0.48334	0.438;0.574;0.358;0.574;0.091;0.033;0.063	T	0.07177	-1.0786	10	0.18710	T	0.47	.	11.8846	0.52594	0.0:0.0684:0.0:0.9316	.	157;115;168;157;89;94;157	F5H4R6;B7Z9C2;F8W0J6;B3KNT8;B3KV44;F8W543;P55209	.;.;.;.;.;.;NP1L1_HUMAN	R	157;151;157;89;94;115;157;157;168;116;130;157;116;163;164	ENSP00000261182:K157R;ENSP00000450236:K151R;ENSP00000376947:K157R;ENSP00000409795:K89R;ENSP00000448167:K94R;ENSP00000444759:K115R;ENSP00000445008:K157R;ENSP00000447793:K157R;ENSP00000447196:K168R;ENSP00000449649:K116R;ENSP00000448133:K130R;ENSP00000448764:K157R;ENSP00000446787:K116R;ENSP00000448836:K163R;ENSP00000446756:K164R	ENSP00000261182:K157R	K	-	2	0	NAP1L1	74736168	1.000000	0.71417	0.988000	0.46212	0.944000	0.59088	8.036000	0.88901	1.107000	0.41642	-0.263000	0.10527	AAA	.		0.323	NAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405850.3	NM_139207	
STRN3	29966	hgsc.bcm.edu	37	14	31483858	31483858	+	Intron	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr14:31483858G>T	ENST00000357479.5	-	1	479				MIR624_ENST00000385217.1_RNA|STRN3_ENST00000355683.5_Intron	NM_001083893.1	NP_001077362.1	Q13033	STRN3_HUMAN	striatin, calmodulin binding protein 3						negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to estradiol (GO:0032355)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.0124)		AAACCACTTAGGTGTAATGCT	0.313																																					.		.											.	.	.	0			.						.						47.0	42.0	43.0					14																	31483858		1502	3414	4916	SO:0001627	intron_variant	693209	.			CACTTAGGTGTAA		CCDS9641.1, CCDS41938.1	14q13-q21	2013-01-10			ENSG00000196792	ENSG00000196792		"""WD repeat domain containing"""	15720	protein-coding gene	gene with protein product	"""cell cycle S/G2 nuclear autoantigen"""	614766				7864889, 10681496	Standard	NM_014574		Approved	SG2NA	uc001wqu.2	Q13033	OTTHUMG00000140201	ENST00000357479.5:c.282+11251C>A	14.37:g.31483858G>T		Somatic	86	0		WXS	Illumina HiSeq	.	89	5	.	A2RTX7|A6NHZ7|Q9NRA5	RNA	SNP	ENST00000357479.5	37	CCDS41938.1																																																																																			.		0.313	STRN3-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409713.1	NM_014574	
CSGALNACT2	55454	hgsc.bcm.edu	37	10	43659315	43659315	+	Splice_Site	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr10:43659315G>T	ENST00000374466.3	+	5	1317	c.982G>T	c.(982-984)Gag>Tag	p.E328*		NM_018590.3	NP_061060.3	Q8N6G5	CGAT2_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 2	328					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|dermatan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050652)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)			endometrium(12)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						TCCTCATAGTGAGTCTAATTT	0.383																																					p.E328X		.											.	.	.	0			c.G982T						.						156.0	140.0	145.0					10																	43659315		2203	4300	6503	SO:0001630	splice_region_variant	55454	exon5			CATAGTGAGTCTA	AF116646	CCDS7201.1	10q11.21	2013-02-19			ENSG00000169826	ENSG00000169826		"""Beta 4-glycosyltransferases"""	24292	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase 2"""					12446672	Standard	NM_018590		Approved	GALNACT2, MGC40204, PRO0082, GALNACT-2	uc001jan.4	Q8N6G5	OTTHUMG00000018023	ENST00000374466.3:c.981-1G>T	10.37:g.43659315G>T		Somatic	46	0		WXS	Illumina HiSeq	.	57	4	NM_018590	B3KWL7|Q6MZJ5|Q6MZP6|Q8TCH4|Q9P1I6	Nonsense_Mutation	SNP	ENST00000374466.3	37	CCDS7201.1	.	.	.	.	.	.	.	.	.	.	G	41	8.792463	0.98956	.	.	ENSG00000169826	ENST00000374466	.	.	.	6.08	6.08	0.98989	.	0.042681	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	-17.655	20.6721	0.99693	0.0:0.0:1.0:0.0	.	.	.	.	X	328	.	ENSP00000363590:E328X	E	+	1	0	CSGALNACT2	42979321	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.135000	0.94478	2.894000	0.99253	0.591000	0.81541	GAG	.		0.383	CSGALNACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047693.1	NM_018590	Nonsense_Mutation
MYADML2	255275	hgsc.bcm.edu	37	17	79898786	79898786	+	Silent	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr17:79898786G>A	ENST00000409745.2	-	3	1186	c.832C>T	c.(832-834)Ctg>Ttg	p.L278L	MYADML2_ENST00000330655.3_Silent_p.L278L|AC137723.5_ENST00000415556.1_RNA	NM_001145113.2	NP_001138585.2	A6NDP7	MADL2_HUMAN	myeloid-associated differentiation marker-like 2	278	MARVEL 2. {ECO:0000255|PROSITE- ProRule:PRU00581}.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(1)	1						GCCACCACCAGCTGGCTGTCC	0.622																																					p.L278L		.											.	.	.	0			c.C832T						.						27.0	32.0	30.0					17																	79898786		692	1590	2282	SO:0001819	synonymous_variant	255275	exon3			CCACCAGCTGGCT	AC137723, BC029306	CCDS45815.1	17q25.3	2008-10-15			ENSG00000185105	ENSG00000185105			34548	protein-coding gene	gene with protein product							Standard	NM_001145113		Approved	LOC255275	uc010wvf.1	A6NDP7	OTTHUMG00000154388	ENST00000409745.2:c.832C>T	17.37:g.79898786G>A		Somatic	80	0		WXS	Illumina HiSeq	.	77	4	NM_001145113		Silent	SNP	ENST00000409745.2	37	CCDS45815.1																																																																																			.		0.622	MYADML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335008.2	XR_041347	
MYO5B	4645	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	47566596	47566596	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr18:47566596G>T	ENST00000285039.7	-	3	526	c.227C>A	c.(226-228)gCc>gAc	p.A76D		NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	76	Myosin motor.				endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		ATAGCTAAGGGCAGTCAGGTC	0.458																																					p.A76D		.											.	.	.	0			c.C227A						.						293.0	283.0	286.0					18																	47566596		1928	4140	6068	SO:0001583	missense	4645	exon3			CTAAGGGCAGTCA	AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.227C>A	18.37:g.47566596G>T	ENSP00000285039:p.Ala76Asp	Somatic	57	0		WXS	Illumina HiSeq	.	30	4	NM_001080467	B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	ENST00000285039.7	37	CCDS42436.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.127544	0.77549	.	.	ENSG00000167306	ENST00000285039;ENST00000356732	D	0.88201	-2.35	5.95	5.95	0.96441	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.88599	0.6480	L	0.60012	1.86	0.80722	D	1	B;B	0.18310	0.027;0.007	B;B	0.30316	0.114;0.009	T	0.83162	-0.0098	10	0.24483	T	0.36	.	18.9528	0.92646	0.0:0.0:1.0:0.0	.	75;76	Q7Z7A5;Q9ULV0	.;MYO5B_HUMAN	D	76;75	ENSP00000285039:A76D	ENSP00000285039:A76D	A	-	2	0	MYO5B	45820594	1.000000	0.71417	1.000000	0.80357	0.832000	0.47134	7.966000	0.87956	2.817000	0.96982	0.563000	0.77884	GCC	.		0.458	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448515.2		
GK2	2712	hgsc.bcm.edu	37	4	80329033	80329033	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr4:80329033G>T	ENST00000358842.3	-	1	339	c.322C>A	c.(322-324)Ctc>Atc	p.L108I		NM_033214.2	NP_149991.2	Q01415	GALK2_HUMAN	glycerol kinase 2	294					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|N-acetylgalactosamine kinase activity (GO:0033858)	p.L108I(1)		autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	39						GCATTGTAGAGAGGCTCTCCT	0.403																																					p.L108I		.											GK2,NS,carcinoma,0,1	GK2	0	1	Substitution - Missense(1)	endometrium(1)	c.C322A						.						167.0	161.0	163.0					4																	80329033		2203	4300	6503	SO:0001583	missense	2712	exon1			TGTAGAGAGGCTC	BC029820	CCDS3585.1	4q13	2008-02-05	2002-10-03	2002-10-04	ENSG00000196475	ENSG00000196475		"""Glycerol kinases"""	4291	protein-coding gene	gene with protein product		600148	"""glycerol kinase pseudogene 2"""	GKP2		7987308	Standard	NM_033214		Approved	GKTA	uc003hlu.3	Q14410	OTTHUMG00000130199	ENST00000358842.3:c.322C>A	4.37:g.80329033G>T	ENSP00000351706:p.Leu108Ile	Somatic	79	0		WXS	Illumina HiSeq	.	49	2	NM_033214	Q7Z4Q4	Missense_Mutation	SNP	ENST00000358842.3	37	CCDS3585.1	.	.	.	.	.	.	.	.	.	.	G	11.53	1.665803	0.29604	.	.	ENSG00000196475	ENST00000358842	T	0.60299	0.2	3.76	2.92	0.33932	Carbohydrate kinase, FGGY, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.62233	0.2411	L	0.51853	1.615	0.58432	D	0.999997	D	0.57899	0.981	D	0.65573	0.936	T	0.58267	-0.7666	10	0.11182	T	0.66	-1.7612	9.7298	0.40355	0.1051:0.0:0.8949:0.0	.	108	Q14410	GLPK2_HUMAN	I	108	ENSP00000351706:L108I	ENSP00000351706:L108I	L	-	1	0	GK2	80548057	1.000000	0.71417	0.950000	0.38849	0.056000	0.15407	5.768000	0.68858	1.183000	0.42943	0.585000	0.79938	CTC	.		0.403	GK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252517.2	NM_033214	
ANGEL2	90806	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	213178743	213178743	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr1:213178743T>C	ENST00000366962.3	-	5	920	c.766A>G	c.(766-768)Att>Gtt	p.I256V	ANGEL2_ENST00000535388.1_Missense_Mutation_p.I87V|ANGEL2_ENST00000544555.1_Missense_Mutation_p.I87V|ANGEL2_ENST00000360506.2_Missense_Mutation_p.I87V|ANGEL2_ENST00000540642.1_Missense_Mutation_p.I130V	NM_144567.3	NP_653168.2	Q5VTE6	ANGE2_HUMAN	angel homolog 2 (Drosophila)	256										central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|skin(1)	24				OV - Ovarian serous cystadenocarcinoma(81;0.00446)|all cancers(67;0.0169)|Epithelial(68;0.0921)|GBM - Glioblastoma multiforme(131;0.185)		TTGAAGCAAATAGCACAGCCA	0.368																																					p.I256V		.											.	.	.	0			c.A766G						.						112.0	120.0	117.0					1																	213178743		2202	4299	6501	SO:0001583	missense	90806	exon5			AGCAAATAGCACA	AL079275	CCDS1512.1, CCDS73027.1	1q32.3	2014-06-17			ENSG00000174606	ENSG00000174606			30534	protein-coding gene	gene with protein product						11943475	Standard	XM_005273344		Approved	KIAA0759L, FLJ12793, Ccr4d	uc001hjz.3	Q5VTE6	OTTHUMG00000036927	ENST00000366962.3:c.766A>G	1.37:g.213178743T>C	ENSP00000355929:p.Ile256Val	Somatic	41	0		WXS	Illumina HiSeq	.	63	6	NM_144567	B7Z2U4|D3DTA3|Q86X13|Q8NHH3	Missense_Mutation	SNP	ENST00000366962.3	37	CCDS1512.1	.	.	.	.	.	.	.	.	.	.	T	7.733	0.699625	0.15106	.	.	ENSG00000174606	ENST00000366962;ENST00000360506;ENST00000544555;ENST00000540642;ENST00000535388	D;D;D;D;D	0.95980	-3.87;-3.6;-3.6;-3.87;-3.6	5.31	4.05	0.47172	Endonuclease/exonuclease/phosphatase (2);	0.158146	0.56097	N	0.000027	D	0.91486	0.7312	L	0.45422	1.42	0.50632	D	0.999886	B;B	0.12013	0.0;0.005	B;B	0.20955	0.002;0.032	D	0.85276	0.1059	10	0.14656	T	0.56	-11.8863	10.9869	0.47526	0.0:0.0794:0.0:0.9206	.	130;256	F5H476;Q5VTE6	.;ANGE2_HUMAN	V	256;87;87;130;87	ENSP00000355929:I256V;ENSP00000353696:I87V;ENSP00000443193:I87V;ENSP00000446124:I130V;ENSP00000438141:I87V	ENSP00000353696:I87V	I	-	1	0	ANGEL2	211245366	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.872000	0.39549	0.838000	0.34948	0.454000	0.30748	ATT	.		0.368	ANGEL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089693.1	NM_144567	
XPNPEP1	7511	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	111674853	111674853	+	Missense_Mutation	SNP	T	T	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr10:111674853T>A	ENST00000502935.1	-	2	156	c.37A>T	c.(37-39)Aat>Tat	p.N13Y	XPNPEP1_ENST00000369683.1_Intron|XPNPEP1_ENST00000430337.1_5'UTR|XPNPEP1_ENST00000369680.4_5'UTR|XPNPEP1_ENST00000322238.8_Missense_Mutation_p.N13Y					X-prolyl aminopeptidase (aminopeptidase P) 1, soluble											endometrium(2)|kidney(9)|large_intestine(4)|lung(9)|ovary(3)|pancreas(2)|skin(1)|urinary_tract(1)	31		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)		TCCTGGTGATTCACCCTTAAG	0.418																																					p.N13Y		.											.	.	.	0			c.A37T						.						147.0	125.0	131.0					10																	111674853		692	1591	2283	SO:0001583	missense	7511	exon2			GGTGATTCACCCT		CCDS7560.1, CCDS7560.2, CCDS53576.1	10q25.3	2006-01-16	2002-07-17		ENSG00000108039	ENSG00000108039	3.4.11.9		12822	protein-coding gene	gene with protein product		602443	"""X-prolyl aminopeptidase (aminopeptidase P)-like"""	XPNPEP, XPNPEPL1, XPNPEPL			Standard	NM_020383		Approved		uc001kyp.2	Q9NQW7	OTTHUMG00000019029	ENST00000502935.1:c.37A>T	10.37:g.111674853T>A	ENSP00000421566:p.Asn13Tyr	Somatic	41	0		WXS	Illumina HiSeq	.	42	11	NM_001167604		Missense_Mutation	SNP	ENST00000502935.1	37	CCDS7560.2	.	.	.	.	.	.	.	.	.	.	T	7.815	0.716617	0.15306	.	.	ENSG00000108039	ENST00000502935;ENST00000322238	.	.	.	5.63	4.43	0.53597	.	.	.	.	.	T	0.21631	0.0521	N	0.17082	0.46	0.36122	D	0.845538	B;P	0.47191	0.38;0.891	B;B	0.38056	0.135;0.264	T	0.09378	-1.0677	8	0.13108	T	0.6	.	9.3078	0.37885	0.0:0.0:0.1808:0.8191	.	13;13	B4E2P4;G5E9Y2	.;.	Y	13	.	ENSP00000324011:N13Y	N	-	1	0	XPNPEP1	111664843	0.006000	0.16342	0.015000	0.15790	0.125000	0.20455	0.814000	0.27239	2.270000	0.75569	0.482000	0.46254	AAT	.		0.418	XPNPEP1-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000050264.2		
MPP5	64398	hgsc.bcm.edu	37	14	67787063	67787063	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr14:67787063C>T	ENST00000261681.4	+	12	2147	c.1486C>T	c.(1486-1488)Cgt>Tgt	p.R496C	MPP5_ENST00000555925.1_Missense_Mutation_p.R462C|ATP6V1D_ENST00000553974.1_Intron	NM_022474.3	NP_071919.2	Q8N3R9	MPP5_HUMAN	membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5)	496	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|establishment of protein localization to plasma membrane (GO:0090002)|morphogenesis of an epithelial sheet (GO:0002011)|myelin assembly (GO:0032288)|peripheral nervous system myelin maintenance (GO:0032287)|protein localization to myelin sheath abaxonal region (GO:0035750)|tight junction assembly (GO:0070830)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lateral loop (GO:0043219)|myelin sheath adaxonal region (GO:0035749)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein domain specific binding (GO:0019904)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|skin(1)	18				all cancers(60;0.000388)|OV - Ovarian serous cystadenocarcinoma(108;0.00762)|BRCA - Breast invasive adenocarcinoma(234;0.0106)		GAATGAATTGCGTCAGAGGCT	0.423																																					p.R496C		.											MPP5,NS,carcinoma,0,1	MPP5	0	0			c.C1486T						.						113.0	106.0	109.0					14																	67787063		2203	4300	6503	SO:0001583	missense	64398	exon12			GAATTGCGTCAGA	AK022677	CCDS9779.1, CCDS58325.1	14q23.3	2008-08-11				ENSG00000072415			18669	protein-coding gene	gene with protein product	"""stardust"""	606958				11927608	Standard	NM_022474		Approved	PALS1, FLJ12615	uc001xjc.4	Q8N3R9		ENST00000261681.4:c.1486C>T	14.37:g.67787063C>T	ENSP00000261681:p.Arg496Cys	Somatic	39	0		WXS	Illumina HiSeq	.	33	2	NM_022474	A1L380|Q7Z631|Q86T98|Q8N7I5|Q9H9Q0	Missense_Mutation	SNP	ENST00000261681.4	37	CCDS9779.1	.	.	.	.	.	.	.	.	.	.	C	18.95	3.730807	0.69074	.	.	ENSG00000072415	ENST00000261681;ENST00000555925	T;T	0.43688	0.94;0.94	5.58	5.58	0.84498	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);	0.000000	0.85682	D	0.000000	T	0.56978	0.2022	L	0.45470	1.425	0.80722	D	1	D	0.57257	0.979	P	0.59288	0.855	T	0.57394	-0.7819	10	0.87932	D	0	.	19.9299	0.97115	0.0:1.0:0.0:0.0	.	496	Q8N3R9	MPP5_HUMAN	C	496;462	ENSP00000261681:R496C;ENSP00000451488:R462C	ENSP00000261681:R496C	R	+	1	0	MPP5	66856816	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.586000	0.60984	2.769000	0.95229	0.655000	0.94253	CGT	.		0.423	MPP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412498.1	NM_022474	
SEMA5B	54437	hgsc.bcm.edu	37	3	122631064	122631064	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr3:122631064C>T	ENST00000357599.3	-	19	3237	c.2851G>A	c.(2851-2853)Ggg>Agg	p.G951R	SEMA5B_ENST00000451055.2_Missense_Mutation_p.G1005R|SEMA5B_ENST00000195173.4_Missense_Mutation_p.G950R	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	951	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		GTGTGCAGCCCGAGACAGATG	0.637																																					p.G1005R		.											SEMA5B_ENST00000451055,right_upper_lobe,carcinoma,0,2	SEMA5B_ENST00000451055	0	0			c.G3013A						.						60.0	50.0	53.0					3																	122631064		2203	4300	6503	SO:0001583	missense	54437	exon19			GCAGCCCGAGACA	AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.2851G>A	3.37:g.122631064C>T	ENSP00000350215:p.Gly951Arg	Somatic	7	1		WXS	Illumina HiSeq	.	7	5	NM_001256347	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	ENST00000357599.3	37	CCDS35491.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.785021	0.90282	.	.	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000418793;ENST00000451055;ENST00000393583	T;T;T;T	0.56941	0.43;0.43;0.43;0.43	4.55	4.55	0.56014	.	0.000000	0.85682	D	0.000000	T	0.80706	0.4674	H	0.95402	3.665	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.994	D	0.87111	0.2185	10	0.87932	D	0	.	16.4825	0.84161	0.0:1.0:0.0:0.0	.	857;951	D3YTI7;Q9P283	.;SEM5B_HUMAN	R	951;950;857;1005;951	ENSP00000350215:G951R;ENSP00000195173:G950R;ENSP00000389588:G1005R;ENSP00000377208:G951R	ENSP00000195173:G950R	G	-	1	0	SEMA5B	124113754	1.000000	0.71417	0.997000	0.53966	0.979000	0.70002	7.638000	0.83328	2.365000	0.80145	0.511000	0.50034	GGG	.		0.637	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277165.1	NM_001031702	
MT-ND2	4536	hgsc.bcm.edu;broad.mit.edu	37	M	2636	2636	+	5'Flank	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chrM:2636G>A	ENST00000361453.3	+	0	0				MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TA_ENST00000387392.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TI_ENST00000387365.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						cctgtatgaatggctccacga	0.517																																					.		.											.	.	.	0			.						.																																			SO:0001631	upstream_gene_variant	6053	.			TGAATGGCTCCAC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.2636G>A	Exception_encountered	Somatic	849	1		WXS	Illumina HiSeq	.	2282	2113	.	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	ENST00000361453.3	37																																																																																				.		0.517	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024027	
GNAS	2778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	57415343	57415343	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr20:57415343G>A	ENST00000313949.7	+	1	571	c.182G>A	c.(181-183)cGc>cAc	p.R61H	GNAS_ENST00000371098.2_Missense_Mutation_p.R61H|GNAS-AS1_ENST00000424094.2_RNA|GNAS_ENST00000371075.3_Missense_Mutation_p.R61H|GNAS-AS1_ENST00000443966.1_RNA|GNAS-AS1_ENST00000598163.1_RNA			P63092	GNAS2_HUMAN	GNAS complex locus	0					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			GCCCAACAGCGCCGGAGCTTC	0.692			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											p.R61H	Colon(117;935 1597 6045 8307 46442)	.		Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	.	.	.	0			c.G182A						.						30.0	37.0	35.0					20																	57415343		2202	4291	6493	SO:0001583	missense	2778	exon1			AACAGCGCCGGAG	M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000313949.7:c.182G>A	20.37:g.57415343G>A	ENSP00000323571:p.Arg61His	Somatic	36	0		WXS	Illumina HiSeq	.	49	25	NM_016592	A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	ENST00000313949.7	37	CCDS13471.1	.	.	.	.	.	.	.	.	.	.	G	17.50	3.405563	0.62288	.	.	ENSG00000087460	ENST00000313949;ENST00000371098;ENST00000371075	.	.	.	3.72	3.72	0.42706	.	.	.	.	.	T	0.54398	0.1856	N	0.24115	0.695	0.80722	D	1	D	0.76494	0.999	D	0.64144	0.922	T	0.57814	-0.7746	8	0.72032	D	0.01	.	11.3015	0.49309	0.0:0.0:1.0:0.0	.	61	O95467	GNAS3_HUMAN	H	61	.	ENSP00000323571:R61H	R	+	2	0	GNAS	56848738	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	1.556000	0.36288	2.390000	0.81377	0.460000	0.39030	CGC	.		0.692	GNAS-002	KNOWN	NMD_exception|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080418.7	NM_000516	
SEMA4F	10505	hgsc.bcm.edu	37	2	74900824	74900824	+	Missense_Mutation	SNP	G	G	A	rs375402877		TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr2:74900824G>A	ENST00000357877.2	+	7	840	c.691G>A	c.(691-693)Gtg>Atg	p.V231M	SEMA4F_ENST00000339773.5_Intron	NM_004263.3	NP_004254.2	O95754	SEM4F_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F	231	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|negative regulation of axon extension (GO:0030517)|nervous system development (GO:0007399)|retinal ganglion cell axon guidance (GO:0031290)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)	p.V231L(1)		biliary_tract(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	45						TGTCGCAGCCGTGGCCTTGAG	0.567																																					p.V231M		.											SEMA4F,NS,carcinoma,0,1	SEMA4F	0	1	Substitution - Missense(1)	lung(1)	c.G691A						.	G	MET/VAL	1,4405	2.1+/-5.4	0,1,2202	66.0	65.0	66.0		691	-3.2	0.1	2		66	1,8599	1.2+/-3.3	0,1,4299	no	missense	SEMA4F	NM_004263.3	21	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	benign	231/771	74900824	2,13004	2203	4300	6503	SO:0001583	missense	10505	exon7			GCAGCCGTGGCCT	AF038652	CCDS1955.1, CCDS62942.1, CCDS74529.1	2p13.1	2008-05-21			ENSG00000135622	ENSG00000135622		"""Semaphorins"""	10734	protein-coding gene	gene with protein product	"""m-Sema M"""	603706		SEMAM		10051670	Standard	NM_004263		Approved	SEMAW	uc002sna.2	O95754	OTTHUMG00000129952	ENST00000357877.2:c.691G>A	2.37:g.74900824G>A	ENSP00000350547:p.Val231Met	Somatic	41	0		WXS	Illumina HiSeq	.	59	3	NM_004263	Q542Y7|Q9NS35	Missense_Mutation	SNP	ENST00000357877.2	37	CCDS1955.1	.	.	.	.	.	.	.	.	.	.	G	11.50	1.656169	0.29425	2.27E-4	1.16E-4	ENSG00000135622	ENST00000357877	T	0.11385	2.78	4.79	-3.21	0.05140	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.621093	0.15848	N	0.241645	T	0.07007	0.0178	L	0.38175	1.15	0.09310	N	1	B	0.21381	0.055	B	0.22880	0.042	T	0.26985	-1.0087	10	0.33940	T	0.23	.	6.2394	0.20783	0.5226:0.1347:0.3427:0.0	.	231	O95754	SEM4F_HUMAN	M	231	ENSP00000350547:V231M	ENSP00000350547:V231M	V	+	1	0	SEMA4F	74754332	0.004000	0.15560	0.127000	0.21898	0.975000	0.68041	-0.614000	0.05604	-1.049000	0.03234	0.462000	0.41574	GTG	.		0.567	SEMA4F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252214.2	NM_004263	
LCE1B	353132	hgsc.bcm.edu	37	1	152785258	152785258	+	Silent	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr1:152785258G>A	ENST00000360090.3	+	1	812	c.336G>A	c.(334-336)caG>caA	p.Q112Q		NM_178349.1	NP_848126.1	Q5T7P3	LCE1B_HUMAN	late cornified envelope 1B	112	Gly-rich.				keratinization (GO:0031424)			p.Q112H(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(5)|skin(2)	18	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GGAGTGGCCAGCACTCTGGAG	0.612																																					p.Q112Q		.											LCE1B,NS,carcinoma,0,1	LCE1B	0	1	Substitution - Missense(1)	lung(1)	c.G336A						.						36.0	44.0	42.0					1																	152785258		2202	4298	6500	SO:0001819	synonymous_variant	353132	exon1			TGGCCAGCACTCT	BI670515	CCDS1027.1	1q21.3	2008-02-05	2004-10-11	2004-10-15	ENSG00000196734	ENSG00000196734		"""Late cornified envelopes"""	16611	protein-coding gene	gene with protein product		612604	"""small proline rich-like (epidermal differentiation complex) 2A"""	SPRL2A		11698679	Standard	NM_178349		Approved	LEP2	uc001faq.3	Q5T7P3	OTTHUMG00000014402	ENST00000360090.3:c.336G>A	1.37:g.152785258G>A		Somatic	79	0		WXS	Illumina HiSeq	.	98	4	NM_178349	A4IF40	Silent	SNP	ENST00000360090.3	37	CCDS1027.1																																																																																			.		0.612	LCE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040060.1	NM_178349	
MDN1	23195	hgsc.bcm.edu	37	6	90472214	90472214	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr6:90472214G>T	ENST00000369393.3	-	16	2295	c.2180C>A	c.(2179-2181)cCc>cAc	p.P727H	MDN1_ENST00000428876.1_Missense_Mutation_p.P727H			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	727					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CTCCCGTAAGGGTAGCCAAAT	0.413																																					p.P727H		.											.	.	.	0			c.C2180A						.						91.0	84.0	86.0					6																	90472214		2203	4300	6503	SO:0001583	missense	23195	exon16			CGTAAGGGTAGCC	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.2180C>A	6.37:g.90472214G>T	ENSP00000358400:p.Pro727His	Somatic	41	0		WXS	Illumina HiSeq	.	46	3	NM_014611	O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	37	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	G	19.45	3.829520	0.71258	.	.	ENSG00000112159	ENST00000369393;ENST00000428876;ENST00000439638	T;T;T	0.57273	0.41;0.41;0.41	5.86	5.86	0.93980	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	0.000000	0.85682	D	0.000000	T	0.76919	0.4055	M	0.91768	3.24	0.80722	D	1	D;D	0.76494	0.999;0.993	D;D	0.73380	0.977;0.98	T	0.80930	-0.1162	10	0.72032	D	0.01	.	20.1858	0.98214	0.0:0.0:1.0:0.0	.	654;727	Q5T795;Q9NU22	.;MDN1_HUMAN	H	727;727;654	ENSP00000358400:P727H;ENSP00000413970:P727H;ENSP00000409664:P654H	ENSP00000358400:P727H	P	-	2	0	MDN1	90528935	1.000000	0.71417	0.982000	0.44146	0.913000	0.54294	9.476000	0.97823	2.777000	0.95525	0.591000	0.81541	CCC	.		0.413	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2		
DNAH5	1767	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	13865904	13865904	+	Missense_Mutation	SNP	T	T	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr5:13865904T>A	ENST00000265104.4	-	27	4332	c.4228A>T	c.(4228-4230)Aat>Tat	p.N1410Y	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1410	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TGTAGAAGATTTAGTTGCTTC	0.333									Kartagener syndrome																												p.N1410Y		.											.	.	.	0			c.A4228T						.						51.0	54.0	53.0					5																	13865904		2203	4299	6502	SO:0001583	missense	1767	exon27	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	GAAGATTTAGTTG	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.4228A>T	5.37:g.13865904T>A	ENSP00000265104:p.Asn1410Tyr	Somatic	59	0		WXS	Illumina HiSeq	.	70	33	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	T	12.71	2.020894	0.35606	.	.	ENSG00000039139	ENST00000265104	T	0.62364	0.03	5.88	3.48	0.39840	Dynein heavy chain, domain-2 (1);	0.455487	0.25783	N	0.028321	T	0.63628	0.2527	M	0.83118	2.625	0.23076	N	0.998331	B	0.09022	0.002	B	0.23150	0.044	T	0.60047	-0.7339	10	0.66056	D	0.02	.	8.9005	0.35493	0.0:0.0653:0.1277:0.807	.	1410	Q8TE73	DYH5_HUMAN	Y	1410	ENSP00000265104:N1410Y	ENSP00000265104:N1410Y	N	-	1	0	DNAH5	13918904	0.924000	0.31332	0.816000	0.32577	0.985000	0.73830	2.180000	0.42537	0.492000	0.27815	-0.279000	0.10071	AAT	.		0.333	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
MUC4	4585	hgsc.bcm.edu	37	3	195507064	195507064	+	Missense_Mutation	SNP	G	G	C			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr3:195507064G>C	ENST00000463781.3	-	2	11846	c.11387C>G	c.(11386-11388)aCc>aGc	p.T3796S	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T3796S|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T3796S(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGAAGTGTCGGTGACAGGAAG	0.602																																					p.T3796S		.											MUC4_ENST00000463781,NS,carcinoma,0,1	MUC4_ENST00000463781	0	1	Substitution - Missense(1)	endometrium(1)	c.C11387G						.						7.0	7.0	7.0					3																	195507064		638	1493	2131	SO:0001583	missense	4585	exon2			GTGTCGGTGACAG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11387C>G	3.37:g.195507064G>C	ENSP00000417498:p.Thr3796Ser	Somatic	63	0		WXS	Illumina HiSeq	.	92	5	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	5.869	0.344521	0.11126	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.37752	1.26;1.18	.	.	.	.	1.826270	0.06000	U	0.647533	T	0.22475	0.0542	N	0.19112	0.55	0.19300	N	0.999973	P	0.42584	0.784	B	0.39706	0.307	T	0.19451	-1.0305	8	.	.	.	.	5.844	0.18652	9.0E-4:0.0:0.9991:0.0	.	3668	E7ESK3	.	S	3796	ENSP00000417498:T3796S;ENSP00000420243:T3796S	.	T	-	2	0	MUC4	196991843	0.000000	0.05858	0.066000	0.19879	0.066000	0.16364	-0.667000	0.05274	0.064000	0.16427	0.064000	0.15345	ACC	.		0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
TAS2R30	259293	hgsc.bcm.edu	37	12	11286072	11286072	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr12:11286072G>T	ENST00000539585.1	-	1	1171	c.772C>A	c.(772-774)Caa>Aaa	p.Q258K	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_001097643.1	NP_001091112.1	P59541	T2R30_HUMAN	taste receptor, type 2, member 30	258					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	13						AAGACAGGTTGCTTTTCCAGC	0.388																																					p.Q258K		.											TAS2R30,NS,carcinoma,0,1	TAS2R30	0	0			c.C772A						.						133.0	143.0	139.0					12																	11286072		2202	4299	6501	SO:0001583	missense	259293	exon1			CAGGTTGCTTTTC	AX097746, AF494233	CCDS53750.1	12p13.2	2012-08-22				ENSG00000256188		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19112	protein-coding gene	gene with protein product		613963	"""taste receptor, type 2, member 47"""	TAS2R47			Standard	NM_001097643		Approved	T2R30	uc009zhs.1	P59541		ENST00000539585.1:c.772C>A	12.37:g.11286072G>T	ENSP00000444736:p.Gln258Lys	Somatic	101	2		WXS	Illumina HiSeq	.	112	8	NM_001097643	Q645X7	Missense_Mutation	SNP	ENST00000539585.1	37	CCDS53750.1	.	.	.	.	.	.	.	.	.	.	-	0.004	-2.273469	0.00257	.	.	ENSG00000256188	ENST00000539585	T	0.00655	5.95	2.04	-4.08	0.03963	.	.	.	.	.	T	0.00178	0.0005	N	0.00035	-2.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.41963	-0.9479	9	0.02654	T	1	.	3.9342	0.09299	0.0:0.3445:0.1912:0.4643	.	258	P59541	T2R30_HUMAN	K	258	ENSP00000444736:Q258K	ENSP00000444736:Q258K	Q	-	1	0	TAS2R30	11177339	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.866000	0.01647	-1.098000	0.03038	-0.875000	0.02981	CAA	.		0.388	TAS2R30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400238.1	NM_001097643	
ANKS1A	23294	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	34949681	34949681	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr6:34949681C>T	ENST00000360359.3	+	4	788	c.650C>T	c.(649-651)aCc>aTc	p.T217I	ANKS1A_ENST00000535627.1_Missense_Mutation_p.T217I	NM_015245.2	NP_056060.2	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1A	217					ephrin receptor signaling pathway (GO:0048013)|neuron remodeling (GO:0016322)|substrate-dependent cell migration (GO:0006929)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleus (GO:0005634)				cervix(2)|endometrium(3)|large_intestine(4)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						AAGAAGCACACCCCTCTGCAC	0.592																																					p.T217I		.											.	.	.	0			c.C650T						.						140.0	129.0	133.0					6																	34949681		2203	4300	6503	SO:0001583	missense	23294	exon4			AGCACACCCCTCT	D86982	CCDS4798.1	6p21.31	2013-01-10	2006-02-17	2006-02-17	ENSG00000064999	ENSG00000064999		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20961	protein-coding gene	gene with protein product		608994	"""ankyrin repeat and SAM domain containing 1"", ""ankyrin repeat and sterile alpha motif domain containing 1"""	ANKS1		9039502	Standard	NM_015245		Approved	KIAA0229	uc003ojx.4	Q92625	OTTHUMG00000014559	ENST00000360359.3:c.650C>T	6.37:g.34949681C>T	ENSP00000353518:p.Thr217Ile	Somatic	24	0		WXS	Illumina HiSeq	.	35	11	NM_015245	A2RUC1|B4DQW8|Q5JYI9|Q5SYR2|Q86WQ7	Missense_Mutation	SNP	ENST00000360359.3	37	CCDS4798.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.623441	0.87460	.	.	ENSG00000064999	ENST00000544150;ENST00000360359;ENST00000535627	T;T	0.63744	-0.06;-0.06	5.96	5.96	0.96718	Ankyrin repeat-containing domain (3);	0.000000	0.50627	D	0.000106	D	0.84088	0.5395	M	0.93462	3.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	D	0.86899	0.2053	10	0.87932	D	0	-25.5452	20.422	0.99049	0.0:1.0:0.0:0.0	.	217;217	B4DQW8;Q92625	.;ANS1A_HUMAN	I	217	ENSP00000353518:T217I;ENSP00000438752:T217I	ENSP00000353518:T217I	T	+	2	0	ANKS1A	35057659	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.783000	0.85696	2.832000	0.97577	0.655000	0.94253	ACC	.		0.592	ANKS1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040262.1	XM_166478	
ADAM21P1	145241	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	14	70714144	70714144	+	RNA	SNP	A	A	G	rs111296958		TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr14:70714144A>G	ENST00000530196.1	-	0	374					NR_003951.1				ADAM metallopeptidase domain 21 pseudogene 1																		AGAGCTTCTTAACCCTCATAT	0.502																																					.		.											.	.	.	0			.						.																																					145241	.			CTTCTTAACCCTC			14q24.2	2014-03-25	2010-01-12	2010-01-12	ENSG00000235812	ENSG00000235812			19822	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 21 pseudogene"", ""ADAM metallopeptidase domain 21 pseudogene"""	ADAM21P			Standard	NR_003951		Approved		uc010ttg.2		OTTHUMG00000166565		14.37:g.70714144A>G		Somatic	40	0		WXS	Illumina HiSeq	.	39	6	.		RNA	SNP	ENST00000530196.1	37																																																																																				.		0.502	ADAM21P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000390451.1	NG_002467	
MAST4	375449	hgsc.bcm.edu;broad.mit.edu	37	5	66427645	66427645	+	Silent	SNP	A	A	G			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr5:66427645A>G	ENST00000403625.2	+	16	2254	c.1959A>G	c.(1957-1959)ggA>ggG	p.G653G	MAST4_ENST00000261569.7_Silent_p.G459G|MAST4_ENST00000405643.1_Silent_p.G474G|MAST4_ENST00000403666.1_Silent_p.G464G|MAST4_ENST00000404260.3_Silent_p.G656G	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	656	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		TTACAGGGGGAGACTGTGCTA	0.393																																					p.G653G		.											.	.	.	0			c.A1959G						.						116.0	115.0	115.0					5																	66427645		1864	4100	5964	SO:0001819	synonymous_variant	375449	exon16			AGGGGGAGACTGT	AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.1959A>G	5.37:g.66427645A>G		Somatic	91	0		WXS	Illumina HiSeq	.	88	4	NM_001164664	A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Silent	SNP	ENST00000403625.2	37	CCDS54861.1																																																																																			.		0.393	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326324.2		
TRIM51EP	399940	hgsc.bcm.edu;bcgsc.ca	37	11	89591706	89591706	+	IGR	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr11:89591706G>A								TRIM49 (49963 upstream) : TRIM64B (10743 downstream)																							ACACAGGGGAGTGCATACCAA	0.378																																					.		.											.	.	.	0			.						.																																			SO:0001628	intergenic_variant	100847066	.			AGGGGAGTGCATA																													11.37:g.89591706G>A		Somatic	126	0		WXS	Illumina HiSeq	.	108	29	.		RNA	SNP		37																																																																																				.	0	0.378								
SMYD4	114826	hgsc.bcm.edu	37	17	1703342	1703342	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr17:1703342G>A	ENST00000305513.7	-	5	1513	c.1346C>T	c.(1345-1347)gCa>gTa	p.A449V		NM_052928.2	NP_443160.2	Q8IYR2	SMYD4_HUMAN	SET and MYND domain containing 4	449	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.						metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.A449V(1)		breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(5)|stomach(1)	21						TCTGCACAGTGCAGAAACACA	0.458																																					p.A449V		.											SMYD4,NS,carcinoma,0,1	SMYD4	0	1	Substitution - Missense(1)	lung(1)	c.C1346T						.						89.0	79.0	82.0					17																	1703342		2203	4300	6503	SO:0001583	missense	114826	exon5			CACAGTGCAGAAA	AB067523	CCDS11013.1	17p13.3	2004-04-21			ENSG00000186532	ENSG00000186532		"""Zinc fingers, MYND-type"""	21067	protein-coding gene	gene with protein product						11572484	Standard	NM_052928		Approved	KIAA1936, ZMYND21	uc002ftm.4	Q8IYR2	OTTHUMG00000090570	ENST00000305513.7:c.1346C>T	17.37:g.1703342G>A	ENSP00000304360:p.Ala449Val	Somatic	39	0		WXS	Illumina HiSeq	.	31	2	NM_052928	Q8N1P2|Q8NAT0|Q96LV4|Q96PV2	Missense_Mutation	SNP	ENST00000305513.7	37	CCDS11013.1	.	.	.	.	.	.	.	.	.	.	G	13.23	2.176501	0.38413	.	.	ENSG00000186532	ENST00000305513	T	0.10099	2.91	6.03	1.86	0.25419	SET domain (2);	0.301840	0.41294	N	0.000908	T	0.12305	0.0299	M	0.70595	2.14	0.28173	N	0.928509	B	0.17038	0.02	B	0.21708	0.036	T	0.42732	-0.9434	10	0.06891	T	0.86	-1.7258	13.1655	0.59569	0.2395:0.0:0.7605:0.0	.	449	Q8IYR2	SMYD4_HUMAN	V	449	ENSP00000304360:A449V	ENSP00000304360:A449V	A	-	2	0	SMYD4	1650092	0.997000	0.39634	0.833000	0.33012	0.963000	0.63663	3.063000	0.49978	-0.041000	0.13558	-0.797000	0.03246	GCA	.		0.458	SMYD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207108.4	XM_056082	
PTPRH	5794	hgsc.bcm.edu	37	19	55697250	55697250	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr19:55697250G>A	ENST00000376350.3	-	17	2903	c.2881C>T	c.(2881-2883)Cgg>Tgg	p.R961W	PTPRH_ENST00000263434.5_Missense_Mutation_p.R783W	NM_002842.3	NP_002833.3	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	961	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				apoptotic process (GO:0006915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(8)|lung(27)|ovary(2)|prostate(5)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	67		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		AGCAGTTCCCGCACCGTCCAG	0.622																																					p.R961W		.											.	.	.	0			c.C2881T						.						97.0	82.0	87.0					19																	55697250		2203	4300	6503	SO:0001583	missense	5794	exon17			GTTCCCGCACCGT		CCDS33110.1, CCDS54321.1	19q13.4	2013-02-11				ENSG00000080031		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9672	protein-coding gene	gene with protein product		602510				8294459	Standard	XM_006723312		Approved	SAP-1	uc002qjq.3	Q9HD43		ENST00000376350.3:c.2881C>T	19.37:g.55697250G>A	ENSP00000365528:p.Arg961Trp	Somatic	10	0		WXS	Illumina HiSeq	.	19	4	NM_002842	C9JCH2|Q15426|Q2NKN9|Q2NKP0	Missense_Mutation	SNP	ENST00000376350.3	37	CCDS33110.1	.	.	.	.	.	.	.	.	.	.	G	17.71	3.457728	0.63401	.	.	ENSG00000080031	ENST00000376350;ENST00000263434	T;T	0.15952	2.38;2.38	5.06	-0.158	0.13383	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.34676	N	0.003773	T	0.52629	0.1746	H	0.96970	3.915	0.49687	D	0.999817	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.67991	-0.5527	10	0.87932	D	0	.	13.6105	0.62076	0.0:0.0:0.4542:0.5458	.	783;961	C9JCH2;Q9HD43	.;PTPRH_HUMAN	W	961;783	ENSP00000365528:R961W;ENSP00000263434:R783W	ENSP00000263434:R783W	R	-	1	2	PTPRH	60389062	0.664000	0.27457	0.001000	0.08648	0.012000	0.07955	0.837000	0.27558	-0.074000	0.12820	0.650000	0.86243	CGG	.		0.622	PTPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452649.1		
WDR27	253769	hgsc.bcm.edu	37	6	170013745	170013745	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr6:170013745G>A	ENST00000448612.1	-	22	2340	c.2231C>T	c.(2230-2232)tCa>tTa	p.S744L	WDR27_ENST00000423258.1_Missense_Mutation_p.S617L|WDR27_ENST00000546525.1_5'UTR|WDR27_ENST00000333572.6_Missense_Mutation_p.S744L	NM_182552.4	NP_872358.4	A2RRH5	WDR27_HUMAN	WD repeat domain 27	714						nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)|skin(1)	12		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)		GGTTGTAAATGATGAACCCTA	0.423																																					p.S744L		.											WDR27_ENST00000448612,bladder,carcinoma,0,2	WDR27_ENST00000448612	0	0			c.C2231T						.						70.0	69.0	70.0					6																	170013745		1868	4111	5979	SO:0001583	missense	253769	exon22			GTAAATGATGAAC	AK131435	CCDS47520.1, CCDS47520.2, CCDS56459.1	6q27	2013-01-09	2003-06-18		ENSG00000184465	ENSG00000184465		"""WD repeat domain containing"""	21248	protein-coding gene	gene with protein product							Standard	NM_182552		Approved	MGC43690	uc003qwx.3	A2RRH5	OTTHUMG00000016061	ENST00000448612.1:c.2231C>T	6.37:g.170013745G>A	ENSP00000416289:p.Ser744Leu	Somatic	45	0		WXS	Illumina HiSeq	.	37	2	NM_182552	A5PLM8|C9JGV0|Q5T066	Missense_Mutation	SNP	ENST00000448612.1	37	CCDS47520.2	.	.	.	.	.	.	.	.	.	.	G	16.73	3.203296	0.58234	.	.	ENSG00000184465	ENST00000448612;ENST00000333572;ENST00000423258	T;T;T	0.38240	1.79;1.15;1.7	4.88	4.01	0.46588	.	1.117080	0.06928	N	0.810584	T	0.26376	0.0644	N	0.16166	0.38	0.28015	N	0.934761	P;D;P	0.71674	0.773;0.998;0.822	B;D;B	0.66351	0.138;0.943;0.315	T	0.36261	-0.9755	10	0.45353	T	0.12	-0.3203	11.1924	0.48693	0.092:0.0:0.908:0.0	.	744;617;744	F2Z2U5;A2RRH5-2;C9JGV0	.;.;.	L	744;744;617	ENSP00000416289:S744L;ENSP00000330265:S744L;ENSP00000397869:S617L	ENSP00000330265:S744L	S	-	2	0	WDR27	169755670	0.748000	0.28294	0.001000	0.08648	0.027000	0.11550	3.148000	0.50647	1.174000	0.42811	0.585000	0.79938	TCA	.		0.423	WDR27-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000407334.1	NM_182552	
KMT2B	9757	hgsc.bcm.edu	37	19	36213993	36213993	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr19:36213993G>T	ENST00000222270.7	+	6	2819	c.2819G>T	c.(2818-2820)gGt>gTt	p.G940V	KMT2B_ENST00000420124.1_Missense_Mutation_p.G940V|KMT2B_ENST00000607650.1_RNA	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	940					chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										GAGCCCACAGGTTCTGGAGGG	0.642																																					p.G940V		.											.	.	.	0			c.G2819T						.						37.0	47.0	44.0					19																	36213993		2070	4201	6271	SO:0001583	missense	8085	exon6			CCACAGGTTCTGG	AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.2819G>T	19.37:g.36213993G>T	ENSP00000222270:p.Gly940Val	Somatic	50	0		WXS	Illumina HiSeq	.	71	4	NM_014727	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Missense_Mutation	SNP	ENST00000222270.7	37	CCDS46055.1	.	.	.	.	.	.	.	.	.	.	G	8.771	0.925900	0.18056	.	.	ENSG00000105663	ENST00000222270;ENST00000420124	D;D	0.83673	-1.75;-1.75	5.82	4.77	0.60923	.	0.000000	0.41097	D	0.000942	T	0.73877	0.3643	L	0.36672	1.1	0.80722	D	1	B	0.29909	0.261	B	0.20184	0.028	T	0.71922	-0.4446	10	0.45353	T	0.12	.	12.0648	0.53581	0.0:0.0:0.8278:0.1722	.	940	Q9UMN6	MLL4_HUMAN	V	940	ENSP00000222270:G940V;ENSP00000398837:G940V	ENSP00000222270:G940V	G	+	2	0	AD000671.1	40905833	1.000000	0.71417	0.847000	0.33407	0.154000	0.21943	2.891000	0.48617	1.424000	0.47217	0.655000	0.94253	GGT	.		0.642	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014727	
PHKA1	5255	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	71932695	71932695	+	Missense_Mutation	SNP	A	A	G			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chrX:71932695A>G	ENST00000373542.4	-	2	322	c.163T>C	c.(163-165)Tgg>Cgg	p.W55R	PHKA1_ENST00000373539.3_Missense_Mutation_p.W55R|PHKA1_ENST00000541944.1_Missense_Mutation_p.W55R|PHKA1_ENST00000373545.3_Missense_Mutation_p.W55R|PHKA1_ENST00000339490.3_Missense_Mutation_p.W55R|PHKA1-AS1_ENST00000420998.1_RNA	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	55					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					CCCAAACCCCACACAGCCAAG	0.473																																					p.W55R		.											.	.	.	0			c.T163C						.						63.0	53.0	56.0					X																	71932695		2203	4297	6500	SO:0001583	missense	5255	exon2			AACCCCACACAGC		CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.163T>C	X.37:g.71932695A>G	ENSP00000362643:p.Trp55Arg	Somatic	18	0		WXS	Illumina HiSeq	.	27	23	NM_001172436	B7ZL05|B7ZL07|Q2M3D7	Missense_Mutation	SNP	ENST00000373542.4	37	CCDS14421.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.164793	0.78339	.	.	ENSG00000067177	ENST00000373545;ENST00000373542;ENST00000541944;ENST00000339490;ENST00000373539	D;D;D;D;D	0.90324	-2.65;-2.65;-2.65;-2.65;-2.65	4.52	4.52	0.55395	Six-hairpin glycosidase (1);Six-hairpin glycosidase-like (1);Glycoside hydrolase 15-related (1);	0.056535	0.85682	D	0.000000	D	0.96175	0.8753	H	0.94698	3.57	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.96596	0.9441	10	0.87932	D	0	-5.8748	10.9069	0.47086	1.0:0.0:0.0:0.0	.	55;55;55	B7ZL07;P46020-2;P46020	.;.;KPB1_HUMAN	R	55	ENSP00000362646:W55R;ENSP00000362643:W55R;ENSP00000441251:W55R;ENSP00000342469:W55R;ENSP00000362640:W55R	ENSP00000342469:W55R	W	-	1	0	PHKA1	71849420	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.981000	0.93465	1.773000	0.52216	0.486000	0.48141	TGG	.		0.473	PHKA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058896.1		
ADRM1	11047	hgsc.bcm.edu	37	20	60879633	60879633	+	Splice_Site	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr20:60879633G>T	ENST00000253003.2	+	3	376	c.330G>T	c.(328-330)caG>caT	p.Q110H	RP11-157P1.4_ENST00000414042.1_RNA|ADRM1_ENST00000462554.1_Intron	NM_007002.2|NM_175573.1	NP_008933.2|NP_783163.1	Q16186	ADRM1_HUMAN	adhesion regulating molecule 1	110	Interaction with PSMD1.|PH.				positive regulation of endopeptidase activity (GO:0010950)|proteasome assembly (GO:0043248)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)	endopeptidase activator activity (GO:0061133)|protease binding (GO:0002020)|proteasome binding (GO:0070628)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|urinary_tract(1)	5	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;2.51e-06)			TCTGGATGCAGGTATGGGGCA	0.557																																					p.Q110H		.											.	.	.	0			c.G330T						.						159.0	156.0	157.0					20																	60879633		2203	4298	6501	SO:0001630	splice_region_variant	11047	exon3			GATGCAGGTATGG	D64154	CCDS13496.1, CCDS74747.1	20q13.33	2008-05-22			ENSG00000130706	ENSG00000130706			15759	protein-coding gene	gene with protein product		610650				8033103	Standard	NM_007002		Approved	GP110, Rpn13, ARM1	uc002yco.3	Q16186	OTTHUMG00000032904	ENST00000253003.2:c.330+1G>T	20.37:g.60879633G>T		Somatic	42	0		WXS	Illumina HiSeq	.	46	2	NM_175573	A0PKB1|Q96FJ7|Q9H1P2	Missense_Mutation	SNP	ENST00000253003.2	37	CCDS13496.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.383954	0.82792	.	.	ENSG00000130706	ENST00000370744;ENST00000253003	.	.	.	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	D	0.87732	0.6251	H	0.96547	3.84	0.80722	D	1	D;D	0.89917	1.0;0.981	D;D	0.91635	0.999;0.988	D	0.92062	0.5657	9	0.87932	D	0	-14.5783	17.4309	0.87539	0.0:0.0:1.0:0.0	.	110;110	B4DMP7;Q16186	.;ADRM1_HUMAN	H	110	.	ENSP00000253003:Q110H	Q	+	3	2	ADRM1	60313028	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	6.249000	0.72427	2.209000	0.71365	0.655000	0.94253	CAG	.		0.557	ADRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080007.1		Missense_Mutation
RC3H2	54542	hgsc.bcm.edu	37	9	125613429	125613429	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr9:125613429G>T	ENST00000373670.1	-	19	3911	c.3311C>A	c.(3310-3312)cCa>cAa	p.P1104Q	RC3H2_ENST00000357244.2_Missense_Mutation_p.P1104Q			Q9HBD1	RC3H2_HUMAN	ring finger and CCCH-type domains 2	1104					B cell homeostasis (GO:0001782)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymph node development (GO:0048535)|multicellular organism growth (GO:0035264)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|post-embryonic development (GO:0009791)|posttranscriptional regulation of gene expression (GO:0010608)|protein polyubiquitination (GO:0000209)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(6)|large_intestine(4)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33						CTGCTGTACTGGATGCCCATT	0.388																																					p.P1104Q		.											RC3H2,right_lower_lobe,carcinoma,0,1	RC3H2	0	0			c.C3311A						.						174.0	167.0	169.0					9																	125613429		1951	4152	6103	SO:0001583	missense	54542	exon20			TGTACTGGATGCC	AK000308	CCDS43874.1, CCDS48014.1	9q34	2013-01-18	2010-09-15	2007-02-06	ENSG00000056586	ENSG00000056586		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	21461	protein-coding gene	gene with protein product		615231	"""membrane associated DNA binding protein"", ""ring finger and CCCH-type zinc finger domains 2"""	MNAB		10938276	Standard	NM_001100588		Approved	FLJ20301, FLJ20713, RNF164	uc010mwc.1	Q9HBD1	OTTHUMG00000020632	ENST00000373670.1:c.3311C>A	9.37:g.125613429G>T	ENSP00000362774:p.Pro1104Gln	Somatic	45	0		WXS	Illumina HiSeq	.	34	2	NM_001100588	Q4VXB1|Q5JPD7|Q86ST6|Q8N3D6|Q96F27|Q9H5J2|Q9HBD2|Q9NWN9|Q9NXE1	Missense_Mutation	SNP	ENST00000373670.1	37	CCDS43874.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.43|15.43	2.830466|2.830466	0.50845|0.50845	.|.	.|.	ENSG00000056586|ENSG00000056586	ENST00000373670;ENST00000357244|ENST00000454740	T;T|.	0.43688|.	0.94;0.94|.	5.89|5.89	5.89|5.89	0.94794|0.94794	.|.	0.297846|.	0.29362|.	N|.	0.012378|.	T|T	0.37461|0.37461	0.1004|0.1004	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	B|.	0.32693|.	0.38|.	B|.	0.31869|.	0.137|.	T|T	0.27054|0.27054	-1.0085|-1.0085	10|5	0.72032|.	D|.	0.01|.	-16.3039|-16.3039	12.6961|12.6961	0.57005|0.57005	0.0776:0.0:0.9224:0.0|0.0776:0.0:0.9224:0.0	.|.	1104|.	Q9HBD1|.	RC3H2_HUMAN|.	Q|K	1104|163	ENSP00000362774:P1104Q;ENSP00000349783:P1104Q|.	ENSP00000349783:P1104Q|.	P|Q	-|-	2|1	0|0	RC3H2|RC3H2	124653250|124653250	0.970000|0.970000	0.33590|0.33590	1.000000|1.000000	0.80357|0.80357	0.977000|0.977000	0.68977|0.68977	2.862000|2.862000	0.48388|0.48388	2.793000|2.793000	0.96121|0.96121	0.655000|0.655000	0.94253|0.94253	CCA|CAG	.		0.388	RC3H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053966.1	NM_018835	
LRFN4	78999	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	66625573	66625573	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr11:66625573G>A	ENST00000309602.4	+	1	601	c.358G>A	c.(358-360)Gtc>Atc	p.V120I	PC_ENST00000393960.1_Intron|PC_ENST00000393955.2_Intron|PC_ENST00000393958.2_Intron|LRFN4_ENST00000393952.3_Missense_Mutation_p.V120I	NM_024036.4	NP_076941.2	Q6PJG9	LRFN4_HUMAN	leucine rich repeat and fibronectin type III domain containing 4	120						integral component of membrane (GO:0016021)				breast(1)|lung(1)|prostate(1)	3						CCGGGGCCCCGTCAATCTGCA	0.682																																					p.V120I		.											.	.	.	0			c.G358A						.						38.0	45.0	43.0					11																	66625573		2198	4293	6491	SO:0001583	missense	78999	exon1			GGCCCCGTCAATC	BC007718	CCDS8153.1	11q13.1	2013-02-11				ENSG00000173621		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	28456	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 6"""	612810				16495444, 16828986	Standard	NM_024036		Approved	MGC3103, SALM3., FIGLER6	uc001ojr.3	Q6PJG9		ENST00000309602.4:c.358G>A	11.37:g.66625573G>A	ENSP00000312535:p.Val120Ile	Somatic	29	0		WXS	Illumina HiSeq	.	119	9	NM_024036	Q4VBZ3|Q59GV4|Q8N644|Q9BWJ0	Missense_Mutation	SNP	ENST00000309602.4	37	CCDS8153.1	.	.	.	.	.	.	.	.	.	.	G	4.153	0.026849	0.08054	.	.	ENSG00000173621	ENST00000393952;ENST00000309602;ENST00000525479	T;T	0.57107	0.42;0.42	4.17	-0.961	0.10337	.	0.690856	0.12584	N	0.456144	T	0.31918	0.0812	N	0.19112	0.55	0.23271	N	0.998004	B;B	0.15473	0.013;0.003	B;B	0.18263	0.021;0.013	T	0.21827	-1.0234	10	0.21014	T	0.42	.	8.5007	0.33156	0.4752:0.0:0.5248:0.0	.	120;120	E9PLQ1;Q6PJG9	.;LRFN4_HUMAN	I	120	ENSP00000377524:V120I;ENSP00000312535:V120I	ENSP00000312535:V120I	V	+	1	0	LRFN4	66382149	0.000000	0.05858	0.889000	0.34880	0.173000	0.22820	-1.809000	0.01731	-0.059000	0.13154	-0.680000	0.03767	GTC	.		0.682	LRFN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393127.1	NM_024036	
CUBNP3	100421634	hgsc.bcm.edu	37	10	45643042	45643042	+	RNA	SNP	C	C	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr10:45643042C>A	ENST00000427229.2	+	0	86																											GGATCTAGGCCGTATGGAGGA	0.408																																					.		.											.	.	.	0			.						.																																					100133308	.			CTAGGCCGTATGG																													10.37:g.45643042C>A		Somatic	45	0		WXS	Illumina HiSeq	.	42	3	.		RNA	SNP	ENST00000427229.2	37																																																																																				.		0.408	RP11-445N18.7-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript	OTTHUMT00000470688.1		
RAD1	5810	hgsc.bcm.edu	37	5	34915888	34915888	+	De_novo_Start_OutOfFrame	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr5:34915888G>T	ENST00000382038.2	-	0	983				BRIX1_ENST00000336767.5_Missense_Mutation_p.Q15H|RAD1_ENST00000341754.4_Intron|BRIX1_ENST00000506023.1_3'UTR	NM_002853.3	NP_002844.1	O60671	RAD1_HUMAN	RAD1 checkpoint DNA exonuclease						cellular response to DNA damage stimulus (GO:0006974)|cellular response to ionizing radiation (GO:0071479)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|meiotic recombination checkpoint (GO:0051598)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|substantia nigra development (GO:0021762)	chromosome (GO:0005694)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|damaged DNA binding (GO:0003684)|exodeoxyribonuclease III activity (GO:0008853)			endometrium(3)|large_intestine(1)|lung(5)|urinary_tract(1)	10	all_lung(31;0.000107)	Lung NSC(810;5.19e-05)|Ovarian(839;0.0448)|Breast(839;0.198)	COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)			TTGCAGTTCAGGCGAAGAAGC	0.617								Other conserved DNA damage response genes																													p.Q15H		.											.	.	.	0			c.G45T						.						47.0	52.0	50.0					5																	34915888		2192	4291	6483			55299	exon1			AGTTCAGGCGAAG	AF074717	CCDS3905.1	5p13	2014-08-08	2014-08-08		ENSG00000113456	ENSG00000113456	3.1.11.2		9806	protein-coding gene	gene with protein product	"""exonuclease homolog RAD1"", ""checkpoint control protein HRAD1"", ""cell cycle checkpoint protein Hrad1"", ""Rad1-like DNA damage checkpoint"", ""DNA repair exonuclease REC1"""	603153	"""RAD1 (S. pombe) homolog"", ""RAD1 homolog (S. pombe)"""			9716408, 9828137	Standard	NR_026591		Approved	HRAD1, REC1	uc003jix.3	O60671	OTTHUMG00000090783	ENST00000382038.2:c.-437C>A	5.37:g.34915888G>T		Somatic	84	0		WXS	Illumina HiSeq	.	85	3	NM_018321	O75572|O95304|Q1W161|Q5KSM0|Q5KSM1|Q9UEP1	Missense_Mutation	SNP	ENST00000382038.2	37	CCDS3905.1	.	.	.	.	.	.	.	.	.	.	g	12.67	2.007884	0.35415	.	.	ENSG00000113460	ENST00000336767	T	0.44482	0.92	4.91	3.78	0.43462	.	0.331424	0.30879	N	0.008697	T	0.29423	0.0733	L	0.36672	1.1	0.26613	N	0.972794	P;P	0.39964	0.511;0.697	B;B	0.35510	0.125;0.204	T	0.15178	-1.0446	10	0.51188	T	0.08	-1.9009	8.886	0.35402	0.1367:0.0:0.8633:0.0	.	15;15	B4E0B8;Q8TDN6	.;BRX1_HUMAN	H	15	ENSP00000338862:Q15H	ENSP00000338862:Q15H	Q	+	3	2	BRIX1	34951645	0.242000	0.23868	0.944000	0.38274	0.348000	0.29142	1.720000	0.38022	0.945000	0.37605	0.651000	0.88453	CAG	.		0.617	RAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207567.1	NM_002853	
OR4K1	79544	hgsc.bcm.edu	37	14	20404579	20404579	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr14:20404579G>T	ENST00000285600.4	+	1	813	c.754G>T	c.(754-756)Ggg>Tgg	p.G252W		NM_001004063.2	NP_001004063.2	Q8NGD4	OR4K1_HUMAN	olfactory receptor, family 4, subfamily K, member 1	252						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(24)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	43	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00124)		TCTTTTCTTCGGGCCTTGCAT	0.438																																					p.G252W		.											OR4K1,NS,carcinoma,0,1	OR4K1	0	0			c.G754T						.						128.0	127.0	127.0					14																	20404579		2203	4300	6503	SO:0001583	missense	79544	exon1			TTCTTCGGGCCTT		CCDS32025.1	14q11.2	2013-09-23			ENSG00000155249	ENSG00000155249		"""GPCR / Class A : Olfactory receptors"""	14726	protein-coding gene	gene with protein product							Standard	NM_001004063		Approved		uc001vwj.2	Q8NGD4	OTTHUMG00000170633	ENST00000285600.4:c.754G>T	14.37:g.20404579G>T	ENSP00000285600:p.Gly252Trp	Somatic	60	0		WXS	Illumina HiSeq	.	47	2	NM_001004063	B9EKV9|Q8NGD6|Q96R73	Missense_Mutation	SNP	ENST00000285600.4	37	CCDS32025.1	.	.	.	.	.	.	.	.	.	.	.	11.30	1.597042	0.28445	.	.	ENSG00000155249	ENST00000285600	T	0.39229	1.09	5.09	3.25	0.37280	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000022	T	0.74913	0.3779	H	0.99261	4.49	0.28773	N	0.900244	D	0.89917	1.0	D	0.97110	1.0	T	0.71457	-0.4587	10	0.87932	D	0	.	6.2927	0.21069	0.0931:0.0:0.7251:0.1818	.	252	Q8NGD4	OR4K1_HUMAN	W	252	ENSP00000285600:G252W	ENSP00000285600:G252W	G	+	1	0	OR4K1	19474419	0.000000	0.05858	0.945000	0.38365	0.460000	0.32559	-0.166000	0.09954	0.723000	0.32274	-0.182000	0.12963	GGG	.		0.438	OR4K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409881.1		
MARCO	8685	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	119739044	119739044	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr2:119739044C>A	ENST00000327097.4	+	9	961	c.826C>A	c.(826-828)Cag>Aag	p.Q276K	MARCO_ENST00000541757.1_Missense_Mutation_p.Q198K	NM_006770.3	NP_006761.1	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure	276	Collagen-like.				apoptotic cell clearance (GO:0043277)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(12)|lung(37)|ovary(4)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	70						TCCTGGAGCCCAGGGGAGTAA	0.522																																					p.Q276K	GBM(8;18 374 7467 11269 32796)	.											.	.	.	0			c.C826A						.						33.0	34.0	34.0					2																	119739044		2203	4300	6503	SO:0001583	missense	8685	exon9			GGAGCCCAGGGGA	AF035819	CCDS2124.1	2q14.2	2011-10-11			ENSG00000019169	ENSG00000019169			6895	protein-coding gene	gene with protein product	"""scavenger receptor class A, member 2"""	604870				9468508, 7867067, 10331948	Standard	NM_006770		Approved	SCARA2	uc002tln.1	Q9UEW3	OTTHUMG00000131400	ENST00000327097.4:c.826C>A	2.37:g.119739044C>A	ENSP00000318916:p.Gln276Lys	Somatic	61	0		WXS	Illumina HiSeq	.	38	11	NM_006770	B4DW79|Q9Y5S3	Missense_Mutation	SNP	ENST00000327097.4	37	CCDS2124.1	.	.	.	.	.	.	.	.	.	.	C	10.59	1.391931	0.25118	.	.	ENSG00000019169	ENST00000327097;ENST00000410021;ENST00000541757	D;D	0.83591	-1.74;-1.74	5.33	4.46	0.54185	.	0.909201	0.09429	N	0.803296	T	0.73505	0.3595	N	0.20986	0.625	0.09310	N	1	B	0.25441	0.126	B	0.28916	0.096	T	0.60094	-0.7330	9	.	.	.	.	9.903	0.41359	0.0:0.9085:0.0:0.0915	.	276	Q9UEW3	MARCO_HUMAN	K	276;276;198	ENSP00000318916:Q276K;ENSP00000441769:Q198K	.	Q	+	1	0	MARCO	119455514	0.006000	0.16342	0.020000	0.16555	0.947000	0.59692	2.288000	0.43514	1.487000	0.48415	0.655000	0.94253	CAG	.		0.522	MARCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254190.2	NM_006770	
ELN	2006	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	73474351	73474351	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr7:73474351C>A	ENST00000252034.7	+	23	1949	c.1550C>A	c.(1549-1551)cCc>cAc	p.P517H	ELN_ENST00000380562.4_Missense_Mutation_p.P523H|ELN_ENST00000380576.5_Missense_Mutation_p.P498H|ELN_ENST00000320492.7_Missense_Mutation_p.P436H|ELN_ENST00000358929.4_Missense_Mutation_p.P552H|ELN_ENST00000320399.6_Missense_Mutation_p.P517H|ELN_ENST00000429192.1_Missense_Mutation_p.P503H|CTB-51J22.1_ENST00000435932.1_RNA|ELN_ENST00000414324.1_Missense_Mutation_p.P493H|ELN_ENST00000458204.1_Missense_Mutation_p.P507H|ELN_ENST00000357036.5_Missense_Mutation_p.P522H|ELN_ENST00000445912.1_Missense_Mutation_p.P517H|ELN_ENST00000380553.4_Missense_Mutation_p.P381H|ELN_ENST00000380584.4_Missense_Mutation_p.P484H|ELN_ENST00000380575.4_Missense_Mutation_p.P488H	NM_000501.2|NM_001278915.1	NP_000492.2|NP_001265844.1	P15502	ELN_HUMAN	elastin	0	Ala-rich.				blood circulation (GO:0008015)|blood vessel remodeling (GO:0001974)|cell proliferation (GO:0008283)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|organ morphogenesis (GO:0009887)|regulation of actin filament polymerization (GO:0030833)|respiratory gaseous exchange (GO:0007585)|skeletal muscle tissue development (GO:0007519)|stress fiber assembly (GO:0043149)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(4)|pancreas(2)|prostate(1)|skin(2)|stomach(1)	32		Lung NSC(55;0.159)				GGCGTGGCTCCCGGCATTGGC	0.652			T	PAX5	B-ALL		"""Supravalvular Aortic Stenosis, Cutis laxa , Williams-Beuren Syndrome"""																														p.P522H		.		Dom	yes		7	7q11.23	2006	elastin	yes	L	.	.	.	0			c.C1565A						.						111.0	105.0	107.0					7																	73474351		2203	4300	6503	SO:0001583	missense	2006	exon23			TGGCTCCCGGCAT		CCDS5562.2, CCDS43598.1, CCDS43599.1, CCDS47611.1, CCDS47612.1, CCDS64673.1, CCDS64674.1, CCDS64675.1, CCDS64676.1, CCDS64677.1, CCDS64678.1, CCDS75616.1, CCDS75617.1	7q11.1-q21.1	2008-08-01	2008-08-01		ENSG00000049540	ENSG00000049540			3327	protein-coding gene	gene with protein product	"""tropoelastin"", ""supravalvular aortic stenosis"", ""Williams-Beuren syndrome"""	130160				8096434	Standard	NM_001278939		Approved	WBS, WS, SVAS	uc003tzn.3	P15502	OTTHUMG00000150229	ENST00000252034.7:c.1550C>A	7.37:g.73474351C>A	ENSP00000252034:p.Pro517His	Somatic	85	0		WXS	Illumina HiSeq	.	80	15	NM_001081754	B3KTS6|O15336|O15337|Q14233|Q14234|Q14235|Q14238|Q6P0L4|Q6ZWJ6|Q75MU5|Q7Z316|Q7Z3F5|Q9UMF5	Missense_Mutation	SNP	ENST00000252034.7	37	CCDS5562.2	.	.	.	.	.	.	.	.	.	.	C	12.35	1.912620	0.33721	.	.	ENSG00000049540	ENST00000445912;ENST00000252034;ENST00000358929;ENST00000320492;ENST00000414324;ENST00000380562;ENST00000380575;ENST00000380584;ENST00000458204;ENST00000357036;ENST00000429192;ENST00000442462;ENST00000380553;ENST00000380576;ENST00000320399	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.42900	1.12;1.25;1.09;1.29;0.96;1.09;1.12;1.36;1.22;1.22;1.04;0.98;1.1;1.14	4.2	2.24	0.28232	.	.	.	.	.	T	0.47135	0.1429	.	.	.	0.09310	N	1	P;P;P;P;P;P;P;P;P;P;P;P;P	0.49447	0.924;0.924;0.924;0.924;0.924;0.924;0.924;0.924;0.924;0.924;0.924;0.924;0.924	P;P;P;P;P;P;P;P;P;P;P;P;P	0.53313	0.723;0.723;0.723;0.723;0.723;0.723;0.723;0.723;0.723;0.723;0.723;0.723;0.723	T	0.26985	-1.0087	8	0.49607	T	0.09	.	7.1884	0.25813	0.0:0.6568:0.2419:0.1014	.	517;436;493;507;523;488;503;522;498;381;428;484;517	E7ENM0;G5E950;G3V0G6;E7EN65;P15502-1;P15502-7;P15502-12;P15502-5;P15502-13;P15502-11;B3KRT8;P15502-8;P15502-2	.;.;.;.;.;.;.;.;.;.;.;.;.	H	517;517;552;436;493;523;488;484;507;522;503;456;381;498;517	ENSP00000389857:P517H;ENSP00000252034:P517H;ENSP00000351807:P552H;ENSP00000315607:P436H;ENSP00000392575:P493H;ENSP00000369936:P523H;ENSP00000369949:P488H;ENSP00000369958:P484H;ENSP00000403162:P507H;ENSP00000349540:P522H;ENSP00000391129:P503H;ENSP00000369926:P381H;ENSP00000369950:P498H;ENSP00000313565:P517H	ENSP00000252034:P517H	P	+	2	0	ELN	73112287	0.007000	0.16637	0.003000	0.11579	0.021000	0.10359	1.492000	0.35594	0.402000	0.25451	0.650000	0.86243	CCC	.		0.652	ELN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316913.1	NM_000501	
PPAP2A	8611	hgsc.bcm.edu	37	5	54825063	54825063	+	Intron	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr5:54825063G>A	ENST00000307259.8	-	1	479				PPAP2A_ENST00000264775.5_Intron|PPAP2A_ENST00000515132.1_Intron	NM_003711.2	NP_003702.2	O14494	LPP1_HUMAN	phosphatidic acid phosphatase type 2A						androgen receptor signaling pathway (GO:0030521)|germ cell migration (GO:0008354)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|lipid metabolic process (GO:0006629)|negative regulation of cell proliferation (GO:0008285)|phospholipid dephosphorylation (GO:0046839)|protein dephosphorylation (GO:0006470)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of lipid metabolic process (GO:0019216)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidate phosphatase activity (GO:0008195)			breast(2)|endometrium(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	9		Lung NSC(810;4.08e-05)|Prostate(74;0.0181)|Breast(144;0.0544)				CTGAAAAACTGcatacacaca	0.279																																					.		.											.	.	.	0			.						.																																			SO:0001627	intron_variant	379013	.			AAAACTGCATACA	AB000888	CCDS34159.1, CCDS34160.1	5q11	2009-05-27			ENSG00000067113	ENSG00000067113	3.1.3.4		9228	protein-coding gene	gene with protein product		607124				9305923	Standard	NM_003711		Approved	PAP-2a, LPP1	uc003jpz.4	O14494	OTTHUMG00000162240	ENST00000307259.8:c.58+5336C>T	5.37:g.54825063G>A		Somatic	66	0		WXS	Illumina HiSeq	.	75	4	.	B7ZKN8|G3XA95|O60457|O60463|Q17RZ4	RNA	SNP	ENST00000307259.8	37	CCDS34159.1																																																																																			.		0.279	PPAP2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368073.1		
CSMD2	114784	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	34238182	34238182	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr1:34238182G>A	ENST00000338325.1	-	7	1070	c.658C>T	c.(658-660)Cca>Tca	p.P220S	CSMD2_ENST00000373381.4_Missense_Mutation_p.P612S			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	572	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P572S(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				ACGCAGCCTGGCTTCTTAGCC	0.592																																					p.P572S		.											CSMD2,NS,carcinoma,0,1	CSMD2	0	1	Substitution - Missense(1)	endometrium(1)	c.C1714T						.						121.0	107.0	112.0					1																	34238182		2203	4300	6503	SO:0001583	missense	114784	exon13			AGCCTGGCTTCTT	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000338325.1:c.658C>T	1.37:g.34238182G>A	ENSP00000340311:p.Pro220Ser	Somatic	7	0		WXS	Illumina HiSeq	.	10	5	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000338325.1	37		.	.	.	.	.	.	.	.	.	.	G	33	5.261285	0.95368	.	.	ENSG00000121904	ENST00000373381;ENST00000338325	T;T	0.76968	-1.06;-1.06	5.92	5.92	0.95590	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	D	0.93321	0.7871	H	0.98629	4.285	0.80722	D	1	P;D	0.89917	0.944;1.0	D;D	0.85130	0.928;0.997	D	0.95232	0.8343	10	0.72032	D	0.01	.	18.8845	0.92370	0.0:0.0:1.0:0.0	.	572;612	Q7Z408;E7EUA6	CSMD2_HUMAN;.	S	612;220	ENSP00000362479:P612S;ENSP00000340311:P220S	ENSP00000241312:P572S	P	-	1	0	CSMD2	34010769	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.841000	0.99482	2.813000	0.96785	0.561000	0.74099	CCA	.		0.592	CSMD2-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000036404.2	NM_052896	
LINC00467	84791	hgsc.bcm.edu	37	1	211591370	211591370	+	RNA	SNP	G	G	A	rs201196913		TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr1:211591370G>A	ENST00000423222.1	+	0	420					NR_026761.2		Q9BRT7	CA097_HUMAN	long intergenic non-protein coding RNA 467																		AAaaaaaaaagaaaaattttt	0.303																																					.		.											.	.	.	0			.						.																																					84791	.			AAAAAAGAAAAAT	BC005997		1q32.3	2014-03-04	2013-12-05	2013-12-05	ENSG00000153363	ENSG00000153363		"""Long non-coding RNAs"""	28227	non-coding RNA	RNA, long non-coding			"""chromosome 1 open reading frame 97"""	C1orf97		24586304	Standard	NR_026761		Approved	MGC14801	uc001hil.4	Q9BRT7	OTTHUMG00000036998		1.37:g.211591370G>A		Somatic	26	0		WXS	Illumina HiSeq	.	43	4	.		RNA	SNP	ENST00000423222.1	37																																																																																				.		0.303	LINC00467-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000089831.3	NR_026761	
VPS33B	26276	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	91544680	91544680	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr15:91544680T>C	ENST00000333371.3	-	19	1771	c.1418A>G	c.(1417-1419)gAt>gGt	p.D473G	VPS33B_ENST00000535906.1_Missense_Mutation_p.D446G|VPS33B_ENST00000535843.1_Missense_Mutation_p.D382G	NM_018668.3	NP_061138.3	Q9H267	VP33B_HUMAN	vacuolar protein sorting 33 homolog B (yeast)	473					lysosome localization (GO:0032418)|melanosome localization (GO:0032400)|membrane fusion (GO:0061025)|platelet alpha granule organization (GO:0070889)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule (GO:0031091)				central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|stomach(2)	16	Lung NSC(78;0.0987)|all_lung(78;0.175)					ACTGAAGGCATCAGTAATCTT	0.473																																					p.D473G		.											.	.	.	0			c.A1418G						.						115.0	105.0	108.0					15																	91544680		2198	4298	6496	SO:0001583	missense	26276	exon19			AAGGCATCAGTAA	AF201694	CCDS10369.1, CCDS73783.1	15q26.1	2006-12-19	2006-12-19		ENSG00000184056	ENSG00000184056			12712	protein-coding gene	gene with protein product		608552	"""vacuolar protein sorting 33B (yeast homolog)"""			8996080	Standard	XM_005254887		Approved	FLJ14848	uc002bqp.1	Q9H267	OTTHUMG00000149835	ENST00000333371.3:c.1418A>G	15.37:g.91544680T>C	ENSP00000327650:p.Asp473Gly	Somatic	42	0		WXS	Illumina HiSeq	.	45	23	NM_018668	B3KQF6|Q96K14|Q9NRP6|Q9NSF3	Missense_Mutation	SNP	ENST00000333371.3	37	CCDS10369.1	.	.	.	.	.	.	.	.	.	.	T	17.28	3.349522	0.61183	.	.	ENSG00000184056	ENST00000333371;ENST00000535906;ENST00000535843;ENST00000537510	T;T;T	0.58797	0.32;0.31;0.9	5.89	5.89	0.94794	.	0.053328	0.85682	D	0.000000	T	0.65831	0.2729	L	0.34521	1.04	0.80722	D	1	D;D	0.69078	0.996;0.997	D;D	0.83275	0.993;0.996	T	0.61267	-0.7097	10	0.22109	T	0.4	-33.9645	16.0173	0.80450	0.0:0.0:0.0:1.0	.	446;473	F5H008;Q9H267	.;VP33B_HUMAN	G	473;446;382;428	ENSP00000327650:D473G;ENSP00000444053:D446G;ENSP00000446267:D382G	ENSP00000327650:D473G	D	-	2	0	VPS33B	89345684	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.894000	0.75655	2.254000	0.74563	0.529000	0.55759	GAT	.		0.473	VPS33B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313496.1	NM_018668	
WDR11	55717	hgsc.bcm.edu	37	10	122648768	122648768	+	3'UTR	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr10:122648768G>T	ENST00000604509.1	+	0	2195				WDR11_ENST00000263461.6_Intron			Q8WWQ0	PHIP_HUMAN	WD repeat domain 11						cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(9)|prostate(2)|skin(2)|stomach(5)	38						ttgttttgttgagatggtgtc	0.443																																					.		.											.	.	.	0			.						.																																			SO:0001624	3_prime_UTR_variant	100847064	.			TTTGTTGAGATGG	AF320223	CCDS7619.1	10q26	2013-01-21	2010-01-06	2010-01-06	ENSG00000120008	ENSG00000120008		"""WD repeat domain containing"""	13831	protein-coding gene	gene with protein product		606417	"""bromodomain and WD repeat domain containing 2"""	BRWD2		10718198, 11536051	Standard	NM_018117		Approved	KIAA1351, FLJ10506, WDR15, HH14, DR11	uc021pzt.1	Q9BZH6	OTTHUMG00000019171	ENST00000604509.1:c.*2192G>T	10.37:g.122648768G>T		Somatic	11	0		WXS	Illumina HiSeq	.	20	8	.	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	RNA	SNP	ENST00000604509.1	37																																																																																				.		0.443	WDR11-006	KNOWN	non_canonical_U12|basic	processed_transcript	protein_coding	OTTHUMT00000468479.1		
MT-ND2	4536	hgsc.bcm.edu;broad.mit.edu	37	M	2776	2776	+	5'Flank	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chrM:2776G>A	ENST00000361453.3	+	0	0				MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TI_ENST00000387365.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						AACAAACCCACAGGTCCTAAA	0.473																																					.		.											.	.	.	0			.						.																																			SO:0001631	upstream_gene_variant	6053	.			CCCACAGGTCCTA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.2776G>A	Exception_encountered	Somatic	354	0		WXS	Illumina HiSeq	.	892	827	.	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	ENST00000361453.3	37																																																																																				.		0.473	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024027	
LPO	4025	hgsc.bcm.edu	37	17	56343531	56343531	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr17:56343531G>T	ENST00000262290.4	+	11	1853	c.1537G>T	c.(1537-1539)Gtg>Ttg	p.V513L	LPO_ENST00000421678.2_Missense_Mutation_p.V430L|LPO_ENST00000582328.1_Missense_Mutation_p.V430L|LPO_ENST00000543544.1_Missense_Mutation_p.V454L	NM_006151.2	NP_006142.1	P22079	PERL_HUMAN	lactoperoxidase	513					defense response to bacterium (GO:0042742)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|hydrogen peroxide catabolic process (GO:0042744)|response to oxidative stress (GO:0006979)|thiocyanate metabolic process (GO:0018969)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|thiocyanate peroxidase activity (GO:0036393)			breast(5)|cervix(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30						TGATCCTCTGGTGCGGGGCCT	0.527																																					p.V513L		.											.	.	.	0			c.G1537T						.						53.0	47.0	49.0					17																	56343531		2203	4300	6503	SO:0001583	missense	4025	exon11			CCTCTGGTGCGGG	M58151	CCDS32689.1, CCDS54149.1	17q23.1	2008-02-05				ENSG00000167419	1.11.1.7		6678	protein-coding gene	gene with protein product		150205				2222811, 8964511	Standard	NM_006151		Approved	SPO	uc002ivt.3	P22079		ENST00000262290.4:c.1537G>T	17.37:g.56343531G>T	ENSP00000262290:p.Val513Leu	Somatic	31	0		WXS	Illumina HiSeq	.	40	3	NM_006151	A5JUY4|E7EMJ3|Q13408|Q3KNQ2	Missense_Mutation	SNP	ENST00000262290.4	37	CCDS32689.1	.	.	.	.	.	.	.	.	.	.	G	2.617	-0.289525	0.05605	.	.	ENSG00000167419	ENST00000262290;ENST00000421678;ENST00000543544;ENST00000389576	T;T;T	0.62364	0.03;0.03;0.03	6.06	1.72	0.24424	.	0.419988	0.26549	N	0.023760	T	0.24470	0.0593	N	0.02985	-0.445	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.06405	0.001;0.002	T	0.22800	-1.0206	10	0.02654	T	1	-9.2339	1.6414	0.02753	0.223:0.2598:0.3837:0.1336	.	430;513	E7EMJ3;P22079	.;PERL_HUMAN	L	513;430;454;258	ENSP00000262290:V513L;ENSP00000400245:V430L;ENSP00000445344:V454L	ENSP00000262290:V513L	V	+	1	0	LPO	53698530	0.002000	0.14202	0.964000	0.40570	0.998000	0.95712	-0.287000	0.08388	0.109000	0.17891	0.655000	0.94253	GTG	.		0.527	LPO-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443961.1		
OTUD4	54726	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	4	146065546	146065546	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr4:146065546G>T	ENST00000447906.2	-	15	1650	c.1463C>A	c.(1462-1464)cCa>cAa	p.P488Q	OTUD4_ENST00000454497.2_Missense_Mutation_p.P423Q|OTUD4_ENST00000455611.2_5'UTR			Q01804	OTUD4_HUMAN	OTU deubiquitinase 4	488					protein K48-linked deubiquitination (GO:0071108)		poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(180;0.151)					CTGGACACATGGATTGCTACT	0.378																																					p.P423Q		.											.	.	.	0			c.C1268A						.						202.0	196.0	198.0					4																	146065546		2203	4300	6503	SO:0001583	missense	54726	exon15			ACACATGGATTGC		CCDS3764.1, CCDS47139.1	4q31.21	2014-02-24	2014-02-24		ENSG00000164164	ENSG00000164164		"""OTU domain containing"""	24949	protein-coding gene	gene with protein product		611744	"""OTU domain containing 4"""			1475186, 12727813, 19996094	Standard	NM_001102653		Approved	HSHIN1, KIAA1046, DUBA6	uc003ika.4	Q01804	OTTHUMG00000161480	ENST00000447906.2:c.1463C>A	4.37:g.146065546G>T	ENSP00000395487:p.Pro488Gln	Somatic	42	0		WXS	Illumina HiSeq	.	41	4	NM_001102653	B4DYS4|Q147U2|Q1ZYK1|Q6PG39|Q96MQ5|Q9NT94|Q9UPV6	Missense_Mutation	SNP	ENST00000447906.2	37		.	.	.	.	.	.	.	.	.	.	G	1.358	-0.589484	0.03799	.	.	ENSG00000164164	ENST00000454497;ENST00000447906	T;T	0.30182	1.54;1.54	5.46	3.72	0.42706	.	0.546416	0.17720	N	0.164299	T	0.17450	0.0419	N	0.19112	0.55	0.09310	N	0.999998	B;B	0.30973	0.302;0.201	B;B	0.29353	0.101;0.047	T	0.16482	-1.0401	10	0.29301	T	0.29	-0.8372	7.081	0.25231	0.0809:0.0:0.5539:0.3652	.	488;487	G3V0I6;Q01804	.;OTUD4_HUMAN	Q	423;488	ENSP00000409279:P423Q;ENSP00000395487:P488Q	ENSP00000395487:P488Q	P	-	2	0	OTUD4	146284996	0.588000	0.26799	0.352000	0.25734	0.526000	0.34562	1.374000	0.34283	0.653000	0.30826	-0.261000	0.10672	CCA	.		0.378	OTUD4-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000365117.2	NM_017493	
CCNL2	81669	hgsc.bcm.edu	37	1	1326205	1326205	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr1:1326205G>A	ENST00000400809.3	-	6	705	c.700C>T	c.(700-702)Cgg>Tgg	p.R234W	CCNL2_ENST00000408952.5_Missense_Mutation_p.R12W|CCNL2_ENST00000505849.1_5'UTR	NM_030937.4	NP_112199.2	Q96S94	CCNL2_HUMAN	cyclin L2	234	Cyclin-like 2.				regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)|ovary(2)|prostate(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.03e-36)|OV - Ovarian serous cystadenocarcinoma(86;4.17e-22)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.0023)|BRCA - Breast invasive adenocarcinoma(365;0.00465)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.146)		GGCTGGAACCGCACGAAGACG	0.547																																					p.R234W		.											.	.	.	0			c.C700T						.						84.0	85.0	84.0					1																	1326205		2203	4296	6499	SO:0001583	missense	81669	exon6			GGAACCGCACGAA	AF251294	CCDS30557.1, CCDS30558.1	1p36.33	2014-07-03			ENSG00000221978	ENSG00000221978			20570	protein-coding gene	gene with protein product	"""cyclin S"""	613482	"""cyclin M"""	CCNM		14725631	Standard	NM_030937		Approved	ania-6b, PCEE, SB138, HLA-ISO, CCNS	uc001afi.2	Q96S94	OTTHUMG00000002917	ENST00000400809.3:c.700C>T	1.37:g.1326205G>A	ENSP00000383611:p.Arg234Trp	Somatic	63	0		WXS	Illumina HiSeq	.	59	4	NM_030937	A8K8A3|B1B152|Q5T2N5|Q5T2N6|Q6IQ12|Q7Z4Z8|Q8N3C9|Q8N3D5|Q8NHE3|Q8TEL0|Q96B00	Missense_Mutation	SNP	ENST00000400809.3	37	CCDS30557.1	.	.	.	.	.	.	.	.	.	.	G	18.97	3.736658	0.69304	.	.	ENSG00000221978	ENST00000400809;ENST00000408952	T;T	0.23754	1.89;1.89	5.84	-0.504	0.11997	Cyclin, C-terminal (1);Cyclin-like (3);	0.000000	0.85682	D	0.000000	T	0.56514	0.1990	M	0.91818	3.245	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.69709	-0.5072	10	0.87932	D	0	.	15.491	0.75605	0.0:0.0:0.3986:0.6014	.	234	Q96S94	CCNL2_HUMAN	W	234;12	ENSP00000383611:R234W;ENSP00000386132:R12W	ENSP00000383611:R234W	R	-	1	2	CCNL2	1316068	0.884000	0.30299	0.997000	0.53966	0.598000	0.36846	0.850000	0.27737	-0.011000	0.14247	-0.182000	0.12963	CGG	.		0.547	CCNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008146.2	NM_030937	
KIAA1804	84451	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	233490614	233490614	+	Missense_Mutation	SNP	T	T	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr1:233490614T>A	ENST00000366624.3	+	4	1429	c.1168T>A	c.(1168-1170)Tcg>Acg	p.S390T	MLK4_ENST00000366623.3_Missense_Mutation_p.S390T	NM_032435.2	NP_115811.2																					TATTCGTCCATCGTTTGCCTT	0.383																																					p.S390T		.											.	.	.	0			c.T1168A						.						147.0	141.0	143.0					1																	233490614		2203	4300	6503	SO:0001583	missense	0	exon4			CGTCCATCGTTTG																												ENST00000366624.3:c.1168T>A	1.37:g.233490614T>A	ENSP00000355583:p.Ser390Thr	Somatic	47	0		WXS	Illumina HiSeq	.	61	39	NM_032435		Missense_Mutation	SNP	ENST00000366624.3	37	CCDS1598.1	.	.	.	.	.	.	.	.	.	.	T	9.503	1.103766	0.20632	.	.	ENSG00000143674	ENST00000366623;ENST00000366624	D;D	0.88664	-2.41;-2.41	5.22	5.22	0.72569	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000002	D	0.85452	0.5700	L	0.36672	1.1	0.80722	D	1	B;B	0.33379	0.41;0.04	B;B	0.41135	0.348;0.061	D	0.83983	0.0333	10	0.44086	T	0.13	.	9.7134	0.40258	0.0:0.0767:0.0:0.9233	.	390;390	Q5TCX8;Q5TCX8-2	M3KL4_HUMAN;.	T	390	ENSP00000355582:S390T;ENSP00000355583:S390T	ENSP00000355582:S390T	S	+	1	0	RP5-862P8.2	231557237	0.996000	0.38824	0.296000	0.24974	0.131000	0.20780	3.211000	0.51137	2.193000	0.70182	0.533000	0.62120	TCG	.		0.383	MLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092495.1		
HS3ST5	222537	hgsc.bcm.edu;bcgsc.ca	37	6	114379057	114379057	+	Silent	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr6:114379057G>T	ENST00000312719.5	-	5	1593	c.405C>A	c.(403-405)ggC>ggA	p.G135G	RP3-399L15.3_ENST00000519104.1_RNA|RP3-399L15.3_ENST00000519270.1_RNA|RP3-399L15.3_ENST00000523087.1_RNA|HS3ST5_ENST00000411826.1_Silent_p.G135G			Q8IZT8	HS3S5_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 5	135					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|negative regulation of coagulation (GO:0050819)|protein sulfation (GO:0006477)|regulation of viral entry into host cell (GO:0046596)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)			breast(4)|endometrium(2)|kidney(1)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	41		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)		ACCACTCAATGCCCTTACCAT	0.423																																					p.G135G		.											.	.	.	0			c.C405A						.						112.0	114.0	113.0					6																	114379057		2203	4300	6503	SO:0001819	synonymous_variant	222537	exon2			CTCAATGCCCTTA	AF503292	CCDS34517.1	6q21	2011-11-16			ENSG00000249853	ENSG00000249853		"""Sulfotransferases, membrane-bound"""	19419	protein-coding gene	gene with protein product		609407				12138164	Standard	NM_153612		Approved	3-OST-5	uc003pwg.4	Q8IZT8	OTTHUMG00000015412	ENST00000312719.5:c.405C>A	6.37:g.114379057G>T		Somatic	47	0		WXS	Illumina HiSeq	.	55	4	NM_153612	A8K1J2|Q52LI2|Q8N285	Silent	SNP	ENST00000312719.5	37	CCDS34517.1																																																																																			.		0.423	HS3ST5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041911.2	NM_153612	
HAUS6	54801	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	19063525	19063525	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr9:19063525G>T	ENST00000380502.3	-	13	1897	c.1430C>A	c.(1429-1431)aCa>aAa	p.T477K	HAUS6_ENST00000380496.1_Missense_Mutation_p.T341K|SCARNA8_ENST00000515924.1_RNA	NM_001270890.1|NM_017645.4	NP_001257819.1|NP_060115.3	Q7Z4H7	HAUS6_HUMAN	HAUS augmin-like complex, subunit 6	477					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						TTCAAGTACTGTAACACTGTT	0.284																																					p.T477K		.											.	.	.	0			c.C1430A						.						38.0	40.0	39.0					9																	19063525		2203	4300	6503	SO:0001583	missense	54801	exon13			AGTACTGTAACAC	AL832495	CCDS6489.1	9p22.1	2011-10-24	2009-04-20	2009-04-20	ENSG00000147874	ENSG00000147874		"""HAUS augmin-like complex subunits"""	25948	protein-coding gene	gene with protein product		613433	"""family with sequence similarity 29, member A"""	FAM29A		10997877, 19427217	Standard	NM_001270890		Approved	FLJ20060, KIAA1574, dgt6	uc003znk.4	Q7Z4H7	OTTHUMG00000019622	ENST00000380502.3:c.1430C>A	9.37:g.19063525G>T	ENSP00000369871:p.Thr477Lys	Somatic	40	0		WXS	Illumina HiSeq	.	55	5	NM_017645	B3KPK4|B4DX82|Q05CG1|Q14CB6|Q14CD9|Q2TA91|Q6IQ10|Q6NZX5|Q8IZQ4|Q96FN0|Q9H950|Q9H998|Q9HCJ8|Q9NXT8	Missense_Mutation	SNP	ENST00000380502.3	37	CCDS6489.1	.	.	.	.	.	.	.	.	.	.	G	8.468	0.856821	0.17106	.	.	ENSG00000147874	ENST00000380502;ENST00000380496	T;T	0.24538	1.86;1.85	5.52	-2.94	0.05581	.	1.496330	0.03302	N	0.189109	T	0.15349	0.0370	L	0.51422	1.61	0.09310	N	1	B;B;B;B	0.28933	0.228;0.137;0.019;0.228	B;B;B;B	0.18561	0.022;0.022;0.012;0.022	T	0.10800	-1.0614	10	0.06625	T	0.88	0.7303	0.458	0.00512	0.3888:0.143:0.203:0.2652	.	442;477;341;477	Q7Z4H7-3;Q7Z4H7-2;Q5VY60;Q7Z4H7	.;.;.;HAUS6_HUMAN	K	477;341	ENSP00000369871:T477K;ENSP00000369865:T341K	ENSP00000369865:T341K	T	-	2	0	HAUS6	19053525	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	0.126000	0.15769	-0.347000	0.08299	-0.777000	0.03380	ACA	.		0.284	HAUS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051825.1	NM_017645	
AGAP2-AS1	100130776	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	58121322	58121322	+	Missense_Mutation	SNP	G	G	C			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr12:58121322G>C	ENST00000542466.2	+	2	683	c.547G>C	c.(547-549)Gat>Cat	p.D183H	AGAP2_ENST00000257897.3_Missense_Mutation_p.I611M|AGAP2_ENST00000547588.1_Missense_Mutation_p.I967M|RP11-571M6.8_ENST00000548410.2_RNA					AGAP2 antisense RNA 1									p.I611I(1)									CAGAACACTCGATGCAGATGA	0.672																																					p.I967M		.											AGAP2,colon,carcinoma,0,1	AGAP2	0	1	Substitution - coding silent(1)	large_intestine(1)	c.C2901G						.						73.0	69.0	71.0					12																	58121322		2203	4300	6503	SO:0001583	missense	116986	exon17			ACACTCGATGCAG	BC039697, BC069024		12q14.1	2013-05-30			ENSG00000255737	ENSG00000255737		"""Long non-coding RNAs"""	48633	non-coding RNA	RNA, long non-coding							Standard	NR_027032		Approved				OTTHUMG00000170286	ENST00000542466.2:c.547G>C	12.37:g.58121322G>C	ENSP00000437523:p.Asp183His	Somatic	33	0		WXS	Illumina HiSeq	.	416	38	NM_001122772		Missense_Mutation	SNP	ENST00000542466.2	37		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	16.35|16.35|16.35	3.097608|3.097608|3.097608	0.56075|0.56075|0.56075	.|.|.	.|.|.	ENSG00000255737|ENSG00000135439|ENSG00000135439	ENST00000542466|ENST00000257897;ENST00000547588|ENST00000328568	.|T;T|.	.|0.50001|.	.|0.76;0.76|.	5.0|5.0|5.0	4.09|4.09|4.09	0.47781|0.47781|0.47781	.|.|.	.|0.000000|.	.|0.85682|.	.|D|.	.|0.000000|.	T|T|T	0.72645|0.72645|0.72645	0.3486|0.3486|0.3486	M|M|M	0.84219|0.84219|0.84219	2.685|2.685|2.685	0.58432|0.58432|0.58432	D|D|D	0.999992|0.999992|0.999992	D|D;D;D|.	0.89917|0.89917|.	1.0|1.0;1.0;1.0|.	D|D;D;D|.	0.76071|0.97110|.	0.987|0.998;0.999;1.0|.	T|T|T	0.74293|0.74293|0.74293	-0.3712|-0.3712|-0.3712	8|10|5	0.87932|0.87932|.	D|D|.	0|0|.	.|.|.	7.323|7.323|7.323	0.26539|0.26539|0.26539	0.2383:0.0:0.7617:0.0|0.2383:0.0:0.7617:0.0|0.2383:0.0:0.7617:0.0	.|.|.	183|611;967;967|.	B7Z718|Q99490-2;F8VVT9;Q99490|.	.|.;.;AGAP2_HUMAN|.	H|M|G	183|611;967|811	.|ENSP00000257897:I611M;ENSP00000449241:I967M|.	ENSP00000437523:D183H|ENSP00000257897:I611M|.	D|I|R	+|-|-	1|3|1	0|3|2	RP11-571M6.6|AGAP2|AGAP2	56407589|56407589|56407589	0.999000|0.999000|0.999000	0.42202|0.42202|0.42202	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.984000|0.984000|0.984000	0.73092|0.73092|0.73092	0.505000|0.505000|0.505000	0.22642|0.22642|0.22642	2.480000|2.480000|2.480000	0.83734|0.83734|0.83734	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GAT|ATC|CGA	.		0.672	AGAP2-AS1-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000408368.1		
TRIP11	9321	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	14	92470476	92470476	+	Nonsense_Mutation	SNP	T	T	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr14:92470476T>A	ENST00000267622.4	-	11	4217	c.3844A>T	c.(3844-3846)Aaa>Taa	p.K1282*		NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	1282					protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		CCAAAATTTTTGAGTTTGGTT	0.378			T	PDGFRB	AML																																p.K1282X	Ovarian(84;609 1888 9852 42686)	.		Dom	yes		14	14q31-q32	9321	thyroid hormone receptor interactor 11		L	.	.	.	0			c.A3844T						.						56.0	58.0	57.0					14																	92470476		2202	4300	6502	SO:0001587	stop_gained	9321	exon11			AATTTTTGAGTTT	L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.3844A>T	14.37:g.92470476T>A	ENSP00000267622:p.Lys1282*	Somatic	32	0		WXS	Illumina HiSeq	.	37	10	NM_004239	B2RUT2|O14689|O15154|O95949	Nonsense_Mutation	SNP	ENST00000267622.4	37	CCDS9899.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	36|36	5.972174|5.972174	0.97162|0.97162	.|.	.|.	ENSG00000100815|ENSG00000100815	ENST00000267622;ENST00000542257|ENST00000554357	.|.	.|.	.|.	5.24|5.24	4.06|4.06	0.47325|0.47325	.|.	0.267150|.	0.38720|.	N|.	0.001584|.	.|T	.|0.61048	.|0.2316	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.67760	.|-0.5587	.|3	0.02654|.	T|.	1|.	.|.	12.0531|12.0531	0.53518|0.53518	0.0:0.0:0.1445:0.8555|0.0:0.0:0.1445:0.8555	.|.	.|.	.|.	.|.	X|L	1282;1018|997	.|.	ENSP00000267622:K1282X|.	K|Q	-|-	1|2	0|0	TRIP11|TRIP11	91540229|91540229	0.437000|0.437000	0.25593|0.25593	0.920000|0.920000	0.36463|0.36463	0.396000|0.396000	0.30629|0.30629	3.281000|3.281000	0.51685|0.51685	0.789000|0.789000	0.33779|0.33779	0.374000|0.374000	0.22700|0.22700	AAA|CAA	.		0.378	TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411823.1		
CCDC142	84865	hgsc.bcm.edu;bcgsc.ca	37	2	74701921	74701921	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr2:74701921G>T	ENST00000393965.3	-	9	2401	c.2005C>A	c.(2005-2007)Cag>Aag	p.Q669K	MRPL53_ENST00000258105.7_5'Flank|CCDC142_ENST00000290418.4_Missense_Mutation_p.Q662K|MRPL53_ENST00000409710.1_5'Flank	NM_032779.3	NP_116168.3	Q17RM4	CC142_HUMAN	coiled-coil domain containing 142	669										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	16						TGGACCTCCTGACAAGCACCT	0.557																																					p.Q662K		.											.	.	.	0			c.C1984A						.						37.0	40.0	39.0					2																	74701921		2203	4300	6503	SO:0001583	missense	84865	exon9			CCTCCTGACAAGC	AK075543	CCDS1945.1	2p13.1	2008-02-05			ENSG00000135637	ENSG00000135637			25889	protein-coding gene	gene with protein product							Standard	NM_032779		Approved	FLJ14397	uc002slq.3	Q17RM4	OTTHUMG00000129962	ENST00000393965.3:c.2005C>A	2.37:g.74701921G>T	ENSP00000377537:p.Gln669Lys	Somatic	35	0		WXS	Illumina HiSeq	.	56	4	NM_032779	B7ZKV5|Q8NBJ3|Q8NBV2|Q96KA7	Missense_Mutation	SNP	ENST00000393965.3	37		.	.	.	.	.	.	.	.	.	.	G	0.155	-1.087374	0.01873	.	.	ENSG00000135637	ENST00000393965;ENST00000290418	T;T	0.40476	1.03;1.03	4.88	-2.78	0.05859	.	0.808617	0.10962	N	0.614931	T	0.14570	0.0352	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.23940	-1.0174	10	0.11485	T	0.65	6.7656	1.0446	0.01567	0.1408:0.2158:0.3132:0.3303	.	669;662	Q17RM4;Q17RM4-2	CC142_HUMAN;.	K	669;662	ENSP00000377537:Q669K;ENSP00000290418:Q662K	ENSP00000290418:Q662K	Q	-	1	0	CCDC142	74555429	0.010000	0.17322	0.002000	0.10522	0.242000	0.25591	-0.240000	0.08952	-0.663000	0.05331	-1.108000	0.02087	CAG	.		0.557	CCDC142-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000328391.1	NM_032779	
CKLF	51192	hgsc.bcm.edu	37	16	66597060	66597060	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr16:66597060G>T	ENST00000264001.4	+	3	422	c.273G>T	c.(271-273)atG>atT	p.M91I	CKLF_ENST00000351137.4_Missense_Mutation_p.M38I|CKLF_ENST00000417030.2_Missense_Mutation_p.M91I|CKLF_ENST00000563092.1_3'UTR|CKLF-CMTM1_ENST00000532838.1_Missense_Mutation_p.M38I|CKLF_ENST00000345436.4_Intron|CKLF-CMTM1_ENST00000527729.1_Intron|CKLF_ENST00000362093.4_Intron	NM_016951.3	NP_058647.1	Q9UBR5	CKLF_HUMAN	chemokine-like factor	91	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cell proliferation (GO:0008283)|lymphocyte chemotaxis (GO:0048247)|macrophage chemotaxis (GO:0048246)|neutrophil chemotaxis (GO:0030593)|secretion by cell (GO:0032940)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	chemokine activity (GO:0008009)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|upper_aerodigestive_tract(1)	5		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0689)|Epithelial(162;0.217)		CAGTATTCATGCTCATCGTAT	0.393																																					p.M91I		.											CKLF,NS,carcinoma,0,1	CKLF	0	0			c.G273T						.						195.0	164.0	174.0					16																	66597060		2201	4300	6501	SO:0001583	missense	51192	exon3			ATTCATGCTCATC	AF096895	CCDS10806.1, CCDS10807.1, CCDS10808.1, CCDS10809.1, CCDS45502.1	16q22.1-q22.3	2008-02-05	2003-02-28	2003-03-07	ENSG00000217555	ENSG00000217555			13253	protein-coding gene	gene with protein product			"""chemokine-like factor 1"""	CKLF1		11042152, 11415443	Standard	NM_016326		Approved	UCK-1, CKLF3, CKLF4, HSPC224, C32		Q9UBR5	OTTHUMG00000137504	ENST00000264001.4:c.273G>T	16.37:g.66597060G>T	ENSP00000264001:p.Met91Ile	Somatic	45	0		WXS	Illumina HiSeq	.	45	2	NM_001040138	C9JE38|Q9UHM7|Q9UHN8|Q9UI41	Missense_Mutation	SNP	ENST00000264001.4	37	CCDS10807.1	.	.	.	.	.	.	.	.	.	.	G	11.58	1.681561	0.29872	.	.	ENSG00000217555;ENSG00000217555;ENSG00000217555;ENSG00000217555;ENSG00000217555;ENSG00000254788	ENST00000264001;ENST00000351137;ENST00000361141;ENST00000417030;ENST00000532838;ENST00000529718	T;T	0.43688	0.94;0.94	5.02	4.01	0.46588	Marvel (1);	.	.	.	.	T	0.38639	0.1048	L	0.50333	1.59	0.80722	D	1	B;B;B	0.28291	0.122;0.206;0.206	B;B;B	0.33454	0.036;0.059;0.164	T	0.36648	-0.9739	9	0.56958	D	0.05	-21.3557	9.7372	0.40395	0.0:0.0:0.7792:0.2208	.	91;91;38	Q9UBR5-5;Q9UBR5;Q5BJH6	.;CKLF_HUMAN;.	I	91;38;91;91;38;10	ENSP00000264001:M91I;ENSP00000416678:M91I	ENSP00000433503:M10I	M	+	3	0	CKLF;CKLF-CMTM1	65154561	0.922000	0.31269	0.941000	0.38009	0.435000	0.31806	1.377000	0.34317	2.608000	0.88229	0.650000	0.86243	ATG	.		0.393	CKLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268816.2	NM_016326	
CGGBP1	8545	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	88104670	88104670	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr3:88104670C>T	ENST00000398392.2	-	1	1789	c.457G>A	c.(457-459)Gat>Aat	p.D153N	CGGBP1_ENST00000462901.1_Missense_Mutation_p.D153N|CGGBP1_ENST00000482016.1_Missense_Mutation_p.D153N|CGGBP1_ENST00000309534.6_Missense_Mutation_p.D153N|CGGBP1_ENST00000474441.1_5'Flank			Q9UFW8	CGBP1_HUMAN	CGG triplet repeat binding protein 1	153					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)			kidney(1)|large_intestine(2)|lung(2)	5		Lung NSC(201;0.0283)		LUSC - Lung squamous cell carcinoma(29;0.00359)|Lung(72;0.00677)		TCATATCCATCAGGAAGATAT	0.448																																					p.D153N		.											.	.	.	0			c.G457A						.						132.0	124.0	127.0					3																	88104670		1946	4156	6102	SO:0001583	missense	8545	exon4			ATCCATCAGGAAG	AJ000258	CCDS43111.1	3p12-p11.1	2008-07-18			ENSG00000163320	ENSG00000163320			1888	protein-coding gene	gene with protein product	"""p20-CGG binding protein"""	603363				9201980, 14667814	Standard	NM_001195308		Approved	p20-CGGBP, CGGBP	uc003dqt.3	Q9UFW8	OTTHUMG00000159009	ENST00000398392.2:c.457G>A	3.37:g.88104670C>T	ENSP00000381429:p.Asp153Asn	Somatic	47	0		WXS	Illumina HiSeq	.	60	25	NM_001195308	D3DU38|O15183	Missense_Mutation	SNP	ENST00000398392.2	37	CCDS43111.1	.	.	.	.	.	.	.	.	.	.	C	15.34	2.805776	0.50421	.	.	ENSG00000163320	ENST00000309534;ENST00000398392;ENST00000482016;ENST00000462901	.	.	.	5.7	5.7	0.88788	.	0.000000	0.40385	U	0.001117	T	0.60235	0.2253	N	0.19112	0.55	0.43300	D	0.995297	D	0.60575	0.988	P	0.62885	0.908	T	0.55685	-0.8102	9	0.24483	T	0.36	-20.2881	17.0533	0.86525	0.0:1.0:0.0:0.0	.	153	Q9UFW8	CGBP1_HUMAN	N	153	.	ENSP00000381428:D153N	D	-	1	0	CGGBP1	88187360	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.914000	0.63348	2.711000	0.92665	0.650000	0.86243	GAT	.		0.448	CGGBP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352955.1	NM_001008390	
KIAA0100	9703	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	26948452	26948452	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr17:26948452C>A	ENST00000528896.2	-	27	5098	c.5024G>T	c.(5023-5025)gGg>gTg	p.G1675V	KIAA0100_ENST00000544884.1_Missense_Mutation_p.G1532V|KIAA0100_ENST00000579924.2_5'Flank|KIAA0100_ENST00000389003.3_Missense_Mutation_p.G1532V	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	1675						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					CACTGCCTGCCCACTCTCCAT	0.557																																					p.G1675V		.											.	.	.	0			c.G5024T						.						112.0	101.0	104.0					17																	26948452		2203	4300	6503	SO:0001583	missense	9703	exon27			GCCTGCCCACTCT	D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.5024G>T	17.37:g.26948452C>A	ENSP00000436773:p.Gly1675Val	Somatic	25	0		WXS	Illumina HiSeq	.	31	4	NM_014680	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	ENST00000528896.2	37	CCDS32595.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.359897	0.82353	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896;ENST00000544884	T;T	0.45668	0.89;0.96	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.63896	0.2550	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.63427	-0.6640	10	0.62326	D	0.03	.	18.2554	0.90017	0.0:1.0:0.0:0.0	.	1675	Q14667	K0100_HUMAN	V	1675;1645;1675;1532	ENSP00000436773:G1675V;ENSP00000446443:G1532V	ENSP00000005905:G1675V	G	-	2	0	KIAA0100	23972579	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.277000	0.78572	2.826000	0.97356	0.491000	0.48974	GGG	.		0.557	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	NM_014680	
ABCA13	154664	hgsc.bcm.edu	37	7	48318055	48318055	+	Nonsense_Mutation	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr7:48318055G>T	ENST00000435803.1	+	18	7288	c.7264G>T	c.(7264-7266)Gag>Tag	p.E2422*		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	2422					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						ATGTTCAACAGAGATGGCAAG	0.398																																					p.E2422X		.											.	.	.	0			c.G7264T						.						84.0	82.0	82.0					7																	48318055		1850	4097	5947	SO:0001587	stop_gained	154664	exon18			TCAACAGAGATGG	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.7264G>T	7.37:g.48318055G>T	ENSP00000411096:p.Glu2422*	Somatic	35	0		WXS	Illumina HiSeq	.	72	3	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Nonsense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	G	47	13.194291	0.99726	.	.	ENSG00000179869	ENST00000435803	.	.	.	4.82	3.92	0.45320	.	0.306710	0.23118	N	0.051723	.	.	.	.	.	.	0.18873	N	0.999988	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	9.5575	0.39348	0.103:0.0:0.897:0.0	.	.	.	.	X	2422	.	ENSP00000411096:E2422X	E	+	1	0	ABCA13	48288601	0.006000	0.16342	0.005000	0.12908	0.114000	0.19823	1.466000	0.35310	2.406000	0.81754	0.655000	0.94253	GAG	.		0.398	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
OBSCN	84033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	228444441	228444441	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr1:228444441G>A	ENST00000422127.1	+	15	4443	c.4399G>A	c.(4399-4401)Gct>Act	p.A1467T	OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000284548.11_Missense_Mutation_p.A1467T|OBSCN_ENST00000359599.6_Missense_Mutation_p.A31T|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000570156.2_Missense_Mutation_p.A1559T	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	1467	Ig-like 15.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CTGCGAGGTGGCTCAGGCCCA	0.647																																					p.A1559T		.											.	.	.	0			c.G4675A						.						49.0	50.0	50.0					1																	228444441		2071	4194	6265	SO:0001583	missense	84033	exon16			GAGGTGGCTCAGG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.4399G>A	1.37:g.228444441G>A	ENSP00000409493:p.Ala1467Thr	Somatic	31	0		WXS	Illumina HiSeq	.	36	4	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	.	19.04	3.749857	0.69533	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000359599	T;T;T	0.65916	-0.18;-0.18;3.71	4.7	4.7	0.59300	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.078090	0.49916	D	0.000139	T	0.69815	0.3153	L	0.45422	1.42	0.80722	D	1	D;D	0.71674	0.998;0.995	D;D	0.69307	0.963;0.92	T	0.69483	-0.5133	10	0.42905	T	0.14	.	12.6934	0.56988	0.0:0.0:0.835:0.165	.	1467;1467	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	T	1467;1467;31	ENSP00000284548:A1467T;ENSP00000409493:A1467T;ENSP00000352613:A31T	ENSP00000284548:A1467T	A	+	1	0	OBSCN	226511064	1.000000	0.71417	1.000000	0.80357	0.687000	0.40016	2.108000	0.41854	2.157000	0.67596	0.491000	0.48974	GCT	.		0.647	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
WISP3	8838	hgsc.bcm.edu	37	6	112389433	112389433	+	Nonsense_Mutation	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr6:112389433G>A	ENST00000368666.2	+	4	901	c.615G>A	c.(613-615)tgG>tgA	p.W205*	WISP3_ENST00000604763.1_Nonsense_Mutation_p.W205*|WISP3_ENST00000361714.1_Nonsense_Mutation_p.W223*|WISP3_ENST00000368663.3_Nonsense_Mutation_p.W182*|WISP3_ENST00000409166.1_5'UTR|WISP3_ENST00000230529.5_Nonsense_Mutation_p.W205*	NM_198239.1	NP_937882.1	O95389	WISP3_HUMAN	WNT1 inducible signaling pathway protein 3	205					cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	extracellular space (GO:0005615)				breast(1)|central_nervous_system(1)|large_intestine(3)|lung(7)|prostate(1)	13		all_cancers(87;0.000196)|Acute lymphoblastic leukemia(125;1.18e-05)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0283)|OV - Ovarian serous cystadenocarcinoma(136;0.0613)|Epithelial(106;0.0827)|GBM - Glioblastoma multiforme(226;0.0972)|BRCA - Breast invasive adenocarcinoma(108;0.246)		CACTTATTTGGAAAAAAAAAT	0.333																																					p.W223X		.											.,1	.	33	0			c.G669A						.						45.0	46.0	46.0					6																	112389433		2203	4298	6501	SO:0001587	stop_gained	8838	exon4			TATTTGGAAAAAA	AF100781	CCDS5097.1, CCDS5098.1	6q21	2014-05-06			ENSG00000112761	ENSG00000112761			12771	protein-coding gene	gene with protein product		603400				9843955	Standard	NM_003880		Approved	CCN6	uc003pvo.3	O95389	OTTHUMG00000185101	ENST00000368666.2:c.615G>A	6.37:g.112389433G>A	ENSP00000357655:p.Trp205*	Somatic	92	0		WXS	Illumina HiSeq	.	91	4	NM_198239	Q3KR29|Q5H8W4|Q6UXH6	Nonsense_Mutation	SNP	ENST00000368666.2	37	CCDS5098.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.660110|5.660110	0.96734|0.96734	.|.	.|.	ENSG00000112761|ENSG00000112761	ENST00000541400|ENST00000368666;ENST00000230529;ENST00000361714;ENST00000541400;ENST00000368663	.|.	.|.	.|.	5.8|5.8	5.8|5.8	0.92144|0.92144	.|.	.|0.200433	.|0.48286	.|D	.|0.000197	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|0.41790	.|T	.|0.15	.|-0.8536	20.0706|20.0706	0.97721|0.97721	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	.|X	-1|205;205;223;205;182	.|.	.|ENSP00000230529:W205X	.|W	+|+	.|3	.|0	WISP3|WISP3	112496126|112496126	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	5.716000|5.716000	0.68437|0.68437	2.744000|2.744000	0.94065|0.94065	0.655000|0.655000	0.94253|0.94253	.|TGG	.		0.333	WISP3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041873.2	NM_003880	
KIAA1033	23325	hgsc.bcm.edu	37	12	105558483	105558483	+	Missense_Mutation	SNP	C	C	T	rs199807811		TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr12:105558483C>T	ENST00000332180.5	+	32	3506	c.3419C>T	c.(3418-3420)gCg>gTg	p.A1140V	KIAA1033_ENST00000547171.1_3'UTR	NM_015275.1	NP_056090.1			KIAA1033											breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	41						GACAAGACTGCGGCTGAAGAA	0.333																																					p.A1140V		.											.	.	.	0			c.C3419T						.	C	VAL/ALA	1,3609		0,1,1804	24.0	25.0	24.0		3419	6.2	1.0	12		24	0,8140		0,0,4070	no	missense	KIAA1033	NM_015275.1	64	0,1,5874	TT,TC,CC		0.0,0.0277,0.0085	probably-damaging	1140/1174	105558483	1,11749	1805	4070	5875	SO:0001583	missense	23325	exon32			AGACTGCGGCTGA	AB028956	CCDS41826.1, CCDS73514.1	12q24.11	2014-05-09				ENSG00000136051			29174	protein-coding gene	gene with protein product		615748				20376207, 20498093, 21498477	Standard	XM_005268742		Approved	SWIP	uc001tld.3	Q2M389		ENST00000332180.5:c.3419C>T	12.37:g.105558483C>T	ENSP00000328062:p.Ala1140Val	Somatic	44	0		WXS	Illumina HiSeq	.	37	4	NM_015275		Missense_Mutation	SNP	ENST00000332180.5	37	CCDS41826.1	.	.	.	.	.	.	.	.	.	.	C	32	5.164581	0.94727	2.77E-4	0.0	ENSG00000136051	ENST00000332180	T	0.48522	0.81	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.66076	0.2753	L	0.55481	1.735	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.73708	0.981;0.981	T	0.56553	-0.7960	10	0.31617	T	0.26	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	1141;1140	B7ZKT9;Q2M389	.;WASH7_HUMAN	V	1140	ENSP00000328062:A1140V	ENSP00000328062:A1140V	A	+	2	0	KIAA1033	104082613	1.000000	0.71417	0.994000	0.49952	0.986000	0.74619	7.756000	0.85195	2.941000	0.99782	0.655000	0.94253	GCG	0.001		0.333	KIAA1033-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406138.4	NM_015275	
SARDH	1757	hgsc.bcm.edu;bcgsc.ca	37	9	136550380	136550380	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr9:136550380C>T	ENST00000371872.4	-	17	2355	c.2098G>A	c.(2098-2100)Gca>Aca	p.A700T	SARDH_ENST00000439388.1_Missense_Mutation_p.A700T|SARDH_ENST00000371868.1_Missense_Mutation_p.A128T|SARDH_ENST00000422262.2_Missense_Mutation_p.A532T	NM_007101.3	NP_009032.2	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase	700					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|sarcosine dehydrogenase activity (GO:0008480)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(13)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	44				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		CTCAGGTCTGCGTCCAGCACC	0.647																																					p.A700T		.											.	.	.	0			c.G2098A						.						101.0	78.0	86.0					9																	136550380		2203	4300	6503	SO:0001583	missense	1757	exon17			GGTCTGCGTCCAG		CCDS6978.1	9q33-q34	2008-02-05			ENSG00000123453	ENSG00000123453	1.5.99.2		10536	protein-coding gene	gene with protein product		604455		DMGDHL1		10444331	Standard	NM_007101		Approved	SDH	uc004cep.4	Q9UL12	OTTHUMG00000020879	ENST00000371872.4:c.2098G>A	9.37:g.136550380C>T	ENSP00000360938:p.Ala700Thr	Somatic	58	0		WXS	Illumina HiSeq	.	80	5	NM_007101	B2RMR5|B4DPI2|B7ZLT6|Q5SYV0|Q9Y280|Q9Y2Y3	Missense_Mutation	SNP	ENST00000371872.4	37	CCDS6978.1	.	.	.	.	.	.	.	.	.	.	C	3.432	-0.115925	0.06881	.	.	ENSG00000123453	ENST00000371872;ENST00000371868;ENST00000439388;ENST00000422262	D;D;D;D	0.83591	-1.74;-1.74;-1.74;-1.74	4.27	0.744	0.18353	Glycine cleavage T-protein, N-terminal (1);	0.374478	0.29594	N	0.011719	T	0.67599	0.2910	L	0.33753	1.03	0.48135	D	0.999598	B;B	0.10296	0.003;0.002	B;B	0.11329	0.004;0.006	T	0.50608	-0.8808	10	0.10636	T	0.68	.	6.6805	0.23117	0.0:0.4829:0.0:0.5171	.	700;128	Q9UL12;Q5SYV2	SARDH_HUMAN;.	T	700;128;700;532	ENSP00000360938:A700T;ENSP00000360934:A128T;ENSP00000403084:A700T;ENSP00000415537:A532T	ENSP00000360934:A128T	A	-	1	0	SARDH	135540201	0.001000	0.12720	0.715000	0.30552	0.450000	0.32258	-0.189000	0.09629	0.253000	0.21552	0.462000	0.41574	GCA	.		0.647	SARDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054931.1		
MYPN	84665	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	69881563	69881563	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr10:69881563G>A	ENST00000358913.5	+	2	856	c.368G>A	c.(367-369)cGa>cAa	p.R123Q	MYPN_ENST00000540630.1_Missense_Mutation_p.R123Q|MYPN_ENST00000373675.3_Missense_Mutation_p.R123Q|MYPN_ENST00000354393.2_Intron	NM_001256267.1|NM_032578.3	NP_001243196.1|NP_115967.2	Q86TC9	MYPN_HUMAN	myopalladin	123	Interaction with CARP.				sarcomere organization (GO:0045214)	I band (GO:0031674)|nucleus (GO:0005634)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|muscle alpha-actinin binding (GO:0051371)|SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(13)|kidney(6)|large_intestine(13)|liver(1)|lung(43)|ovary(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(5)	94						GATAACCCTCGAAGTCCCACC	0.433																																					p.R123Q		.											MYPN,NS,carcinoma,0,1	MYPN	0	0			c.G368A						.						43.0	42.0	43.0					10																	69881563		2203	4300	6503	SO:0001583	missense	84665	exon2			ACCCTCGAAGTCC	AL834247	CCDS7275.1, CCDS73142.1	10q22.1	2014-09-17			ENSG00000138347	ENSG00000138347		"""Immunoglobulin superfamily / I-set domain containing"""	23246	protein-coding gene	gene with protein product	"""sarcomeric protein myopalladin, 145 kDa"""	608517				11309420, 12482578	Standard	NM_032578		Approved	MYOP	uc001jnm.5	Q86TC9	OTTHUMG00000018344	ENST00000358913.5:c.368G>A	10.37:g.69881563G>A	ENSP00000351790:p.Arg123Gln	Somatic	88	0		WXS	Illumina HiSeq	.	96	25	NM_032578	Q5VV35|Q5VV36|Q86T37|Q8N3L4|Q96K90|Q96KF5	Missense_Mutation	SNP	ENST00000358913.5	37	CCDS7275.1	.	.	.	.	.	.	.	.	.	.	G	5.881	0.346645	0.11126	.	.	ENSG00000138347	ENST00000358913;ENST00000540630;ENST00000373675	T;T;T	0.61040	0.5;0.48;0.14	6.03	-12.1	0.00011	.	1.186290	0.05748	N	0.602629	T	0.35128	0.0921	N	0.22421	0.69	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.16394	-1.0404	9	.	.	.	.	12.2188	0.54423	0.5278:0.256:0.2162:0.0	.	123;123	Q86TC9-3;Q86TC9	.;MYPN_HUMAN	Q	123	ENSP00000351790:R123Q;ENSP00000441668:R123Q;ENSP00000362779:R123Q	.	R	+	2	0	MYPN	69551569	0.000000	0.05858	0.000000	0.03702	0.894000	0.52154	-1.256000	0.02869	-2.908000	0.00309	-0.768000	0.03414	CGA	.		0.433	MYPN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048307.1	NM_032578	
AADAC	13	hgsc.bcm.edu	37	3	151545576	151545576	+	Silent	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr3:151545576G>T	ENST00000232892.7	+	5	942	c.816G>T	c.(814-816)gtG>gtT	p.V272V	RP11-454C18.2_ENST00000483843.2_RNA|RP11-454C18.2_ENST00000475855.1_RNA	NM_001086.2	NP_001077.2	P22760	AAAD_HUMAN	arylacetamide deacetylase	272					positive regulation of triglyceride catabolic process (GO:0010898)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)|deacetylase activity (GO:0019213)|lipase activity (GO:0016298)|serine hydrolase activity (GO:0017171)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(5)|skin(2)	19		Myeloproliferative disorder(1037;0.0255)|all_neural(597;0.112)	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			ATGTACCTGTGGAATCAAGTC	0.368																																					p.V272V	Ovarian(30;839 841 2699 32801 46334)	.											AADAC,NS,carcinoma,0,1	AADAC	0	0			c.G816T						.						63.0	65.0	64.0					3																	151545576		2203	4299	6502	SO:0001819	synonymous_variant	13	exon5			ACCTGTGGAATCA	L32179	CCDS33877.1	3q25.1	2014-03-18	2012-07-13		ENSG00000114771	ENSG00000114771	3.1.1.3		17	protein-coding gene	gene with protein product		600338	"""arylacetamide deacetylase (esterase)"""			8063807	Standard	XM_005247103		Approved	DAC, CES5A1	uc003eze.3	P22760	OTTHUMG00000159876	ENST00000232892.7:c.816G>T	3.37:g.151545576G>T		Somatic	28	0		WXS	Illumina HiSeq	.	43	2	NM_001086	A8K3L3|D3DNJ6|Q8N1A9	Silent	SNP	ENST00000232892.7	37	CCDS33877.1																																																																																			.		0.368	AADAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357883.2	NM_001086	
BCL6	604	hgsc.bcm.edu	37	3	187439688	187439688	+	3'UTR	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr3:187439688G>T	ENST00000406870.2	-	0	3045				RP11-211G3.3_ENST00000437407.1_Intron|RP11-211G3.3_ENST00000449623.1_Intron	NM_001706.4	NP_001697.2	P41182	BCL6_HUMAN	B-cell CLL/lymphoma 6						actin cytoskeleton organization (GO:0030036)|B cell differentiation (GO:0030183)|cell morphogenesis (GO:0000902)|cellular response to DNA damage stimulus (GO:0006974)|erythrocyte development (GO:0048821)|germinal center formation (GO:0002467)|inflammatory response (GO:0006954)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of mast cell cytokine production (GO:0032764)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cellular component movement (GO:0051272)|protein import into nucleus, translocation (GO:0000060)|regulation of germinal center formation (GO:0002634)|regulation of immune response (GO:0050776)|regulation of inflammatory response (GO:0050727)|regulation of memory T cell differentiation (GO:0043380)|regulation of Rho GTPase activity (GO:0032319)|Rho protein signal transduction (GO:0007266)|spermatogenesis (GO:0007283)|type 2 immune response (GO:0042092)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(9)|lung(10)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	40	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)		ACAAAATCGAGCCTTTAACGC	0.244			"""T, Mis"""	"""IG loci, ZNFN1A1, LCP1, PIM1, TFRC, CIITA, NACA, HSPCB, HSPCA, HIST1H4I, IL21R,  POU2AF1, ARHH, EIF4A2, SFRS3"""	"""NHL, CLL"""																																.		.		Dom	yes		3	3q27	604	B-cell CLL/lymphoma 6		L	.	.	.	0			.						.																																			SO:0001624	3_prime_UTR_variant	604	.			AATCGAGCCTTTA		CCDS3289.1, CCDS46975.1	3q27	2013-01-09	2008-08-01		ENSG00000113916	ENSG00000113916		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1001	protein-coding gene	gene with protein product		109565	"""zinc finger protein 51"""	ZNF51			Standard	NM_001130845		Approved	ZBTB27, LAZ3, BCL5, BCL6A	uc003frq.2	P41182	OTTHUMG00000156441	ENST00000406870.2:c.*558C>A	3.37:g.187439688G>T		Somatic	51	0		WXS	Illumina HiSeq	.	84	3	.	A7E241|B8PSA7|D3DNV5	RNA	SNP	ENST00000406870.2	37	CCDS3289.1																																																																																			.		0.244	BCL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344202.1	NM_138931	
ZSCAN16	80345	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	28094609	28094609	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr6:28094609C>A	ENST00000340487.4	+	3	585	c.436C>A	c.(436-438)Ccc>Acc	p.P146T	ZSCAN16-AS1_ENST00000602810.1_RNA|ZSCAN16-AS1_ENST00000600652.1_RNA	NM_025231.1	NP_079507.1	Q9H4T2	ZSC16_HUMAN	zinc finger and SCAN domain containing 16	146					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(5)|liver(1)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10						CAAGTTGGCCCCCTTGGGAAG	0.478																																					p.P146T		.											.	.	.	0			c.C436A						.						86.0	78.0	81.0					6																	28094609		2203	4300	6503	SO:0001583	missense	80345	exon3			TTGGCCCCCTTGG	AK025844	CCDS4644.1	6p21.33	2013-01-08	2007-02-20	2007-02-20	ENSG00000196812	ENSG00000196812		"""-"", ""Zinc fingers, C2H2-type"""	20813	protein-coding gene	gene with protein product			"""zinc finger protein 392"", ""zinc finger protein 435"""	ZNF392, ZNF435			Standard	NM_025231		Approved	FLJ22191, dJ265C24.3	uc003nkm.3	Q9H4T2	OTTHUMG00000014509	ENST00000340487.4:c.436C>A	6.37:g.28094609C>A	ENSP00000366527:p.Pro146Thr	Somatic	43	0		WXS	Illumina HiSeq	.	49	22	NM_025231	Q9H6K2	Missense_Mutation	SNP	ENST00000340487.4	37	CCDS4644.1	.	.	.	.	.	.	.	.	.	.	C	6.087	0.384261	0.11524	.	.	ENSG00000196812	ENST00000340487	T	0.06218	3.33	3.97	-1.5	0.08691	Transcription regulator SCAN (1);	0.782832	0.10487	N	0.668822	T	0.00815	0.0027	N	0.19112	0.55	0.09310	N	1	P;B	0.35411	0.5;0.01	B;B	0.29353	0.101;0.01	T	0.46373	-0.9196	10	0.25106	T	0.35	.	1.1157	0.01714	0.1687:0.2859:0.3314:0.214	.	146;146	B4DFB7;Q9H4T2	.;ZSC16_HUMAN	T	146	ENSP00000366527:P146T	ENSP00000366527:P146T	P	+	1	0	ZSCAN16	28202588	0.005000	0.15991	0.001000	0.08648	0.961000	0.63080	0.295000	0.19065	-0.188000	0.10499	-0.150000	0.13652	CCC	.		0.478	ZSCAN16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040177.1	NM_025231	
AK3	50808	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	4740952	4740952	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr9:4740952T>C	ENST00000381809.3	-	1	366	c.136A>G	c.(136-138)Atg>Gtg	p.M46V	AK3_ENST00000359883.2_Intron|AK3_ENST00000447596.4_Missense_Mutation_p.M46V	NM_016282.3	NP_057366.2	P27144	KAD4_HUMAN	adenylate kinase 3	44	NMPbind.				ADP biosynthetic process (GO:0006172)|AMP metabolic process (GO:0046033)|ATP metabolic process (GO:0046034)|brain development (GO:0007420)|GTP metabolic process (GO:0046039)|liver development (GO:0001889)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|response to drug (GO:0042493)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside triphosphate adenylate kinase activity (GO:0046899)			large_intestine(2)|lung(1)|ovary(2)	5	all_hematologic(13;0.137)	Breast(48;0.238)		GBM - Glioblastoma multiforme(50;0.0302)	Adefovir Dipivoxil(DB00718)|Tenofovir(DB00300)	CCCCGCAGCATGTTGTCCCGG	0.721																																					p.M46V		.											.	.	.	0			c.A136G						.						28.0	26.0	27.0					9																	4740952		2202	4300	6502	SO:0001583	missense	50808	exon1			GCAGCATGTTGTC	BC013771	CCDS6455.1, CCDS56561.1, CCDS56562.1	9p24.1	2010-09-29	2004-06-11	2005-04-07	ENSG00000147853	ENSG00000147853			17376	protein-coding gene	gene with protein product		609290	"""adenylate kinase 6"", ""adenylate kinase 3 like 1"""	AK6, AK3L1		8288, 182062	Standard	NM_001199852		Approved	AKL3L1	uc003ziq.2	Q9UIJ7	OTTHUMG00000019472	ENST00000381809.3:c.136A>G	9.37:g.4740952T>C	ENSP00000371230:p.Met46Val	Somatic	56	0		WXS	Illumina HiSeq	.	56	33	NM_016282	B2R927|D3DQ62|Q6IBH4|Q6NXQ5|Q8IUU9	Missense_Mutation	SNP	ENST00000381809.3	37	CCDS6455.1	.	.	.	.	.	.	.	.	.	.	T	11.18	1.562622	0.27915	.	.	ENSG00000147853	ENST00000381809;ENST00000447596	T;T	0.74421	-0.84;-0.84	4.25	4.25	0.50352	.	0.172164	0.53938	D	0.000056	T	0.33556	0.0867	N	0.00456	-1.48	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.09377	0.004;0.001	T	0.47983	-0.9074	10	0.02654	T	1	-10.0745	8.0284	0.30451	0.0:0.0946:0.0:0.9054	.	46;46	E7ET30;Q9UIJ7	.;KAD3_HUMAN	V	46	ENSP00000371230:M46V;ENSP00000413933:M46V	ENSP00000371230:M46V	M	-	1	0	AK3	4730952	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.577000	0.53885	1.767000	0.52121	0.379000	0.24179	ATG	.		0.721	AK3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051585.1	NM_016282	
KRT7	3855	hgsc.bcm.edu	37	12	52629096	52629096	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr12:52629096G>A	ENST00000331817.5	+	2	665	c.482G>A	c.(481-483)cGc>cAc	p.R161H		NM_005556.3	NP_005547.3	P08729	K2C7_HUMAN	keratin 7	161	Coil 1B.|Rod.				viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(2)|stomach(1)|urinary_tract(1)	14				BRCA - Breast invasive adenocarcinoma(357;0.105)	Primaquine(DB01087)	GATGGGGGCCGCCTGGAGGCG	0.627																																					p.R161H		.											.	.	.	0			c.G482A						.						47.0	53.0	51.0					12																	52629096		2203	4300	6503	SO:0001583	missense	3855	exon2			GGGGCCGCCTGGA		CCDS8822.1	12q13.13	2013-01-16			ENSG00000135480	ENSG00000135480		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6445	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 7"", ""cytokeratin 7"", ""sarcolectin"", ""keratin, 55K type II cytoskeletal"""	148059				1713141, 16831889	Standard	XR_245927		Approved	K7, CK7, K2C7, SCL	uc001saa.1	P08729	OTTHUMG00000169580	ENST00000331817.5:c.482G>A	12.37:g.52629096G>A	ENSP00000329243:p.Arg161His	Somatic	18	0		WXS	Illumina HiSeq	.	89	4	NM_005556	Q92676|Q9BUD8|Q9Y3R7	Missense_Mutation	SNP	ENST00000331817.5	37	CCDS8822.1	.	.	.	.	.	.	.	.	.	.	G	15.40	2.822532	0.50739	.	.	ENSG00000135480	ENST00000331817;ENST00000543899;ENST00000422319;ENST00000551537	D	0.90563	-2.69	4.6	2.77	0.32553	Filament (1);	0.000000	0.36167	N	0.002746	D	0.89241	0.6659	M	0.86178	2.8	0.39292	D	0.964743	B;P	0.38167	0.187;0.621	B;B	0.34652	0.105;0.187	D	0.87941	0.2717	10	0.87932	D	0	.	8.1219	0.30976	0.2442:0.0:0.7558:0.0	.	161;161	F8VZY5;P08729	.;K2C7_HUMAN	H	161;161;137;161	ENSP00000329243:R161H	ENSP00000329243:R161H	R	+	2	0	KRT7	50915363	0.443000	0.25641	0.999000	0.59377	0.989000	0.77384	3.677000	0.54619	0.678000	0.31325	0.655000	0.94253	CGC	.		0.627	KRT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404897.1	NM_005556	
TUBB2A	7280	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	3155891	3155891	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr6:3155891C>T	ENST00000333628.3	-	3	307	c.245G>A	c.(244-246)gGc>gAc	p.G82D	TUBB2A_ENST00000489942.1_5'UTR|RP1-40E16.11_ENST00000447644.1_RNA	NM_001069.2	NP_001060.1	Q13885	TBB2A_HUMAN	tubulin, beta 2A class IIa	82					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|large_intestine(4)|lung(2)|skin(1)	9	Ovarian(93;0.0386)	all_hematologic(90;0.0895)				GAAGATCTGGCCGAAGGGTCC	0.512																																					p.G82D		.											.	.	.	0			c.G245A						.						77.0	67.0	71.0					6																	3155891		2203	4300	6503	SO:0001583	missense	7280	exon3			ATCTGGCCGAAGG	AY159127	CCDS4484.1	6p25.2	2012-10-02	2011-10-10	2005-11-03	ENSG00000137267	ENSG00000137267		"""Tubulins"""	12412	protein-coding gene	gene with protein product	"""class IIa beta-tubulin"""	615101	"""tubulin, beta polypeptide"", ""tubulin, beta 2"", ""tubulin, beta 2A"""	TUBB, TUBB2		14574404	Standard	NM_001069		Approved	dJ40E16.7	uc003mvc.3	Q13885	OTTHUMG00000014135	ENST00000333628.3:c.245G>A	6.37:g.3155891C>T	ENSP00000369703:p.Gly82Asp	Somatic	26	0		WXS	Illumina HiSeq	.	36	6	NM_001069	Q6FGZ8|Q8IWR2	Missense_Mutation	SNP	ENST00000333628.3	37	CCDS4484.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.103018	0.76983	.	.	ENSG00000137267	ENST00000333628	T	0.69040	-0.37	5.16	5.16	0.70880	Tubulin/FtsZ, GTPase domain (4);	0.000000	0.56097	U	0.000039	D	0.89015	0.6595	H	0.98721	4.31	0.80722	D	1	D;D	0.89917	0.991;1.0	D;D	0.97110	0.994;1.0	D	0.93314	0.6687	10	0.87932	D	0	.	18.9935	0.92803	0.0:1.0:0.0:0.0	.	82;82	Q13885;Q8N6N5	TBB2A_HUMAN;.	D	82	ENSP00000369703:G82D	ENSP00000369703:G82D	G	-	2	0	TUBB2A	3100890	1.000000	0.71417	0.999000	0.59377	0.922000	0.55478	7.565000	0.82337	2.569000	0.86673	0.650000	0.86243	GGC	.		0.512	TUBB2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039662.1	NM_001069	
NACA	4666	hgsc.bcm.edu	37	12	57113583	57113583	+	Silent	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr12:57113583G>T	ENST00000454682.1	-	3	2012	c.1731C>A	c.(1729-1731)tcC>tcA	p.S577S	NACA_ENST00000548563.1_Intron|NACA_ENST00000551793.1_Intron|NACA_ENST00000356769.3_Intron|NACA_ENST00000552540.1_Intron|NACA_ENST00000393891.4_Intron|NACA_ENST00000546392.1_Intron|NACA_ENST00000550952.1_Silent_p.S577S	NM_001113203.2	NP_001106674.2	E9PAV3	NACAM_HUMAN	nascent polypeptide-associated complex alpha subunit	577	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	10						CTGGAGAAGAGGATGTACTTT	0.512			T	BCL6	NHL																																p.S577S		.		Dom	yes		12	12q23-q24.1	4666	nascent-polypeptide-associated complex alpha polypeptide		L	NACA_ENST00000550952,NS,carcinoma,0,2	NACA_ENST00000550952	0	0			c.C1731A						.						61.0	60.0	60.0					12																	57113583		1568	3582	5150	SO:0001819	synonymous_variant	4666	exon3			AGAAGAGGATGTA	X80909	CCDS31837.1, CCDS44925.1, CCDS44925.2	12q23-q24.1	2008-09-05	2007-04-20		ENSG00000196531	ENSG00000196531			7629	protein-coding gene	gene with protein product		601234	"""nascent-polypeptide-associated complex alpha polypeptide"""			8047162	Standard	NM_001113202		Approved	NACA1	uc001sma.2	E9PAV3		ENST00000454682.1:c.1731C>A	12.37:g.57113583G>T		Somatic	41	0		WXS	Illumina HiSeq	.	43	2	NM_001113203		Silent	SNP	ENST00000454682.1	37																																																																																				.		0.512	NACA-201	KNOWN	basic	protein_coding	protein_coding		NM_005594	
PDGFD	80310	hgsc.bcm.edu	37	11	103814350	103814350	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr11:103814350G>A	ENST00000393158.2	-	5	781	c.602C>T	c.(601-603)aCg>aTg	p.T201M	RP11-617B3.2_ENST00000527804.1_RNA|PDGFD_ENST00000302251.5_Missense_Mutation_p.T195M			Q9GZP0	PDGFD_HUMAN	platelet derived growth factor D	201					cellular response to amino acid stimulus (GO:0071230)|multicellular organismal development (GO:0007275)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell division (GO:0051781)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)		p.T201M(2)		biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)|prostate(3)|upper_aerodigestive_tract(1)	23		Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Melanoma(852;0.0563)|all_neural(303;0.165)		BRCA - Breast invasive adenocarcinoma(274;0.00136)|Epithelial(105;0.111)		AGTGGGATCCGTTACTGATGG	0.413																																					p.T201M		.											PDGFD_ENST00000393158,colon,carcinoma,0,2	PDGFD_ENST00000393158	0	2	Substitution - Missense(2)	large_intestine(2)	c.C602T						.						81.0	70.0	74.0					11																	103814350		2202	4299	6501	SO:0001583	missense	80310	exon5			GGATCCGTTACTG	AF113216	CCDS8326.1, CCDS41703.1	11q22.3	2008-02-05			ENSG00000170962	ENSG00000170962			30620	protein-coding gene	gene with protein product	"""spinal cord derived growth factor B"""	609673				11162582, 11980634	Standard	NM_033135		Approved	SCDGF-B, MSTP036, IEGF	uc001phq.3	Q9GZP0	OTTHUMG00000165953	ENST00000393158.2:c.602C>T	11.37:g.103814350G>A	ENSP00000376865:p.Thr201Met	Somatic	40	0		WXS	Illumina HiSeq	.	43	2	NM_025208	A8K9T6|Q9BWV5	Missense_Mutation	SNP	ENST00000393158.2	37	CCDS41703.1	.	.	.	.	.	.	.	.	.	.	G	17.17	3.321767	0.60634	.	.	ENSG00000170962	ENST00000393158;ENST00000302251	T;T	0.27256	1.68;1.68	5.53	5.53	0.82687	.	0.167413	0.52532	D	0.000063	T	0.25269	0.0614	L	0.49350	1.555	0.58432	D	0.999999	B;P	0.43352	0.272;0.804	B;B	0.34536	0.036;0.185	T	0.02958	-1.1089	10	0.33940	T	0.23	-12.7101	19.823	0.96605	0.0:0.0:1.0:0.0	.	201;195	Q9GZP0;Q9GZP0-2	PDGFD_HUMAN;.	M	201;195	ENSP00000376865:T201M;ENSP00000302193:T195M	ENSP00000302193:T195M	T	-	2	0	PDGFD	103319560	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.384000	0.66225	2.770000	0.95276	0.650000	0.86243	ACG	.		0.413	PDGFD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387231.2	NM_025208	
SPHAR	10638	hgsc.bcm.edu	37	1	229440935	229440935	+	Nonsense_Mutation	SNP	C	C	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr1:229440935C>A	ENST00000366688.3	+	1	807	c.54C>A	c.(52-54)tgC>tgA	p.C18*	RAB4A_ENST00000366690.4_3'UTR	NM_006542.3	NP_006533.1	Q15513	SPHAR_HUMAN	S-phase response (cyclin related)	18					DNA replication (GO:0006260)							Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.167)				TTGAGTTTTGCTTTTTTTATG	0.289																																					p.C18X		.											.	.	.	0			c.C54A						.						71.0	71.0	71.0					1																	229440935		2199	4292	6491	SO:0001587	stop_gained	10638	exon1			GTTTTGCTTTTTT	BC070287	CCDS1576.1	1q42.13	2009-03-11			ENSG00000213029	ENSG00000213029			16957	protein-coding gene	gene with protein product						7799938	Standard	NM_006542		Approved		uc001htk.4	Q15513	OTTHUMG00000058947	ENST00000366688.3:c.54C>A	1.37:g.229440935C>A	ENSP00000355649:p.Cys18*	Somatic	33	0		WXS	Illumina HiSeq	.	67	3	NM_006542	Q4EW09|Q6NSB9	Nonsense_Mutation	SNP	ENST00000366688.3	37	CCDS1576.1	.	.	.	.	.	.	.	.	.	.	C	32	5.174544	0.94807	.	.	ENSG00000213029	ENST00000366688	.	.	.	4.27	-3.63	0.04529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	5.9786	0.19395	0.0:0.271:0.1494:0.5796	.	.	.	.	X	18	.	ENSP00000355649:C18X	C	+	3	2	SPHAR	227507558	0.000000	0.05858	0.000000	0.03702	0.060000	0.15804	-0.969000	0.03813	-1.054000	0.03214	-0.345000	0.07892	TGC	.		0.289	SPHAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130347.1	NM_006542	
EIF4ENIF1	56478	hgsc.bcm.edu	37	22	31859005	31859005	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr22:31859005C>T	ENST00000397525.1	-	6	923	c.700G>A	c.(700-702)Gaa>Aaa	p.E234K	RP11-247I13.8_ENST00000439588.1_RNA|EIF4ENIF1_ENST00000344710.5_Intron|EIF4ENIF1_ENST00000330125.5_Missense_Mutation_p.E234K|EIF4ENIF1_ENST00000397523.1_Missense_Mutation_p.E234K|RP11-247I13.11_ENST00000483736.1_RNA|RP11-247I13.11_ENST00000464523.1_RNA	NM_001164501.1	NP_001157973.1	Q9NRA8	4ET_HUMAN	eukaryotic translation initiation factor 4E nuclear import factor 1	234						cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						CCAGTCAGTTCGATGGTTTCA	0.443																																					p.E234K		.											EIF4ENIF1,colon,carcinoma,0,1	EIF4ENIF1	0	0			c.G700A						.						126.0	106.0	113.0					22																	31859005		2203	4300	6503	SO:0001583	missense	56478	exon6			TCAGTTCGATGGT	AF240775	CCDS13898.1, CCDS54520.1	22q11.2	2007-01-16			ENSG00000184708	ENSG00000184708			16687	protein-coding gene	gene with protein product		607445				10856257	Standard	NM_019843		Approved	4E-T, FLJ21601, Clast4, 2610509L04Rik	uc003akz.2	Q9NRA8	OTTHUMG00000030793	ENST00000397525.1:c.700G>A	22.37:g.31859005C>T	ENSP00000380659:p.Glu234Lys	Somatic	30	0		WXS	Illumina HiSeq	.	49	2	NM_019843	B1AKL2|B1AKL3|B2RBF1|Q8NCF2|Q9H708	Missense_Mutation	SNP	ENST00000397525.1	37	CCDS13898.1	.	.	.	.	.	.	.	.	.	.	C	36	5.704650	0.96812	.	.	ENSG00000184708	ENST00000397525;ENST00000330125;ENST00000397523;ENST00000420671	.	.	.	5.66	5.66	0.87406	.	0.100020	0.64402	D	0.000002	T	0.79947	0.4534	M	0.74467	2.265	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.79671	-0.1706	9	0.54805	T	0.06	-18.9548	18.7679	0.91880	0.0:1.0:0.0:0.0	.	234	Q9NRA8	4ET_HUMAN	K	234	.	ENSP00000328103:E234K	E	-	1	0	EIF4ENIF1	30189005	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.220000	0.78008	2.857000	0.98124	0.650000	0.86243	GAA	.		0.443	EIF4ENIF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127926.1	NM_019843	
KPNA7	402569	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	7	98775657	98775657	+	Silent	SNP	C	C	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr7:98775657C>T	ENST00000327442.6	-	9	1389	c.1350G>A	c.(1348-1350)ctG>ctA	p.L450L		NM_001145715.1	NP_001139187.1	A9QM74	IMA8_HUMAN	karyopherin alpha 7 (importin alpha 8)	450					cytokine-mediated signaling pathway (GO:0019221)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	protein transporter activity (GO:0008565)			breast(3)|endometrium(2)|kidney(1)|prostate(1)|skin(1)	8						TCAGAAGACACAGGTTTTCCT	0.517																																					p.L450L		.											.	.	.	0			c.G1350A						.						193.0	149.0	163.0					7																	98775657		692	1591	2283	SO:0001819	synonymous_variant	402569	exon9			AAGACACAGGTTT		CCDS47651.1	7q22.1	2013-02-14			ENSG00000185467	ENSG00000185467		"""Importins"", ""Armadillo repeat containing"""	21839	protein-coding gene	gene with protein product		614107					Standard	NM_001145715		Approved		uc010lft.2	A9QM74	OTTHUMG00000154412	ENST00000327442.6:c.1350G>A	7.37:g.98775657C>T		Somatic	18	0		WXS	Illumina HiSeq	.	32	17	NM_001145715	A4D277	Silent	SNP	ENST00000327442.6	37	CCDS47651.1																																																																																			.		0.517	KPNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335118.1	NM_001145715	
HTT	3064	hgsc.bcm.edu	37	4	3076659	3076659	+	Missense_Mutation	SNP	A	A	C			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr4:3076659A>C	ENST00000355072.5	+	1	252	c.107A>C	c.(106-108)cAg>cCg	p.Q36P	HTT-AS_ENST00000503893.1_RNA	NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	36	Poly-Gln.				anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		cagcagcagcagcaacagccg	0.706																																					p.Q36P		.											.	.	.	0			c.A107C						.						1.0	2.0	2.0					4																	3076659		405	1354	1759	SO:0001583	missense	3064	exon1			AGCAGCAGCAACA	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.107A>C	4.37:g.3076659A>C	ENSP00000347184:p.Gln36Pro	Somatic	6	0		WXS	Illumina HiSeq	.	8	7	NM_002111	Q9UQB7	Missense_Mutation	SNP	ENST00000355072.5	37	CCDS43206.1	.	.	.	.	.	.	.	.	.	.	-	0.013	-1.614452	0.00835	.	.	ENSG00000197386	ENST00000355072	T	0.20738	2.05	0.538	-0.648	0.11464	.	.	.	.	.	T	0.08714	0.0216	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33879	-0.9851	8	0.30078	T	0.28	.	.	.	.	.	36	P42858	HD_HUMAN	P	36	ENSP00000347184:Q36P	ENSP00000347184:Q36P	Q	+	2	0	HTT	3046457	0.992000	0.36948	0.001000	0.08648	0.032000	0.12392	0.173000	0.16724	-0.308000	0.08792	0.138000	0.15974	CAG	.		0.706	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
SMC3	9126	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	10	112352927	112352927	+	Nonsense_Mutation	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr10:112352927G>T	ENST00000361804.4	+	18	2035	c.1909G>T	c.(1909-1911)Gaa>Taa	p.E637*		NM_005445.3	NP_005436.1	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	637	Flexible hinge.				DNA repair (GO:0006281)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid cohesion (GO:0007064)|mitotic spindle organization (GO:0007052)|negative regulation of DNA endoreduplication (GO:0032876)|regulation of DNA replication (GO:0006275)|signal transduction (GO:0007165)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	basement membrane (GO:0005604)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cohesin core heterodimer (GO:0008280)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear matrix (GO:0016363)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|dynein binding (GO:0045502)|microtubule motor activity (GO:0003777)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		TCGTAGCATGGAAGTTTCAAC	0.368																																					p.E637X		.											.	.	.	0			c.G1909T						.						103.0	95.0	97.0					10																	112352927		2203	4300	6503	SO:0001587	stop_gained	9126	exon18			AGCATGGAAGTTT	AF020043	CCDS31285.1	10q25	2014-09-17	2006-07-06	2006-07-06	ENSG00000108055	ENSG00000108055		"""Structural maintenance of chromosomes proteins"", ""Proteoglycans / Extracellular Matrix : Other"""	2468	protein-coding gene	gene with protein product	"""bamacan proteoglycan"""	606062	"""chondroitin sulfate proteoglycan 6 (bamacan)"""	CSPG6		9506951, 10358101	Standard	NM_005445		Approved	HCAP, BAM, SMC3L1, bamacan	uc001kze.3	Q9UQE7	OTTHUMG00000019042	ENST00000361804.4:c.1909G>T	10.37:g.112352927G>T	ENSP00000354720:p.Glu637*	Somatic	47	0		WXS	Illumina HiSeq	.	59	20	NM_005445	A8K156|O60464|Q5T482	Nonsense_Mutation	SNP	ENST00000361804.4	37	CCDS31285.1	.	.	.	.	.	.	.	.	.	.	G	40	8.023481	0.98616	.	.	ENSG00000108055	ENST00000361804	.	.	.	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	19.0294	0.92950	0.0:0.0:1.0:0.0	.	.	.	.	X	637	.	ENSP00000354720:E637X	E	+	1	0	SMC3	112342917	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.682000	0.98655	2.569000	0.86673	0.585000	0.79938	GAA	.		0.368	SMC3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050337.1	NM_005445	
FILIP1L	11259	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	99568867	99568867	+	Silent	SNP	G	G	C	rs558970547		TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr3:99568867G>C	ENST00000354552.3	-	5	2123	c.1653C>G	c.(1651-1653)acC>acG	p.T551T	FILIP1L_ENST00000487087.1_Silent_p.T127T|FILIP1L_ENST00000383694.2_Silent_p.T311T|FILIP1L_ENST00000331335.5_Silent_p.T551T|FILIP1L_ENST00000471562.1_Silent_p.T311T|FILIP1L_ENST00000476723.1_Intron|CMSS1_ENST00000496116.1_Intron|CMSS1_ENST00000421999.2_Intron	NM_182909.2	NP_878913.2	Q4L180	FIL1L_HUMAN	filamin A interacting protein 1-like	551						cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	35						CTTCTACATCGGTTTTGGACT	0.383																																					p.T551T		.											FILIP1L_ENST00000354552,NS,carcinoma,0,2	FILIP1L_ENST00000354552	0	0			c.C1653G						.						104.0	92.0	95.0					3																	99568867		1859	4095	5954	SO:0001819	synonymous_variant	11259	exon5			TACATCGGTTTTG		CCDS43117.1, CCDS43118.1, CCDS43119.1, CCDS63700.1, CCDS74969.1	3q12.1	2011-10-21			ENSG00000168386	ENSG00000168386			24589	protein-coding gene	gene with protein product	"""downregulated in ovarian cancer 1"", ""GPBP-interacting protein of 130 kDa"""	612993				8314147, 15935955, 21832087	Standard	NM_001282793		Approved	DOC-1, GIP130	uc003dtm.3	Q4L180	OTTHUMG00000159055	ENST00000354552.3:c.1653C>G	3.37:g.99568867G>C		Somatic	17	0		WXS	Illumina HiSeq	.	33	12	NM_182909	B2CNV7|B2CNV8|Q13597|Q2YDY5|Q6KFX5|Q6KFX6|Q6KFX7|Q8IUM3|Q8N6Z0	Silent	SNP	ENST00000354552.3	37	CCDS43117.1																																																																																			.		0.383	FILIP1L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353069.1	NM_014890	
FUK	197258	hgsc.bcm.edu	37	16	70497537	70497537	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr16:70497537C>T	ENST00000288078.6	+	3	326	c.94C>T	c.(94-96)Cgg>Tgg	p.R32W	FUK_ENST00000571514.1_Intron|FUK_ENST00000378912.2_Missense_Mutation_p.R32W|FUK_ENST00000428974.2_Missense_Mutation_p.R32W	NM_145059.2	NP_659496.2	Q8N0W3	FUK_HUMAN	fucokinase	32						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|fucokinase activity (GO:0050201)	p.R32W(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(11)|ovary(2)|prostate(2)	23		Ovarian(137;0.0694)				ACTGGAAGTGCGGCAGAAGCG	0.617																																					p.R32W		.											FUK_ENST00000428974,NS,carcinoma,0,3	FUK_ENST00000428974	0	1	Substitution - Missense(1)	lung(1)	c.C94T						.						67.0	73.0	71.0					16																	70497537		2019	4166	6185	SO:0001583	missense	197258	exon3			GAAGTGCGGCAGA		CCDS10891.2	16q22.1	2008-02-05			ENSG00000157353	ENSG00000157353	2.7.1.52		29500	protein-coding gene	gene with protein product	"""L-fucose kinase"""	608675				12056818	Standard	XM_006721161		Approved	FLJ39408	uc002eyy.3	Q8N0W3	OTTHUMG00000074085	ENST00000288078.6:c.94C>T	16.37:g.70497537C>T	ENSP00000288078:p.Arg32Trp	Somatic	30	0		WXS	Illumina HiSeq	.	41	2	NM_145059	Q5PSM3|Q5XKL6|Q6ZRA0|Q96MT9	Missense_Mutation	SNP	ENST00000288078.6	37	CCDS10891.2	.	.	.	.	.	.	.	.	.	.	C	21.0	4.084491	0.76642	.	.	ENSG00000157353	ENST00000288078;ENST00000378912;ENST00000428974	T;T;T	0.51574	3.05;2.97;0.7	5.05	3.0	0.34707	.	0.000000	0.64402	D	0.000001	T	0.67287	0.2877	M	0.78637	2.42	0.39927	D	0.97423	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.995;0.977;0.999	T	0.71626	-0.4536	10	0.72032	D	0.01	-27.2187	12.664	0.56830	0.4431:0.5569:0.0:0.0	.	32;32;32	B4DEU5;Q8N0W3-2;Q8N0W3	.;.;FUK_HUMAN	W	32	ENSP00000288078:R32W;ENSP00000368192:R32W;ENSP00000408007:R32W	ENSP00000288078:R32W	R	+	1	2	FUK	69055038	0.999000	0.42202	0.995000	0.50966	0.947000	0.59692	1.248000	0.32827	0.575000	0.29434	0.655000	0.94253	CGG	.		0.617	FUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157291.2	NM_145059	
ADAMTS13	11093	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	136305517	136305517	+	Silent	SNP	T	T	G			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr9:136305517T>G	ENST00000371929.3	+	16	2283	c.1839T>G	c.(1837-1839)ccT>ccG	p.P613P	ADAMTS13_ENST00000485925.1_3'UTR|ADAMTS13_ENST00000536611.1_Silent_p.P285P|ADAMTS13_ENST00000356589.2_Silent_p.P582P|ADAMTS13_ENST00000355699.2_Silent_p.P613P|ADAMTS13_ENST00000371916.1_3'UTR	NM_139025.3|NM_139027.3	NP_620594.1|NP_620596.2	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 13	613	Spacer.				cell-matrix adhesion (GO:0007160)|glycoprotein metabolic process (GO:0009100)|integrin-mediated signaling pathway (GO:0007229)|peptide catabolic process (GO:0043171)|platelet activation (GO:0030168)|protein processing (GO:0016485)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to interleukin-4 (GO:0070670)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(4)	36				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		GCATCTCCCCTAACACCACCT	0.647																																					p.P613P		.											.	.	.	0			c.T1839G						.						132.0	94.0	107.0					9																	136305517		2203	4300	6503	SO:0001819	synonymous_variant	11093	exon16			CTCCCCTAACACC	AJ011374	CCDS6970.1, CCDS6971.1, CCDS6972.1	9q34	2008-07-21	2005-08-19	2001-09-21	ENSG00000160323	ENSG00000160323		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	1366	protein-coding gene	gene with protein product		604134	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13"""	C9orf8		11557746, 11535495	Standard	NM_139025		Approved	VWFCP, TTP, vWF-CP, FLJ42993, MGC118899, MGC118900, DKFZp434C2322	uc004cdv.4	Q76LX8	OTTHUMG00000020876	ENST00000371929.3:c.1839T>G	9.37:g.136305517T>G		Somatic	30	0		WXS	Illumina HiSeq	.	25	9	NM_139027	Q6UY16|Q710F6|Q711T8|Q96L37|Q9H0G3|Q9UGQ1	Silent	SNP	ENST00000371929.3	37	CCDS6970.1																																																																																			.		0.647	ADAMTS13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054920.1	NM_139025	
EIF5B	9669	hgsc.bcm.edu	37	2	100007024	100007024	+	Silent	SNP	G	G	C			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr2:100007024G>C	ENST00000289371.6	+	17	2806	c.2604G>C	c.(2602-2604)ggG>ggC	p.G868G		NM_015904.3	NP_056988.3	O60841	IF2P_HUMAN	eukaryotic translation initiation factor 5B	868					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of translational initiation (GO:0006446)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						CTCTCCCGGGGATGGGCACCA	0.403																																					p.G868G	Colon(162;2388 2567 2705 3444)	.											EIF5B,NS,carcinoma,0,1	EIF5B	0	0			c.G2604C						.						159.0	144.0	149.0					2																	100007024		1907	4125	6032	SO:0001819	synonymous_variant	9669	exon17			CCCGGGGATGGGC	AF078035	CCDS42721.1	2q11.2	2012-09-20			ENSG00000158417	ENSG00000158417			30793	protein-coding gene	gene with protein product	"""translation initiation factor IF2"""	606086				10200264, 10432305	Standard	XM_005264075		Approved	IF2, KIAA0741, DKFZp434I036, FLJ10524	uc002tab.3	O60841	OTTHUMG00000153242	ENST00000289371.6:c.2604G>C	2.37:g.100007024G>C		Somatic	39	0		WXS	Illumina HiSeq	.	43	2	NM_015904	O95805|Q53RV7|Q53SI8|Q9UF81|Q9UMN7	Silent	SNP	ENST00000289371.6	37	CCDS42721.1																																																																																			.		0.403	EIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330364.2	NM_015904	
POLB	5423	hgsc.bcm.edu;bcgsc.ca	37	8	42202490	42202490	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr8:42202490G>T	ENST00000265421.4	+	3	309	c.139G>T	c.(139-141)Gca>Tca	p.A47S	POLB_ENST00000538005.1_5'UTR	NM_002690.2	NP_002681.1	P06746	DPOLB_HUMAN	polymerase (DNA directed), beta	47					base-excision repair (GO:0006284)|base-excision repair, gap-filling (GO:0006287)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|DNA-dependent DNA replication (GO:0006261)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|neuron apoptotic process (GO:0051402)|pyrimidine dimer repair (GO:0006290)|response to ethanol (GO:0045471)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|enzyme binding (GO:0019899)|lyase activity (GO:0016829)|metal ion binding (GO:0046872)|microtubule binding (GO:0008017)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(5)|ovary(1)	16	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;2.58e-12)|Lung NSC(13;4.24e-11)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.1)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;3.18e-11)|Lung(22;0.00467)|OV - Ovarian serous cystadenocarcinoma(14;0.00523)|LUSC - Lung squamous cell carcinoma(45;0.024)		Cytarabine(DB00987)	ATCTGTTATAGCAAAATACCC	0.343								DNA polymerases (catalytic subunits)																													p.A47S		.											.	.	.	0			c.G139T						.						157.0	160.0	159.0					8																	42202490		2203	4300	6503	SO:0001583	missense	5423	exon3			GTTATAGCAAAAT		CCDS6129.1	8p12-p11	2012-10-02			ENSG00000070501	ENSG00000070501	2.7.7.7	"""DNA polymerases"""	9174	protein-coding gene	gene with protein product		174760					Standard	NM_002690		Approved		uc003xoz.2	P06746	OTTHUMG00000164093	ENST00000265421.4:c.139G>T	8.37:g.42202490G>T	ENSP00000265421:p.Ala47Ser	Somatic	50	0		WXS	Illumina HiSeq	.	58	4	NM_002690	B2RC78|Q3KP48|Q6FI34	Missense_Mutation	SNP	ENST00000265421.4	37	CCDS6129.1	.	.	.	.	.	.	.	.	.	.	G	13.68	2.307986	0.40895	.	.	ENSG00000070501	ENST00000265421;ENST00000518925	T;T	0.44482	0.92;0.92	5.65	5.65	0.86999	DNA-directed DNA polymerase X (1);DNA-directed DNA polymerase, family X, beta-like, N-terminal (2);	0.166497	0.52532	D	0.000070	T	0.25865	0.0630	N	0.10760	0.04	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.07233	-1.0783	10	0.22109	T	0.4	-0.0127	17.2265	0.86972	0.0:0.0:1.0:0.0	.	47;47	Q53EV2;P06746	.;DPOLB_HUMAN	S	47	ENSP00000265421:A47S;ENSP00000430784:A47S	ENSP00000265421:A47S	A	+	1	0	POLB	42321647	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.314000	0.43743	2.662000	0.90505	0.650000	0.86243	GCA	.		0.343	POLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377242.1	NM_002690	
HELQ	113510	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	84337954	84337954	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr4:84337954G>A	ENST00000295488.3	-	17	3290	c.3128C>T	c.(3127-3129)cCt>cTt	p.P1043L	HELQ_ENST00000510985.1_Missense_Mutation_p.P976L	NM_133636.2	NP_598375	Q8TDG4	HELQ_HUMAN	helicase, POLQ-like	1043					double-strand break repair via homologous recombination (GO:0000724)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(10)|lung(17)|ovary(2)|skin(2)	38						GAGCACTTCAGGATTTGCATT	0.358								Other identified genes with known or suspected DNA repair function																													p.P1043L		.											.	.	.	0			c.C3128T						.						185.0	176.0	179.0					4																	84337954		2203	4300	6503	SO:0001583	missense	113510	exon17			ACTTCAGGATTTG	AF436845	CCDS3603.1, CCDS75158.1	4q21.23	2009-02-26			ENSG00000163312	ENSG00000163312			18536	protein-coding gene	gene with protein product		606769				11751861	Standard	XM_005262711		Approved	Hel308	uc003hom.3	Q8TDG4	OTTHUMG00000130423	ENST00000295488.3:c.3128C>T	4.37:g.84337954G>A	ENSP00000295488:p.Pro1043Leu	Somatic	64	0		WXS	Illumina HiSeq	.	42	30	NM_133636	Q05DF9|Q502W9|Q659B8|Q6ZQX4|Q6ZTS4|Q96EX7	Missense_Mutation	SNP	ENST00000295488.3	37	CCDS3603.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.536156	0.85812	.	.	ENSG00000163312	ENST00000295488;ENST00000510985	T;T	0.65549	0.12;-0.16	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.81545	0.4845	M	0.81942	2.565	0.80722	D	1	D;D	0.89917	1.0;0.992	D;P	0.85130	0.997;0.885	T	0.82242	-0.0554	10	0.59425	D	0.04	-8.5694	19.9273	0.97107	0.0:0.0:1.0:0.0	.	976;1043	E3W980;Q8TDG4	.;HELQ_HUMAN	L	1043;976	ENSP00000295488:P1043L;ENSP00000424539:P976L	ENSP00000295488:P1043L	P	-	2	0	HELQ	84556978	1.000000	0.71417	0.997000	0.53966	0.723000	0.41478	8.734000	0.91543	2.718000	0.92993	0.591000	0.81541	CCT	.		0.358	HELQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252810.1	NM_133636	
TTN	7273	hgsc.bcm.edu	37	2	179611465	179611465	+	Intron	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr2:179611465G>T	ENST00000591111.1	-	46	10585				TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000589042.1_Intron|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.S5221Y|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTCTAGTAAAGATTTATTTCG	0.388																																					p.S5221Y		.											TTN_ENST00000360870,NS,carcinoma,0,1	TTN_ENST00000360870	0	0			c.C15662A						.						99.0	97.0	98.0					2																	179611465		2203	4299	6502	SO:0001627	intron_variant	7273	exon46			AGTAAAGATTTAT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10361-4817C>A	2.37:g.179611465G>T		Somatic	49	0		WXS	Illumina HiSeq	.	50	4	NM_133379	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	11.63	1.697312	0.30142	.	.	ENSG00000155657	ENST00000360870;ENST00000306136	T	0.70045	-0.45	5.95	5.95	0.96441	.	.	.	.	.	D	0.82305	0.5008	M	0.70787	2.145	0.80722	D	1	D	0.58970	0.984	D	0.72075	0.976	T	0.81957	-0.0695	9	0.62326	D	0.03	.	20.3854	0.98941	0.0:0.0:1.0:0.0	.	5221	Q8WZ42-6	.	Y	5221;502	ENSP00000354117:S5221Y	ENSP00000304714:S502Y	S	-	2	0	TTN	179319710	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	4.506000	0.60428	2.825000	0.97269	0.655000	0.94253	TCT	.		0.388	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
SLC13A5	284111	hgsc.bcm.edu	37	17	6599187	6599187	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr17:6599187C>T	ENST00000433363.2	-	7	1146	c.913G>A	c.(913-915)Gag>Aag	p.E305K	SLC13A5_ENST00000293800.6_Missense_Mutation_p.E288K|SLC13A5_ENST00000573648.1_Missense_Mutation_p.E305K|SLC13A5_ENST00000381074.4_Missense_Mutation_p.E262K	NM_001284510.1|NM_177550.3	NP_001271439.1|NP_808218.1	Q86YT5	S13A5_HUMAN	solute carrier family 13 (sodium-dependent citrate transporter), member 5	305					transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	citrate transmembrane transporter activity (GO:0015137)|sodium:dicarboxylate symporter activity (GO:0017153)|succinate transmembrane transporter activity (GO:0015141)	p.E305K(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|prostate(5)|skin(3)|urinary_tract(1)	26						TTCCGGTACTCCTCCTGCAGC	0.557																																					p.E305K		.											SLC13A5,NS,carcinoma,0,1	SLC13A5	0	1	Substitution - Missense(1)	endometrium(1)	c.G913A						.						133.0	137.0	135.0					17																	6599187		2203	4300	6503	SO:0001583	missense	284111	exon7			GGTACTCCTCCTG	AJ489980	CCDS11079.1, CCDS45593.1, CCDS67136.1, CCDS67137.1	17p13.1	2013-05-22			ENSG00000141485	ENSG00000141485		"""Solute carriers"""	23089	protein-coding gene	gene with protein product		608305				12445824	Standard	NM_001284510		Approved	NACT	uc002gdj.3	Q86YT5	OTTHUMG00000102052	ENST00000433363.2:c.913G>A	17.37:g.6599187C>T	ENSP00000406220:p.Glu305Lys	Somatic	15	0		WXS	Illumina HiSeq	.	29	3	NM_001143838	B3KXR0|B7Z4P2|B7ZLB4|F8W7N2|Q6ZMG1	Missense_Mutation	SNP	ENST00000433363.2	37	CCDS11079.1	.	.	.	.	.	.	.	.	.	.	C	33	5.201777	0.94997	.	.	ENSG00000141485	ENST00000293800;ENST00000433363;ENST00000381074	T;T	0.03330	3.97;3.97	5.29	5.29	0.74685	.	0.094859	0.64402	D	0.000001	T	0.15696	0.0378	M	0.65498	2.005	0.80722	D	1	P;P;P;P;P	0.51351	0.904;0.94;0.904;0.904;0.944	P;P;P;P;D	0.62955	0.869;0.794;0.869;0.792;0.909	T	0.00022	-1.2339	10	0.59425	D	0.04	.	16.8046	0.85623	0.0:1.0:0.0:0.0	.	305;262;262;288;305	B7ZLB4;F8W7N2;B7Z4P2;B3KXR0;Q86YT5	.;.;.;.;S13A5_HUMAN	K	305;305;262	ENSP00000406220:E305K;ENSP00000370464:E262K	ENSP00000293800:E305K	E	-	1	0	SLC13A5	6539911	1.000000	0.71417	0.957000	0.39632	0.631000	0.37964	5.666000	0.68059	2.647000	0.89833	0.655000	0.94253	GAG	.		0.557	SLC13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219853.2	NM_177550	
OR52E8	390079	hgsc.bcm.edu	37	11	5878458	5878458	+	Silent	SNP	G	G	A	rs549924845	byFrequency	TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr11:5878458G>A	ENST00000537935.1	-	1	506	c.475C>T	c.(475-477)Ctg>Ttg	p.L159L	TRIM5_ENST00000380027.1_Intron	NM_001005168.1	NP_001005168.1	Q6IFG1	O52E8_HUMAN	olfactory receptor, family 52, subfamily E, member 8	159						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	20		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.114)		Epithelial(150;2.37e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACCATGTACAGGCTCCTCAGG	0.507													G|||	10	0.00199681	0.0068	0.0	5008	,	,		18808	0.0		0.0	False		,,,				2504	0.001				p.L159L		.											OR52E8,NS,carcinoma,0,1	OR52E8	0	0			c.C475T						.						135.0	147.0	143.0					11																	5878458		2154	4296	6450	SO:0001819	synonymous_variant	390079	exon1			TGTACAGGCTCCT	BK004301	CCDS31400.1	11p15.4	2012-08-09	2003-12-15		ENSG00000183269	ENSG00000183269		"""GPCR / Class A : Olfactory receptors"""	15217	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily E, member 8 pseudogene"""				Standard	NM_001005168		Approved		uc010qzr.2	Q6IFG1	OTTHUMG00000168803	ENST00000537935.1:c.475C>T	11.37:g.5878458G>A		Somatic	33	1		WXS	Illumina HiSeq	.	42	2	NM_001005168	B9EH38	Silent	SNP	ENST00000537935.1	37	CCDS31400.1																																																																																			.		0.507	OR52E8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401145.1	NM_001005168	
UNC80	285175	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	210703977	210703977	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr2:210703977C>T	ENST00000439458.1	+	19	3153	c.3073C>T	c.(3073-3075)Cgg>Tgg	p.R1025W	UNC80_ENST00000272845.6_Missense_Mutation_p.R1020W	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	1025					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						CAACTTGGGGCGGAAAGATTT	0.473																																					p.R1025W		.											UNC80_ENST00000439458,caecum,carcinoma,0,1	UNC80_ENST00000439458	0	0			c.C3073T						.						42.0	43.0	43.0					2																	210703977		692	1591	2283	SO:0001583	missense	285175	exon19			TTGGGGCGGAAAG	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.3073C>T	2.37:g.210703977C>T	ENSP00000391088:p.Arg1025Trp	Somatic	31	0		WXS	Illumina HiSeq	.	32	16	NM_032504	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	ENST00000439458.1	37	CCDS46504.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.946999	0.73672	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.41758	0.99;0.99	5.54	4.66	0.58398	.	0.000000	0.85682	D	0.000000	T	0.55609	0.1931	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.60156	-0.7318	10	0.87932	D	0	-17.6133	15.8806	0.79201	0.1366:0.8634:0.0:0.0	.	1025	Q8N2C7	UNC80_HUMAN	W	1025;1020	ENSP00000391088:R1025W;ENSP00000272845:R1020W	ENSP00000272845:R1020W	R	+	1	2	UNC80	210412222	0.982000	0.34865	0.979000	0.43373	0.885000	0.51271	2.651000	0.46674	1.326000	0.45319	-0.158000	0.13435	CGG	.		0.473	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	
HDAC9	9734	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	18631142	18631142	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr7:18631142C>T	ENST00000432645.2	+	4	410	c.410C>T	c.(409-411)gCa>gTa	p.A137V	HDAC9_ENST00000417496.2_Missense_Mutation_p.A179V|HDAC9_ENST00000406072.1_Missense_Mutation_p.A168V|HDAC9_ENST00000456174.2_Missense_Mutation_p.A109V|HDAC9_ENST00000405010.3_Missense_Mutation_p.A137V|HDAC9_ENST00000401921.1_Missense_Mutation_p.A140V|HDAC9_ENST00000406451.4_Missense_Mutation_p.A137V|HDAC9_ENST00000524023.1_Missense_Mutation_p.A106V|HDAC9_ENST00000428307.2_Missense_Mutation_p.A137V|HDAC9_ENST00000441542.2_Missense_Mutation_p.A140V	NM_058176.2	NP_478056.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	137	Interaction with MEF2. {ECO:0000250}.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	ATTTCAGGGGCAGTGGCAAGT	0.428																																					p.A179V		.											.	.	.	0			c.C536T						.						34.0	34.0	34.0					7																	18631142		1948	4145	6093	SO:0001583	missense	9734	exon7			CAGGGGCAGTGGC	AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000432645.2:c.410C>T	7.37:g.18631142C>T	ENSP00000410337:p.Ala137Val	Somatic	21	0		WXS	Illumina HiSeq	.	24	8	NM_001204144	A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Missense_Mutation	SNP	ENST00000432645.2	37	CCDS47555.1	.	.	.	.	.	.	.	.	.	.	C	34	5.330388	0.95733	.	.	ENSG00000048052	ENST00000417496;ENST00000262069;ENST00000413380;ENST00000405010;ENST00000406451;ENST00000428307;ENST00000406072;ENST00000401921;ENST00000432645;ENST00000441542;ENST00000441986;ENST00000456174;ENST00000524023;ENST00000341009	T;T;T;D;T;T;D;D;D;T;T;T	0.82893	-1.06;-0.14;-1.34;-1.65;-1.05;-1.12;-1.57;-1.66;-1.65;0.23;-1.36;-1.02	5.74	4.83	0.62350	.	0.111338	0.39407	N	0.001370	D	0.90356	0.6982	M	0.84219	2.685	0.80722	D	1	P;P;P;D;P;P;D;P;P;P;P;P;P	0.59357	0.824;0.923;0.954;0.985;0.824;0.629;0.974;0.954;0.939;0.813;0.954;0.954;0.923	B;P;P;P;P;B;P;P;P;P;P;P;P	0.59643	0.378;0.596;0.772;0.861;0.5;0.382;0.772;0.772;0.672;0.478;0.772;0.772;0.596	D	0.91720	0.5388	10	0.87932	D	0	-3.833	16.8211	0.85746	0.0:0.8718:0.1282:0.0	.	106;109;137;168;179;140;140;140;137;109;137;137;159	E7EX34;C9JS87;Q9UKV0-4;B5MCF1;B7Z917;Q68D71;Q9UKV0-6;Q9UKV0-7;Q9UKV0;B7Z928;Q9UKV0-5;Q9UKV0-3;Q8N879	.;.;.;.;.;.;.;.;HDAC9_HUMAN;.;.;.;.	V	179;182;140;137;137;137;168;140;137;140;106;109;106;137	ENSP00000401669:A179V;ENSP00000392564:A140V;ENSP00000384382:A137V;ENSP00000384657:A137V;ENSP00000395655:A137V;ENSP00000384017:A168V;ENSP00000383912:A140V;ENSP00000410337:A137V;ENSP00000408617:A140V;ENSP00000404763:A106V;ENSP00000388568:A109V;ENSP00000430036:A106V	ENSP00000262069:A182V	A	+	2	0	HDAC9	18597667	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.992000	0.70609	2.712000	0.92718	0.650000	0.86243	GCA	.		0.428	HDAC9-023	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376176.1		
OR52I1	390037	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	4615690	4615690	+	Missense_Mutation	SNP	C	C	A	rs202168611		TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr11:4615690C>A	ENST00000530443.2	+	1	422	c.422C>A	c.(421-423)aCg>aAg	p.T141K	OR52I1_ENST00000450052.2_Missense_Mutation_p.T165K	NM_001005169.1	NP_001005169.1	Q8NGK6	O52I1_HUMAN	olfactory receptor, family 52, subfamily I, member 1	141						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T166R(1)		central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)	15		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;7.98e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		AGAATTCTCACGCCTCAAGTG	0.512																																					p.T141K		.											OR52I1,NS,carcinoma,0,1	OR52I1	0	1	Substitution - Missense(1)	lung(1)	c.C422A						.						78.0	72.0	74.0					11																	4615690		2201	4298	6499	SO:0001583	missense	390037	exon1			TTCTCACGCCTCA	BK004371	CCDS59223.1	11p15.4	2012-08-09				ENSG00000232268		"""GPCR / Class A : Olfactory receptors"""	15220	protein-coding gene	gene with protein product							Standard	NM_001005169		Approved		uc010qyi.2	Q8NGK6		ENST00000530443.2:c.422C>A	11.37:g.4615690C>A	ENSP00000436453:p.Thr141Lys	Somatic	32	0		WXS	Illumina HiSeq	.	25	8	NM_001005169	Q6IF91	Missense_Mutation	SNP	ENST00000530443.2	37	CCDS59223.1	.	.	.	.	.	.	.	.	.	.	C	12.36	1.914109	0.33815	.	.	ENSG00000232268	ENST00000450052;ENST00000530443	T;T	0.00388	7.59;7.59	4.96	4.04	0.47022	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46145	D	0.000314	T	0.00524	0.0017	M	0.87827	2.91	0.29542	N	0.852038	P	0.35481	0.504	B	0.36808	0.233	T	0.15292	-1.0442	9	0.87932	D	0	-12.5133	11.5906	0.50943	0.0:0.8206:0.1794:0.0	.	141	Q8NGK6	O52I1_HUMAN	K	165;141	ENSP00000409094:T165K;ENSP00000436453:T141K	ENSP00000409094:T165K	T	+	2	0	OR52I1	4572266	0.012000	0.17670	0.987000	0.45799	0.544000	0.35116	0.134000	0.15932	1.451000	0.47736	-0.273000	0.10243	ACG	.		0.512	OR52I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385947.2	NM_001005169	
FARSB	10056	hgsc.bcm.edu	37	2	223497945	223497945	+	Missense_Mutation	SNP	C	C	T	rs139596776		TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr2:223497945C>T	ENST00000281828.6	-	7	951	c.688G>A	c.(688-690)Gtc>Atc	p.V230I	FARSB_ENST00000536361.1_Missense_Mutation_p.V131I	NM_005687.3	NP_005678.3	Q9NSD9	SYFB_HUMAN	phenylalanyl-tRNA synthetase, beta subunit	230					gene expression (GO:0010467)|phenylalanyl-tRNA aminoacylation (GO:0006432)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|phenylalanine-tRNA ligase activity (GO:0004826)|RNA binding (GO:0003723)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	24		Renal(207;0.0183)		Epithelial(121;3.47e-10)|all cancers(144;1.86e-07)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.011)	L-Phenylalanine(DB00120)	ATTGAAAGGACGACACCATTG	0.343																																					p.V230I		.											FARSB,caecum,carcinoma,0,1	FARSB	0	0			c.G688A						.	C	ILE/VAL	0,4406		0,0,2203	123.0	121.0	121.0		688	3.3	0.5	2	dbSNP_134	121	3,8595	3.0+/-9.4	0,3,4296	yes	missense	FARSB	NM_005687.3	29	0,3,6499	TT,TC,CC		0.0349,0.0,0.0231	benign	230/590	223497945	3,13001	2203	4299	6502	SO:0001583	missense	10056	exon7			AAAGGACGACACC	AF042346	CCDS2454.1	2q36.2	2011-07-01	2007-02-23	2007-02-23	ENSG00000116120	ENSG00000116120	6.1.1.20	"""Aminoacyl tRNA synthetases / Class II"""	17800	protein-coding gene	gene with protein product	"""phenylalanine tRNA ligase 1, beta, cytoplasmic"""	609690	"""phenylalanyl-tRNA synthetase-like, beta subunit"""	FARSLB		10049785	Standard	NM_005687		Approved	PheHB, FRSB	uc002vne.1	Q9NSD9	OTTHUMG00000133155	ENST00000281828.6:c.688G>A	2.37:g.223497945C>T	ENSP00000281828:p.Val230Ile	Somatic	41	0		WXS	Illumina HiSeq	.	55	3	NM_005687	B4DFM0|O95708|Q4ZFX1|Q57ZJ5|Q9NZZ6	Missense_Mutation	SNP	ENST00000281828.6	37	CCDS2454.1	.	.	.	.	.	.	.	.	.	.	C	14.58	2.577343	0.45902	0.0	3.49E-4	ENSG00000116120	ENST00000281828;ENST00000536361	T;T	0.28666	1.6;1.6	5.29	3.29	0.37713	B3/B4 tRNA-binding domain (2);Phenylalanyl-tRNA synthetase, B3/B4 (1);	0.239136	0.42548	N	0.000690	T	0.26195	0.0639	M	0.67953	2.075	0.50171	D	0.999851	P;B	0.36974	0.576;0.06	B;B	0.32211	0.142;0.045	T	0.03576	-1.1023	10	0.41790	T	0.15	-6.6224	6.3995	0.21630	0.0:0.6778:0.1427:0.1795	.	230;230	A8K666;Q9NSD9	.;SYFB_HUMAN	I	230;131	ENSP00000281828:V230I;ENSP00000442950:V131I	ENSP00000281828:V230I	V	-	1	0	FARSB	223206189	0.902000	0.30710	0.492000	0.27490	0.978000	0.69477	1.837000	0.39201	0.579000	0.29504	0.478000	0.44815	GTC	0.000		0.343	FARSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256855.2	NM_005687	
C17orf78	284099	hgsc.bcm.edu;bcgsc.ca	37	17	35746210	35746210	+	Silent	SNP	C	C	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr17:35746210C>T	ENST00000300618.4	+	6	713	c.663C>T	c.(661-663)tgC>tgT	p.C221C	C17orf78_ENST00000586700.1_Missense_Mutation_p.P141S|ACACA_ENST00000353139.5_Intron|ACACA_ENST00000589665.1_Intron|ACACA_ENST00000416895.1_Intron|RP11-378E13.3_ENST00000592238.1_RNA	NM_173625.3	NP_775896.3	Q8N4C9	CQ078_HUMAN	chromosome 17 open reading frame 78	221						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|large_intestine(1)|lung(2)|stomach(1)	6		Breast(25;0.00295)|Ovarian(249;0.15)				GGAAGCTGTGCCAATGCCAGT	0.493																																					p.C221C		.											.	.	.	0			c.C663T						.						46.0	48.0	48.0					17																	35746210		1972	4163	6135	SO:0001819	synonymous_variant	284099	exon6			GCTGTGCCAATGC	BC034672	CCDS45655.1	17q12	2014-05-06			ENSG00000167230	ENSG00000278505			26831	protein-coding gene	gene with protein product						14702039	Standard	NM_173625		Approved	FLJ39647	uc002hns.3	Q8N4C9	OTTHUMG00000188467	ENST00000300618.4:c.663C>T	17.37:g.35746210C>T		Somatic	31	0		WXS	Illumina HiSeq	.	31	4	NM_173625	Q8N8D2	Silent	SNP	ENST00000300618.4	37	CCDS45655.1	.	.	.	.	.	.	.	.	.	.	C	12.02	1.813713	0.32053	.	.	ENSG00000167230	ENST00000321564	.	.	.	4.89	3.92	0.45320	.	.	.	.	.	T	0.49167	0.1541	.	.	.	0.80722	D	1	P	0.49961	0.93	P	0.44477	0.451	T	0.52719	-0.8538	7	0.59425	D	0.04	-1.4057	9.6024	0.39612	0.0:0.9045:0.0:0.0955	.	141	Q8N4C9-2	.	S	141	.	ENSP00000318689:P141S	P	+	1	0	C17orf78	32820323	0.918000	0.31147	0.997000	0.53966	0.663000	0.39108	1.043000	0.30316	1.436000	0.47453	0.650000	0.86243	CCA	.		0.493	C17orf78-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451570.2	NM_173625	
SND1	27044	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	7	127724776	127724776	+	Splice_Site	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr7:127724776G>A	ENST00000354725.3	+	19	2305	c.2111G>A	c.(2110-2112)gGc>gAc	p.G704D	MIR593_ENST00000384856.1_RNA	NM_014390.2	NP_055205.2	Q7KZF4	SND1_HUMAN	staphylococcal nuclease and tudor domain containing 1	704					gene silencing by RNA (GO:0031047)|osteoblast differentiation (GO:0001649)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|dense body (GO:0097433)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|RISC complex (GO:0016442)	nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|transcription cofactor activity (GO:0003712)			central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	41						TCCCTGGCAGGCACCCAGTTG	0.582																																					p.G704D		.											.	.	.	0			c.G2111A						.						88.0	76.0	80.0					7																	127724776		2203	4300	6503	SO:0001630	splice_region_variant	27044	exon19			TGGCAGGCACCCA		CCDS34747.1	7q31.3	2014-03-24			ENSG00000197157	ENSG00000197157		"""Tudor domain containing"""	30646	protein-coding gene	gene with protein product	"""p100 EBNA2 co-activator"", ""Tudor-SN"""	602181				7651391, 9003410, 12819296	Standard	NM_014390		Approved	TDRD11, p100	uc003vmi.3	Q7KZF4	OTTHUMG00000157560	ENST00000354725.3:c.2111-1G>A	7.37:g.127724776G>A		Somatic	14	0		WXS	Illumina HiSeq	.	17	6	NM_014390	Q13122|Q96AG0	Missense_Mutation	SNP	ENST00000354725.3	37	CCDS34747.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.985321	0.93044	.	.	ENSG00000197157	ENST00000354725;ENST00000438400;ENST00000486037	T;T	0.08458	3.09;3.09	5.52	5.52	0.82312	Maternal tudor protein (1);	0.000000	0.85682	D	0.000000	T	0.29817	0.0745	M	0.75615	2.305	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.00498	-1.1704	9	.	.	.	.	16.9341	0.86199	0.0:0.0:1.0:0.0	.	704	Q7KZF4	SND1_HUMAN	D	704;694;190	ENSP00000346762:G704D;ENSP00000419327:G190D	.	G	+	2	0	SND1	127512012	1.000000	0.71417	1.000000	0.80357	0.766000	0.43426	9.146000	0.94640	2.586000	0.87340	0.561000	0.74099	GGC	.		0.582	SND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349148.1	NM_014390	Missense_Mutation
MS4A10	341116	hgsc.bcm.edu	37	11	60561564	60561564	+	Silent	SNP	C	C	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr11:60561564C>T	ENST00000308287.1	+	5	576	c.480C>T	c.(478-480)taC>taT	p.Y160Y		NM_206893.3	NP_996776.2	Q96PG2	M4A10_HUMAN	membrane-spanning 4-domains, subfamily A, member 10	160						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|skin(2)	21						GGAGAATGTACCCCAACTCCA	0.552																																					p.Y160Y		.											MS4A10,NS,carcinoma,0,1	MS4A10	0	0			c.C480T						.						96.0	89.0	91.0					11																	60561564		2203	4299	6502	SO:0001819	synonymous_variant	341116	exon5			AATGTACCCCAAC	AK122633	CCDS7992.1	11q12.2	2008-02-05				ENSG00000172689			13368	protein-coding gene	gene with protein product		608403				11486273, 11401424	Standard	NM_206893		Approved	CD20L7, MS4A9	uc001npz.1	Q96PG2		ENST00000308287.1:c.480C>T	11.37:g.60561564C>T		Somatic	35	0		WXS	Illumina HiSeq	.	47	2	NM_206893	B2RP45|Q96PG3	Silent	SNP	ENST00000308287.1	37	CCDS7992.1																																																																																			.		0.552	MS4A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395619.1	NM_206893	
PTPRK	5796	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	6	128304395	128304395	+	Nonsense_Mutation	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr6:128304395G>A	ENST00000368215.3	-	23	3375	c.3376C>T	c.(3376-3378)Cag>Tag	p.Q1126*	PTPRK_ENST00000368207.3_Nonsense_Mutation_p.Q1159*|PTPRK_ENST00000532331.1_Nonsense_Mutation_p.Q1149*|PTPRK_ENST00000368226.4_Nonsense_Mutation_p.Q1127*|PTPRK_ENST00000368213.5_Nonsense_Mutation_p.Q1133*|PTPRK_ENST00000368210.3_Nonsense_Mutation_p.Q1145*|PTPRK_ENST00000368227.3_Nonsense_Mutation_p.Q1144*			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	1126	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)		PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		ACCTCTGTCTGGACCATATTA	0.348																																					p.Q1133X		.											.	.	.	0			c.C3397T						.						72.0	60.0	64.0					6																	128304395		2202	4299	6501	SO:0001587	stop_gained	5796	exon24			CTGTCTGGACCAT	L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.3376C>T	6.37:g.128304395G>A	ENSP00000357198:p.Gln1126*	Somatic	31	0		WXS	Illumina HiSeq	.	48	20	NM_001135648	B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	Nonsense_Mutation	SNP	ENST00000368215.3	37		.	.	.	.	.	.	.	.	.	.	G	43	9.887876	0.99288	.	.	ENSG00000152894	ENST00000368226;ENST00000368227;ENST00000532331;ENST00000368213;ENST00000368210;ENST00000368215;ENST00000368207	.	.	.	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.5264	0.90974	0.0:0.0:1.0:0.0	.	.	.	.	X	1127;1144;1149;1133;1145;1126;1159	.	ENSP00000357190:Q1159X	Q	-	1	0	PTPRK	128346088	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.869000	0.99810	2.623000	0.88846	0.585000	0.79938	CAG	.		0.348	PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000042163.1		
NPHP3	27031	hgsc.bcm.edu	37	3	132415510	132415510	+	Intron	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr3:132415510G>T	ENST00000337331.5	-	15	2258				NPHP3_ENST00000326682.8_Intron	NM_153240.4	NP_694972.3	Q7Z494	NPHP3_HUMAN	nephronophthisis 3 (adolescent)						atrial septum development (GO:0003283)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|determination of intestine left/right asymmetry (GO:0071908)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|determination of stomach left/right asymmetry (GO:0071909)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|establishment or maintenance of cell polarity (GO:0007163)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|kidney development (GO:0001822)|kidney morphogenesis (GO:0060993)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|maintenance of organ identity (GO:0048496)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|photoreceptor cell maintenance (GO:0045494)|regulation of cAMP metabolic process (GO:0030814)|regulation of planar cell polarity pathway involved in neural tube closure (GO:2000167)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|ureter development (GO:0072189)|Wnt signaling pathway (GO:0016055)	cilium (GO:0005929)|primary cilium (GO:0072372)				NS(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(15)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						AGTTTTGCAGGGTGAGAAAGG	0.423																																					.		.											.	.	.	0			.						.																																			SO:0001627	intron_variant	0	.			TTGCAGGGTGAGA	AB056657	CCDS3078.1	3q22	2014-07-18			ENSG00000113971	ENSG00000113971		"""Tetratricopeptide (TTC) repeat domain containing"""	7907	protein-coding gene	gene with protein product	"""nephrocystin-3"", ""Meckel syndrome, type 7"", ""cilia and flagella associated protein 31"""	608002				12872122, 15381417	Standard	NM_153240		Approved	NPH3, KIAA2000, FLJ30691, FLJ36696, MKS7, SLSN3, CFAP31	uc003epe.2	Q7Z494	OTTHUMG00000159713	ENST00000337331.5:c.2171+64C>A	3.37:g.132415510G>T		Somatic	41	0		WXS	Illumina HiSeq	.	50	4	.	Q5JPE3|Q5JPE6|Q68D99|Q6NVH3|Q7Z492|Q7Z493|Q8N9R2|Q8NCM5|Q96N70|Q96NK2	RNA	SNP	ENST00000337331.5	37	CCDS3078.1																																																																																			.		0.423	NPHP3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357020.2	NM_153240	
CYP2G1P	22952	hgsc.bcm.edu	37	19	41404594	41404594	+	IGR	SNP	A	A	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr19:41404594A>T	ENST00000601627.1	+	0	575				CYP2G1P_ENST00000252909.4_RNA																							TATATCATAGAACCATAAAGT	0.378																																					.		.											.	.	.	0			.						.																																			SO:0001628	intergenic_variant	22952	.			TCATAGAACCATA																													19.37:g.41404594A>T		Somatic	21	0		WXS	Illumina HiSeq	.	28	16	.		RNA	SNP	ENST00000601627.1	37																																																																																				.		0.378	CTC-490E21.12-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	protein_coding	OTTHUMT00000463921.1		
LLGL2	3993	hgsc.bcm.edu	37	17	73569305	73569305	+	Missense_Mutation	SNP	C	C	T	rs372867184		TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr17:73569305C>T	ENST00000392550.3	+	20	2788	c.2671C>T	c.(2671-2673)Cgc>Tgc	p.R891C	LLGL2_ENST00000167462.5_Missense_Mutation_p.R891C|LLGL2_ENST00000577200.1_Missense_Mutation_p.R891C	NM_001031803.1	NP_001026973.1	Q6P1M3	L2GL2_HUMAN	lethal giant larvae homolog 2 (Drosophila)	891					cell cycle (GO:0007049)|cell division (GO:0051301)|exocytosis (GO:0006887)|regulation of establishment or maintenance of cell polarity (GO:0032878)	cytoplasm (GO:0005737)	PDZ domain binding (GO:0030165)			NS(1)|breast(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)			CAGCTGCATCCGCCGGGAGGA	0.662																																					p.R891C		.											LLGL2_ENST00000167462,colon,carcinoma,0,2	LLGL2_ENST00000167462	0	0			c.C2671T						.	C	CYS/ARG,CYS/ARG	0,4404		0,0,2202	60.0	54.0	56.0		2671,2671	5.2	1.0	17		56	1,8599		0,1,4299	no	missense,missense	LLGL2	NM_001031803.1,NM_004524.2	180,180	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	891/1021,891/1016	73569305	1,13003	2202	4300	6502	SO:0001583	missense	3993	exon20			TGCATCCGCCGGG	X87342	CCDS11725.1, CCDS32733.1, CCDS45776.1	17q25.1	2013-01-10	2001-11-28			ENSG00000073350		"""WD repeat domain containing"""	6629	protein-coding gene	gene with protein product			"""lethal giant larvae (Drosophila) homolog 2"""				Standard	XR_243659		Approved	HGL	uc002joh.3	Q6P1M3		ENST00000392550.3:c.2671C>T	17.37:g.73569305C>T	ENSP00000376333:p.Arg891Cys	Somatic	36	0		WXS	Illumina HiSeq	.	37	2	NM_004524	Q14521|Q9BR62	Missense_Mutation	SNP	ENST00000392550.3	37	CCDS32733.1	.	.	.	.	.	.	.	.	.	.	C	15.98	2.993383	0.54041	0.0	1.16E-4	ENSG00000073350	ENST00000167462;ENST00000392550;ENST00000545227	T;T	0.05855	3.38;3.49	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.30166	0.0756	M	0.82716	2.605	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.975;0.997;0.999;0.988;0.993	T	0.07712	-1.0758	10	0.87932	D	0	-0.4832	18.6921	0.91586	0.0:1.0:0.0:0.0	.	518;880;880;891;891	B4DVR9;B3KX47;G3V1I9;Q6P1M3-2;Q6P1M3	.;.;.;.;L2GL2_HUMAN	C	891;891;880	ENSP00000167462:R891C;ENSP00000376333:R891C	ENSP00000167462:R891C	R	+	1	0	LLGL2	71080900	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.770000	0.85390	2.408000	0.81797	0.400000	0.26472	CGC	.		0.662	LLGL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447633.1	NM_004524	
STIP1	10963	hgsc.bcm.edu	37	11	63965024	63965024	+	Nonsense_Mutation	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr11:63965024G>T	ENST00000305218.4	+	7	1006	c.859G>T	c.(859-861)Gaa>Taa	p.E287*	STIP1_ENST00000538945.1_Nonsense_Mutation_p.E263*|STIP1_ENST00000358794.5_Nonsense_Mutation_p.E334*	NM_006819.2	NP_006810.1	P31948	STIP1_HUMAN	stress-induced phosphoprotein 1	287					response to stress (GO:0006950)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.E287*(1)		endometrium(4)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(1)|skin(1)	27						GAAGGCCATTGAAGTGGGGAG	0.498																																					p.E287X		.											STIP1,rectum,carcinoma,0,1	STIP1	0	1	Substitution - Nonsense(1)	large_intestine(1)	c.G859T						.						67.0	69.0	69.0					11																	63965024		2201	4297	6498	SO:0001587	stop_gained	10963	exon7			GCCATTGAAGTGG	BC039299	CCDS8058.1, CCDS60827.1, CCDS60828.1	11q13	2014-01-13	2014-01-13		ENSG00000168439	ENSG00000168439		"""Tetratricopeptide (TTC) repeat domain containing"""	11387	protein-coding gene	gene with protein product	"""Hsp70/Hsp90-organizing protein"""	605063	"""stress-induced-phosphoprotein 1"""			1569099	Standard	NM_006819		Approved	HOP, STI1	uc001nyk.1	P31948	OTTHUMG00000167789	ENST00000305218.4:c.859G>T	11.37:g.63965024G>T	ENSP00000305958:p.Glu287*	Somatic	23	0		WXS	Illumina HiSeq	.	24	2	NM_006819	B4DM70|F5H0T1|G3XAD8|Q3ZCU9|Q5TZU9	Nonsense_Mutation	SNP	ENST00000305218.4	37	CCDS8058.1	.	.	.	.	.	.	.	.	.	.	G	37	6.281134	0.97440	.	.	ENSG00000168439	ENST00000358794;ENST00000305218;ENST00000538945	.	.	.	5.73	5.73	0.89815	.	0.199495	0.51477	D	0.000085	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-24.2585	19.059	0.93080	0.0:0.0:1.0:0.0	.	.	.	.	X	334;287;263	.	ENSP00000305958:E287X	E	+	1	0	STIP1	63721600	1.000000	0.71417	0.961000	0.40146	0.851000	0.48451	7.320000	0.79064	2.882000	0.98803	0.655000	0.94253	GAA	.		0.498	STIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396289.2	NM_006819	
COL12A1	1303	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	6	75853032	75853032	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr6:75853032G>A	ENST00000322507.8	-	26	5072	c.4763C>T	c.(4762-4764)cCt>cTt	p.P1588L	COL12A1_ENST00000345356.6_Missense_Mutation_p.P424L|COL12A1_ENST00000416123.2_Missense_Mutation_p.P1588L|COL12A1_ENST00000483888.2_Missense_Mutation_p.P1588L	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1588	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						TCCAGGCACAGGTTCCCAAAA	0.398																																					p.P1588L		.											.	.	.	0			c.C4763T						.						151.0	138.0	142.0					6																	75853032		1877	4120	5997	SO:0001583	missense	1303	exon26			GGCACAGGTTCCC	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.4763C>T	6.37:g.75853032G>A	ENSP00000325146:p.Pro1588Leu	Somatic	39	0		WXS	Illumina HiSeq	.	42	4	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	37	CCDS43482.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.595057	0.86953	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888	T;T;T;T	0.61510	0.1;0.1;0.1;0.1	5.81	5.81	0.92471	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.119515	0.56097	D	0.000034	T	0.60881	0.2303	M	0.86502	2.82	0.54753	D	0.99998	P;P	0.45634	0.835;0.863	B;B	0.43990	0.311;0.438	T	0.70490	-0.4857	10	0.72032	D	0.01	.	16.3372	0.83068	0.0:0.1319:0.8681:0.0	.	424;1588	Q99715-2;Q99715	.;COCA1_HUMAN	L	1588;1588;424;1588;1588	ENSP00000325146:P1588L;ENSP00000305147:P424L;ENSP00000412864:P1588L;ENSP00000421216:P1588L	ENSP00000325146:P1588L	P	-	2	0	COL12A1	75909752	1.000000	0.71417	0.976000	0.42696	0.939000	0.58152	5.959000	0.70339	2.746000	0.94184	0.655000	0.94253	CCT	.		0.398	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
BPIFA2	140683	hgsc.bcm.edu	37	20	31761957	31761957	+	Silent	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr20:31761957G>T	ENST00000253362.2	+	4	521	c.375G>T	c.(373-375)ctG>ctT	p.L125L	BPIFA2_ENST00000354932.5_Silent_p.L125L			Q96DR5	BPIA2_HUMAN	BPI fold containing family A, member 2	125						extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	lipopolysaccharide binding (GO:0001530)										GCCTTAACCTGAGCTTCCCTG	0.517																																					p.L125L		.											.	.	.	0			c.G375T						.						194.0	136.0	156.0					20																	31761957		2203	4300	6503	SO:0001819	synonymous_variant	140683	exon4			TAACCTGAGCTTC	AF432917	CCDS13214.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000131050	ENSG00000131050		"""BPI fold containing"""	16203	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 70"""	C20orf70		11971875	Standard	NM_080574		Approved	bA49G10.1, SPLUNC2, PSP	uc002wyo.1	Q96DR5	OTTHUMG00000032244	ENST00000253362.2:c.375G>T	20.37:g.31761957G>T		Somatic	32	0		WXS	Illumina HiSeq	.	50	4	NM_080574	Q9BQQ0	Silent	SNP	ENST00000253362.2	37	CCDS13214.1																																																																																			.		0.517	BPIFA2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257117.1	NM_080574	
ZACN	353174	hgsc.bcm.edu	37	17	74077646	74077646	+	Silent	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr17:74077646G>A	ENST00000334586.5	+	7	773	c.690G>A	c.(688-690)gcG>gcA	p.A230A	EXOC7_ENST00000332065.5_3'UTR|EXOC7_ENST00000591724.1_Intron|EXOC7_ENST00000589210.1_3'UTR|EXOC7_ENST00000607838.1_3'UTR	NM_180990.3	NP_851321.2	Q401N2	ZACN_HUMAN	zinc activated ligand-gated ion channel	230	Leu-rich.				ion transmembrane transport (GO:0034220)|response to zinc ion (GO:0010043)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)|ligand-gated ion channel activity (GO:0015276)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	11						AGAACACGGCGCTCAAGTCCA	0.667																																					p.A230A		.											ZACN,caecum,carcinoma,0,1	ZACN	0	0			c.G690A						.						97.0	92.0	94.0					17																	74077646		2203	4300	6503	SO:0001819	synonymous_variant	353174	exon7			CACGGCGCTCAAG	AK122638	CCDS11740.2	17q25.3	2012-01-18	2008-04-17	2008-04-17	ENSG00000186919	ENSG00000186919		"""Ligand-gated ion channels / Zinc activated channels"""	29504	protein-coding gene	gene with protein product		610935	"""ligand-gated ion channel, zinc activated 1"""	LGICZ1		12381728, 16083862	Standard	NM_180990		Approved	LGICZ, L2, ZAC, ZAC1	uc002jqn.2	Q401N2	OTTHUMG00000157186	ENST00000334586.5:c.690G>A	17.37:g.74077646G>A		Somatic	20	0		WXS	Illumina HiSeq	.	16	2	NM_180990	Q2TB29|Q6ZWK3|Q86YW4	Silent	SNP	ENST00000334586.5	37	CCDS11740.2																																																																																			.		0.667	ZACN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347827.2	NM_180990	
LRRTM4	80059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	77745440	77745440	+	Intron	SNP	A	A	G			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr2:77745440A>G	ENST00000409093.1	-	3	1888				LRRTM4_ENST00000409088.3_Nonstop_Mutation_p.*519R|LRRTM4_ENST00000409884.1_Intron|LRRTM4_ENST00000409282.1_Nonstop_Mutation_p.*520R|LRRTM4_ENST00000409911.1_Intron			Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4						alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|regulation of presynaptic membrane organization (GO:1901629)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				autonomic_ganglia(1)|endometrium(1)|large_intestine(6)|lung(49)|ovary(2)|pancreas(3)|prostate(1)|upper_aerodigestive_tract(1)	64				Colorectal(11;0.059)		ATCATGGTTCATACCTCACAT	0.453																																					p.X519R		.											.	.	.	0			c.T1555C						.						64.0	63.0	63.0					2																	77745440		1882	4114	5996	SO:0001627	intron_variant	80059	exon3			TGGTTCATACCTC	AK122612	CCDS46346.1, CCDS46347.1, CCDS74530.1	2p12	2008-02-05			ENSG00000176204	ENSG00000176204			19411	protein-coding gene	gene with protein product		610870				12676565	Standard	NM_024993		Approved	FLJ12568	uc002snr.3	Q86VH4	OTTHUMG00000152842	ENST00000409093.1:c.1551+3T>C	2.37:g.77745440A>G		Somatic	56	0		WXS	Illumina HiSeq	.	76	13	NM_024993	Q4FZ98|Q6UXJ7	Missense_Mutation	SNP	ENST00000409093.1	37	CCDS46346.1	.	.	.	.	.	.	.	.	.	.	A	12.17	1.858268	0.32791	.	.	ENSG00000176204	ENST00000409088;ENST00000409282	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4863	0.67619	1.0:0.0:0.0:0.0	.	.	.	.	R	519;520	.	.	X	-	1	0	LRRTM4	77598948	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.567000	0.82357	2.095000	0.63458	0.450000	0.29827	TGA	.		0.453	LRRTM4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328225.1	NM_024993	
CHGB	1114	hgsc.bcm.edu	37	20	5903817	5903817	+	Nonsense_Mutation	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr20:5903817G>T	ENST00000378961.4	+	4	1231	c.1027G>T	c.(1027-1029)Gaa>Taa	p.E343*		NM_001819.2	NP_001810.2	P05060	SCG1_HUMAN	chromogranin B (secretogranin 1)	343						extracellular region (GO:0005576)|secretory granule (GO:0030141)	hormone activity (GO:0005179)			breast(7)|kidney(2)|large_intestine(8)|lung(19)|ovary(1)|pancreas(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	47						TGAATATGGAGAAGAAATAAA	0.527																																					p.E343X		.											CHGB,NS,carcinoma,0,1	CHGB	0	0			c.G1027T						.						62.0	66.0	65.0					20																	5903817		2203	4300	6503	SO:0001587	stop_gained	1114	exon4			TATGGAGAAGAAA		CCDS13092.1	20p12.3	2013-09-19			ENSG00000089199	ENSG00000089199			1930	protein-coding gene	gene with protein product	"""secretogranin B"""	118920		SCG1		3608978	Standard	NM_001819		Approved		uc002wmg.3	P05060	OTTHUMG00000031821	ENST00000378961.4:c.1027G>T	20.37:g.5903817G>T	ENSP00000368244:p.Glu343*	Somatic	24	0		WXS	Illumina HiSeq	.	34	2	NM_001819	A8K021|Q59EU9|Q6IBS6|Q9BQV6|Q9UC25|Q9UJA6	Nonsense_Mutation	SNP	ENST00000378961.4	37	CCDS13092.1	.	.	.	.	.	.	.	.	.	.	G	18.18	3.566780	0.65651	.	.	ENSG00000089199	ENST00000378961	.	.	.	5.45	5.45	0.79879	.	0.246239	0.33572	N	0.004777	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-4.5289	13.8076	0.63243	0.0:0.0:0.8466:0.1534	.	.	.	.	X	343	.	ENSP00000368244:E343X	E	+	1	0	CHGB	5851817	0.870000	0.30015	0.151000	0.22473	0.036000	0.12997	4.870000	0.63035	2.547000	0.85894	0.563000	0.77884	GAA	.		0.527	CHGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077897.2	NM_001819	
TMEM2	23670	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	74300266	74300266	+	Silent	SNP	T	T	C			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr9:74300266T>C	ENST00000377044.4	-	24	4538	c.3999A>G	c.(3997-3999)tcA>tcG	p.S1333S	TMEM2_ENST00000377066.5_Silent_p.S1270S|TMEM2_ENST00000396272.3_Silent_p.S326S	NM_001135820.1|NM_013390.2	NP_001129292.1|NP_037522.1	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2	1333					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(15)|liver(1)|lung(19)|ovary(2)|prostate(5)|skin(1)|stomach(1)|urinary_tract(2)	56		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		GCTTAGTCCATGATGGTTTAA	0.378																																					p.S1333S		.											.	.	.	0			c.A3999G						.						73.0	67.0	69.0					9																	74300266		2203	4300	6503	SO:0001819	synonymous_variant	23670	exon24			AGTCCATGATGGT		CCDS6638.1, CCDS47979.1	9q21.13	2011-07-19			ENSG00000135048	ENSG00000135048			11869	protein-coding gene	gene with protein product		605835					Standard	NM_013390		Approved		uc011lsa.1	Q9UHN6	OTTHUMG00000020000	ENST00000377044.4:c.3999A>G	9.37:g.74300266T>C		Somatic	47	0		WXS	Illumina HiSeq	.	38	12	NM_013390	A6H8W9|B2RTQ6|Q5T838|Q5T839|Q5T840|Q5T841|Q8NBP6|Q9P2D5	Silent	SNP	ENST00000377044.4	37	CCDS6638.1																																																																																			.		0.378	TMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052618.2	NM_013390	
NAV2	89797	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	19890524	19890524	+	Silent	SNP	C	C	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr11:19890524C>A	ENST00000396087.3	+	4	591	c.492C>A	c.(490-492)atC>atA	p.I164I	NAV2_ENST00000527559.2_Silent_p.I93I|NAV2_ENST00000534229.1_3'UTR|NAV2_ENST00000349880.4_Silent_p.I164I|NAV2_ENST00000540292.1_Silent_p.I95I|NAV2_ENST00000396085.1_Silent_p.I164I|NAV2_ENST00000360655.4_Silent_p.I100I	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	164	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						GAATAAACATCCAGGGGCTGT	0.413																																					p.I164I		.											.	.	.	0			c.C492A						.						71.0	68.0	69.0					11																	19890524		2199	4293	6492	SO:0001819	synonymous_variant	89797	exon4			AAACATCCAGGGG	AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.492C>A	11.37:g.19890524C>A		Somatic	16	0		WXS	Illumina HiSeq	.	21	7	NM_145117	A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Silent	SNP	ENST00000396087.3	37	CCDS58126.1																																																																																			.		0.413	NAV2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324112.1	NM_145117	
NMT1	4836	hgsc.bcm.edu;ucsc.edu	37	17	43182337	43182337	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr17:43182337G>T	ENST00000592782.1	+	12	1574	c.1443G>T	c.(1441-1443)tgG>tgT	p.W481C	NMT1_ENST00000258960.2_Missense_Mutation_p.W481C			P30419	NMT1_HUMAN	N-myristoyltransferase 1	481					apoptotic process (GO:0006915)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|N-terminal protein myristoylation (GO:0006499)|phototransduction, visible light (GO:0007603)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein lipoylation (GO:0009249)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	catalytic activity (GO:0003824)|glycylpeptide N-tetradecanoyltransferase activity (GO:0004379)			breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)	8		Prostate(33;0.155)				TTTACAATTGGAAATGCCCCA	0.542																																					p.W481C		.											.	.	.	0			c.G1443T						.						91.0	83.0	86.0					17																	43182337		2203	4300	6503	SO:0001583	missense	4836	exon11			CAATTGGAAATGC		CCDS11494.1	17q21.31	2012-10-02			ENSG00000136448	ENSG00000136448			7857	protein-coding gene	gene with protein product	"""alternative, short form NMT-S"", ""myristoyl-CoA:protein N-myristoyltransferase"", ""long form, NMT-L"""	160993				1570339	Standard	NM_021079		Approved	NMT	uc002ihz.3	P30419	OTTHUMG00000180003	ENST00000592782.1:c.1443G>T	17.37:g.43182337G>T	ENSP00000468424:p.Trp481Cys	Somatic	22	0		WXS	Illumina HiSeq	.	36	4	NM_021079	A8K7C1|Q9UE09	Missense_Mutation	SNP	ENST00000592782.1	37	CCDS11494.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.607442	0.87157	.	.	ENSG00000136448	ENST00000258960	T	0.54866	0.55	6.07	6.07	0.98685	Acyl-CoA N-acyltransferase (2);Myristoyl-CoA:protein N-myristoyltransferase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.81517	0.4839	M	0.93283	3.4	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.84866	0.0822	10	0.87932	D	0	-8.1599	20.6439	0.99570	0.0:0.0:1.0:0.0	.	481	P30419	NMT1_HUMAN	C	481	ENSP00000258960:W481C	ENSP00000258960:W481C	W	+	3	0	NMT1	40537863	1.000000	0.71417	1.000000	0.80357	0.814000	0.46013	9.774000	0.98992	2.884000	0.98904	0.655000	0.94253	TGG	.		0.542	NMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449239.1	NM_021079	
CGGBP1	8545	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	88104763	88104763	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr3:88104763C>T	ENST00000398392.2	-	1	1696	c.364G>A	c.(364-366)Gat>Aat	p.D122N	CGGBP1_ENST00000462901.1_Missense_Mutation_p.D122N|CGGBP1_ENST00000482016.1_Missense_Mutation_p.D122N|CGGBP1_ENST00000309534.6_Missense_Mutation_p.D122N|CGGBP1_ENST00000474441.1_5'Flank			Q9UFW8	CGBP1_HUMAN	CGG triplet repeat binding protein 1	122					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)			kidney(1)|large_intestine(2)|lung(2)	5		Lung NSC(201;0.0283)		LUSC - Lung squamous cell carcinoma(29;0.00359)|Lung(72;0.00677)		GCTGGGTGATCAGCCTTCTCA	0.488																																					p.D122N		.											CGGBP1_ENST00000462901,bladder,carcinoma,0,2	CGGBP1_ENST00000462901	0	0			c.G364A						.						114.0	114.0	114.0					3																	88104763		2008	4178	6186	SO:0001583	missense	8545	exon4			GGTGATCAGCCTT	AJ000258	CCDS43111.1	3p12-p11.1	2008-07-18			ENSG00000163320	ENSG00000163320			1888	protein-coding gene	gene with protein product	"""p20-CGG binding protein"""	603363				9201980, 14667814	Standard	NM_001195308		Approved	p20-CGGBP, CGGBP	uc003dqt.3	Q9UFW8	OTTHUMG00000159009	ENST00000398392.2:c.364G>A	3.37:g.88104763C>T	ENSP00000381429:p.Asp122Asn	Somatic	39	0		WXS	Illumina HiSeq	.	83	49	NM_001195308	D3DU38|O15183	Missense_Mutation	SNP	ENST00000398392.2	37	CCDS43111.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.341051	0.81911	.	.	ENSG00000163320	ENST00000309534;ENST00000398392;ENST00000482016;ENST00000462901	.	.	.	5.86	5.86	0.93980	.	0.000000	0.40064	U	0.001181	T	0.65004	0.2650	L	0.29908	0.895	0.43517	D	0.995786	D	0.60575	0.988	P	0.62885	0.908	T	0.65290	-0.6204	9	0.54805	T	0.06	-21.6335	17.392	0.87434	0.0:1.0:0.0:0.0	.	122	Q9UFW8	CGBP1_HUMAN	N	122	.	ENSP00000381428:D122N	D	-	1	0	CGGBP1	88187453	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.914000	0.63348	2.787000	0.95880	0.650000	0.86243	GAT	.		0.488	CGGBP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352955.1	NM_001008390	
FAM129A	116496	hgsc.bcm.edu	37	1	184868427	184868427	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr1:184868427G>A	ENST00000367511.3	-	2	264	c.71C>T	c.(70-72)gCc>gTc	p.A24V		NM_052966.2	NP_443198.1	Q9BZQ8	NIBAN_HUMAN	family with sequence similarity 129, member A	24					negative regulation of protein phosphorylation (GO:0001933)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(6)|liver(1)|lung(22)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	45						GTTTTTGATGGCAGCCTCAGT	0.408																																					p.A24V		.											.	.	.	0			c.C71T						.						95.0	93.0	94.0					1																	184868427		2203	4300	6503	SO:0001583	missense	116496	exon2			TTGATGGCAGCCT	AF288391	CCDS1364.1	1q25	2008-10-08	2006-11-23	2006-11-23	ENSG00000135842	ENSG00000135842			16784	protein-coding gene	gene with protein product	"""cell growth inhibiting protein 39"""		"""chromosome 1 open reading frame 24"""	C1orf24		15085203, 16444351	Standard	NM_052966		Approved	NIBAN, GIG39	uc001gra.4	Q9BZQ8	OTTHUMG00000035388	ENST00000367511.3:c.71C>T	1.37:g.184868427G>A	ENSP00000356481:p.Ala24Val	Somatic	61	0		WXS	Illumina HiSeq	.	95	4	NM_052966	Q2TTR2|Q5TEM8|Q8TEI5|Q9H593|Q9H9Y8|Q9HCB9	Missense_Mutation	SNP	ENST00000367511.3	37	CCDS1364.1	.	.	.	.	.	.	.	.	.	.	G	3.020	-0.202080	0.06219	.	.	ENSG00000135842	ENST00000367511	T	0.08896	3.04	5.61	2.75	0.32379	.	0.488214	0.23706	N	0.045364	T	0.03871	0.0109	N	0.10874	0.06	0.09310	N	0.999999	B	0.16603	0.018	B	0.08055	0.003	T	0.41980	-0.9478	10	0.25751	T	0.34	-0.5365	6.3272	0.21251	0.3545:0.0:0.6455:0.0	.	24	Q9BZQ8	NIBAN_HUMAN	V	24	ENSP00000356481:A24V	ENSP00000356481:A24V	A	-	2	0	FAM129A	183135050	0.556000	0.26538	0.541000	0.28102	0.996000	0.88848	0.731000	0.26058	0.739000	0.32628	0.655000	0.94253	GCC	.		0.408	FAM129A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085786.1		
CHD7	55636	hgsc.bcm.edu;bcgsc.ca	37	8	61734399	61734399	+	Silent	SNP	C	C	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr8:61734399C>T	ENST00000423902.2	+	10	3227	c.2748C>T	c.(2746-2748)agC>agT	p.S916S	CHD7_ENST00000524602.1_Intron|CHD7_ENST00000525508.1_Silent_p.S916S	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	916	Chromo 2. {ECO:0000255|PROSITE- ProRule:PRU00053}.				adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			ATGAAGACAGCACGTGGGAGC	0.453																																					p.S916S		.											.	.	.	0			c.C2748T						.						54.0	54.0	54.0					8																	61734399		1904	4136	6040	SO:0001819	synonymous_variant	55636	exon10			AGACAGCACGTGG	AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.2748C>T	8.37:g.61734399C>T		Somatic	49	0		WXS	Illumina HiSeq	.	49	4	NM_017780	D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Silent	SNP	ENST00000423902.2	37	CCDS47865.1																																																																																			.		0.453	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2	XM_098762	
P4HA2	8974	hgsc.bcm.edu	37	5	131531134	131531134	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr5:131531134C>A	ENST00000401867.1	-	14	1979	c.1411G>T	c.(1411-1413)Gat>Tat	p.D471Y	P4HA2_ENST00000379100.2_Missense_Mutation_p.D469Y|P4HA2_ENST00000379086.1_Missense_Mutation_p.D469Y|P4HA2_ENST00000166534.4_Missense_Mutation_p.D471Y|P4HA2_ENST00000360568.3_Missense_Mutation_p.D469Y|P4HA2-AS1_ENST00000417667.1_RNA|P4HA2_ENST00000379104.2_Missense_Mutation_p.D471Y			O15460	P4HA2_HUMAN	prolyl 4-hydroxylase, alpha polypeptide II	471	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|procollagen-proline 4-dioxygenase complex (GO:0016222)	electron carrier activity (GO:0009055)|iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|procollagen-proline 4-dioxygenase activity (GO:0004656)	p.D471H(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24		all_cancers(142;0.103)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Proline(DB00172)|Succinic acid(DB00139)	GCCCCCAGATCAGGGAAGACG	0.493																																					p.D471Y	Esophageal Squamous(68;117 1135 17362 19256 34242)	.											P4HA2,NS,carcinoma,0,1	P4HA2	0	1	Substitution - Missense(1)	lung(1)	c.G1411T						.						122.0	109.0	113.0					5																	131531134		2203	4300	6503	SO:0001583	missense	8974	exon13			CCAGATCAGGGAA	U90441	CCDS4151.1, CCDS34230.1	5q31	2008-12-09	2008-12-09		ENSG00000072682	ENSG00000072682	1.14.11.2		8547	protein-coding gene	gene with protein product	"""4-PH alpha 2"", ""collagen prolyl 4-hydroxylase alpha(II)"""	600608	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide II"""			9211872, 9149945	Standard	NM_001142598		Approved	C-P4Halpha(II)	uc003kwl.3	O15460	OTTHUMG00000059647	ENST00000401867.1:c.1411G>T	5.37:g.131531134C>A	ENSP00000384999:p.Asp471Tyr	Somatic	39	0		WXS	Illumina HiSeq	.	39	2	NM_004199	D3DQ85|D3DQ86|Q8WWN0	Missense_Mutation	SNP	ENST00000401867.1	37	CCDS4151.1	.	.	.	.	.	.	.	.	.	.	C	29.4	5.001034	0.93227	.	.	ENSG00000072682	ENST00000401867;ENST00000379086;ENST00000166534;ENST00000360568;ENST00000379104;ENST00000379100	T;T;T;T;T;T	0.77750	-1.12;-1.12;-1.12;-1.12;-1.12;-1.12	5.71	5.71	0.89125	Oxoglutarate/iron-dependent oxygenase (2);Prolyl 4-hydroxylase, alpha subunit (1);	0.000000	0.85682	D	0.000000	T	0.78375	0.4273	N	0.26092	0.79	0.80722	D	1	P;P	0.42871	0.792;0.57	P;B	0.50537	0.643;0.219	T	0.80089	-0.1528	10	0.72032	D	0.01	-3.697	19.9403	0.97159	0.0:1.0:0.0:0.0	.	471;469	O15460;O15460-2	P4HA2_HUMAN;.	Y	471;469;471;469;471;469	ENSP00000384999:D471Y;ENSP00000368379:D469Y;ENSP00000166534:D471Y;ENSP00000353772:D469Y;ENSP00000368398:D471Y;ENSP00000368394:D469Y	ENSP00000166534:D471Y	D	-	1	0	P4HA2	131559033	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.295000	0.78780	2.712000	0.92718	0.650000	0.86243	GAT	.		0.493	P4HA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000132653.4	NM_004199	
YPEL2	388403	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	57474462	57474462	+	Splice_Site	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr17:57474462G>T	ENST00000312655.4	+	5	589	c.271G>T	c.(271-273)Gaa>Taa	p.E91*	YPEL2_ENST00000581865.1_3'UTR|YPEL2_ENST00000585166.1_Splice_Site_p.E91*	NM_001005404.3	NP_001005404.1	Q96QA6	YPEL2_HUMAN	yippee-like 2 (Drosophila)	91						nucleus (GO:0005634)				endometrium(1)|large_intestine(1)|lung(3)	5	all_neural(34;0.0837)|Medulloblastoma(34;0.0922)					TATTTCCTAGGAACATGCTTT	0.398																																					p.E91X	Melanoma(86;1113 1364 8518 42220 42625)	.											.	.	.	0			c.G271T						.						89.0	77.0	81.0					17																	57474462		2203	4300	6503	SO:0001630	splice_region_variant	388403	exon5			TCCTAGGAACATG	AF305195	CCDS32695.1	17q23	2004-02-20				ENSG00000175155			18326	protein-coding gene	gene with protein product		609723					Standard	NM_001005404		Approved	FKSG4	uc002ixm.1	Q96QA6		ENST00000312655.4:c.271-1G>T	17.37:g.57474462G>T		Somatic	33	0		WXS	Illumina HiSeq	.	29	14	NM_001005404	A0PK16|A2RUG4|Q65ZA0|Q8N3W2	Nonsense_Mutation	SNP	ENST00000312655.4	37	CCDS32695.1	.	.	.	.	.	.	.	.	.	.	G	36	5.792784	0.96945	.	.	ENSG00000175155	ENST00000312655	.	.	.	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-23.6971	19.0544	0.93058	0.0:0.0:1.0:0.0	.	.	.	.	X	91	.	.	E	+	1	0	YPEL2	54829244	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.813000	0.99286	2.826000	0.97356	0.561000	0.74099	GAA	.		0.398	YPEL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446032.1	XM_371070	Nonsense_Mutation
GYS2	2998	hgsc.bcm.edu	37	12	21711151	21711151	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr12:21711151G>T	ENST00000261195.2	-	11	1659	c.1405C>A	c.(1405-1407)Cgc>Agc	p.R469S		NM_021957.3	NP_068776.2	P54840	GYS2_HUMAN	glycogen synthase 2 (liver)	469					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|ectoplasm (GO:0043265)	glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein homodimerization activity (GO:0042803)			NS(1)|breast(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(14)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						CTATCTGTGCGGTTGTTGAAA	0.413																																					p.R469S	Colon(149;9 1820 3690 10544 50424)	.											GYS2,NS,carcinoma,0,2	GYS2	0	0			c.C1405A						.						148.0	126.0	133.0					12																	21711151		2203	4300	6503	SO:0001583	missense	2998	exon11			CTGTGCGGTTGTT		CCDS8690.1	12p12.2-p11.2	2013-02-22			ENSG00000111713	ENSG00000111713	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4707	protein-coding gene	gene with protein product		138571					Standard	NM_021957		Approved		uc001rfb.3	P54840	OTTHUMG00000169135	ENST00000261195.2:c.1405C>A	12.37:g.21711151G>T	ENSP00000261195:p.Arg469Ser	Somatic	39	0		WXS	Illumina HiSeq	.	47	2	NM_021957	A0AVD8	Missense_Mutation	SNP	ENST00000261195.2	37	CCDS8690.1	.	.	.	.	.	.	.	.	.	.	G	0.063	-1.219338	0.01542	.	.	ENSG00000111713	ENST00000261195	T	0.62639	0.01	4.56	3.65	0.41850	.	0.058335	0.64402	N	0.000002	T	0.45256	0.1333	L	0.31157	0.91	0.42490	D	0.992895	B	0.13145	0.007	B	0.24155	0.051	T	0.32534	-0.9903	10	0.05436	T	0.98	-16.4295	12.2001	0.54319	0.0:0.0:0.6899:0.3101	.	469	P54840	GYS2_HUMAN	S	469	ENSP00000261195:R469S	ENSP00000261195:R469S	R	-	1	0	GYS2	21602418	1.000000	0.71417	0.051000	0.19133	0.129000	0.20672	3.903000	0.56318	1.258000	0.44101	0.655000	0.94253	CGC	.		0.413	GYS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402396.1	NM_021957	
HLF	3131	hgsc.bcm.edu	37	17	53392723	53392723	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr17:53392723G>T	ENST00000226067.5	+	3	1060	c.587G>T	c.(586-588)cGc>cTc	p.R196L	HLF_ENST00000575345.1_Missense_Mutation_p.R111L|HLF_ENST00000430986.2_Missense_Mutation_p.R111L|HLF_ENST00000573945.1_Missense_Mutation_p.R111L	NM_002126.4	NP_002117.1	Q16534	HLF_HUMAN	hepatic leukemia factor	196	Pro-rich (proline/acidic region (PAR)).				multicellular organismal development (GO:0007275)|rhythmic process (GO:0048511)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R196H(1)		large_intestine(1)|ovary(2)	3						TTTGACCCTCGCAAACGCAAG	0.517			T	TCF3	ALL																																p.R196L		.		Dom	yes		17	17q22	3131	hepatic leukemia factor		L	HLF_ENST00000226067,colon,carcinoma,+1,1	HLF_ENST00000226067	+1	1	Substitution - Missense(1)	large_intestine(1)	c.G587T						.						100.0	93.0	95.0					17																	53392723		2203	4300	6503	SO:0001583	missense	3131	exon3			ACCCTCGCAAACG		CCDS11585.1	17q22	2011-05-19			ENSG00000108924	ENSG00000108924			4977	protein-coding gene	gene with protein product		142385				1386162	Standard	XM_005257269		Approved	MGC33822	uc002iug.1	Q16534		ENST00000226067.5:c.587G>T	17.37:g.53392723G>T	ENSP00000226067:p.Arg196Leu	Somatic	29	1		WXS	Illumina HiSeq	.	46	2	NM_002126	A8K1X8|Q6FHS9	Missense_Mutation	SNP	ENST00000226067.5	37	CCDS11585.1	.	.	.	.	.	.	.	.	.	.	G	35	5.484331	0.96307	.	.	ENSG00000108924	ENST00000226067;ENST00000430986	.	.	.	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	D	0.83709	0.5313	M	0.84326	2.69	0.80722	D	1	P;D	0.89917	0.913;1.0	P;D	0.81914	0.706;0.995	D	0.85547	0.1219	9	0.72032	D	0.01	.	18.6178	0.91310	0.0:0.0:1.0:0.0	.	144;196	B4DIQ5;Q16534	.;HLF_HUMAN	L	196;111	.	ENSP00000226067:R196L	R	+	2	0	HLF	50747722	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.869000	0.99810	2.644000	0.89710	0.655000	0.94253	CGC	.		0.517	HLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439185.1	NM_002126	
TTN	7273	hgsc.bcm.edu	37	2	179434990	179434990	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr2:179434990G>T	ENST00000591111.1	-	276	71170	c.70946C>A	c.(70945-70947)cCt>cAt	p.P23649H	TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P22722H|TTN_ENST00000589042.1_Missense_Mutation_p.P25290H|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P16350H|TTN_ENST00000460472.2_Missense_Mutation_p.P16225H|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P16417H|TTN-AS1_ENST00000590807.1_RNA			Q8WZ42	TITIN_HUMAN	titin	23649	Fibronectin type-III 71. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGATTCAAGAGGTTCACCAAC	0.423																																					p.P25290H		.											.	.	.	0			c.C75869A						.						99.0	90.0	93.0					2																	179434990		1948	4137	6085	SO:0001583	missense	7273	exon326			TCAAGAGGTTCAC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.70946C>A	2.37:g.179434990G>T	ENSP00000465570:p.Pro23649His	Somatic	61	0		WXS	Illumina HiSeq	.	40	4	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	14.28	2.488677	0.44249	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57752	0.38;0.38;0.38;0.38	5.87	5.87	0.94306	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.81828	0.4905	H	0.94771	3.58	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.998;0.998;1.0	D	0.86003	0.1496	9	0.87932	D	0	.	20.2245	0.98337	0.0:0.0:1.0:0.0	.	16225;16350;16417;23649	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	H	22722;16225;16417;16350;16223	ENSP00000343764:P22722H;ENSP00000434586:P16225H;ENSP00000340554:P16417H;ENSP00000352154:P16350H	ENSP00000340554:P16417H	P	-	2	0	TTN	179143236	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.721000	0.74728	2.770000	0.95276	0.650000	0.86243	CCT	.		0.423	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
CCDC42B	387885	hgsc.bcm.edu	37	12	113593196	113593196	+	Silent	SNP	C	C	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr12:113593196C>T	ENST00000335621.6	+	6	822	c.822C>T	c.(820-822)atC>atT	p.I274I	Y_RNA_ENST00000363029.1_RNA	NM_001144872.1	NP_001138344.1	A6NFT4	CC42B_HUMAN	coiled-coil domain containing 42B	274																	CCCTGGACATCGAGGACACGG	0.592																																					p.I274I		.											.	.	.	0			c.C822T						.						63.0	69.0	67.0					12																	113593196		692	1591	2283	SO:0001819	synonymous_variant	387885	exon6			GGACATCGAGGAC		CCDS44983.1	12q24.13	2014-07-31			ENSG00000186710	ENSG00000186710			37100	protein-coding gene	gene with protein product						23569216	Standard	NM_001144872		Approved	MIA2	uc010sys.2	A6NFT4	OTTHUMG00000169655	ENST00000335621.6:c.822C>T	12.37:g.113593196C>T		Somatic	68	0		WXS	Illumina HiSeq	.	51	3	NM_001144872		Silent	SNP	ENST00000335621.6	37	CCDS44983.1	.	.	.	.	.	.	.	.	.	.	C	0.139	-1.104474	0.01828	.	.	ENSG00000186710	ENST00000550918	.	.	.	3.77	-7.53	0.01336	.	.	.	.	.	T	0.48768	0.1518	.	.	.	0.36045	D	0.840385	.	.	.	.	.	.	T	0.55661	-0.8106	4	.	.	.	-2.0E-4	9.2832	0.37742	0.0:0.4344:0.2348:0.3308	.	.	.	.	L	104	.	.	S	+	2	0	CCDC42B	112077579	0.059000	0.20769	0.002000	0.10522	0.014000	0.08584	-0.079000	0.11357	-2.953000	0.00292	-0.611000	0.04053	TCG	.		0.592	CCDC42B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405303.1	NM_001144872	
ADAMTS16	170690	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	5239928	5239928	+	Missense_Mutation	SNP	T	T	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr5:5239928T>A	ENST00000274181.7	+	16	2551	c.2413T>A	c.(2413-2415)Tgg>Agg	p.W805R		NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	805	Spacer.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						GACCGTGGACTGGCCCGGCCG	0.517																																					p.W805R		.											.	.	.	0			c.T2413A						.						105.0	101.0	102.0					5																	5239928		1876	4106	5982	SO:0001583	missense	170690	exon16			GTGGACTGGCCCG	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.2413T>A	5.37:g.5239928T>A	ENSP00000274181:p.Trp805Arg	Somatic	35	0		WXS	Illumina HiSeq	.	32	7	NM_139056	C6G490|Q8IVE2	Missense_Mutation	SNP	ENST00000274181.7	37	CCDS43299.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.264906	0.80358	.	.	ENSG00000145536	ENST00000274181;ENST00000536857	T	0.50277	0.75	5.56	4.39	0.52855	ADAM-TS Spacer 1 (1);	0.000000	0.85682	D	0.000000	T	0.65450	0.2692	M	0.74467	2.265	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	T	0.64504	-0.6392	10	0.41790	T	0.15	.	10.6054	0.45392	0.0:0.0772:0.0:0.9228	.	805;805	Q8TE57;Q8TE57-2	ATS16_HUMAN;.	R	805	ENSP00000274181:W805R	ENSP00000274181:W805R	W	+	1	0	ADAMTS16	5292928	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.611000	0.67674	0.935000	0.37341	0.533000	0.62120	TGG	.		0.517	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056	
FAT4	79633	hgsc.bcm.edu	37	4	126336935	126336935	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr4:126336935G>T	ENST00000394329.3	+	5	6830	c.6817G>T	c.(6817-6819)Ggg>Tgg	p.G2273W	FAT4_ENST00000335110.5_Missense_Mutation_p.G571W	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	2273	Cadherin 22. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G2273R(1)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TGAGAATTTAGGGACACTACC	0.358																																					p.G2273W		.											FAT4,NS,NS,0,1	FAT4	0	1	Substitution - Missense(1)	pancreas(1)	c.G6817T						.						46.0	46.0	46.0					4																	126336935		2203	4300	6503	SO:0001583	missense	79633	exon5			AATTTAGGGACAC	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.6817G>T	4.37:g.126336935G>T	ENSP00000377862:p.Gly2273Trp	Somatic	36	0		WXS	Illumina HiSeq	.	34	2	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	G	10.91	1.484192	0.26598	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.01838	4.61;4.61	5.29	4.45	0.53987	Cadherin (3);Cadherin-like (1);	0.221369	0.22073	U	0.065005	T	0.06096	0.0158	N	0.14661	0.345	0.29618	N	0.846413	D;D	0.64830	0.986;0.994	D;D	0.69307	0.963;0.952	T	0.21449	-1.0245	10	0.72032	D	0.01	.	18.8963	0.92424	0.0:0.118:0.882:0.0	.	571;2273	Q6V0I7-2;Q6V0I7	.;FAT4_HUMAN	W	2273;571	ENSP00000377862:G2273W;ENSP00000335169:G571W	ENSP00000335169:G571W	G	+	1	0	FAT4	126556385	0.998000	0.40836	0.127000	0.21898	0.265000	0.26407	3.630000	0.54273	0.627000	0.30340	-1.255000	0.01485	GGG	.		0.358	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
GTF2IRD1	9569	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	73927158	73927158	+	Splice_Site	SNP	A	A	G			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr7:73927158A>G	ENST00000265755.3	+	3	516		c.e3-1		GTF2IRD1_ENST00000476977.1_Splice_Site|GTF2IRD1_ENST00000455841.2_Splice_Site|GTF2IRD1_ENST00000489094.1_Splice_Site|GTF2IRD1_ENST00000424337.2_Splice_Site	NM_005685.3|NM_016328.2	NP_005676.3|NP_057412.1	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1						multicellular organismal development (GO:0007275)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transition between slow and fast fiber (GO:0014886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(19)|ovary(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						CCCTTCCCACAGTGCTCAGCG	0.612																																					.		.											.	.	.	0			c.124-2A>G						.						69.0	63.0	65.0					7																	73927158		2203	4300	6503	SO:0001630	splice_region_variant	9569	exon3			TCCCACAGTGCTC	AF151354	CCDS5571.1, CCDS47613.1, CCDS56492.1	7q11.23	2008-04-18	2002-01-14		ENSG00000006704	ENSG00000006704			4661	protein-coding gene	gene with protein product	"""binding factor for early enhancer"""	604318	"""GTF2I repeat domain-containing 1"""	WBSCR11		9774679, 10198167	Standard	NM_016328		Approved	MusTRD1, RBAP2, GTF3, WBSCR12, BEN, Cream1	uc010lbq.3	Q9UHL9	OTTHUMG00000023782	ENST00000265755.3:c.124-1A>G	7.37:g.73927158A>G		Somatic	36	0		WXS	Illumina HiSeq	.	33	15	NM_005685	O95444|Q6DSU6|Q75MX7|Q86UM3|Q8WVC4|Q9UHK8|Q9UI91	Splice_Site	SNP	ENST00000265755.3	37	CCDS5571.1	.	.	.	.	.	.	.	.	.	.	A	18.98	3.737658	0.69304	.	.	ENSG00000006704	ENST00000265755;ENST00000455841;ENST00000424337;ENST00000476977	.	.	.	4.52	4.52	0.55395	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7282	0.62771	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GTF2IRD1	73565094	1.000000	0.71417	0.982000	0.44146	0.806000	0.45545	8.333000	0.90026	1.978000	0.57642	0.528000	0.53228	.	.		0.612	GTF2IRD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252654.2	NM_016328	Intron
TMEM55A	55529	hgsc.bcm.edu	37	8	92033557	92033557	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr8:92033557C>T	ENST00000285419.3	-	2	496	c.182G>A	c.(181-183)tGc>tAc	p.C61Y	GS1-251I9.3_ENST00000517920.1_RNA	NM_018710.2	NP_061180.1	Q8N4L2	TM55A_HUMAN	transmembrane protein 55A	61						endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)	hydrolase activity (GO:0016787)	p.C61Y(1)		breast(1)|endometrium(2)|large_intestine(5)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	13			BRCA - Breast invasive adenocarcinoma(11;0.033)			TAGTGATTGGCACACACGGCA	0.443																																					p.C61Y		.											TMEM55A,colon,carcinoma,0,1	TMEM55A	0	1	Substitution - Missense(1)	large_intestine(1)	c.G182A						.						128.0	116.0	120.0					8																	92033557		2203	4300	6503	SO:0001583	missense	55529	exon2			GATTGGCACACAC	BC033892	CCDS6252.1	8q21.3	2005-08-09			ENSG00000155099	ENSG00000155099			25452	protein-coding gene	gene with protein product		609864				12477932	Standard	NM_018710		Approved	DKFZp762O076	uc003yes.3	Q8N4L2	OTTHUMG00000164019	ENST00000285419.3:c.182G>A	8.37:g.92033557C>T	ENSP00000285419:p.Cys61Tyr	Somatic	40	0		WXS	Illumina HiSeq	.	43	2	NM_018710	B2R9H4|Q68CU2	Missense_Mutation	SNP	ENST00000285419.3	37	CCDS6252.1	.	.	.	.	.	.	.	.	.	.	C	16.28	3.077469	0.55753	.	.	ENSG00000155099	ENST00000285419;ENST00000520014	.	.	.	5.37	4.5	0.54988	.	0.000000	0.85682	D	0.000000	T	0.76615	0.4012	M	0.68317	2.08	0.80722	D	1	D	0.62365	0.991	D	0.77557	0.99	T	0.79711	-0.1689	9	0.87932	D	0	-2.7366	14.169	0.65497	0.0:0.9288:0.0:0.0712	.	61	Q8N4L2	TM55A_HUMAN	Y	61;67	.	ENSP00000285419:C61Y	C	-	2	0	TMEM55A	92102733	1.000000	0.71417	1.000000	0.80357	0.254000	0.26022	7.320000	0.79064	1.505000	0.48720	-0.142000	0.14014	TGC	.		0.443	TMEM55A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376778.1	NM_018710	
C7orf71	285941	hgsc.bcm.edu	37	7	26685944	26685944	+	Missense_Mutation	SNP	G	G	T	rs375873814	byFrequency	TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr7:26685944G>T	ENST00000409974.3	+	4	1011	c.295G>T	c.(295-297)Ggc>Tgc	p.G99C		NM_001145531.1	NP_001139003.1	A4D174	CG071_HUMAN	chromosome 7 open reading frame 71	99																	TGGGACTCTCGGCCTCATTAT	0.443																																					p.G99C		.											C7orf71_ENST00000409974,colon,carcinoma,0,2	C7orf71_ENST00000409974	0	0			c.G295T						.						82.0	72.0	75.0					7																	26685944		692	1591	2283	SO:0001583	missense	285941	exon4			ACTCTCGGCCTCA		CCDS47565.1	7p15.2	2009-09-11			ENSG00000222004	ENSG00000222004			22364	protein-coding gene	gene with protein product							Standard	NM_001145531		Approved		uc003syb.3	A4D174	OTTHUMG00000152860	ENST00000409974.3:c.295G>T	7.37:g.26685944G>T	ENSP00000386749:p.Gly99Cys	Somatic	42	0		WXS	Illumina HiSeq	.	41	2	NM_001145531		Missense_Mutation	SNP	ENST00000409974.3	37	CCDS47565.1	.	.	.	.	.	.	.	.	.	.	G	5.755	0.323731	0.10900	.	.	ENSG00000222004	ENST00000409974	.	.	.	4.68	-2.8	0.05823	.	.	.	.	.	T	0.15869	0.0382	N	0.08118	0	0.09310	N	1	B	0.27013	0.166	B	0.25405	0.06	T	0.19976	-1.0289	8	0.56958	D	0.05	.	5.1149	0.14829	0.4629:0.0:0.3963:0.1409	.	99	A4D174	CG071_HUMAN	C	99	.	ENSP00000386749:G99C	G	+	1	0	C7orf71	26652469	0.005000	0.15991	0.007000	0.13788	0.008000	0.06430	-0.374000	0.07484	-0.505000	0.06568	-0.345000	0.07892	GGC	.		0.443	C7orf71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328272.1	NM_001145531	
LMBR1	64327	hgsc.bcm.edu	37	7	156480753	156480753	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr7:156480753G>A	ENST00000353442.5	-	16	1594	c.1358C>T	c.(1357-1359)gCa>gTa	p.A453V	LMBR1_ENST00000540390.1_Intron|LMBR1_ENST00000354505.4_Missense_Mutation_p.A494V|LMBR1_ENST00000359422.4_Intron	NM_022458.3	NP_071903.2	Q8WVP7	LMBR1_HUMAN	limb development membrane protein 1	453					embryonic digit morphogenesis (GO:0042733)	integral component of membrane (GO:0016021)		p.A453V(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	18	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.208)		TTCTCGAACTGCAGAGGTGAA	0.343																																					p.A453V		.											LMBR1,NS,carcinoma,0,1	LMBR1	0	1	Substitution - Missense(1)	endometrium(1)	c.C1358T						.						70.0	74.0	73.0					7																	156480753		2203	4300	6503	SO:0001583	missense	64327	exon16			CGAACTGCAGAGG	AF107454	CCDS5945.1	7q36.3	2013-08-05	2013-08-05	2005-07-25	ENSG00000105983	ENSG00000105983			13243	protein-coding gene	gene with protein product		605522	"""chromosome 7 open reading frame 2"", ""limb region 1 homolog (mouse)"""	C7orf2		10329000, 11090342	Standard	NM_022458		Approved	ACHP, FLJ11665, ZRS	uc003wmw.4	Q8WVP7	OTTHUMG00000151510	ENST00000353442.5:c.1358C>T	7.37:g.156480753G>A	ENSP00000326604:p.Ala453Val	Somatic	89	0		WXS	Illumina HiSeq	.	70	3	NM_022458	A4D242|Q8N3E3|Q96QZ5|Q9H5N0|Q9HAG9|Q9UDN5|Q9Y6U2	Missense_Mutation	SNP	ENST00000353442.5	37	CCDS5945.1	.	.	.	.	.	.	.	.	.	.	G	33	5.288608	0.95517	.	.	ENSG00000105983	ENST00000353442;ENST00000415428;ENST00000354505	T;T;T	0.51325	0.71;0.74;0.74	5.63	4.74	0.60224	.	0.000000	0.85682	D	0.000000	T	0.61261	0.2333	M	0.63843	1.955	0.80722	D	1	D;P	0.58970	0.984;0.759	P;B	0.57204	0.815;0.259	T	0.65792	-0.6082	10	0.66056	D	0.02	-11.4016	15.6202	0.76799	0.0:0.0:0.8613:0.1387	.	494;453	Q8WVP7-3;Q8WVP7	.;LMBR1_HUMAN	V	453;492;494	ENSP00000326604:A453V;ENSP00000408256:A492V;ENSP00000346500:A494V	ENSP00000326604:A453V	A	-	2	0	LMBR1	156173514	1.000000	0.71417	0.983000	0.44433	0.971000	0.66376	9.507000	0.97996	1.368000	0.46115	0.655000	0.94253	GCA	.		0.343	LMBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347939.3	NM_022458	
CHRNA5	1138	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	78882199	78882199	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr15:78882199G>T	ENST00000299565.5	+	5	666	c.466G>T	c.(466-468)Ggc>Tgc	p.G156C	RP11-650L12.2_ENST00000567141.1_RNA|CHRNA5_ENST00000559554.1_Intron	NM_000745.3	NP_000736.2	P30532	ACHA5_HUMAN	cholinergic receptor, nicotinic, alpha 5 (neuronal)	156					behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)|skin(3)	15					Galantamine(DB00674)|Nicotine(DB00184)	CAGGTACAATGGCACTGTCAC	0.403																																					p.G156C		.											.	.	.	0			c.G466T						.						172.0	150.0	157.0					15																	78882199		2196	4293	6489	SO:0001583	missense	1138	exon5			TACAATGGCACTG		CCDS10304.1	15q24	2012-02-11	2012-02-07		ENSG00000169684	ENSG00000169684		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1959	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 5 (neuronal)"""	118505	"""cholinergic receptor, nicotinic, alpha polypeptide 5"""			2004777	Standard	NM_000745		Approved		uc002bdy.3	P30532	OTTHUMG00000143858	ENST00000299565.5:c.466G>T	15.37:g.78882199G>T	ENSP00000299565:p.Gly156Cys	Somatic	36	0		WXS	Illumina HiSeq	.	42	4	NM_000745	Q15824|Q99554	Missense_Mutation	SNP	ENST00000299565.5	37	CCDS10304.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.511388	0.85389	.	.	ENSG00000169684	ENST00000299565;ENST00000394802	D	0.97404	-4.37	5.37	5.37	0.77165	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.99309	0.9758	H	0.99573	4.635	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98372	1.0554	10	0.87932	D	0	.	19.4881	0.95039	0.0:0.0:1.0:0.0	.	156	P30532	ACHA5_HUMAN	C	156;107	ENSP00000299565:G156C	ENSP00000299565:G156C	G	+	1	0	CHRNA5	76669254	1.000000	0.71417	0.974000	0.42286	0.802000	0.45316	9.805000	0.99149	2.673000	0.90976	0.655000	0.94253	GGC	.		0.403	CHRNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290106.1		
STK3	6788	hgsc.bcm.edu	37	8	99786981	99786981	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr8:99786981C>A	ENST00000419617.2	-	2	233	c.93G>T	c.(91-93)gaG>gaT	p.E31D	STK3_ENST00000523601.1_Missense_Mutation_p.E59D	NM_006281.3	NP_006272.2	Q13188	STK3_HUMAN	serine/threonine kinase 3	31	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell differentiation involved in embryonic placenta development (GO:0060706)|central nervous system development (GO:0007417)|endocardium development (GO:0003157)|hepatocyte apoptotic process (GO:0097284)|hippo signaling (GO:0035329)|intracellular signal transduction (GO:0035556)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of organ growth (GO:0046621)|neural tube formation (GO:0001841)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|primitive hemopoiesis (GO:0060215)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein dimerization activity (GO:0046983)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	17	Breast(36;2.4e-06)	Breast(495;0.106)	OV - Ovarian serous cystadenocarcinoma(57;0.0382)	KIRC - Kidney renal clear cell carcinoma(542;9.44e-06)		CTCCAAGCTTCTCTAATACAT	0.269																																					p.E59D		.											STK3,NS,carcinoma,0,1	STK3	0	0			c.G177T						.						60.0	55.0	57.0					8																	99786981		1791	4060	5851	SO:0001583	missense	6788	exon4			AAGCTTCTCTAAT	BC010640	CCDS47900.1, CCDS59108.1, CCDS75774.1	8q22.2	2011-05-24	2010-06-25		ENSG00000104375	ENSG00000104375			11406	protein-coding gene	gene with protein product		605030	"""serine/threonine kinase 3 (Ste20, yeast homolog)"""			8816758	Standard	NM_006281		Approved	MST2, KRS1	uc003yip.4	Q13188	OTTHUMG00000164651	ENST00000419617.2:c.93G>T	8.37:g.99786981C>A	ENSP00000390500:p.Glu31Asp	Somatic	23	0		WXS	Illumina HiSeq	.	40	2	NM_001256312	A8K722|B3KYA7|Q15445|Q15801|Q96FM6	Missense_Mutation	SNP	ENST00000419617.2	37	CCDS47900.1	.	.	.	.	.	.	.	.	.	.	C	12.43	1.937049	0.34189	.	.	ENSG00000104375	ENST00000419617;ENST00000523601;ENST00000518165	T;T;T	0.14391	2.51;2.51;3.08	5.3	4.42	0.53409	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.09423	0.0232	L	0.39898	1.24	0.49130	D	0.999755	B;B;B	0.26512	0.04;0.079;0.151	B;B;B	0.24006	0.027;0.04;0.05	T	0.06881	-1.0802	10	0.06625	T	0.88	.	8.5656	0.33538	0.0:0.7684:0.0:0.2316	.	31;31;59	E5RFQ9;Q13188;B3KYA7	.;STK3_HUMAN;.	D	31;59;31	ENSP00000390500:E31D;ENSP00000429744:E59D;ENSP00000428014:E31D	ENSP00000390500:E31D	E	-	3	2	STK3	99856157	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.321000	0.33678	1.226000	0.43582	0.563000	0.77884	GAG	.		0.269	STK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379635.1	NM_006281	
PLOD1	5351	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	12017915	12017915	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr1:12017915T>C	ENST00000196061.4	+	8	785	c.758T>C	c.(757-759)cTg>cCg	p.L253P	PLOD1_ENST00000376369.3_Missense_Mutation_p.L300P|PLOD1_ENST00000485046.1_3'UTR	NM_000302.3	NP_000293.2	Q02809	PLOD1_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1	253					cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|extracellular matrix organization (GO:0030198)|hydroxylysine biosynthetic process (GO:0046947)|oxidation-reduction process (GO:0055114)|response to hypoxia (GO:0001666)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	29	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.06e-06)|COAD - Colon adenocarcinoma(227;0.000273)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000809)|KIRC - Kidney renal clear cell carcinoma(229;0.00267)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)	Succinic acid(DB00139)|Vitamin C(DB00126)	TTGAACTACCTGGGCAACTAC	0.632																																					p.L253P													.	PLOD1	75	0			c.T758C						.						134.0	126.0	129.0					1																	12017915		2203	4300	6503	SO:0001583	missense	5351	exon8			ACTACCTGGGCAA	BC016657	CCDS142.1	1p36.22	2011-08-25	2011-08-24	2004-12-14	ENSG00000083444	ENSG00000083444	1.14.11.4		9081	protein-coding gene	gene with protein product	"""lysyl hydroxlase 1"""	153454	"""procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase, Ehlers-Danlos syndrome type VI)"""	LLH, PLOD		1577494	Standard	NM_000302		Approved	LH1	uc001atm.3	Q02809	OTTHUMG00000002393	ENST00000196061.4:c.758T>C	1.37:g.12017915T>C	ENSP00000196061:p.Leu253Pro	Somatic	46	1		WXS	Illumina GAIIx	Phase_I	46	15	NM_000302	B4DR87|Q96AV9|Q9H132	Missense_Mutation	SNP	ENST00000196061.4	37	CCDS142.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.359060	0.82353	.	.	ENSG00000083444	ENST00000376369;ENST00000429000;ENST00000196061	T;T;T	0.72615	-0.67;1.12;-0.64	4.69	4.69	0.59074	.	0.077249	0.52532	D	0.000071	D	0.83741	0.5320	M	0.86268	2.805	0.80722	D	1	D;D	0.76494	0.999;0.983	D;P	0.64776	0.929;0.873	D	0.86798	0.1990	10	0.87932	D	0	.	13.4903	0.61390	0.0:0.0:0.0:1.0	.	300;253	B4DR87;Q02809	.;PLOD1_HUMAN	P	300;255;253	ENSP00000365548:L300P;ENSP00000405372:L255P;ENSP00000196061:L253P	ENSP00000196061:L253P	L	+	2	0	PLOD1	11940502	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.730000	0.84881	1.971000	0.57363	0.459000	0.35465	CTG	.		0.632	PLOD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000006865.1	NM_000302	
RP11-782C8.2	0	broad.mit.edu	37	1	143195473	143195473	+	lincRNA	DEL	A	A	-	rs201120234		TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr1:143195473delA	ENST00000412204.2	-	0	2287				RP11-782C8.1_ENST00000438000.1_lincRNA																							ATACAAAAGCAAAAAAAAAAA	0.244																																					.													.	.	.	0			.						.																																					0	.			AAAAGCAAAAAAA																													1.37:g.143195473delA		Somatic	41	8		WXS	Illumina GAIIx	Phase_I	114	20	.		RNA	DEL	ENST00000412204.2	37																																																																																				.		0.244	RP11-782C8.2-004	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000037567.2		
SEC22B	9554	broad.mit.edu;bcgsc.ca	37	1	145116152	145116152	+	RNA	SNP	C	C	T	rs74909635	byFrequency	TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr1:145116152C>T	ENST00000453618.1	+	0	1238							O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B (S. cerevisiae) (gene/pseudogene)						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											ATTGTTATTTCGTTTTTTCCC	0.413													C|||	394	0.0786741	0.0877	0.1225	5008	,	,		68996	0.0744		0.0586	False		,,,				2504	0.0603				.													.	.	.	0			.						.																																					9554	.			TTATTTCGTTTTT	AF047442		1q21.1	2012-04-20	2010-03-12	2006-04-25	ENSG00000223380				10700	protein-coding gene	gene with protein product		604029	"""SEC22, vesicle trafficking protein (S. cerevisiae)-like 1"", ""SEC22 vesicle trafficking protein-like 1 (S. cerevisiae)"", ""SEC22 vesicle trafficking protein homolog B (S. cerevisiae)"""	SEC22L1		9094723, 16354670	Standard	NM_004892		Approved	sec22b, ERS-24	uc031poa.1	O75396	OTTHUMG00000013745		1.37:g.145116152C>T		Somatic	25	0		WXS	Illumina GAIIx	Phase_I	32	4	.	A8K1G0	RNA	SNP	ENST00000453618.1	37																																																																																				.		0.413	SEC22B-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000038523.5	NM_004892	
RP11-403I13.4	0	broad.mit.edu	37	1	149258520	149258521	+	lincRNA	DEL	TG	TG	-			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr1:149258520_149258521delTG	ENST00000325963.8	+	0	862																											TTTCGTTGTATGTGTGTGTGTG	0.406																																					.													.	.	.	0			.						.																																					0	.			GTTGTATGTGTGT																													1.37:g.149258530_149258531delTG		Somatic	111	1		WXS	Illumina GAIIx	Phase_I	185	6	.		RNA	DEL	ENST00000325963.8	37																																																																																				.		0.406	RP11-403I13.4-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	lincRNA	OTTHUMT00000099551.1		
FMN2	56776	broad.mit.edu	37	1	240255531	240255531	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr1:240255531G>A	ENST00000319653.9	+	1	352	c.122G>A	c.(121-123)gGc>gAc	p.G41D		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	41					cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GGGAGCGGGGGCAAGAAGGCG	0.687																																					p.G41D													.	FMN2	451	0			c.G122A						.						5.0	6.0	6.0					1																	240255531		2070	4069	6139	SO:0001583	missense	56776	exon1			GCGGGGGCAAGAA	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.122G>A	1.37:g.240255531G>A	ENSP00000318884:p.Gly41Asp	Somatic	18	0		WXS	Illumina GAIIx	Phase_I	27	3	NM_020066	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	37	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	G	7.435	0.639505	0.14386	.	.	ENSG00000155816	ENST00000319653	T	0.27104	1.69	3.66	1.64	0.23874	.	0.342497	0.24189	N	0.040729	T	0.23766	0.0575	L	0.44542	1.39	0.20563	N	0.999887	P	0.50066	0.931	P	0.44732	0.459	T	0.09640	-1.0665	10	0.38643	T	0.18	.	11.8308	0.52295	0.0:0.0:0.6816:0.3184	.	41	Q9NZ56	FMN2_HUMAN	D	41	ENSP00000318884:G41D	ENSP00000318884:G41D	G	+	2	0	FMN2	238322154	0.977000	0.34250	0.943000	0.38184	0.436000	0.31835	1.362000	0.34148	0.291000	0.22468	0.313000	0.20887	GGC	.		0.687	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
HSD17B7P2	158160	broad.mit.edu	37	10	38654432	38654432	+	RNA	SNP	A	A	G	rs2257765		TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr10:38654432A>G	ENST00000494540.1	+	0	599					NR_003086.1				hydroxysteroid (17-beta) dehydrogenase 7 pseudogene 2																		TCATCTCGCAATGCAAGGAAA	0.453																																					.													.	.	.	0			.						.																																					0	.			CTCGCAATGCAAG			10p11.1	2011-06-29			ENSG00000099251	ENSG00000099251			28120	pseudogene	pseudogene						10544267	Standard	NR_003086		Approved	HSD17B7, bA291L22.1	uc010qex.1		OTTHUMG00000017993		10.37:g.38654432A>G		Somatic	46	1		WXS	Illumina GAIIx	Phase_I	25	3	.		RNA	SNP	ENST00000494540.1	37																																																																																				A|1.000;|0.000		0.453	HSD17B7P2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000047631.2	NR_003086	
FAM35A	54537	broad.mit.edu	37	10	88911830	88911830	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr10:88911830C>A	ENST00000298784.1	+	3	833	c.719C>A	c.(718-720)aCa>aAa	p.T240K	FAM35A_ENST00000298786.4_Missense_Mutation_p.T240K|RN7SL733P_ENST00000582253.1_RNA	NM_019054.2	NP_061927.2	Q86V20	FA35A_HUMAN	family with sequence similarity 35, member A	240								p.T240K(2)		endometrium(2)|kidney(2)|large_intestine(5)|lung(1)|ovary(2)|prostate(2)|skin(2)	16						TCAACTGATACAGAATTTCTC	0.388																																					p.T240K	Ovarian(175;703 2004 25460 32514 43441)												FAM35A,NS,carcinoma,0,3	FAM35A	48	2	Substitution - Missense(2)	large_intestine(1)|kidney(1)	c.C719A						.						30.0	30.0	30.0					10																	88911830		2203	4295	6498	SO:0001583	missense	54537	exon3			CTGATACAGAATT	BC051863	CCDS7383.1	10q23.2	2010-06-02			ENSG00000122376	ENSG00000122376			28773	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_019054		Approved	MGC5560, bA163M19.1, FAM35A1	uc001kei.4	Q86V20	OTTHUMG00000018669	ENST00000298784.1:c.719C>A	10.37:g.88911830C>A	ENSP00000298784:p.Thr240Lys	Somatic	195	1		WXS	Illumina GAIIx	Phase_I	200	4	NM_019054	O95885|Q9H991	Missense_Mutation	SNP	ENST00000298784.1	37	CCDS7383.1	.	.	.	.	.	.	.	.	.	.	c	16.25	3.071539	0.55646	.	.	ENSG00000122376	ENST00000298786;ENST00000298784;ENST00000358313	T;T;T	0.27104	1.7;1.69;1.69	4.09	3.09	0.35607	.	0.289768	0.25801	N	0.028214	T	0.45716	0.1356	.	.	.	0.34044	D	0.655393	D	0.63046	0.992	D	0.65573	0.936	T	0.61700	-0.7009	9	0.59425	D	0.04	-9.6069	12.3445	0.55114	0.0:0.9021:0.0:0.0979	.	240	Q86V20	FA35A_HUMAN	K	240	ENSP00000298786:T240K;ENSP00000298784:T240K;ENSP00000351064:T240K	ENSP00000298784:T240K	T	+	2	0	FAM35A	88901810	1.000000	0.71417	0.665000	0.29768	0.884000	0.51177	2.667000	0.46808	2.134000	0.65973	0.537000	0.68136	ACA	.		0.388	FAM35A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049196.2	NM_019054	
AGAP2	116986	broad.mit.edu	37	12	58131300	58131302	+	In_Frame_Del	DEL	CGG	CGG	-			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr12:58131300_58131302delCGG	ENST00000547588.1	-	1	727_729	c.728_730delCCG	c.(727-732)gccggg>ggg	p.A243del	AGAP2_ENST00000257897.3_Intron	NM_001122772.2	NP_001116244.1	Q99490	AGAP2_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 2	243					axon guidance (GO:0007411)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|large_intestine(7)|lung(20)|prostate(3)|skin(1)|stomach(1)	48						CCCCCTCCCCcggcggcggcggc	0.685																																					p.243_244del													.	AGAP2	167	0			c.728_730del						.																																			SO:0001651	inframe_deletion	116986	exon1			CTCCCCCGGCGGC	AF413077	CCDS8951.1, CCDS44932.1	12q13.2	2013-05-30	2008-09-22	2008-09-22	ENSG00000135439	ENSG00000135439		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16921	protein-coding gene	gene with protein product		605476	"""centaurin, gamma 1"""	CENTG1			Standard	NM_001122772		Approved		uc001spq.3	Q99490	OTTHUMG00000170285	ENST00000547588.1:c.728_730delCCG	12.37:g.58131309_58131311delCGG	ENSP00000449241:p.Ala243del	Somatic	34	0		WXS	Illumina GAIIx	Phase_I	377	5	NM_001122772	A8K9F7|O00578|Q548E0|Q8IWU3	In_Frame_Del	DEL	ENST00000547588.1	37	CCDS44932.1																																																																																			.		0.685	AGAP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408367.1	NM_014770	
CTD-2311B13.7	0	broad.mit.edu	37	14	19969451	19969451	+	lincRNA	SNP	C	C	T	rs202195525		TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr14:19969451C>T	ENST00000547399.1	-	0	2841																											GTCAAATAGACATATTTTGAA	0.274																																					.													.	.	.	0			.						.																																					0	.			AATAGACATATTT																													14.37:g.19969451C>T		Somatic	13	0		WXS	Illumina GAIIx	Phase_I	42	8	.		RNA	SNP	ENST00000547399.1	37																																																																																				C|0.250;T|0.750		0.274	CTD-2311B13.7-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000409457.1		
RP11-106M3.2	0	broad.mit.edu	37	15	72617486	72617486	+	RNA	DEL	T	T	-	rs58190245|rs564194599|rs374358826		TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr15:72617486delT	ENST00000379915.4	-	0	617				RP11-106M3.3_ENST00000570175.1_RNA																							tctttctttcttttctttctt	0.289																																					.													.	.	.	0			.						.																																					0	.			TCTTTCTTTTCTT																													15.37:g.72617486delT		Somatic	5	0		WXS	Illumina GAIIx	Phase_I	10	4	.		RNA	DEL	ENST00000379915.4	37																																																																																				.		0.289	RP11-106M3.2-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript	OTTHUMT00000420186.1		
POLR3E	55718	broad.mit.edu	37	16	22337151	22337151	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr16:22337151C>T	ENST00000299853.5	+	18	1585	c.1418C>T	c.(1417-1419)gCg>gTg	p.A473V	POLR3E_ENST00000359210.4_Missense_Mutation_p.A473V|POLR3E_ENST00000418581.2_Missense_Mutation_p.A437V|POLR3E_ENST00000564209.1_Missense_Mutation_p.A473V	NM_001258033.1|NM_001258035.1|NM_018119.3	NP_001244962.1|NP_001244964.1|NP_060589.1	Q9NVU0	RPC5_HUMAN	polymerase (RNA) III (DNA directed) polypeptide E (80kD)	473					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	centrosome (GO:0005813)|cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA-directed RNA polymerase activity (GO:0003899)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27				GBM - Glioblastoma multiforme(48;0.012)		CAGAACCACGCGTTGCTGGAG	0.701																																					p.A473V													POLR3E,rectum,carcinoma,+1,1	POLR3E	62	0			c.C1418T						.						24.0	24.0	24.0					16																	22337151		2196	4297	6493	SO:0001583	missense	55718	exon18			ACCACGCGTTGCT	AY092085	CCDS10605.1, CCDS58432.1, CCDS58433.1, CCDS58434.1, CCDS73845.1	16p12	2013-01-21			ENSG00000058600	ENSG00000058600		"""RNA polymerase subunits"""	30347	protein-coding gene	gene with protein product						10819331, 10521666	Standard	NM_018119		Approved	RPC5, SIN, FLJ10509	uc002dkk.4	Q9NVU0	OTTHUMG00000094779	ENST00000299853.5:c.1418C>T	16.37:g.22337151C>T	ENSP00000299853:p.Ala473Val	Somatic	46	0		WXS	Illumina GAIIx	Phase_I	50	5	NM_001258033	B4DL24|B4DUP6|H3BT11|Q9BWF7|Q9H8W8|Q9H907|Q9P276	Missense_Mutation	SNP	ENST00000299853.5	37	CCDS10605.1	.	.	.	.	.	.	.	.	.	.	C	12.85	2.062149	0.36373	.	.	ENSG00000058600	ENST00000299853;ENST00000359210;ENST00000418581	T;T;T	0.45276	0.91;0.91;0.9	5.27	0.661	0.17874	.	0.636877	0.16035	N	0.232686	T	0.28599	0.0708	L	0.38531	1.155	0.09310	N	1	B;B;B;B;B;B	0.20164	0.025;0.001;0.003;0.002;0.001;0.042	B;B;B;B;B;B	0.14023	0.004;0.002;0.003;0.002;0.002;0.01	T	0.23619	-1.0183	10	0.87932	D	0	-4.0025	5.666	0.17695	0.0:0.4324:0.1794:0.3883	.	417;437;473;473;473;473	B4DDR0;B4DL24;B4DUP6;Q9NVU0-2;Q9NVU0;Q9NVU0-3	.;.;.;.;RPC5_HUMAN;.	V	473;473;437	ENSP00000299853:A473V;ENSP00000352140:A473V;ENSP00000399254:A437V	ENSP00000299853:A473V	A	+	2	0	POLR3E	22244652	0.000000	0.05858	0.003000	0.11579	0.951000	0.60555	0.177000	0.16801	0.250000	0.21479	0.462000	0.41574	GCG	.		0.701	POLR3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211590.1	NM_018119	
IGHV3OR16-9	28307	broad.mit.edu	37	16	32077601	32077601	+	RNA	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr16:32077601G>A	ENST00000354689.6	+	0	216				RP11-1166P10.6_ENST00000566806.1_RNA					immunoglobulin heavy variable 3/OR16-9 (non-functional)																		CCATCTCCAGGGACAACGCCA	0.502																																					.													.	.	.	0			.						.																																					0	.			CTCCAGGGACAAC	Z29606		16p11.2	2013-12-06	2008-09-11		ENSG00000270472	ENSG00000270472		"""Immunoglobulins / IGH orphons"""	5644	other	immunoglobulin gene			"""immunoglobulin heavy variable 3/OR16-9"""				Standard			Approved	IGHV3/OR16-9			OTTHUMG00000184753		16.37:g.32077601G>A		Somatic	113	0		WXS	Illumina GAIIx	Phase_I	118	5	.		RNA	SNP	ENST00000354689.6	37																																																																																				.		0.502	IGHV3OR16-9-001	KNOWN	mRNA_start_NF|mRNA_end_NF|cds_start_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene	OTTHUMT00000432530.2		
LOC101927755	101927755	broad.mit.edu	37	17	58066651	58066651	+	lincRNA	SNP	C	C	T	rs376360537		TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr17:58066651C>T	ENST00000586209.1	+	0	158																											ACTGGTAAAGCTGTTTAAGAG	0.333																																					.													.	.	.	0			.						.																																					0	.			GTAAAGCTGTTTA																													17.37:g.58066651C>T		Somatic	46	0		WXS	Illumina GAIIx	Phase_I	70	7	.		RNA	SNP	ENST00000586209.1	37																																																																																				.		0.333	RP11-178C3.2-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000449162.1		
AMZ2P1	201283	broad.mit.edu	37	17	62968690	62968690	+	RNA	SNP	A	A	G			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr17:62968690A>G	ENST00000430983.1	-	0	1554					NR_026903.1				archaelysin family metallopeptidase 2 pseudogene 1																		AAAATTCCACAAGTCTCTTGG	0.373																																					.													.	.	.	0			.						.																																					0	.			TTCCACAAGTCTC	AK056627		17q24.1	2012-10-16	2010-04-08		ENSG00000214174	ENSG00000214174			26491	pseudogene	pseudogene							Standard	NR_026903		Approved	FLJ32065	uc002jfb.3		OTTHUMG00000132075		17.37:g.62968690A>G		Somatic	75	1		WXS	Illumina GAIIx	Phase_I	87	3	.		RNA	SNP	ENST00000430983.1	37																																																																																				.		0.373	AMZ2P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000255102.1	NM_153032	
KEAP1	9817	broad.mit.edu;bcgsc.ca	37	19	10602675	10602680	+	In_Frame_Del	DEL	CAGGTA	CAGGTA	-			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr19:10602675_10602680delCAGGTA	ENST00000171111.5	-	3	1445_1450	c.898_903delTACCTG	c.(898-903)tacctgdel	p.YL300del	KEAP1_ENST00000393623.2_In_Frame_Del_p.YL300del|CTC-429L19.3_ENST00000592671.1_RNA|KEAP1_ENST00000588024.1_5'UTR	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	300					cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	AGATCTTGACCAGGTAGTCCTTGCAG	0.655																																					p.300_301del													.	KEAP1	182	0			c.898_903del						.																																			SO:0001651	inframe_deletion	9817	exon3			CTTGACCAGGTAG	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.898_903delTACCTG	19.37:g.10602675_10602680delCAGGTA	ENSP00000171111:p.Tyr300_Leu301del	Somatic	35	0		WXS	Illumina GAIIx	Phase_I	18	6	NM_012289	B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	In_Frame_Del	DEL	ENST00000171111.5	37	CCDS12239.1																																																																																			.		0.655	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289	
AC017002.1	0	broad.mit.edu	37	2	112252464	112252464	+	lincRNA	SNP	G	G	A	rs1128295		TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr2:112252464G>A	ENST00000455309.1	+	0	390				AC017002.2_ENST00000432268.1_lincRNA																							ATACTCACCAGGGAGAGGCTG	0.537																																					.													.	.	.	0			.						.																																					0	.			TCACCAGGGAGAG																													2.37:g.112252464G>A		Somatic	67	1		WXS	Illumina GAIIx	Phase_I	84	4	.		RNA	SNP	ENST00000455309.1	37																																																																																				G|0.500;A|0.500		0.537	AC017002.1-001	KNOWN	basic|exp_conf	lincRNA	lincRNA	OTTHUMT00000332149.1		
RANBP2	5903	broad.mit.edu	37	2	109367844	109367844	+	Missense_Mutation	SNP	T	T	G			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr2:109367844T>G	ENST00000283195.6	+	10	1524	c.1398T>G	c.(1396-1398)caT>caG	p.H466Q		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	466					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.H466Q(6)	RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						ATTTGCCCCATGAAACCTCAA	0.358																																					p.H466Q													RANBP2_ENST00000283195,NS,carcinoma,0,6	RANBP2	488	6	Substitution - Missense(6)	endometrium(6)	c.T1398G						.						69.0	78.0	75.0					2																	109367844		1510	2703	4213	SO:0001583	missense	5903	exon10			GCCCCATGAAACC	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.1398T>G	2.37:g.109367844T>G	ENSP00000283195:p.His466Gln	Somatic	342	0		WXS	Illumina GAIIx	Phase_I	347	4	NM_006267	Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	ENST00000283195.6	37	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	G	2.180	-0.387877	0.04932	.	.	ENSG00000153201	ENST00000409491;ENST00000283195	D	0.82526	-1.62	5.25	2.44	0.29823	.	.	.	.	.	T	0.43545	0.1252	N	0.00197	-1.87	0.20563	N	0.999888	B	0.02656	0.0	B	0.01281	0.0	T	0.50039	-0.8874	9	0.02654	T	1	-0.0972	5.4961	0.16804	0.3195:0.0:0.5396:0.1409	.	466	P49792	RBP2_HUMAN	Q	466	ENSP00000283195:H466Q	ENSP00000283195:H466Q	H	+	3	2	RANBP2	108734276	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.307000	0.43682	0.319000	0.23209	-0.127000	0.14921	CAT	.		0.358	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
PRPF40A	55660	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	153514468	153514468	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr2:153514468C>A	ENST00000410080.1	-	25	3176	c.2635G>T	c.(2635-2637)Gac>Tac	p.D879Y		NM_017892.3	NP_060362.3	O75400	PR40A_HUMAN	PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)	906					cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|mRNA processing (GO:0006397)|regulation of cell shape (GO:0008360)|regulation of cytokinesis (GO:0032465)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|prostate(1)|urinary_tract(1)	21						CTAGTTCTGTCTTTTTCACTT	0.353																																					p.D879Y													.	PRPF40A	149	0			c.G2635T						.						212.0	171.0	184.0					2																	153514468		1812	4063	5875	SO:0001583	missense	55660	exon25			TTCTGTCTTTTTC	AF049523	CCDS46430.1	2q23.3	2010-01-25	2007-01-12	2006-01-13	ENSG00000196504	ENSG00000196504			16463	protein-coding gene	gene with protein product		612941	"""formin-binding protein 3"", ""formin binding protein 3"", ""PRP40 pre-mRNA processing factor 40 homolog A (yeast)"""	FNBP3		9724750, 12460579	Standard	NM_017892		Approved	FLJ20585, FBP11, HYPA, NY-REN-6, HIP10, FBP-11, FLAF1, Prp40	uc002tyh.4	O75400	OTTHUMG00000154031	ENST00000410080.1:c.2635G>T	2.37:g.153514468C>A	ENSP00000386458:p.Asp879Tyr	Somatic	93	1		WXS	Illumina GAIIx	Phase_I	106	40	NM_017892	O43856|O75404|Q8TBQ1|Q9H782|Q9NWU9|Q9P0Q2|Q9Y5A8	Missense_Mutation	SNP	ENST00000410080.1	37	CCDS46430.1	.	.	.	.	.	.	.	.	.	.	C	18.86	3.712540	0.68730	.	.	ENSG00000196504	ENST00000410080;ENST00000356402;ENST00000440252	T	0.36878	1.23	5.27	5.27	0.74061	.	0.151201	0.64402	D	0.000014	T	0.48822	0.1521	L	0.53249	1.67	0.80722	D	1	D;D	0.58970	0.984;0.984	P;P	0.54372	0.75;0.75	T	0.49457	-0.8938	10	0.72032	D	0.01	-9.0824	15.988	0.80176	0.0:1.0:0.0:0.0	.	906;879	O75400;E9PFS0	PR40A_HUMAN;.	Y	879;888;775	ENSP00000386458:D879Y	ENSP00000348770:D888Y	D	-	1	0	PRPF40A	153222714	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.440000	0.66563	2.615000	0.88500	0.563000	0.77884	GAC	.		0.353	PRPF40A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333559.2	XM_371575	
LINC01598	105379478	broad.mit.edu	37	20	29589311	29589312	+	RNA	DEL	TG	TG	-			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr20:29589311_29589312delTG	ENST00000432067.1	-	0	152																											tgctgcatcctgtaagttttgt	0.317																																					.													.	.	.	0			.						.																																					0	.			GCATCCTGTAAGT																													20.37:g.29589311_29589312delTG		Somatic	10	0		WXS	Illumina GAIIx	Phase_I	6	2	.		RNA	DEL	ENST00000432067.1	37																																																																																				.		0.317	RP4-610C12.1-002	KNOWN	basic	antisense	antisense	OTTHUMT00000078489.3		
HEG1	57493	broad.mit.edu	37	3	124738300	124738300	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr3:124738300G>T	ENST00000311127.4	-	5	1461	c.1394C>A	c.(1393-1395)aCa>aAa	p.T465K	HEG1_ENST00000477536.1_5'UTR	NM_020733.1	NP_065784.1	Q9ULI3	HEG1_HUMAN	heart development protein with EGF-like domains 1	465	Ser-rich.				cardiac atrium morphogenesis (GO:0003209)|cell-cell junction assembly (GO:0007043)|endothelial cell morphogenesis (GO:0001886)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|lymph circulation (GO:0003017)|lymph vessel development (GO:0001945)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|post-embryonic development (GO:0009791)|regulation of body fluid levels (GO:0050878)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(24)|ovary(2)|urinary_tract(4)	47						ATCTGCAGATGTTGTGCTGTT	0.498																																					p.T465K													.	HEG1	109	0			c.C1394A						.						253.0	246.0	248.0					3																	124738300		2098	4236	6334	SO:0001583	missense	57493	exon5			GCAGATGTTGTGC	AK074987	CCDS46898.1	3q21.2	2013-03-08	2013-03-08		ENSG00000173706	ENSG00000173706			29227	protein-coding gene	gene with protein product	"""heart of glass"""	614182	"""HEG homolog 1 (zebrafish)"""			10574462, 19151727, 23007647	Standard	NM_020733		Approved	KIAA1237, HEG	uc003ehs.4	Q9ULI3	OTTHUMG00000159486	ENST00000311127.4:c.1394C>A	3.37:g.124738300G>T	ENSP00000311502:p.Thr465Lys	Somatic	27	0		WXS	Illumina GAIIx	Phase_I	31	3	NM_020733	Q6NX66|Q8NC40|Q9BSV0	Missense_Mutation	SNP	ENST00000311127.4	37	CCDS46898.1	.	.	.	.	.	.	.	.	.	.	G	12.84	2.057048	0.36277	.	.	ENSG00000173706	ENST00000311127	D	0.90261	-2.64	5.07	2.3	0.28687	.	.	.	.	.	D	0.88855	0.6550	L	0.56769	1.78	0.09310	N	1	P;P	0.43701	0.815;0.718	P;B	0.45681	0.49;0.296	T	0.80303	-0.1439	9	0.56958	D	0.05	.	6.6131	0.22763	0.288:0.0:0.712:0.0	.	465;465	Q9ULI3-2;Q9ULI3	.;HEG1_HUMAN	K	465	ENSP00000311502:T465K	ENSP00000311502:T465K	T	-	2	0	HEG1	126220990	0.003000	0.15002	0.001000	0.08648	0.033000	0.12548	1.027000	0.30115	0.843000	0.35070	0.650000	0.86243	ACA	.		0.498	HEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355732.2	XM_087386	
GPR149	344758	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	154055683	154055683	+	Silent	SNP	C	C	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr3:154055683C>T	ENST00000389740.2	-	4	2100	c.2001G>A	c.(1999-2001)ggG>ggA	p.G667G		NM_001038705.1	NP_001033794.1	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	667					antral ovarian follicle growth (GO:0001547)|estrous cycle phase (GO:0060206)|negative regulation of ovulation (GO:0060280)|preantral ovarian follicle growth (GO:0001546)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(22)|ovary(7)|prostate(1)|skin(1)|urinary_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			AGGCTGTTTCCCCTAGGTCAC	0.433																																					p.G667G													.	GPR149	134	0			c.G2001A						.						238.0	220.0	226.0					3																	154055683		1962	4157	6119	SO:0001819	synonymous_variant	344758	exon4			TGTTTCCCCTAGG	AY255534	CCDS43162.1	3q25.2	2012-08-21			ENSG00000174948	ENSG00000174948		"""GPCR / Class A : Orphans"""	23627	protein-coding gene	gene with protein product						12679517	Standard	NM_001038705		Approved	PGR10, IEDA	uc003faa.3	Q86SP6	OTTHUMG00000159131	ENST00000389740.2:c.2001G>A	3.37:g.154055683C>T		Somatic	64	0		WXS	Illumina GAIIx	Phase_I	82	17	NM_001038705		Silent	SNP	ENST00000389740.2	37	CCDS43162.1																																																																																			.		0.433	GPR149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353430.1	XM_293580	
LINC00969	440993	broad.mit.edu	37	3	195392705	195392705	+	lincRNA	DEL	C	C	-	rs59802848		TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr3:195392705delC	ENST00000445430.1	+	0	647									long intergenic non-protein coding RNA 969																		AAATGTGTCACCAACATAGGA	0.567																																					.													.	.	.	0			.						.																																					0	.			GTGTCACCAACAT	AK128346		3q29	2013-06-07			ENSG00000242086	ENSG00000242086		"""Long non-coding RNAs"""	48729	non-coding RNA	RNA, long non-coding							Standard	XR_427455		Approved				OTTHUMG00000155834		3.37:g.195392705delC		Somatic	9	1		WXS	Illumina GAIIx	Phase_I	14	6	.		RNA	DEL	ENST00000445430.1	37																																																																																				.		0.567	LINC00969-038	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000341951.1		
RP11-190P13.2	0	broad.mit.edu	37	3	114998900	114998900	+	lincRNA	DEL	A	A	-	rs566064368		TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr3:114998900delA	ENST00000459855.1	+	0	338																											TGCTAAATTTAAAAAAAAAAA	0.363																																					.													.	.	.	0			.						.																																					0	.			AAATTTAAAAAAA																													3.37:g.114998900delA		Somatic	8	0		WXS	Illumina GAIIx	Phase_I	10	3	.		RNA	DEL	ENST00000459855.1	37																																																																																				.		0.363	RP11-190P13.2-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000354479.1		
MUC4	4585	broad.mit.edu	37	3	195509879	195509879	+	Missense_Mutation	SNP	A	A	G			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr3:195509879A>G	ENST00000463781.3	-	2	9031	c.8572T>C	c.(8572-8574)Tcc>Ccc	p.S2858P	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.S2858P|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.S2858P(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGACCTGTGGACACTGAGGAA	0.587																																					p.S2858P													MUC4_ENST00000463781,NS,carcinoma,0,2	MUC4	1505	2	Substitution - Missense(2)	endometrium(2)	c.T8572C						.						43.0	30.0	34.0					3																	195509879		682	1572	2254	SO:0001583	missense	4585	exon2			CTGTGGACACTGA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8572T>C	3.37:g.195509879A>G	ENSP00000417498:p.Ser2858Pro	Somatic	100	1		WXS	Illumina GAIIx	Phase_I	103	9	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	a	4.416	0.076953	0.08485	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.38887	1.11;1.34	.	.	.	.	.	.	.	.	T	0.37892	0.1020	N	0.19112	0.55	0.09310	N	1	D	0.53885	0.963	D	0.65874	0.939	T	0.17289	-1.0374	7	.	.	.	.	1.4356	0.02342	0.333:0.0:0.3289:0.3381	.	2730	E7ESK3	.	P	2858	ENSP00000417498:S2858P;ENSP00000420243:S2858P	.	S	-	1	0	MUC4	196994658	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	-0.006000	0.12833	-0.000000	0.14550	0.000000	0.15137	TCC	.		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
SMARCA5	8467	broad.mit.edu	37	4	144451680	144451680	+	Splice_Site	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr4:144451680G>T	ENST00000283131.3	+	9	1620		c.e9+1			NM_003601.3	NP_003592.3	O60264	SMCA5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5						ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA-templated transcription, initiation (GO:0006352)|double-strand break repair (GO:0006302)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin silencing complex (GO:0005677)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NURF complex (GO:0016589)|RSF complex (GO:0031213)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)		EWSR1/SMARCA5(2)	endometrium(2)|kidney(2)|large_intestine(9)|lung(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_hematologic(180;0.158)					GCTTCATATGGTAAGTATTTT	0.308																																					.													.	SMARCA5	73	0			c.1158+1G>T						.						99.0	110.0	106.0					4																	144451680		2203	4300	6503	SO:0001630	splice_region_variant	8467	exon9			CATATGGTAAGTA	AB010882	CCDS3761.1	4q31.1-q31.2	2011-04-20			ENSG00000153147	ENSG00000153147			11101	protein-coding gene	gene with protein product		603375				9730600	Standard	NM_003601		Approved	hSNF2H, hISWI, ISWI	uc003ijg.3	O60264	OTTHUMG00000161474	ENST00000283131.3:c.1158+1G>T	4.37:g.144451680G>T		Somatic	86	0		WXS	Illumina GAIIx	Phase_I	74	3	NM_003601		Splice_Site	SNP	ENST00000283131.3	37	CCDS3761.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.617542	0.87359	.	.	ENSG00000153147	ENST00000283131;ENST00000536484;ENST00000535006	.	.	.	5.19	5.19	0.71726	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0742	0.93154	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SMARCA5	144671130	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.622000	0.98378	2.576000	0.86940	0.650000	0.86243	.	.		0.308	SMARCA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365077.3		Intron
MTRR	4552	broad.mit.edu	37	5	7885967	7885967	+	Splice_Site	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr5:7885967G>T	ENST00000264668.2	+	7	1168	c.1138G>T	c.(1138-1140)Gga>Tga	p.G380*	MTRR_ENST00000341013.6_3'UTR|MTRR_ENST00000440940.2_Splice_Site_p.G353*	NM_002454.2|NM_024010.2	NP_002445.2|NP_076915.2	Q9UBK8	MTRR_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase reductase	380	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|DNA methylation (GO:0006306)|folic acid metabolic process (GO:0046655)|methionine biosynthetic process (GO:0009086)|methionine metabolic process (GO:0006555)|methylation (GO:0032259)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	[methionine synthase] reductase activity (GO:0030586)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|oxidoreductase activity, oxidizing metal ions, NAD or NADP as acceptor (GO:0016723)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(14)|ovary(1)|prostate(3)|stomach(1)	31					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	AAAGAAGAAAGGTAACAGCCC	0.498																																					p.G380X													.	MTRR	74	0			c.G1138T						.						82.0	82.0	82.0					5																	7885967		2203	4300	6503	SO:0001630	splice_region_variant	4552	exon7			AAGAAAGGTAACA	AF025794	CCDS3874.1, CCDS47190.1	5p15.31	2011-05-12			ENSG00000124275	ENSG00000124275	1.16.1.8		7473	protein-coding gene	gene with protein product		602568				9501215	Standard	NM_024010		Approved	cblE	uc003jed.3	Q9UBK8	OTTHUMG00000090477	ENST00000264668.2:c.1138+1G>T	5.37:g.7885967G>T		Somatic	43	0		WXS	Illumina GAIIx	Phase_I	62	4	NM_024010	O60471|Q32MA9|Q7Z4M8	Splice_Site	SNP	ENST00000264668.2	37	CCDS3874.1	.	.	.	.	.	.	.	.	.	.	G	39	7.442387	0.98286	.	.	ENSG00000124275	ENST00000264668;ENST00000440940	.	.	.	5.53	5.53	0.82687	.	0.554714	0.20710	N	0.087116	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	-26.1004	19.8371	0.96661	0.0:0.0:1.0:0.0	.	.	.	.	X	380;353	.	ENSP00000264668:G380X	G	+	1	0	MTRR	7938967	1.000000	0.71417	1.000000	0.80357	0.728000	0.41692	8.855000	0.92236	2.753000	0.94483	0.650000	0.86243	GGA	.		0.498	MTRR-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206931.1		Nonsense_Mutation
LOC100653061	100653061	broad.mit.edu	37	5	34179621	34179621	+	RNA	DEL	G	G	-	rs142410298	byFrequency	TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr5:34179621delG	ENST00000514048.1	-	0	231																											caaaaagaaagaaaagaaaag	0.433																																					.													.	.	.	0			.						.																																					0	.			AAGAAAGAAAAGA																													5.37:g.34179621delG		Somatic	4	0		WXS	Illumina GAIIx	Phase_I	8	2	.		RNA	DEL	ENST00000514048.1	37																																																																																				.		0.433	RP11-1023L17.1-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000367775.1		
STAG3L1	54441	broad.mit.edu	37	7	74991539	74991539	+	RNA	DEL	C	C	-	rs375690101		TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr7:74991539delC	ENST00000402225.5	+	0	434							P0CL83	ST3L1_HUMAN	stromal antigen 3-like 1 (pseudogene)							nucleus (GO:0005634)											AGAGCATGttctttttttttt	0.418																																					.													.	STAG3L1	2	0			.						.																																					0	.			CATGTTCTTTTTT			7q11.23	2013-06-26	2013-06-26		ENSG00000205583	ENSG00000205583			33852	pseudogene	pseudogene			"""stromal antigen 3-like 1"""				Standard	NR_040583		Approved	DKFZP434A0131, STAG3L1P	uc022agf.1	P0CL83	OTTHUMG00000155940		7.37:g.74991539delC		Somatic	14	0		WXS	Illumina GAIIx	Phase_I	30	2	.	A6NMT8|A8K0A1|Q32NE4|Q6NXR2|Q7L5M5|Q7Z5K6	RNA	DEL	ENST00000402225.5	37																																																																																				.		0.418	STAG3L1-012	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000437242.1	NM_001002840	
TMUB1	83590	broad.mit.edu	37	7	150778815	150778815	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr7:150778815G>A	ENST00000392818.3	-	3	919	c.562C>T	c.(562-564)Ccc>Tcc	p.P188S	TMUB1_ENST00000482202.1_Missense_Mutation_p.P188S|FASTK_ENST00000482571.1_5'Flank|FASTK_ENST00000540185.1_5'Flank|TMUB1_ENST00000297533.4_Missense_Mutation_p.P188S|FASTK_ENST00000297532.6_5'Flank|TMUB1_ENST00000462940.1_Missense_Mutation_p.P188S|FASTK_ENST00000353841.2_5'Flank|TMUB1_ENST00000476627.1_Missense_Mutation_p.P188S|FASTK_ENST00000489884.1_5'Flank	NM_031434.3	NP_113622.1	Q9BVT8	TMUB1_HUMAN	transmembrane and ubiquitin-like domain containing 1	188						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				endometrium(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(82;0.00989)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GAGGGGCCGGGCTCGGACCCC	0.677																																					p.P188S													.	TMUB1	7	0			c.C562T						.						8.0	10.0	9.0					7																	150778815		2161	4235	6396	SO:0001583	missense	83590	exon3			GGCCGGGCTCGGA	BC000936	CCDS5920.1	7q36.1	2006-06-27	2006-06-27	2006-06-27	ENSG00000164897	ENSG00000164897			21709	protein-coding gene	gene with protein product		614792	"""chromosome 7 open reading frame 21"""	C7orf21			Standard	NM_001136044		Approved	SB144	uc003wjd.3	Q9BVT8	OTTHUMG00000158621	ENST00000392818.3:c.562C>T	7.37:g.150778815G>A	ENSP00000376565:p.Pro188Ser	Somatic	18	0		WXS	Illumina GAIIx	Phase_I	21	9	NM_031434	D3DX06|Q53AQ2	Missense_Mutation	SNP	ENST00000392818.3	37	CCDS5920.1	.	.	.	.	.	.	.	.	.	.	G	13.39	2.224083	0.39300	.	.	ENSG00000164897	ENST00000297533;ENST00000392818;ENST00000462940;ENST00000482202;ENST00000476627	T;T;T;T;T	0.60424	0.19;0.19;0.19;0.19;0.19	4.46	3.5	0.40072	.	0.154326	0.44483	D	0.000450	T	0.38295	0.1035	L	0.27053	0.805	0.30055	N	0.8114	B	0.29988	0.264	B	0.26693	0.072	T	0.27020	-1.0086	10	0.22706	T	0.39	.	8.9217	0.35615	0.0:0.1476:0.6827:0.1697	.	188	Q9BVT8	TMUB1_HUMAN	S	188	ENSP00000297533:P188S;ENSP00000376565:P188S;ENSP00000417519:P188S;ENSP00000418709:P188S;ENSP00000419214:P188S	ENSP00000297533:P188S	P	-	1	0	TMUB1	150409748	0.999000	0.42202	1.000000	0.80357	0.946000	0.59487	2.264000	0.43302	2.295000	0.77249	0.313000	0.20887	CCC	.		0.677	TMUB1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351485.1	NM_031434	
MLLT3	4300	broad.mit.edu;bcgsc.ca	37	9	20414379	20414379	+	Silent	SNP	G	G	A	rs373338988		TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr9:20414379G>A	ENST00000380338.4	-	5	751	c.465C>T	c.(463-465)agC>agT	p.S155S	MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000429426.2_Silent_p.S152S|MLLT3_ENST00000475957.1_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	155	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.S155S(4)		central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctactgctgctgctgc	0.532			T	MLL	ALL																																p.S155S				Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	MLLT3,NS,carcinoma,0,8	MLLT3	125	4	Substitution - coding silent(4)	urinary_tract(1)|large_intestine(1)|lung(1)|kidney(1)	c.C465T						.						10.0	15.0	14.0					9																	20414379		1871	3851	5722	SO:0001819	synonymous_variant	4300	exon5			GCTACTGCTGCTG	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.465C>T	9.37:g.20414379G>A		Somatic	81	0		WXS	Illumina GAIIx	Phase_I	105	6	NM_004529	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	ENST00000380338.4	37	CCDS6494.1																																																																																			.		0.532	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051872.1	NM_004529	
PTCH1	5727	broad.mit.edu	37	9	98229635	98229635	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr9:98229635G>T	ENST00000331920.6	-	15	2622	c.2323C>A	c.(2323-2325)Ctg>Atg	p.L775M	PTCH1_ENST00000375274.2_Missense_Mutation_p.L774M|PTCH1_ENST00000437951.1_Missense_Mutation_p.L709M|PTCH1_ENST00000429896.2_Missense_Mutation_p.L624M|PTCH1_ENST00000418258.1_Missense_Mutation_p.L624M|PTCH1_ENST00000430669.2_Missense_Mutation_p.L709M|PTCH1_ENST00000421141.1_Missense_Mutation_p.L624M	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	775					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)			NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				GTAAGGTCCAGCCCGTCTCTC	0.473																																					p.L775M													.	PTCH1	1850	0			c.C2323A						.						94.0	94.0	94.0					9																	98229635		2203	4300	6503	SO:0001583	missense	5727	exon15			GGTCCAGCCCGTC	AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.2323C>A	9.37:g.98229635G>T	ENSP00000332353:p.Leu775Met	Somatic	48	0		WXS	Illumina GAIIx	Phase_I	40	3	NM_000264	A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Missense_Mutation	SNP	ENST00000331920.6	37	CCDS6714.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.106875	0.77096	.	.	ENSG00000185920	ENST00000331920;ENST00000437951;ENST00000421141;ENST00000418258;ENST00000375275;ENST00000430669;ENST00000429896;ENST00000375274	D;D;D;D;D;D;D	0.94330	-3.39;-3.38;-3.37;-3.37;-3.38;-3.37;-3.4	5.73	4.84	0.62591	.	0.000000	0.85682	D	0.000000	D	0.97021	0.9027	M	0.88570	2.965	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.97617	1.0133	10	0.72032	D	0.01	-15.3324	14.7134	0.69249	0.0697:0.0:0.9303:0.0	.	709;774;775	Q13635-3;Q13635-2;Q13635	.;.;PTC1_HUMAN	M	775;709;624;624;211;709;624;774	ENSP00000332353:L775M;ENSP00000389744:L709M;ENSP00000399981:L624M;ENSP00000396135:L624M;ENSP00000410287:L709M;ENSP00000414823:L624M;ENSP00000364423:L774M	ENSP00000332353:L775M	L	-	1	2	PTCH1	97269456	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.396000	0.73234	1.425000	0.47237	0.591000	0.81541	CTG	.		0.473	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053229.2	NM_000264	
MAGEE1	57692	broad.mit.edu	37	X	75648348	75648350	+	In_Frame_Del	DEL	CGC	CGC	-			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chrX:75648348_75648350delCGC	ENST00000361470.2	+	1	303_305	c.25_27delCGC	c.(25-27)cgcdel	p.R14del		NM_020932.2	NP_065983.1	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	14	Poly-Arg.					dendrite (GO:0030425)|dystrophin-associated glycoprotein complex (GO:0016010)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	51						CCAGAATTcgcgccgccgccgcc	0.665																																					p.9_9del													.	MAGEE1	236	0			c.25_27del						.			72,3531		2,46,22,1505,475						1.4	1.0			14	144,6194		5,74,60,2248,1624	no	coding	MAGEE1	NM_020932.2		7,120,82,3753,2099	A1A1,A1R,A1,RR,R		2.272,1.9983,2.1728				216,9725				SO:0001651	inframe_deletion	57692	exon1			AATTCGCGCCGCC	AF490507	CCDS14433.1	Xq13	2008-02-05			ENSG00000198934	ENSG00000198934			24934	protein-coding gene	gene with protein product		300759				14623885	Standard	NM_020932		Approved	KIAA1587, DAMAGE	uc004ecm.2	Q9HCI5	OTTHUMG00000021879	ENST00000361470.2:c.25_27delCGC	X.37:g.75648357_75648359delCGC	ENSP00000354912:p.Arg14del	Somatic	40	0		WXS	Illumina GAIIx	Phase_I	74	7	NM_020932	Q5JXC7|Q86TG0|Q8TD92|Q9H216	In_Frame_Del	DEL	ENST00000361470.2	37	CCDS14433.1																																																																																			.		0.665	MAGEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057298.1	NM_020932	
NXF4	55999	broad.mit.edu	37	X	101822612	101822612	+	RNA	DEL	T	T	-			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chrX:101822612delT	ENST00000360035.2	+	0	2365					NR_002216.1				nuclear RNA export factor 4 pseudogene											endometrium(2)|lung(8)	10						CTTGTTCCTATTTTTGCCCTC	0.498																																					.													.	NXF4	14	0			.						.																																					0	.			TTCCTATTTTTGC	AK124700		Xq22	2005-01-24			ENSG00000196970	ENSG00000196970			8074	pseudogene	pseudogene		300318	"""nuclear RNA export factor 4"""			11566096	Standard	NR_002216		Approved		uc004ejf.1		OTTHUMG00000039695		X.37:g.101822612delT		Somatic	5	0		WXS	Illumina GAIIx	Phase_I	6	2	.		RNA	DEL	ENST00000360035.2	37																																																																																				.		0.498	NXF4-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000095720.1		
PHKA1	5255	broad.mit.edu	37	X	71839078	71839078	+	Nonsense_Mutation	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chrX:71839078G>A	ENST00000373542.4	-	20	2374	c.2215C>T	c.(2215-2217)Cga>Tga	p.R739*	PHKA1_ENST00000373539.3_Nonsense_Mutation_p.R739*|PHKA1_ENST00000541944.1_Nonsense_Mutation_p.R680*|PHKA1_ENST00000373545.3_Nonsense_Mutation_p.R680*|PHKA1_ENST00000339490.3_Nonsense_Mutation_p.R739*	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	739					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					TTCTCCTGTCGGGGATGAGGT	0.383																																					p.R739X													.	PHKA1	129	0			c.C2215T						.						66.0	58.0	60.0					X																	71839078		2203	4300	6503	SO:0001587	stop_gained	5255	exon20			CCTGTCGGGGATG		CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.2215C>T	X.37:g.71839078G>A	ENSP00000362643:p.Arg739*	Somatic	82	0		WXS	Illumina GAIIx	Phase_I	122	8	NM_002637	B7ZL05|B7ZL07|Q2M3D7	Nonsense_Mutation	SNP	ENST00000373542.4	37	CCDS14421.1	.	.	.	.	.	.	.	.	.	.	g	37	6.585036	0.97684	.	.	ENSG00000067177	ENST00000373545;ENST00000373542;ENST00000541944;ENST00000339490;ENST00000373539	.	.	.	5.16	-0.274	0.12910	.	1.832770	0.02327	N	0.073597	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	-6.0E-4	4.6141	0.12417	0.4456:0.1567:0.3977:0.0	.	.	.	.	X	680;739;680;739;739	.	ENSP00000342469:R739X	R	-	1	2	PHKA1	71755803	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	0.299000	0.19138	-0.620000	0.05641	0.509000	0.49947	CGA	.		0.383	PHKA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058896.1		
PTCH2	8643	ucsc.edu;bcgsc.ca	37	1	45295102	45295102	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr1:45295102G>A	ENST00000372192.3	-	9	1317	c.1187C>T	c.(1186-1188)gCc>gTc	p.A396V	PTCH2_ENST00000447098.2_Missense_Mutation_p.A396V	NM_003738.4	NP_003729.3	Q9Y6C5	PTC2_HUMAN	patched 2	396	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				epidermis development (GO:0008544)|hair cycle (GO:0042633)|negative regulation of smoothened signaling pathway (GO:0045879)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|smoothened binding (GO:0005119)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	50	Acute lymphoblastic leukemia(166;0.155)					CACCACACGGGCAGCACTGAC	0.632									Basal Cell Nevus syndrome																												p.A396V													.	PTCH2	96	0			c.C1187T						.						109.0	111.0	110.0					1																	45295102		2203	4300	6503	SO:0001583	missense	8643	exon9	Familial Cancer Database	Gorlin syndrome, Gorlin-Golz syndrome, Naevoid Basal Cell Carcinoma syndrome, NBCCS	ACACGGGCAGCAC	AF091501	CCDS516.1, CCDS53312.1	1p34.1	2010-06-24	2010-06-24		ENSG00000117425	ENSG00000117425			9586	protein-coding gene	gene with protein product		603673	"""patched (Drosophila) homolog 2"", ""patched homolog 2 (Drosophila)"""			9811851, 9931336	Standard	NM_003738		Approved		uc010olf.2	Q9Y6C5	OTTHUMG00000008490	ENST00000372192.3:c.1187C>T	1.37:g.45295102G>A	ENSP00000361266:p.Ala396Val	Somatic	28	0		WXS	Illumina HiSeq		32	4	NM_001166292	O95341|O95856|Q53Z57|Q5QP87|Q6UX14	Missense_Mutation	SNP	ENST00000372192.3	37	CCDS516.1	.	.	.	.	.	.	.	.	.	.	G	10.90	1.479945	0.26598	.	.	ENSG00000117425	ENST00000447098;ENST00000372192	D;D	0.91351	-2.83;-2.83	4.54	2.5	0.30297	Sterol-sensing domain (1);	0.648557	0.14404	N	0.321710	T	0.61565	0.2357	N	0.00197	-1.87	0.28621	N	0.908193	B;B	0.02656	0.0;0.0	B;B	0.09377	0.001;0.004	T	0.61520	-0.7046	10	0.10902	T	0.67	-20.332	4.2965	0.10904	0.4633:0.0:0.5367:0.0	.	396;396	Q9Y6C5-2;Q9Y6C5	.;PTC2_HUMAN	V	396	ENSP00000389703:A396V;ENSP00000361266:A396V	ENSP00000361266:A396V	A	-	2	0	PTCH2	45067689	1.000000	0.71417	0.546000	0.28166	0.994000	0.84299	4.933000	0.63484	1.139000	0.42245	0.561000	0.74099	GCC	.		0.632	PTCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023428.4	NM_003738	
NUP210L	91181	ucsc.edu	37	1	153967582	153967582	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr1:153967582C>T	ENST00000368559.3	-	38	5532	c.5461G>A	c.(5461-5463)Gtg>Atg	p.V1821M	NUP210L_ENST00000271854.3_Missense_Mutation_p.V1669M|NUP210L_ENST00000368553.1_Missense_Mutation_p.V602M|U3_ENST00000516860.1_RNA	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	1821					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			GATGCCAGCACTGCAAAGAGG	0.408																																					p.V1821M													.	NUP210L	181	0			c.G5461A						.						78.0	80.0	79.0					1																	153967582		1928	4137	6065	SO:0001583	missense	91181	exon38			CCAGCACTGCAAA	AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.5461G>A	1.37:g.153967582C>T	ENSP00000357547:p.Val1821Met	Somatic	24	0		WXS	Illumina HiSeq		38	4	NM_207308	E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	ENST00000368559.3	37	CCDS41399.1	.	.	.	.	.	.	.	.	.	.	C	14.09	2.432387	0.43224	.	.	ENSG00000143552	ENST00000368559;ENST00000368553;ENST00000271854	T;T;T	0.28454	3.39;1.61;2.92	5.6	0.472	0.16758	.	0.444908	0.20918	N	0.083327	T	0.05777	0.0151	N	0.19112	0.55	0.09310	N	1	B;B	0.26120	0.007;0.142	B;B	0.24701	0.009;0.055	T	0.30446	-0.9978	10	0.49607	T	0.09	-39.9665	4.5977	0.12338	0.1419:0.5487:0.0:0.3094	.	1669;1821	E7EP56;Q5VU65	.;P210L_HUMAN	M	1821;602;1669	ENSP00000357547:V1821M;ENSP00000357541:V602M;ENSP00000271854:V1669M	ENSP00000271854:V1669M	V	-	1	0	NUP210L	152234206	0.004000	0.15560	0.000000	0.03702	0.942000	0.58702	0.131000	0.15870	-0.160000	0.11002	0.650000	0.86243	GTG	.		0.408	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087270.3	NM_207308	
HTR1F	3355	ucsc.edu;bcgsc.ca	37	3	88040342	88040342	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr3:88040342G>T	ENST00000319595.4	+	1	497	c.443G>T	c.(442-444)tGg>tTg	p.W148L		NM_000866.3	NP_000857.1	P30939	5HT1F_HUMAN	5-hydroxytryptamine (serotonin) receptor 1F, G protein-coupled	148					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(8;0.147)	Lung NSC(201;0.0283)		LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00664)	Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Ketamine(DB01221)|Methysergide(DB00247)|Mianserin(DB06148)|Naratriptan(DB00952)|Rizatriptan(DB00953)|Sumatriptan(DB00669)|Zolmitriptan(DB00315)	ACAATAGTTTGGATTATATCT	0.423																																					p.W148L													.	HTR1F	66	0			c.G443T						.						70.0	66.0	67.0					3																	88040342		2203	4300	6503	SO:0001583	missense	3355	exon2			TAGTTTGGATTAT	L05597	CCDS2920.1	3p12	2012-08-08	2012-02-03		ENSG00000179097	ENSG00000179097		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5292	protein-coding gene	gene with protein product		182134	"""5-hydroxytryptamine (serotonin) receptor 1F"""			8384716, 8380639	Standard	NM_000866		Approved	HTR1EL, 5-HT1F	uc003dqr.2	P30939	OTTHUMG00000159008	ENST00000319595.4:c.443G>T	3.37:g.88040342G>T	ENSP00000322924:p.Trp148Leu	Somatic	27	0		WXS	Illumina HiSeq		22	4	NM_000866		Missense_Mutation	SNP	ENST00000319595.4	37	CCDS2920.1	.	.	.	.	.	.	.	.	.	.	G	19.31	3.802626	0.70682	.	.	ENSG00000179097	ENST00000319595	D	0.88741	-2.42	5.01	5.01	0.66863	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.96549	0.8874	H	0.97516	4.02	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98005	1.0362	10	0.87932	D	0	.	15.8163	0.78604	0.0:0.0:1.0:0.0	.	148	P30939	5HT1F_HUMAN	L	148	ENSP00000322924:W148L	ENSP00000322924:W148L	W	+	2	0	HTR1F	88123032	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	9.823000	0.99369	2.340000	0.79590	0.305000	0.20034	TGG	.		0.423	HTR1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352890.1	NM_000866	
CATSPER1	117144	ucsc.edu;bcgsc.ca	37	11	65792768	65792768	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr11:65792768G>T	ENST00000312106.5	-	1	1220	c.1083C>A	c.(1081-1083)caC>caA	p.H361Q		NM_053054.3	NP_444282.3	Q8NEC5	CTSR1_HUMAN	cation channel, sperm associated 1	361					calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|fusion of sperm to egg plasma membrane (GO:0007342)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|regulation of calcium ion transport (GO:0051924)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|endometrium(9)|kidney(3)|large_intestine(6)|liver(3)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44						GAGTCATGCTGTGAGCCGAGC	0.572																																					p.H361Q													.	CATSPER1	101	0			c.C1083A						.						132.0	106.0	115.0					11																	65792768		2201	4296	6497	SO:0001583	missense	117144	exon1			CATGCTGTGAGCC	AF407333	CCDS8127.1	11q12.1	2011-07-05			ENSG00000175294	ENSG00000175294		"""Voltage-gated ion channels / Cation channels, sperm associated"""	17116	protein-coding gene	gene with protein product		606389				11675491, 11595941, 16382101	Standard	NM_053054		Approved	CATSPER	uc001ogt.3	Q8NEC5	OTTHUMG00000166668	ENST00000312106.5:c.1083C>A	11.37:g.65792768G>T	ENSP00000309052:p.His361Gln	Somatic	38	0		WXS	Illumina HiSeq		42	4	NM_053054	Q96P76	Missense_Mutation	SNP	ENST00000312106.5	37	CCDS8127.1	.	.	.	.	.	.	.	.	.	.	G	4.326	0.059900	0.08339	.	.	ENSG00000175294	ENST00000312106	D	0.96885	-4.16	1.53	1.53	0.23141	.	.	.	.	.	D	0.91446	0.7300	L	0.42245	1.32	0.09310	N	1	B	0.22346	0.068	B	0.18263	0.021	T	0.80054	-0.1543	9	0.10902	T	0.67	.	6.5148	0.22242	0.0:0.0:1.0:0.0	.	361	Q8NEC5	CTSR1_HUMAN	Q	361	ENSP00000309052:H361Q	ENSP00000309052:H361Q	H	-	3	2	CATSPER1	65549344	0.000000	0.05858	0.003000	0.11579	0.045000	0.14185	-2.030000	0.01429	1.197000	0.43143	0.460000	0.39030	CAC	.		0.572	CATSPER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391055.1	NM_053054	
LIMA1	51474	ucsc.edu;bcgsc.ca	37	12	50625494	50625494	+	Splice_Site	SNP	C	C	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr12:50625494C>T	ENST00000341247.4	-	3	269		c.e3-1		MIR1293_ENST00000408677.1_RNA|LIMA1_ENST00000394943.3_Splice_Site|RP3-405J10.4_ENST00000551284.1_RNA	NM_001113546.1|NM_016357.4	NP_001107018.1|NP_057441.1	Q9UHB6	LIMA1_HUMAN	LIM domain and actin binding 1						actin filament bundle assembly (GO:0051017)|negative regulation of actin filament depolymerization (GO:0030835)|ruffle organization (GO:0031529)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(2)	44						TTTCTGGTACCTTCAGAGAAG	0.368																																					.													.	LIMA1	67	0			c.120-1G>A						.						152.0	140.0	144.0					12																	50625494		2203	4300	6503	SO:0001630	splice_region_variant	51474	exon4			TGGTACCTTCAGA	AF198454	CCDS8802.1, CCDS44877.1, CCDS55826.1, CCDS58230.1	12q13.12	2006-04-12				ENSG00000050405			24636	protein-coding gene	gene with protein product	"""epithelial protein lost in neoplasm beta"""	608364				10806352, 10618726, 12566430	Standard	NM_016357		Approved	EPLIN	uc001rwk.4	Q9UHB6		ENST00000341247.4:c.120-1G>A	12.37:g.50625494C>T		Somatic	32	0		WXS	Illumina HiSeq		34	4	NM_001113546	B2RB09|Q2TAN7|Q59FE8|Q9BVF2|Q9H8J1|Q9HBN5|Q9NX96|Q9NXC3|Q9NXU6|Q9P0H8|Q9UHB5	Splice_Site	SNP	ENST00000341247.4	37	CCDS8802.1	.	.	.	.	.	.	.	.	.	.	C	18.38	3.611504	0.66558	.	.	ENSG00000050405	ENST00000394943;ENST00000341247;ENST00000551691;ENST00000550592	.	.	.	5.08	5.08	0.68730	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5828	0.76459	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LIMA1	48911761	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	4.039000	0.57325	2.532000	0.85374	0.591000	0.81541	.	.		0.368	LIMA1-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406235.2	NM_016357	Intron
ZNF106	64397	ucsc.edu;bcgsc.ca	37	15	42764468	42764468	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr15:42764468C>A	ENST00000565380.1	-	2	177	c.20G>T	c.(19-21)tGc>tTc	p.C7F				Q9H2Y7	ZN106_HUMAN	zinc finger protein 106	776					insulin receptor signaling pathway (GO:0008286)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										GCATAATATGCATTTTCGTTC	0.378																																					.													.	.	.	0			.						.																																			SO:0001583	missense	0	.			AATATGCATTTTC	AF205632	CCDS32208.1, CCDS61602.1, CCDS61603.1	15q15.1	2012-11-27	2012-11-27		ENSG00000103994	ENSG00000103994		"""Zinc fingers, C2H2-type"""	12886	protein-coding gene	gene with protein product	"""SH3-domain binding protein 3"""		"""zinc finger protein 106 homolog (mouse)"""	ZFP106			Standard	XM_005254591		Approved	ZNF474, SH3BP3	uc001zpw.3	Q9H2Y7	OTTHUMG00000173244	ENST00000565380.1:c.20G>T	15.37:g.42764468C>A	ENSP00000455674:p.Cys7Phe	Somatic	40	0		WXS	Illumina HiSeq		39	4	.	B4DZ40|E9PE29|Q6NSD9|Q6PEK1|Q86T43|Q86T45|Q86T50|Q86T58|Q86TA9|Q96M37|Q9H7B8	Missense_Mutation	SNP	ENST00000565380.1	37		.	.	.	.	.	.	.	.	.	.	C	18.48	3.632651	0.67015	.	.	ENSG00000103994	ENST00000434903	.	.	.	5.18	4.26	0.50523	.	.	.	.	.	T	0.39226	0.1070	.	.	.	0.80722	D	1	P	0.39624	0.681	B	0.27170	0.077	T	0.42327	-0.9458	7	0.87932	D	0	.	10.9456	0.47299	0.0:0.9111:0.0:0.0889	.	7	E9PE29	.	F	7	.	ENSP00000401297:C7F	C	-	2	0	ZFP106	40551760	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.518000	0.60510	1.312000	0.45043	0.591000	0.81541	TGC	.		0.378	ZNF106-012	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000429959.1	NM_022473	
CSPG4	1464	ucsc.edu	37	15	75981976	75981976	+	Missense_Mutation	SNP	C	C	T	rs200493777		TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr15:75981976C>T	ENST00000308508.5	-	3	1522	c.1430G>A	c.(1429-1431)cGc>cAc	p.R477H		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	477	Globular or compact configuration stabilized by disulfide bonds.|Neurite growth inhibition. {ECO:0000250}.			RH -> HY (in Ref. 1; CAA65529). {ECO:0000305}.	activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)	p.R477H(1)		breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						CTCGCCATGGCGTGCCCCTCG	0.637																																					p.R477H													CSPG4,NS,carcinoma,0,2	CSPG4	175	1	Substitution - Missense(1)	kidney(1)	c.G1430A						.						67.0	61.0	63.0					15																	75981976		2197	4291	6488	SO:0001583	missense	1464	exon3			CCATGGCGTGCCC	X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.1430G>A	15.37:g.75981976C>T	ENSP00000312506:p.Arg477His	Somatic	58	3		WXS	Illumina HiSeq		90	14	NM_001897	D3DW77|Q92675	Missense_Mutation	SNP	ENST00000308508.5	37	CCDS10284.1	.	.	.	.	.	.	.	.	.	.	.	9.517	1.107225	0.20714	.	.	ENSG00000173546	ENST00000308508	T	0.19532	2.14	5.12	4.19	0.49359	.	0.096704	0.44483	D	0.000447	T	0.17746	0.0426	L	0.57536	1.79	0.27465	N	0.953023	P	0.35628	0.513	B	0.27380	0.079	T	0.14783	-1.0460	10	0.41790	T	0.15	.	9.3594	0.38186	0.0:0.8315:0.0:0.1685	.	477	Q6UVK1	CSPG4_HUMAN	H	477	ENSP00000312506:R477H	ENSP00000312506:R477H	R	-	2	0	CSPG4	73769031	0.038000	0.19896	0.145000	0.22337	0.035000	0.12851	1.407000	0.34657	2.375000	0.81037	0.555000	0.69702	CGC	C|0.999;T|0.001		0.637	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286472.1	NM_001897	
FDXR	2232	ucsc.edu	37	17	72860068	72860068	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr17:72860068G>T	ENST00000293195.5	-	10	1202	c.1124C>A	c.(1123-1125)tCc>tAc	p.S375Y	FDXR_ENST00000420580.2_Missense_Mutation_p.S335Y|FDXR_ENST00000442102.2_Missense_Mutation_p.S418Y|FDXR_ENST00000582944.1_Missense_Mutation_p.S367Y|FDXR_ENST00000581530.1_Missense_Mutation_p.S381Y|FDXR_ENST00000544854.1_Missense_Mutation_p.S323Y|FDXR_ENST00000413947.2_Missense_Mutation_p.S406Y|FDXR_ENST00000455107.2_Missense_Mutation_p.P358T|FDXR_ENST00000581969.1_5'Flank|GRIN2C_ENST00000578159.1_5'Flank|FDXR_ENST00000583917.1_Missense_Mutation_p.S347Y	NM_001258014.1|NM_004110.3|NM_024417.2	NP_001244943.1|NP_004101.2|NP_077728.2	P22570	ADRO_HUMAN	ferredoxin reductase	375					cholesterol metabolic process (GO:0008203)|generation of precursor metabolites and energy (GO:0006091)|NADPH oxidation (GO:0070995)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ferredoxin-NADP+ reductase activity (GO:0004324)|NADPH binding (GO:0070402)|NADPH-adrenodoxin reductase activity (GO:0015039)			central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	16	all_lung(278;0.172)|Lung NSC(278;0.207)				Flavin adenine dinucleotide(DB03147)	CCCAAGCTTGGAGTCAAAGGG	0.602																																					p.S418Y													.	FDXR	68	0			c.C1253A						.						95.0	92.0	93.0					17																	72860068		2203	4300	6503	SO:0001583	missense	2232	exon10			AGCTTGGAGTCAA	J03826	CCDS11707.1, CCDS58591.1, CCDS58592.1, CCDS58593.1, CCDS58594.1, CCDS58595.1, CCDS58596.1	17q25.1	2013-06-18			ENSG00000161513	ENSG00000161513	1.18.1.6		3642	protein-coding gene	gene with protein product	"""adrenodoxin-NADP(+) reductase"", ""adrenodoxin reductase"""	103270		ADXR		2969697	Standard	NM_001258014		Approved		uc010wrl.2	P22570	OTTHUMG00000179026	ENST00000293195.5:c.1124C>A	17.37:g.72860068G>T	ENSP00000293195:p.Ser375Tyr	Somatic	20	0		WXS	Illumina HiSeq		35	4	NM_001258012	B4DDI7|B4DHX5|B4DQQ4|B4DX24|B7Z7G2|E7EQC1|Q13716|Q4PJI0|Q9BU12	Missense_Mutation	SNP	ENST00000293195.5	37	CCDS58593.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.37|12.37	1.918996|1.918996	0.33908|0.33908	.|.	.|.	ENSG00000161513|ENSG00000161513	ENST00000455107|ENST00000420580;ENST00000544854;ENST00000293195;ENST00000442102;ENST00000413947	T|T;T;T;T	0.16597|0.37058	2.33|1.22;1.22;1.91;1.91	4.29|4.29	3.31|3.31	0.37934|0.37934	.|NAD(P)-binding domain (1);	.|0.529435	.|0.21283	.|N	.|0.077117	T|T	0.29556|0.29556	0.0737|0.0737	L|L	0.37507|0.37507	1.11|1.11	0.23132|0.23132	N|N	0.998244|0.998244	.|B;B;B;B;B;B;B;B;B;B	.|0.34399	.|0.004;0.061;0.452;0.009;0.358;0.01;0.009;0.241;0.009;0.032	.|B;B;B;B;B;B;B;B;B;B	.|0.34722	.|0.005;0.062;0.142;0.005;0.188;0.017;0.017;0.098;0.017;0.037	T|T	0.16100|0.16100	-1.0414|-1.0414	7|10	0.13470|0.56958	T|D	0.59|0.05	0.0|0.0	11.8516|11.8516	0.52415|0.52415	0.0872:0.0:0.9128:0.0|0.0872:0.0:0.9128:0.0	.|.	.|335;418;406;373;323;406;375;367;375;381	.|B4DQQ4;B4DHX5;E7EQC1;B4DDI9;B7Z7G2;B4DDI7;Q6GSK2;B4DX24;P22570;P22570-2	.|.;.;.;.;.;.;.;.;ADRO_HUMAN;.	T|Y	358|335;323;381;418;406	ENSP00000390875:P358T|ENSP00000414172:S335Y;ENSP00000445432:S323Y;ENSP00000416515:S418Y;ENSP00000408595:S406Y	ENSP00000390875:P358T|ENSP00000293195:S381Y	P|S	-|-	1|2	0|0	FDXR|FDXR	70371663|70371663	1.000000|1.000000	0.71417|0.71417	0.980000|0.980000	0.43619|0.43619	0.882000|0.882000	0.50991|0.50991	2.356000|2.356000	0.44116|0.44116	0.807000|0.807000	0.34208|0.34208	-0.291000|-0.291000	0.09656|0.09656	CCA|TCC	.		0.602	FDXR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000444449.1	NM_004110	
BAIAP2	10458	ucsc.edu;bcgsc.ca	37	17	79090074	79090074	+	Missense_Mutation	SNP	A	A	G			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr17:79090074A>G	ENST00000321300.6	+	15	1721	c.1628A>G	c.(1627-1629)gAt>gGt	p.D543G		NM_001144888.1|NM_017451.2	NP_001138360.1|NP_059345.1	Q9UQB8	BAIP2_HUMAN	BAI1-associated protein 2	543					actin crosslink formation (GO:0051764)|actin filament bundle assembly (GO:0051017)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|filopodium assembly (GO:0046847)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of synaptic plasticity (GO:0048167)|response to bacterium (GO:0009617)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	cytoskeletal adaptor activity (GO:0008093)|identical protein binding (GO:0042802)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|skin(1)	18	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			GAGCACGGGGATGGGAGCGCC	0.637																																					p.D543G													.	BAIAP2	74	0			c.A1628G						.						52.0	59.0	57.0					17																	79090074		2202	4299	6501	SO:0001583	missense	10458	exon15			ACGGGGATGGGAG	AB015019	CCDS11775.1, CCDS11776.1, CCDS11777.1, CCDS45806.1	17q25.3	2014-09-11			ENSG00000175866				947	protein-coding gene	gene with protein product		605475				10343108	Standard	NM_017451		Approved	BAP2	uc002jzg.2	Q9UQB8	OTTHUMG00000177698	ENST00000321300.6:c.1628A>G	17.37:g.79090074A>G	ENSP00000316338:p.Asp543Gly	Somatic	34	0		WXS	Illumina HiSeq		42	4	NM_017451	O43858|Q53HB1|Q86WC1|Q8N5C0|Q96CR7|Q9UBR3|Q9UQ43	Missense_Mutation	SNP	ENST00000321300.6	37	CCDS11775.1	.	.	.	.	.	.	.	.	.	.	A	13.74	2.326017	0.41197	.	.	ENSG00000175866	ENST00000321300	T	0.26223	1.75	1.89	-3.79	0.04320	.	.	.	.	.	T	0.14700	0.0355	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.23833	-1.0177	9	0.87932	D	0	.	6.9421	0.24498	0.2205:0.6221:0.1574:0.0	.	543	Q9UQB8	BAIP2_HUMAN	G	543	ENSP00000316338:D543G	ENSP00000316338:D543G	D	+	2	0	BAIAP2	76704669	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-1.954000	0.01525	-1.296000	0.02353	0.260000	0.18958	GAT	.		0.637	BAIAP2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000438553.1		
ZNF362	149076	bcgsc.ca	37	1	33741758	33741758	+	Silent	SNP	C	C	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr1:33741758C>A	ENST00000539719.1	+	3	266	c.96C>A	c.(94-96)ccC>ccA	p.P32P	ZNF362_ENST00000373428.5_Silent_p.P32P	NM_152493.2	NP_689706.2	Q5T0B9	ZN362_HUMAN	zinc finger protein 362	32					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(1)|large_intestine(4)|lung(2)	10		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				CCACCATGCCCAGCCAGGTAA	0.662																																					p.P32P	Pancreas(162;1431 2676 35353 38425)												.	ZNF362	31	0			c.C96A						.						79.0	74.0	75.0					1																	33741758		2203	4300	6503	SO:0001819	synonymous_variant	149076	exon3			CATGCCCAGCCAG		CCDS377.1	1p35.1	2013-01-08			ENSG00000160094	ENSG00000160094		"""Zinc fingers, C2H2-type"""	18079	protein-coding gene	gene with protein product	"""rotund homolog (Drosophila)"""						Standard	NM_152493		Approved	FLJ25476, lin-29, RN	uc001bxc.1	Q5T0B9	OTTHUMG00000004124	ENST00000539719.1:c.96C>A	1.37:g.33741758C>A		Somatic	32	0		WXS	Illumina HiSeq	Phase_1	18	3	NM_152493	Q8WYU4	Silent	SNP	ENST00000539719.1	37	CCDS377.1																																																																																			.		0.662	ZNF362-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011857.2	NM_152493	
LPIN1	23175	bcgsc.ca	37	2	11913797	11913797	+	Silent	SNP	C	C	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr2:11913797C>T	ENST00000256720.2	+	5	741	c.648C>T	c.(646-648)aaC>aaT	p.N216N	LPIN1_ENST00000396098.1_Silent_p.N222N|LPIN1_ENST00000449576.2_Silent_p.N265N|LPIN1_ENST00000396099.1_Silent_p.N222N|LPIN1_ENST00000425416.2_Silent_p.N222N	NM_145693.2	NP_663731.1	Q14693	LPIN1_HUMAN	lipin 1	216					cellular lipid metabolic process (GO:0044255)|fatty acid catabolic process (GO:0009062)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)|triglyceride mobilization (GO:0006642)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(15)|liver(1)|lung(10)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	45	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)		CTGAGGAAAACCTCTCCCTGG	0.433																																					p.N265N													.	LPIN1	99	0			c.C795T						.						120.0	123.0	122.0					2																	11913797		2203	4300	6503	SO:0001819	synonymous_variant	23175	exon6			GGAAAACCTCTCC	D80010	CCDS1682.1, CCDS58699.1, CCDS58700.1, CCDS58701.1	2p25.1	2008-05-23			ENSG00000134324	ENSG00000134324			13345	protein-coding gene	gene with protein product		605518				11138012, 8724849, 16950137	Standard	NM_145693		Approved	KIAA0188	uc010yjm.3	Q14693	OTTHUMG00000119082	ENST00000256720.2:c.648C>T	2.37:g.11913797C>T		Somatic	46	0		WXS	Illumina HiSeq	Phase_1	53	4	NM_001261428	A8MU38|B4DET9|B4DGS4|B4DGZ6|B5MC18|B7Z858|D6W506|E7ESE7|F5GY24|Q53T25	Silent	SNP	ENST00000256720.2	37	CCDS1682.1																																																																																			.		0.433	LPIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239296.3	NM_145693	
PAX8	7849	bcgsc.ca	37	2	113993051	113993051	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr2:113993051C>T	ENST00000429538.3	-	9	1201	c.1007G>A	c.(1006-1008)gGc>gAc	p.G336D	AC016683.6_ENST00000437551.1_RNA|AC016683.6_ENST00000431844.2_RNA|AC016683.6_ENST00000436293.2_RNA|AC016683.6_ENST00000451179.1_RNA|AC016683.6_ENST00000445745.1_RNA|AC016683.6_ENST00000333145.5_RNA|PAX8_ENST00000263334.5_Missense_Mutation_p.A310T|AC016683.6_ENST00000422956.2_RNA|PAX8_ENST00000397647.3_Intron|PAX8_ENST00000263335.7_Intron|AC016683.6_ENST00000553869.2_RNA|PAX8_ENST00000348715.5_Missense_Mutation_p.A310T|AC016683.6_ENST00000556070.1_RNA|AC016683.6_ENST00000456685.1_RNA	NM_003466.3	NP_003457.1	Q06710	PAX8_HUMAN	paired box 8	336					anatomical structure morphogenesis (GO:0009653)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular response to gonadotropin stimulus (GO:0071371)|central nervous system development (GO:0007417)|inner ear morphogenesis (GO:0042472)|kidney development (GO:0001822)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|mesonephros development (GO:0001823)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric distal convoluted tubule development (GO:0072221)|metanephric epithelium development (GO:0072207)|metanephric nephron tubule formation (GO:0072289)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process involved in metanephric collecting duct development (GO:1900215)|negative regulation of apoptotic process involved in metanephric nephron tubule development (GO:1900218)|negative regulation of mesenchymal cell apoptotic process involved in metanephric nephron morphogenesis (GO:0072305)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|otic vesicle development (GO:0071599)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0072108)|positive regulation of metanephric DCT cell differentiation (GO:2000594)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric field specification (GO:0039003)|pronephros development (GO:0048793)|regulation of apoptotic process (GO:0042981)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of thyroid-stimulating hormone secretion (GO:2000612)|thyroid gland development (GO:0030878)|thyroid-stimulating hormone signaling pathway (GO:0038194)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid-stimulating hormone receptor activity (GO:0004996)|transcription regulatory region DNA binding (GO:0044212)		PAX8/PPARG(117)	breast(1)|endometrium(4)|kidney(2)|large_intestine(1)|liver(1)|lung(9)|ovary(1)|skin(1)	20						GACCCCGGAGCCGACTTGCTG	0.612			T	PPARG	follicular thyroid		Thyroid dysgenesis																														p.G336D	Ovarian(188;7 2067 9084 29802 29892)			Dom	yes		2	2q12-q14	7849	paired box gene 8	yes	E	.	PAX8	42	0			c.G1007A						.						38.0	46.0	44.0					2																	113993051		1906	4130	6036	SO:0001583	missense	7849	exon9			CCGGAGCCGACTT	X69699	CCDS42735.1, CCDS42736.1, CCDS46398.1, CCDS46399.1	2q13	2011-06-20	2007-07-12		ENSG00000125618	ENSG00000125618		"""Paired boxes"", ""Homeoboxes / PRD class"""	8622	protein-coding gene	gene with protein product		167415	"""paired box gene 8"""			8431641, 7981748	Standard	NM_003466		Approved		uc010yxt.2	Q06710	OTTHUMG00000128529	ENST00000429538.3:c.1007G>A	2.37:g.113993051C>T	ENSP00000395498:p.Gly336Asp	Somatic	42	0		WXS	Illumina HiSeq	Phase_1	49	4	NM_003466	Q09155|Q16337|Q16338|Q16339|Q4ZG35|Q96J49	Missense_Mutation	SNP	ENST00000429538.3	37	CCDS46398.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.73|18.73	3.686566|3.686566	0.68157|0.68157	.|.	.|.	ENSG00000125618|ENSG00000125618	ENST00000348715;ENST00000263334|ENST00000429538	D;D|D	0.97303|0.95756	-4.33;-4.33|-3.8	5.64|5.64	5.64|5.64	0.86602|0.86602	.|.	.|0.254268	.|0.38897	.|N	.|0.001538	D|D	0.92753|0.92753	0.7696|0.7696	.|.	.|.	.|.	0.25543|0.25543	N|N	0.987169|0.987169	P|P	0.36535|0.37914	0.557|0.611	B|B	0.33620|0.37198	0.167|0.243	D|D	0.86986|0.86986	0.2107|0.2107	8|9	0.22706|0.35671	T|T	0.39|0.21	.|.	17.1975|17.1975	0.86897|0.86897	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	310|336	Q06710-3|Q06710	.|PAX8_HUMAN	T|D	310|336	ENSP00000314750:A310T;ENSP00000263334:A310T|ENSP00000395498:G336D	ENSP00000263334:A310T|ENSP00000395498:G336D	A|G	-|-	1|2	0|0	PAX8|PAX8	113709522|113709522	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	3.394000|3.394000	0.52551|0.52551	2.655000|2.655000	0.90218|0.90218	0.655000|0.655000	0.94253|0.94253	GCT|GGC	.		0.612	PAX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250353.5		
POTEJ	653781	bcgsc.ca	37	2	131415051	131415051	+	Silent	SNP	C	C	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr2:131415051C>T	ENST00000409602.1	+	15	2770	c.2718C>T	c.(2716-2718)ccC>ccT	p.P906P		NM_001277083.1	NP_001264012.1	P0CG39	POTEJ_HUMAN	POTE ankyrin domain family, member J	906	Actin-like.				retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				lung(5)	5						ACGAGCTGCCCGATGGCCAGG	0.582																																					.													.	POTEJ	38	0			.						.																																			SO:0001819	synonymous_variant	653781	.			GCTGCCCGATGGC		CCDS59432.1	2q21.1	2013-01-10			ENSG00000222038	ENSG00000222038		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37094	protein-coding gene	gene with protein product						16364570	Standard	NM_001277083		Approved	POTE2beta	uc021vor.2	P0CG39	OTTHUMG00000154050	ENST00000409602.1:c.2718C>T	2.37:g.131415051C>T		Somatic	48	0		WXS	Illumina HiSeq	Phase_1	62	17	.		Silent	SNP	ENST00000409602.1	37	CCDS59432.1																																																																																			.		0.582	POTEJ-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000333665.1	XM_929706	
SEPSECS	51091	bcgsc.ca	37	4	25157778	25157778	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr4:25157778G>A	ENST00000382103.2	-	4	500	c.428C>T	c.(427-429)gCa>gTa	p.A143V	SEPSECS_ENST00000302922.3_Missense_Mutation_p.A64V	NM_016955.3	NP_058651.3	Q9HD40	SPCS_HUMAN	Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase	143					selenocysteine incorporation (GO:0001514)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	pyridoxal phosphate binding (GO:0030170)|transferase activity, transferring selenium-containing groups (GO:0016785)|tRNA binding (GO:0000049)			endometrium(1)|large_intestine(4)|lung(2)|stomach(1)	8		Breast(46;0.173)				CATACCAGTTGCCATAGGAAC	0.408																																					p.A143V													.	SEPSECS	55	0			c.C428T						.						125.0	116.0	120.0					4																	25157778		2203	4300	6503	SO:0001583	missense	51091	exon4			CCAGTTGCCATAG	AJ238617	CCDS3432.1, CCDS3432.2	4p15.2	2008-10-27			ENSG00000109618	ENSG00000109618			30605	protein-coding gene	gene with protein product	"""soluble liver antigen/liver pancreas antigen"""	613009				16230358, 10931155, 17142313, 17194211	Standard	NM_016955		Approved	SLA/LP, SLA	uc003grg.3	Q9HD40	OTTHUMG00000128563	ENST00000382103.2:c.428C>T	4.37:g.25157778G>A	ENSP00000371535:p.Ala143Val	Somatic	99	0		WXS	Illumina HiSeq	Phase_1	50	4	NM_016955	A8K8W1|Q0D2P3|Q17RT1|Q9NXZ5|Q9UGM9|Q9Y353	Missense_Mutation	SNP	ENST00000382103.2	37	CCDS3432.2	.	.	.	.	.	.	.	.	.	.	G	24.7	4.556742	0.86231	.	.	ENSG00000109618	ENST00000302922;ENST00000382103	D;D	0.85088	-1.94;-1.94	5.15	5.15	0.70609	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.93294	0.7863	M	0.86028	2.79	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.997	D	0.93919	0.7204	10	0.66056	D	0.02	-25.9025	18.9796	0.92751	0.0:0.0:1.0:0.0	.	142;83;143	Q9HD40-3;A1A4F3;Q9HD40	.;.;SPCS_HUMAN	V	64;143	ENSP00000305956:A64V;ENSP00000371535:A143V	ENSP00000305956:A64V	A	-	2	0	SEPSECS	24766876	1.000000	0.71417	1.000000	0.80357	0.589000	0.36550	9.365000	0.97139	2.573000	0.86826	0.455000	0.32223	GCA	.		0.408	SEPSECS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250414.2	NM_016955	
RP11-1023L17.1	0	bcgsc.ca	37	5	34192532	34192532	+	RNA	SNP	C	C	G			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr5:34192532C>G	ENST00000514048.1	-	0	0																											ACCCTCACGGCCTTCCCACAC	0.617																																					.													.	.	.	0			.						.																																					0	.			TCACGGCCTTCCC																													5.37:g.34192532C>G		Somatic	570	0		WXS	Illumina HiSeq	Phase_1	610	26	.		RNA	SNP	ENST00000514048.1	37																																																																																				.		0.617	RP11-1023L17.1-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000367775.1		
PAXIP1	22976	bcgsc.ca	37	7	154785435	154785435	+	Splice_Site	SNP	C	C	T	rs537365659		TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr7:154785435C>T	ENST00000404141.1	-	3	415		c.e3+1		PAXIP1_ENST00000397192.1_Splice_Site|PAXIP1_ENST00000473219.1_Splice_Site			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1						adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		AAAAAGGATACGGCAGAAGAG	0.378													C|||	1	0.000199681	0.0008	0.0	5008	,	,		14309	0.0		0.0	False		,,,				2504	0.0				.													.	PAXIP1	150	0			c.260+1G>A						.						85.0	76.0	79.0					7																	154785435		1811	4073	5884	SO:0001630	splice_region_variant	22976	exon4			AGGATACGGCAGA	U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.260+1G>A	7.37:g.154785435C>T		Somatic	54	0		WXS	Illumina HiSeq	Phase_1	59	5	NM_007349	O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	Splice_Site	SNP	ENST00000404141.1	37	CCDS47753.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.690036	0.88735	.	.	ENSG00000157212	ENST00000404141;ENST00000397192	.	.	.	5.09	5.09	0.68999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5377	0.91017	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PAXIP1	154416368	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.492000	0.81482	2.351000	0.79841	0.655000	0.94253	.	.		0.378	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322223.1	NM_007349	Intron
TEK	7010	bcgsc.ca	37	9	27212798	27212798	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr9:27212798C>T	ENST00000380036.4	+	17	3222	c.2780C>T	c.(2779-2781)gCc>gTc	p.A927V	TEK_ENST00000406359.4_Missense_Mutation_p.A884V|TEK_ENST00000519097.1_Missense_Mutation_p.A779V	NM_000459.3	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial	927	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|definitive hemopoiesis (GO:0060216)|endochondral ossification (GO:0001958)|endothelial cell proliferation (GO:0001935)|glomerulus vasculature development (GO:0072012)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of inflammatory response (GO:0050728)|organ regeneration (GO:0031100)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of endothelial cell apoptotic process (GO:2000351)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of vascular permeability (GO:0043114)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)|Tie signaling pathway (GO:0048014)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(3)|kidney(1)|lung(2)|ovary(3)|skin(3)	15		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)	Ponatinib(DB08901)|Regorafenib(DB08896)|Vandetanib(DB05294)	CCAGCATTTGCCATTGCCAAT	0.587																																					p.A927V													.	TEK	250	0			c.C2780T						.						99.0	78.0	85.0					9																	27212798		2203	4300	6503	SO:0001583	missense	7010	exon17			CATTTGCCATTGC	L06139	CCDS6519.1, CCDS75825.1	9p21	2013-02-11	2008-07-31		ENSG00000120156	ENSG00000120156		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11724	protein-coding gene	gene with protein product		600221	"""venous malformations, multiple cutaneous and mucosal"""	VMCM		1312667, 7833915	Standard	XM_005251561		Approved	TIE2, TIE-2, VMCM1, CD202b	uc003zqi.4	Q02763	OTTHUMG00000019712	ENST00000380036.4:c.2780C>T	9.37:g.27212798C>T	ENSP00000369375:p.Ala927Val	Somatic	27	0		WXS	Illumina HiSeq	Phase_1	17	3	NM_000459	A8K6W0|B4DH20|B4DHD3|D3DRK5|E7EWI2|Q5TCU2|Q8IV34	Missense_Mutation	SNP	ENST00000380036.4	37	CCDS6519.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.534602	0.85812	.	.	ENSG00000120156	ENST00000519097;ENST00000380036;ENST00000406359	T;T;T	0.68903	-0.36;-0.36;-0.36	5.46	5.46	0.80206	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.50627	D	0.000101	T	0.69708	0.3141	N	0.11000	0.08	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.81914	0.988;0.991;0.995	T	0.76361	-0.2987	10	0.72032	D	0.01	.	19.6629	0.95879	0.0:1.0:0.0:0.0	.	779;960;927	E7EWI2;Q59HG2;Q02763	.;.;TIE2_HUMAN	V	779;927;884	ENSP00000430686:A779V;ENSP00000369375:A927V;ENSP00000383977:A884V	ENSP00000369375:A927V	A	+	2	0	TEK	27202798	1.000000	0.71417	0.998000	0.56505	0.193000	0.23685	5.985000	0.70556	2.726000	0.93360	0.655000	0.94253	GCC	.		0.587	TEK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051965.3		
TAOK3	51347	bcgsc.ca	37	12	118619240	118619240	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr12:118619240G>A	ENST00000392533.3	-	15	1992	c.1502C>T	c.(1501-1503)gCc>gTc	p.A501V	TAOK3_ENST00000419821.2_Missense_Mutation_p.A501V|TAOK3_ENST00000537952.1_Missense_Mutation_p.A41V	NM_016281.3	NP_057365.3	Q9H2K8	TAOK3_HUMAN	TAO kinase 3	501					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|MAPK cascade (GO:0000165)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of JNK cascade (GO:0046329)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			central_nervous_system(1)|lung(5)|skin(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CGAGTTGTTGGCATGCGTCTC	0.562											OREG0022177	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A501V													.	TAOK3	151	0			c.C1502T						.						186.0	142.0	157.0					12																	118619240		2203	4300	6503	SO:0001583	missense	51347	exon15			TTGTTGGCATGCG	AF135158	CCDS9188.1	12q	2007-08-03				ENSG00000135090			18133	protein-coding gene	gene with protein product						10559204, 10924369	Standard	NM_016281		Approved	JIK, DPK, MAP3K18	uc001twy.4	Q9H2K8		ENST00000392533.3:c.1502C>T	12.37:g.118619240G>A	ENSP00000376317:p.Ala501Val	Somatic	49	0	1489	WXS	Illumina HiSeq	Phase_1	20	3	NM_016281	Q658N1|Q8IUM4|Q9HC79|Q9NZM9|Q9UHG7	Missense_Mutation	SNP	ENST00000392533.3	37	CCDS9188.1	.	.	.	.	.	.	.	.	.	.	G	12.21	1.868872	0.32977	.	.	ENSG00000135090	ENST00000419821;ENST00000392533;ENST00000537952;ENST00000359811	T;T;T	0.25912	1.77;1.77;1.77	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.23289	0.0563	L	0.46157	1.445	0.80722	D	1	B	0.20887	0.049	B	0.16722	0.016	T	0.12293	-1.0553	10	0.02654	T	1	.	19.4372	0.94801	0.0:0.0:1.0:0.0	.	501	Q9H2K8	TAOK3_HUMAN	V	501;501;41;121	ENSP00000416374:A501V;ENSP00000376317:A501V;ENSP00000443834:A41V	ENSP00000352863:A121V	A	-	2	0	TAOK3	117103623	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.657000	0.98554	2.827000	0.97445	0.650000	0.86243	GCC	.		0.562	TAOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401456.2	NM_016281	
AQR	9716	bcgsc.ca	37	15	35185921	35185921	+	Silent	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr15:35185921G>T	ENST00000156471.5	-	23	2739	c.2514C>A	c.(2512-2514)tcC>tcA	p.S838S		NM_014691.2	NP_055506.1	O60306	AQR_HUMAN	aquarius intron-binding spliceosomal factor	838					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(10)|lung(18)|ovary(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	57		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		GGTAGATGTTGGATATGATCT	0.428																																					p.S838S													.	AQR	139	0			c.C2514A						.						280.0	281.0	281.0					15																	35185921		1983	4163	6146	SO:0001819	synonymous_variant	9716	exon23			GATGTTGGATATG	AB011132	CCDS42013.1	15q13	2013-09-12	2013-09-12			ENSG00000021776			29513	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 164"""	610548	"""aquarius homolog (mouse)"""			9626505, 16949364	Standard	NM_014691		Approved	KIAA0560, fSAP164, IBP160	uc001ziv.3	O60306		ENST00000156471.5:c.2514C>A	15.37:g.35185921G>T		Somatic	72	0		WXS	Illumina HiSeq	Phase_1	78	4	NM_014691	A0JP17|A5YKK3|Q2YDX9|Q6IRU8|Q6PIC8	Silent	SNP	ENST00000156471.5	37	CCDS42013.1																																																																																			.		0.428	AQR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417526.2	NM_014691	
VWA9	81556	bcgsc.ca	37	15	65877170	65877170	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr15:65877170G>T	ENST00000395644.4	-	10	1512	c.1177C>A	c.(1177-1179)Ccc>Acc	p.P393T	VWA9_ENST00000569180.1_5'UTR|VWA9_ENST00000569491.1_Missense_Mutation_p.P343T|VWA9_ENST00000420799.2_Missense_Mutation_p.P336T|VWA9_ENST00000442903.3_Missense_Mutation_p.P357T|VWA9_ENST00000431261.2_Missense_Mutation_p.P314T|VWA9_ENST00000313182.2_Missense_Mutation_p.P393T|VWA9_ENST00000567744.1_Missense_Mutation_p.P429T			Q96SY0	VWA9_HUMAN	von Willebrand factor A domain containing 9	393																	TTGTTTTTGGGCTGCAGGGGG	0.438																																					p.P375T													.	VWA9	15	0			c.C1123A						.						162.0	142.0	148.0					15																	65877170		2201	4299	6500	SO:0001583	missense	81556	exon10			TTTTGGGCTGCAG	AL136662	CCDS55969.1, CCDS45283.1	15q22.31	2012-09-27	2012-09-27	2012-09-27	ENSG00000138614	ENSG00000138614			25372	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 44"""	C15orf44		11230166	Standard	NM_001136043		Approved	DKFZP564O1664	uc010uja.2	Q96SY0	OTTHUMG00000133159	ENST00000395644.4:c.1177C>A	15.37:g.65877170G>T	ENSP00000379006:p.Pro393Thr	Somatic	72	1		WXS	Illumina HiSeq	Phase_1	75	5	NM_001207058	B4DDI6|B4DVD5|Q49AH8|Q96HX5|Q9H0S5	Missense_Mutation	SNP	ENST00000395644.4	37		.	.	.	.	.	.	.	.	.	.	G	33	5.258511	0.95368	.	.	ENSG00000138614	ENST00000395644;ENST00000313182;ENST00000431261;ENST00000420799;ENST00000442903	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.75170	0.3813	L	0.49126	1.545	0.80722	D	1	D;P;P;P	0.76494	0.999;0.773;0.787;0.647	D;B;B;B	0.66979	0.948;0.389;0.322;0.203	T	0.68337	-0.5435	9	0.31617	T	0.26	-21.1935	20.8794	0.99867	0.0:0.0:1.0:0.0	.	343;357;429;393	B4DWZ3;B4DVT3;B4DJL6;Q96SY0	.;.;.;CO044_HUMAN	T	393;393;314;336;357	.	ENSP00000326379:P393T	P	-	1	0	C15orf44	63664223	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.731000	0.98807	2.941000	0.99782	0.655000	0.94253	CCC	.		0.438	VWA9-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420604.3	NM_030800	
CSPG4	1464	bcgsc.ca	37	15	75968449	75968449	+	Silent	SNP	G	G	T	rs367613285		TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr15:75968449G>T	ENST00000308508.5	-	10	6503	c.6411C>A	c.(6409-6411)ccC>ccA	p.P2137P	AC105020.1_ENST00000435356.1_5'Flank|CTD-2026K11.1_ENST00000569467.1_RNA	NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	2137	Cysteine-containing.|Neurite growth inhibition. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						TGTCACCTGCGGGGCCGGGGG	0.697																																					p.P2137P													.	CSPG4	175	0			c.C6411A						.						11.0	11.0	11.0					15																	75968449		2109	4156	6265	SO:0001819	synonymous_variant	1464	exon10			ACCTGCGGGGCCG	X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.6411C>A	15.37:g.75968449G>T		Somatic	41	0		WXS	Illumina HiSeq	Phase_1	45	4	NM_001897	D3DW77|Q92675	Silent	SNP	ENST00000308508.5	37	CCDS10284.1																																																																																			.		0.697	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286472.1	NM_001897	
DNM1P47	100216544	bcgsc.ca	37	15	102299919	102299919	+	RNA	SNP	C	C	G			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr15:102299919C>G	ENST00000561463.1	+	0	7965									DNM1 pseudogene 47																		GTGGAGGCGTCGGCAGAGCAG	0.597																																					.													.	.	.	0			.						.																																					0	.			AGGCGTCGGCAGA	AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102299919C>G		Somatic	103	1		WXS	Illumina HiSeq	Phase_1	127	12	.		RNA	SNP	ENST00000561463.1	37																																																																																				.		0.597	DNM1P47-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417589.1	NG_009149	
TMEM256	254863	bcgsc.ca	37	17	7307394	7307394	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr17:7307394G>T	ENST00000302422.3	-	1	62	c.10C>A	c.(10-12)Cca>Aca	p.P4T	TMEM256-PLSCR3_ENST00000535512.1_5'UTR|C17orf61-PLSCR3_ENST00000573331.1_Missense_Mutation_p.P4T|NLGN2_ENST00000575301.1_5'Flank	NM_152766.3	NP_689979.1	Q8N2U0	TM256_HUMAN	transmembrane protein 256	4						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											GCTGCAGCTGGCCCGGCCATA	0.667																																					p.P4T													.	.	.	0			c.C10A						.						10.0	13.0	12.0					17																	7307394		2170	4265	6435	SO:0001583	missense	254863	exon1			CAGCTGGCCCGGC	BC030270	CCDS11102.1	17p13.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000205544	ENSG00000205544			28618	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 61"""	C17orf61		12477932	Standard	NM_152766		Approved	MGC40107	uc002ggs.3	Q8N2U0	OTTHUMG00000132900	ENST00000302422.3:c.10C>A	17.37:g.7307394G>T	ENSP00000301939:p.Pro4Thr	Somatic	76	1		WXS	Illumina HiSeq	Phase_1	69	4	NM_152766		Missense_Mutation	SNP	ENST00000302422.3	37	CCDS11102.1	.	.	.	.	.	.	.	.	.	.	G	6.110	0.388470	0.11581	.	.	ENSG00000205544	ENST00000302422	.	.	.	4.97	-2.63	0.06133	.	2.559450	0.01387	N	0.013136	T	0.14874	0.0359	N	0.03608	-0.345	0.09310	N	1	B	0.13594	0.008	B	0.09377	0.004	T	0.13575	-1.0504	9	0.13108	T	0.6	19.8283	5.1458	0.14983	0.337:0.2688:0.3942:0.0	.	4	Q8N2U0	CQ061_HUMAN	T	4	.	ENSP00000301939:P4T	P	-	1	0	C17orf61	7248118	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.078000	0.14761	-0.286000	0.09076	0.561000	0.74099	CCA	.		0.667	TMEM256-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256404.1	NM_152766	
RNASEH1	246243	bcgsc.ca	37	17	16587076	16587076	+	IGR	SNP	C	C	A			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr17:16587076C>A								RP11-92B11.4 (28975 upstream) : CCDC144A (6469 downstream)																							GAGATGAAAGCGCAGAGCCAT	0.547																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	390766	.			TGAAAGCGCAGAG																													17.37:g.16587076C>A		Somatic	65	0		WXS	Illumina HiSeq	Phase_1	59	4	.		RNA	SNP		37																																																																																				.	0	0.547								
DOT1L	84444	bcgsc.ca	37	19	2189743	2189743	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr19:2189743G>T	ENST00000398665.3	+	4	249	c.213G>T	c.(211-213)atG>atT	p.M71I		NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	71	DOT1. {ECO:0000255|PROSITE- ProRule:PRU00902}.				histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCGAGAGCATGCAGAGGCTCT	0.622																																					p.M71I													.	DOT1L	205	0			c.G213T						.						62.0	70.0	67.0					19																	2189743		2125	4236	6361	SO:0001583	missense	84444	exon4			GAGCATGCAGAGG	AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.213G>T	19.37:g.2189743G>T	ENSP00000381657:p.Met71Ile	Somatic	26	0		WXS	Illumina HiSeq	Phase_1	14	3	NM_032482	O60379|Q96JL1	Missense_Mutation	SNP	ENST00000398665.3	37	CCDS42460.1	.	.	.	.	.	.	.	.	.	.	G	18.72	3.685321	0.68157	.	.	ENSG00000104885	ENST00000398665;ENST00000221482;ENST00000452696	T;T	0.20200	2.09;2.09	3.59	3.59	0.41128	.	0.000000	0.85682	D	0.000000	T	0.41305	0.1153	L	0.60455	1.87	0.58432	D	0.999998	D	0.54047	0.964	D	0.69307	0.963	T	0.41215	-0.9521	10	0.87932	D	0	-29.9156	14.7259	0.69343	0.0:0.0:1.0:0.0	.	71	Q8TEK3-2	.	I	71	ENSP00000381657:M71I;ENSP00000404284:M71I	ENSP00000221482:M71I	M	+	3	0	DOT1L	2140743	1.000000	0.71417	1.000000	0.80357	0.593000	0.36681	8.655000	0.91098	1.989000	0.58080	0.313000	0.20887	ATG	.		0.622	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318066.1	NM_032482	
EIF4G1	1981	hgsc.bcm.edu	37	3	184039769	184039770	+	Missense_Mutation	DNP	GA	GA	AG	rs111659103|rs398102387		TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	GA	GA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr3:184039769_184039770GA>AG	ENST00000346169.2	+	10	1668_1669	c.1397_1398GA>AG	c.(1396-1398)gGA>gAG	p.G466E	EIF4G1_ENST00000350481.5_Missense_Mutation_p.G302E|EIF4G1_ENST00000411531.1_Missense_Mutation_p.G426E|EIF4G1_ENST00000382330.3_Missense_Mutation_p.G473E|EIF2B5_ENST00000444495.1_Intron|EIF4G1_ENST00000392537.2_Missense_Mutation_p.G379E|EIF4G1_ENST00000352767.3_Missense_Mutation_p.G473E|EIF4G1_ENST00000441154.1_Missense_Mutation_p.G302E|EIF4G1_ENST00000434061.2_Missense_Mutation_p.G270E|EIF4G1_ENST00000342981.4_Missense_Mutation_p.G466E|EIF4G1_ENST00000319274.6_Missense_Mutation_p.G466E|EIF4G1_ENST00000435046.2_Missense_Mutation_p.G270E|EIF4G1_ENST00000424196.1_Missense_Mutation_p.G473E|EIF4G1_ENST00000414031.1_Missense_Mutation_p.G426E|EIF4G1_ENST00000427845.1_Missense_Mutation_p.G379E	NM_198241.2	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4 gamma, 1	466	Poly-Glu.		Missing. {ECO:0000269|PubMed:21907011}.		cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|lung development (GO:0030324)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|response to ethanol (GO:0045471)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(5)|large_intestine(14)|lung(41)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	75	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			gaggaagaaggagaagcaggag	0.55																																					p.G473E		.											.	.	.	0			c.A1419G						.																																			SO:0001583	missense	1981	exon11			AGAAGGAGAAGCA	D12686	CCDS3259.1, CCDS3260.1, CCDS3261.1, CCDS46970.1, CCDS46970.2, CCDS54687.1, CCDS54688.1	3q27.1	2013-09-19			ENSG00000114867	ENSG00000114867		"""Parkinson disease"""	3296	protein-coding gene	gene with protein product		600495		EIF4G, EIF4F		1429670, 9372926, 21907011	Standard	NM_182917		Approved	p220, PARK18	uc010hxy.3	Q04637	OTTHUMG00000156784	Exception_encountered	3.37:g.184039769_184039770delinsAG	ENSP00000316879:p.Gly466Glu	Somatic	39	0		WXS	Illumina HiSeq	.	60	7	NM_001194946	D3DNT2|D3DNT4|D3DNT5|E9PFM1|G5E9S1|O43177|O95066|Q5HYG0|Q6ZN21|Q8N102	Missense_Mutation	DNP	ENST00000346169.2	37	CCDS3259.1																																																																																			.		0.550	EIF4G1-007	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000345733.1	NM_182917	
DPY19L2P2	349152	broad.mit.edu	37	7	102825946	102825947	+	RNA	DNP	CA	CA	TG			TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	CA	CA						Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr7:102825946_102825947CA>TG	ENST00000312132.4	-	0	3750_3751							Q6ZN68	D19P2_HUMAN	DPY19L2 pseudogene 2							integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)										GACAGCTTGACACTTGCCATTG	0.376																																					.													.	.	.	0			.						.																																					0	.			CTTGACACTTGCC	AL834175		7q22.1	2013-09-12	2013-09-12		ENSG00000170629	ENSG00000170629			21764	pseudogene	pseudogene			"""dpy-19-like 2 pseudogene 2 (C. elegans)"""				Standard	NR_027768		Approved	DKFZp434E092, FLJ36166	uc003vbh.4	Q6ZN68	OTTHUMG00000157200	Exception_encountered	7.37:g.102825946_102825947delinsTG		Somatic	44	0		WXS	Illumina GAIIx	Phase_I	44	5	.	Q8N9V4|Q8ND62	RNA	DNP	ENST00000312132.4	37																																																																																				.		0.376	DPY19L2P2-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000347877.1	NM_182634	
FOLR3	2352	hgsc.bcm.edu	37	11	71850156	71850156	+	Missense_Mutation	SNP	C	C	A	rs139130389	byFrequency	TCGA-W5-AA2X-01A-11D-A417-09	TCGA-W5-AA2X-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afef815a-3e3b-497a-acf5-e9713ec6617f	ba2e4258-c494-4727-b7c4-7d24a61ce6ce	g.chr11:71850156C>A	ENST00000445078.2	+	3	511	c.440C>A	c.(439-441)tCt>tAt	p.S147Y	FOLR3_ENST00000456237.1_Missense_Mutation_p.S149Y|FOLR3_ENST00000442948.2_Splice_Site_p.L106L			P41439	FOLR3_HUMAN	folate receptor 3 (gamma)	105					folic acid transport (GO:0015884)	extracellular region (GO:0005576)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)	folic acid binding (GO:0005542)			large_intestine(3)|lung(8)|prostate(2)	13					Folic Acid(DB00158)	ACAGCTGTCTCTGAGTGCTCA	0.567																																					.		.											.	.	.	0			.						.						40.0	46.0	44.0					11																	71850156		2200	4293	6493	SO:0001583	missense	2352	p.S149Y			CTGTCTCTGAGTG	U08471	CCDS73344.1	11q13.4	2012-11-14			ENSG00000110203	ENSG00000110203			3795	protein-coding gene	gene with protein product		602469				8110752	Standard	NM_000804		Approved	FR-G	uc001orx.1	P41439	OTTHUMG00000167870	ENST00000445078.2:c.440C>A	11.37:g.71850156C>A	ENSP00000390338:p.Ser147Tyr	Somatic	64	0		WXS	Illumina HiSeq	Phase_I	110	4	.	J3KQ90|Q05C14	Missense_Mutation	SNP	ENST00000445078.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|N	0.001|0.001	-23.225135|-23.225135	0.00000|0.00000	.|.	.|.	ENSG00000110203|ENSG00000110203	ENST00000442948|ENST00000445078;ENST00000456237	.|T;T	.|0.73575	.|-0.76;-0.76	3.21|3.21	-0.263|-0.263	0.12954|0.12954	.|.	.|.	.|.	.|.	.|.	.|T	.|0.49626	.|0.1568	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|B	.|0.16802	.|0.019	.|B	.|0.15484	.|0.013	.|T	.|0.45308	.|-0.9270	.|8	.|0.02654	.|T	.|1	.|.	12.496|12.496	0.55929|0.55929	0.0:0.5007:0.4993:0.0|0.0:0.5007:0.4993:0.0	.|.	.|149	.|E9PGT2	.|.	.|Y	-1|147;149	.|ENSP00000390338:S147Y;ENSP00000399235:S149Y	.|ENSP00000390338:S147Y	.|S	+|+	.|2	.|0	FOLR3|FOLR3	71527804|71527804	0.100000|0.100000	0.21855|0.21855	0.962000|0.962000	0.40283|0.40283	0.074000|0.074000	0.17049|0.17049	-0.481000|-0.481000	0.06552|0.06552	-0.155000|-0.155000	0.11098|0.11098	-0.282000|-0.282000	0.10007|0.10007	.|TCT	.		0.567	FOLR3-001	NOVEL	upstream_ATG|basic	protein_coding	protein_coding	OTTHUMT00000396739.1	NM_000804	
