#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVarCov_SOL	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SYCE1	93426	hgsc.bcm.edu	37	10	135371375	135371375	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr10:135371375C>T	ENST00000343131.5	-	6	471	c.367G>A	c.(367-369)Gca>Aca	p.A123T	SYCE1_ENST00000432597.2_Missense_Mutation_p.A87T|SPRN_ENST00000541506.1_Intron|SYCE1_ENST00000368517.3_Missense_Mutation_p.A87T	NM_001143764.1	NP_001137236.1	Q8N0S2	SYCE1_HUMAN	synaptonemal complex central element protein 1	123					synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				breast(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|stomach(3)|urinary_tract(1)	19		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		TACCTGTGTGCCTCACTTTCC	0.512																																					p.A123T		.											SYCE1_ENST00000343131,NS,malignant_melanoma,0,2	SYCE1_ENST00000343131	0	0			c.G367A						.						127.0	93.0	104.0					10																	135371375		2203	4300	6503	SO:0001583	missense	93426	exon6			TGTGTGCCTCACT	AY027808	CCDS7687.1, CCDS44500.1, CCDS44501.1	10q26.3	2009-03-12	2005-09-27	2005-09-27	ENSG00000171772	ENSG00000171772			28852	protein-coding gene	gene with protein product	"""cancer/testis antigen 76"""	611486	"""chromosome 10 open reading frame 94"""	C10orf94		11829491	Standard	NM_130784		Approved	bA108K14.6, CT76	uc001lno.2	Q8N0S2	OTTHUMG00000019321	ENST00000343131.5:c.367G>A	10.37:g.135371375C>T	ENSP00000341282:p.Ala123Thr	Somatic	48	0		WXS	Illumina HiSeq	.	43	2	NM_001143763	B2RC80|Q9BWU3|Q9BWU4	Missense_Mutation	SNP	ENST00000343131.5	37	CCDS44501.1	.	.	.	.	.	.	.	.	.	.	C	19.84	3.901467	0.72754	.	.	ENSG00000171772	ENST00000303903;ENST00000432597;ENST00000368517;ENST00000343131	T;T;T;T	0.34275	1.37;3.19;3.19;3.19	4.44	3.52	0.40303	.	0.096894	0.45361	D	0.000377	T	0.44644	0.1303	L	0.40543	1.245	0.29186	N	0.876154	D;D	0.76494	0.999;0.999	D;D	0.69479	0.964;0.964	T	0.26326	-1.0106	10	0.30078	T	0.28	-12.3155	9.8501	0.41051	0.2041:0.7959:0.0:0.0	.	123;87	Q8N0S2;Q8N0S2-2	SYCE1_HUMAN;.	T	123;87;87;123	ENSP00000303978:A123T;ENSP00000411779:A87T;ENSP00000357503:A87T;ENSP00000341282:A123T	ENSP00000303978:A123T	A	-	1	0	SYCE1	135221365	1.000000	0.71417	0.999000	0.59377	0.938000	0.57974	0.863000	0.27913	1.442000	0.47568	0.655000	0.94253	GCA	.		0.512	SYCE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_201564	
ACTG1	71	hgsc.bcm.edu	37	17	79478576	79478576	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr17:79478576C>T	ENST00000575842.1	-	3	866	c.440G>A	c.(439-441)cGc>cAc	p.R147H	ACTG1_ENST00000573283.1_Missense_Mutation_p.R147H|RP13-766D20.2_ENST00000430912.1_RNA|ACTG1_ENST00000331925.2_Missense_Mutation_p.R147H|AC139149.1_ENST00000584254.1_RNA|ACTG1_ENST00000575087.1_Missense_Mutation_p.R147H			P63261	ACTG_HUMAN	actin, gamma 1	147					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|lung(8)|ovary(2)|prostate(5)|urinary_tract(1)	29	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0547)			GCCAGTGGTGCGCCCAGAGGC	0.627																																					p.R147H		.											ACTG1,colon,carcinoma,0,1	ACTG1	0	0			c.G440A						.						69.0	75.0	73.0					17																	79478576		2203	4300	6503	SO:0001583	missense	71	exon4			GTGGTGCGCCCAG		CCDS11782.1	17q25	2010-04-23	2004-05-19		ENSG00000184009	ENSG00000184009			144	protein-coding gene	gene with protein product		102560	"""deafness, autosomal dominant 20; deafness, autosomal dominant 26"""	ACTG, DFNA20, DFNA26		14684684	Standard	NM_001614		Approved		uc002kal.2	P63261		ENST00000575842.1:c.440G>A	17.37:g.79478576C>T	ENSP00000458162:p.Arg147His	Somatic	35	0		WXS	Illumina HiSeq	.	27	2	NM_001614	A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Missense_Mutation	SNP	ENST00000575842.1	37	CCDS11782.1	.	.	.	.	.	.	.	.	.	.	c	13.30	2.195859	0.38806	.	.	ENSG00000184009	ENST00000331925	D	0.98455	-4.94	4.6	1.45	0.22620	.	0.000000	0.64402	D	0.000001	D	0.98333	0.9447	H	0.97465	4.01	0.47778	D	0.999513	P	0.49090	0.919	P	0.46076	0.503	D	0.96416	0.9308	10	0.87932	D	0	.	6.6797	0.23113	0.0:0.6841:0.1472:0.1687	.	147	P63261	ACTG_HUMAN	H	147	ENSP00000331514:R147H	ENSP00000331514:R147H	R	-	2	0	ACTG1	77093171	1.000000	0.71417	0.516000	0.27786	0.442000	0.32017	7.475000	0.81041	0.060000	0.16281	0.558000	0.71614	CGC	.		0.627	ACTG1-012	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439935.2	NM_001614	
ZNF391	346157	hgsc.bcm.edu	37	6	27368676	27368676	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr6:27368676G>T	ENST00000244576.4	+	3	1072	c.527G>T	c.(526-528)cGg>cTg	p.R176L		NM_001076781.1	NP_001070249.1	Q9UJN7	ZN391_HUMAN	zinc finger protein 391	176					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(6)|lung(7)|pancreas(2)|skin(3)|upper_aerodigestive_tract(1)	21						GCTTTTAGCCGGAGCACACAT	0.403																																					p.R176L		.											ZNF391_ENST00000244576,colon,carcinoma,0,2	ZNF391_ENST00000244576	0	0			c.G527T						.						72.0	79.0	77.0					6																	27368676		2199	4298	6497	SO:0001583	missense	346157	exon3			TTAGCCGGAGCAC	BC132797	CCDS43429.1	6p21	2013-01-08			ENSG00000124613	ENSG00000124613		"""Zinc fingers, C2H2-type"""	18779	protein-coding gene	gene with protein product							Standard	NM_001076781		Approved	dJ153G14.3	uc003njf.1	Q9UJN7	OTTHUMG00000014477	ENST00000244576.4:c.527G>T	6.37:g.27368676G>T	ENSP00000244576:p.Arg176Leu	Somatic	43	0		WXS	Illumina HiSeq	.	31	3	NM_001076781	B4DH77	Missense_Mutation	SNP	ENST00000244576.4	37	CCDS43429.1	.	.	.	.	.	.	.	.	.	.	G	11.46	1.646847	0.29246	.	.	ENSG00000124613	ENST00000244576	T	0.19669	2.13	4.01	-0.954	0.10359	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03305	0.0096	N	0.16567	0.415	0.09310	N	1	P	0.35612	0.512	B	0.32864	0.154	T	0.36335	-0.9752	9	0.56958	D	0.05	.	3.2057	0.06665	0.5304:0.0:0.2656:0.204	.	176	Q9UJN7	ZN391_HUMAN	L	176	ENSP00000244576:R176L	ENSP00000244576:R176L	R	+	2	0	ZNF391	27476655	0.000000	0.05858	0.008000	0.14137	0.798000	0.45092	-0.677000	0.05215	0.186000	0.20125	0.563000	0.77884	CGG	.		0.403	ZNF391-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040145.2	NM_001076781	
SELL	6402	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	169670779	169670779	+	Missense_Mutation	SNP	A	A	G			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr1:169670779A>G	ENST00000236147.4	-	7	1202	c.1042T>C	c.(1042-1044)Ttc>Ctc	p.F348L	C1orf112_ENST00000498289.1_Intron|SELL_ENST00000463108.1_5'UTR	NM_000655.4	NP_000646.2	P14151	LYAM1_HUMAN	selectin L	335					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|regulation of immune response (GO:0050776)|response to ATP (GO:0033198)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|protease binding (GO:0002020)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(3)|lung(5)|urinary_tract(1)	15	all_hematologic(923;0.208)					ACTGGAATGAAGAGGGGGTTA	0.393																																					p.F348L		.											.	.	.	0			c.T1042C						.						47.0	44.0	45.0					1																	169670779		1855	4096	5951	SO:0001583	missense	6402	exon7			GAATGAAGAGGGG	M25280	CCDS53427.1	1q23-q25	2008-07-31	2008-07-31		ENSG00000188404	ENSG00000188404		"""CD molecules"""	10720	protein-coding gene	gene with protein product		153240	"""lymphocyte adhesion molecule 1"""	LYAM1, LNHR		2664786, 1375831	Standard	NR_029467		Approved	LSEL, LAM1, LAM-1, hLHRc, Leu-8, Lyam-1, PLNHR, CD62L	uc001ggk.3	P14151	OTTHUMG00000034809	ENST00000236147.4:c.1042T>C	1.37:g.169670779A>G	ENSP00000236147:p.Phe348Leu	Somatic	58	0		WXS	Illumina HiSeq	.	68	9	NM_000655	B2R6Q8|P15023|Q9UJ43	Missense_Mutation	SNP	ENST00000236147.4	37	CCDS53427.1	.	.	.	.	.	.	.	.	.	.	A	15.08	2.726068	0.48833	.	.	ENSG00000188404	ENST00000236147	T	0.12879	2.64	5.79	4.67	0.58626	.	0.233907	0.30620	N	0.009227	T	0.05227	0.0139	L	0.49640	1.575	0.36082	D	0.842861	B;B	0.15930	0.015;0.015	B;B	0.15052	0.012;0.012	T	0.14587	-1.0467	10	0.32370	T	0.25	-18.0116	8.5476	0.33430	0.9134:0.0:0.0866:0.0	.	348;335	Q8WW79;P14151	.;LYAM1_HUMAN	L	348	ENSP00000236147:F348L	ENSP00000236147:F348L	F	-	1	0	SELL	167937403	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	4.247000	0.58750	1.028000	0.39785	0.533000	0.62120	TTC	.		0.393	SELL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084233.1	NM_000655	
DTX1	1840	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	113531422	113531422	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr12:113531422C>T	ENST00000257600.3	+	4	1585	c.1082C>T	c.(1081-1083)cCg>cTg	p.P361L	DTX1_ENST00000547974.1_3'UTR	NM_004416.2	NP_004407.2	Q86Y01	DTX1_HUMAN	deltex 1, E3 ubiquitin ligase	361	Pro-rich.				cell surface receptor signaling pathway (GO:0007166)|glial cell differentiation (GO:0010001)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of T cell differentiation (GO:0045581)|Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)|regulation of Notch signaling pathway (GO:0008593)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Notch binding (GO:0005112)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	32						CTGCACCCGCCGCCCGTGAGC	0.692																																					p.P361L		.											.	.	.	0			c.C1082T						.						15.0	21.0	19.0					12																	113531422		2196	4290	6486	SO:0001583	missense	1840	exon4			ACCCGCCGCCCGT	AF053700	CCDS9164.1	12q24	2014-01-28	2014-01-28			ENSG00000135144			3060	protein-coding gene	gene with protein product		602582	"""deltex homolog 1 (Drosophila)"""			9590294, 12670957	Standard	NM_004416		Approved	hDx-1	uc001tuk.1	Q86Y01	OTTHUMG00000169610	ENST00000257600.3:c.1082C>T	12.37:g.113531422C>T	ENSP00000257600:p.Pro361Leu	Somatic	39	0		WXS	Illumina HiSeq	.	64	13	NM_004416	O60630|Q9BS04	Missense_Mutation	SNP	ENST00000257600.3	37	CCDS9164.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.414564	0.83449	.	.	ENSG00000135144	ENST00000257600	T	0.18338	2.22	3.79	3.79	0.43588	.	0.124934	0.53938	D	0.000044	T	0.20981	0.0505	M	0.76574	2.34	0.80722	D	1	P	0.41569	0.755	B	0.35550	0.205	T	0.18366	-1.0339	10	0.49607	T	0.09	-0.0647	15.2654	0.73657	0.0:1.0:0.0:0.0	.	361	Q86Y01	DTX1_HUMAN	L	361	ENSP00000257600:P361L	ENSP00000257600:P361L	P	+	2	0	DTX1	112015805	1.000000	0.71417	0.989000	0.46669	0.975000	0.68041	7.630000	0.83225	2.060000	0.61445	0.491000	0.48974	CCG	.		0.692	DTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405045.2		
FAT3	120114	hgsc.bcm.edu	37	11	92534618	92534618	+	Silent	SNP	C	C	A			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr11:92534618C>A	ENST00000298047.6	+	9	8456	c.8439C>A	c.(8437-8439)gtC>gtA	p.V2813V	FAT3_ENST00000409404.2_Silent_p.V2813V|FAT3_ENST00000525166.1_Silent_p.V2663V			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2813	Cadherin 25. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V2813V(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ACAAGCCAGTCTTTGAAACTT	0.418										TCGA Ovarian(4;0.039)																											p.V2813V		.											FAT3_ENST00000409404,NS,carcinoma,0,2	FAT3_ENST00000409404	0	2	Substitution - coding silent(2)	lung(2)	c.C8439A						.						51.0	52.0	52.0					11																	92534618		1904	4117	6021	SO:0001819	synonymous_variant	120114	exon9			GCCAGTCTTTGAA	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.8439C>A	11.37:g.92534618C>A		Somatic	57	0		WXS	Illumina HiSeq	.	49	2	NM_001008781	B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	37																																																																																				.		0.418	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
NBEAL1	65065	hgsc.bcm.edu	37	2	203995146	203995146	+	Missense_Mutation	SNP	G	G	T	rs376644554	byFrequency	TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr2:203995146G>T	ENST00000449802.1	+	24	3757	c.3424G>T	c.(3424-3426)Gca>Tca	p.A1142S		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	1142										NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						CATACTGTACGCATTGCTCTT	0.398																																					p.A1142S		.											NBEAL1_ENST00000449802,colon,carcinoma,0,1	NBEAL1_ENST00000449802	0	0			c.G3424T						.						161.0	121.0	133.0					2																	203995146		692	1591	2283	SO:0001583	missense	65065	exon24			CTGTACGCATTGC	AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.3424G>T	2.37:g.203995146G>T	ENSP00000399903:p.Ala1142Ser	Somatic	24	0		WXS	Illumina HiSeq	.	42	2	NM_001114132	A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Missense_Mutation	SNP	ENST00000449802.1	37	CCDS46495.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.960316	0.74016	.	.	ENSG00000144426	ENST00000449802;ENST00000340268	T	0.32988	1.43	5.33	5.33	0.75918	.	.	.	.	.	T	0.35480	0.0933	M	0.70275	2.135	0.49213	D	0.999761	P	0.43392	0.805	B	0.38755	0.281	T	0.18398	-1.0338	9	0.22109	T	0.4	.	18.9799	0.92751	0.0:0.0:1.0:0.0	.	1142	Q6ZS30	NBEL1_HUMAN	S	1142	ENSP00000399903:A1142S	ENSP00000344985:A1142S	A	+	1	0	NBEAL1	203703391	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	4.281000	0.58965	2.632000	0.89209	0.557000	0.71058	GCA	.		0.398	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333982.4		
SELL	6402	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	169670703	169670703	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr1:169670703T>C	ENST00000236147.4	-	7	1278	c.1118A>G	c.(1117-1119)aAa>aGa	p.K373R	C1orf112_ENST00000498289.1_Intron|SELL_ENST00000463108.1_5'UTR	NM_000655.4	NP_000646.2	P14151	LYAM1_HUMAN	selectin L	360					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|regulation of immune response (GO:0050776)|response to ATP (GO:0033198)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|protease binding (GO:0002020)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(3)|lung(5)|urinary_tract(1)	15	all_hematologic(923;0.208)					TCACATACCTTTTTTTAATCT	0.363																																					p.K373R		.											.	.	.	0			c.A1118G						.						50.0	43.0	45.0					1																	169670703		1827	4076	5903	SO:0001583	missense	6402	exon7			ATACCTTTTTTTA	M25280	CCDS53427.1	1q23-q25	2008-07-31	2008-07-31		ENSG00000188404	ENSG00000188404		"""CD molecules"""	10720	protein-coding gene	gene with protein product		153240	"""lymphocyte adhesion molecule 1"""	LYAM1, LNHR		2664786, 1375831	Standard	NR_029467		Approved	LSEL, LAM1, LAM-1, hLHRc, Leu-8, Lyam-1, PLNHR, CD62L	uc001ggk.3	P14151	OTTHUMG00000034809	ENST00000236147.4:c.1118A>G	1.37:g.169670703T>C	ENSP00000236147:p.Lys373Arg	Somatic	68	0		WXS	Illumina HiSeq	.	81	13	NM_000655	B2R6Q8|P15023|Q9UJ43	Missense_Mutation	SNP	ENST00000236147.4	37	CCDS53427.1	.	.	.	.	.	.	.	.	.	.	T	18.51	3.639945	0.67244	.	.	ENSG00000188404	ENST00000236147	T	0.15487	2.42	5.64	3.31	0.37934	.	0.102711	0.42821	N	0.000660	T	0.05868	0.0153	L	0.49640	1.575	0.29673	N	0.842344	B;B	0.22080	0.058;0.064	B;B	0.17979	0.017;0.02	T	0.20773	-1.0265	10	0.45353	T	0.12	-3.1096	7.427	0.27105	0.0:0.1761:0.0:0.8239	.	373;360	Q8WW79;P14151	.;LYAM1_HUMAN	R	373	ENSP00000236147:K373R	ENSP00000236147:K373R	K	-	2	0	SELL	167937327	1.000000	0.71417	0.988000	0.46212	0.989000	0.77384	1.474000	0.35398	0.976000	0.38417	0.533000	0.62120	AAA	.		0.363	SELL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084233.1	NM_000655	
GRB7	2886	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	17	37899545	37899545	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr17:37899545G>T	ENST00000309156.4	+	5	833	c.576G>T	c.(574-576)aaG>aaT	p.K192N	GRB7_ENST00000309185.3_Missense_Mutation_p.K192N|GRB7_ENST00000578702.1_3'UTR|GRB7_ENST00000394209.2_Missense_Mutation_p.K192N|GRB7_ENST00000394211.3_Missense_Mutation_p.K192N|GRB7_ENST00000445327.2_Missense_Mutation_p.K215N|GRB7_ENST00000394204.1_Missense_Mutation_p.K192N	NM_005310.3	NP_005301.2	Q14451	GRB7_HUMAN	growth factor receptor-bound protein 7	192					blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|leukocyte migration (GO:0050900)|negative regulation of translation (GO:0017148)|positive regulation of cell migration (GO:0030335)|positive regulation of signal transduction (GO:0009967)|stress granule assembly (GO:0034063)	cell projection (GO:0042995)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;6.86e-60)|all cancers(3;1.65e-53)|BRCA - Breast invasive adenocarcinoma(8;2.03e-43)|STAD - Stomach adenocarcinoma(3;1.43e-12)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			AACTGTTCAAGAGCTCCCCAG	0.602																																					p.K215N		.											.	.	.	0			c.G645T						.						96.0	92.0	93.0					17																	37899545		2203	4300	6503	SO:0001583	missense	2886	exon5			GTTCAAGAGCTCC	D43772	CCDS11345.1, CCDS56028.1	17q12	2013-02-14			ENSG00000141738	ENSG00000141738		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4567	protein-coding gene	gene with protein product		601522					Standard	NM_005310		Approved		uc021twu.1	Q14451	OTTHUMG00000133253	ENST00000309156.4:c.576G>T	17.37:g.37899545G>T	ENSP00000310771:p.Lys192Asn	Somatic	37	0		WXS	Illumina HiSeq	.	39	4	NM_001242442	B2RAV1|B3KNL0|B3KWP9|B7WP75|J3KQM4|Q53YD3|Q92568|Q96DF9|Q9Y220	Missense_Mutation	SNP	ENST00000309156.4	37	CCDS11345.1	.	.	.	.	.	.	.	.	.	.	G	13.97	2.396168	0.42512	.	.	ENSG00000141738	ENST00000309185;ENST00000309156;ENST00000394211;ENST00000394209;ENST00000445327;ENST00000394204	T;T;T;T;T;T	0.75589	-0.95;-0.95;-0.95;-0.95;-0.95;-0.95	5.31	5.31	0.75309	.	0.092388	0.64402	D	0.000001	T	0.81044	0.4741	L	0.57536	1.79	0.43740	D	0.996232	D;D	0.65815	0.995;0.995	P;P	0.60415	0.837;0.874	T	0.82125	-0.0612	10	0.72032	D	0.01	-37.0618	12.913	0.58190	0.0:0.0:0.8374:0.1625	.	192;192	Q14451-2;Q14451	.;GRB7_HUMAN	N	192;192;192;192;215;192	ENSP00000311752:K192N;ENSP00000310771:K192N;ENSP00000377761:K192N;ENSP00000377759:K192N;ENSP00000403459:K215N;ENSP00000377754:K192N	ENSP00000310771:K192N	K	+	3	2	GRB7	35153071	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.021000	0.41020	2.768000	0.95171	0.561000	0.74099	AAG	.		0.602	GRB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257024.2	NM_005310	
MARCH1	55016	hgsc.bcm.edu	37	4	164449941	164449941	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr4:164449941G>T	ENST00000503008.1	-	8	1805	c.829C>A	c.(829-831)Cca>Aca	p.P277T	MARCH1_ENST00000514618.1_Missense_Mutation_p.P533T|MARCH1_ENST00000274056.7_Missense_Mutation_p.P277T|RP11-218F10.3_ENST00000609356.1_lincRNA|MARCH1_ENST00000339875.5_Missense_Mutation_p.P260T	NM_001166373.1	NP_001159845.1	Q8TCQ1	MARH1_HUMAN	membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase	277	Responsible for down-regulation of CD86 and MHC class II cell surface expression. {ECO:0000250}.				antigen processing and presentation of peptide antigen via MHC class II (GO:0002495)|immune response (GO:0006955)|protein polyubiquitination (GO:0000209)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	ligase activity (GO:0016874)|MHC protein binding (GO:0042287)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P277S(1)|p.P260S(1)		endometrium(2)|kidney(3)|large_intestine(3)|lung(20)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	36	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				TCTGCAGATGGCAGTGAATTT	0.463																																					p.P277T		.											MARCH1_ENST00000503008,NS,carcinoma,0,2	MARCH1_ENST00000503008	0	2	Substitution - Missense(2)	endometrium(2)	c.C829A						.						106.0	93.0	98.0					4																	164449941		2203	4300	6503	SO:0001583	missense	55016	exon8			CAGATGGCAGTGA	AK000675	CCDS3806.1, CCDS54814.1	4q32.2	2013-01-09	2012-02-23			ENSG00000145416		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	26077	protein-coding gene	gene with protein product		613331	"""membrane-associated ring finger (C3HC4) 1"""			14722266	Standard	NM_017923		Approved	FLJ20668, MARCH-I, RNF171	uc003iqs.2	Q8TCQ1		ENST00000503008.1:c.829C>A	4.37:g.164449941G>T	ENSP00000427223:p.Pro277Thr	Somatic	48	0		WXS	Illumina HiSeq	.	65	3	NM_001166373	D3DP29|Q9NWR0	Missense_Mutation	SNP	ENST00000503008.1	37	CCDS54814.1	.	.	.	.	.	.	.	.	.	.	G	6.272	0.418244	0.11870	.	.	ENSG00000145416	ENST00000274056;ENST00000503008;ENST00000514618;ENST00000339875	T;T;T;T	0.32023	1.89;1.89;1.47;1.5	5.34	4.5	0.54988	.	0.179533	0.38778	N	0.001565	T	0.13157	0.0319	N	0.05078	-0.115	0.20975	N	0.999818	B;B	0.02656	0.0;0.0	B;B	0.08055	0.001;0.003	T	0.24621	-1.0155	10	0.07990	T	0.79	-5.2847	10.5147	0.44883	0.1487:0.0:0.8513:0.0	.	277;260	Q8TCQ1;Q8TCQ1-2	MARH1_HUMAN;.	T	277;277;533;260	ENSP00000274056:P277T;ENSP00000427223:P277T;ENSP00000421322:P533T;ENSP00000345676:P260T	ENSP00000274056:P277T	P	-	1	0	MARCH1	164669391	1.000000	0.71417	0.284000	0.24805	0.939000	0.58152	4.276000	0.58933	1.399000	0.46721	0.655000	0.94253	CCA	.		0.463	MARCH1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364493.2	NM_017923	
C5orf30	90355	hgsc.bcm.edu	37	5	102611819	102611819	+	Missense_Mutation	SNP	G	G	T	rs377580691		TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr5:102611819G>T	ENST00000319933.2	+	3	507	c.199G>T	c.(199-201)Ggc>Tgc	p.G67C	C5orf30_ENST00000510890.1_Missense_Mutation_p.G67C|C5orf30_ENST00000515669.1_Missense_Mutation_p.G67C	NM_033211.2	NP_149988.1	Q96GV9	CE030_HUMAN	chromosome 5 open reading frame 30	67					cilium morphogenesis (GO:0060271)|protein transport (GO:0015031)	ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)				NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)	9		all_cancers(142;2.22e-05)|all_epithelial(76;9.54e-08)|Prostate(80;0.0174)|Colorectal(57;0.0551)|Ovarian(225;0.11)|Lung NSC(167;0.136)|all_lung(232;0.18)		Epithelial(69;2.84e-14)|COAD - Colon adenocarcinoma(37;0.00762)		CTTCACGACTGGCGAGGAACT	0.557																																					p.G67C		.											C5orf30,NS,carcinoma,0,1	C5orf30	0	0			c.G199T						.						79.0	64.0	69.0					5																	102611819		2203	4300	6503	SO:0001583	missense	90355	exon3			ACGACTGGCGAGG		CCDS4095.1	5q21.1	2012-02-23			ENSG00000181751	ENSG00000181751			25052	protein-coding gene	gene with protein product						22085962	Standard	NM_033211		Approved	FLJ25291	uc003kog.1	Q96GV9	OTTHUMG00000128738	ENST00000319933.2:c.199G>T	5.37:g.102611819G>T	ENSP00000326110:p.Gly67Cys	Somatic	37	0		WXS	Illumina HiSeq	.	47	2	NM_033211		Missense_Mutation	SNP	ENST00000319933.2	37	CCDS4095.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.026369	0.75390	.	.	ENSG00000181751	ENST00000319933;ENST00000515669;ENST00000510890	.	.	.	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.72342	0.3448	L	0.29908	0.895	0.80722	D	1	D	0.71674	0.998	D	0.72625	0.978	T	0.73585	-0.3936	9	0.87932	D	0	-13.3142	20.6208	0.99490	0.0:0.0:1.0:0.0	.	67	Q96GV9	CE030_HUMAN	C	67	.	ENSP00000326110:G67C	G	+	1	0	C5orf30	102639718	1.000000	0.71417	0.349000	0.25694	0.430000	0.31655	8.938000	0.92943	2.882000	0.98803	0.655000	0.94253	GGC	.		0.557	C5orf30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250649.1	NM_033211	
DMAP1	55929	hgsc.bcm.edu	37	1	44684374	44684374	+	Nonsense_Mutation	SNP	G	G	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr1:44684374G>T	ENST00000372289.2	+	5	930	c.667G>T	c.(667-669)Gaa>Taa	p.E223*	DMAP1_ENST00000361745.6_Nonsense_Mutation_p.E223*|DMAP1_ENST00000488433.1_3'UTR|DMAP1_ENST00000315913.5_Nonsense_Mutation_p.E223*	NM_019100.4	NP_061973.1	Q9NPF5	DMAP1_HUMAN	DNA methyltransferase 1 associated protein 1	223					chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA methylation (GO:0006306)|DNA repair (GO:0006281)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription factor import into nucleus (GO:0042993)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|RNA polymerase II repressing transcription factor binding (GO:0001103)|transcription corepressor activity (GO:0003714)			breast(1)|cervix(1)|endometrium(6)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	Acute lymphoblastic leukemia(166;0.155)					TGCTGGGCACGAACGACGGCG	0.572											OREG0013437	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E223X		.											DMAP1,NS,carcinoma,0,1	DMAP1	0	0			c.G667T						.						121.0	114.0	116.0					1																	44684374		2203	4300	6503	SO:0001587	stop_gained	55929	exon6			GGGCACGAACGAC	AB037846	CCDS509.1	1p34	2009-07-13			ENSG00000178028	ENSG00000178028			18291	protein-coding gene	gene with protein product		605077				10888872, 10718198	Standard	XM_005271039		Approved	DNMAP1, FLJ11543, KIAA1425, DNMTAP1, EAF2, MEAF2, SWC4	uc001clq.1	Q9NPF5	OTTHUMG00000007577	ENST00000372289.2:c.667G>T	1.37:g.44684374G>T	ENSP00000361363:p.Glu223*	Somatic	35	0	925	WXS	Illumina HiSeq	.	43	2	NM_001034024	A8K001|D3DPY8|Q0JSM4|Q5TG41|Q7Z3H7|Q9H0S8|Q9P2C2	Nonsense_Mutation	SNP	ENST00000372289.2	37	CCDS509.1	.	.	.	.	.	.	.	.	.	.	G	35	5.497540	0.96355	.	.	ENSG00000178028	ENST00000361745;ENST00000446292;ENST00000372283;ENST00000440641;ENST00000437511;ENST00000315913;ENST00000372289	.	.	.	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-25.0561	20.0263	0.97523	0.0:0.0:1.0:0.0	.	.	.	.	X	223;223;249;223;249;223;223	.	ENSP00000312697:E223X	E	+	1	0	DMAP1	44456961	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.359000	0.97115	2.735000	0.93741	0.655000	0.94253	GAA	.		0.572	DMAP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020027.3	NM_019100	
DDHD1	80821	hgsc.bcm.edu	37	14	53619480	53619480	+	Missense_Mutation	SNP	T	T	C	rs140904345|rs55671452|rs200797826	byFrequency	TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr14:53619480T>C	ENST00000323669.5	-	1	336	c.337A>G	c.(337-339)Agc>Ggc	p.S113G	DDHD1_ENST00000357758.3_Missense_Mutation_p.S113G|DDHD1_ENST00000395606.1_Missense_Mutation_p.S113G|RP11-547D23.1_ENST00000554235.1_RNA|AL356020.1_ENST00000584587.1_RNA	NM_001160148.1	NP_001153620.1	Q8NEL9	DDHD1_HUMAN	DDHD domain containing 1	113					cell death (GO:0008219)|lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)	25	Breast(41;0.037)					GACAAGGAGCTGCCGCCGCCG	0.701																																					p.S113G		.											.,102	.	202	0			c.A337G						.						6.0	8.0	7.0					14																	53619480		1971	3847	5818	SO:0001583	missense	80821	exon1			AGGAGCTGCCGCC	AB051492	CCDS9714.1, CCDS53895.1, CCDS53896.1	14q21	2012-11-23			ENSG00000100523	ENSG00000100523			19714	protein-coding gene	gene with protein product	"""phosphatidic acid-preferring phospholipase A1"""	614603	"""spastic paraplegia 28 (autosomal recessive)"""	SPG28		11214970, 20359546	Standard	NM_030637		Approved	KIAA1705, PA-PLA1	uc001xai.3	Q8NEL9	OTTHUMG00000140305	ENST00000323669.5:c.337A>G	14.37:g.53619480T>C	ENSP00000327104:p.Ser113Gly	Somatic	9	0		WXS	Illumina HiSeq	.	15	4	NM_001160147	G5E9D1|Q8WVH3|Q96LL2|Q9C0F8	Missense_Mutation	SNP	ENST00000323669.5	37	CCDS53895.1	.	.	.	.	.	.	.	.	.	.	T	16.03	3.006520	0.54361	.	.	ENSG00000100523	ENST00000323669;ENST00000395606;ENST00000357758;ENST00000395610	.	.	.	3.77	2.61	0.31194	.	0.746995	0.12231	N	0.487421	T	0.35566	0.0936	N	0.22421	0.69	0.20975	N	0.999816	P;B;P	0.52577	0.954;0.0;0.954	D;B;D	0.66351	0.916;0.0;0.943	T	0.17167	-1.0378	9	0.18276	T	0.48	-5.0646	3.2899	0.06945	0.0:0.2878:0.2128:0.4994	.	113;113;113	G5E9D1;Q8NEL9;Q8NEL9-2	.;DDHD1_HUMAN;.	G	113	.	ENSP00000327104:S113G	S	-	1	0	DDHD1	52689230	.	.	0.767000	0.31495	0.958000	0.62258	.	.	0.510000	0.28216	0.374000	0.22700	AGC	.		0.701	DDHD1-003	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276901.1		
NPHP4	261734	hgsc.bcm.edu	37	1	5951028	5951028	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr1:5951028C>A	ENST00000378156.4	-	17	2469	c.2204G>T	c.(2203-2205)cGg>cTg	p.R735L	NPHP4_ENST00000478423.2_5'UTR|AL356261.1_ENST00000585151.1_RNA	NM_015102.3	NP_055917.1	O75161	NPHP4_HUMAN	nephronophthisis 4	735			R -> W (in NPHP4; dbSNP:rs191913664). {ECO:0000269|PubMed:15776426}.		actin cytoskeleton organization (GO:0030036)|hippo signaling (GO:0035329)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(4)	47	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		AAAGCAGCGCCGCTCACCTGG	0.602																																					p.R735L		.											NPHP4,colon,carcinoma,0,1	NPHP4	0	0			c.G2204T						.						23.0	25.0	24.0					1																	5951028		1968	4142	6110	SO:0001583	missense	261734	exon17			CAGCGCCGCTCAC	AB014573	CCDS44052.1	1p36	2010-03-26			ENSG00000131697	ENSG00000131697			19104	protein-coding gene	gene with protein product	"""nephroretinin"", ""nephrocystin-4"", ""POC10 centriolar protein homolog (Chlamydomonas)"""	607215				11920287, 12205563	Standard	XR_244787		Approved	SLSN4, KIAA0673, POC10	uc001alq.2	O75161	OTTHUMG00000000701	ENST00000378156.4:c.2204G>T	1.37:g.5951028C>A	ENSP00000367398:p.Arg735Leu	Somatic	32	0		WXS	Illumina HiSeq	.	36	2	NM_015102	Q8IWC0	Missense_Mutation	SNP	ENST00000378156.4	37	CCDS44052.1	.	.	.	.	.	.	.	.	.	.	C	11.94	1.787558	0.31593	.	.	ENSG00000131697	ENST00000378156;ENST00000378160	D	0.87809	-2.3	5.61	-1.25	0.09405	.	0.588511	0.16061	N	0.231488	T	0.70710	0.3255	N	0.24115	0.695	0.31010	N	0.71935	P	0.35527	0.507	B	0.31869	0.137	T	0.64799	-0.6322	10	0.48119	T	0.1	.	1.8002	0.03070	0.1324:0.3265:0.1366:0.4045	.	735	O75161	NPHP4_HUMAN	L	735;138	ENSP00000367398:R735L	ENSP00000367398:R735L	R	-	2	0	NPHP4	5873615	0.770000	0.28543	0.964000	0.40570	0.147000	0.21601	-0.089000	0.11180	-0.173000	0.10761	0.591000	0.81541	CGG	.		0.602	NPHP4-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001715.2		
SAAL1	113174	hgsc.bcm.edu	37	11	18127573	18127573	+	Missense_Mutation	SNP	A	A	G			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr11:18127573A>G	ENST00000524803.1	-	1	65	c.16T>C	c.(16-18)Tcg>Ccg	p.S6P	SAAL1_ENST00000300013.4_Missense_Mutation_p.S6P|SAAL1_ENST00000533851.1_5'UTR|SAAL1_ENST00000529318.1_Missense_Mutation_p.S6P			Q96ER3	SAAL1_HUMAN	serum amyloid A-like 1	6										breast(2)|large_intestine(5)|lung(8)	15						GGCGGCGGCGAGGGGTTGCGG	0.687											OREG0020819	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S6P		.											.	.	.	0			c.T16C						.						24.0	22.0	22.0					11																	18127573		2199	4291	6490	SO:0001583	missense	113174	exon1			GCGGCGAGGGGTT	AK123457	CCDS31439.1	11p15.1	2005-10-28			ENSG00000166788	ENSG00000166788			25158	protein-coding gene	gene with protein product							Standard	NM_138421		Approved	FLJ41463	uc001mnq.3	Q96ER3	OTTHUMG00000166428	ENST00000524803.1:c.16T>C	11.37:g.18127573A>G	ENSP00000432487:p.Ser6Pro	Somatic	76	0	723	WXS	Illumina HiSeq	.	97	6	NM_138421	A6NH05	Missense_Mutation	SNP	ENST00000524803.1	37	CCDS31439.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.330841	0.81690	.	.	ENSG00000166788	ENST00000524803;ENST00000300013;ENST00000529318;ENST00000530180	T;T;T;T	0.36157	1.27;1.27;1.27;1.27	5.46	5.46	0.80206	.	0.143663	0.48767	D	0.000161	T	0.55226	0.1907	L	0.54323	1.7	0.52501	D	0.999954	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.83275	0.996;0.996;0.996	T	0.57487	-0.7803	10	0.72032	D	0.01	-5.4498	14.065	0.64824	1.0:0.0:0.0:0.0	.	6;6;6	E9PRZ1;G1UCX3;Q96ER3	.;.;SAAL1_HUMAN	P	6	ENSP00000432487:S6P;ENSP00000300013:S6P;ENSP00000432216:S6P;ENSP00000431489:S6P	ENSP00000300013:S6P	S	-	1	0	SAAL1	18084149	0.984000	0.35163	0.782000	0.31804	0.379000	0.30106	2.802000	0.47916	2.196000	0.70406	0.533000	0.62120	TCG	.		0.687	SAAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389728.1	NM_138421	
SLX4	84464	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	3640840	3640840	+	Silent	SNP	G	G	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr16:3640840G>T	ENST00000294008.3	-	12	3439	c.2799C>A	c.(2797-2799)ggC>ggA	p.G933G		NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	933	Interaction with PLK1 and TERF2-TERF2IP.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)			breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						CTGAGTGCTGGCCCTGGGGTG	0.682								Direct reversal of damage																													p.G933G		.											.	.	.	0			c.C2799A						.						61.0	66.0	64.0					16																	3640840		2197	4300	6497	SO:0001819	synonymous_variant	84464	exon12			GTGCTGGCCCTGG	AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.2799C>A	16.37:g.3640840G>T		Somatic	25	0		WXS	Illumina HiSeq	.	34	4	NM_032444	Q69YT8|Q8TF15|Q96JP1	Silent	SNP	ENST00000294008.3	37	CCDS10506.2																																																																																			.		0.682	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157301.3	NM_032444	
GLYATL1	92292	hgsc.bcm.edu	37	11	58723373	58723373	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr11:58723373C>A	ENST00000317391.4	+	8	1122	c.782C>A	c.(781-783)cCa>cAa	p.P261Q	RP11-142C4.6_ENST00000533954.1_RNA|RP11-142C4.6_ENST00000525714.1_RNA|GLYATL1_ENST00000300079.5_Missense_Mutation_p.P292Q	NM_001220494.1	NP_001207423.1	Q969I3	GLYL1_HUMAN	glycine-N-acyltransferase-like 1	261						mitochondrion (GO:0005739)	glutamine N-acyltransferase activity (GO:0047946)|glycine N-acyltransferase activity (GO:0047961)			NS(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|skin(4)|urinary_tract(1)	34					Glycine(DB00145)	AAGAATATTCCATTTTACATC	0.463																																					p.P292Q		.											GLYATL1_ENST00000317391,NS,carcinoma,0,2	GLYATL1_ENST00000317391	0	0			c.C875A						.						76.0	71.0	73.0					11																	58723373		2201	4295	6496	SO:0001583	missense	92292	exon7			ATATTCCATTTTA	AK091965	CCDS31556.1, CCDS55768.1	11q12.1	2014-08-12			ENSG00000166840	ENSG00000166840			30519	protein-coding gene	gene with protein product		614761				12477932	Standard	NM_080661		Approved	MGC15397, FLJ34646	uc001nnh.2	Q969I3	OTTHUMG00000167221	ENST00000317391.4:c.782C>A	11.37:g.58723373C>A	ENSP00000322223:p.Pro261Gln	Somatic	29	0		WXS	Illumina HiSeq	.	20	2	NM_080661	A6NDT0|Q7Z510|Q8NAW8	Missense_Mutation	SNP	ENST00000317391.4	37	CCDS55768.1	.	.	.	.	.	.	.	.	.	.	.	12.40	1.926654	0.34002	.	.	ENSG00000166840	ENST00000444580;ENST00000317391;ENST00000300079	T;T	0.17213	2.29;2.29	1.97	0.827	0.18835	Acyl-CoA N-acyltransferase (2);Glycine N-acyltransferase, C-terminal (1);	0.000000	0.64402	U	0.000018	T	0.32675	0.0837	M	0.75085	2.285	0.09310	N	1	D;D	0.76494	0.999;0.999	D;D	0.91635	0.998;0.999	T	0.09840	-1.0656	10	0.48119	T	0.1	.	3.9747	0.09468	0.0:0.711:0.0:0.289	.	292;261	Q969I3-2;Q969I3	.;GLYL1_HUMAN	Q	238;261;292	ENSP00000322223:P261Q;ENSP00000300079:P292Q	ENSP00000300079:P292Q	P	+	2	0	GLYATL1	58479949	0.204000	0.23447	0.021000	0.16686	0.151000	0.21798	0.585000	0.23879	-0.098000	0.12285	0.411000	0.27672	CCA	.		0.463	GLYATL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393783.1	NM_080661	
SDK1	221935	hgsc.bcm.edu	37	7	4218209	4218209	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr7:4218209G>T	ENST00000404826.2	+	35	5228	c.5089G>T	c.(5089-5091)Ggc>Tgc	p.G1697C	SDK1_ENST00000389531.3_Missense_Mutation_p.G1677C	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1697	Fibronectin type-III 10. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		GGTCTTTGTCGGCGAGGCTGG	0.622																																					p.G1697C		.											SDK1,spleen,lymphoid_neoplasm,0,1	SDK1	0	0			c.G5089T						.						62.0	69.0	67.0					7																	4218209		2203	4300	6503	SO:0001583	missense	221935	exon35			TTTGTCGGCGAGG	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.5089G>T	7.37:g.4218209G>T	ENSP00000385899:p.Gly1697Cys	Somatic	32	0		WXS	Illumina HiSeq	.	45	2	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	37	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	G	17.76	3.469413	0.63625	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.54279	0.58;0.6	5.09	5.09	0.68999	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.074731	0.52532	D	0.000067	T	0.76695	0.4023	M	0.87682	2.9	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.994;0.983	T	0.81351	-0.0972	10	0.87932	D	0	.	17.0409	0.86489	0.0:0.0:1.0:0.0	.	1677;184;1697	F8W6X9;F2Z3E9;Q7Z5N4	.;.;SDK1_HUMAN	C	1697;1677	ENSP00000385899:G1697C;ENSP00000374182:G1677C	ENSP00000374182:G1677C	G	+	1	0	SDK1	4184735	1.000000	0.71417	0.979000	0.43373	0.234000	0.25298	7.536000	0.82023	2.525000	0.85131	0.655000	0.94253	GGC	.		0.622	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
SLC37A3	84255	hgsc.bcm.edu	37	7	140043303	140043303	+	Missense_Mutation	SNP	C	C	T	rs557916487		TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr7:140043303C>T	ENST00000326232.9	-	13	1438	c.1235G>A	c.(1234-1236)cGc>cAc	p.R412H	SLC37A3_ENST00000340308.3_Intron|SLC37A3_ENST00000447932.2_Missense_Mutation_p.R396H	NM_207113.1	NP_996996.1	Q8NCC5	SPX3_HUMAN	solute carrier family 37, member 3	412					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)	p.R412H(1)		endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|stomach(3)	24	Melanoma(164;0.0142)					GAGCTCCTGGCGACCCAAGTC	0.458													C|||	1	0.000199681	0.0	0.0014	5008	,	,		17859	0.0		0.0	False		,,,				2504	0.0				p.R412H	Esophageal Squamous(133;211 1716 4665 11387 37873)	.											SLC37A3,rectum,carcinoma,0,1	SLC37A3	0	1	Substitution - Missense(1)	large_intestine(1)	c.G1235A						.						102.0	89.0	94.0					7																	140043303		2203	4300	6503	SO:0001583	missense	84255	exon13			TCCTGGCGACCCA	AK074823	CCDS5858.1, CCDS5859.1, CCDS75669.1	7q34	2013-07-17	2013-07-17		ENSG00000157800	ENSG00000157800		"""Solute carriers"""	20651	protein-coding gene	gene with protein product							Standard	NM_001287498		Approved	DKFZp761N0624	uc003vvo.3	Q8NCC5	OTTHUMG00000157343	ENST00000326232.9:c.1235G>A	7.37:g.140043303C>T	ENSP00000321498:p.Arg412His	Somatic	40	0		WXS	Illumina HiSeq	.	53	3	NM_207113	Q6PIU7|Q86SS4|Q9BQG7	Missense_Mutation	SNP	ENST00000326232.9	37	CCDS5859.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.97|16.97	3.267583|3.267583	0.59540|0.59540	.|.	.|.	ENSG00000157800|ENSG00000157800	ENST00000485538;ENST00000477006|ENST00000447932;ENST00000326232;ENST00000498469	.|T;T;T	.|0.46819	.|2.52;2.5;0.86	5.51|5.51	3.38|3.38	0.38709|0.38709	.|Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	.|0.098119	.|0.64402	.|N	.|0.000002	T|T	0.40719|0.40719	0.1128|0.1128	L|L	0.39566|0.39566	1.225|1.225	0.80722|0.80722	D|D	1|1	.|B;B;B	.|0.30824	.|0.122;0.296;0.131	.|B;B;B	.|0.33960	.|0.049;0.173;0.023	T|T	0.38845|0.38845	-0.9642|-0.9642	5|10	.|0.45353	.|T	.|0.12	-36.7665|-36.7665	13.2165|13.2165	0.59863|0.59863	0.0:0.8489:0.0:0.1511|0.0:0.8489:0.0:0.1511	.|.	.|396;412;24	.|Q8NCC5-2;Q8NCC5;B3KX37	.|.;SPX3_HUMAN;.	T|H	10;50|396;412;51	.|ENSP00000397481:R396H;ENSP00000321498:R412H;ENSP00000418158:R51H	.|ENSP00000321498:R412H	A|R	-|-	1|2	0|0	SLC37A3|SLC37A3	139689772|139689772	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.967000|0.967000	0.64934|0.64934	4.878000|4.878000	0.63093|0.63093	1.330000|1.330000	0.45394|0.45394	0.655000|0.655000	0.94253|0.94253	GCC|CGC	.		0.458	SLC37A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348492.1	NM_032295	
SIRPD	128646	hgsc.bcm.edu	37	20	1532455	1532455	+	Silent	SNP	G	G	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr20:1532455G>T	ENST00000381623.3	-	2	1492	c.303C>A	c.(301-303)tcC>tcA	p.S101S	SIRPD_ENST00000381621.1_Silent_p.S101S			Q9H106	SIRPD_HUMAN	signal-regulatory protein delta	101	Ig-like V-type.					extracellular region (GO:0005576)				breast(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)	15						GGATGCGGGTGGAAAAGTCTG	0.463																																					p.S101S		.											.	.	.	0			c.C303A						.						164.0	161.0	162.0					20																	1532455		2203	4300	6503	SO:0001819	synonymous_variant	128646	exon2			GCGGGTGGAAAAG	AL049634	CCDS13018.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000125900	ENSG00000125900		"""Signal-regulatory proteins"", ""Immunoglobulin superfamily / V-set domain containing"""	16248	protein-coding gene	gene with protein product			"""protein tyrosine phosphatase, non-receptor type substrate 1-like 2"""	PTPNS1L2		16339511	Standard	NM_178460		Approved	dJ576H24.4	uc002wfi.3	Q9H106	OTTHUMG00000031674	ENST00000381623.3:c.303C>A	20.37:g.1532455G>T		Somatic	66	0		WXS	Illumina HiSeq	.	80	4	NM_178460	B3KS88|Q5TFQ6	Silent	SNP	ENST00000381623.3	37	CCDS13018.1																																																																																			.		0.463	SIRPD-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077552.1	NM_178460	
DYRK4	8798	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	4700465	4700465	+	Splice_Site	SNP	G	G	A			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr12:4700465G>A	ENST00000540757.2	+	3	278		c.e3+1		DYRK4_ENST00000010132.5_Splice_Site|DYRK4_ENST00000543431.1_Splice_Site	NM_001282285.1|NM_001282286.1|NM_003845.1	NP_001269214.1|NP_001269215.1|NP_003836.1	Q9NR20	DYRK4_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4							cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27			Colorectal(7;0.103)			ACAGCGGCAGGTATGCCTTTG	0.532																																					.		.											.	.	.	0			c.118+1G>A						.						66.0	60.0	62.0					12																	4700465		2203	4300	6503	SO:0001630	splice_region_variant	8798	exon3			CGGCAGGTATGCC	Y09305	CCDS8530.1	12p13.32	2014-09-11			ENSG00000010219	ENSG00000010219			3095	protein-coding gene	gene with protein product		609181				9748265	Standard	NM_003845		Approved		uc001qmx.3	Q9NR20	OTTHUMG00000168204	ENST00000540757.2:c.118+1G>A	12.37:g.4700465G>A		Somatic	51	0		WXS	Illumina HiSeq	.	69	23	NM_003845	A8K8F7|Q8NEF2|Q92631	Splice_Site	SNP	ENST00000540757.2	37	CCDS8530.1	.	.	.	.	.	.	.	.	.	.	G	14.24	2.476641	0.44044	.	.	ENSG00000010219	ENST00000542744;ENST00000540757;ENST00000010132;ENST00000543431	.	.	.	4.34	4.34	0.51931	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6091	0.68504	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DYRK4	4570726	1.000000	0.71417	0.978000	0.43139	0.124000	0.20399	5.127000	0.64727	2.359000	0.80004	0.505000	0.49811	.	.		0.532	DYRK4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398780.2		Intron
SLC23A3	151295	hgsc.bcm.edu	37	2	220034386	220034386	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr2:220034386C>A	ENST00000409878.3	-	2	209	c.177G>T	c.(175-177)atG>atT	p.M59I	SLC23A3_ENST00000455516.2_Missense_Mutation_p.M59I|SLC23A3_ENST00000295738.7_Missense_Mutation_p.M59I|SLC23A3_ENST00000396775.3_Start_Codon_SNP_p.M1I	NM_001144889.1	NP_001138361.1	Q6PIS1	S23A3_HUMAN	solute carrier family 23, member 3	59					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)	p.M59I(2)		endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	11		Renal(207;0.0474)		Epithelial(149;9.27e-07)|all cancers(144;0.000156)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GCAGAGAAGCCATGACCAAGA	0.532																																					p.M59I		.											SLC23A3_ENST00000455516,NS,carcinoma,0,2	SLC23A3_ENST00000455516	0	2	Substitution - Missense(2)	lung(2)	c.G177T						.						62.0	81.0	74.0					2																	220034386		2101	4228	6329	SO:0001583	missense	151295	exon2			AGAAGCCATGACC	BC030243	CCDS42819.1, CCDS46517.1, CCDS46518.1	2q35	2013-07-18	2013-07-18		ENSG00000213901	ENSG00000213901		"""Solute carriers"""	20601	protein-coding gene	gene with protein product							Standard	NM_144712		Approved	SVCT3, FLJ31168, Yspl1	uc010zkr.2	Q6PIS1	OTTHUMG00000154616	ENST00000409878.3:c.177G>T	2.37:g.220034386C>A	ENSP00000386473:p.Met59Ile	Somatic	54	0		WXS	Illumina HiSeq	.	60	2	NM_001144890	B7Z512|Q2PYN6|Q96NA6	Missense_Mutation	SNP	ENST00000409878.3	37	CCDS46518.1	.	.	.	.	.	.	.	.	.	.	C	14.26	2.482721	0.44147	.	.	ENSG00000213901	ENST00000396775;ENST00000295738;ENST00000409878;ENST00000455516;ENST00000409370;ENST00000430764	T;T;T;T;T	0.34072	2.09;2.09;2.09;2.09;1.38	5.18	4.31	0.51392	.	0.417145	0.20140	N	0.098395	T	0.30510	0.0767	L	0.43152	1.355	0.80722	D	1	B;B;B	0.14438	0.01;0.0;0.0	B;B;B	0.13407	0.009;0.002;0.001	T	0.06180	-1.0841	9	.	.	.	.	13.0798	0.59107	0.0:0.9209:0.0:0.0791	.	59;59;59	Q6PIS1;B7Z512;Q6PIS1-2	S23A3_HUMAN;.;.	I	1;59;59;59;59;59	ENSP00000295738:M59I;ENSP00000386473:M59I;ENSP00000406546:M59I;ENSP00000386989:M59I;ENSP00000388907:M59I	.	M	-	3	0	SLC23A3	219742630	0.889000	0.30405	0.894000	0.35097	0.907000	0.53573	1.233000	0.32648	1.424000	0.47217	0.655000	0.94253	ATG	.		0.532	SLC23A3-010	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336331.2	NM_144712	
WWP2	11060	hgsc.bcm.edu	37	16	69921986	69921986	+	Missense_Mutation	SNP	G	G	T	rs139052693		TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr16:69921986G>T	ENST00000359154.2	+	8	849	c.748G>T	c.(748-750)Gtt>Ttt	p.V250F	WWP2_ENST00000569174.1_Missense_Mutation_p.V250F|WWP2_ENST00000544162.1_3'UTR|WWP2_ENST00000542271.1_Missense_Mutation_p.V134F|WWP2_ENST00000448661.1_Missense_Mutation_p.V250F|WWP2_ENST00000356003.2_Missense_Mutation_p.V250F	NM_001270454.1|NM_007014.4	NP_001257383.1|NP_008945.2	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase 2	250					cellular protein modification process (GO:0006464)|negative regulation of gene expression (GO:0010629)|negative regulation of protein transport (GO:0051224)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transporter activity (GO:0032410)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			breast(4)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						AGAACCTTCCGTTGTTGGTGT	0.488																																					p.V250F		.											WWP2,NS,carcinoma,0,1	WWP2	0	0			c.G748T						.						152.0	129.0	137.0					16																	69921986		2198	4300	6498	SO:0001583	missense	11060	exon8			CCTTCCGTTGTTG	BC013645	CCDS10885.1, CCDS58475.1, CCDS58476.1, CCDS58477.1	16q22.1	2008-02-05			ENSG00000198373	ENSG00000198373			16804	protein-coding gene	gene with protein product		602308				9169421, 12167593	Standard	NM_007014		Approved	AIP2	uc002exv.2	O00308	OTTHUMG00000137573	ENST00000359154.2:c.748G>T	16.37:g.69921986G>T	ENSP00000352069:p.Val250Phe	Somatic	51	0		WXS	Illumina HiSeq	.	49	2	NM_001270454	A6NEP1|B2R706|B4DTL5|F5H213|H3BRF3|I3RSG8|Q6ZTQ5|Q96CZ2|Q9BWN6	Missense_Mutation	SNP	ENST00000359154.2	37	CCDS10885.1	.	.	.	.	.	.	.	.	.	.	G	12.10	1.836073	0.32421	.	.	ENSG00000198373	ENST00000359154;ENST00000448661;ENST00000356003;ENST00000544162;ENST00000542271	T;T;T;T	0.31247	1.5;1.5;1.5;1.5	5.93	4.97	0.65823	.	0.478491	0.21880	N	0.067746	T	0.19805	0.0476	N	0.24115	0.695	0.29065	N	0.883668	B	0.33379	0.41	B	0.29785	0.107	T	0.08126	-1.0737	9	.	.	.	.	12.9533	0.58413	0.0759:0.0:0.9241:0.0	.	250	O00308	WWP2_HUMAN	F	250;250;250;137;134	ENSP00000352069:V250F;ENSP00000396871:V250F;ENSP00000348283:V250F;ENSP00000445616:V134F	.	V	+	1	0	WWP2	68479487	0.235000	0.23794	0.979000	0.43373	0.024000	0.10985	1.577000	0.36515	2.815000	0.96918	0.561000	0.74099	GTT	.		0.488	WWP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268954.1	NM_007014	
HERC1	8925	hgsc.bcm.edu;bcgsc.ca	37	15	63967058	63967058	+	Silent	SNP	G	G	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr15:63967058G>T	ENST00000443617.2	-	38	7416	c.7329C>A	c.(7327-7329)ggC>ggA	p.G2443G	RP11-317G6.1_ENST00000559303.2_RNA	NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	2443					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						CAGATGTTAGGCCTGTTCGCA	0.433																																					p.G2443G		.											.	.	.	0			c.C7329A						.						186.0	179.0	181.0					15																	63967058		2037	4212	6249	SO:0001819	synonymous_variant	8925	exon38			TGTTAGGCCTGTT	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.7329C>A	15.37:g.63967058G>T		Somatic	63	0		WXS	Illumina HiSeq	.	65	4	NM_003922	Q8IW65	Silent	SNP	ENST00000443617.2	37	CCDS45277.1																																																																																			.		0.433	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922	
FLNC	2318	hgsc.bcm.edu;bcgsc.ca	37	7	128496613	128496613	+	Silent	SNP	G	G	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr7:128496613G>T	ENST00000325888.8	+	44	7554	c.7293G>T	c.(7291-7293)gtG>gtT	p.V2431V	RP11-309L24.2_ENST00000469965.1_RNA|FLNC_ENST00000346177.6_Silent_p.V2398V	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	2431	Interaction with INPPL1.				cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						CCTTTGCCGTGCAGCTGAACG	0.652																																					p.V2431V		.											.	.	.	0			c.G7293T						.						62.0	74.0	70.0					7																	128496613		2115	4208	6323	SO:0001819	synonymous_variant	2318	exon44			TGCCGTGCAGCTG	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.7293G>T	7.37:g.128496613G>T		Somatic	57	0		WXS	Illumina HiSeq	.	80	4	NM_001458	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Silent	SNP	ENST00000325888.8	37	CCDS43644.1																																																																																			.		0.652	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3		
PDIA4	9601	hgsc.bcm.edu	37	7	148701059	148701059	+	Missense_Mutation	SNP	C	C	T	rs374110175	byFrequency	TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr7:148701059C>T	ENST00000286091.4	-	10	1997	c.1765G>A	c.(1765-1767)Gac>Aac	p.D589N		NM_004911.4	NP_004902.1	P13667	PDIA4_HUMAN	protein disulfide isomerase family A, member 4	589	Thioredoxin 3. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein secretion (GO:0009306)|response to endoplasmic reticulum stress (GO:0034976)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)	poly(A) RNA binding (GO:0044822)|protein disulfide isomerase activity (GO:0003756)			large_intestine(6)|lung(15)|ovary(2)|prostate(1)	24	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00385)			CTGGGGACGTCGTTGGCAGTG	0.582													C|||	3	0.000599042	0.0015	0.0	5008	,	,		17037	0.0		0.0	False		,,,				2504	0.001				p.D589N		.											PDIA4,NS,carcinoma,0,1	PDIA4	0	0			c.G1765A						.	C	ASN/ASP	2,4404	4.2+/-10.8	0,2,2201	104.0	104.0	104.0		1765	5.8	0.9	7		104	0,8600		0,0,4300	no	missense	PDIA4	NM_004911.4	23	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging	589/646	148701059	2,13004	2203	4300	6503	SO:0001583	missense	9601	exon10			GGACGTCGTTGGC	BC001928	CCDS5893.1	7q35	2009-11-20	2005-06-29		ENSG00000155660	ENSG00000155660	5.3.4.1	"""Protein disulfide isomerases"""	30167	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 4"""			2549034, 2002068	Standard	NM_004911		Approved	ERP70, ERP72	uc003wff.2	P13667	OTTHUMG00000150248	ENST00000286091.4:c.1765G>A	7.37:g.148701059C>T	ENSP00000286091:p.Asp589Asn	Somatic	42	0		WXS	Illumina HiSeq	.	36	2	NM_004911	A8K4K6|Q549T6	Missense_Mutation	SNP	ENST00000286091.4	37	CCDS5893.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.121003	0.77436	4.54E-4	0.0	ENSG00000155660	ENST00000286091	T	0.22539	1.95	5.81	5.81	0.92471	Thioredoxin domain (1);Thioredoxin-like fold (3);Disulphide isomerase (1);	0.043926	0.85682	D	0.000000	T	0.50667	0.1629	M	0.76574	2.34	0.80722	D	1	D	0.69078	0.997	D	0.83275	0.996	T	0.49679	-0.8914	10	0.87932	D	0	.	20.0734	0.97734	0.0:1.0:0.0:0.0	.	589	P13667	PDIA4_HUMAN	N	589	ENSP00000286091:D589N	ENSP00000286091:D589N	D	-	1	0	PDIA4	148331992	1.000000	0.71417	0.894000	0.35097	0.010000	0.07245	7.574000	0.82434	2.751000	0.94390	0.555000	0.69702	GAC	.		0.582	PDIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317077.1	NM_004911	
GPC1	2817	hgsc.bcm.edu;bcgsc.ca	37	2	241401740	241401740	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr2:241401740G>A	ENST00000264039.2	+	3	706	c.458G>A	c.(457-459)cGc>cAc	p.R153H		NM_002081.2	NP_002072.2	P35052	GPC1_HUMAN	glypican 1	153					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan catabolic process (GO:0030200)|myelin assembly (GO:0032288)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|phototransduction, visible light (GO:0007603)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|retinoid metabolic process (GO:0001523)|Schwann cell differentiation (GO:0014037)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	copper ion binding (GO:0005507)|fibroblast growth factor binding (GO:0017134)|laminin binding (GO:0043236)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	9		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;4.51e-33)|all cancers(36;1.74e-30)|OV - Ovarian serous cystadenocarcinoma(60;4.73e-15)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;9.1e-06)|Colorectal(34;0.000487)|Lung(119;0.0013)|LUSC - Lung squamous cell carcinoma(224;0.0154)|COAD - Colon adenocarcinoma(134;0.0194)|READ - Rectum adenocarcinoma(96;0.0949)		CTGTACTACCGCGGTGCCAAC	0.677																																					p.R153H		.											.	.	.	0			c.G458A						.						20.0	21.0	21.0					2																	241401740		2185	4293	6478	SO:0001583	missense	2817	exon3			ACTACCGCGGTGC	AK095397	CCDS2534.1	2q35-q37	2008-02-05			ENSG00000063660	ENSG00000063660		"""Proteoglycans / Cell Surface : Glypicans"""	4449	protein-coding gene	gene with protein product	"""glypican proteoglycan 1"""	600395				7774946	Standard	NM_002081		Approved	glypican	uc002vyw.4	P35052	OTTHUMG00000133349	ENST00000264039.2:c.458G>A	2.37:g.241401740G>A	ENSP00000264039:p.Arg153His	Somatic	69	0		WXS	Illumina HiSeq	.	63	4	NM_002081	B3KTD1|Q53QM4	Missense_Mutation	SNP	ENST00000264039.2	37	CCDS2534.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	14.41|14.41	2.527262|2.527262	0.44969|0.44969	.|.	.|.	ENSG00000063660|ENSG00000063660	ENST00000427506;ENST00000425056|ENST00000264039;ENST00000426280	.|T;T	.|0.50548	.|0.74;0.74	3.1|3.1	2.2|2.2	0.27929|0.27929	.|.	.|0.181348	.|0.43919	.|N	.|0.000501	T|T	0.46502|0.46502	0.1396|0.1396	M|M	0.79475|0.79475	2.455|2.455	0.38617|0.38617	D|D	0.951056|0.951056	.|B	.|0.17465	.|0.022	.|B	.|0.21546	.|0.035	T|T	0.49523|0.49523	-0.8931|-0.8931	5|10	.|0.56958	.|D	.|0.05	-23.0764|-23.0764	7.9795|7.9795	0.30175|0.30175	0.1305:0.0:0.8695:0.0|0.1305:0.0:0.8695:0.0	.|.	.|153	.|P35052	.|GPC1_HUMAN	T|H	110;149|153;103	.|ENSP00000264039:R153H;ENSP00000410251:R103H	.|ENSP00000264039:R153H	A|R	+|+	1|2	0|0	GPC1|GPC1	241050413|241050413	0.993000|0.993000	0.37304|0.37304	0.707000|0.707000	0.30419|0.30419	0.855000|0.855000	0.48748|0.48748	2.285000|2.285000	0.43487|0.43487	0.637000|0.637000	0.30526|0.30526	0.586000|0.586000	0.80456|0.80456	GCG|CGC	.		0.677	GPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257179.3	NM_002081	
AFF4	27125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	132232701	132232701	+	Nonsense_Mutation	SNP	C	C	A			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr5:132232701C>A	ENST00000265343.5	-	11	2000	c.1621G>T	c.(1621-1623)Gaa>Taa	p.E541*	AFF4_ENST00000378595.3_Nonsense_Mutation_p.E541*	NM_014423.3	NP_055238.1	Q9UHB7	AFF4_HUMAN	AF4/FMR2 family, member 4	541					spermatid development (GO:0007286)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	sequence-specific DNA binding transcription factor activity (GO:0003700)		SEPT8/AFF4(2)	breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(7)|lung(11)|ovary(3)|pancreas(1)|prostate(3)|skin(2)	43		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CGCCCACTTTCTGATCCCTTT	0.502																																					p.E541X	Ovarian(126;889 1733 2942 10745 11605)	.											.	.	.	0			c.G1621T						.						138.0	129.0	132.0					5																	132232701		2203	4300	6503	SO:0001587	stop_gained	27125	exon11			CACTTTCTGATCC	AF197927	CCDS4164.1	5q31	2006-04-28			ENSG00000072364	ENSG00000072364			17869	protein-coding gene	gene with protein product	"""ALL1 fused gene from 5q31"""	604417				10588740	Standard	XM_005271963		Approved	AF5Q31, MCEF	uc003kyd.3	Q9UHB7	OTTHUMG00000059838	ENST00000265343.5:c.1621G>T	5.37:g.132232701C>A	ENSP00000265343:p.Glu541*	Somatic	28	0		WXS	Illumina HiSeq	.	31	4	NM_014423	B2RP19|B7WPD2|Q498B2|Q59FB3|Q6P592|Q8TDR1|Q9P0E4	Nonsense_Mutation	SNP	ENST00000265343.5	37	CCDS4164.1	.	.	.	.	.	.	.	.	.	.	C	40	8.137029	0.98672	.	.	ENSG00000072364	ENST00000265343;ENST00000378595	.	.	.	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	-18.2768	19.4427	0.94827	0.0:1.0:0.0:0.0	.	.	.	.	X	541	.	ENSP00000265343:E541X	E	-	1	0	AFF4	132260600	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.221000	0.78016	2.649000	0.89929	0.563000	0.77884	GAA	.		0.502	AFF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133049.1	NM_014423	
BRD7	29117	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	16	50368662	50368662	+	Nonsense_Mutation	SNP	C	C	A	rs573438030		TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr16:50368662C>A	ENST00000394688.3	-	7	1006	c.847G>T	c.(847-849)Gaa>Taa	p.E283*	BRD7_ENST00000394689.2_Nonsense_Mutation_p.E283*			Q9NPI1	BRD7_HUMAN	bromodomain containing 7	283					cell cycle (GO:0007049)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|prostate(2)|urinary_tract(2)	22		all_cancers(37;0.0127)				GCGTGTGCTTCGGCATCTCCA	0.473																																					p.E283X		.											.	.	.	0			c.G847T						.						134.0	140.0	138.0					16																	50368662		2198	4300	6498	SO:0001587	stop_gained	29117	exon7			GTGCTTCGGCATC	AF213969	CCDS10742.1, CCDS54007.1	16q12.1	2008-11-18	2002-01-14		ENSG00000166164	ENSG00000166164			14310	protein-coding gene	gene with protein product			"""bromodomain-containing 7"""			10526152, 18809673	Standard	NM_013263		Approved	CELTIX1, BP75	uc002ege.2	Q9NPI1	OTTHUMG00000133170	ENST00000394688.3:c.847G>T	16.37:g.50368662C>A	ENSP00000378180:p.Glu283*	Somatic	24	0		WXS	Illumina HiSeq	.	13	9	NM_013263	Q4VC09|Q8N2L9|Q96KA4|Q9BV48|Q9UH59	Nonsense_Mutation	SNP	ENST00000394688.3	37	CCDS10742.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.487393	0.84854	.	.	ENSG00000166164	ENST00000394688;ENST00000394689	.	.	.	5.47	5.47	0.80525	.	0.358682	0.34959	N	0.003542	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13853	T	0.58	-11.8466	17.8821	0.88843	0.0:1.0:0.0:0.0	.	.	.	.	X	283	.	ENSP00000378180:E283X	E	-	1	0	BRD7	48926163	0.937000	0.31787	0.293000	0.24932	0.557000	0.35523	3.193000	0.50997	2.733000	0.93635	0.650000	0.86243	GAA	.		0.473	BRD7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256874.3	NM_013263	
DLGAP5	9787	hgsc.bcm.edu	37	14	55636119	55636119	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr14:55636119G>T	ENST00000247191.2	-	12	1762	c.1546C>A	c.(1546-1548)Cag>Aag	p.Q516K	DLGAP5_ENST00000395425.2_Missense_Mutation_p.Q516K	NM_014750.4	NP_055565.3	Q15398	DLGP5_HUMAN	discs, large (Drosophila) homolog-associated protein 5	516					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|dephosphorylation (GO:0016311)|mitotic chromosome movement towards spindle pole (GO:0007079)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|spindle pole centrosome (GO:0031616)	phosphoprotein phosphatase activity (GO:0004721)	p.Q516K(1)		biliary_tract(1)|breast(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	44						CCACATACCTGAAAACTAACC	0.323																																					p.Q516K		.											DLGAP5,NS,carcinoma,0,1	DLGAP5	0	1	Substitution - Missense(1)	lung(1)	c.C1546A						.						99.0	94.0	96.0					14																	55636119		2203	4300	6503	SO:0001583	missense	9787	exon12			ATACCTGAAAACT	D13633	CCDS9723.1, CCDS53897.1	14q22.3	2008-05-30	2008-05-30	2008-05-30	ENSG00000126787	ENSG00000126787			16864	protein-coding gene	gene with protein product			"""discs, large homolog 7 (Drosophila)"""	DLG7		7584026, 7584028	Standard	NM_014750		Approved	KIAA0008, DLG1, HURP	uc001xbs.3	Q15398	OTTHUMG00000140310	ENST00000247191.2:c.1546C>A	14.37:g.55636119G>T	ENSP00000247191:p.Gln516Lys	Somatic	36	0		WXS	Illumina HiSeq	.	32	2	NM_014750	A8MTM6|B4DRM8|Q86T11|Q8NG58	Missense_Mutation	SNP	ENST00000247191.2	37	CCDS9723.1	.	.	.	.	.	.	.	.	.	.	G	18.53	3.644612	0.67358	.	.	ENSG00000126787	ENST00000395425;ENST00000247191	T;T	0.20200	2.09;2.09	5.85	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.54013	0.1832	M	0.89785	3.06	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.79108	0.972;0.992	T	0.61564	-0.7037	10	0.72032	D	0.01	.	16.0203	0.80478	0.0674:0.0:0.9326:0.0	.	516;516	A8MTM6;Q15398	.;DLGP5_HUMAN	K	516	ENSP00000378815:Q516K;ENSP00000247191:Q516K	ENSP00000247191:Q516K	Q	-	1	0	DLGAP5	54705872	1.000000	0.71417	1.000000	0.80357	0.334000	0.28698	7.297000	0.78799	2.941000	0.99782	0.655000	0.94253	CAG	.		0.323	DLGAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276908.2	NM_014750	
PATZ1	23598	hgsc.bcm.edu	37	22	31731753	31731753	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr22:31731753G>A	ENST00000266269.5	-	3	2061	c.1432C>T	c.(1432-1434)Cgg>Tgg	p.R478W	RP3-400N23.6_ENST00000440456.1_RNA|PATZ1_ENST00000351933.4_Missense_Mutation_p.R478W|RP3-400N23.6_ENST00000451161.1_RNA|PATZ1_ENST00000405309.3_Missense_Mutation_p.R478W	NM_014323.2	NP_055138.2	Q9HBE1	PATZ1_HUMAN	POZ (BTB) and AT hook containing zinc finger 1	478					male gonad development (GO:0008584)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R478W(1)	EWSR1/PATZ1(2)	NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(2)	12						TATGCTGCCCGCAAGTACTTC	0.567																																					p.R478W		.											ZNF278,NS,carcinoma,0,1	ZNF278	0	1	Substitution - Missense(1)	ovary(1)	c.C1432T						.						113.0	102.0	105.0					22																	31731753		2203	4300	6503	SO:0001583	missense	23598	exon3			CTGCCCGCAAGTA	AL096880	CCDS13894.1, CCDS13895.1, CCDS13896.1, CCDS46691.1	22q12.2	2013-01-09	2006-09-19	2006-09-19	ENSG00000100105	ENSG00000100105		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13071	protein-coding gene	gene with protein product		605165	"""zinc finger protein 278"""	ZNF278		10591208, 18241078, 18401526	Standard	NM_014323		Approved	MAZR, dJ400N23, ZBTB19, ZSG, RIAZ, PATZ	uc003akq.3	Q9HBE1	OTTHUMG00000151254	ENST00000266269.5:c.1432C>T	22.37:g.31731753G>A	ENSP00000266269:p.Arg478Trp	Somatic	65	0		WXS	Illumina HiSeq	.	38	2	NM_032050	Q9HBE2|Q9HBE3|Q9P1A9|Q9UDU0|Q9Y529	Missense_Mutation	SNP	ENST00000266269.5	37	CCDS13894.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.356868	0.82243	.	.	ENSG00000100105	ENST00000266269;ENST00000405309;ENST00000351933	T;T;T	0.12039	4.65;2.72;2.72	5.33	3.21	0.36854	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.31482	0.0798	L	0.55990	1.75	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.994;0.996;0.994	T	0.01753	-1.1281	10	0.59425	D	0.04	-17.0252	13.92	0.63926	0.0:0.0:0.6078:0.3921	.	478;478;478	Q9HBE1-3;Q9HBE1;Q9HBE1-2	.;PATZ1_HUMAN;.	W	478	ENSP00000266269:R478W;ENSP00000384173:R478W;ENSP00000337520:R478W	ENSP00000266269:R478W	R	-	1	2	PATZ1	30061753	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.254000	0.32897	0.611000	0.30052	0.563000	0.77884	CGG	.		0.567	PATZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321932.1	NM_032052	
ZNF766	90321	hgsc.bcm.edu;bcgsc.ca	37	19	52793998	52793998	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr19:52793998G>T	ENST00000439461.1	+	4	997	c.954G>T	c.(952-954)tgG>tgT	p.W318C	ZNF766_ENST00000593612.1_Missense_Mutation_p.W333C|ZNF766_ENST00000359102.4_Missense_Mutation_p.W333C|ZNF766_ENST00000599581.1_3'UTR|CTD-2525I3.5_ENST00000594865.1_RNA	NM_001010851.2	NP_001010851.1	Q5HY98	ZN766_HUMAN	zinc finger protein 766	318					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	17				GBM - Glioblastoma multiforme(134;0.00236)|OV - Ovarian serous cystadenocarcinoma(262;0.00871)		CACAACATTGGAGAATTCATA	0.378																																					p.W318C		.											.	.	.	0			c.G954T						.						31.0	34.0	33.0					19																	52793998		2125	4271	6396	SO:0001583	missense	90321	exon4			ACATTGGAGAATT	AK024074	CCDS46163.1	19q13.33	2013-01-08				ENSG00000196214		"""Zinc fingers, C2H2-type"", ""-"""	28063	protein-coding gene	gene with protein product							Standard	XM_006723458		Approved		uc002pyr.1	Q5HY98		ENST00000439461.1:c.954G>T	19.37:g.52793998G>T	ENSP00000409652:p.Trp318Cys	Somatic	38	0		WXS	Illumina HiSeq	.	43	4	NM_001010851	B2RNE0|Q7Z326	Missense_Mutation	SNP	ENST00000439461.1	37	CCDS46163.1	.	.	.	.	.	.	.	.	.	.	G	5.617	0.298497	0.10622	.	.	ENSG00000196214	ENST00000439461;ENST00000359102	T;T	0.17370	2.28;2.28	2.24	-1.88	0.07713	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05914	0.0154	N	0.12182	0.205	0.09310	N	1	P;P	0.49307	0.904;0.922	B;B	0.32465	0.09;0.146	T	0.27365	-1.0076	9	0.87932	D	0	.	3.2268	0.06735	0.5015:0.0:0.302:0.1965	.	333;318	G3XAE0;Q5HY98	.;ZN766_HUMAN	C	318;333	ENSP00000409652:W318C;ENSP00000352005:W333C	ENSP00000352005:W333C	W	+	3	0	ZNF766	57485810	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-1.385000	0.02540	-0.538000	0.06281	-0.188000	0.12872	TGG	.		0.378	ZNF766-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462764.1	NM_001010851	
DSTYK	25778	hgsc.bcm.edu;bcgsc.ca	37	1	205132087	205132087	+	Silent	SNP	C	C	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr1:205132087C>T	ENST00000367162.3	-	5	1635	c.1605G>A	c.(1603-1605)tcG>tcA	p.S535S	DSTYK_ENST00000367160.4_Intron|DSTYK_ENST00000367161.3_Silent_p.S535S	NM_015375.2	NP_056190.1	Q6XUX3	DUSTY_HUMAN	dual serine/threonine and tyrosine protein kinase	535					cellular response to fibroblast growth factor stimulus (GO:0044344)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of kinase activity (GO:0033674)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(2)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(2)	14						TTGTAACTGACGACCCTGAGT	0.403																																					p.S535S		.											.	.	.	0			c.G1605A						.						206.0	191.0	196.0					1																	205132087		2203	4300	6503	SO:0001819	synonymous_variant	25778	exon5			AACTGACGACCCT	AF068286	CCDS1451.1, CCDS1452.1	1q32	2008-12-18	2008-12-18	2008-12-18	ENSG00000133059	ENSG00000133059			29043	protein-coding gene	gene with protein product		612666	"""receptor interacting protein kinase 5"""	RIPK5		15178406	Standard	NM_015375		Approved	KIAA0472, DustyPK, RIP5	uc001hbw.3	Q6XUX3	OTTHUMG00000037102	ENST00000367162.3:c.1605G>A	1.37:g.205132087C>T		Somatic	78	0		WXS	Illumina HiSeq	.	87	4	NM_199462	B7ZL64|O75060|Q17R94|Q5RKT0|Q6IN87|Q6P997|Q86Y03|Q9P1S5	Silent	SNP	ENST00000367162.3	37	CCDS1451.1																																																																																			.		0.403	DSTYK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090345.1	NM_015375	
INTS2	57508	hgsc.bcm.edu	37	17	59981823	59981823	+	Silent	SNP	G	G	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr17:59981823G>T	ENST00000444766.3	-	9	1404	c.1329C>A	c.(1327-1329)gtC>gtA	p.V443V	INTS2_ENST00000251334.6_Silent_p.V435V	NM_020748.2	NP_065799	Q9H0H0	INT2_HUMAN	integrator complex subunit 2	443					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|intracellular (GO:0005622)|membrane (GO:0016020)				NS(1)|breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	38						TTAGGTACCTGACAAGTGTAG	0.388																																					p.V443V		.											INTS2,bladder,carcinoma,0,1	INTS2	0	0			c.C1329A						.						63.0	62.0	62.0					17																	59981823		1891	4095	5986	SO:0001819	synonymous_variant	57508	exon9			GTACCTGACAAGT	AB033113	CCDS45750.1	17q23.2	2006-04-26	2006-03-15	2006-03-15		ENSG00000108506			29241	protein-coding gene	gene with protein product		611346	"""KIAA1287"""	KIAA1287		16239144	Standard	NR_026641		Approved	INT2	uc002izn.3	Q9H0H0		ENST00000444766.3:c.1329C>A	17.37:g.59981823G>T		Somatic	43	0		WXS	Illumina HiSeq	.	46	2	NM_020748	Q9ULD3	Silent	SNP	ENST00000444766.3	37	CCDS45750.1																																																																																			.		0.388	INTS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000445368.1	NM_020748	
PRKDC	5591	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	48710796	48710796	+	Splice_Site	SNP	A	A	G			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr8:48710796A>G	ENST00000523565.1	-	73	10514		c.e73+1		PRKDC_ENST00000338368.3_Splice_Site|PRKDC_ENST00000314191.2_Splice_Site			P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide						B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	AAAGACACCAACCTCTTTTGT	0.358								Non-homologous end-joining																													.	Esophageal Squamous(79;1091 1253 12329 31680 40677)	.											.	.	.	0			c.10457+2T>C						.						92.0	87.0	89.0					8																	48710796		1839	4091	5930	SO:0001630	splice_region_variant	5591	exon74			ACACCAACCTCTT		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000523565.1:c.2994+1T>C	8.37:g.48710796A>G		Somatic	65	0		WXS	Illumina HiSeq	.	76	9	NM_001081640	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Splice_Site	SNP	ENST00000523565.1	37		.	.	.	.	.	.	.	.	.	.	A	19.61	3.859203	0.71834	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	.	.	.	5.24	5.24	0.73138	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4263	0.75055	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PRKDC	48873349	1.000000	0.71417	0.991000	0.47740	0.658000	0.38924	8.500000	0.90498	2.107000	0.64212	0.379000	0.24179	.	.		0.358	PRKDC-002	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000377896.1	NM_001081640	Intron
BICD1	636	hgsc.bcm.edu	37	12	32480599	32480599	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr12:32480599C>T	ENST00000281474.5	+	5	1313	c.1210C>T	c.(1210-1212)Cat>Tat	p.H404Y	BICD1_ENST00000548411.1_Missense_Mutation_p.H404Y	NM_001714.2	NP_001705.2	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 (Drosophila)	404					anatomical structure morphogenesis (GO:0009653)|intracellular mRNA localization (GO:0008298)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900737)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein localization to organelle (GO:0033365)|regulation of proteinase activated receptor activity (GO:1900276)|RNA processing (GO:0006396)|stress granule assembly (GO:0034063)|viral process (GO:0016032)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|host cell viral assembly compartment (GO:0072517)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	cytoskeletal adaptor activity (GO:0008093)|dynactin binding (GO:0034452)|dynein binding (GO:0045502)|proteinase activated receptor binding (GO:0031871)|Rab GTPase binding (GO:0017137)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			GGAGGAGGCCCATGACTATGA	0.532																																					p.H404Y		.											.	.	.	0			c.C1210T						.						60.0	55.0	57.0					12																	32480599		2203	4300	6503	SO:0001583	missense	636	exon5			GAGGCCCATGACT	U90028	CCDS8726.1, CCDS44859.1	12p11.2-p11.1	2005-01-13	2001-11-28			ENSG00000151746			1049	protein-coding gene	gene with protein product		602204	"""Bicaudal D (Drosophila) homolog 1"""			9367685	Standard	NM_001714		Approved		uc001rku.3	Q96G01	OTTHUMG00000169307	ENST00000281474.5:c.1210C>T	12.37:g.32480599C>T	ENSP00000281474:p.His404Tyr	Somatic	18	0		WXS	Illumina HiSeq	.	43	4	NM_001714	A8K2C3|F8W113|O43892|O43893	Missense_Mutation	SNP	ENST00000281474.5	37	CCDS8726.1	.	.	.	.	.	.	.	.	.	.	C	9.954	1.220964	0.22457	.	.	ENSG00000151746	ENST00000548411;ENST00000281474	T;T	0.42513	0.97;0.97	5.32	5.32	0.75619	.	0.180797	0.50627	D	0.000103	T	0.36608	0.0973	L	0.38531	1.155	0.80722	D	1	P;P	0.44578	0.838;0.662	B;B	0.37550	0.253;0.137	T	0.34950	-0.9808	10	0.62326	D	0.03	.	19.3625	0.94446	0.0:1.0:0.0:0.0	.	404;404	F8W113;Q96G01	.;BICD1_HUMAN	Y	404	ENSP00000446793:H404Y;ENSP00000281474:H404Y	ENSP00000281474:H404Y	H	+	1	0	BICD1	32371866	0.184000	0.23200	0.999000	0.59377	0.952000	0.60782	1.552000	0.36244	2.653000	0.90120	0.655000	0.94253	CAT	.		0.532	BICD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403380.1	NM_001714	
ZNF598	90850	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	16	2052396	2052396	+	Missense_Mutation	SNP	G	G	A	rs560217707		TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr16:2052396G>A	ENST00000563630.1	-	5	783	c.541C>T	c.(541-543)Cgg>Tgg	p.R181W	ZNF598_ENST00000562103.1_Missense_Mutation_p.R181W|ZNF598_ENST00000431526.1_Missense_Mutation_p.R236W			Q86UK7	ZN598_HUMAN	zinc finger protein 598	236							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						TGCTTCTCCCGGAAGTGCTCA	0.657																																					p.R236W		.											.	.	.	0			c.C706T						.						71.0	80.0	77.0					16																	2052396		2143	4244	6387	SO:0001583	missense	90850	exon7			TCTCCCGGAAGTG	BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000563630.1:c.541C>T	16.37:g.2052396G>A	ENSP00000455882:p.Arg181Trp	Somatic	17	0		WXS	Illumina HiSeq	.	30	12	NM_178167	Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Missense_Mutation	SNP	ENST00000563630.1	37		.	.	.	.	.	.	.	.	.	.	.	22.1	4.246377	0.80024	.	.	ENSG00000167962	ENST00000431526	T	0.34072	1.38	4.92	4.92	0.64577	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.66973	0.2844	M	0.91038	3.17	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75286	-0.3371	10	0.87932	D	0	-25.9293	13.7201	0.62720	0.0:0.0:0.8455:0.1545	.	236	Q86UK7	ZN598_HUMAN	W	236	ENSP00000411409:R236W	ENSP00000411409:R236W	R	-	1	2	ZNF598	1992397	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.651000	0.61447	2.274000	0.75844	0.462000	0.41574	CGG	.		0.657	ZNF598-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000434439.1	NM_178167	
SLCO4C1	353189	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	101582976	101582976	+	Silent	SNP	A	A	G			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr5:101582976A>G	ENST00000310954.6	-	10	2077	c.1791T>C	c.(1789-1791)ccT>ccC	p.P597P		NM_180991.4	NP_851322.3			solute carrier organic anion transporter family, member 4C1											breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	50		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)		ACACAGTTATAGGAGTACCGG	0.383																																					p.P597P		.											.	.	.	0			c.T1791C						.						75.0	80.0	78.0					5																	101582976		2203	4300	6503	SO:0001819	synonymous_variant	353189	exon10			AGTTATAGGAGTA	AY273896	CCDS34205.1	5q21	2013-05-22	2003-11-25		ENSG00000173930	ENSG00000173930		"""Solute carriers"""	23612	protein-coding gene	gene with protein product		609013					Standard	NM_180991		Approved	SLC21A20, OATP4C1, OATPX, OATP-H	uc003knm.3	Q6ZQN7	OTTHUMG00000162757	ENST00000310954.6:c.1791T>C	5.37:g.101582976A>G		Somatic	52	0		WXS	Illumina HiSeq	.	94	7	NM_180991		Silent	SNP	ENST00000310954.6	37	CCDS34205.1																																																																																			.		0.383	SLCO4C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370332.1	NM_180991	
CCDC150	284992	hgsc.bcm.edu	37	2	197521765	197521765	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr2:197521765C>T	ENST00000389175.4	+	4	616	c.481C>T	c.(481-483)Cgc>Tgc	p.R161C	CCDC150_ENST00000272831.7_Intron|CCDC150_ENST00000472405.2_Missense_Mutation_p.R58C|CCDC150_ENST00000423093.2_Intron	NM_001080539.1	NP_001074008.1	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150	161										breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(14)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	33						TATGAATTTGCGCCAGCAACT	0.468																																					p.R161C		.											CCDC150,NS,carcinoma,0,1	CCDC150	0	0			c.C481T						.						78.0	80.0	79.0					2																	197521765		1976	4165	6141	SO:0001583	missense	284992	exon4			AATTTGCGCCAGC		CCDS46478.1	2q33.1	2008-04-10			ENSG00000144395	ENSG00000144395			26834	protein-coding gene	gene with protein product							Standard	NM_001080539		Approved	FLJ39660	uc002utp.1	Q8NCX0	OTTHUMG00000154475	ENST00000389175.4:c.481C>T	2.37:g.197521765C>T	ENSP00000373827:p.Arg161Cys	Somatic	25	0		WXS	Illumina HiSeq	.	33	2	NM_001080539	Q6P5U6|Q6P663|Q8N8V5	Missense_Mutation	SNP	ENST00000389175.4	37	CCDS46478.1	.	.	.	.	.	.	.	.	.	.	C	10.62	1.402346	0.25291	.	.	ENSG00000144395	ENST00000389175;ENST00000536389;ENST00000472405	T;T	0.29917	1.55;1.55	4.78	4.78	0.61160	.	0.181068	0.38381	N	0.001706	T	0.27697	0.0681	L	0.54323	1.7	0.80722	D	1	B;B	0.29531	0.218;0.247	B;B	0.24269	0.022;0.052	T	0.07233	-1.0783	10	0.48119	T	0.1	-3.5953	10.9097	0.47101	0.0:0.9095:0.0:0.0905	.	161;161	Q8NCX0;F5H6M2	CC150_HUMAN;.	C	161;161;58	ENSP00000373827:R161C;ENSP00000441149:R58C	ENSP00000373827:R161C	R	+	1	0	CCDC150	197230010	1.000000	0.71417	1.000000	0.80357	0.095000	0.18619	2.384000	0.44362	2.485000	0.83878	0.655000	0.94253	CGC	.		0.468	CCDC150-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335377.2	NM_001080539	
FTH1	2495	hgsc.bcm.edu	37	11	61734852	61734852	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr11:61734852C>A	ENST00000273550.7	-	1	280	c.46G>T	c.(46-48)Gac>Tac	p.D16Y	AP003733.1_ENST00000601917.1_5'Flank|FTH1_ENST00000532601.1_5'Flank|FTH1_ENST00000529191.1_Missense_Mutation_p.D16Y|FTH1_ENST00000529631.1_Missense_Mutation_p.D16Y|FTH1_ENST00000526640.1_Intron	NM_002032.2	NP_002023.2	P02794	FRIH_HUMAN	ferritin, heavy polypeptide 1	16	Ferritin-like diiron. {ECO:0000255|PROSITE-ProRule:PRU00085}.				cellular iron ion homeostasis (GO:0006879)|immune response (GO:0006955)|intracellular sequestering of iron ion (GO:0006880)|iron ion transport (GO:0006826)|membrane organization (GO:0061024)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fibroblast proliferation (GO:0048147)|post-Golgi vesicle-mediated transport (GO:0006892)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular ferritin complex (GO:0008043)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ferric iron binding (GO:0008199)|ferroxidase activity (GO:0004322)|iron ion binding (GO:0005506)	p.D16Y(1)		NS(2)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8					Iron Dextran(DB00893)	GCCTCTGAGTCCTGGTGGTAG	0.697																																					p.D16Y		.											FTH1,NS,malignant_melanoma,0,1	FTH1	0	1	Substitution - Missense(1)	NS(1)	c.G46T						.						10.0	11.0	11.0					11																	61734852		1923	4038	5961	SO:0001583	missense	2495	exon1			CTGAGTCCTGGTG		CCDS41655.1	11q13	2012-10-02			ENSG00000167996	ENSG00000167996			3976	protein-coding gene	gene with protein product	"""apoferritin"", ""placenta immunoregulatory factor"", ""proliferation-inducing protein 15"""	134770		FTHL6		3020541	Standard	NM_002032		Approved	FTH, PLIF, PIG15, FHC	uc001nsu.3	P02794		ENST00000273550.7:c.46G>T	11.37:g.61734852C>A	ENSP00000273550:p.Asp16Tyr	Somatic	38	0		WXS	Illumina HiSeq	.	29	3	NM_002032	B3KNR5|Q3KRA8|Q3SWW1	Missense_Mutation	SNP	ENST00000273550.7	37	CCDS41655.1	.	.	.	.	.	.	.	.	.	.	.	36	5.640479	0.96693	.	.	ENSG00000167996	ENST00000529191;ENST00000529631;ENST00000530019;ENST00000273550;ENST00000406545	T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38	4.76	4.76	0.60689	Ferritin/ribonucleotide reductase-like (1);Ferritin-related (1);Ferritin-like (1);	0.141911	0.64402	D	0.000007	D	0.84097	0.5397	H	0.96142	3.775	0.80722	D	1	P	0.49447	0.924	P	0.52309	0.695	D	0.89969	0.4092	10	0.87932	D	0	.	17.7341	0.88387	0.0:1.0:0.0:0.0	.	16	P02794	FRIH_HUMAN	Y	16;16;16;16;65	ENSP00000431659:D16Y;ENSP00000431575:D16Y;ENSP00000433470:D16Y;ENSP00000273550:D16Y	ENSP00000273550:D16Y	D	-	1	0	FTH1	61491428	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.164000	0.77533	2.319000	0.78375	0.484000	0.47621	GAC	.		0.697	FTH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388444.1	NM_002032	
MCM8	84515	hgsc.bcm.edu;bcgsc.ca	37	20	5948523	5948523	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr20:5948523G>T	ENST00000378896.3	+	10	1452	c.1075G>T	c.(1075-1077)Gca>Tca	p.A359S	MCM8_ENST00000265187.4_Splice_Site|MCM8_ENST00000378886.2_Missense_Mutation_p.A359S|MCM8_ENST00000378883.1_Missense_Mutation_p.A359S	NM_001281520.1|NM_032485.4|NM_182802.1	NP_001268449.1|NP_115874.3|NP_877954.1	Q9UJA3	MCM8_HUMAN	minichromosome maintenance complex component 8	359					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via homologous recombination (GO:0000724)|female gamete generation (GO:0007292)|G1/S transition of mitotic cell cycle (GO:0000082)|male gamete generation (GO:0048232)|mitotic cell cycle (GO:0000278)	MCM8-MCM9 complex (GO:0097362)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	23						GTATATTGAAGCAAATTCTAT	0.323																																					p.A359S		.											.	.	.	0			c.G1075T						.						83.0	89.0	87.0					20																	5948523		2203	4300	6503	SO:0001583	missense	84515	exon10			ATTGAAGCAAATT	AJ439063	CCDS13094.1, CCDS13095.1, CCDS63226.1, CCDS63227.1	20p12.3	2007-04-04	2007-04-04	2003-07-09	ENSG00000125885	ENSG00000125885			16147	protein-coding gene	gene with protein product	"""REC homolog (Drosophila)"""	608187	"""chromosome 20 open reading frame 154"""	C20orf154		12527764	Standard	NM_032485		Approved	MGC4816, MGC12866, MGC119522, MGC119523, dJ967N21.5, REC	uc002wmi.3	Q9UJA3	OTTHUMG00000031822	ENST00000378896.3:c.1075G>T	20.37:g.5948523G>T	ENSP00000368174:p.Ala359Ser	Somatic	86	0		WXS	Illumina HiSeq	.	75	4	NM_032485	B2RBG7|D3DW08|E7EQU7|Q495R4|Q495R6|Q495R7|Q86US4|Q969I5	Missense_Mutation	SNP	ENST00000378896.3	37	CCDS13094.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.2|20.2	3.945016|3.945016	0.73672|0.73672	.|.	.|.	ENSG00000125885|ENSG00000125885	ENST00000265187|ENST00000378896;ENST00000378883;ENST00000378886	.|T;T;T	.|0.06528	.|3.29;3.29;3.29	5.75|5.75	5.75|5.75	0.90469|0.90469	.|Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	.|T	.|0.34774	.|0.0909	M|M	0.90595|0.90595	3.13|3.13	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;0.985;0.999	.|D;P;D	.|0.81914	.|0.995;0.688;0.98	.|T	.|0.25984	.|-1.0116	.|10	.|0.72032	.|D	.|0.01	.|-17.307	19.9525|19.9525	0.97208|0.97208	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|359;359;359	.|Q9UJA3-2;E7EQU7;Q9UJA3	.|.;.;MCM8_HUMAN	.|S	-1|359	.|ENSP00000368174:A359S;ENSP00000368161:A359S;ENSP00000368164:A359S	.|ENSP00000368161:A359S	.|A	+|+	.|1	.|0	MCM8|MCM8	5896523|5896523	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.705000|7.705000	0.84606|0.84606	2.719000|2.719000	0.93026|0.93026	0.655000|0.655000	0.94253|0.94253	.|GCA	.		0.323	MCM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077900.1	NM_032485	
CACNA1E	777	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	181686266	181686266	+	Silent	SNP	G	G	A			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr1:181686266G>A	ENST00000367573.2	+	11	1353	c.1353G>A	c.(1351-1353)aaG>aaA	p.K451K	CACNA1E_ENST00000367567.4_Silent_p.K58K|CACNA1E_ENST00000367570.1_Silent_p.K451K|CACNA1E_ENST00000526775.1_Silent_p.K451K|CACNA1E_ENST00000360108.3_Silent_p.K451K|CACNA1E_ENST00000358338.5_Silent_p.K402K|CACNA1E_ENST00000357570.5_Silent_p.K402K	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	451					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						AAAGTGCAAAGGTAGACGGGG	0.517																																					p.K451K		.											.	.	.	0			c.G1353A						.						98.0	96.0	97.0					1																	181686266		1894	4118	6012	SO:0001819	synonymous_variant	777	exon11			TGCAAAGGTAGAC	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.1353G>A	1.37:g.181686266G>A		Somatic	23	0		WXS	Illumina HiSeq	.	37	5	NM_001205293	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Silent	SNP	ENST00000367573.2	37	CCDS55664.1																																																																																			.		0.517	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
FOXK1	221937	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	4722453	4722453	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr7:4722453G>T	ENST00000328914.4	+	1	514	c.514G>T	c.(514-516)Ggg>Tgg	p.G172W	FOXK1_ENST00000446823.1_Intron	NM_001037165.1	NP_001032242.1			forkhead box K1											breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;7.43e-15)		CTTCGTGGACGGGGCCTTCCA	0.731																																					p.G172W		.											.	.	.	0			c.G514T						.						10.0	10.0	10.0					7																	4722453		2194	4293	6487	SO:0001583	missense	221937	exon1			GTGGACGGGGCCT	BK004104	CCDS34591.1	7p22	2006-12-15			ENSG00000164916	ENSG00000164916		"""Forkhead boxes"""	23480	protein-coding gene	gene with protein product						15202027	Standard	NM_001037165		Approved	IMAGE:5164497	uc003snc.1	P85037	OTTHUMG00000151739	ENST00000328914.4:c.514G>T	7.37:g.4722453G>T	ENSP00000328720:p.Gly172Trp	Somatic	25	0		WXS	Illumina HiSeq	.	23	11	NM_001037165		Missense_Mutation	SNP	ENST00000328914.4	37	CCDS34591.1	.	.	.	.	.	.	.	.	.	.	g	22.7	4.320143	0.81469	.	.	ENSG00000164916	ENST00000328914;ENST00000545598	T	0.35236	1.32	3.3	3.3	0.37823	Forkhead-associated (FHA) domain (4);SMAD/FHA domain (1);	0.000000	0.64402	U	0.000001	T	0.66327	0.2778	M	0.92555	3.32	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.75563	-0.3274	10	0.87932	D	0	.	12.4439	0.55639	0.0:0.0:1.0:0.0	.	172;55	P85037;F5H8G8	FOXK1_HUMAN;.	W	172;55	ENSP00000328720:G172W	ENSP00000328720:G172W	G	+	1	0	FOXK1	4688979	1.000000	0.71417	1.000000	0.80357	0.782000	0.44232	6.616000	0.74205	1.565000	0.49641	0.282000	0.19409	GGG	.		0.731	FOXK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323729.2		
IFT172	26160	hgsc.bcm.edu;bcgsc.ca	37	2	27702379	27702379	+	Silent	SNP	G	G	A			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr2:27702379G>A	ENST00000260570.3	-	10	1105	c.1002C>T	c.(1000-1002)agC>agT	p.S334S	IFT172_ENST00000416524.2_Silent_p.S313S|IFT172_ENST00000359466.6_Silent_p.S334S	NM_015662.1	NP_056477.1	Q9UG01	IF172_HUMAN	intraflagellar transport 172	334					bone development (GO:0060348)|brain development (GO:0007420)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|epidermis development (GO:0008544)|heart looping (GO:0001947)|hindgut development (GO:0061525)|left/right axis specification (GO:0070986)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube closure (GO:0001843)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)	axoneme (GO:0005930)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)|vesicle (GO:0031982)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(17)|lung(17)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	43	Acute lymphoblastic leukemia(172;0.155)					TGCTTACCTGGCTAGGTCCCA	0.488																																					p.S334S		.											.	.	.	0			c.C1002T						.						155.0	135.0	142.0					2																	27702379		2203	4300	6503	SO:0001819	synonymous_variant	26160	exon10			TACCTGGCTAGGT	AB033005	CCDS1755.1	2p23.3	2014-07-03	2014-07-03		ENSG00000138002	ENSG00000138002		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	30391	protein-coding gene	gene with protein product	"""wimple homolog"""	607386	"""intraflagellar transport 172 homolog (Chlamydomonas)"""			10788441, 10574461, 24140113	Standard	XM_005264254		Approved	SLB, wim, osm-1, NPHP17	uc002rku.3	Q9UG01	OTTHUMG00000128425	ENST00000260570.3:c.1002C>T	2.37:g.27702379G>A		Somatic	77	0		WXS	Illumina HiSeq	.	60	4	NM_015662	A5PKZ0|B2RNU5|Q86X44|Q96HW4|Q9UFJ9|Q9ULP1	Silent	SNP	ENST00000260570.3	37	CCDS1755.1																																																																																			.		0.488	IFT172-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250213.2	NM_015662	
ARHGEF11	9826	hgsc.bcm.edu;bcgsc.ca	37	1	156914912	156914912	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr1:156914912C>T	ENST00000361409.2	-	29	3512	c.2770G>A	c.(2770-2772)Gta>Ata	p.V924I	ARHGEF11_ENST00000487682.1_5'UTR|ARHGEF11_ENST00000315174.8_Missense_Mutation_p.V340I|ARHGEF11_ENST00000368194.3_Missense_Mutation_p.V964I	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	924					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GTTTGTTTTACCGCTTCATTC	0.567																																					p.V964I		.											.	.	.	0			c.G2890A						.						104.0	107.0	106.0					1																	156914912		2203	4300	6503	SO:0001583	missense	9826	exon30			GTTTTACCGCTTC	AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.2770G>A	1.37:g.156914912C>T	ENSP00000354644:p.Val924Ile	Somatic	42	0		WXS	Illumina HiSeq	.	66	4	NM_198236	D3DVD0|Q5VY40|Q6PFW2	Missense_Mutation	SNP	ENST00000361409.2	37	CCDS1162.1	.	.	.	.	.	.	.	.	.	.	C	33	5.200697	0.94997	.	.	ENSG00000132694	ENST00000368194;ENST00000361409;ENST00000315174	T;T;T	0.69175	-0.38;-0.38;-0.38	5.28	5.28	0.74379	Dbl homology (DH) domain (2);	0.000000	0.52532	D	0.000074	T	0.73418	0.3584	L	0.48642	1.525	0.80722	D	1	B;D;D	0.76494	0.432;0.999;0.999	B;D;D	0.85130	0.323;0.988;0.997	T	0.71626	-0.4536	10	0.45353	T	0.12	-19.0723	18.6972	0.91605	0.0:1.0:0.0:0.0	.	340;924;964	F8W8P9;O15085;O15085-2	.;ARHGB_HUMAN;.	I	964;924;340	ENSP00000357177:V964I;ENSP00000354644:V924I;ENSP00000313470:V340I	ENSP00000313470:V340I	V	-	1	0	ARHGEF11	155181536	1.000000	0.71417	0.929000	0.37066	0.757000	0.42996	7.364000	0.79526	2.756000	0.94617	0.650000	0.86243	GTA	.		0.567	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000098931.1	NM_198236	
TIGD3	220359	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	65123582	65123582	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr11:65123582G>A	ENST00000309880.5	+	2	510	c.303G>A	c.(301-303)atG>atA	p.M101I		NM_145719.2	NP_663771.1	Q6B0B8	TIGD3_HUMAN	tigger transposable element derived 3	101	HTH CENPB-type. {ECO:0000255|PROSITE- ProRule:PRU00583}.					nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(3)|large_intestine(1)|lung(9)|prostate(2)|skin(2)	17						CGGGGCCCATGCTGCTCCACA	0.642																																					p.M101I		.											.	.	.	0			c.G303A						.						57.0	61.0	59.0					11																	65123582		2201	4297	6498	SO:0001583	missense	220359	exon2			GCCCATGCTGCTC		CCDS8101.1	11q13.1	2008-07-21				ENSG00000173825			18334	protein-coding gene	gene with protein product							Standard	NM_145719		Approved		uc001odo.4	Q6B0B8		ENST00000309880.5:c.303G>A	11.37:g.65123582G>A	ENSP00000308354:p.Met101Ile	Somatic	38	0		WXS	Illumina HiSeq	.	34	13	NM_145719		Missense_Mutation	SNP	ENST00000309880.5	37	CCDS8101.1	.	.	.	.	.	.	.	.	.	.	G	14.22	2.470433	0.43942	.	.	ENSG00000173825	ENST00000309880	T	0.12672	2.66	4.48	3.47	0.39725	Homeodomain-related (1);Pogo transposase / Cenp-B / PDC2, DNA-binding HTH domain (3);Homeodomain-like (1);	0.000000	0.41500	D	0.000864	T	0.07052	0.0179	N	0.11023	0.085	0.31863	N	0.620786	B	0.25441	0.126	B	0.28916	0.096	T	0.15838	-1.0423	10	0.19147	T	0.46	-13.4584	9.7262	0.40333	0.0:0.2114:0.7886:0.0	.	101	Q6B0B8	TIGD3_HUMAN	I	101	ENSP00000308354:M101I	ENSP00000308354:M101I	M	+	3	0	TIGD3	64880158	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	1.647000	0.37260	2.453000	0.82957	0.456000	0.33151	ATG	.		0.642	TIGD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387310.1	NM_145719	
CALCR	799	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	93055882	93055882	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr7:93055882C>T	ENST00000394441.1	-	13	1526	c.1211G>A	c.(1210-1212)cGc>cAc	p.R404H	CALCR_ENST00000426151.1_Missense_Mutation_p.R404H|CALCR_ENST00000359558.2_Missense_Mutation_p.R438H|CALCR_ENST00000360249.4_Missense_Mutation_p.R420H|CALCR_ENST00000421592.1_Missense_Mutation_p.R420H	NM_001164738.1	NP_001158210.1	P30988	CALCR_HUMAN	calcitonin receptor	438					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|response to glucocorticoid (GO:0051384)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcitonin binding (GO:0032841)|calcitonin receptor activity (GO:0004948)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(3)	45	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Pramlintide(DB01278)|Salmon Calcitonin(DB00017)	GGCCCATTGGCGCTTCACGGT	0.542																																					p.R438H		.											CALCR_ENST00000359558,NS,carcinoma,-1,2	CALCR_ENST00000359558	-1	0			c.G1313A						.						34.0	38.0	37.0					7																	93055882		2203	4300	6503	SO:0001583	missense	799	exon16			CATTGGCGCTTCA	L00587	CCDS5631.1, CCDS55125.1	7q21.3	2012-08-10			ENSG00000004948	ENSG00000004948		"""GPCR / Class B : Calcitonin receptors"""	1440	protein-coding gene	gene with protein product		114131				1331173	Standard	NM_001742		Approved	CTR	uc003umw.2	P30988	OTTHUMG00000023599	ENST00000394441.1:c.1211G>A	7.37:g.93055882C>T	ENSP00000377959:p.Arg404His	Somatic	23	0		WXS	Illumina HiSeq	.	21	8	NM_001164737	A4D1G6|F5H605|O14585|Q13941|Q5ZGL8|Q659U6|Q6DJU8|Q6T712	Missense_Mutation	SNP	ENST00000394441.1	37	CCDS5631.1	.	.	.	.	.	.	.	.	.	.	C	19.61	3.860068	0.71834	.	.	ENSG00000004948	ENST00000359558;ENST00000360249;ENST00000421592;ENST00000394441;ENST00000426151	T;T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17;-0.17	4.92	4.92	0.64577	.	.	.	.	.	T	0.80385	0.4613	M	0.85542	2.76	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.985	T	0.83058	-0.0149	9	0.87932	D	0	.	13.8286	0.63366	0.0:1.0:0.0:0.0	.	438;404	F5H605;A4D1G6	.;.	H	438;420;420;404;404	ENSP00000352561:R438H;ENSP00000353385:R420H;ENSP00000399552:R420H;ENSP00000377959:R404H;ENSP00000389295:R404H	ENSP00000352561:R438H	R	-	2	0	CALCR	92893818	1.000000	0.71417	0.999000	0.59377	0.322000	0.28314	5.785000	0.68998	2.728000	0.93425	0.585000	0.79938	CGC	.		0.542	CALCR-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254661.2	NM_001742	
CNTN4	152330	hgsc.bcm.edu	37	3	3072560	3072560	+	Missense_Mutation	SNP	A	A	G			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr3:3072560A>G	ENST00000397461.1	+	15	2068	c.1684A>G	c.(1684-1686)Atg>Gtg	p.M562V	CNTN4_ENST00000358480.3_Missense_Mutation_p.M343V|CNTN4_ENST00000427331.1_Missense_Mutation_p.M562V|CNTN4_ENST00000397459.2_Missense_Mutation_p.M234V|CNTN4_ENST00000418658.1_Missense_Mutation_p.M562V|CNTN4_ENST00000448906.2_Missense_Mutation_p.M234V	NM_001206955.1	NP_001193884.1	Q8IWV2	CNTN4_HUMAN	contactin 4	562	Ig-like C2-type 6.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|brain development (GO:0007420)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|neuron cell-cell adhesion (GO:0007158)|neuron projection development (GO:0031175)|regulation of synaptic plasticity (GO:0048167)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(19)|ovary(2)|pancreas(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		TGGTGATTTGATGATCCGAAA	0.438																																					p.M562V		.											CNTN4_ENST00000418658,NS,lymphoid_neoplasm,0,2	CNTN4_ENST00000418658	0	0			c.A1684G						.						143.0	132.0	136.0					3																	3072560		2203	4300	6503	SO:0001583	missense	152330	exon16			GATTTGATGATCC	AW665944	CCDS2558.1, CCDS43041.1	3p26.3	2013-02-11			ENSG00000144619	ENSG00000144619		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2174	protein-coding gene	gene with protein product		607280				8586965, 12202991	Standard	NM_175607		Approved	BIG-2	uc003bpc.3	Q8IWV2	OTTHUMG00000119031	ENST00000397461.1:c.1684A>G	3.37:g.3072560A>G	ENSP00000380602:p.Met562Val	Somatic	55	0		WXS	Illumina HiSeq	.	47	2	NM_175607	B2RAX3|Q8IX14|Q8TC35	Missense_Mutation	SNP	ENST00000397461.1	37	CCDS43041.1	.	.	.	.	.	.	.	.	.	.	A	19.80	3.895130	0.72639	.	.	ENSG00000144619	ENST00000418658;ENST00000397461;ENST00000427331;ENST00000358480;ENST00000397459;ENST00000448906	T;T;T;T;T;T	0.11495	2.77;2.77;2.77;2.77;2.77;2.77	5.33	5.33	0.75918	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.25568	0.0622	L	0.56280	1.765	0.80722	D	1	D;P;D	0.69078	0.968;0.786;0.997	P;P;D	0.71656	0.8;0.771;0.974	T	0.03493	-1.1031	10	0.15066	T	0.55	.	15.6241	0.76840	1.0:0.0:0.0:0.0	.	561;562;562	Q8IWV2-3;B3KTK4;Q8IWV2	.;.;CNTN4_HUMAN	V	562;562;562;343;234;234	ENSP00000396010:M562V;ENSP00000380602:M562V;ENSP00000413642:M562V;ENSP00000351267:M343V;ENSP00000380600:M234V;ENSP00000392077:M234V	ENSP00000351267:M343V	M	+	1	0	CNTN4	3047560	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.694000	0.91293	2.145000	0.66743	0.533000	0.62120	ATG	.		0.438	CNTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239236.2		
N4BP2	55728	hgsc.bcm.edu;bcgsc.ca	37	4	40133497	40133497	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr4:40133497C>T	ENST00000261435.6	+	13	5020	c.4604C>T	c.(4603-4605)gCc>gTc	p.A1535V		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	1535					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)			breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						ATATTTCCAGCCATTAACCAA	0.363																																					p.A1535V		.											.	.	.	0			c.C4604T						.						97.0	96.0	97.0					4																	40133497		2203	4300	6503	SO:0001583	missense	55728	exon13			TTCCAGCCATTAA	AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.4604C>T	4.37:g.40133497C>T	ENSP00000261435:p.Ala1535Val	Somatic	56	0		WXS	Illumina HiSeq	.	65	4	NM_018177	A0AVR3|Q9NVK2|Q9P2D4	Missense_Mutation	SNP	ENST00000261435.6	37	CCDS3457.1	.	.	.	.	.	.	.	.	.	.	C	15.28	2.786900	0.49997	.	.	ENSG00000078177	ENST00000261435;ENST00000381804	T	0.18810	2.19	5.23	4.39	0.52855	.	0.359574	0.28214	N	0.016173	T	0.15609	0.0376	N	0.22421	0.69	0.28984	N	0.88845	B;B	0.30686	0.29;0.191	B;B	0.32864	0.154;0.073	T	0.10660	-1.0620	10	0.56958	D	0.05	-0.9019	10.9521	0.47336	0.1462:0.7132:0.1407:0.0	.	1535;1535	Q86UW6-2;Q86UW6	.;N4BP2_HUMAN	V	1535;1455	ENSP00000261435:A1535V	ENSP00000261435:A1535V	A	+	2	0	N4BP2	39809892	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	3.696000	0.54757	1.202000	0.43218	-0.440000	0.05779	GCC	.		0.363	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250458.2	NM_018177	
CLUH	23277	hgsc.bcm.edu	37	17	2598253	2598253	+	Missense_Mutation	SNP	G	G	C			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr17:2598253G>C	ENST00000570628.2	-	16	2738	c.2633C>G	c.(2632-2634)cCg>cGg	p.P878R	CLUH_ENST00000538975.1_Missense_Mutation_p.P878R|CLUH_ENST00000435359.1_Missense_Mutation_p.P878R			O75153	CLU_HUMAN	clustered mitochondria (cluA/CLU1) homolog	878					intracellular distribution of mitochondria (GO:0048312)	cytoplasm (GO:0005737)											TGCAGCCCCCGGGGGCCGGTT	0.602																																					p.P878R		.											.,2	.	.	0			c.C2633G						.						28.0	32.0	31.0					17																	2598253		1852	4085	5937	SO:0001583	missense	23277	exon16			GCCCCCGGGGGCC	AB014564	CCDS45572.1	17p13.3	2012-12-18	2012-11-30	2012-11-30	ENSG00000132361	ENSG00000132361			29094	protein-coding gene	gene with protein product			"""KIAA0664"""	KIAA0664			Standard	XM_005256567		Approved	CLU1	uc002fuy.1	O75153	OTTHUMG00000177575	ENST00000570628.2:c.2633C>G	17.37:g.2598253G>C	ENSP00000458986:p.Pro878Arg	Somatic	32	0		WXS	Illumina HiSeq	.	32	4	NM_015229	Q6AHY2|Q6P3X7|Q6ZUG8|Q8N4U7|Q9BTA3|Q9H979	Missense_Mutation	SNP	ENST00000570628.2	37	CCDS45572.1	.	.	.	.	.	.	.	.	.	.	g	3.635	-0.074818	0.07184	.	.	ENSG00000132361	ENST00000435359;ENST00000322335;ENST00000538975	T;T	0.80304	-1.36;-1.36	5.48	4.37	0.52481	.	0.122706	0.56097	D	0.000023	T	0.72566	0.3476	L	0.37697	1.125	0.42761	D	0.993808	B;B	0.25048	0.117;0.117	B;B	0.37780	0.258;0.209	T	0.62506	-0.6840	10	0.18276	T	0.48	.	6.4298	0.21790	0.3346:0.0:0.6654:0.0	.	878;879	O75153;C9J6D7	K0664_HUMAN;.	R	878;879;878	ENSP00000388872:P878R;ENSP00000439628:P878R	ENSP00000320468:P879R	P	-	2	0	KIAA0664	2545003	0.971000	0.33674	0.724000	0.30704	0.241000	0.25554	2.362000	0.44169	1.066000	0.40716	0.556000	0.70494	CCG	.		0.602	CLUH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437807.2	NM_015229	
PSAP	5660	hgsc.bcm.edu;bcgsc.ca	37	10	73588681	73588681	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr10:73588681G>T	ENST00000394936.3	-	5	676	c.529C>A	c.(529-531)Ctc>Atc	p.L177I	PSAP_ENST00000394934.1_Missense_Mutation_p.L177I			P07602	SAP_HUMAN	prosaposin	177					blood coagulation (GO:0007596)|cellular response to organic substance (GO:0071310)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|glycosphingolipid metabolic process (GO:0006687)|lipid transport (GO:0006869)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catalytic activity (GO:0043085)|prostate gland growth (GO:0060736)|regulation of lipid metabolic process (GO:0019216)|regulation of MAPK cascade (GO:0043408)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|lipid binding (GO:0008289)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	13						TAGAGGAGGAGAGGGATGTTG	0.582																																					p.L177I		.											.	.	.	0			c.C529A						.						68.0	66.0	67.0					10																	73588681		2203	4300	6503	SO:0001583	missense	5660	exon5			GGAGGAGAGGGAT	BC004275	CCDS7311.1	10q21-q22	2014-01-30	2008-07-31		ENSG00000197746	ENSG00000197746		"""Endogenous ligands"""	9498	protein-coding gene	gene with protein product	"""variant Gaucher disease and variant metachromatic leukodystrophy"""	176801	"""sphingolipid activator protein-1"""	SAP1, GLBA		2717620	Standard	NM_001042465		Approved		uc001jsm.3	P07602	OTTHUMG00000018429	ENST00000394936.3:c.529C>A	10.37:g.73588681G>T	ENSP00000378394:p.Leu177Ile	Somatic	53	0		WXS	Illumina HiSeq	.	55	4	NM_001042466	P07292|P15793|P78538|P78541|P78546|P78547|P78558|Q53Y86|Q6IBQ6|Q92739|Q92740|Q92741|Q92742	Missense_Mutation	SNP	ENST00000394936.3	37	CCDS7311.1	.	.	.	.	.	.	.	.	.	.	G	19.09	3.760639	0.69763	.	.	ENSG00000197746	ENST00000394936;ENST00000373120;ENST00000357471;ENST00000394934;ENST00000404083;ENST00000394940	T;T	0.72051	-0.62;-0.61	5.06	4.15	0.48705	.	0.445971	0.24933	N	0.034448	T	0.77350	0.4117	M	0.75264	2.295	0.37503	D	0.916834	D	0.54601	0.967	P	0.53224	0.721	T	0.79524	-0.1768	10	0.32370	T	0.25	-1.51	13.5169	0.61545	0.0773:0.0:0.9227:0.0	.	177	P07602	SAP_HUMAN	I	177;177;177;177;180;102	ENSP00000378394:L177I;ENSP00000378392:L177I	ENSP00000350063:L177I	L	-	1	0	PSAP	73258687	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.285000	0.58989	1.269000	0.44280	0.313000	0.20887	CTC	.		0.582	PSAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048553.1	NM_002778	
GRIN2D	2906	hgsc.bcm.edu	37	19	48925132	48925132	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr19:48925132G>A	ENST00000263269.3	+	10	2270	c.2182G>A	c.(2182-2184)Gac>Aac	p.D728N		NM_000836.2	NP_000827.2	O15399	NMDE4_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	728					adult locomotory behavior (GO:0008344)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|regulation of sensory perception of pain (GO:0051930)|signal transduction (GO:0007165)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			autonomic_ganglia(1)|breast(6)|endometrium(2)|large_intestine(9)|lung(12)|ovary(5)|pancreas(1)|prostate(1)	37		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CAACTATCCCGACATGCACAG	0.647																																					p.D728N		.											GRIN2D,NS,carcinoma,0,1	GRIN2D	0	0			c.G2182A						.						98.0	91.0	93.0					19																	48925132		2203	4300	6503	SO:0001583	missense	2906	exon10			TATCCCGACATGC	U77783	CCDS12719.1	19q13.33	2012-08-29			ENSG00000105464	ENSG00000105464		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4588	protein-coding gene	gene with protein product	"""N-methyl-d-aspartate receptor subunit 2D"""	602717		NMDAR2D		9480759, 9418891	Standard	NM_000836		Approved	GluN2D, EB11, NR2D	uc002pjc.4	O15399		ENST00000263269.3:c.2182G>A	19.37:g.48925132G>A	ENSP00000263269:p.Asp728Asn	Somatic	16	0		WXS	Illumina HiSeq	.	40	2	NM_000836		Missense_Mutation	SNP	ENST00000263269.3	37	CCDS12719.1	.	.	.	.	.	.	.	.	.	.	G	19.58	3.853415	0.71719	.	.	ENSG00000105464	ENST00000263269	T	0.26957	1.7	4.57	4.57	0.56435	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.113273	0.56097	D	0.000032	T	0.28400	0.0702	L	0.38175	1.15	0.53005	D	0.999962	D	0.54207	0.965	P	0.47044	0.535	T	0.03202	-1.1061	10	0.52906	T	0.07	.	16.6522	0.85219	0.0:0.0:1.0:0.0	.	728	O15399	NMDE4_HUMAN	N	728	ENSP00000263269:D728N	ENSP00000263269:D728N	D	+	1	0	GRIN2D	53616944	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.655000	0.83696	2.538000	0.85594	0.655000	0.94253	GAC	.		0.647	GRIN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466121.1		
SCN3B	55800	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	123513240	123513240	+	Missense_Mutation	SNP	C	C	G			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr11:123513240C>G	ENST00000392770.2	-	3	1161	c.359G>C	c.(358-360)tGc>tCc	p.C120S	SCN3B_ENST00000299333.3_Missense_Mutation_p.C120S|SCN3B_ENST00000530277.1_Missense_Mutation_p.C120S	NM_018400.3	NP_060870.1	Q9NY72	SCN3B_HUMAN	sodium channel, voltage-gated, type III, beta subunit	120	Ig-like C2-type.				atrial cardiac muscle cell action potential (GO:0086014)|axon guidance (GO:0007411)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|positive regulation of heart rate (GO:0010460)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|ventricular cardiac muscle cell action potential (GO:0086005)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ion channel binding (GO:0044325)|sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|skin(2)	26		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.37e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0227)	Valproic Acid(DB00313)|Zonisamide(DB00909)	GGACACATTGCAGGTGTAGAG	0.597																																					p.C120S		.											.	.	.	0			c.G359C						.						102.0	95.0	97.0					11																	123513240		2202	4299	6501	SO:0001583	missense	55800	exon3			ACATTGCAGGTGT	AJ243396	CCDS8442.1	11q24.1	2014-09-17	2012-02-28		ENSG00000166257	ENSG00000166257		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"""	20665	protein-coding gene	gene with protein product		608214	"""sodium channel, voltage-gated, type III, beta"""			10688874	Standard	XR_428980		Approved	HSA243396	uc001pzb.1	Q9NY72	OTTHUMG00000166006	ENST00000392770.2:c.359G>C	11.37:g.123513240C>G	ENSP00000376523:p.Cys120Ser	Somatic	19	0		WXS	Illumina HiSeq	.	31	12	NM_018400	A5H1I5|Q17RL3|Q9ULR2	Missense_Mutation	SNP	ENST00000392770.2	37	CCDS8442.1	.	.	.	.	.	.	.	.	.	.	C	34	5.294365	0.95546	.	.	ENSG00000166257	ENST00000392770;ENST00000299333;ENST00000530277;ENST00000527836	D;D;D;D	0.99080	-5.4;-5.4;-5.4;-5.4	6.03	6.03	0.97812	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.99393	0.9786	M	0.85945	2.785	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.99316	1.0905	10	0.87932	D	0	-4.2253	20.5666	0.99351	0.0:1.0:0.0:0.0	.	120	Q9NY72	SCN3B_HUMAN	S	120	ENSP00000376523:C120S;ENSP00000299333:C120S;ENSP00000432785:C120S;ENSP00000435554:C120S	ENSP00000299333:C120S	C	-	2	0	SCN3B	123018450	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.410000	0.80065	2.854000	0.98071	0.655000	0.94253	TGC	.		0.597	SCN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387412.1	NM_018400	
PNPLA6	10908	hgsc.bcm.edu	37	19	7625960	7625960	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr19:7625960C>T	ENST00000221249.6	+	33	4194	c.3763C>T	c.(3763-3765)Ccc>Tcc	p.P1255S	PNPLA6_ENST00000545201.2_Missense_Mutation_p.P1228S|PNPLA6_ENST00000600737.1_Missense_Mutation_p.P1293S|PNPLA6_ENST00000414982.3_Missense_Mutation_p.P1303S|PNPLA6_ENST00000450331.3_Missense_Mutation_p.P1255S	NM_006702.4	NP_006693.3	Q8IY17	PLPL6_HUMAN	patatin-like phospholipase domain containing 6	1294					angiogenesis (GO:0001525)|cell death (GO:0008219)|lipid catabolic process (GO:0016042)|organ morphogenesis (GO:0009887)|phosphatidylcholine metabolic process (GO:0046470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipase activity (GO:0004622)	p.T1257fs*17(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)	35						CCGGATTGAGCCCCCCACGAG	0.642																																					p.P1303S		.											.,1	.	163	1	Deletion - Frameshift(1)	large_intestine(1)	c.C3907T						.						33.0	32.0	32.0					19																	7625960		2203	4300	6503	SO:0001583	missense	10908	exon32			ATTGAGCCCCCCA	AJ004832	CCDS32891.1, CCDS54206.1, CCDS54207.1, CCDS59343.1	19p13.2	2013-09-11						"""Patatin-like phospholipase domain containing"""	16268	protein-coding gene	gene with protein product	"""neuropathy target esterase"""	603197				9576844, 16799181, 19029121	Standard	NM_006702		Approved	NTE, sws, iPLA2delta, SPG39	uc010xjq.2	Q8IY17		ENST00000221249.6:c.3763C>T	19.37:g.7625960C>T	ENSP00000221249:p.Pro1255Ser	Somatic	31	0		WXS	Illumina HiSeq	.	36	2	NM_001166111	A6NGQ0|B4DFB9|B7Z7T2|F5H5K9|J3KQS3|O60859|Q86W58|Q9UG58	Missense_Mutation	SNP	ENST00000221249.6	37	CCDS32891.1	.	.	.	.	.	.	.	.	.	.	c	18.65	3.670156	0.67814	.	.	ENSG00000032444	ENST00000221249;ENST00000545201;ENST00000414982;ENST00000450331	T;T;T;T	0.04156	3.71;3.76;3.69;3.71	4.7	4.7	0.59300	.	0.000000	0.64402	D	0.000003	T	0.21103	0.0508	M	0.76574	2.34	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.998	D;D;D;D	0.97110	1.0;1.0;1.0;0.951	T	0.00282	-1.1850	10	0.72032	D	0.01	-29.4302	15.1627	0.72798	0.0:1.0:0.0:0.0	.	1294;1228;1293;1255	Q8IY17;F5H5K9;Q8IY17-3;Q8IY17-2	PLPL6_HUMAN;.;.;.	S	1255;1228;1303;1255	ENSP00000221249:P1255S;ENSP00000443323:P1228S;ENSP00000407509:P1303S;ENSP00000394348:P1255S	ENSP00000221249:P1255S	P	+	1	0	PNPLA6	7531960	1.000000	0.71417	1.000000	0.80357	0.328000	0.28507	7.304000	0.78882	2.423000	0.82170	0.561000	0.74099	CCC	.		0.642	PNPLA6-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459275.1	NM_006702	
MGARP	84709	hgsc.bcm.edu	37	4	140196546	140196546	+	Splice_Site	SNP	G	G	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr4:140196546G>T	ENST00000398955.1	-	2	262	c.83C>A	c.(82-84)gCa>gAa	p.A28E		NM_032623.3	NP_116012.2	Q8TDB4	HUMMR_HUMAN	mitochondria-localized glutamic acid-rich protein	28					anterograde axon cargo transport (GO:0008089)|axon transport of mitochondrion (GO:0019896)|cellular response to gonadotropin-releasing hormone (GO:0097211)|cellular response to hypoxia (GO:0071456)|cellular response to steroid hormone stimulus (GO:0071383)|positive regulation of mitochondrion organization (GO:0010822)|protein targeting to mitochondrion (GO:0006626)|retrograde axon cargo transport (GO:0008090)	integral component of mitochondrial outer membrane (GO:0031307)|mitochondrion (GO:0005739)											GCGCAGAGATGCTAGGAAAAA	0.358																																					p.A28E		.											C4orf49,NS,chondrosarcoma,0,1	C4orf49	0	0			c.C83A						.						84.0	75.0	78.0					4																	140196546		1875	4109	5984	SO:0001630	splice_region_variant	84709	exon2			AGAGATGCTAGGA	AF484960	CCDS43269.1	4q31.1	2014-02-19	2014-02-19	2012-04-17	ENSG00000137463	ENSG00000137463			29969	protein-coding gene	gene with protein product	"""ovary-specific acidic protein"", ""corneal endothelium-specific protein 1"", ""hypoxia up-regulated mitochondrial movement regulator"""		"""chromosome 4 open reading frame 49"""	C4orf49			Standard	NM_032623		Approved	OSAP, CESP-1, HUMMR	uc003ihr.1	Q8TDB4	OTTHUMG00000161325	ENST00000398955.1:c.83-1C>A	4.37:g.140196546G>T		Somatic	30	0		WXS	Illumina HiSeq	.	37	2	NM_032623	Q9BZC3	Missense_Mutation	SNP	ENST00000398955.1	37	CCDS43269.1	.	.	.	.	.	.	.	.	.	.	G	19.44	3.827214	0.71143	.	.	ENSG00000137463	ENST00000398955	T	0.54866	0.55	5.73	3.96	0.45880	.	0.138338	0.47852	D	0.000213	T	0.66489	0.2794	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.65434	-0.6169	10	0.52906	T	0.07	.	8.3003	0.32010	0.1884:0.0:0.8116:0.0	.	28	Q8TDB4	CD049_HUMAN	E	28	ENSP00000381928:A28E	ENSP00000381928:A28E	A	-	2	0	C4orf49	140415996	0.999000	0.42202	0.999000	0.59377	0.989000	0.77384	1.369000	0.34227	0.841000	0.35020	0.555000	0.69702	GCA	.		0.358	MGARP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364536.1	NM_032623	Missense_Mutation
ZNF7	7553	hgsc.bcm.edu;bcgsc.ca	37	8	146067377	146067377	+	Silent	SNP	G	G	A			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr8:146067377G>A	ENST00000528372.1	+	5	1125	c.885G>A	c.(883-885)caG>caA	p.Q295Q	ZNF7_ENST00000325217.5_Intron|ZNF7_ENST00000525266.1_Intron|ZNF7_ENST00000544249.1_Silent_p.Q199Q|ZNF7_ENST00000446747.2_Silent_p.Q306Q|ZNF7_ENST00000325241.6_Silent_p.Q295Q			P17097	ZNF7_HUMAN	zinc finger protein 7	295					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|ovary(5)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.0812)|Ovarian(118;0.0822)|Acute lymphoblastic leukemia(644;0.143)	Epithelial(56;8.75e-39)|OV - Ovarian serous cystadenocarcinoma(54;1.13e-38)|all cancers(56;8.48e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;2.11e-07)		AACTTATTCAGCATCAAAGAA	0.478																																					p.Q295Q		.											.	.	.	0			c.G885A						.						67.0	73.0	71.0					8																	146067377		2203	4300	6503	SO:0001819	synonymous_variant	7553	exon5			TATTCAGCATCAA	AB209619	CCDS6435.1, CCDS64996.1, CCDS64998.1, CCDS64999.1	8q24	2013-01-08	2006-05-09		ENSG00000147789	ENSG00000147789		"""Zinc fingers, C2H2-type"", ""-"""	13139	protein-coding gene	gene with protein product		194531	"""zinc finger protein 7 (KOX 4, clone HF.16)"""			2106481, 1946370	Standard	NM_003416		Approved	KOX4, HF.16	uc003zeg.4	P17097	OTTHUMG00000165200	ENST00000528372.1:c.885G>A	8.37:g.146067377G>A		Somatic	31	0		WXS	Illumina HiSeq	.	44	4	NM_003416	B4DT08|D3DWN6|P17015|Q8N8Y4	Silent	SNP	ENST00000528372.1	37	CCDS6435.1																																																																																			.		0.478	ZNF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382660.1	NM_003416	
TEX2	55852	hgsc.bcm.edu	37	17	62248512	62248512	+	Silent	SNP	G	G	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr17:62248512G>T	ENST00000583097.1	-	7	2791	c.2619C>A	c.(2617-2619)ggC>ggA	p.G873G	TEX2_ENST00000584379.1_Silent_p.G873G|TEX2_ENST00000258991.3_Silent_p.G880G			Q8IWB9	TEX2_HUMAN	testis expressed 2	873					signal transduction (GO:0007165)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)				breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		GCACAGCCACGCCCATGTCAA	0.443																																					p.G880G		.											TEX2,NS,carcinoma,0,1	TEX2	0	0			c.C2640A						.						126.0	105.0	112.0					17																	62248512		2203	4300	6503	SO:0001819	synonymous_variant	55852	exon7			AGCCACGCCCATG	AB051525	CCDS11658.1, CCDS74131.1	17q23.3	2007-03-13	2007-03-13			ENSG00000136478			30884	protein-coding gene	gene with protein product	"""transmembrane protein 96"""		"""testis expressed sequence 2"""			11214970	Standard	XM_005257507		Approved	HT008, TMEM96, KIAA1738	uc002jee.3	Q8IWB9		ENST00000583097.1:c.2619C>A	17.37:g.62248512G>T		Somatic	34	0		WXS	Illumina HiSeq	.	30	3	NM_018469	Q6AHZ5|Q8N3L0|Q9C0C5	Silent	SNP	ENST00000583097.1	37																																																																																				.		0.443	TEX2-003	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000443745.1	NM_018469	
TTC37	9652	hgsc.bcm.edu	37	5	94852864	94852864	+	Silent	SNP	G	G	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr5:94852864G>T	ENST00000358746.2	-	21	2575	c.2277C>A	c.(2275-2277)ctC>ctA	p.L759L	TTC37_ENST00000515176.1_5'Flank	NM_014639.3	NP_055454.1	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37	759						cytoplasm (GO:0005737)|nucleus (GO:0005634)|Ski complex (GO:0055087)|transcriptionally active chromatin (GO:0035327)		p.L759L(1)		breast(2)|endometrium(6)|kidney(3)|large_intestine(13)|liver(1)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	47						CTCCAAGGTGGAGGAGCTCAT	0.358																																					p.L759L		.											TTC37,NS,carcinoma,0,1	TTC37	0	1	Substitution - coding silent(1)	lung(1)	c.C2277A						.						96.0	86.0	89.0					5																	94852864		2203	4299	6502	SO:0001819	synonymous_variant	9652	exon21			AAGGTGGAGGAGC	AB002370	CCDS4072.1	5q15	2014-09-17	2008-06-11	2008-06-11	ENSG00000198677	ENSG00000198677		"""Tetratricopeptide (TTC) repeat domain containing"""	23639	protein-coding gene	gene with protein product		614589	"""KIAA0372"""	KIAA0372		9205841	Standard	NM_014639		Approved		uc003klb.3	Q6PGP7	OTTHUMG00000121165	ENST00000358746.2:c.2277C>A	5.37:g.94852864G>T		Somatic	36	0		WXS	Illumina HiSeq	.	42	2	NM_014639	O15077|Q6PJI3	Silent	SNP	ENST00000358746.2	37	CCDS4072.1																																																																																			.		0.358	TTC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241651.1	NM_014639	
MGME1	92667	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	17956445	17956445	+	Missense_Mutation	SNP	G	G	C			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr20:17956445G>C	ENST00000377710.5	+	3	918	c.630G>C	c.(628-630)caG>caC	p.Q210H	MGME1_ENST00000377704.4_Intron|MGME1_ENST00000467391.1_Intron|MGME1_ENST00000377709.1_Missense_Mutation_p.Q130H	NM_052865.2	NP_443097.1			mitochondrial genome maintenance exonuclease 1																		AAAGTGTCCAGCATATTCTGA	0.433																																					p.Q210H		.											.	.	.	0			c.G630C						.						111.0	107.0	108.0					20																	17956445		2203	4300	6503	SO:0001583	missense	92667	exon3			TGTCCAGCATATT		CCDS13131.1	20p11.23	2013-08-29	2013-01-11	2013-01-11	ENSG00000125871	ENSG00000125871			16205	protein-coding gene	gene with protein product		615076	"""chromosome 20 open reading frame 72"""	C20orf72		23313956, 23358826, 23434322	Standard	NM_052865		Approved	bA504H3.4, DDK1	uc002wqh.3	Q9BQP7	OTTHUMG00000031955	ENST00000377710.5:c.630G>C	20.37:g.17956445G>C	ENSP00000366939:p.Gln210His	Somatic	43	0		WXS	Illumina HiSeq	.	45	12	NM_052865		Missense_Mutation	SNP	ENST00000377710.5	37	CCDS13131.1	.	.	.	.	.	.	.	.	.	.	G	17.69	3.452797	0.63290	.	.	ENSG00000125871	ENST00000377710;ENST00000377709	T;T	0.47869	0.83;0.87	5.49	5.49	0.81192	.	0.309656	0.37012	N	0.002286	T	0.61476	0.2350	M	0.75264	2.295	0.80722	D	1	D	0.56287	0.975	P	0.55011	0.766	T	0.64309	-0.6438	10	0.54805	T	0.06	-6.4183	13.1259	0.59354	0.083:0.0:0.917:0.0	.	210	Q9BQP7	CT072_HUMAN	H	210;130	ENSP00000366939:Q210H;ENSP00000366938:Q130H	ENSP00000366938:Q130H	Q	+	3	2	C20orf72	17904445	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	1.870000	0.39529	2.575000	0.86900	0.655000	0.94253	CAG	.		0.433	MGME1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078139.1	NM_052865	
CCSER1	401145	hgsc.bcm.edu;bcgsc.ca	37	4	91234071	91234071	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr4:91234071G>T	ENST00000509176.1	+	3	1670	c.1382G>T	c.(1381-1383)cGa>cTa	p.R461L	CCSER1_ENST00000333691.8_Missense_Mutation_p.R461L|CCSER1_ENST00000432775.2_Missense_Mutation_p.R461L	NM_001145065.1	NP_001138537.1	Q9C0I3	CCSE1_HUMAN	coiled-coil serine-rich protein 1	461																	AGGAGACTGCGATCCTCGTCA	0.363																																					p.R461L		.											.	.	.	0			c.G1382T						.						39.0	37.0	38.0					4																	91234071		1847	4102	5949	SO:0001583	missense	401145	exon3			GACTGCGATCCTC		CCDS47099.1, CCDS47100.1	4q22.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184305	ENSG00000184305			29349	protein-coding gene	gene with protein product			"""family with sequence similarity 190, member A"""	FAM190A		11214970	Standard	NM_001145065		Approved	KIAA1680	uc003hsv.4	Q9C0I3	OTTHUMG00000160950	ENST00000509176.1:c.1382G>T	4.37:g.91234071G>T	ENSP00000425040:p.Arg461Leu	Somatic	87	0		WXS	Illumina HiSeq	.	85	4	NM_001145065	Q4W5M0|Q86V57	Missense_Mutation	SNP	ENST00000509176.1	37	CCDS47099.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.834723	0.91036	.	.	ENSG00000184305	ENST00000509176;ENST00000432775;ENST00000333691;ENST00000458365	T;T;T	0.65178	0.29;-0.14;0.29	4.67	4.67	0.58626	.	0.067953	0.56097	D	0.000037	T	0.74809	0.3765	L	0.48642	1.525	0.41763	D	0.989726	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	T	0.77800	-0.2452	10	0.72032	D	0.01	-4.2679	18.457	0.90724	0.0:0.0:1.0:0.0	.	461;461;461	Q9C0I3-2;Q9C0I3;E7EUW0	.;F190A_HUMAN;.	L	461	ENSP00000425040:R461L;ENSP00000389283:R461L;ENSP00000329482:R461L	ENSP00000329482:R461L	R	+	2	0	FAM190A	91453094	1.000000	0.71417	0.992000	0.48379	0.980000	0.70556	8.286000	0.89916	2.517000	0.84864	0.591000	0.81541	CGA	.		0.363	CCSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363109.3	NM_001145065	
EPRS	2058	hgsc.bcm.edu	37	1	220195933	220195933	+	Intron	SNP	G	G	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr1:220195933G>T	ENST00000366923.3	-	9	1213					NM_004446.2	NP_004437.2	P07814	SYEP_HUMAN	glutamyl-prolyl-tRNA synthetase						cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|negative regulation of translation (GO:0017148)|prolyl-tRNA aminoacylation (GO:0006433)|protein complex assembly (GO:0006461)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|GAIT complex (GO:0097452)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|proline-tRNA ligase activity (GO:0004827)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(11)|kidney(2)|large_intestine(13)|lung(24)|ovary(1)|prostate(3)|skin(2)|stomach(2)|urinary_tract(3)	63				GBM - Glioblastoma multiforme(131;0.0735)	L-Proline(DB00172)	GCTATAATTTGATATAAATTT	0.289																																					.		.											.	.	.	0			.						.																																			SO:0001627	intron_variant	26828	.			TAATTTGATATAA	X54326	CCDS31027.1	1q41	2011-07-01			ENSG00000136628	ENSG00000136628	6.1.1.15, 6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"", ""Aminoacyl tRNA synthetases / Class II"""	3418	protein-coding gene	gene with protein product	"""glutamate tRNA ligase"", ""proline tRNA ligase"""	138295		QPRS, QARS		1988429	Standard	NM_004446		Approved	EARS, PARS, GLUPRORS	uc001hly.1	P07814	OTTHUMG00000037433	ENST00000366923.3:c.944-73C>A	1.37:g.220195933G>T		Somatic	35	0		WXS	Illumina HiSeq	.	41	10	.	A0AVA9|B9EGH3|Q05BP6|Q05DF8|Q5DSM1|Q5H9S5|Q6PD57|Q86X73	RNA	SNP	ENST00000366923.3	37	CCDS31027.1																																																																																			.		0.289	EPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091133.2	NM_004446	
SLC9C1	285335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	111958835	111958835	+	Nonsense_Mutation	SNP	G	G	C			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr3:111958835G>C	ENST00000305815.5	-	12	1550	c.1298C>G	c.(1297-1299)tCa>tGa	p.S433*	SLC9C1_ENST00000487372.1_Nonsense_Mutation_p.S385*	NM_183061.1	NP_898884.1	Q4G0N8	SL9C1_HUMAN	solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1	433					cell differentiation (GO:0030154)|ion transmembrane transport (GO:0034220)|multicellular organismal development (GO:0007275)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)										ATATTTTGTTGATGTGGCATC	0.348																																					p.S433X		.											.	.	.	0			c.C1298G						.						110.0	98.0	102.0					3																	111958835		2203	4300	6503	SO:0001587	stop_gained	285335	exon12			TTTGTTGATGTGG	AK128084	CCDS33817.1	3q13	2013-05-22	2012-03-22	2012-03-22	ENSG00000172139	ENSG00000172139		"""Solute carriers"""	31401	protein-coding gene	gene with protein product	"""sperm-NHE"""	612738	"""solute carrier family 9, isoform 10"", ""solute carrier family 9, member 10"""	SLC9A10		12783626	Standard	NM_183061		Approved	NHE	uc003dyu.3	Q4G0N8	OTTHUMG00000159245	ENST00000305815.5:c.1298C>G	3.37:g.111958835G>C	ENSP00000306627:p.Ser433*	Somatic	36	0		WXS	Illumina HiSeq	.	39	10	NM_183061	Q6ZRP4|Q7RTP2	Nonsense_Mutation	SNP	ENST00000305815.5	37	CCDS33817.1	.	.	.	.	.	.	.	.	.	.	G	37	6.242547	0.97408	.	.	ENSG00000172139	ENST00000305815;ENST00000487372	.	.	.	5.48	4.5	0.54988	.	0.151221	0.31589	N	0.007388	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	-16.3678	6.2206	0.20679	0.1568:0.0:0.8432:0.0	.	.	.	.	X	433;385	.	ENSP00000306627:S433X	S	-	2	0	SLC9A10	113441525	1.000000	0.71417	1.000000	0.80357	0.442000	0.32017	3.299000	0.51826	2.565000	0.86533	0.511000	0.50034	TCA	.		0.348	SLC9C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354066.1	NM_183061	
CELSR2	1952	hgsc.bcm.edu	37	1	109813581	109813581	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr1:109813581G>T	ENST00000271332.3	+	25	7577	c.7516G>T	c.(7516-7518)Ggg>Tgg	p.G2506W	CELSR2_ENST00000498157.1_3'UTR	NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	2506					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.G2506W(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CGAGGGCTACGGGAACCCTGA	0.642																																					p.G2506W	NSCLC(158;1285 2011 34800 34852 42084)	.											CELSR2,colon,NS,0,1	CELSR2	0	1	Substitution - Missense(1)	large_intestine(1)	c.G7516T						.						158.0	151.0	153.0					1																	109813581		2203	4300	6503	SO:0001583	missense	1952	exon25			GGCTACGGGAACC	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.7516G>T	1.37:g.109813581G>T	ENSP00000271332:p.Gly2506Trp	Somatic	39	1		WXS	Illumina HiSeq	.	45	2	NM_001408	Q5T2Y7|Q92566	Missense_Mutation	SNP	ENST00000271332.3	37	CCDS796.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.650366	0.87958	.	.	ENSG00000143126	ENST00000271332	T	0.49139	0.79	4.59	4.59	0.56863	GPCR, family 2-like (1);	.	.	.	.	T	0.78278	0.4258	H	0.97983	4.12	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87155	0.2211	9	0.87932	D	0	.	17.5928	0.88001	0.0:0.0:1.0:0.0	.	2506	Q9HCU4	CELR2_HUMAN	W	2506	ENSP00000271332:G2506W	ENSP00000271332:G2506W	G	+	1	0	CELSR2	109615104	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.366000	0.79548	2.377000	0.81083	0.561000	0.74099	GGG	.		0.642	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	
MYO7A	4647	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	76883884	76883884	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr11:76883884C>A	ENST00000409709.3	+	16	2160	c.1888C>A	c.(1888-1890)Ccc>Acc	p.P630T	MYO7A_ENST00000409893.1_Missense_Mutation_p.P630T|MYO7A_ENST00000409619.2_Missense_Mutation_p.P619T|MYO7A_ENST00000458637.2_Missense_Mutation_p.P630T	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	630	Myosin motor.				actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						TGCCTGCCAGCCCTTCTTTGT	0.647																																					p.P630T		.											.	.	.	0			c.C1888A						.						23.0	26.0	25.0					11																	76883884		2006	4074	6080	SO:0001583	missense	4647	exon16			TGCCAGCCCTTCT	U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.1888C>A	11.37:g.76883884C>A	ENSP00000386331:p.Pro630Thr	Somatic	53	0		WXS	Illumina HiSeq	.	39	17	NM_001127179	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Missense_Mutation	SNP	ENST00000409709.3	37	CCDS53683.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.706461	0.89018	.	.	ENSG00000137474	ENST00000409709;ENST00000409893;ENST00000458637;ENST00000409619;ENST00000358342;ENST00000343356;ENST00000341717;ENST00000343419	D;D;D;D	0.90197	-2.63;-2.63;-2.63;-2.63	4.77	4.77	0.60923	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.96097	0.8728	M	0.89414	3.03	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.96939	0.9686	10	0.87932	D	0	.	18.1567	0.89693	0.0:1.0:0.0:0.0	.	630;630;630	B9A012;F8VUN5;Q13402	.;.;MYO7A_HUMAN	T	630;630;630;619;629;629;506;629	ENSP00000386331:P630T;ENSP00000386689:P630T;ENSP00000392185:P630T;ENSP00000386635:P619T	ENSP00000345075:P506T	P	+	1	0	MYO7A	76561532	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.339000	0.79282	2.368000	0.80403	0.549000	0.68633	CCC	.		0.647	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328133.1	NM_000260	
ARHGAP36	158763	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	130218321	130218321	+	Missense_Mutation	SNP	C	C	G			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chrX:130218321C>G	ENST00000276211.5	+	5	1033	c.688C>G	c.(688-690)Ccg>Gcg	p.P230A	ARHGAP36_ENST00000370921.1_Missense_Mutation_p.P94A|ARHGAP36_ENST00000370922.1_Missense_Mutation_p.P218A	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	230	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						GAGTCTCAATCCGATTGCGAA	0.473																																					p.P230A		.											.	.	.	0			c.C688G						.						49.0	46.0	47.0					X																	130218321		2203	4300	6503	SO:0001583	missense	158763	exon5			CTCAATCCGATTG		CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.688C>G	X.37:g.130218321C>G	ENSP00000276211:p.Pro230Ala	Somatic	49	0		WXS	Illumina HiSeq	.	44	13	NM_144967	B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Missense_Mutation	SNP	ENST00000276211.5	37	CCDS14628.1	.	.	.	.	.	.	.	.	.	.	C	15.35	2.808827	0.50421	.	.	ENSG00000147256	ENST00000276211;ENST00000370922;ENST00000423277;ENST00000412432;ENST00000370921	T;T;T;T;T	0.40476	2.71;2.7;1.03;1.03;1.03	4.99	4.99	0.66335	Rho GTPase-activating protein domain (1);Rho GTPase activation protein (1);	0.000000	0.50627	D	0.000113	T	0.58206	0.2106	M	0.62266	1.93	0.54753	D	0.999982	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.85130	0.997;0.997;0.994	T	0.52704	-0.8540	10	0.24483	T	0.36	.	12.5345	0.56135	0.0:1.0:0.0:0.0	.	199;218;230	Q6ZRI8-2;Q6ZRI8-4;Q6ZRI8	.;.;RHG36_HUMAN	A	230;218;182;199;94	ENSP00000276211:P230A;ENSP00000359960:P218A;ENSP00000409218:P182A;ENSP00000408515:P199A;ENSP00000359959:P94A	ENSP00000276211:P230A	P	+	1	0	ARHGAP36	130046002	1.000000	0.71417	0.955000	0.39395	0.138000	0.21146	6.439000	0.73430	2.451000	0.82905	0.529000	0.55759	CCG	.		0.473	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355073.1	NM_144967	
IQCA1	79781	hgsc.bcm.edu	37	2	237233410	237233410	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr2:237233410G>T	ENST00000409907.3	-	19	2664	c.2390C>A	c.(2389-2391)aCt>aAt	p.T797N	IQCA1_ENST00000309507.5_Missense_Mutation_p.T794N|IQCA1_ENST00000431676.2_Missense_Mutation_p.T756N	NM_024726.4	NP_079002.3	Q86XH1	IQCA1_HUMAN	IQ motif containing with AAA domain 1	797							ATP binding (GO:0005524)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(1)	26						ACCCAGAGGAGTTTTGGCATA	0.388																																					p.T805N		.											.	.	.	0			c.C2414A						.						55.0	49.0	51.0					2																	237233410		1872	4098	5970	SO:0001583	missense	79781	exon19			AGAGGAGTTTTGG	AK026180	CCDS46549.1, CCDS59441.1, CCDS74677.1	2q37.3	2014-07-18	2008-07-02	2008-07-02	ENSG00000132321	ENSG00000132321		"""ATPases / AAA-type"""	26195	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 11"""		"""IQ motif containing with AAA domain"""	IQCA		23427265	Standard	NM_024726		Approved	FLJ22527, DRC11	uc002vwb.3	Q86XH1	OTTHUMG00000153058	ENST00000409907.3:c.2390C>A	2.37:g.237233410G>T	ENSP00000387347:p.Thr797Asn	Somatic	53	0		WXS	Illumina HiSeq	.	76	4	NM_001270585	B4DFH9|E7EWQ0|Q4G164|Q53R37|Q53RV3|Q96NS7|Q9H680	Missense_Mutation	SNP	ENST00000409907.3	37	CCDS46549.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.493827	0.84962	.	.	ENSG00000132321	ENST00000409907;ENST00000457693;ENST00000309507;ENST00000431676	D;D;T	0.94613	-3.47;-3.47;1.6	4.95	4.95	0.65309	.	0.000000	0.85682	D	0.000000	D	0.97489	0.9178	M	0.88775	2.98	0.58432	D	0.999996	D;D;D	0.71674	0.998;0.997;0.998	D;D;D	0.71656	0.964;0.974;0.974	D	0.97688	1.0177	10	0.49607	T	0.09	.	17.351	0.87324	0.0:0.0:1.0:0.0	.	756;805;797	E7EWQ0;E9PH78;Q86XH1	.;.;IQCA1_HUMAN	N	797;805;794;756	ENSP00000387347:T797N;ENSP00000311951:T794N;ENSP00000407213:T756N	ENSP00000311951:T794N	T	-	2	0	IQCA1	236898149	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	8.062000	0.89475	2.441000	0.82636	0.655000	0.94253	ACT	.		0.388	IQCA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000329266.1	NM_024726	
MUC16	94025	hgsc.bcm.edu	37	19	9018540	9018540	+	Missense_Mutation	SNP	A	A	G	rs200155559	byFrequency	TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr19:9018540A>G	ENST00000397910.4	-	24	37837	c.37634T>C	c.(37633-37635)cTg>cCg	p.L12545P		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12547	SEA 4. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GAGGGTGAACAGCACCAGGAG	0.463													N|||	174	0.0347444	0.1225	0.0144	5008	,	,		16777	0.0		0.001	False		,,,				2504	0.001				p.L12545P		.											.	.	.	0			c.T37634C						.	A	PRO/LEU	289,3607		11,267,1670	211.0	180.0	190.0		37634	-0.2	0.0	19	dbSNP_132	190	4,8306		0,4,4151	no	missense	MUC16	NM_024690.2	98	11,271,5821	GG,GA,AA		0.0481,7.4179,2.4005	benign	12545/14508	9018540	293,11913	1948	4155	6103	SO:0001583	missense	94025	exon24			GTGAACAGCACCA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.37634T>C	19.37:g.9018540A>G	ENSP00000381008:p.Leu12545Pro	Somatic	68	0		WXS	Illumina HiSeq	.	77	6	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	.	2.115	-0.402778	0.04865	0.074179	4.81E-4	ENSG00000181143	ENST00000397910	T	0.33438	1.41	2.01	-0.223	0.13118	.	.	.	.	.	T	0.00637	0.0021	N	0.00788	-1.185	.	.	.	B	0.02656	0.0	B	0.01281	0.0	T	0.20174	-1.0283	8	0.87932	D	0	.	4.4182	0.11466	0.3648:0.0:0.6352:0.0	.	12545	B5ME49	.	P	12545	ENSP00000381008:L12545P	ENSP00000381008:L12545P	L	-	2	0	MUC16	8879540	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	-1.227000	0.02950	0.008000	0.14787	-1.232000	0.01568	CTG	.		0.463	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
SSH3	54961	hgsc.bcm.edu;bcgsc.ca	37	11	67074544	67074544	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr11:67074544C>T	ENST00000308127.4	+	5	674	c.496C>T	c.(496-498)Ccc>Tcc	p.P166S	SSH3_ENST00000532181.1_3'UTR|SSH3_ENST00000308298.7_Missense_Mutation_p.P166S|SSH3_ENST00000376757.5_Missense_Mutation_p.P166S	NM_017857.3	NP_060327.3	Q8TE77	SSH3_HUMAN	slingshot protein phosphatase 3	166					protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|DNA binding (GO:0003677)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			CCTGGTCTTGCCCCTCTGGAG	0.607																																					p.P166S		.											.	.	.	0			c.C496T						.						60.0	61.0	61.0					11																	67074544		2200	4295	6495	SO:0001583	missense	54961	exon5			GTCTTGCCCCTCT	AF085851	CCDS8157.1	11q13	2013-03-05	2013-03-05		ENSG00000172830	ENSG00000172830		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30581	protein-coding gene	gene with protein product		606780	"""slingshot homolog 3 (Drosophila)"""			11832213	Standard	NM_017857		Approved	FLJ20515, FLJ10928	uc001okj.3	Q8TE77	OTTHUMG00000167105	ENST00000308127.4:c.496C>T	11.37:g.67074544C>T	ENSP00000312081:p.Pro166Ser	Somatic	39	0		WXS	Illumina HiSeq	.	46	4	NM_017857	Q6PK42|Q76I75|Q8N9L8|Q8WYL0|Q9NV45|Q9NWZ7	Missense_Mutation	SNP	ENST00000308127.4	37	CCDS8157.1	.	.	.	.	.	.	.	.	.	.	c	21.4	4.140854	0.77775	.	.	ENSG00000172830	ENST00000308127;ENST00000308298;ENST00000376757	T;T;T	0.42900	0.96;0.96;0.96	4.76	3.85	0.44370	.	0.214824	0.28338	N	0.015716	T	0.62011	0.2393	M	0.75085	2.285	0.54753	D	0.999989	D;D	0.89917	1.0;0.996	D;D	0.87578	0.998;0.969	T	0.64719	-0.6341	10	0.87932	D	0	-17.0896	10.8895	0.46988	0.0:0.9109:0.0:0.0891	.	20;166	Q8TE77-3;Q8TE77	.;SSH3_HUMAN	S	166	ENSP00000312081:P166S;ENSP00000310055:P166S;ENSP00000365948:P166S	ENSP00000312081:P166S	P	+	1	0	SSH3	66831120	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.369000	0.79578	0.990000	0.38787	-0.141000	0.14075	CCC	.		0.607	SSH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393167.1	NM_018276	
IVL	3713	hgsc.bcm.edu;bcgsc.ca	37	1	152883026	152883026	+	Silent	SNP	G	G	A	rs45544033	byFrequency	TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr1:152883026G>A	ENST00000368764.3	+	2	817	c.753G>A	c.(751-753)ggG>ggA	p.G251G	IVL_ENST00000392667.2_Silent_p.G105G			P07476	INVO_HUMAN	involucrin	251	39 X 10 AA approximate tandem repeats of [LP]-[EKG]-[LHVYQEK]-[PLSQE]-[EQDV]- [QHEKRGA]-Q-[EMVQLP]-[GKLE]-[QHVNLD].				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			agcaggaggggcagctggagc	0.667																																					p.G251G		.											.	.	.	0			c.G753A						.						8.0	9.0	8.0					1																	152883026		1963	3875	5838	SO:0001819	synonymous_variant	3713	exon2			GGAGGGGCAGCTG	BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.753G>A	1.37:g.152883026G>A		Somatic	26	0		WXS	Illumina HiSeq	.	39	7	NM_005547	Q5T7P4	Silent	SNP	ENST00000368764.3	37	CCDS1030.1																																																																																			.		0.667	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034664.1	NM_005547	
CALR3	125972	hgsc.bcm.edu	37	19	16593513	16593513	+	Silent	SNP	C	C	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr19:16593513C>T	ENST00000269881.3	-	6	824	c.762G>A	c.(760-762)ccG>ccA	p.P254P	CTD-3222D19.2_ENST00000409035.1_3'UTR|CALR3_ENST00000602234.1_5'UTR	NM_145046.4	NP_659483.2	Q96L12	CALR3_HUMAN	calreticulin 3	254	3 X approximate repeats.|P-domain.				cell differentiation (GO:0030154)|protein folding (GO:0006457)|spermatogenesis (GO:0007283)	endoplasmic reticulum (GO:0005783)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|prostate(1)|skin(1)	15						TCTGGAGCATCGGCGCTGGCC	0.607																																					p.P254P		.											CALR3,NS,carcinoma,0,1	CALR3	0	0			c.G762A						.						48.0	48.0	48.0					19																	16593513		2203	4300	6503	SO:0001819	synonymous_variant	125972	exon6			GAGCATCGGCGCT	AK058084	CCDS12344.1	19p13.11	2014-09-17				ENSG00000269058			20407	protein-coding gene	gene with protein product	"""cancer/testis antigen 93"", ""calsperin"""	611414				12384296	Standard	NM_145046		Approved	CRT2, FLJ25355, MGC26577, CT93	uc002ned.3	Q96L12		ENST00000269881.3:c.762G>A	19.37:g.16593513C>T		Somatic	36	0		WXS	Illumina HiSeq	.	32	2	NM_145046	D9N574|Q96LN3	Silent	SNP	ENST00000269881.3	37	CCDS12344.1																																																																																			.		0.607	CALR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461089.1	NM_145046	
PTGS1	5742	hgsc.bcm.edu	37	9	125133501	125133501	+	Missense_Mutation	SNP	T	T	C	rs200490358		TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr9:125133501T>C	ENST00000362012.2	+	2	49	c.44T>C	c.(43-45)cTg>cCg	p.L15P	PTGS1_ENST00000223423.4_Missense_Mutation_p.L15P|RP11-498E2.9_ENST00000602325.1_RNA|PTGS1_ENST00000540753.1_5'UTR	NM_000962.3|NM_001271164.1|NM_001271367.1|NM_080591.2	NP_000953.2|NP_001258093.1|NP_001258296.1|NP_542158.1	P23219	PGH1_HUMAN	prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)	15					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|prostaglandin biosynthetic process (GO:0001516)|regulation of blood pressure (GO:0008217)|regulation of cell proliferation (GO:0042127)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)	dioxygenase activity (GO:0051213)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)|prostaglandin-endoperoxide synthase activity (GO:0004666)			large_intestine(3)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	8					Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Antipyrine(DB01435)|Antrafenine(DB01419)|Balsalazide(DB01014)|Bortezomib(DB00188)|Bromfenac(DB00963)|Candesartan(DB00796)|Carprofen(DB00821)|Carvedilol(DB01136)|Chlorpropamide(DB00672)|Dapsone(DB00250)|Desmopressin(DB00035)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Diflunisal(DB00861)|Dihomo-gamma-linolenic acid(DB00154)|Diphenhydramine(DB01075)|Dronabinol(DB00470)|Eletriptan(DB00216)|Eszopiclone(DB00402)|Etodolac(DB00749)|Etoposide(DB00773)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|Hexobarbital(DB01355)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Icosapent(DB00159)|Ifosfamide(DB01181)|Imatinib(DB00619)|Indomethacin(DB00328)|Irbesartan(DB01029)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lornoxicam(DB06725)|Lumiracoxib(DB01283)|Magnesium salicylate(DB01397)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Minoxidil(DB00350)|Montelukast(DB00471)|Nabumetone(DB00461)|Naproxen(DB00788)|Nateglinide(DB00731)|Nepafenac(DB06802)|Niflumic Acid(DB04552)|Nortriptyline(DB00540)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Rosiglitazone(DB00412)|Salicylate-sodium(DB01398)|Salicylic acid(DB00936)|Salsalate(DB01399)|Sulfamethoxazole(DB01015)|Sulfasalazine(DB00795)|Sulindac(DB00605)|Suprofen(DB00870)|Tenoxicam(DB00469)|Terbinafine(DB00857)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Torasemide(DB00214)|Trabectedin(DB05109)|Triflusal(DB08814)|Trisalicylate-choline(DB01401)|Valproic Acid(DB00313)|Voriconazole(DB00582)|Zafirlukast(DB00549)|Zileuton(DB00744)|Zolpidem(DB00425)|Zopiclone(DB01198)	TTCCTGCTCCTGCTCCCGCCG	0.667																																					p.L15P		.											.,1	.	84	0			c.T44C						.						55.0	58.0	57.0					9																	125133501		2203	4300	6503	SO:0001583	missense	5742	exon2			TGCTCCTGCTCCC	M59979	CCDS6842.1, CCDS6843.1, CCDS59520.1, CCDS59521.1, CCDS75895.1	9q32-q33.3	2008-02-05			ENSG00000095303	ENSG00000095303	1.14.99.1		9604	protein-coding gene	gene with protein product		176805				2512924, 1907252	Standard	NM_000962		Approved	COX1, PGHS-1, PTGHS	uc004bmg.2	P23219	OTTHUMG00000020605	ENST00000362012.2:c.44T>C	9.37:g.125133501T>C	ENSP00000354612:p.Leu15Pro	Somatic	20	2		WXS	Illumina HiSeq	.	26	5	NM_001271164	A8K1V7|B4DHQ2|B4E2S5|Q15122|Q3HY28|Q3HY29|Q5T7T6|Q5T7T7|Q5T7T8	Missense_Mutation	SNP	ENST00000362012.2	37	CCDS6842.1	.	.	.	.	.	.	.	.	.	.	t	7.738	0.700635	0.15106	.	.	ENSG00000095303	ENST00000362012;ENST00000223423;ENST00000426608	T;T;T	0.70986	-0.53;-0.53;1.48	3.31	3.31	0.37934	.	0.761229	0.12202	N	0.490211	T	0.73713	0.3622	L	0.29908	0.895	0.80722	D	1	D;D	0.69078	0.995;0.997	D;D	0.78314	0.979;0.991	T	0.72347	-0.4321	10	0.72032	D	0.01	-4.2016	8.4086	0.32629	0.0:0.0:0.0:1.0	.	15;15	P23219;P23219-2	PGH1_HUMAN;.	P	15;15;12	ENSP00000354612:L15P;ENSP00000223423:L15P;ENSP00000411606:L12P	ENSP00000223423:L15P	L	+	2	0	PTGS1	124173322	1.000000	0.71417	1.000000	0.80357	0.022000	0.10575	3.017000	0.49615	1.754000	0.51921	0.451000	0.29950	CTG	.		0.667	PTGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053933.1		
KRTAP9-3	83900	hgsc.bcm.edu	37	17	39389206	39389206	+	Silent	SNP	C	C	T	rs562752908		TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr17:39389206C>T	ENST00000411528.2	+	1	492	c.453C>T	c.(451-453)taC>taT	p.Y151Y		NM_031962.2	NP_114168.1	Q9BYQ3	KRA93_HUMAN	keratin associated protein 9-3	151	16 X 5 AA repeats of C-C-[RQVSHE]-[SPTN]- [TASPI].					keratin filament (GO:0045095)				breast(1)|endometrium(3)|lung(2)|ovary(1)|prostate(1)	8		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			CCTGTGTGTACAGCTGCTGCC	0.552													.|||	1	0.000199681	0.0	0.0014	5008	,	,		19446	0.0		0.0	False		,,,				2504	0.0				p.Y151Y		.											.	.	.	0			c.C453T						.						135.0	170.0	158.0					17																	39389206		2104	4300	6404	SO:0001819	synonymous_variant	83900	exon1			TGTGTACAGCTGC	AJ406947	CCDS11385.1	17q21.2	2013-06-25			ENSG00000204873	ENSG00000204873		"""Keratin associated proteins"""	16927	protein-coding gene	gene with protein product						11279113	Standard	NM_031962		Approved	KAP9.3	uc021txg.1	Q9BYQ3	OTTHUMG00000133427	ENST00000411528.2:c.453C>T	17.37:g.39389206C>T		Somatic	60	0		WXS	Illumina HiSeq	.	72	4	NM_031962		Silent	SNP	ENST00000411528.2	37	CCDS11385.1																																																																																			.		0.552	KRTAP9-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257290.1		
CCDC37	348807	hgsc.bcm.edu	37	3	126142435	126142435	+	Missense_Mutation	SNP	G	G	A	rs140223152|rs398102320|rs35657615|rs200815085	byFrequency	TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr3:126142435G>A	ENST00000352312.1	+	13	1333	c.1234G>A	c.(1234-1236)Gag>Aag	p.E412K	CCDC37_ENST00000393425.1_Missense_Mutation_p.E413K|CCDC37_ENST00000505024.1_Missense_Mutation_p.E413K	NM_182628.2	NP_872434.2	Q494V2	CCD37_HUMAN	coiled-coil domain containing 37	412				Missing (in Ref. 3; AAI01370/AAI01368). {ECO:0000305}.						NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|skin(3)	23				GBM - Glioblastoma multiforme(114;0.166)		CCAGGAGACGGAGAAGACCCT	0.612													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17029	0.0		0.0	False		,,,				2504	0.0				p.E412K		.											CCDC37,rectum,carcinoma,0,1	CCDC37	0	0			c.G1234A						.						109.0	83.0	92.0					3																	126142435		2200	4257	6457	SO:0001583	missense	348807	exon13			GAGACGGAGAAGA	AK097402	CCDS3037.1	3q21.2	2014-07-31			ENSG00000163885	ENSG00000163885			26842	protein-coding gene	gene with protein product						23569216	Standard	NM_182628		Approved	FLJ40083, MIA1	uc003eiu.1	Q494V2	OTTHUMG00000162691	ENST00000352312.1:c.1234G>A	3.37:g.126142435G>A	ENSP00000344749:p.Glu412Lys	Somatic	41	0		WXS	Illumina HiSeq	.	43	2	NM_182628	D3DNA8|Q494V1|Q494V4|Q8N838	Missense_Mutation	SNP	ENST00000352312.1	37	CCDS3037.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.295376	0.81025	.	.	ENSG00000163885	ENST00000352312;ENST00000393425;ENST00000505024	T;T;T	0.41400	1.0;1.0;1.0	4.93	4.93	0.64822	.	0.159668	0.53938	D	0.000054	T	0.66015	0.2747	M	0.83384	2.64	0.58432	D	0.999999	D;D	0.69078	0.997;0.996	D;P	0.66716	0.946;0.884	T	0.71137	-0.4680	10	0.56958	D	0.05	-35.5644	15.657	0.77144	0.0:0.0:1.0:0.0	.	413;412	Q494V2-2;Q494V2	.;CCD37_HUMAN	K	412;413;413	ENSP00000344749:E412K;ENSP00000377076:E413K;ENSP00000423046:E413K	ENSP00000344749:E412K	E	+	1	0	CCDC37	127625125	1.000000	0.71417	1.000000	0.80357	0.523000	0.34469	6.860000	0.75473	2.284000	0.76573	0.491000	0.48974	GAG	.		0.612	CCDC37-001	KNOWN	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000370099.4	NM_182628	
ADAMTS7	11173	hgsc.bcm.edu	37	15	79090371	79090371	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr15:79090371G>T	ENST00000388820.4	-	3	751	c.541C>A	c.(541-543)Cat>Aat	p.H181N	ADAMTS7_ENST00000566303.1_5'UTR	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	181					cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						TACACCACATGGGGCTGGGCG	0.627																																					p.H181N		.											ADAMTS7,NS,malignant_melanoma,0,1	ADAMTS7	0	0			c.C541A						.						62.0	63.0	62.0					15																	79090371		2196	4293	6489	SO:0001583	missense	11173	exon3			CCACATGGGGCTG	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.541C>A	15.37:g.79090371G>T	ENSP00000373472:p.His181Asn	Somatic	33	0		WXS	Illumina HiSeq	.	51	3	NM_014272	Q14F51|Q6P7J9	Missense_Mutation	SNP	ENST00000388820.4	37	CCDS32303.1	.	.	.	.	.	.	.	.	.	.	G	18.06	3.540119	0.65085	.	.	ENSG00000136378	ENST00000388820;ENST00000456326	T	0.12147	2.71	4.26	4.26	0.50523	Peptidase M12B, propeptide (1);	0.000000	0.85682	D	0.000000	T	0.47820	0.1466	M	0.93854	3.465	0.58432	D	0.999994	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.993;0.995;0.993	T	0.64271	-0.6447	10	0.87932	D	0	.	15.5895	0.76517	0.0:0.0:1.0:0.0	.	181;181;181	E7EP58;A8MQ00;Q9UKP4	.;.;ATS7_HUMAN	N	181	ENSP00000373472:H181N	ENSP00000373472:H181N	H	-	1	0	ADAMTS7	76877426	1.000000	0.71417	0.959000	0.39883	0.344000	0.29017	6.570000	0.73996	2.083000	0.62718	0.313000	0.20887	CAT	.		0.627	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
FSD1	79187	hgsc.bcm.edu;bcgsc.ca	37	19	4323106	4323106	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr19:4323106C>T	ENST00000221856.6	+	11	1310	c.1163C>T	c.(1162-1164)gCc>gTc	p.A388V	STAP2_ENST00000597593.1_5'Flank|FSD1_ENST00000597590.1_Missense_Mutation_p.A388V	NM_024333.2	NP_077309.1	Q9BTV5	FSD1_HUMAN	fibronectin type III and SPRY domain containing 1	388	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)				breast(2)|cervix(1)|endometrium(1)|large_intestine(4)|liver(1)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.034)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCAAGACGGCCGCCTCCTGG	0.667																																					p.A388V		.											.	.	.	0			c.C1163T						.						41.0	37.0	39.0					19																	4323106		2203	4300	6503	SO:0001583	missense	79187	exon11			AGACGGCCGCCTC	AF316829	CCDS12127.1	19p13.3	2013-02-11	2005-03-01			ENSG00000105255		"""Fibronectin type III domain containing"""	13745	protein-coding gene	gene with protein product		609828	"""fibronectin type 3 and SPRY domain containing 1"""			11267680	Standard	NM_024333		Approved	MGC3213, MIR1	uc002lzy.2	Q9BTV5		ENST00000221856.6:c.1163C>T	19.37:g.4323106C>T	ENSP00000221856:p.Ala388Val	Somatic	35	0		WXS	Illumina HiSeq	.	50	4	NM_024333	B2RDT0|Q9BXN0|Q9HAG4	Missense_Mutation	SNP	ENST00000221856.6	37	CCDS12127.1	.	.	.	.	.	.	.	.	.	.	C	13.38	2.219763	0.39201	.	.	ENSG00000105255	ENST00000221856	T	0.70282	-0.47	4.55	4.55	0.56014	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.367242	0.28161	N	0.016375	T	0.67915	0.2944	L	0.60904	1.88	0.09310	N	1	B	0.23540	0.087	B	0.32928	0.155	T	0.63033	-0.6727	10	0.54805	T	0.06	.	10.1564	0.42825	0.1998:0.8002:0.0:0.0	.	388	Q9BTV5	FSD1_HUMAN	V	388	ENSP00000221856:A388V	ENSP00000221856:A388V	A	+	2	0	FSD1	4274106	0.002000	0.14202	0.235000	0.24058	0.939000	0.58152	1.469000	0.35343	2.097000	0.63578	0.485000	0.47835	GCC	.		0.667	FSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458091.1	NM_024333	
H2BFM	286436	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	103294757	103294757	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chrX:103294757C>A	ENST00000355016.3	+	1	242	c.214C>A	c.(214-216)Cac>Aac	p.H72N	H2BFM_ENST00000243297.5_Missense_Mutation_p.H175N	NM_001164416.1	NP_001157888.1	P0C1H6	H2BFM_HUMAN	H2B histone family, member M	72						nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|lung(1)|ovary(1)	3						GAAGCAGGTTCACCAGGGCCT	0.647																																					p.H72N		.											.	.	.	0			c.C214A						.						33.0	37.0	36.0					X																	103294757		692	1591	2283	SO:0001583	missense	286436	exon1			CAGGTTCACCAGG	AK093522	CCDS55468.1	Xq22.2	2011-01-27			ENSG00000101812	ENSG00000101812		"""Histones / Replication-independent"""	27867	protein-coding gene	gene with protein product							Standard	NM_001164416		Approved		uc004els.2	P0C1H6	OTTHUMG00000022122	ENST00000355016.3:c.214C>A	X.37:g.103294757C>A	ENSP00000347119:p.His72Asn	Somatic	70	0		WXS	Illumina HiSeq	.	57	5	NM_001164416	A6NP82	Missense_Mutation	SNP	ENST00000355016.3	37	CCDS55468.1	.	.	.	.	.	.	.	.	.	.	.	16.75	3.210445	0.58343	.	.	ENSG00000101812	ENST00000243297;ENST00000355016	T;T	0.25579	1.79;1.79	2.54	2.54	0.30619	Histone-fold (2);Histone core (1);	.	.	.	.	T	0.47358	0.1441	M	0.75264	2.295	0.40049	D	0.975753	D	0.62365	0.991	D	0.76575	0.988	T	0.52660	-0.8546	9	0.87932	D	0	.	10.3652	0.44019	0.0:1.0:0.0:0.0	.	175	P0C1H6	H2BFM_HUMAN	N	175;72	ENSP00000243297:H175N;ENSP00000347119:H72N	ENSP00000243297:H175N	H	+	1	0	H2BFM	103181413	0.999000	0.42202	0.001000	0.08648	0.005000	0.04900	6.257000	0.72480	1.328000	0.45358	0.507000	0.49892	CAC	.		0.647	H2BFM-001	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057758.2	XM_210048	
CHST2	9435	hgsc.bcm.edu	37	3	142840192	142840192	+	Silent	SNP	G	G	A			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr3:142840192G>A	ENST00000309575.3	+	2	1918	c.534G>A	c.(532-534)tcG>tcA	p.S178S		NM_004267.4	NP_004258.2	Q9Y4C5	CHST2_HUMAN	carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2	178					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|multicellular organismal development (GO:0007275)|N-acetylglucosamine metabolic process (GO:0006044)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|trans-Golgi network (GO:0005802)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(2)	22						CTGGCTCGTCGTTCTTCGGCG	0.622																																					p.S178S		.											CHST2,colon,adenoma,0,1	CHST2	0	0			c.G534A						.						36.0	44.0	41.0					3																	142840192		2203	4300	6503	SO:0001819	synonymous_variant	9435	exon2			CTCGTCGTTCTTC	BC042160	CCDS3129.1	3q24	2007-03-14			ENSG00000175040	ENSG00000175040		"""Sulfotransferases, membrane-bound"""	1970	protein-coding gene	gene with protein product		603798				10049591	Standard	NM_004267		Approved	C6ST	uc003evm.3	Q9Y4C5	OTTHUMG00000159351	ENST00000309575.3:c.534G>A	3.37:g.142840192G>A		Somatic	47	0		WXS	Illumina HiSeq	.	37	3	NM_004267	D3DNG5|Q2M370|Q9GZN5|Q9UED5|Q9Y6F2	Silent	SNP	ENST00000309575.3	37	CCDS3129.1																																																																																			.		0.622	CHST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354850.1	NM_004267	
RPRD2	23248	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	150445250	150445250	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr1:150445250C>T	ENST00000369068.4	+	11	3830	c.3826C>T	c.(3826-3828)Cct>Tct	p.P1276S	RPRD2_ENST00000401000.4_Missense_Mutation_p.P1250S|RPRD2_ENST00000492220.1_3'UTR	NM_015203.3	NP_056018.2	Q5VT52	RPRD2_HUMAN	regulation of nuclear pre-mRNA domain containing 2	1276	Pro-rich.					DNA-directed RNA polymerase II, holoenzyme (GO:0016591)				central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						TCCTCCCCCTCCTGGGGAACA	0.627																																					p.P1276S		.											.	.	.	0			c.C3826T						.						67.0	73.0	71.0					1																	150445250		2007	4168	6175	SO:0001583	missense	23248	exon11			CCCCCTCCTGGGG	BX641025	CCDS44216.1, CCDS72907.1	1q21.2	2012-02-09	2008-08-15	2008-07-28	ENSG00000163125	ENSG00000163125			29039	protein-coding gene	gene with protein product		614695	"""KIAA0460"""	KIAA0460		22231121	Standard	XM_005245033		Approved	FLJ32145, HSPC099	uc009wlr.3	Q5VT52	OTTHUMG00000012808	ENST00000369068.4:c.3826C>T	1.37:g.150445250C>T	ENSP00000358064:p.Pro1276Ser	Somatic	65	0		WXS	Illumina HiSeq	.	79	21	NM_015203	A8K6N8|B3KPT1|B4E2Q6|O75048|Q5VT51|Q5VT53|Q6MZL4|Q86XD2|Q9P0D7	Missense_Mutation	SNP	ENST00000369068.4	37	CCDS44216.1	.	.	.	.	.	.	.	.	.	.	C	11.72	1.723668	0.30593	.	.	ENSG00000163125	ENST00000401000;ENST00000369068	T;T	0.61859	0.08;0.07	4.58	2.71	0.32032	.	0.079450	0.50627	N	0.000104	T	0.26304	0.0642	L	0.29908	0.895	0.80722	D	1	B;B	0.19331	0.02;0.035	B;B	0.14023	0.004;0.01	T	0.13098	-1.0522	10	0.56958	D	0.05	-4.3649	10.0149	0.42008	0.0:0.7714:0.0:0.2286	.	1276;1250	Q5VT52;Q5VT52-3	RPRD2_HUMAN;.	S	1250;1276	ENSP00000383785:P1250S;ENSP00000358064:P1276S	ENSP00000358064:P1276S	P	+	1	0	RPRD2	148711874	0.526000	0.26298	0.993000	0.49108	0.773000	0.43773	0.900000	0.28431	0.551000	0.29008	-0.143000	0.13931	CCT	.		0.627	RPRD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000035844.1	NM_015203	
SMARCC1	6599	hgsc.bcm.edu	37	3	47716999	47716999	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr3:47716999C>T	ENST00000254480.5	-	18	1924	c.1805G>A	c.(1804-1806)cGt>cAt	p.R602H	SMARCC1_ENST00000425518.1_5'UTR	NM_003074.3	NP_003065.3	Q92922	SMRC1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1	602					ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|insulin receptor signaling pathway (GO:0008286)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein N-terminus binding (GO:0047485)|transcription coactivator activity (GO:0003713)	p.R602H(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33				BRCA - Breast invasive adenocarcinoma(193;7.47e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)		AATGTCAGTACGGAGACCAAA	0.363																																					p.R602H		.											SMARCC1,NS,carcinoma,0,1	SMARCC1	0	1	Substitution - Missense(1)	endometrium(1)	c.G1805A						.						151.0	143.0	146.0					3																	47716999		2203	4300	6503	SO:0001583	missense	6599	exon18			TCAGTACGGAGAC	U66615	CCDS2758.1	3p21.31	2008-05-15			ENSG00000173473	ENSG00000173473			11104	protein-coding gene	gene with protein product		601732				8804307	Standard	NM_003074		Approved	BAF155, SRG3, Rsc8, CRACC1	uc003crq.2	Q92922	OTTHUMG00000133519	ENST00000254480.5:c.1805G>A	3.37:g.47716999C>T	ENSP00000254480:p.Arg602His	Somatic	52	0		WXS	Illumina HiSeq	.	55	3	NM_003074	Q17RS0|Q6P172|Q8IWH2	Missense_Mutation	SNP	ENST00000254480.5	37	CCDS2758.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.710557	0.89112	.	.	ENSG00000173473	ENST00000254480	T	0.51071	0.72	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.68118	0.2966	M	0.62266	1.93	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.66748	-0.5845	10	0.59425	D	0.04	-16.3291	19.1586	0.93522	0.0:1.0:0.0:0.0	.	602	Q92922	SMRC1_HUMAN	H	602	ENSP00000254480:R602H	ENSP00000254480:R602H	R	-	2	0	SMARCC1	47692003	1.000000	0.71417	0.991000	0.47740	0.919000	0.55068	7.614000	0.82996	2.873000	0.98535	0.563000	0.77884	CGT	.		0.363	SMARCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257491.1		
MUC5B	727897	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	1247459	1247459	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr11:1247459G>A	ENST00000529681.1	+	3	210	c.152G>A	c.(151-153)cGg>cAg	p.R51Q	MUC5B_ENST00000447027.1_Missense_Mutation_p.R51Q	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	51			R -> W (in dbSNP:rs2075853).		cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		TCGCCCACCCGGCGCGTGAGC	0.672																																					p.R51Q		.											.	.	.	0			c.G152A						.						21.0	27.0	25.0					11																	1247459		1952	4063	6015	SO:0001583	missense	727897	exon3			CCACCCGGCGCGT	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.152G>A	11.37:g.1247459G>A	ENSP00000436812:p.Arg51Gln	Somatic	85	0		WXS	Illumina HiSeq	.	104	38	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	G	10.36	1.327926	0.24080	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.18960	2.18;2.36	3.24	0.275	0.15659	.	.	.	.	.	T	0.14270	0.0345	L	0.52573	1.65	0.09310	N	1	B;P;P	0.35011	0.01;0.48;0.48	B;B;B	0.18561	0.002;0.013;0.022	T	0.17501	-1.0367	9	0.87932	D	0	.	5.11	0.14804	0.4158:0.0:0.5842:0.0	.	51;677;51	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	Q	51;51;51;54	ENSP00000436812:R51Q;ENSP00000415793:R51Q	ENSP00000343037:R51Q	R	+	2	0	MUC5B	1204035	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	-1.073000	0.03430	0.220000	0.20860	0.561000	0.74099	CGG	.		0.672	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
ACP2	53	hgsc.bcm.edu	37	11	47264423	47264423	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr11:47264423C>A	ENST00000256997.3	-	10	1105	c.989G>T	c.(988-990)cGg>cTg	p.R330L	ACP2_ENST00000525230.1_5'UTR|ACP2_ENST00000529444.1_Missense_Mutation_p.R267L|ACP2_ENST00000527256.1_Missense_Mutation_p.R298L|ACP2_ENST00000537863.1_Missense_Mutation_p.R143L|ACP2_ENST00000533929.1_Missense_Mutation_p.R302L	NM_001610.2	NP_001601.1	P11117	PPAL_HUMAN	acid phosphatase 2, lysosomal	330					dephosphorylation (GO:0016311)|lysosome organization (GO:0007040)|skeletal system development (GO:0001501)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)	acid phosphatase activity (GO:0003993)	p.R330Q(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)	10						ACTCTCGTTCCGAAAGTACAT	0.642																																					p.R330L	Melanoma(90;262 1440 11488 44828 48531)	.											ACP2,colon,carcinoma,0,1	ACP2	0	1	Substitution - Missense(1)	large_intestine(1)	c.G989T						.						41.0	45.0	44.0					11																	47264423		2201	4297	6498	SO:0001583	missense	53	exon10			TCGTTCCGAAAGT	X15525	CCDS7928.1, CCDS44583.1	11p11.2	2008-02-05			ENSG00000134575	ENSG00000134575	3.1.3.2		123	protein-coding gene	gene with protein product		171650				975882	Standard	NM_001610		Approved		uc001nei.3	P11117	OTTHUMG00000166949	ENST00000256997.3:c.989G>T	11.37:g.47264423C>A	ENSP00000256997:p.Arg330Leu	Somatic	29	0		WXS	Illumina HiSeq	.	29	2	NM_001610	E9PCI1|Q561W5|Q9BTU7	Missense_Mutation	SNP	ENST00000256997.3	37	CCDS7928.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.756336	0.89843	.	.	ENSG00000134575	ENST00000256997;ENST00000529444;ENST00000527256;ENST00000537863;ENST00000540414;ENST00000533929;ENST00000529663	T;T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9;0.9	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.67646	0.2915	M	0.78049	2.395	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.72104	-0.4391	10	0.87932	D	0	.	18.8188	0.92088	0.0:1.0:0.0:0.0	.	267;298;302;320;330	E9PHY0;B7Z7D2;E9PQY3;F5H1S6;P11117	.;.;.;.;PPAL_HUMAN	L	330;267;298;143;320;302;297	ENSP00000256997:R330L;ENSP00000436658:R267L;ENSP00000432205:R298L;ENSP00000441933:R143L;ENSP00000432439:R302L;ENSP00000436487:R297L	ENSP00000256997:R330L	R	-	2	0	ACP2	47220999	1.000000	0.71417	1.000000	0.80357	0.598000	0.36846	5.487000	0.66863	2.438000	0.82558	0.460000	0.39030	CGG	.		0.642	ACP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392022.2	NM_001610	
USP13	8975	hgsc.bcm.edu	37	3	179458119	179458119	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr3:179458119G>T	ENST00000263966.3	+	11	1810	c.1339G>T	c.(1339-1341)Gat>Tat	p.D447Y	USP13_ENST00000482333.1_3'UTR|USP13_ENST00000496897.1_Missense_Mutation_p.D382Y	NM_003940.2	NP_003931.2	Q92995	UBP13_HUMAN	ubiquitin specific peptidase 13 (isopeptidase T-3)	447	USP.				autophagy (GO:0006914)|cell proliferation (GO:0008283)|melanocyte differentiation (GO:0030318)|protein K63-linked deubiquitination (GO:0070536)|protein stabilization (GO:0050821)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	46	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			CAGGCAGCAAGATGCCCAGGA	0.507																																					p.D447Y		.											USP13,bladder,carcinoma,0,1	USP13	0	0			c.G1339T						.						90.0	84.0	86.0					3																	179458119		2203	4300	6503	SO:0001583	missense	8975	exon11			CAGCAAGATGCCC	U75362	CCDS3235.1	3q26.2-q26.3	2008-04-11	2005-08-08		ENSG00000058056	ENSG00000058056		"""Ubiquitin-specific peptidases"""	12611	protein-coding gene	gene with protein product		603591	"""ubiquitin specific protease 13 (isopeptidase T-3)"""			12838346	Standard	NM_003940		Approved	IsoT-3	uc003fkh.3	Q92995	OTTHUMG00000157783	ENST00000263966.3:c.1339G>T	3.37:g.179458119G>T	ENSP00000263966:p.Asp447Tyr	Somatic	29	0		WXS	Illumina HiSeq	.	30	2	NM_003940	A8K2S3|B4DYF3|D3DNS2|Q96B25	Missense_Mutation	SNP	ENST00000263966.3	37	CCDS3235.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.038888	0.75617	.	.	ENSG00000058056	ENST00000263966;ENST00000496897;ENST00000497155	D;D;D	0.95069	-3.6;-3.6;-3.6	5.65	5.65	0.86999	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	D	0.98356	0.9454	H	0.96048	3.76	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99167	1.0863	10	0.87932	D	0	-22.5714	19.7156	0.96119	0.0:0.0:1.0:0.0	.	447;447	Q92995;A8K2S3	UBP13_HUMAN;.	Y	447;382;93	ENSP00000263966:D447Y;ENSP00000417146:D382Y;ENSP00000420057:D93Y	ENSP00000263966:D447Y	D	+	1	0	USP13	180940813	1.000000	0.71417	1.000000	0.80357	0.289000	0.27227	9.776000	0.99001	2.667000	0.90743	0.655000	0.94253	GAT	.		0.507	USP13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349617.1		
FANCI	55215	hgsc.bcm.edu	37	15	89856160	89856160	+	Missense_Mutation	SNP	C	C	T	rs367665900		TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr15:89856160C>T	ENST00000310775.7	+	35	3763	c.3677C>T	c.(3676-3678)aCg>aTg	p.T1226M	FANCI_ENST00000300027.8_Missense_Mutation_p.T1166M|FANCI_ENST00000566615.1_3'UTR	NM_001113378.1	NP_001106849.1	Q9NVI1	FANCI_HUMAN	Fanconi anemia, complementation group I	1226					cell cycle (GO:0007049)|DNA repair (GO:0006281)|positive regulation of protein ubiquitination (GO:0031398)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA polymerase binding (GO:0070182)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	Lung NSC(78;0.0472)|all_lung(78;0.089)					CTGAACTATACGGGAGAGAAA	0.403								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.T1226M		.											.	.	.	0			c.C3677T						.	C	MET/THR,MET/THR	1,4399	2.1+/-5.4	0,1,2199	72.0	72.0	72.0		3677,3497	4.5	0.7	15		72	0,8598		0,0,4299	no	missense,missense	FANCI	NM_001113378.1,NM_018193.2	81,81	0,1,6498	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	1226/1329,1166/1269	89856160	1,12997	2200	4299	6499	SO:0001583	missense	55215	exon35	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	ACTATACGGGAGA	BC004277	CCDS10349.2, CCDS45346.1	15q26.1	2014-09-17	2007-05-03	2007-05-03	ENSG00000140525	ENSG00000140525		"""Fanconi anemia, complementation groups"""	25568	protein-coding gene	gene with protein product		611360	"""KIAA1794"""	KIAA1794		14630800, 17460694, 17412408	Standard	NM_001113378		Approved	FLJ10719	uc010bnp.1	Q9NVI1	OTTHUMG00000132993	ENST00000310775.7:c.3677C>T	15.37:g.89856160C>T	ENSP00000310842:p.Thr1226Met	Somatic	95	0		WXS	Illumina HiSeq	.	84	4	NM_001113378	A4ZVE4|A5YMH4|A6NJZ0|Q96JN1|Q96ST0|Q9BT96	Missense_Mutation	SNP	ENST00000310775.7	37	CCDS45346.1	.	.	.	.	.	.	.	.	.	.	C	13.01	2.108084	0.37242	2.27E-4	0.0	ENSG00000140525	ENST00000300027;ENST00000310775	T;T	0.70045	-0.45;-0.45	5.37	4.46	0.54185	.	0.783877	0.12621	N	0.453049	T	0.64505	0.2604	L	0.36672	1.1	0.80722	D	1	D;D;D	0.59357	0.98;0.985;0.985	P;P;P	0.50617	0.646;0.564;0.564	T	0.61088	-0.7133	10	0.46703	T	0.11	-7.0E-4	9.975	0.41777	0.0:0.9094:0.0:0.0906	.	1226;1165;1166	Q9NVI1;Q9NVI1-2;Q9NVI1-1	FANCI_HUMAN;.;.	M	1166;1226	ENSP00000300027:T1166M;ENSP00000310842:T1226M	ENSP00000300027:T1166M	T	+	2	0	FANCI	87657164	0.910000	0.30920	0.721000	0.30653	0.298000	0.27526	2.550000	0.45811	1.499000	0.48617	0.650000	0.86243	ACG	.		0.403	FANCI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421140.1	NM_018193	
AASS	10157	hgsc.bcm.edu	37	7	121755176	121755176	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr7:121755176C>T	ENST00000393376.1	-	8	1090	c.995G>A	c.(994-996)gGc>gAc	p.G332D	AASS_ENST00000417368.2_Missense_Mutation_p.G332D|AASS_ENST00000473553.1_Intron			Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase	332	Lysine-ketoglutarate reductase.				cellular nitrogen compound metabolic process (GO:0034641)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|protein tetramerization (GO:0051262)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity (GO:0047131)|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity (GO:0047130)			autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(6)|large_intestine(12)|lung(27)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	54						TGAGAACTTGCCCGGAGCCAG	0.488																																					p.G332D		.											AASS,NS,adenocarcinoma,0,1	AASS	0	0			c.G995A						.						124.0	115.0	118.0					7																	121755176		2203	4300	6503	SO:0001583	missense	10157	exon9			AACTTGCCCGGAG	AF229180	CCDS5783.1	7q31.3	2010-12-14			ENSG00000008311	ENSG00000008311			17366	protein-coding gene	gene with protein product		605113				10775527	Standard	NM_005763		Approved	LORSDH, LKRSDH	uc003vkb.3	Q9UDR5	OTTHUMG00000157058	ENST00000393376.1:c.995G>A	7.37:g.121755176C>T	ENSP00000377040:p.Gly332Asp	Somatic	89	0		WXS	Illumina HiSeq	.	65	3	NM_005763	O95462	Missense_Mutation	SNP	ENST00000393376.1	37	CCDS5783.1	.	.	.	.	.	.	.	.	.	.	C	4.267	0.048563	0.08243	.	.	ENSG00000008311	ENST00000393376;ENST00000417368	.	.	.	5.68	-0.506	0.11989	Alanine dehydrogenase/PNT, C-terminal (1);	0.615801	0.17256	N	0.180955	T	0.19525	0.0469	N	0.21373	0.66	0.09310	N	1	B	0.28470	0.213	B	0.33339	0.162	T	0.31223	-0.9951	9	0.10902	T	0.67	-0.5644	6.5835	0.22609	0.6959:0.1491:0.0749:0.0801	.	332	Q9UDR5	AASS_HUMAN	D	332	.	ENSP00000351834:G332D	G	-	2	0	AASS	121542412	0.003000	0.15002	0.952000	0.39060	0.416000	0.31233	0.318000	0.19504	-0.025000	0.13918	-0.181000	0.13052	GGC	.		0.488	AASS-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347300.1	NM_005763	
ESPNP	284729	broad.mit.edu	37	1	17018952	17018952	+	RNA	DEL	C	C	-	rs369477933|rs59953955|rs370514988	byFrequency	TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr1:17018952delC	ENST00000492551.1	-	0	1938					NR_026567.1				espin pseudogene																		cggggaggcgcggcgggccgg	0.746																																					.													.	.	.	0			.						.																																					0	.			GAGGCGCGGCGGG	AL035288		1p36.13	2013-05-22			ENSG00000268869	ENSG00000268869			23285	pseudogene	pseudogene						15286153	Standard	NR_026567		Approved		uc001azn.1		OTTHUMG00000000803		1.37:g.17018952delC		Somatic	13	0		WXS	Illumina GAIIx	Phase_I	11	3	.		RNA	DEL	ENST00000492551.1	37																																																																																				.		0.746	ESPNP-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000326311.1		
AGAP6	414189	broad.mit.edu	37	10	51768543	51768543	+	Missense_Mutation	SNP	T	T	C	rs368970869		TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr10:51768543T>C	ENST00000374056.4	+	7	987	c.589T>C	c.(589-591)Tcg>Ccg	p.S197P	AGAP6_ENST00000412531.3_Missense_Mutation_p.S220P			Q5VW22	AGAP6_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 6	197					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.S220P(3)		NS(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(1)|lung(8)|prostate(3)|skin(1)|stomach(2)	29						CTCCATTCCATCGACTCCCAG	0.532																																					p.S220P													AGAP6,NS,carcinoma,0,3	AGAP6	53	3	Substitution - Missense(3)	endometrium(2)|NS(1)	c.T658C						.																																			SO:0001583	missense	414189	exon8			ATTCCATCGACTC		CCDS44397.1	10q11.23	2013-01-10	2008-09-22	2008-09-22	ENSG00000204149	ENSG00000204149		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	23466	protein-coding gene	gene with protein product			"""centaurin, gamma-like family, member 3"""	CTGLF3			Standard	NM_001077665		Approved	bA324H6.1	uc001jix.4	Q5VW22	OTTHUMG00000018220	ENST00000374056.4:c.589T>C	10.37:g.51768543T>C	ENSP00000363168:p.Ser197Pro	Somatic	222	1		WXS	Illumina GAIIx	Phase_I	335	4	NM_001077665		Missense_Mutation	SNP	ENST00000374056.4	37		.	.	.	.	.	.	.	.	.	.	.	7.332	0.619129	0.14129	.	.	ENSG00000204149	ENST00000374056;ENST00000412531	T	0.56776	0.44	0.0465	0.0465	0.14256	.	0.149774	0.46145	D	0.000318	T	0.42314	0.1197	M	0.65498	2.005	0.37828	D	0.92861	B	0.14012	0.009	B	0.13407	0.009	T	0.20140	-1.0284	10	0.31617	T	0.26	.	4.565	0.12180	0.0:6.0E-4:0.0:0.9994	.	220	C9IYN2	.	P	220;197	ENSP00000400972:S197P	ENSP00000363168:S220P	S	+	1	0	AGAP6	51438549	1.000000	0.71417	0.059000	0.19551	0.060000	0.15804	3.691000	0.54720	0.115000	0.18071	0.113000	0.15668	TCG	T|0.500;C|0.500		0.532	AGAP6-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_001077665	
LINC00596	414767	broad.mit.edu	37	14	24403643	24403643	+	lincRNA	SNP	G	G	T	rs200528830		TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr14:24403643G>T	ENST00000559615.1	-	0	134							Q86U02	CN165_HUMAN	long intergenic non-protein coding RNA 596							integral component of membrane (GO:0016021)											TTTCAGTGGGGAACATGCCCT	0.418																																					.													.	.	.	0			.						.																																					0	.			AGTGGGGAACATG	BX161431, CR615368		14q11.2	2012-10-12	2012-04-30	2012-04-30	ENSG00000259334	ENSG00000259334		"""Long non-coding RNAs"""	23167	non-coding RNA	RNA, long non-coding			"""chromosome 14 open reading frame 165"""	C14orf165			Standard			Approved	CNSLT1I7G		Q86U02	OTTHUMG00000171723		14.37:g.24403643G>T		Somatic	54	0		WXS	Illumina GAIIx	Phase_I	40	3	.		RNA	SNP	ENST00000559615.1	37																																																																																				G|0.996;A|0.004		0.418	LINC00596-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000415721.1		
GOLGA6B	55889	broad.mit.edu	37	15	72954652	72954652	+	Missense_Mutation	SNP	G	G	A	rs201023176		TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr15:72954652G>A	ENST00000421285.3	+	11	907	c.907G>A	c.(907-909)Gag>Aag	p.E303K	RN7SL853P_ENST00000477951.2_RNA	NM_018652.4	NP_061122.4	A6NDN3	GOG6B_HUMAN	golgin A6 family, member B	303						Golgi apparatus (GO:0005794)				NS(1)|breast(1)|endometrium(1)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	16						GCTACAAGATGAGGCCAAACA	0.542																																					p.E303K													.	GOLGA6B	30	0			c.G907A						.						19.0	20.0	19.0					15																	72954652		1615	3286	4901	SO:0001583	missense	55889	exon11			CAAGATGAGGCCA		CCDS10245.2	15q24.1	2011-10-25	2010-02-12		ENSG00000215186	ENSG00000215186			32205	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6B"""				Standard	XM_006720604		Approved		uc010uks.1	A6NDN3	OTTHUMG00000133511	ENST00000421285.3:c.907G>A	15.37:g.72954652G>A	ENSP00000408132:p.Glu303Lys	Somatic	51	1		WXS	Illumina GAIIx	Phase_I	59	5	NM_018652	A8MYY7	Missense_Mutation	SNP	ENST00000421285.3	37	CCDS10245.2	.	.	.	.	.	.	.	.	.	.	.	12.22	1.873991	0.33069	.	.	ENSG00000215186	ENST00000421285	T	0.27402	1.67	0.69	-1.38	0.09027	.	.	.	.	.	T	0.46927	0.1418	M	0.86953	2.85	0.09310	N	1	P	0.49696	0.927	P	0.56563	0.801	T	0.41052	-0.9530	9	0.72032	D	0.01	.	3.318	0.07040	0.243:0.2692:0.4878:0.0	.	303	A6NDN3	GOG6B_HUMAN	K	303	ENSP00000408132:E303K	ENSP00000408132:E303K	E	+	1	0	GOLGA6B	70741706	0.994000	0.37717	0.000000	0.03702	0.138000	0.21146	0.379000	0.20585	-1.142000	0.02869	0.089000	0.15464	GAG	G|0.998;A|0.002		0.542	GOLGA6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257474.4	NM_018652	
C16orf59	80178	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	2510831	2510831	+	Missense_Mutation	SNP	C	C	G			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr16:2510831C>G	ENST00000361837.4	+	4	276	c.211C>G	c.(211-213)Cca>Gca	p.P71A	C16orf59_ENST00000563531.1_Missense_Mutation_p.P71A|C16orf59_ENST00000569496.1_Missense_Mutation_p.P71A|RP11-715J22.4_ENST00000566085.1_lincRNA|C16orf59_ENST00000483320.1_5'UTR	NM_025108.2	NP_079384.2	Q7L2K0	CP059_HUMAN	chromosome 16 open reading frame 59	71										lung(1)|skin(1)|urinary_tract(1)	3		Ovarian(90;0.17)				CACACCCAGTCCACAAGACCT	0.567																																					p.P71A													.	C16orf59	13	0			c.C211G						.						78.0	86.0	83.0					16																	2510831		2063	4218	6281	SO:0001583	missense	80178	exon4			CCCAGTCCACAAG	AK023971	CCDS10468.2	16p13.3	2008-10-30			ENSG00000162062	ENSG00000162062			25849	protein-coding gene	gene with protein product						12477932	Standard	XM_006720955		Approved	FLJ13909	uc002cqh.3	Q7L2K0	OTTHUMG00000128859	ENST00000361837.4:c.211C>G	16.37:g.2510831C>G	ENSP00000355022:p.Pro71Ala	Somatic	42	0		WXS	Illumina GAIIx	Phase_I	43	5	NM_025108	B4DXD7|Q96H61|Q9H872	Missense_Mutation	SNP	ENST00000361837.4	37	CCDS10468.2	.	.	.	.	.	.	.	.	.	.	C	11.28	1.591747	0.28357	.	.	ENSG00000162062	ENST00000361837	T	0.46451	0.87	4.59	2.57	0.30868	.	0.272597	0.19489	U	0.113023	T	0.38268	0.1034	M	0.62723	1.935	0.18873	N	0.999989	P	0.40180	0.705	B	0.41510	0.359	T	0.24225	-1.0166	10	0.46703	T	0.11	-4.3981	5.0685	0.14594	0.2063:0.6842:0.0:0.1095	.	71	Q7L2K0	CP059_HUMAN	A	71	ENSP00000355022:P71A	ENSP00000355022:P71A	P	+	1	0	C16orf59	2450832	0.016000	0.18221	0.003000	0.11579	0.006000	0.05464	1.003000	0.29809	0.625000	0.30304	0.655000	0.94253	CCA	.		0.567	C16orf59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250802.3	NM_025108	
FAM157C	100996541	broad.mit.edu	37	16	90234762	90234762	+	RNA	SNP	A	A	G	rs377351882	byFrequency	TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr16:90234762A>G	ENST00000570230.1	+	0	1556				RP11-356C4.5_ENST00000565965.1_lincRNA			P0CG43	F157C_HUMAN	family with sequence similarity 157, member C																		AGCACTGGTTAGAGAACAGCC	0.677													.|||	2514	0.501997	0.7958	0.3213	5008	,	,		9544	0.7431		0.1978	False		,,,				2504	0.2975				.													.	.	.	0			.						.																																					0	.			CTGGTTAGAGAAC			16q24.3	2013-01-24	2013-01-18	2013-01-18	ENSG00000260528	ENSG00000260528			34081	other	unknown							Standard	XR_429804		Approved			P0CG43	OTTHUMG00000172848		16.37:g.90234762A>G		Somatic	83	1		WXS	Illumina GAIIx	Phase_I	59	4	.		RNA	SNP	ENST00000570230.1	37																																																																																				G|1.000;|0.000		0.677	FAM157C-004	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000420872.1		
COX10-AS1	100874058	broad.mit.edu	37	17	13927849	13927849	+	RNA	SNP	T	T	C	rs200545546		TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr17:13927849T>C	ENST00000602743.1	-	0	224									COX10 antisense RNA 1																		GTGTTGCTTCTCCACTTTGAG	0.552																																					.													.	.	.	0			.						.																																					0	.			TGCTTCTCCACTT			17p12	2013-05-22	2012-08-15	2010-11-25	ENSG00000236088	ENSG00000236088		"""Long non-coding RNAs"""	38873	non-coding RNA	RNA, long non-coding			"""COX10 antisense RNA (non-protein coding)"", ""COX10 antisense RNA 1 (non-protein coding)"""	COX10AS, COX10-AS			Standard	NR_049718		Approved		uc002goe.1		OTTHUMG00000058771		17.37:g.13927849T>C		Somatic	21	0		WXS	Illumina GAIIx	Phase_I	28	4	.		RNA	SNP	ENST00000602743.1	37																																																																																				.		0.552	COX10-AS1-005	KNOWN	basic	antisense	processed_transcript	OTTHUMT00000467585.1		
MLLT6	4302	broad.mit.edu	37	17	36861675	36861675	+	5'Flank	DEL	G	G	-			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr17:36861675delG	ENST00000325718.7	+	0	0				CTB-58E17.3_ENST00000583409.1_RNA|CTB-58E17.1_ENST00000563897.1_lincRNA|MLLT6_ENST00000378137.5_5'Flank	NM_005937.3	NP_005928	P55198	AF17_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6						regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(3)|lung(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8	Breast(7;4.43e-21)					AGAGCACGGCGGGGGGGGCGG	0.736			T	MLL	AL																																.				Dom	yes		17	17q21	4302	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 (AF17)"""		L	.	MLLT6	80	0			.						.																																			SO:0001631	upstream_gene_variant	0	.			CACGGCGGGGGGG		CCDS11327.1	17q21	2014-04-10	2001-11-28		ENSG00000108292	ENSG00000275023		"""Zinc fingers, PHD-type"""	7138	protein-coding gene	gene with protein product	"""Myeloid/lymphoid or mixed-lineage leukemia, translocated to, 6"", ""trithorax homolog"""	600328	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 6"""			8058765	Standard	NM_005937		Approved	AF17, FLJ23480	uc002hqi.4	P55198	OTTHUMG00000188498		17.37:g.36861675delG	Exception_encountered	Somatic	5	0		WXS	Illumina GAIIx	Phase_I	5	2	.	Q59F28|Q96IU3|Q9H5F6|Q9UF49	RNA	DEL	ENST00000325718.7	37	CCDS11327.1																																																																																			.		0.736	MLLT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256799.1	NM_005937	
KCNN1	3780	broad.mit.edu	37	19	18092607	18092607	+	Silent	SNP	C	C	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr19:18092607C>T	ENST00000222249.9	+	5	907	c.588C>T	c.(586-588)tgC>tgT	p.C196C		NM_002248.3	NP_002239.2	Q92952	KCNN1_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1	196					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			endometrium(1)|kidney(1)|lung(5)|urinary_tract(1)	8					Miconazole(DB01110)|Procaine(DB00721)	TGGCAGTGTGCGCCATTCACC	0.677																																					p.C196C													.	KCNN1	74	0			c.C588T						.						25.0	27.0	26.0					19																	18092607		2171	4248	6419	SO:0001819	synonymous_variant	0	exon5			AGTGTGCGCCATT	U69883	CCDS67611.1	19p13.1	2012-07-05				ENSG00000105642		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6290	protein-coding gene	gene with protein product		602982				8781233, 10516439, 16382103	Standard	NM_002248		Approved	KCa2.1, hSK1	uc002nht.3	Q92952		ENST00000222249.9:c.588C>T	19.37:g.18092607C>T		Somatic	49	1		WXS	Illumina GAIIx	Phase_I	42	4	NM_002248	Q5KR10|Q6DJU4	RNA	SNP	ENST00000222249.9	37																																																																																				.		0.677	KCNN1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000471896.2	NM_002248	
SDHAP1	255812	broad.mit.edu	37	3	195690535	195690539	+	RNA	DEL	TGCTT	TGCTT	-	rs369282394		TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr3:195690535_195690539delTGCTT	ENST00000427841.1	-	0	2203					NR_003264.2				succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 1																		agattctcagtgctttgctttacaa	0.4																																					.	Ovarian(67;1158 1227 12109 20189 43170)												.	.	.	0			.						.																																					0	.			TCTCAGTGCTTTG	BC071730		3q29	2009-12-02	2006-11-21	2009-12-02	ENSG00000185485	ENSG00000185485			32455	pseudogene	pseudogene			"""succinate dehydrogenase complex, subunit A, flavoprotein-like 1"""	SDHAL1, SDHALP1			Standard	NR_003264		Approved		uc003fvy.3		OTTHUMG00000155716		3.37:g.195690540_195690544delTGCTT		Somatic	9	0		WXS	Illumina GAIIx	Phase_I	9	2	.		RNA	DEL	ENST00000427841.1	37																																																																																				.		0.400	SDHAP1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000341367.1		
CARD6	84674	broad.mit.edu	37	5	40841684	40841684	+	Missense_Mutation	SNP	A	A	G			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr5:40841684A>G	ENST00000254691.5	+	1	399	c.200A>G	c.(199-201)aAg>aGg	p.K67R	CARD6_ENST00000381677.3_Missense_Mutation_p.K67R	NM_032587.3	NP_115976.2	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	67	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				apoptotic process (GO:0006915)|regulation of apoptotic process (GO:0042981)					NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(2)|lung(29)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	62						GTACAGAAAAAGGGAGAGGCG	0.423																																					p.K67R													.	CARD6	141	0			c.A200G						.						115.0	120.0	119.0					5																	40841684		2203	4300	6503	SO:0001583	missense	84674	exon1			AGAAAAAGGGAGA	AF356193	CCDS3935.1	5p13.1	2008-05-23			ENSG00000132357	ENSG00000132357			16394	protein-coding gene	gene with protein product		609986				12775719	Standard	NM_032587		Approved	CINCIN1	uc003jmg.3	Q9BX69	OTTHUMG00000094775	ENST00000254691.5:c.200A>G	5.37:g.40841684A>G	ENSP00000254691:p.Lys67Arg	Somatic	76	1		WXS	Illumina GAIIx	Phase_I	85	5	NM_032587	Q52LR2	Missense_Mutation	SNP	ENST00000254691.5	37	CCDS3935.1	.	.	.	.	.	.	.	.	.	.	A	19.16	3.773080	0.69992	.	.	ENSG00000132357	ENST00000254691;ENST00000381677;ENST00000444789;ENST00000509771	T;T	0.51071	0.72;0.72	4.88	4.88	0.63580	DEATH-like (2);Caspase Recruitment (3);	0.097855	0.44688	D	0.000422	T	0.64461	0.2600	M	0.68952	2.095	0.28923	N	0.892005	D	0.89917	1.0	D	0.97110	1.0	T	0.62586	-0.6823	10	0.87932	D	0	-15.0983	10.7802	0.46374	1.0:0.0:0.0:0.0	.	67	Q9BX69	CARD6_HUMAN	R	67	ENSP00000254691:K67R;ENSP00000371093:K67R	ENSP00000254691:K67R	K	+	2	0	CARD6	40877441	0.994000	0.37717	0.850000	0.33497	0.604000	0.37047	2.133000	0.42093	2.045000	0.60652	0.460000	0.39030	AAG	.		0.423	CARD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211584.3		
LOC100128340	100128340	broad.mit.edu	37	5	177386808	177386808	+	RNA	DEL	T	T	-			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr5:177386808delT	ENST00000502514.1	+	0	1226				RP11-423H2.3_ENST00000503263.1_RNA|RP11-423H2.3_ENST00000366189.3_RNA|RP11-1252I4.2_ENST00000511650.1_RNA|RP11-423H2.3_ENST00000507072.1_RNA																							CCCCTCCTCCttttttttttt	0.488																																					.													.	.	.	0			.						.																																					0	.			TCCTCCTTTTTTT																													5.37:g.177386808delT		Somatic	4	0		WXS	Illumina GAIIx	Phase_I	6	1	.		RNA	DEL	ENST00000502514.1	37																																																																																				.		0.488	RP11-423H2.3-001	KNOWN	basic	antisense	antisense	OTTHUMT00000373528.1		
BTN3A1	11119	broad.mit.edu	37	6	26408115	26408115	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr6:26408115G>A	ENST00000289361.6	+	4	1018	c.650G>A	c.(649-651)gGt>gAt	p.G217D	BTN3A1_ENST00000414912.2_Missense_Mutation_p.G165D|BTN3A1_ENST00000425234.2_Missense_Mutation_p.G217D|BTN3A1_ENST00000476549.2_Missense_Mutation_p.G217D	NM_001145008.1|NM_001145009.1|NM_007048.5	NP_001138480.1|NP_001138481.1|NP_008979.3	O00481	BT3A1_HUMAN	butyrophilin, subfamily 3, member A1	217	Ig-like V-type 2.				activated T cell proliferation (GO:0050798)|cytokine secretion (GO:0050663)|interferon-gamma secretion (GO:0072643)|T cell receptor signaling pathway (GO:0050852)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28						TCTGGGGAGGGTGTATCCTGT	0.557																																					p.G217D													.	BTN3A1	80	0			c.G650A						.						178.0	165.0	169.0					6																	26408115		2203	4300	6503	SO:0001583	missense	0	exon4			GGGAGGGTGTATC	U90552	CCDS4608.1, CCDS4609.1, CCDS47388.1, CCDS47389.1	6p22.1	2014-01-14			ENSG00000026950	ENSG00000026950		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1138	protein-coding gene	gene with protein product		613593				9149941	Standard	NM_007048		Approved	BT3.1, BTF5, CD277, BTN3.1	uc003nhv.3	O00481	OTTHUMG00000014449	ENST00000289361.6:c.650G>A	6.37:g.26408115G>A	ENSP00000289361:p.Gly217Asp	Somatic	50	0		WXS	Illumina GAIIx	Phase_I	44	3	NM_007048	A2A278|A8K2C8|B4DIQ1|B4DRM2|E9PGB4|E9PHG8|Q0P515|Q147X5|Q53F15|Q99420|Q9HCY1	Missense_Mutation	SNP	ENST00000289361.6	37	CCDS4608.1	.	.	.	.	.	.	.	.	.	.	.	6.678	0.493676	0.12702	.	.	ENSG00000026950	ENST00000476549;ENST00000289361;ENST00000425234;ENST00000414912	T;T;T;T	0.75260	-0.92;-0.92;-0.92;0.85	2.0	-3.99	0.04069	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.46521	0.1397	L	0.41573	1.285	0.09310	N	1	P;P;P;P	0.47545	0.682;0.897;0.897;0.822	B;B;P;B	0.44696	0.141;0.435;0.458;0.393	T	0.50101	-0.8867	9	0.62326	D	0.03	.	7.3574	0.26727	0.7047:0.0:0.2952:0.0	.	165;217;217;217	E9PGB4;O00481-3;O00481-2;O00481	.;.;.;BT3A1_HUMAN	D	217;217;217;165	ENSP00000420010:G217D;ENSP00000289361:G217D;ENSP00000396684:G217D;ENSP00000406667:G165D	ENSP00000289361:G217D	G	+	2	0	BTN3A1	26516094	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	-1.976000	0.01497	-1.254000	0.02485	-0.350000	0.07774	GGT	.		0.557	BTN3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040112.3		
SPDYE1	285955	broad.mit.edu	37	7	44040390	44040394	+	5'Flank	DEL	CAAAA	CAAAA	-	rs60646391|rs373526685		TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr7:44040390_44040394delCAAAA	ENST00000258704.3	+	0	0				POLR2J4_ENST00000427076.1_RNA|RP5-1165K10.2_ENST00000454572.1_RNA	NM_001099435.2|NM_175064.2	NP_001092905.2|NP_778234.2	Q8NFV5	SPDE1_HUMAN	speedy/RINGO cell cycle regulator family member E1											endometrium(1)|kidney(4)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	11						gattctgtGTcaaaacaaaacaaaa	0.478																																					.													.	.	.	0			.						.																																			SO:0001631	upstream_gene_variant	0	.			CTGTGTCAAAACA	AF412027	CCDS5475.1	7q11.23	2013-05-08	2013-05-08	2009-02-17	ENSG00000136206	ENSG00000136206		"""Speedy homologs"""	16408	protein-coding gene	gene with protein product	"""Speedy E"""		"""Williams Beuren syndrome chromosome region 19"", ""speedy homolog E1 (Xenopus laevis)"""	WBSCR19		12073013	Standard	NM_175064		Approved	Ringo1, SPDYE	uc003tjf.3	Q8NFV5	OTTHUMG00000128985		7.37:g.44040400_44040404delCAAAA	Exception_encountered	Somatic	5	0		WXS	Illumina GAIIx	Phase_I	7	2	.	Q9NTH5	RNA	DEL	ENST00000258704.3	37	CCDS5475.1																																																																																			.		0.478	SPDYE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250974.1	NM_175064	
KMT2C	58508	broad.mit.edu	37	7	151945305	151945305	+	Missense_Mutation	SNP	G	G	C			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr7:151945305G>C	ENST00000262189.6	-	14	2432	c.2214C>G	c.(2212-2214)gaC>gaG	p.D738E	KMT2C_ENST00000355193.2_Missense_Mutation_p.D738E	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	738					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TCATTTCAGAGTCCATCAATC	0.358																																					p.D738E													.	MLL3	1564	0			c.C2214G						.						76.0	74.0	75.0					7																	151945305		2203	4300	6503	SO:0001583	missense	58508	exon14			TTCAGAGTCCATC	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.2214C>G	7.37:g.151945305G>C	ENSP00000262189:p.Asp738Glu	Somatic	62	1		WXS	Illumina GAIIx	Phase_I	51	6	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	G	7.161	0.585622	0.13749	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.81821	-1.54;-1.53	5.23	2.15	0.27550	.	0.139470	0.32015	N	0.006703	T	0.55577	0.1929	N	0.14661	0.345	0.28186	N	0.927979	B	0.09022	0.002	B	0.08055	0.003	T	0.43343	-0.9397	10	0.02654	T	1	.	4.9692	0.14105	0.1988:0.0:0.3272:0.474	.	738	Q8NEZ4	MLL3_HUMAN	E	738	ENSP00000262189:D738E;ENSP00000347325:D738E	ENSP00000262189:D738E	D	-	3	2	MLL3	151576238	0.972000	0.33761	0.111000	0.21465	0.658000	0.38924	1.307000	0.33516	0.238000	0.21222	0.650000	0.86243	GAC	.		0.358	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
TUBBP5	643224	broad.mit.edu	37	9	141069208	141069208	+	RNA	SNP	G	G	A			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr9:141069208G>A	ENST00000503395.1	+	0	907									tubulin, beta pseudogene 5																		tagggatttagtcttactaaa	0.512																																					.													.	.	.	0			.						.																																					0	.			GATTTAGTCTTAC	AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141069208G>A		Somatic	37	0		WXS	Illumina GAIIx	Phase_I	57	7	.		RNA	SNP	ENST00000503395.1	37																																																																																				.		0.512	TUBBP5-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000373087.1	NR_027156	
NUDT10	170685	broad.mit.edu	37	X	51076024	51076024	+	Silent	SNP	G	G	A	rs143435240		TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chrX:51076024G>A	ENST00000376006.3	+	2	427	c.207G>A	c.(205-207)gaG>gaA	p.E69E	NUDT10_ENST00000356450.2_Silent_p.E69E	NM_153183.2	NP_694853.1	Q9BW91	NUDT9_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 10	234					ADP catabolic process (GO:0046032)|IDP catabolic process (GO:0046709)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrial matrix (GO:0005759)	adenosine-diphosphatase activity (GO:0043262)|ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)	p.E69E(8)		cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(1)|prostate(3)|upper_aerodigestive_tract(1)	16	Ovarian(276;0.236)					TGTACGAAGAGGCGGGAGTCA	0.657																																					p.E69E	NSCLC(90;1817 2035 37909 38249)												.	NUDT10	28	8	Substitution - coding silent(8)	endometrium(5)|cervix(1)|prostate(1)|lung(1)	c.G207A						.						52.0	62.0	59.0					X																	51076024		2203	4300	6503	SO:0001819	synonymous_variant	170685	exon2			CGAAGAGGCGGGA	AF469196	CCDS35278.1	Xp11.22-p11.1	2014-05-20			ENSG00000122824	ENSG00000122824		"""Nudix motif containing"""	17621	protein-coding gene	gene with protein product		300527				12105228	Standard	NM_153183		Approved	DIPP3a, hDIPP3alpha	uc004dph.3	Q8NFP7	OTTHUMG00000021530	ENST00000376006.3:c.207G>A	X.37:g.51076024G>A		Somatic	91	1		WXS	Illumina GAIIx	Phase_I	107	6	NM_153183	Q8NBN1|Q8NCB9|Q8NG25	Silent	SNP	ENST00000376006.3	37	CCDS35278.1																																																																																			.		0.657	NUDT10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056578.1	NM_153183	
COL4A5	1287	broad.mit.edu	37	X	107842054	107842054	+	Silent	SNP	A	A	G			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chrX:107842054A>G	ENST00000361603.2	+	25	2146	c.1902A>G	c.(1900-1902)aaA>aaG	p.K634K	COL4A5_ENST00000328300.6_Silent_p.K634K	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	634	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						TAGGTGAAAAAGGCATACAAG	0.493									Alport syndrome with Diffuse Leiomyomatosis																												p.K634K													.	COL4A5	262	0			c.A1902G						.						73.0	76.0	75.0					X																	107842054		2203	4300	6503	SO:0001819	synonymous_variant	1287	exon25	Familial Cancer Database		TGAAAAAGGCATA	M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.1902A>G	X.37:g.107842054A>G		Somatic	90	1		WXS	Illumina GAIIx	Phase_I	98	3	NM_000495	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Silent	SNP	ENST00000361603.2	37	CCDS14543.1																																																																																			.		0.493	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2		
RNF123	63891	ucsc.edu	37	3	49725034	49725034	+	5'Flank	SNP	T	T	A	rs142964215		TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr3:49725034T>A	ENST00000327697.6	+	0	0				MST1_ENST00000494828.2_5'UTR|AC099668.5_ENST00000563780.1_RNA|MST1_ENST00000449682.2_Missense_Mutation_p.T104S|RNF123_ENST00000432042.1_5'Flank|MST1_ENST00000383728.3_Missense_Mutation_p.T29S|MST1_ENST00000545762.1_Missense_Mutation_p.T90S	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123						protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		CGCAGCCTCGTGTGGGGCGAG	0.617																																					p.T104S													.	MST1	84	0			c.A310T						.						64.0	56.0	59.0					3																	49725034		2203	4300	6503	SO:0001631	upstream_gene_variant	4485	exon3			GCCTCGTGTGGGG	AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891		3.37:g.49725034T>A	Exception_encountered	Somatic	65	5		WXS	Illumina HiSeq		56	12	NM_020998	A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Missense_Mutation	SNP	ENST00000327697.6	37	CCDS33758.1	.	.	.	.	.	.	.	.	.	.	T	8.993	0.978116	0.18812	.	.	ENSG00000173531	ENST00000449682;ENST00000383728;ENST00000545762	D;D;D	0.88664	-2.41;-2.41;-2.41	5.13	3.94	0.45596	.	0.366754	0.19842	N	0.104821	T	0.81389	0.4812	L	0.51422	1.61	0.09310	N	1	P;B	0.35192	0.489;0.019	B;B	0.30179	0.112;0.023	T	0.66284	-0.5962	10	0.12766	T	0.61	.	7.7821	0.29070	0.0:0.2455:0.0:0.7545	.	90;104	B7Z538;G3XAK1	.;.	S	104;29;90	ENSP00000414287:T104S;ENSP00000373234:T29S;ENSP00000437535:T90S	ENSP00000373234:T29S	T	-	1	0	MST1	49700038	0.183000	0.23186	0.007000	0.13788	0.244000	0.25665	0.974000	0.29436	0.858000	0.35431	0.482000	0.46254	ACG	.		0.617	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346475.2	NM_022064	
MUC17	140453	ucsc.edu	37	7	100681474	100681474	+	Silent	SNP	A	A	G			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr7:100681474A>G	ENST00000306151.4	+	3	6841	c.6777A>G	c.(6775-6777)tcA>tcG	p.S2259S		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2259	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					AAGCCACTTCATCTCCTACAA	0.502																																					p.S2259S													.	MUC17	804	0			c.A6777G						.						283.0	287.0	285.0					7																	100681474		2203	4300	6503	SO:0001819	synonymous_variant	140453	exon3			CACTTCATCTCCT	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.6777A>G	7.37:g.100681474A>G		Somatic	58	1		WXS	Illumina HiSeq		72	14	NM_001040105	O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	CCDS34711.1																																																																																			.		0.502	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
MUC17	140453	ucsc.edu	37	7	100681510	100681510	+	Silent	SNP	T	T	C	rs116767656		TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr7:100681510T>C	ENST00000306151.4	+	3	6877	c.6813T>C	c.(6811-6813)acT>acC	p.T2271T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2271	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GCATACCAACTTCAACTCTTA	0.488																																					p.T2271T													.	MUC17	804	0			c.T6813C						.						262.0	265.0	264.0					7																	100681510		2203	4300	6503	SO:0001819	synonymous_variant	140453	exon3			ACCAACTTCAACT	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.6813T>C	7.37:g.100681510T>C		Somatic	56	2		WXS	Illumina HiSeq		72	19	NM_001040105	O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	CCDS34711.1																																																																																			.		0.488	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
COL4A1	1282	ucsc.edu;bcgsc.ca	37	13	110850904	110850904	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr13:110850904G>T	ENST00000375820.4	-	21	1316	c.1195C>A	c.(1195-1197)Cct>Act	p.P399T	COL4A1_ENST00000543140.1_Missense_Mutation_p.P399T	NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	399	Triple-helical region.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			GATGTACCAGGAAATCCTCGG	0.607																																					p.P399T													.	COL4A1	372	0			c.C1195A						.						63.0	66.0	65.0					13																	110850904		2203	4300	6503	SO:0001583	missense	1282	exon21			TACCAGGAAATCC	J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.1195C>A	13.37:g.110850904G>T	ENSP00000364979:p.Pro399Thr	Somatic	37	0		WXS	Illumina HiSeq		29	4	NM_001845	A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Missense_Mutation	SNP	ENST00000375820.4	37	CCDS9511.1	.	.	.	.	.	.	.	.	.	.	G	11.35	1.613880	0.28712	.	.	ENSG00000187498	ENST00000375815;ENST00000375820;ENST00000397198;ENST00000543140	D;D	0.96651	-4.08;-4.08	5.0	5.0	0.66597	.	0.421699	0.26136	N	0.026134	D	0.98153	0.9390	M	0.84846	2.72	0.53005	D	0.999961	D	0.89917	1.0	D	0.91635	0.999	D	0.98385	1.0560	10	0.44086	T	0.13	.	17.0939	0.86628	0.0:0.0:1.0:0.0	.	399	P02462	CO4A1_HUMAN	T	393;399;399;399	ENSP00000364979:P399T;ENSP00000443348:P399T	ENSP00000364973:P393T	P	-	1	0	COL4A1	109648905	1.000000	0.71417	0.229000	0.23960	0.065000	0.16274	4.968000	0.63728	2.306000	0.77630	0.650000	0.86243	CCT	.		0.607	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045759.3		
SHANK1	50944	ucsc.edu	37	19	51165465	51165465	+	Silent	SNP	C	C	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr19:51165465C>T	ENST00000293441.1	-	23	6261	c.6243G>A	c.(6241-6243)ctG>ctA	p.L2081L	SHANK1_ENST00000359082.3_Silent_p.L2072L|SYT3_ENST00000544769.1_Intron|SHANK1_ENST00000391813.1_Silent_p.L1468L|SHANK1_ENST00000483981.2_5'Flank|SHANK1_ENST00000391814.1_Silent_p.L2089L	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	2081					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)			breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		GCAGCGAGAGCAGGCGGGTCG	0.677																																					p.L2081L													.	SHANK1	210	0			c.G6243A						.						40.0	40.0	40.0					19																	51165465		2203	4300	6503	SO:0001819	synonymous_variant	50944	exon23			CGAGAGCAGGCGG	AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.6243G>A	19.37:g.51165465C>T		Somatic	21	0		WXS	Illumina HiSeq		36	4	NM_016148	A8MXP5|B7WNY6|Q9NYW9	Silent	SNP	ENST00000293441.1	37	CCDS12799.1																																																																																			.		0.677	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268071.1	NM_016148	
CROCCP2	84809	bcgsc.ca	37	1	16952872	16952872	+	lincRNA	SNP	C	C	A			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr1:16952872C>A	ENST00000412962.1	-	0	744							Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											AGTTCAGATCCAACTTGTCCT	0.647																																					.													.	.	.	0			.						.																																					84809	.			CAGATCCAACTTG	AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16952872C>A		Somatic	88	0		WXS	Illumina HiSeq	Phase_1	67	4	.	Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	ENST00000412962.1	37																																																																																				.		0.647	CROCCP2-003	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000092784.1	NR_026752.1	
NRD1	4898	bcgsc.ca	37	1	52276063	52276063	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr1:52276063G>T	ENST00000354831.7	-	18	2186	c.1997C>A	c.(1996-1998)gCc>gAc	p.A666D	NRD1_ENST00000485608.1_5'UTR|NRD1_ENST00000544028.1_Missense_Mutation_p.A466D|NRD1_ENST00000539524.1_Missense_Mutation_p.A534D|NRD1_ENST00000352171.7_Missense_Mutation_p.A598D	NM_002525.2	NP_002516.2	O43847	NRDC_HUMAN	nardilysin (N-arginine dibasic convertase)	597					cell migration (GO:0016477)|cell proliferation (GO:0008283)|neuromuscular junction development (GO:0007528)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)	cell surface (GO:0009986)|cytosol (GO:0005829)	epidermal growth factor binding (GO:0048408)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)	27						CTGATTCAAGGCTTCACCAAT	0.378																																					p.A666D													.	NRD1	89	0			c.C1997A						.						81.0	76.0	78.0					1																	52276063		2203	4300	6503	SO:0001583	missense	4898	exon18			TTCAAGGCTTCAC	X93207	CCDS559.1, CCDS41335.1, CCDS55599.1	1p32.2-p32.1	2008-07-18			ENSG00000078618	ENSG00000078618			7995	protein-coding gene	gene with protein product		602651				9581555, 9479496	Standard	NM_002525		Approved	hNRD1, hNRD2	uc001ctc.4	O43847	OTTHUMG00000008278	ENST00000354831.7:c.1997C>A	1.37:g.52276063G>T	ENSP00000346890:p.Ala666Asp	Somatic	88	1		WXS	Illumina HiSeq	Phase_1	89	4	NM_002525	A6NI41|O15241|O15242|Q5VUL0|Q96HB2|Q9NU57	Missense_Mutation	SNP	ENST00000354831.7	37	CCDS559.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.6|26.6	4.753021|4.753021	0.89753|0.89753	.|.	.|.	ENSG00000078618|ENSG00000078618	ENST00000352171;ENST00000354831;ENST00000539524;ENST00000371665;ENST00000546169;ENST00000544028|ENST00000440943	T;T;T;T|.	0.33216|.	1.42;1.44;1.43;1.44|.	5.73|5.73	5.73|5.73	0.89815|0.89815	Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);|.	0.137344|.	0.64402|.	D|.	0.000003|.	T|T	0.78272|0.78272	0.4257|0.4257	M|M	0.79475|0.79475	2.455|2.455	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;0.999;1.0|.	D;D;D|.	0.72338|.	0.977;0.949;0.972|.	T|T	0.77744|0.77744	-0.2473|-0.2473	10|5	0.66056|.	D|.	0.02|.	-8.7349|-8.7349	18.8899|18.8899	0.92395|0.92395	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	598;597;666|.	F5H6R2;O43847;B1AKJ5|.	.;NRDC_HUMAN;.|.	D|R	598;666;534;68;598;466|52	ENSP00000262679:A598D;ENSP00000346890:A666D;ENSP00000444416:A534D;ENSP00000442262:A466D|.	ENSP00000262679:A598D|.	A|S	-|-	2|3	0|2	NRD1|NRD1	52048651|52048651	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.716000|0.716000	0.41182|0.41182	6.226000|6.226000	0.72277|0.72277	2.707000|2.707000	0.92482|0.92482	0.561000|0.561000	0.74099|0.74099	GCC|AGC	.		0.378	NRD1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023045.1	NM_002525	
RP11-640M9.2	0	bcgsc.ca	37	1	144598726	144598726	+	RNA	SNP	A	A	C			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr1:144598726A>C	ENST00000419820.1	+	0	654																											CATTCGGTGCACCAAGAGCAA	0.572																																					.													.	.	.	0			.						.																																					728841	.			CGGTGCACCAAGA																													1.37:g.144598726A>C		Somatic	38	2		WXS	Illumina HiSeq	Phase_1	30	8	.		RNA	SNP	ENST00000419820.1	37																																																																																				.		0.572	RP11-640M9.2-011	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000038365.1		
LAMC1	3915	bcgsc.ca	37	1	183093839	183093839	+	Silent	SNP	C	C	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr1:183093839C>T	ENST00000258341.4	+	14	2732	c.2475C>T	c.(2473-2475)tgC>tgT	p.C825C		NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	825	Laminin EGF-like 7. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						TGAGACTTTGCCGCCTGTGCC	0.507																																					p.C825C													.	LAMC1	176	0			c.C2475T						.						120.0	109.0	113.0					1																	183093839		2203	4300	6503	SO:0001819	synonymous_variant	3915	exon14			ACTTTGCCGCCTG	J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.2475C>T	1.37:g.183093839C>T		Somatic	39	0		WXS	Illumina HiSeq	Phase_1	54	4	NM_002293	Q5VYE7	Silent	SNP	ENST00000258341.4	37	CCDS1351.1																																																																																			.		0.507	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085954.2	NM_002293	
KIAA2012	100652824	bcgsc.ca	37	2	203019494	203019494	+	3'UTR	SNP	C	C	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr2:203019494C>T	ENST00000541917.1	+	0	2572				AC079354.1_ENST00000295844.3_3'UTR																							AAGAATTTTACACGCGCAAGC	0.463																																					.													.	.	.	0			.						.																																			SO:0001624	3_prime_UTR_variant	0	.			ATTTTACACGCGC																												ENST00000541917.1:c.*189C>T	2.37:g.203019494C>T		Somatic	42	0		WXS	Illumina HiSeq	Phase_1	34	4	.		Silent	SNP	ENST00000541917.1	37																																																																																				.		0.463	AC079354.1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			
RBM5	10181	bcgsc.ca	37	3	50143035	50143035	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr3:50143035G>T	ENST00000347869.3	+	10	923	c.748G>T	c.(748-750)Gca>Tca	p.A250S		NM_005778.3	NP_005769.1	P52756	RBM5_HUMAN	RNA binding motif protein 5	250	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				apoptotic process (GO:0006915)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(3)|large_intestine(4)|lung(6)|prostate(2)	19				BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CATCATGACAGCACTGTCTCC	0.483																																					p.A250S													.	RBM5	76	0			c.G748T						.						207.0	165.0	179.0					3																	50143035		2203	4300	6503	SO:0001583	missense	10181	exon10			ATGACAGCACTGT	U23946	CCDS2810.1	3p21.3	2013-08-15			ENSG00000003756	ENSG00000003756		"""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9902	protein-coding gene	gene with protein product		606884				10352938, 23935508	Standard	NM_005778		Approved	LUCA15, H37	uc003cyg.3	P52756	OTTHUMG00000156785	ENST00000347869.3:c.748G>T	3.37:g.50143035G>T	ENSP00000343054:p.Ala250Ser	Somatic	58	1		WXS	Illumina HiSeq	Phase_1	43	4	NM_005778	B2RA45|B4DM16|B4DMF9|B4DZ63|Q93021|Q9BU14|Q9HDA6|Q9UKY8|Q9UL24	Missense_Mutation	SNP	ENST00000347869.3	37	CCDS2810.1	.	.	.	.	.	.	.	.	.	.	G	34	5.359210	0.95854	.	.	ENSG00000003756	ENST00000347869;ENST00000543047	T	0.08282	3.11	6.16	6.16	0.99307	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.152117	0.56097	D	0.000038	T	0.27866	0.0686	M	0.73598	2.24	0.80722	D	1	D	0.62365	0.991	P	0.60173	0.87	T	0.00147	-1.1990	10	0.25751	T	0.34	-12.1026	20.8598	0.99761	0.0:0.0:1.0:0.0	.	250	P52756	RBM5_HUMAN	S	250;249	ENSP00000343054:A250S	ENSP00000343054:A250S	A	+	1	0	RBM5	50118039	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.517000	0.67061	2.937000	0.99478	0.650000	0.86243	GCA	.		0.483	RBM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345797.3	NM_005778	
FNDC1	84624	bcgsc.ca	37	6	159646709	159646709	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr6:159646709G>T	ENST00000297267.9	+	8	1227	c.1027G>T	c.(1027-1029)Gat>Tat	p.D343Y	FNDC1_ENST00000480856.1_3'UTR|FNDC1_ENST00000340366.6_Missense_Mutation_p.D343Y	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	343	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		GGGTGAAAGAGATGGCAAATG	0.413																																					p.D343Y													.	FNDC1	250	0			c.G1027T						.						139.0	143.0	142.0					6																	159646709		1918	4113	6031	SO:0001583	missense	84624	exon8			GAAAGAGATGGCA	AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.1027G>T	6.37:g.159646709G>T	ENSP00000297267:p.Asp343Tyr	Somatic	29	0		WXS	Illumina HiSeq	Phase_1	19	3	NM_032532	A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Missense_Mutation	SNP	ENST00000297267.9	37	CCDS47512.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.81|15.81	2.942165|2.942165	0.53079|0.53079	.|.	.|.	ENSG00000164694|ENSG00000164694	ENST00000297267;ENST00000340366|ENST00000329629	T;T|T	0.57107|0.57107	0.42;0.42|0.42	5.84|5.84	5.84|5.84	0.93424|0.93424	Fibronectin, type III (5);Immunoglobulin-like fold (1);|.	0.231445|.	0.42053|.	D|.	0.000780|.	T|T	0.63082|0.63082	0.2481|0.2481	M|M	0.61703|0.61703	1.905|1.905	0.41351|0.41351	D|D	0.987361|0.987361	D;D|.	0.89917|.	1.0;0.999|.	D;D|.	0.87578|.	0.998;0.985|.	T|T	0.63769|0.63769	-0.6562|-0.6562	10|7	0.62326|0.66056	D|D	0.03|0.02	-27.865|-27.865	20.1346|20.1346	0.98019|0.98019	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	343;343|.	Q4ZHG4-2;Q4ZHG4|.	.;FNDC1_HUMAN|.	Y|I	343|301	ENSP00000297267:D343Y;ENSP00000342460:D343Y|ENSP00000333297:R301I	ENSP00000297267:D343Y|ENSP00000333297:R301I	D|R	+|+	1|2	0|0	FNDC1|FNDC1	159566697|159566697	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.991000|0.991000	0.79684|0.79684	3.360000|3.360000	0.52299|0.52299	2.765000|2.765000	0.95021|0.95021	0.655000|0.655000	0.94253|0.94253	GAT|AGA	.		0.413	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042897.3	NM_032532	
OR7E109P	401540	bcgsc.ca	37	9	93505214	93505214	+	IGR	SNP	A	A	C			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr9:93505214A>C								DIRAS2 (99828 upstream) : SYK (58854 downstream)																							GAAGCAGGTCATTTGTAAGGC	0.413																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			CAGGTCATTTGTA																													9.37:g.93505214A>C		Somatic	40	0		WXS	Illumina HiSeq	Phase_1	41	5	.		RNA	SNP		37																																																																																				.	0	0.413								
MUC19	283463	bcgsc.ca	37	12	40840366	40840366	+	Silent	SNP	C	C	T			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr12:40840366C>T	ENST00000454784.4	+	31	3793	c.3060C>T	c.(3058-3060)tgC>tgT	p.C1020C	RP11-115F18.1_ENST00000552757.1_RNA			Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric	1020	Approximate repeats of G-V-T-G-T-T-G-P-S- A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						TATCTGAGTGCAGCTGTTTCT	0.378																																					.													.	.	.	0			.						.																																			SO:0001819	synonymous_variant	283463	.			TGAGTGCAGCTGT	AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000454784.4:c.3060C>T	12.37:g.40840366C>T		Somatic	75	0		WXS	Illumina HiSeq	Phase_1	84	4	.	Q8NA85	Silent	SNP	ENST00000454784.4	37																																																																																				.		0.378	MUC19-001	NOVEL	non_canonical_conserved|non_canonical_genome_sequence_error|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000384257.6	XM_003403524	
RYR3	6263	bcgsc.ca	37	15	33765642	33765642	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2Z-01A-11D-A417-09	TCGA-W5-AA2Z-11A-11D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b68bdaab-f992-4533-be20-4b56b7dc9031	354bfffb-4959-49d7-b276-66342e562181	g.chr15:33765642G>A	ENST00000389232.4	+	2	144	c.74G>A	c.(73-75)tGc>tAc	p.C25Y	RYR3_ENST00000415757.3_Missense_Mutation_p.C25Y	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	25					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GTACTCCAGTGCATCGCCACC	0.562																																					p.C25Y													.	RYR3	760	0			c.G74A						.						109.0	111.0	110.0					15																	33765642		2091	4220	6311	SO:0001583	missense	6263	exon2			TCCAGTGCATCGC		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.74G>A	15.37:g.33765642G>A	ENSP00000373884:p.Cys25Tyr	Somatic	36	0		WXS	Illumina HiSeq	Phase_1	20	3	NM_001243996	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.533659	0.85812	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.98701	-5.08;-5.08	4.86	4.86	0.63082	Inositol 1,4,5-trisphosphate/ryanodine receptor (1);	0.058919	0.64402	D	0.000001	D	0.99077	0.9683	M	0.80183	2.485	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.998;0.996	D	0.99671	1.0996	10	0.87932	D	0	.	16.924	0.86170	0.0:0.0:1.0:0.0	.	25;25	Q15413-2;Q15413	.;RYR3_HUMAN	Y	25	ENSP00000373884:C25Y;ENSP00000399610:C25Y	ENSP00000354735:C25Y	C	+	2	0	RYR3	31552934	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.149000	0.94659	2.508000	0.84585	0.650000	0.86243	TGC	.		0.562	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
