#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVarCov_SOL	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
APOB	338	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	21225533	21225533	+	Frame_Shift_Del	DEL	G	G	-			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr2:21225533delG	ENST00000233242.1	-	29	12888	c.12761delC	c.(12760-12762)cctfs	p.P4254fs	RP11-116D2.1_ENST00000567376.2_lincRNA	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	4254					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TAACTCGAAAGGAAGTGTAAT	0.368																																					p.P4254fs		.											.	.	.	0			c.12762delT						.						113.0	122.0	119.0					2																	21225533		2203	4300	6503	SO:0001589	frameshift_variant	338	exon29			TCGAAAGGAAGTG	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.12761delC	2.37:g.21225533delG	ENSP00000233242:p.Pro4254fs	Somatic	45	0		WXS	Illumina HiSeq	.	52	12	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Frame_Shift_Del	DEL	ENST00000233242.1	37	CCDS1703.1																																																																																			.		0.368	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
RUFY1	80230	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	179007944	179007948	+	Splice_Site	DEL	AAAGG	AAAGG	-			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	AAAGG	AAAGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr5:179007944_179007948delAAAGG	ENST00000319449.4	+	7	902_903	c.890_891delAAAGG	c.(889-891)gaa>g	p.E297fs	RUFY1_ENST00000437570.2_Splice_Site_p.E189fs|RUFY1_ENST00000393438.2_Splice_Site_p.E189fs|RUFY1_ENST00000377001.2_Splice_Site_p.E297fs	NM_025158.4	NP_079434.3	Q96T51	RUFY1_HUMAN	RUN and FYVE domain containing 1	297					endocytosis (GO:0006897)|regulation of endocytosis (GO:0030100)	cytoplasm (GO:0005737)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	lipid binding (GO:0008289)|protein transporter activity (GO:0008565)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	26	all_cancers(89;0.00018)|all_epithelial(37;8.37e-05)|Renal(175;0.000159)|Lung NSC(126;0.00108)|all_lung(126;0.00195)	all_cancers(40;0.0322)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCTCCTTTTAAAAGGCATGAAAGAA	0.327										HNSCC(44;0.11)																											.		.											.	.	.	0			.						.																																			SO:0001630	splice_region_variant	80230	.			CTTTTAAAAGGCA	AF361055	CCDS4445.2, CCDS34312.1	5q35.3	2008-02-05			ENSG00000176783	ENSG00000176783		"""Zinc fingers, FYVE domain containing"""	19760	protein-coding gene	gene with protein product		610327				11877430	Standard	NM_001040451		Approved	FLJ22251, ZFYVE12, RABIP4	uc003mka.2	Q96T51	OTTHUMG00000130913	ENST00000319449.4:c.891-1AAAGG>-	5.37:g.179007944_179007948delAAAGG		Somatic	72	0		WXS	Illumina HiSeq	.	108	11	.	Q59FF3|Q71S93|Q9H6I3	Splice_Site	DEL	ENST00000319449.4	37	CCDS4445.2																																																																																			.		0.327	RUFY1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253505.2	NM_001040451	Frame_Shift_Del
BRCA2	675	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	32913032	32913032	+	Missense_Mutation	SNP	G	G	C	rs397507725		TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr13:32913032G>C	ENST00000380152.3	+	11	4773	c.4540G>C	c.(4540-4542)Gaa>Caa	p.E1514Q	BRCA2_ENST00000544455.1_Missense_Mutation_p.E1514Q			P51587	BRCA2_HUMAN	breast cancer 2, early onset	1514	Interaction with POLH.|Required for stimulation of POLH DNA polymerization activity.				brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		CGAACGTGATGAAAAGATCAA	0.378			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											p.E1514Q	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	.	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	BRCA2,NS,carcinoma,0,1	BRCA2	0	0			c.G4540C						.						60.0	63.0	62.0					13																	32913032		2203	4296	6499	SO:0001583	missense	675	exon11	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	CGTGATGAAAAGA	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.4540G>C	13.37:g.32913032G>C	ENSP00000369497:p.Glu1514Gln	Somatic	58	0		WXS	Illumina HiSeq	.	32	5	NM_000059	O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	ENST00000380152.3	37	CCDS9344.1	.	.	.	.	.	.	.	.	.	.	G	4.230	0.041645	0.08196	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	T;T	0.00784	5.7;5.7	5.74	0.312	0.15837	.	0.528682	0.19909	N	0.103323	T	0.00666	0.0022	L	0.27053	0.805	0.09310	N	1	P	0.35383	0.498	B	0.30572	0.117	T	0.52403	-0.8580	10	0.42905	T	0.14	.	9.5955	0.39571	0.6196:0.0:0.3804:0.0	.	1514	P51587	BRCA2_HUMAN	Q	1514	ENSP00000369497:E1514Q;ENSP00000439902:E1514Q	ENSP00000369497:E1514Q	E	+	1	0	BRCA2	31811032	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	-0.040000	0.12104	0.065000	0.16485	-0.244000	0.11960	GAA	.		0.378	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059	
TLR3	7098	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	187004484	187004484	+	Silent	SNP	C	C	T	rs147873871	byFrequency	TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr4:187004484C>T	ENST00000296795.3	+	4	1748	c.1644C>T	c.(1642-1644)caC>caT	p.H548H	TLR3_ENST00000504367.1_Silent_p.H271H	NM_003265.2	NP_003256.1	O15455	TLR3_HUMAN	toll-like receptor 3	548					activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to drug (GO:0035690)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|cellular response to interferon-gamma (GO:0071346)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|detection of virus (GO:0009597)|extrinsic apoptotic signaling pathway (GO:0097191)|hyperosmotic response (GO:0006972)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|microglial cell activation involved in immune response (GO:0002282)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic signaling pathway (GO:0097527)|negative regulation of osteoclast differentiation (GO:0045671)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type III interferon production (GO:0034346)|response to exogenous dsRNA (GO:0043330)|signal transduction (GO:0007165)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	double-stranded RNA binding (GO:0003725)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(5)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(30;1.14e-05)|GBM - Glioblastoma multiforme(59;0.000107)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.16)		TCTGGAAACACGCAAACCCTG	0.453													c|||	2	0.000399361	0.0015	0.0	5008	,	,		19900	0.0		0.0	False		,,,				2504	0.0				p.H548H		.											.	.	.	0			c.C1644T						.	T		2,4404	4.2+/-10.8	0,2,2201	109.0	104.0	105.0		1644	-11.3	0.0	4	dbSNP_134	105	0,8600		0,0,4300	no	coding-synonymous	TLR3	NM_003265.2		0,2,6501	TT,TC,CC		0.0,0.0454,0.0154		548/905	187004484	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	7098	exon4			GAAACACGCAAAC	U88879	CCDS3846.1	4q35	2014-09-17				ENSG00000164342		"""CD molecules"""	11849	protein-coding gene	gene with protein product		603029				9435236	Standard	NM_003265		Approved	CD283	uc003iyq.3	O15455		ENST00000296795.3:c.1644C>T	4.37:g.187004484C>T		Somatic	42	0		WXS	Illumina HiSeq	.	25	9	NM_003265	B2RAI7|B7Z7K0|E6Y0F0|E6Y0F1|E9PGH4|Q4VAL2|Q504W0	Silent	SNP	ENST00000296795.3	37	CCDS3846.1																																																																																			0.000		0.453	TLR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360313.4		
ANGPT4	51378	hgsc.bcm.edu;ucsc.edu	37	20	870928	870928	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr20:870928C>T	ENST00000381922.3	-	2	495	c.393G>A	c.(391-393)atG>atA	p.M131I	ANGPT4_ENST00000546022.1_Missense_Mutation_p.M131I	NM_015985.2	NP_057069.1	Q9Y264	ANGP4_HUMAN	angiopoietin 4	131					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to hypoxia (GO:0071456)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)	27						CCAGCTCTAGCATGGGGGCCG	0.602																																					p.M131I	Pancreas(181;481 2077 3259 31286 49856)	.											.	.	.	0			c.G393A						.						95.0	81.0	85.0					20																	870928		2203	4300	6503	SO:0001583	missense	51378	exon2			CTCTAGCATGGGG	AF074332	CCDS13009.1	20p13	2013-02-06			ENSG00000101280	ENSG00000101280		"""Fibrinogen C domain containing"""	487	protein-coding gene	gene with protein product		603705				10051567, 10218486	Standard	NM_015985		Approved		uc002wei.3	Q9Y264	OTTHUMG00000031652	ENST00000381922.3:c.393G>A	20.37:g.870928C>T	ENSP00000371347:p.Met131Ile	Somatic	21	0		WXS	Illumina HiSeq	.	35	4	NM_015985	B4E3J9|Q5TFF4|Q9H4Z4	Missense_Mutation	SNP	ENST00000381922.3	37	CCDS13009.1	.	.	.	.	.	.	.	.	.	.	c	11.06	1.529090	0.27387	.	.	ENSG00000101280	ENST00000381922;ENST00000546022	T;T	0.19105	2.17;2.17	4.38	2.41	0.29592	.	0.285363	0.29707	N	0.011406	T	0.20495	0.0493	M	0.72353	2.195	0.35438	D	0.794631	B;B	0.17465	0.022;0.009	B;B	0.09377	0.004;0.004	T	0.11108	-1.0601	10	0.29301	T	0.29	.	7.3629	0.26756	0.0:0.732:0.171:0.0969	.	131;131	B4E3J9;Q9Y264	.;ANGP4_HUMAN	I	131	ENSP00000371347:M131I;ENSP00000439605:M131I	ENSP00000371347:M131I	M	-	3	0	ANGPT4	818928	1.000000	0.71417	0.979000	0.43373	0.119000	0.20118	3.608000	0.54109	0.459000	0.27016	0.450000	0.29827	ATG	.		0.602	ANGPT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077493.1	NM_015985	
LAMA3	3909	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	21526190	21526190	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr18:21526190C>T	ENST00000313654.9	+	70	9534	c.9293C>T	c.(9292-9294)tCc>tTc	p.S3098F	LAMA3_ENST00000399516.3_Missense_Mutation_p.S3042F|LAMA3_ENST00000588770.1_3'UTR|LAMA3_ENST00000587184.1_Missense_Mutation_p.S1433F|LAMA3_ENST00000269217.6_Missense_Mutation_p.S1489F	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	3098	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					CCTGGAAACTCCACCATCAGC	0.507																																					p.S3098F		.											.	.	.	0			c.C9293T						.						118.0	95.0	102.0					18																	21526190		2203	4300	6503	SO:0001583	missense	3909	exon70			GAAACTCCACCAT	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.9293C>T	18.37:g.21526190C>T	ENSP00000324532:p.Ser3098Phe	Somatic	43	0		WXS	Illumina HiSeq	.	36	7	NM_198129	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	ENST00000313654.9	37	CCDS42419.1	.	.	.	.	.	.	.	.	.	.	C	8.356	0.831959	0.16820	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000269217	T;T;T	0.78816	-1.21;-1.21;-1.21	5.14	4.27	0.50696	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	T	0.65471	0.2694	L	0.28694	0.88	0.38704	D	0.953057	B;B;B;B	0.22480	0.007;0.041;0.034;0.07	B;B;B;B	0.23419	0.011;0.034;0.022;0.046	T	0.63778	-0.6560	9	0.44086	T	0.13	.	8.4135	0.32657	0.0:0.7678:0.0:0.2322	.	1433;1489;3042;3098	Q6VU69;B0YJ33;Q6VU67;Q16787	.;.;.;LAMA3_HUMAN	F	3098;3042;1489	ENSP00000324532:S3098F;ENSP00000382432:S3042F;ENSP00000269217:S1489F	ENSP00000269217:S1489F	S	+	2	0	LAMA3	19780188	0.691000	0.27709	0.998000	0.56505	0.256000	0.26092	1.042000	0.30303	1.394000	0.46624	0.655000	0.94253	TCC	.		0.507	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	
SOX2	6657	hgsc.bcm.edu	37	3	181432147	181432147	+	3'UTR	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr3:181432147G>T	ENST00000325404.1	+	0	2426					NM_003106.3	NP_003097.1	P48431	SOX2_HUMAN	SRY (sex determining region Y)-box 2						adenohypophysis development (GO:0021984)|cell cycle arrest (GO:0007050)|cerebral cortex development (GO:0021987)|chromatin organization (GO:0006325)|detection of mechanical stimulus involved in equilibrioception (GO:0050973)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|diencephalon morphogenesis (GO:0048852)|endodermal cell fate specification (GO:0001714)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|eye development (GO:0001654)|forebrain development (GO:0030900)|forebrain neuron differentiation (GO:0021879)|glial cell fate commitment (GO:0021781)|inner ear development (GO:0048839)|inner ear morphogenesis (GO:0042472)|lens induction in camera-type eye (GO:0060235)|lung alveolus development (GO:0048286)|male genitalia development (GO:0030539)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate commitment (GO:0048663)|neuronal stem cell maintenance (GO:0097150)|olfactory placode formation (GO:0030910)|osteoblast differentiation (GO:0001649)|pigment biosynthetic process (GO:0046148)|pituitary gland development (GO:0021983)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of gene expression (GO:0010468)|regulation of transcription, DNA-templated (GO:0006355)|response to growth factor (GO:0070848)|response to retinoic acid (GO:0032526)|response to wounding (GO:0009611)|retina morphogenesis in camera-type eye (GO:0060042)|somatic stem cell maintenance (GO:0035019)|tongue development (GO:0043586)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|miRNA binding (GO:0035198)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(1)|skin(1)	10	all_cancers(143;1.22e-16)|Ovarian(172;0.0283)		all cancers(12;1.82e-48)|Epithelial(37;9.85e-40)|OV - Ovarian serous cystadenocarcinoma(80;7.37e-23)|Lung(8;2.01e-21)|GBM - Glioblastoma multiforme(1;2.13e-08)			CCTTATAACAGGTACATTTTC	0.279			A		"""NSCLC, oesophageal squamous carcinoma"""		MICROPHTHALMIA AND ESOPHAGEAL ATRESIA SYNDROME																														.		.		Dom	yes		3	3q26.3-q27	6657	SRY (sex determining region Y)-box 2	yes	E	.	.	.	0			.						.																																			SO:0001624	3_prime_UTR_variant	6657	.			ATAACAGGTACAT	BC013923	CCDS3239.1	3q26.3-q27	2014-09-17						"""SRY (sex determining region Y)-boxes"""	11195	protein-coding gene	gene with protein product		184429				7849401	Standard	NM_003106		Approved		uc003fkx.3	P48431		ENST00000325404.1:c.*1045G>T	3.37:g.181432147G>T		Somatic	46	0		WXS	Illumina HiSeq	.	65	2	.	Q14537	RNA	SNP	ENST00000325404.1	37	CCDS3239.1																																																																																			.		0.279	SOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350419.1	NM_003106	
CHAMP1	283489	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	115089740	115089740	+	Missense_Mutation	SNP	G	G	C			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr13:115089740G>C	ENST00000361283.1	+	3	732	c.423G>C	c.(421-423)ttG>ttC	p.L141F		NM_001164144.1|NM_001164145.1|NM_032436.2	NP_001157616.1|NP_001157617.1|NP_115812.1	Q96JM3	CHAP1_HUMAN	chromosome alignment maintaining phosphoprotein 1	141	Pro-rich.				attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation (GO:0051315)|protein localization to kinetochore (GO:0034501)|protein localization to microtubule (GO:0035372)|sister chromatid biorientation (GO:0031134)	condensed chromosome (GO:0000793)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)										GTTCAGTTTTGTCTCCAGAAT	0.483																																					p.L141F		.											.	.	.	0			c.G423C						.						96.0	101.0	99.0					13																	115089740		2203	4300	6503	SO:0001583	missense	283489	exon3			AGTTTTGTCTCCA	AK074894	CCDS9545.1	13q34	2013-01-07	2011-10-07	2011-10-07	ENSG00000198824	ENSG00000198824		"""Zinc fingers, C2H2-type"""	20311	protein-coding gene	gene with protein product	"""chromosome alignment-maintaining phosphoprotein"""		"""chromosome 13 open reading frame 8"", ""zinc finger protein 828"""	C13orf8, ZNF828		21063390	Standard	NM_032436		Approved	CAMP, CHAMP	uc010ahb.3	Q96JM3	OTTHUMG00000017404	ENST00000361283.1:c.423G>C	13.37:g.115089740G>C	ENSP00000354730:p.Leu141Phe	Somatic	38	0		WXS	Illumina HiSeq	.	41	5	NM_001164144	B3KU06|Q6P181|Q8NC88|Q9BST0	Missense_Mutation	SNP	ENST00000361283.1	37	CCDS9545.1	.	.	.	.	.	.	.	.	.	.	G	8.916	0.959957	0.18507	.	.	ENSG00000198824	ENST00000361283	T	0.01430	4.9	5.56	2.67	0.31697	.	0.996122	0.08125	N	0.994117	T	0.01421	0.0046	N	0.24115	0.695	0.09310	N	1	B	0.24483	0.104	B	0.30646	0.118	T	0.50988	-0.8762	9	.	.	.	2.6547	5.5071	0.16860	0.1898:0.0:0.558:0.2522	.	141	Q96JM3	ZN828_HUMAN	F	141	ENSP00000354730:L141F	.	L	+	3	2	ZNF828	114107842	0.001000	0.12720	0.742000	0.31022	0.961000	0.63080	-0.660000	0.05317	0.659000	0.30945	0.655000	0.94253	TTG	.		0.483	CHAMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045977.2	NM_032436	
ALMS1	7840	hgsc.bcm.edu	37	2	73676231	73676231	+	Silent	SNP	G	G	T	rs547563359		TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr2:73676231G>T	ENST00000264448.6	+	8	2685	c.2574G>T	c.(2572-2574)gcG>gcT	p.A858A	ALMS1_ENST00000377715.1_Silent_p.A858A|ALMS1_ENST00000409009.1_Silent_p.A816A	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	858	34 X 47 AA approximate tandem repeat.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.A858A(1)		breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						CTTCCTCTGCGTCCTCTTCAC	0.488																																					p.A858A		.											ALMS1,colon,carcinoma,0,1	ALMS1	0	1	Substitution - coding silent(1)	large_intestine(1)	c.G2574T						.						80.0	83.0	82.0					2																	73676231		1895	4112	6007	SO:0001819	synonymous_variant	7840	exon8			CTCTGCGTCCTCT	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.2574G>T	2.37:g.73676231G>T		Somatic	33	0		WXS	Illumina HiSeq	.	40	3	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Silent	SNP	ENST00000264448.6	37	CCDS42697.1																																																																																			.		0.488	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
CCNH	902	hgsc.bcm.edu	37	5	86703897	86703897	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr5:86703897C>T	ENST00000256897.4	-	4	645	c.421G>A	c.(421-423)Gaa>Aaa	p.E141K	CCNH_ENST00000508855.1_Missense_Mutation_p.E67K|CCNH_ENST00000504878.1_Missense_Mutation_p.E67K|CCNH_ENST00000513499.1_Intron	NM_001239.3	NP_001230.1	P51946	CCNH_HUMAN	cyclin H	141					7-methylguanosine mRNA capping (GO:0006370)|ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cyclin-dependent protein kinase activating kinase holoenzyme complex (GO:0019907)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|TFIIK complex (GO:0070985)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)|kinase activity (GO:0016301)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(1)|lung(2)|ovary(2)	15		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;9.01e-39)|Epithelial(54;5.08e-33)|all cancers(79;4.28e-28)		AGTATCTGTTCAAGTGCCTTC	0.418								Direct reversal of damage;Direct reversal of damage;Nucleotide excision repair (NER)																													p.E141K		.											CCNH,NS,carcinoma,0,1	CCNH	0	0			c.G421A						.						133.0	129.0	130.0					5																	86703897		2203	4300	6503	SO:0001583	missense	902	exon4			TCTGTTCAAGTGC	U12685	CCDS4064.1	5q13.3-q14	2014-03-28			ENSG00000134480	ENSG00000134480		"""General transcription factor IIH complex subunits"""	1594	protein-coding gene	gene with protein product	"""CDK-activating kinase complex subunit"", ""cyclin-dependent kinase-activating kinase complex subunit"", ""MO15-associated protein"", ""CAK complex subunit"""	601953				9465303	Standard	NM_001239		Approved	p34, p37, CycH	uc003kjb.3	P51946	OTTHUMG00000119077	ENST00000256897.4:c.421G>A	5.37:g.86703897C>T	ENSP00000256897:p.Glu141Lys	Somatic	49	0		WXS	Illumina HiSeq	.	42	2	NM_001239	Q53X72|Q8TBL9	Missense_Mutation	SNP	ENST00000256897.4	37	CCDS4064.1	.	.	.	.	.	.	.	.	.	.	C	33	5.206064	0.95033	.	.	ENSG00000134480	ENST00000508855;ENST00000256897;ENST00000504878	T;T;T	0.16597	2.33;2.33;2.33	5.14	5.14	0.70334	Cyclin, N-terminal (1);Cyclin-like (3);	0.095200	0.64402	D	0.000001	T	0.33818	0.0876	L	0.47016	1.485	0.80722	D	1	D;P	0.69078	0.997;0.902	D;P	0.64321	0.924;0.594	T	0.01349	-1.1378	10	0.31617	T	0.26	-17.2016	18.5912	0.91214	0.0:1.0:0.0:0.0	.	141;88	P51946;E9PDB6	CCNH_HUMAN;.	K	67;141;67	ENSP00000426454:E67K;ENSP00000256897:E141K;ENSP00000426075:E67K	ENSP00000256897:E141K	E	-	1	0	CCNH	86739653	1.000000	0.71417	0.986000	0.45419	0.996000	0.88848	5.700000	0.68318	2.398000	0.81561	0.655000	0.94253	GAA	.		0.418	CCNH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239291.3	NM_001239	
OR2L8	391190	hgsc.bcm.edu	37	1	248112794	248112794	+	Missense_Mutation	SNP	G	G	C	rs200574966		TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr1:248112794G>C	ENST00000357191.3	+	1	635	c.635G>C	c.(634-636)gGt>gCt	p.G212A	OR2L13_ENST00000366478.2_Intron	NM_001001963.1	NP_001001963.1	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L, member 8 (gene/pseudogene)	212						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G212A(2)		endometrium(1)|kidney(3)|large_intestine(3)|lung(30)|ovary(1)|prostate(1)|skin(3)	42	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			CCCTTCATTGGTATTTCATGT	0.498																																					p.G212A		.											OR2L8,NS,carcinoma,0,2	OR2L8	0	2	Substitution - Missense(2)	prostate(1)|skin(1)	c.G635C						.						176.0	87.0	117.0					1																	248112794		2203	4300	6503	SO:0001583	missense	391190	exon1			TCATTGGTATTTC	BK004459	CCDS31101.1	1q44	2013-10-10	2013-10-10		ENSG00000196936	ENSG00000196936		"""GPCR / Class A : Olfactory receptors"""	15014	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily L, member 8"""				Standard	NM_001001963		Approved		uc001idt.1	Q8NGY9	OTTHUMG00000040196	ENST00000357191.3:c.635G>C	1.37:g.248112794G>C	ENSP00000349719:p.Gly212Ala	Somatic	62	1		WXS	Illumina HiSeq	.	86	5	NM_001001963	Q6IF03	Missense_Mutation	SNP	ENST00000357191.3	37	CCDS31101.1	.	.	.	.	.	.	.	.	.	.	.	0.010	-1.747988	0.00669	.	.	ENSG00000196936	ENST00000357191	T	0.35973	1.28	1.8	-3.61	0.04556	GPCR, rhodopsin-like superfamily (1);	0.592578	0.12695	U	0.446818	T	0.14657	0.0354	N	0.05012	-0.13	0.09310	N	1	B	0.06786	0.001	B	0.18263	0.021	T	0.11817	-1.0572	10	0.46703	T	0.11	.	5.6462	0.17590	0.0:0.2703:0.1902:0.5394	.	212	Q8NGY9	OR2L8_HUMAN	A	212	ENSP00000349719:G212A	ENSP00000349719:G212A	G	+	2	0	OR2L8	246179417	0.000000	0.05858	0.006000	0.13384	0.165000	0.22458	-1.473000	0.02339	-1.273000	0.02424	-0.515000	0.04445	GGT	.		0.498	OR2L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096853.2		
CACNA1F	778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	49062181	49062181	+	Silent	SNP	G	G	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chrX:49062181G>A	ENST00000376265.2	-	47	5659	c.5598C>T	c.(5596-5598)ggC>ggT	p.G1866G	AF196779.1_ENST00000583131.1_RNA|CACNA1F_ENST00000323022.5_Silent_p.G1855G|CACNA1F_ENST00000376251.1_Silent_p.G1801G	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	1866					axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	CACTGGATCTGCCGAGGTACC	0.667																																					p.G1866G		.											.	.	.	0			c.C5598T						.						44.0	34.0	37.0					X																	49062181		2202	4298	6500	SO:0001819	synonymous_variant	778	exon47			GGATCTGCCGAGG	AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.5598C>T	X.37:g.49062181G>A		Somatic	30	0		WXS	Illumina HiSeq	.	23	14	NM_005183	A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Silent	SNP	ENST00000376265.2	37	CCDS35253.1																																																																																			.		0.667	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358157.1	NM_005183	
PCNXL3	399909	hgsc.bcm.edu	37	11	65402529	65402529	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr11:65402529G>T	ENST00000355703.3	+	30	5430	c.4891G>T	c.(4891-4893)Gac>Tac	p.D1631Y	MIR4690_ENST00000578459.1_RNA	NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	1631						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						GGTCTTTGCCGACATGGACCT	0.632																																					p.D1631Y		.											PCNXL3_ENST00000355703,NS,carcinoma,0,1	PCNXL3_ENST00000355703	0	0			c.G4891T						.						66.0	68.0	67.0					11																	65402529		2127	4233	6360	SO:0001583	missense	399909	exon30			TTTGCCGACATGG	BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	ENST00000355703.3:c.4891G>T	11.37:g.65402529G>T	ENSP00000347931:p.Asp1631Tyr	Somatic	28	0		WXS	Illumina HiSeq	.	13	2	NM_032223	Q6MZN8	Missense_Mutation	SNP	ENST00000355703.3	37	CCDS44650.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.639754	0.87760	.	.	ENSG00000197136	ENST00000355703	T	0.52754	0.65	4.56	4.56	0.56223	.	0.000000	0.85682	D	0.000000	T	0.74351	0.3705	M	0.91406	3.205	0.53005	D	0.999961	D;D	0.89917	0.999;1.0	D;D	0.91635	0.993;0.999	T	0.81172	-0.1054	10	0.87932	D	0	.	14.8614	0.70384	0.0:0.0:1.0:0.0	.	518;1631	Q9H6A9-3;Q9H6A9	.;PCX3_HUMAN	Y	1631	ENSP00000347931:D1631Y	ENSP00000347931:D1631Y	D	+	1	0	PCNXL3	65159105	1.000000	0.71417	0.998000	0.56505	0.962000	0.63368	9.198000	0.94994	2.376000	0.81061	0.563000	0.77884	GAC	.		0.632	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390321.1	NM_032223	
ZNF100	163227	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	21910039	21910039	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr19:21910039T>C	ENST00000358296.6	-	5	1273	c.1075A>G	c.(1075-1077)Acc>Gcc	p.T359A	ZNF100_ENST00000305570.6_Missense_Mutation_p.T295A	NM_173531.3	NP_775802.2	Q8IYN0	ZN100_HUMAN	zinc finger protein 100	359					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(11)|skin(1)|upper_aerodigestive_tract(1)	21						GTAGTAAGGGTTGAGGACTGG	0.388																																					p.T359A		.											.	.	.	0			c.A1075G						.						69.0	73.0	72.0					19																	21910039		2200	4295	6495	SO:0001583	missense	163227	exon5			TAAGGGTTGAGGA	BC035579	CCDS42538.1	19p13.1	2013-01-08	2003-12-19		ENSG00000197020	ENSG00000197020		"""Zinc fingers, C2H2-type"", ""-"""	12880	protein-coding gene	gene with protein product		603982	"""zinc finger protein 100 (Y1)"""			12477932	Standard	NM_173531		Approved		uc002nqi.3	Q8IYN0		ENST00000358296.6:c.1075A>G	19.37:g.21910039T>C	ENSP00000351042:p.Thr359Ala	Somatic	63	0		WXS	Illumina HiSeq	.	53	8	NM_173531	Q7M4M0	Missense_Mutation	SNP	ENST00000358296.6	37	CCDS42538.1	.	.	.	.	.	.	.	.	.	.	.	0	-2.821944	0.00072	.	.	ENSG00000197020	ENST00000358296	T	0.06849	3.25	0.841	-0.455	0.12193	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02156	0.0067	N	0.01202	-0.96	0.09310	N	1	B;B	0.24092	0.009;0.097	B;B	0.23852	0.049;0.034	T	0.47005	-0.9150	9	0.15066	T	0.55	.	2.6908	0.05120	0.0:0.2373:0.27:0.4927	.	359;413	Q8IYN0;Q4G131	ZN100_HUMAN;.	A	359	ENSP00000351042:T359A	ENSP00000351042:T359A	T	-	1	0	ZNF100	21701879	0.000000	0.05858	0.117000	0.21633	0.117000	0.20001	-4.007000	0.00315	0.157000	0.19338	0.155000	0.16302	ACC	.		0.388	ZNF100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464087.1	NM_173531	
MYBPC1	4604	hgsc.bcm.edu	37	12	102061631	102061631	+	Silent	SNP	C	C	T	rs371105415		TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr12:102061631C>T	ENST00000550270.1	+	22	2457	c.2457C>T	c.(2455-2457)agC>agT	p.S819S	MYBPC1_ENST00000550501.1_Intron|MYBPC1_ENST00000392934.3_Silent_p.S788S|MYBPC1_ENST00000547509.1_Silent_p.S787S|MYBPC1_ENST00000452455.2_Silent_p.S819S|MYBPC1_ENST00000549145.1_Silent_p.S832S|MYBPC1_ENST00000441232.1_Silent_p.S819S|MYBPC1_ENST00000545503.2_Silent_p.S801S|MYBPC1_ENST00000360610.2_Silent_p.S819S|MYBPC1_ENST00000361685.2_Silent_p.S826S|MYBPC1_ENST00000536007.1_Silent_p.S782S|MYBPC1_ENST00000547405.1_Silent_p.S775S|MYBPC1_ENST00000541119.1_Silent_p.S789S|MYBPC1_ENST00000361466.2_Silent_p.S826S|MYBPC1_ENST00000551300.1_Silent_p.S702S|MYBPC1_ENST00000553190.1_Silent_p.S801S			Q00872	MYPC1_HUMAN	myosin binding protein C, slow type	819	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myofibril (GO:0030016)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	57						CTGGTGCCAGCGAGCCCAAGT	0.438																																					p.S826S		.											MYBPC1_ENST00000360610,NS,adenocarcinoma,0,2	MYBPC1_ENST00000360610	0	0			c.C2478T						.	C	,,,	1,4405	2.1+/-5.4	0,1,2202	96.0	81.0	86.0		2478,2478,2457,2403	-3.6	1.0	12		86	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	MYBPC1	NM_002465.2,NM_206819.1,NM_206820.1,NM_206821.1	,,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,,	826/1172,826/1149,819/1142,801/1124	102061631	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	4604	exon23			TGCCAGCGAGCCC		CCDS9083.1, CCDS9084.1, CCDS9085.1, CCDS55877.1, CCDS58268.1, CCDS58269.1, CCDS58270.1, CCDS58271.1, CCDS58272.1, CCDS58273.1	12q23.2	2013-02-11	2001-11-28		ENSG00000196091	ENSG00000196091		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7549	protein-coding gene	gene with protein product		160794	"""myosin-binding protein C, slow-type"""			8375400, 16918501	Standard	NM_002465		Approved		uc010svs.2	Q00872	OTTHUMG00000170274	ENST00000550270.1:c.2457C>T	12.37:g.102061631C>T		Somatic	63	0		WXS	Illumina HiSeq	.	48	3	NM_206819	B4DKR5|B7Z8G8|B7ZL02|B7ZL09|B7ZL10|E7ESM5|E7EWS6|G3XAE8|Q15497|Q17RR7|Q569K7|Q86T48|Q86TC8|Q8N3L2	Silent	SNP	ENST00000550270.1	37	CCDS9085.1																																																																																			.		0.438	MYBPC1-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000408806.1		
CTNNBL1	56259	hgsc.bcm.edu	37	20	36396410	36396410	+	Silent	SNP	G	G	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr20:36396410G>A	ENST00000361383.6	+	7	831	c.714G>A	c.(712-714)caG>caA	p.Q238Q	CTNNBL1_ENST00000373473.1_Silent_p.Q51Q|CTNNBL1_ENST00000473857.1_3'UTR|CTNNBL1_ENST00000405275.2_Silent_p.Q211Q	NM_030877.3	NP_110517.2	Q8WYA6	CTBL1_HUMAN	catenin, beta like 1	238					apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|positive regulation of apoptotic process (GO:0043065)|RNA splicing (GO:0008380)|somatic diversification of immunoglobulins (GO:0016445)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|Prp19 complex (GO:0000974)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)	p.Q238Q(1)		autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(6)|lung(6)|ovary(3)|urinary_tract(1)	28		Myeloproliferative disorder(115;0.00878)				AGGGTGCCCAGCAGGGTCTTC	0.522																																					p.Q238Q	Ovarian(184;582 2038 3273 4106 42608)	.											CTNNBL1,NS,carcinoma,0,1	CTNNBL1	0	1	Substitution - coding silent(1)	endometrium(1)	c.G714A						.						119.0	118.0	119.0					20																	36396410		2203	4300	6503	SO:0001819	synonymous_variant	56259	exon7			TGCCCAGCAGGGT	AL023804	CCDS13298.1	20q11.23-q12	2011-06-03	2002-05-27	2002-05-31	ENSG00000132792	ENSG00000132792			15879	protein-coding gene	gene with protein product	"""nuclear associated protein"""	611537	"""chromosome 20 open reading frame 33"""	C20orf33		12659813, 21385873	Standard	NM_030877		Approved	FLJ21108, P14L, P14, NAP, NYD-SP19	uc021wdj.1	Q8WYA6	OTTHUMG00000032428	ENST00000361383.6:c.714G>A	20.37:g.36396410G>A		Somatic	37	0		WXS	Illumina HiSeq	.	43	3	NM_030877	B4DE16|Q0VAL9|Q0VAM0|Q53HI8|Q5JWZ2|Q5JWZ3|Q5JWZ7|Q5JWZ8|Q8N454|Q8NCL2|Q8TBD6|Q96KD2|Q9H7A5|Q9NQF9|Q9NTX0|Q9Y3M7	Silent	SNP	ENST00000361383.6	37	CCDS13298.1																																																																																			.		0.522	CTNNBL1-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079125.1	NM_030877	
PPP1CB	5500	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	29006824	29006824	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr2:29006824C>T	ENST00000395366.2	+	5	844	c.572C>T	c.(571-573)cCt>cTt	p.P191L	PPP1CB_ENST00000296122.6_Missense_Mutation_p.P191L|PPP1CB_ENST00000358506.2_Missense_Mutation_p.P191L|SPDYA_ENST00000462832.1_3'UTR	NM_002709.2	NP_002700.1	P62140	PP1B_HUMAN	protein phosphatase 1, catalytic subunit, beta isozyme	191					cell division (GO:0051301)|circadian regulation of gene expression (GO:0032922)|entrainment of circadian clock by photoperiod (GO:0043153)|G2/M transition of mitotic cell cycle (GO:0000086)|glycogen metabolic process (GO:0005977)|mitotic cell cycle (GO:0000278)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of circadian rhythm (GO:0042752)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of glycogen catabolic process (GO:0005981)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)|triglyceride catabolic process (GO:0019433)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|glycogen granule (GO:0042587)|MLL5-L complex (GO:0070688)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein phosphatase type 1 complex (GO:0000164)|PTW/PP1 phosphatase complex (GO:0072357)	metal ion binding (GO:0046872)|myosin phosphatase activity (GO:0017018)|myosin-light-chain-phosphatase activity (GO:0050115)|phosphatase activity (GO:0016791)|protein kinase binding (GO:0019901)			cervix(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	9	Acute lymphoblastic leukemia(172;0.155)					ATTATGAGACCTACTGATGTC	0.328																																					p.P191L		.											.	.	.	0			c.C572T						.						136.0	144.0	141.0					2																	29006824		2203	4300	6503	SO:0001583	missense	5500	exon6			TGAGACCTACTGA		CCDS33169.1	2p23	2013-01-18	2010-03-05		ENSG00000213639	ENSG00000213639	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9282	protein-coding gene	gene with protein product		600590	"""protein phosphatase 1, catalytic subunit, beta isoform"""			8312365	Standard	NM_002709		Approved	PP1B, PP-1B, PP1beta	uc002rmg.3	P62140	OTTHUMG00000152011	ENST00000395366.2:c.572C>T	2.37:g.29006824C>T	ENSP00000378769:p.Pro191Leu	Somatic	73	0		WXS	Illumina HiSeq	.	74	6	NM_206876	B2R5V4|D6W565|P37140|Q5U087|Q6FG45	Missense_Mutation	SNP	ENST00000395366.2	37	CCDS33169.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.042136	0.93685	.	.	ENSG00000213639	ENST00000455580;ENST00000358506;ENST00000296122;ENST00000395366	T;T;T;T	0.06068	3.35;3.35;3.35;3.35	5.87	4.99	0.66335	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (2);Metallophosphoesterase domain (1);	0.000000	0.85682	D	0.000000	T	0.40272	0.1110	H	0.96916	3.905	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.63274	-0.6674	10	0.87932	D	0	-5.3435	16.8359	0.85957	0.1296:0.8704:0.0:0.0	.	191	P62140	PP1B_HUMAN	L	163;191;191;191	ENSP00000390715:P163L;ENSP00000351298:P191L;ENSP00000296122:P191L;ENSP00000378769:P191L	ENSP00000296122:P191L	P	+	2	0	PPP1CB	28860328	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	7.750000	0.85110	1.615000	0.50252	0.655000	0.94253	CCT	.		0.328	PPP1CB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324841.1		
LOC101928517	101928517	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	51670830	51670830	+	RNA	SNP	C	C	G			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr19:51670830C>G	ENST00000600074.1	-	0	493				SIGLEC17P_ENST00000598286.1_RNA																							AGGGTCTGTGCATCTTTGTGC	0.572																																					.		.											.	.	.	0			.						.																																					284367	.			TCTGTGCATCTTT																													19.37:g.51670830C>G		Somatic	27	0		WXS	Illumina HiSeq	.	16	5	.		RNA	SNP	ENST00000600074.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	10.67|10.67	1.416907|1.416907	0.25552|0.25552	.|.	.|.	ENSG00000171101|ENSG00000171101	ENST00000341811|ENST00000305812	.|.	.|.	.|.	2.95|2.95	-0.696|-0.696	0.11287|0.11287	.|.	0.428233|.	0.17152|.	U|.	0.185032|.	T|T	0.39091|0.39091	0.1065|0.1065	.|.	.|.	.|.	.|.	.|.	.|.	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	T|T	0.44847|0.44847	-0.9301|-0.9301	7|4	0.87932|0.36615	D|T	0|0.2	.|.	6.0814|6.0814	0.19942|0.19942	0.0:0.4282:0.0:0.5718|0.0:0.4282:0.0:0.5718	.|.	12|.	B4DW22|.	.|.	W|D	12|39	.|.	ENSP00000341295:C12W|ENSP00000303760:H39D	C|H	+|+	3|1	2|0	AC063977.1|AC063977.1	56362642|56362642	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.003000|0.003000	0.03518|0.03518	-2.723000|-2.723000	0.00810|0.00810	-0.556000|-0.556000	0.06134|0.06134	-0.409000|-0.409000	0.06214|0.06214	TGC|CAT	.		0.572	CTD-3187F8.14-001	KNOWN	basic	antisense	antisense	OTTHUMT00000465635.1		
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	179411745	179411745	+	Missense_Mutation	SNP	C	C	T	rs375657115		TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr2:179411745C>T	ENST00000591111.1	-	290	89808	c.89584G>A	c.(89584-89586)Gct>Act	p.A29862T	TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.A22438T|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.A22630T|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|RP11-65L3.2_ENST00000603415.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.A31503T|TTN_ENST00000359218.5_Missense_Mutation_p.A22563T|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.A28935T			Q8WZ42	TITIN_HUMAN	titin	29862	Fibronectin type-III 117. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGATTTTGAGCCATTATAGGT	0.363													C|||	1	0.000199681	0.0	0.0014	5008	,	,		24109	0.0		0.0	False		,,,				2504	0.0				p.A31503T		.											.	.	.	0			c.G94507A						.	C	THR/ALA,THR/ALA,THR/ALA,THR/ALA	0,3794		0,0,1897	168.0	161.0	163.0		67312,86803,67687,67888	6.0	1.0	2		163	1,8235		0,1,4117	no	missense,missense,missense,missense	TTN	NM_003319.4,NM_133378.4,NM_133432.3,NM_133437.3	58,58,58,58	0,1,6014	TT,TC,CC		0.0121,0.0,0.0083	probably-damaging,probably-damaging,probably-damaging,probably-damaging	22438/26927,28935/33424,22563/27052,22630/27119	179411745	1,12029	1897	4118	6015	SO:0001583	missense	7273	exon340			TTTGAGCCATTAT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.89584G>A	2.37:g.179411745C>T	ENSP00000465570:p.Ala29862Thr	Somatic	18	0		WXS	Illumina HiSeq	.	25	4	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	18.87	3.716202	0.68844	0.0	1.21E-4	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.55234	0.53;0.53;0.53;0.53	5.97	5.97	0.96955	Fibronectin, type III (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.76449	0.3989	M	0.79693	2.465	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.996;0.996;0.996;0.996	T	0.77773	-0.2462	9	0.87932	D	0	.	20.4214	0.99039	0.0:1.0:0.0:0.0	.	22438;22563;22630;29862	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	T	28935;22438;22630;22563;22435	ENSP00000343764:A28935T;ENSP00000434586:A22438T;ENSP00000340554:A22630T;ENSP00000352154:A22563T	ENSP00000340554:A22630T	A	-	1	0	TTN	179119991	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.820000	0.97059	0.655000	0.94253	GCT	.		0.363	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
THTPA	79178	hgsc.bcm.edu	37	14	24025980	24025980	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr14:24025980T>C	ENST00000288014.6	+	1	750	c.14T>C	c.(13-15)tTg>tCg	p.L5S	RP11-66N24.4_ENST00000555446.1_RNA|THTPA_ENST00000404535.3_Missense_Mutation_p.L5S|THTPA_ENST00000556015.1_Missense_Mutation_p.L5S|THTPA_ENST00000554970.1_Missense_Mutation_p.L5S|THTPA_ENST00000554789.1_Missense_Mutation_p.L5S|RP11-66N24.4_ENST00000553985.1_RNA|RP11-66N24.4_ENST00000556354.1_RNA			Q9BU02	THTPA_HUMAN	thiamine triphosphatase	5	CYTH. {ECO:0000255|PROSITE- ProRule:PRU01044}.				dephosphorylation (GO:0016311)|generation of precursor metabolites and energy (GO:0006091)|small molecule metabolic process (GO:0044281)|thiamine diphosphate metabolic process (GO:0042357)|thiamine metabolic process (GO:0006772)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)	hydrolase activity (GO:0016787)|magnesium ion binding (GO:0000287)|thiamin-triphosphatase activity (GO:0050333)	p.L5S(1)		large_intestine(1)|prostate(2)	3	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00643)		GCCCAGGGCTTGATTGAGGTG	0.597																																					p.L5S		.											THTPA,NS,carcinoma,0,1	THTPA	0	1	Substitution - Missense(1)	prostate(1)	c.T14C						.						34.0	34.0	34.0					14																	24025980		2203	4300	6503	SO:0001583	missense	79178	exon2			AGGGCTTGATTGA	AF432862	CCDS32053.1, CCDS58306.1, CCDS58307.1	14q11.2	2011-04-28					3.6.1.28		18987	protein-coding gene	gene with protein product		611612				11827967	Standard	NR_046051		Approved	THTPASE	uc001wkh.5	Q9BU02		ENST00000288014.6:c.14T>C	14.37:g.24025980T>C	ENSP00000288014:p.Leu5Ser	Somatic	9	1		WXS	Illumina HiSeq	.	10	2	NM_001256321	D3DS50|G3V4J3	Missense_Mutation	SNP	ENST00000288014.6	37	CCDS32053.1	.	.	.	.	.	.	.	.	.	.	T	12.93	2.086263	0.36855	.	.	ENSG00000157306	ENST00000404535;ENST00000288014;ENST00000557630;ENST00000556015;ENST00000554970;ENST00000554789	T;T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0;1.0	5.79	3.52	0.40303	CYTH domain (1);CYTH-like domain (1);	0.513196	0.21008	N	0.081732	T	0.30854	0.0778	L	0.50919	1.6	0.31973	N	0.606882	B;B	0.20164	0.037;0.042	B;B	0.17433	0.018;0.018	T	0.25467	-1.0131	10	0.21540	T	0.41	-2.9172	4.4618	0.11669	0.0:0.1884:0.2234:0.5883	.	5;5	G3V4J3;Q9BU02	.;THTPA_HUMAN	S	5	ENSP00000384580:L5S;ENSP00000288014:L5S;ENSP00000452281:L5S;ENSP00000451835:L5S;ENSP00000452465:L5S;ENSP00000450459:L5S	ENSP00000288014:L5S	L	+	2	0	THTPA	23095820	0.269000	0.24143	1.000000	0.80357	0.948000	0.59901	0.252000	0.18278	1.031000	0.39867	0.533000	0.62120	TTG	.		0.597	THTPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413800.2		
SLC17A9	63910	hgsc.bcm.edu	37	20	61594022	61594022	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr20:61594022G>T	ENST00000370351.4	+	5	675	c.544G>T	c.(544-546)Ggc>Tgc	p.G182C	SLC17A9_ENST00000488738.1_3'UTR|SLC17A9_ENST00000370349.3_Missense_Mutation_p.G176C	NM_022082.3	NP_071365	Q9BYT1	S17A9_HUMAN	solute carrier family 17 (vesicular nucleotide transporter), member 9	182					exocytosis (GO:0006887)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)	p.G182S(1)		endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	23						GGAATGGTACGGCTGGCAGAG	0.637																																					p.G182C		.											SLC17A9,NS,carcinoma,0,1	SLC17A9	0	1	Substitution - Missense(1)	endometrium(1)	c.G544T						.						95.0	114.0	108.0					20																	61594022		2003	4154	6157	SO:0001583	missense	63910	exon5			TGGTACGGCTGGC	AK027065	CCDS42901.1	20q13.33	2013-07-18	2013-07-18	2009-01-22	ENSG00000101194	ENSG00000101194		"""Solute carriers"""	16192	protein-coding gene	gene with protein product		612107	"""chromosome 20 open reading frame 59"", ""solute carrier family 17, member 9"""	C20orf59		18375752	Standard	NM_022082		Approved	FLJ23412, VNUT	uc002yea.4	Q9BYT1	OTTHUMG00000032951	ENST00000370351.4:c.544G>T	20.37:g.61594022G>T	ENSP00000359376:p.Gly182Cys	Somatic	53	0		WXS	Illumina HiSeq	.	38	2	NM_022082	B3KTF2|Q5W198|Q8TB07|Q8TBP4|Q8TEL5|Q9BYT0|Q9BYT2	Missense_Mutation	SNP	ENST00000370351.4	37	CCDS42901.1	.	.	.	.	.	.	.	.	.	.	G	16.74	3.205739	0.58234	.	.	ENSG00000101194	ENST00000370351;ENST00000370349	T;T	0.72051	-0.62;-0.62	4.39	2.35	0.29111	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.050352	0.85682	D	0.000000	D	0.85383	0.5684	M	0.92077	3.27	0.80722	D	1	D;D;D	0.69078	0.997;0.988;0.996	D;D;D	0.80764	0.994;0.992;0.992	D	0.85682	0.1301	10	0.87932	D	0	.	10.0682	0.42317	0.174:0.0:0.826:0.0	.	202;182;176	B4DPU8;Q9BYT1;Q9BYT1-2	.;S17A9_HUMAN;.	C	182;176	ENSP00000359376:G182C;ENSP00000359374:G176C	ENSP00000359374:G176C	G	+	1	0	SLC17A9	61064467	1.000000	0.71417	0.976000	0.42696	0.601000	0.36947	4.177000	0.58276	0.386000	0.24997	-0.424000	0.05967	GGC	.		0.637	SLC17A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080100.1	NM_022082	
WDR92	116143	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	68371718	68371718	+	Splice_Site	SNP	A	A	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr2:68371718A>T	ENST00000295121.6	-	3	530	c.414T>A	c.(412-414)gaT>gaA	p.D138E	WDR92_ENST00000409164.1_Splice_Site_p.D138E|WDR92_ENST00000406245.2_Splice_Site_p.D37E|RP11-474G23.1_ENST00000406334.3_3'UTR|WDR92_ENST00000492039.2_5'UTR	NM_138458.3	NP_612467.1	Q96MX6	WDR92_HUMAN	WD repeat domain 92	138					apoptotic process (GO:0006915)|histone lysine methylation (GO:0034968)		methylated histone binding (GO:0035064)			endometrium(1)|kidney(3)|large_intestine(4)|lung(3)|stomach(1)	12						GGGACTCACCATCTCGGCTGC	0.393																																					p.D138E		.											.	.	.	0			c.T414A						.						112.0	112.0	112.0					2																	68371718		2203	4300	6503	SO:0001630	splice_region_variant	116143	exon3			CTCACCATCTCGG	AK056303	CCDS1884.1, CCDS58712.1	2p14	2013-01-09			ENSG00000243667	ENSG00000243667		"""WD repeat domain containing"""	25176	protein-coding gene	gene with protein product		610729				16487927	Standard	NM_138458		Approved	FLJ31741, Monad	uc002see.2	Q96MX6	OTTHUMG00000152561	ENST00000295121.6:c.415+1T>A	2.37:g.68371718A>T		Somatic	37	0		WXS	Illumina HiSeq	.	52	14	NM_001256476	Q96CR6	Missense_Mutation	SNP	ENST00000295121.6	37	CCDS1884.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.581044	0.86748	.	.	ENSG00000243667	ENST00000295121;ENST00000406245;ENST00000409164	D;D;D	0.89196	-2.48;-2.48;-2.48	6.16	-0.0874	0.13677	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.64402	D	0.000001	D	0.95906	0.8667	H	0.98407	4.225	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94440	0.7657	10	0.87932	D	0	.	10.1639	0.42868	0.6841:0.0:0.3159:0.0	.	138	Q96MX6	WDR92_HUMAN	E	138;37;138	ENSP00000295121:D138E;ENSP00000384518:D37E;ENSP00000386746:D138E	ENSP00000295121:D138E	D	-	3	2	WDR92	68225222	1.000000	0.71417	0.998000	0.56505	0.973000	0.67179	2.290000	0.43531	-0.019000	0.14055	0.528000	0.53228	GAT	.		0.393	WDR92-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251754.2	NM_138458	Missense_Mutation
CLEC2L	154790	hgsc.bcm.edu	37	7	139225079	139225079	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr7:139225079G>A	ENST00000422142.2	+	3	350	c.278G>A	c.(277-279)tGc>tAc	p.C93Y		NM_001080511.2	NP_001073980.2	P0C7M8	CLC2L_HUMAN	C-type lectin domain family 2, member L	93						integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(1)|endometrium(1)|kidney(2)|lung(1)	5	Melanoma(164;0.233)					TCCAAGGGCTGCATCAAGTGC	0.637																																					p.C93Y		.											.	.	.	0			c.G278A						.						16.0	19.0	18.0					7																	139225079		1936	4127	6063	SO:0001583	missense	154790	exon3			AGGGCTGCATCAA	AK057548	CCDS47724.1	7q34	2011-05-18			ENSG00000236279	ENSG00000236279		"""C-type lectin domain containing"""	21969	protein-coding gene	gene with protein product							Standard	NM_001080511		Approved	FLJ32986	uc010lnd.3	P0C7M8	OTTHUMG00000164900	ENST00000422142.2:c.278G>A	7.37:g.139225079G>A	ENSP00000390661:p.Cys93Tyr	Somatic	34	0		WXS	Illumina HiSeq	.	66	4	NM_001080511		Missense_Mutation	SNP	ENST00000422142.2	37	CCDS47724.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.00|18.00	3.524940|3.524940	0.64747|0.64747	.|.	.|.	ENSG00000236279|ENSG00000236279	ENST00000521281|ENST00000422142	.|T	.|0.16597	.|2.33	4.81|4.81	4.81|4.81	0.61882|0.61882	.|.	.|.	.|.	.|.	.|.	T|T	0.26955|0.26955	0.0660|0.0660	L|L	0.38838|0.38838	1.175|1.175	0.35099|0.35099	D|D	0.765|0.765	.|D	.|0.69078	.|0.997	.|D	.|0.64776	.|0.929	T|T	0.15896|0.15896	-1.0421|-1.0421	5|9	.|0.18710	.|T	.|0.47	-9.9835|-9.9835	13.3746|13.3746	0.60730|0.60730	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|93	.|P0C7M8	.|CLC2L_HUMAN	T|Y	17|93	.|ENSP00000390661:C93Y	.|ENSP00000390661:C93Y	A|C	+|+	1|2	0|0	CLEC2L|CLEC2L	138875619|138875619	0.998000|0.998000	0.40836|0.40836	0.999000|0.999000	0.59377|0.59377	0.890000|0.890000	0.51754|0.51754	2.876000|2.876000	0.48498|0.48498	2.200000|2.200000	0.70718|0.70718	0.563000|0.563000	0.77884|0.77884	GCA|TGC	.		0.637	CLEC2L-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380878.1	NM_001080511	
PVR	5817	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	45162133	45162133	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr19:45162133G>T	ENST00000425690.3	+	6	1414	c.1115G>T	c.(1114-1116)cGt>cTt	p.R372L	CTB-171A8.1_ENST00000590796.1_RNA|PVR_ENST00000344956.4_Intron|PVR_ENST00000406449.4_Missense_Mutation_p.R372L|PVR_ENST00000403059.4_Intron	NM_006505.3	NP_006496.3	P15151	PVR_HUMAN	poliovirus receptor	372	DYNLT1 binding.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|regulation of immune response (GO:0050776)|susceptibility to natural killer cell mediated cytotoxicity (GO:0042271)|susceptibility to T cell mediated cytotoxicity (GO:0060370)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|receptor activity (GO:0004872)			large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	6	Lung NSC(12;0.00608)|all_lung(12;0.0148)	Medulloblastoma(540;0.0425)|Ovarian(192;0.0728)|Prostate(69;0.081)|all_neural(266;0.112)		Epithelial(262;0.000601)		AAATGTTCCCGTGAGGTCCTT	0.517																																					p.R372L		.											.	.	.	0			c.G1115T						.						171.0	158.0	162.0					19																	45162133		2203	4300	6503	SO:0001583	missense	5817	exon6			GTTCCCGTGAGGT	BC015542	CCDS12640.1, CCDS46105.1, CCDS46106.1, CCDS46107.1	19q13.2	2013-01-29			ENSG00000073008	ENSG00000073008		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9705	protein-coding gene	gene with protein product	"""nectin-like 5"""	173850		PVS		2170108	Standard	XM_005259120		Approved	CD155, HVED, Necl-5, NECL5, Tage4	uc002ozm.3	P15151	OTTHUMG00000151527	ENST00000425690.3:c.1115G>T	19.37:g.45162133G>T	ENSP00000402060:p.Arg372Leu	Somatic	34	0		WXS	Illumina HiSeq	.	29	12	NM_006505	B4DTS9|P15152|Q15267|Q15268|Q96BJ1	Missense_Mutation	SNP	ENST00000425690.3	37	CCDS12640.1	.	.	.	.	.	.	.	.	.	.	G	11.73	1.725737	0.30593	.	.	ENSG00000073008	ENST00000425690;ENST00000406449	D;D	0.90385	-2.66;-2.36	2.65	2.65	0.31530	.	2.671990	0.01889	U	0.038386	D	0.88310	0.6402	L	0.42245	1.32	0.35874	D	0.828469	B;B	0.27823	0.159;0.19	B;B	0.29176	0.099;0.062	T	0.78041	-0.2359	10	0.51188	T	0.08	.	8.9593	0.35838	0.0:0.0:1.0:0.0	.	372;372	P15151-4;P15151	.;PVR_HUMAN	L	372	ENSP00000402060:R372L;ENSP00000383907:R372L	ENSP00000383907:R372L	R	+	2	0	PVR	49853973	0.951000	0.32395	0.288000	0.24862	0.002000	0.02628	2.445000	0.44899	1.795000	0.52594	0.555000	0.69702	CGT	.		0.517	PVR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000323017.2	NM_006505	
DCHS1	8642	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	6647166	6647166	+	Missense_Mutation	SNP	A	A	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr11:6647166A>T	ENST00000299441.3	-	17	7127	c.6716T>A	c.(6715-6717)aTc>aAc	p.I2239N		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	2239	Cadherin 21. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TTCAGCCCAGATCTCACGGTC	0.582																																					p.I2239N		.											.	.	.	0			c.T6716A						.						173.0	153.0	160.0					11																	6647166		2201	4296	6497	SO:0001583	missense	8642	exon17			GCCCAGATCTCAC	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.6716T>A	11.37:g.6647166A>T	ENSP00000299441:p.Ile2239Asn	Somatic	27	0		WXS	Illumina HiSeq	.	38	9	NM_003737	O15098	Missense_Mutation	SNP	ENST00000299441.3	37	CCDS7771.1	.	.	.	.	.	.	.	.	.	.	A	17.79	3.475295	0.63737	.	.	ENSG00000166341	ENST00000299441	T	0.50548	0.74	4.9	4.9	0.64082	Cadherin (4);Cadherin-like (1);	0.000000	0.47455	D	0.000235	T	0.52484	0.1737	N	0.25992	0.78	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.43393	-0.9394	10	0.15952	T	0.53	.	13.8523	0.63504	1.0:0.0:0.0:0.0	.	2239	Q96JQ0	PCD16_HUMAN	N	2239	ENSP00000299441:I2239N	ENSP00000299441:I2239N	I	-	2	0	DCHS1	6603742	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	8.734000	0.91543	2.060000	0.61445	0.460000	0.39030	ATC	.		0.582	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737	
VPS39	23339	hgsc.bcm.edu	37	15	42465949	42465949	+	Silent	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr15:42465949G>T	ENST00000348544.4	-	12	1094	c.1095C>A	c.(1093-1095)tcC>tcA	p.S365S	VPS39_ENST00000318006.5_Silent_p.S354S			Q96JC1	VPS39_HUMAN	vacuolar protein sorting 39 homolog (S. cerevisiae)	365					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	endosome (GO:0005768)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	small GTPase regulator activity (GO:0005083)			breast(2)|kidney(5)|large_intestine(4)|lung(8)|ovary(1)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_cancers(109;6.78e-16)|all_epithelial(112;1.81e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;3.05e-06)		AGACCTGCATGGACTCATCAA	0.428																																					p.S354S		.											VPS39,NS,carcinoma,0,2	VPS39	0	0			c.C1062A						.						171.0	152.0	158.0					15																	42465949		2203	4299	6502	SO:0001819	synonymous_variant	23339	exon11			CTGCATGGACTCA	AF280814	CCDS10083.1, CCDS73710.1	15q14	2008-02-05	2006-12-19		ENSG00000166887	ENSG00000166887			20593	protein-coding gene	gene with protein product		612188	"""vacuolar protein sorting 39 (yeast)"""			11448994	Standard	XM_005254259		Approved	KIAA0770, VAM6	uc001zpc.3	Q96JC1	OTTHUMG00000130467	ENST00000348544.4:c.1095C>A	15.37:g.42465949G>T		Somatic	35	0		WXS	Illumina HiSeq	.	21	2	NM_015289	O94869|Q71SQ6|Q7Z3V3|Q96B93|Q96RM0	Silent	SNP	ENST00000348544.4	37	CCDS10083.1																																																																																			.		0.428	VPS39-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000420472.1	NM_015289	
KRT81	3887	hgsc.bcm.edu	37	12	52680993	52680993	+	Silent	SNP	C	C	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr12:52680993C>T	ENST00000327741.5	-	7	1208	c.1140G>A	c.(1138-1140)caG>caA	p.Q380Q	KRT86_ENST00000423955.2_Intron|KRT86_ENST00000544024.1_Intron	NM_002281.3	NP_002272.2	Q14533	KRT81_HUMAN	keratin 81	380	Coil 2.|Rod.					extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.Q380Q(2)		breast(2)|endometrium(3)|large_intestine(3)|lung(6)|prostate(1)|stomach(1)	16				BRCA - Breast invasive adenocarcinoma(357;0.189)		AGGCCATGTCCTGCTTGGCCT	0.672																																					p.Q380Q		.											KRT81,NS,carcinoma,0,2	KRT81	0	2	Substitution - coding silent(2)	large_intestine(1)|prostate(1)	c.G1140A						.						64.0	59.0	60.0					12																	52680993		2203	4297	6500	SO:0001819	synonymous_variant	3887	exon7			CATGTCCTGCTTG	X81420	CCDS31805.1	12q13	2013-01-16	2006-07-17	2006-07-17	ENSG00000205426	ENSG00000205426		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6458	protein-coding gene	gene with protein product	"""hard keratin type II 1"""	602153	"""keratin, hair, basic, 1"""	KRTHB1		7556444, 16831889	Standard	NM_002281		Approved	Hb-1	uc001sab.3	Q14533	OTTHUMG00000167574	ENST00000327741.5:c.1140G>A	12.37:g.52680993C>T		Somatic	31	0		WXS	Illumina HiSeq	.	21	2	NM_002281	Q14846|Q16274|Q17R48|Q8WU52|Q9BR74	Silent	SNP	ENST00000327741.5	37	CCDS31805.1																																																																																			.		0.672	KRT81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395128.2	NM_002281	
ZNF431	170959	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	21350428	21350428	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr19:21350428C>T	ENST00000311048.7	+	4	422	c.278C>T	c.(277-279)cCc>cTc	p.P93L	ZNF431_ENST00000594425.1_Intron|ZNF431_ENST00000599296.1_Missense_Mutation_p.P93L|ZNF431_ENST00000600692.1_Missense_Mutation_p.P93L	NM_133473.2	NP_597730.2	Q8TF32	ZN431_HUMAN	zinc finger protein 431	93	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				cell differentiation (GO:0030154)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)	p.P93H(1)		breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(7)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	23						GAAAAAGAGCCCTGGAATATG	0.398																																					p.P93L		.											ZNF431,NS,carcinoma,0,1	ZNF431	0	1	Substitution - Missense(1)	endometrium(1)	c.C278T						.						77.0	83.0	81.0					19																	21350428		2203	4300	6503	SO:0001583	missense	170959	exon4			AAGAGCCCTGGAA	AB075849	CCDS32979.1	19p12	2013-01-08				ENSG00000196705		"""Zinc fingers, C2H2-type"", ""-"""	20809	protein-coding gene	gene with protein product						11853319	Standard	NM_133473		Approved	KIAA1969	uc002npp.2	Q8TF32		ENST00000311048.7:c.278C>T	19.37:g.21350428C>T	ENSP00000308578:p.Pro93Leu	Somatic	66	0		WXS	Illumina HiSeq	.	72	10	NM_133473	A8KAK7|Q8IWC4	Missense_Mutation	SNP	ENST00000311048.7	37	CCDS32979.1	.	.	.	.	.	.	.	.	.	.	.	6.485	0.457757	0.12342	.	.	ENSG00000196705	ENST00000311048	T	0.09630	2.96	0.43	0.43	0.16515	Krueppel-associated box (2);	.	.	.	.	T	0.25158	0.0611	M	0.67625	2.065	0.09310	N	1	D	0.63880	0.993	D	0.67382	0.951	T	0.05402	-1.0887	8	0.72032	D	0.01	.	.	.	.	.	93	Q8TF32	ZN431_HUMAN	L	93	ENSP00000308578:P93L	ENSP00000308578:P93L	P	+	2	0	ZNF431	21142268	0.049000	0.20398	0.113000	0.21522	0.108000	0.19459	0.845000	0.27668	0.459000	0.27016	0.462000	0.41574	CCC	.		0.398	ZNF431-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463943.1	XM_086098	
CTNNA2	1496	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	80816537	80816537	+	Missense_Mutation	SNP	G	G	C			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr2:80816537G>C	ENST00000402739.4	+	14	2121	c.2116G>C	c.(2116-2118)Gac>Cac	p.D706H	CTNNA2_ENST00000496558.1_Missense_Mutation_p.D706H|AC008067.2_ENST00000430876.1_RNA|CTNNA2_ENST00000361291.4_Missense_Mutation_p.D740H|CTNNA2_ENST00000541047.1_Missense_Mutation_p.D706H|CTNNA2_ENST00000540488.1_Missense_Mutation_p.D706H|AC008067.2_ENST00000596887.1_RNA|CTNNA2_ENST00000343114.3_Missense_Mutation_p.D385H|CTNNA2_ENST00000466387.1_Missense_Mutation_p.D706H|AC008067.2_ENST00000609950.1_RNA|AC008067.2_ENST00000595478.1_RNA	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	706					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)	p.D706N(1)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						CAAATGGGACGACAGCGGCAA	0.502																																					p.D706H		.											CTNNA2_ENST00000466387,colon,carcinoma,0,1	CTNNA2_ENST00000466387	0	1	Substitution - Missense(1)	large_intestine(1)	c.G2116C						.						129.0	139.0	136.0					2																	80816537		2199	4300	6499	SO:0001583	missense	1496	exon15			TGGGACGACAGCG		CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.2116G>C	2.37:g.80816537G>C	ENSP00000384638:p.Asp706His	Somatic	21	0		WXS	Illumina HiSeq	.	34	9	NM_001164883	B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	ENST00000402739.4	37		.	.	.	.	.	.	.	.	.	.	G	28.0	4.883486	0.91740	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488;ENST00000343114	T;T;T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02;1.02;1.02	5.97	5.97	0.96955	.	0.101115	0.64402	D	0.000003	T	0.72087	0.3417	M	0.88842	2.985	0.80722	D	1	D;D;D;D	0.76494	0.997;0.999;0.999;0.999	D;D;D;D	0.74023	0.955;0.981;0.982;0.982	T	0.74677	-0.3585	9	.	.	.	.	20.4387	0.99107	0.0:0.0:1.0:0.0	.	338;706;706;706	F6KRI5;P26232;P26232-3;P26232-2	.;CTNA2_HUMAN;.;.	H	706;706;740;706;706;706;385	ENSP00000418191:D706H;ENSP00000419295:D706H;ENSP00000355398:D740H;ENSP00000384638:D706H;ENSP00000444675:D706H;ENSP00000441705:D706H;ENSP00000341500:D385H	.	D	+	1	0	CTNNA2	80670048	1.000000	0.71417	0.989000	0.46669	0.999000	0.98932	9.623000	0.98386	2.836000	0.97738	0.655000	0.94253	GAC	.		0.502	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000328511.4	NM_004389	
LINC00619	414260	hgsc.bcm.edu	37	10	44341076	44341076	+	lincRNA	SNP	G	G	A	rs10535963|rs377158824	byFrequency	TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr10:44341076G>A	ENST00000374432.3	+	0	172					NR_033923.1				long intergenic non-protein coding RNA 619																		CGGTCTCATTGATTATTAAGT	0.498																																					.		.											.	.	.	0			.						.																																					414260	.			CTCATTGATTATT	BC017939		10q11.21	2012-10-12	2012-07-12	2012-07-12	ENSG00000204187	ENSG00000204187		"""Long non-coding RNAs"""	31657	non-coding RNA	RNA, long non-coding			"""chromosome 10 open reading frame 136"""	C10orf136			Standard	NR_033923		Approved	bA168P8.1	uc021ppi.1		OTTHUMG00000018048		10.37:g.44341076G>A		Somatic	27	0		WXS	Illumina HiSeq	.	48	4	.		RNA	SNP	ENST00000374432.3	37																																																																																				.		0.498	LINC00619-001	KNOWN	basic|exp_conf	lincRNA	lincRNA	OTTHUMT00000047731.2	NR_033923	
PLA2G4E	123745	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	15	42276152	42276152	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr15:42276152C>T	ENST00000399518.3	-	20	2893	c.2407G>A	c.(2407-2409)Gag>Aag	p.E803K	PLA2G4E_ENST00000413860.2_Missense_Mutation_p.E774K|CTD-2382E5.1_ENST00000499478.2_RNA	NM_001206670.1	NP_001193599.1	Q3MJ16	PA24E_HUMAN	phospholipase A2, group IVE	791	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phospholipase A2 activity (GO:0004623)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|stomach(1)	16		all_cancers(109;8.09e-13)|all_epithelial(112;2.03e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.0273)		OV - Ovarian serous cystadenocarcinoma(18;7.61e-18)|GBM - Glioblastoma multiforme(94;3.07e-06)		TGCTCCAGCTCCTCAGGGCTT	0.522																																					p.E803K		.											.	.	.	0			c.G2407A						.						41.0	43.0	42.0					15																	42276152		1997	4191	6188	SO:0001583	missense	123745	exon20			CCAGCTCCTCAGG		CCDS55962.1	15q15.1	2008-09-19			ENSG00000188089	ENSG00000188089	3.1.1.4		24791	protein-coding gene	gene with protein product						15866882	Standard	NM_001206670		Approved	FLJ45651	uc021sjp.1	Q3MJ16	OTTHUMG00000130371	ENST00000399518.3:c.2407G>A	15.37:g.42276152C>T	ENSP00000382434:p.Glu803Lys	Somatic	14	0		WXS	Illumina HiSeq	.	21	6	NM_001206670	Q6ZSC0	Missense_Mutation	SNP	ENST00000399518.3	37	CCDS55962.1	.	.	.	.	.	.	.	.	.	.	C	32	5.118005	0.94385	.	.	ENSG00000188089	ENST00000399518;ENST00000413860	T;T	0.05580	3.42;3.42	5.41	5.41	0.78517	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (2);	0.000000	0.85682	D	0.000000	T	0.32164	0.0820	M	0.88450	2.955	0.46317	D	0.998985	D;D	0.71674	0.998;0.997	D;D	0.72625	0.945;0.978	T	0.19353	-1.0308	10	0.87932	D	0	-28.8305	17.9688	0.89107	0.0:1.0:0.0:0.0	.	774;791	C9JK77;Q3MJ16	.;PA24E_HUMAN	K	803;774	ENSP00000382434:E803K;ENSP00000413897:E774K	ENSP00000382434:E803K	E	-	1	0	PLA2G4E	40063444	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	5.542000	0.67218	2.527000	0.85204	0.563000	0.77884	GAG	.		0.522	PLA2G4E-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252738.2	NM_198442	
ITGB6	3694	hgsc.bcm.edu;broad.mit.edu	37	2	160964274	160964274	+	Silent	SNP	G	G	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr2:160964274G>A	ENST00000283249.2	-	14	2421	c.2184C>T	c.(2182-2184)tgC>tgT	p.C728C	ITGB6_ENST00000428609.2_Silent_p.C686C|ITGB6_ENST00000409872.1_Silent_p.C728C|ITGB6_ENST00000409967.2_Silent_p.C621C	NM_001282353.1|NM_001282354.1|NM_001282388.1	NP_001269282.1|NP_001269283.1|NP_001269317.1	P18564	ITB6_HUMAN	integrin, beta 6	728					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|multicellular organismal development (GO:0007275)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23						GCTTCCAGATGCACAGTAGGA	0.433																																					p.C728C		.											.	.	.	0			c.C2184T						.						128.0	124.0	125.0					2																	160964274		2203	4300	6503	SO:0001819	synonymous_variant	3694	exon14			CCAGATGCACAGT		CCDS2212.1, CCDS63040.1, CCDS74596.1, CCDS74597.1	2q24.2	2010-03-23			ENSG00000115221	ENSG00000115221		"""Integrins"""	6161	protein-coding gene	gene with protein product		147558				1729173, 8120056	Standard	NM_001282353		Approved		uc002ubh.2	P18564	OTTHUMG00000132026	ENST00000283249.2:c.2184C>T	2.37:g.160964274G>A		Somatic	45	0		WXS	Illumina HiSeq	.	52	4	NM_000888	B2R9W5|C9JA97|Q0VA95|Q16500|Q53RG5|Q53RR6	Silent	SNP	ENST00000283249.2	37	CCDS2212.1																																																																																			.		0.433	ITGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255036.1	NM_000888	
PABPC3	5042	hgsc.bcm.edu	37	13	25671267	25671267	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr13:25671267C>T	ENST00000281589.3	+	1	968	c.931C>T	c.(931-933)Cgg>Tgg	p.R311W		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	311	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)	p.R311W(2)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		TGAACGTCTCCGGAAAGCGTT	0.418																																					p.R311W		.											PABPC3,NS,carcinoma,0,1	PABPC3	0	2	Substitution - Missense(2)	lung(2)	c.C931T						.						216.0	215.0	216.0					13																	25671267		2203	4300	6503	SO:0001583	missense	5042	exon1			CGTCTCCGGAAAG	AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.931C>T	13.37:g.25671267C>T	ENSP00000281589:p.Arg311Trp	Somatic	65	0		WXS	Illumina HiSeq	.	37	2	NM_030979	Q8NHV0|Q9H086	Missense_Mutation	SNP	ENST00000281589.3	37	CCDS9311.1	.	.	.	.	.	.	.	.	.	.	C	8.982	0.975605	0.18736	.	.	ENSG00000151846	ENST00000281589	T	0.19532	2.14	0.875	-0.0465	0.13846	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.162747	0.27720	U	0.018139	T	0.31104	0.0786	L	0.58354	1.805	0.39621	D	0.97002	D	0.63880	0.993	P	0.62184	0.899	T	0.08659	-1.0711	10	0.72032	D	0.01	.	5.2628	0.15584	0.0:0.7661:0.0:0.2339	.	311	Q9H361	PABP3_HUMAN	W	311	ENSP00000281589:R311W	ENSP00000281589:R311W	R	+	1	2	PABPC3	24569267	0.961000	0.32948	0.751000	0.31187	0.139000	0.21198	1.461000	0.35255	-0.050000	0.13356	-0.643000	0.03959	CGG	.		0.418	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2	NM_030979	
RYR3	6263	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	15	33923462	33923462	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr15:33923462G>T	ENST00000389232.4	+	23	2905	c.2835G>T	c.(2833-2835)gaG>gaT	p.E945D	RYR3_ENST00000415757.3_Missense_Mutation_p.E945D	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	945	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CAGCTGCTGAGGAGGATCTCA	0.443																																					p.E945D		.											.	.	.	0			c.G2835T						.						80.0	78.0	79.0					15																	33923462		1885	4119	6004	SO:0001583	missense	6263	exon23			TGCTGAGGAGGAT		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.2835G>T	15.37:g.33923462G>T	ENSP00000373884:p.Glu945Asp	Somatic	27	0		WXS	Illumina HiSeq	.	35	4	NM_001243996	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	G	17.69	3.451447	0.63290	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.96913	-4.17;-4.17	5.09	-0.383	0.12477	.	0.000000	0.85682	D	0.000000	D	0.97056	0.9038	M	0.76838	2.35	0.41993	D	0.990854	D;D	0.64830	0.99;0.994	D;D	0.72982	0.979;0.97	D	0.94922	0.8074	10	0.48119	T	0.1	.	8.8627	0.35267	0.5298:0.0:0.4702:0.0	.	945;945	Q15413-2;Q15413	.;RYR3_HUMAN	D	945	ENSP00000373884:E945D;ENSP00000399610:E945D	ENSP00000354735:E945D	E	+	3	2	RYR3	31710754	0.983000	0.35010	0.940000	0.37924	0.990000	0.78478	0.186000	0.16978	-0.230000	0.09840	0.563000	0.77884	GAG	.		0.443	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
SORBS1	10580	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	97106174	97106174	+	Silent	SNP	A	A	C			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr10:97106174A>C	ENST00000361941.3	-	24	2444	c.2418T>G	c.(2416-2418)gcT>gcG	p.A806A	SORBS1_ENST00000371246.2_Silent_p.A828A|SORBS1_ENST00000371239.1_Silent_p.A583A|SORBS1_ENST00000371249.2_Silent_p.A588A|SORBS1_ENST00000371227.4_Silent_p.A760A|SORBS1_ENST00000393949.1_Silent_p.A776A|SORBS1_ENST00000354106.3_Silent_p.A776A|SORBS1_ENST00000306402.6_Silent_p.A553A|SORBS1_ENST00000371245.3_Silent_p.A657A|SORBS1_ENST00000353505.5_Silent_p.A657A|SORBS1_ENST00000371241.1_Silent_p.A456A|SORBS1_ENST00000347291.4_Silent_p.A618A|SORBS1_ENST00000607232.1_Silent_p.A1066A|SORBS1_ENST00000277982.5_Silent_p.A828A|SORBS1_ENST00000371247.2_Silent_p.A806A|SORBS1_ENST00000474353.2_5'UTR	NM_001034954.1	NP_001030126			sorbin and SH3 domain containing 1											NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(19)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		TTAGTGTCTGAGCTTTAAAGT	0.348																																					p.A828A		.											.	.	.	0			c.T2484G						.						85.0	84.0	84.0					10																	97106174		2203	4300	6503	SO:0001819	synonymous_variant	10580	exon24			TGTCTGAGCTTTA	AF136381	CCDS7442.1, CCDS31252.1, CCDS31253.1, CCDS31254.1, CCDS31255.1, CCDS31256.1, CCDS73169.1	10q23.33	2011-07-25	2002-05-08		ENSG00000095637	ENSG00000095637			14565	protein-coding gene	gene with protein product	"""c-Cbl-associated protein"""	605264	"""SH3-domain protein 5 (ponsin)"""	SH3D5		10085297, 11001060	Standard	XM_005269405		Approved	FLJ12406, CAP, sh3p12, ponsin, KIAA1296	uc001kkp.3	Q9BX66	OTTHUMG00000018812	ENST00000361941.3:c.2418T>G	10.37:g.97106174A>C		Somatic	31	0		WXS	Illumina HiSeq	.	39	14	NM_001034955		Silent	SNP	ENST00000361941.3	37	CCDS31255.1																																																																																			.		0.348	SORBS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049517.1		
LTBP1	4052	hgsc.bcm.edu;bcgsc.ca	37	2	33540337	33540337	+	Splice_Site	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr2:33540337G>T	ENST00000404816.2	+	24	4083		c.e24+1		LTBP1_ENST00000404525.1_Splice_Site|LTBP1_ENST00000390003.4_Splice_Site|LTBP1_ENST00000407925.1_Splice_Site|LTBP1_ENST00000354476.3_Splice_Site|LTBP1_ENST00000272273.5_Splice_Site|LTBP1_ENST00000418533.2_Splice_Site|LTBP1_ENST00000402934.1_Splice_Site			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1						extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				ACGTGTGAAGGTAAGATAAAC	0.438																																					.		.											.	.	.	0			c.3730+1G>T						.						103.0	91.0	95.0					2																	33540337		2203	4300	6503	SO:0001630	splice_region_variant	4052	exon24			GTGAAGGTAAGAT		CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.3730+1G>T	2.37:g.33540337G>T		Somatic	61	0		WXS	Illumina HiSeq	.	85	4	NM_206943	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Splice_Site	SNP	ENST00000404816.2	37	CCDS33177.2	.	.	.	.	.	.	.	.	.	.	G	17.72	3.459147	0.63401	.	.	ENSG00000049323	ENST00000404816;ENST00000354476;ENST00000390003;ENST00000418533;ENST00000402934;ENST00000404525;ENST00000407925;ENST00000415140;ENST00000272273;ENST00000422669	.	.	.	4.98	4.98	0.66077	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2782	0.90089	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LTBP1	33393841	1.000000	0.71417	1.000000	0.80357	0.742000	0.42306	7.159000	0.77483	2.295000	0.77249	0.655000	0.94253	.	.		0.438	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943	Intron
KIF4B	285643	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	154396256	154396256	+	Missense_Mutation	SNP	A	A	C			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr5:154396256A>C	ENST00000435029.4	+	1	2997	c.2837A>C	c.(2836-2838)aAg>aCg	p.K946T		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	946	Interaction with PRC1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			ATGGCAGAGAAGCAGTTAGAG	0.488																																					p.K946T		.											.	.	.	0			c.A2837C						.						94.0	90.0	91.0					5																	154396256		2203	4300	6503	SO:0001583	missense	285643	exon1			CAGAGAAGCAGTT	AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.2837A>C	5.37:g.154396256A>C	ENSP00000387875:p.Lys946Thr	Somatic	32	0		WXS	Illumina HiSeq	.	28	6	NM_001099293		Missense_Mutation	SNP	ENST00000435029.4	37	CCDS47324.1	.	.	.	.	.	.	.	.	.	.	a	0.211	-1.036655	0.02013	.	.	ENSG00000226650	ENST00000435029	T	0.69040	-0.37	1.76	0.409	0.16382	.	.	.	.	.	T	0.45256	0.1333	N	0.19112	0.55	0.19775	N	0.999959	B	0.11235	0.004	B	0.12156	0.007	T	0.25187	-1.0139	9	0.32370	T	0.25	.	4.3948	0.11358	0.646:0.354:0.0:0.0	.	946	Q2VIQ3	KIF4B_HUMAN	T	946	ENSP00000387875:K946T	ENSP00000387875:K946T	K	+	2	0	KIF4B	154376449	0.117000	0.22190	0.947000	0.38551	0.123000	0.20343	-0.038000	0.12144	0.102000	0.17638	0.455000	0.32223	AAG	.		0.488	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377478.1		
SRGAP1	57522	hgsc.bcm.edu	37	12	64505698	64505698	+	Silent	SNP	T	T	C			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr12:64505698T>C	ENST00000355086.3	+	17	2600	c.2076T>C	c.(2074-2076)acT>acC	p.T692T	SRGAP1_ENST00000543397.1_Silent_p.T629T|RP11-196H14.4_ENST00000535806.1_RNA|SRGAP1_ENST00000357825.3_Silent_p.T669T	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	692	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		ACCATGAGACTATTTTCCCAG	0.428																																					p.T692T		.											.	.	.	0			c.T2076C						.						164.0	148.0	153.0					12																	64505698		2203	4300	6503	SO:0001819	synonymous_variant	57522	exon17			TGAGACTATTTTC	AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.2076T>C	12.37:g.64505698T>C		Somatic	52	0		WXS	Illumina HiSeq	.	39	3	NM_020762	Q9H8A3|Q9P2P2	Silent	SNP	ENST00000355086.3	37	CCDS8967.1																																																																																			.		0.428	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400896.1		
KCNMB2	10242	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	178560605	178560605	+	Silent	SNP	G	G	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr3:178560605G>A	ENST00000432997.1	+	5	940	c.588G>A	c.(586-588)ctG>ctA	p.L196L	RP11-385J1.2_ENST00000432385.1_RNA|KCNMB2_ENST00000452583.1_Silent_p.L196L|RP11-385J1.2_ENST00000425330.1_RNA|KCNMB2_ENST00000358316.3_Silent_p.L196L|RP11-385J1.2_ENST00000437488.1_RNA|RP11-385J1.2_ENST00000451742.1_RNA|KCNMB2_ENST00000420517.2_Silent_p.L196L	NM_001278911.1	NP_001265840.1	Q9NPA1	KCMB3_HUMAN	potassium large conductance calcium-activated channel, subfamily M, beta member 2	210					action potential (GO:0001508)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|neuronal action potential (GO:0019228)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|potassium channel regulator activity (GO:0015459)			NS(2)|endometrium(4)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	12	all_cancers(143;5.38e-18)|Ovarian(172;0.00769)|Breast(254;0.125)		OV - Ovarian serous cystadenocarcinoma(80;1.32e-27)|GBM - Glioblastoma multiforme(14;0.0321)|BRCA - Breast invasive adenocarcinoma(182;0.0841)		Miconazole(DB01110)|Procaine(DB00721)	CCAACGTGCTGTTCCATTCAC	0.458																																					p.L196L		.											.	.	.	0			c.G588A						.						98.0	92.0	94.0					3																	178560605		2203	4300	6503	SO:0001819	synonymous_variant	10242	exon6			CGTGCTGTTCCAT	AF099137	CCDS3223.1	3q26.32	2005-10-13			ENSG00000197584	ENSG00000197584		"""Potassium channels"""	6286	protein-coding gene	gene with protein product		605214				10097176	Standard	NM_181361		Approved		uc003fjd.3	Q9Y691	OTTHUMG00000157264	ENST00000432997.1:c.588G>A	3.37:g.178560605G>A		Somatic	38	0		WXS	Illumina HiSeq	.	45	18	NM_005832	B7Z9C9|D3DNR2|E9PER5|Q9NPG7|Q9NRM9|Q9UHN3	Silent	SNP	ENST00000432997.1	37	CCDS3223.1																																																																																			.		0.458	KCNMB2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348251.1	NM_181361	
CSMD1	64478	hgsc.bcm.edu	37	8	3265726	3265726	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr8:3265726G>T	ENST00000520002.1	-	15	2324	c.1769C>A	c.(1768-1770)aCg>aAg	p.T590K	CSMD1_ENST00000537824.1_Missense_Mutation_p.T589K|CSMD1_ENST00000602723.1_Missense_Mutation_p.T590K|CSMD1_ENST00000539096.1_Missense_Mutation_p.T589K|CSMD1_ENST00000400186.3_Missense_Mutation_p.T590K|CSMD1_ENST00000542608.1_Missense_Mutation_p.T589K|CSMD1_ENST00000602557.1_Missense_Mutation_p.T590K			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	590	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		AGATGATGCCGTAAAGTTGAA	0.383																																					p.T589K		.											CSMD1_ENST00000537824,NS,carcinoma,0,2	CSMD1_ENST00000537824	0	0			c.C1766A						.						22.0	19.0	20.0					8																	3265726		1860	4112	5972	SO:0001583	missense	64478	exon14			GATGCCGTAAAGT			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.1769C>A	8.37:g.3265726G>T	ENSP00000430733:p.Thr590Lys	Somatic	43	0		WXS	Illumina HiSeq	.	35	2	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.3|27.3	4.816088|4.816088	0.90790|0.90790	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096|ENST00000335551	T;T;T;T;T|.	0.38401|.	1.14;1.14;1.14;1.14;1.14|.	5.23|5.23	5.23|5.23	0.72850|0.72850	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.78868|.	0.4351|.	M|M	0.81614|0.81614	2.55|2.55	0.58432|0.58432	D|D	0.999995|0.999995	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	T|.	0.80072|.	-0.1535|.	10|.	0.46703|.	T|.	0.11|.	.|.	18.7996|18.7996	0.92010|0.92010	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	590|.	E5RIG2|.	.|.	K|X	590;590;452;589;589;589|69	ENSP00000383047:T590K;ENSP00000430733:T590K;ENSP00000441462:T589K;ENSP00000446243:T589K;ENSP00000441675:T589K|.	ENSP00000320445:T452K|.	T|Y	-|-	2|3	0|2	CSMD1|CSMD1	3253133|3253133	1.000000|1.000000	0.71417|0.71417	0.835000|0.835000	0.33067|0.33067	0.984000|0.984000	0.73092|0.73092	9.602000|9.602000	0.98312|0.98312	2.437000|2.437000	0.82529|0.82529	0.467000|0.467000	0.42956|0.42956	ACG|TAC	.		0.383	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
CLHC1	130162	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	55439844	55439844	+	Missense_Mutation	SNP	C	C	G			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr2:55439844C>G	ENST00000401408.1	-	5	809	c.464G>C	c.(463-465)tGt>tCt	p.C155S	CLHC1_ENST00000494539.1_Intron|CLHC1_ENST00000407122.1_Missense_Mutation_p.C155S|CLHC1_ENST00000406437.2_Intron|CLHC1_ENST00000406076.1_Missense_Mutation_p.C33S|AC012358.7_ENST00000366153.2_RNA	NM_152385.2	NP_689598.2	Q8NHS4	CLHC1_HUMAN	clathrin heavy chain linker domain containing 1	155																	GGAGAAAGTACAATATTTTAC	0.318																																					p.C155S		.											.	.	.	0			c.G464C						.						130.0	124.0	126.0					2																	55439844		2201	4300	6501	SO:0001583	missense	130162	exon5			AAAGTACAATATT		CCDS33201.1, CCDS46287.1	2p16.1	2012-08-03	2012-08-03	2012-08-03	ENSG00000162994	ENSG00000162994			26453	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 63"""	C2orf63			Standard	NM_152385		Approved	FLJ31438	uc002ryi.2	Q8NHS4	OTTHUMG00000151918	ENST00000401408.1:c.464G>C	2.37:g.55439844C>G	ENSP00000384869:p.Cys155Ser	Somatic	45	0		WXS	Illumina HiSeq	.	55	12	NM_152385	B2RDV1|Q53R93|Q8N403	Missense_Mutation	SNP	ENST00000401408.1	37	CCDS33201.1	.	.	.	.	.	.	.	.	.	.	C	0.627	-0.818699	0.02776	.	.	ENSG00000162994	ENST00000407122;ENST00000401408;ENST00000406076	T;T;T	0.16743	2.32;2.32;2.34	4.6	-0.892	0.10570	.	1.060450	0.07312	N	0.876085	T	0.11495	0.0280	L	0.45581	1.43	0.09310	N	1	B	0.13145	0.007	B	0.04013	0.001	T	0.40515	-0.9559	10	0.18276	T	0.48	-0.011	0.5595	0.00676	0.3273:0.3081:0.1604:0.2042	.	155	Q8NHS4	CB063_HUMAN	S	155;155;33	ENSP00000385778:C155S;ENSP00000384869:C155S;ENSP00000385512:C33S	ENSP00000384869:C155S	C	-	2	0	C2orf63	55293348	0.000000	0.05858	0.001000	0.08648	0.259000	0.26198	-0.167000	0.09940	0.120000	0.18254	0.305000	0.20034	TGT	.		0.318	CLHC1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324412.4	NM_152385	
DOCK8	81704	hgsc.bcm.edu	37	9	428485	428485	+	Missense_Mutation	SNP	C	C	G			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr9:428485C>G	ENST00000453981.1	+	35	4574	c.4462C>G	c.(4462-4464)Ctc>Gtc	p.L1488V	DOCK8_ENST00000469391.1_Missense_Mutation_p.L1388V|DOCK8_ENST00000382329.1_Missense_Mutation_p.L955V|DOCK8_ENST00000432829.2_Missense_Mutation_p.L1420V			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	1488					blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.L1488V(1)|p.L1420V(1)		breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		ACTCCGTGCTCTCATCGCCAA	0.463																																					p.L1488V		.											DOCK8_ENST00000453981,brain,primitive_neuroectodermal_tumour-medulloblastoma,0,2	DOCK8_ENST00000453981	0	2	Substitution - Missense(2)	central_nervous_system(2)	c.C4462G						.						134.0	109.0	118.0					9																	428485		2203	4300	6503	SO:0001583	missense	81704	exon35			CGTGCTCTCATCG	AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.4462C>G	9.37:g.428485C>G	ENSP00000408464:p.Leu1488Val	Somatic	19	0		WXS	Illumina HiSeq	.	12	2	NM_203447	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Missense_Mutation	SNP	ENST00000453981.1	37	CCDS6440.2	.	.	.	.	.	.	.	.	.	.	C	28.4	4.920604	0.92249	.	.	ENSG00000107099	ENST00000453981;ENST00000287364;ENST00000432829;ENST00000469391;ENST00000382329	T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23	5.65	5.65	0.86999	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.83312	0.5227	M	0.87758	2.905	0.80722	D	1	D;D;D	0.56968	0.978;0.978;0.978	P;P;P	0.60949	0.881;0.844;0.881	D	0.84576	0.0658	10	0.51188	T	0.08	.	19.713	0.96103	0.0:1.0:0.0:0.0	.	1388;955;1488	E9PH09;A2A369;Q8NF50	.;.;DOCK8_HUMAN	V	1488;1456;1420;1388;955	ENSP00000408464:L1488V;ENSP00000394888:L1420V;ENSP00000419438:L1388V;ENSP00000371766:L955V	ENSP00000287364:L1456V	L	+	1	0	DOCK8	418485	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.887000	0.69751	2.648000	0.89879	0.650000	0.86243	CTC	.		0.463	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171792.5	XM_036307	
TM9SF3	56889	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	98292847	98292847	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr10:98292847C>T	ENST00000371142.4	-	10	1502	c.1286G>A	c.(1285-1287)cGt>cAt	p.R429H		NM_020123.3	NP_064508.3	Q9HD45	TM9S3_HUMAN	transmembrane 9 superfamily member 3	429						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(2)|prostate(1)	15		Colorectal(252;0.158)		Epithelial(162;1.84e-09)|all cancers(201;2.84e-08)		AGCATTGACACGACAAGGAAA	0.398																																					p.R429H		.											.	.	.	0			c.G1286A						.						152.0	138.0	143.0					10																	98292847		2203	4300	6503	SO:0001583	missense	56889	exon10			TTGACACGACAAG	AF160213, AF269150	CCDS7450.1	10q24.2	2006-04-12			ENSG00000077147	ENSG00000077147			21529	protein-coding gene	gene with protein product						11530251, 11595169	Standard	NM_020123		Approved	SMBP	uc001kmm.4	Q9HD45	OTTHUMG00000018834	ENST00000371142.4:c.1286G>A	10.37:g.98292847C>T	ENSP00000360184:p.Arg429His	Somatic	73	0		WXS	Illumina HiSeq	.	81	20	NM_020123	Q5TB57|Q6UWE7|Q9NWL8|Q9P0G9|Q9UHW8	Missense_Mutation	SNP	ENST00000371142.4	37	CCDS7450.1	.	.	.	.	.	.	.	.	.	.	C	36	5.642088	0.96704	.	.	ENSG00000077147	ENST00000371142	T	0.53206	0.63	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.76407	0.3983	M	0.90870	3.155	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.81695	-0.0816	10	0.87932	D	0	-9.5478	18.6637	0.91481	0.0:1.0:0.0:0.0	.	429	Q9HD45	TM9S3_HUMAN	H	429	ENSP00000360184:R429H	ENSP00000360184:R429H	R	-	2	0	TM9SF3	98282837	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.786000	0.85741	2.652000	0.90054	0.563000	0.77884	CGT	.		0.398	TM9SF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049610.2	NM_020123	
CFDP1	10428	hgsc.bcm.edu	37	16	75339062	75339062	+	Silent	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr16:75339062G>T	ENST00000283882.3	-	6	801	c.669C>A	c.(667-669)ggC>ggA	p.G223G		NM_006324.2	NP_006315.1	Q9UEE9	CFDP1_HUMAN	craniofacial development protein 1	223	BCNT-C. {ECO:0000255|PROSITE- ProRule:PRU00610}.				cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|negative regulation of fibroblast apoptotic process (GO:2000270)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)			p.G223G(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5						GGCTGCTCATGCCACTTGATC	0.413																																					p.G223G		.											CFDP1,NS,carcinoma,0,1	CFDP1	0	1	Substitution - coding silent(1)	endometrium(1)	c.C669A						.						92.0	93.0	93.0					16																	75339062		2198	4300	6498	SO:0001819	synonymous_variant	10428	exon6			GCTCATGCCACTT	AB009285	CCDS10916.1	16q22.2-q22.3	2011-08-12			ENSG00000153774	ENSG00000153774			1873	protein-coding gene	gene with protein product	"""Bucentaur"", ""centromere protein 29"""	608108				9602175, 9006920, 11992732	Standard	NM_006324		Approved	BCNT, p97, CP27, SWC5, Yeti, CENP-29	uc002fdy.3	Q9UEE9	OTTHUMG00000137615	ENST00000283882.3:c.669C>A	16.37:g.75339062G>T		Somatic	23	0		WXS	Illumina HiSeq	.	18	2	NM_006324	O00393|O00404|Q9UEF0|Q9UEF1|Q9UEF8	Silent	SNP	ENST00000283882.3	37	CCDS10916.1																																																																																			.		0.413	CFDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269031.2	NM_006324	
PCDHB5	26167	hgsc.bcm.edu	37	5	140516886	140516886	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr5:140516886C>T	ENST00000231134.5	+	1	2087	c.1870C>T	c.(1870-1872)Cgc>Tgc	p.R624C		NM_015669.2	NP_056484.1	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5	624	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|kidney(1)|large_intestine(18)|lung(25)|ovary(3)|prostate(6)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	81			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGGCGAGGTGCGCACCGCCAG	0.701																																					p.R624C		.											PCDHB5,NS,carcinoma,0,2	PCDHB5	0	0			c.C1870T						.						40.0	43.0	42.0					5																	140516886		2146	4196	6342	SO:0001583	missense	26167	exon1			GAGGTGCGCACCG	AF152498	CCDS4247.1	5q31	2010-01-26			ENSG00000113209	ENSG00000113209		"""Cadherins / Protocadherins : Clustered"""	8690	other	protocadherin		606331				10380929	Standard	NM_015669		Approved	DKFZp586B0217, PCDH-BETA5	uc003liq.3	Q9Y5E4	OTTHUMG00000129616	ENST00000231134.5:c.1870C>T	5.37:g.140516886C>T	ENSP00000231134:p.Arg624Cys	Somatic	68	0		WXS	Illumina HiSeq	.	65	4	NM_015669	Q549F4|Q9UFU9	Missense_Mutation	SNP	ENST00000231134.5	37	CCDS4247.1	.	.	.	.	.	.	.	.	.	.	C	14.82	2.649925	0.47362	.	.	ENSG00000113209	ENST00000231134	T	0.52754	0.65	4.65	4.65	0.58169	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.69967	0.3170	M	0.90542	3.125	0.40112	D	0.976502	D	0.89917	1.0	D	0.87578	0.998	T	0.75147	-0.3420	9	0.72032	D	0.01	.	7.3497	0.26684	0.2843:0.6336:0.0:0.0821	.	624	Q9Y5E4	PCDB5_HUMAN	C	624	ENSP00000231134:R624C	ENSP00000231134:R624C	R	+	1	0	PCDHB5	140497070	0.087000	0.21565	1.000000	0.80357	0.886000	0.51366	1.626000	0.37039	2.301000	0.77427	0.430000	0.28490	CGC	.		0.701	PCDHB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251811.1	NM_015669	
CACNA1E	777	hgsc.bcm.edu	37	1	181727219	181727219	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr1:181727219C>T	ENST00000367573.2	+	31	4466	c.4466C>T	c.(4465-4467)gCc>gTc	p.A1489V	CACNA1E_ENST00000358338.5_Missense_Mutation_p.A1421V|CACNA1E_ENST00000357570.5_Missense_Mutation_p.A1440V|CACNA1E_ENST00000367570.1_Missense_Mutation_p.A1489V|CACNA1E_ENST00000367567.4_Missense_Mutation_p.A1096V|CACNA1E_ENST00000360108.3_Missense_Mutation_p.A1470V|CACNA1E_ENST00000526775.1_Missense_Mutation_p.A1470V	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1489					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						GCCATGATCGCCTTGAATACT	0.557																																					p.A1489V		.											CACNA1E_ENST00000367573,colon,carcinoma,0,2	CACNA1E_ENST00000367573	0	0			c.C4466T						.						105.0	106.0	105.0					1																	181727219		2124	4242	6366	SO:0001583	missense	777	exon31			TGATCGCCTTGAA	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.4466C>T	1.37:g.181727219C>T	ENSP00000356545:p.Ala1489Val	Somatic	28	0		WXS	Illumina HiSeq	.	34	2	NM_001205293	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	37	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.747157	0.89663	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.97161	-4.27;-4.27;-4.27;-4.27;-4.27;-4.27;-4.27	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	D	0.97179	0.9078	L	0.33339	1.005	0.80722	D	1	B;B;D	0.71674	0.372;0.114;0.998	P;B;D	0.80764	0.501;0.417;0.994	D	0.96750	0.9553	10	0.32370	T	0.25	.	18.5085	0.90907	0.0:1.0:0.0:0.0	.	1470;1489;1489	Q15878-2;Q15878;Q15878-3	.;CAC1E_HUMAN;.	V	1489;1470;1440;1421;1096;1470;1489	ENSP00000356542:A1489V;ENSP00000434814:A1470V;ENSP00000350183:A1440V;ENSP00000351101:A1421V;ENSP00000356539:A1096V;ENSP00000353222:A1470V;ENSP00000356545:A1489V	ENSP00000350183:A1440V	A	+	2	0	CACNA1E	179993842	1.000000	0.71417	0.998000	0.56505	0.952000	0.60782	7.711000	0.84669	2.465000	0.83290	0.655000	0.94253	GCC	.		0.557	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
ADRBK1	156	hgsc.bcm.edu	37	11	67049787	67049787	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr11:67049787G>T	ENST00000308595.5	+	12	1293	c.1003G>T	c.(1003-1005)Gac>Tac	p.D335Y	ADRBK1_ENST00000527176.1_Intron|ADRBK1_ENST00000526285.1_Missense_Mutation_p.D335Y	NM_001619.3	NP_001610.2	P25098	ARBK1_HUMAN	adrenergic, beta, receptor kinase 1	335	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|cardiac muscle contraction (GO:0060048)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of striated muscle contraction (GO:0045988)|negative regulation of the force of heart contraction by chemical signal (GO:0003108)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of catecholamine secretion (GO:0033605)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|tachykinin receptor signaling pathway (GO:0007217)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|ATP binding (GO:0005524)|beta-adrenergic receptor kinase activity (GO:0047696)|Edg-2 lysophosphatidic acid receptor binding (GO:0031755)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|liver(2)|lung(8)|prostate(2)	22			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)		Adenosine triphosphate(DB00171)	GCGGATCTCGGACCTGGGCCT	0.652																																					p.D335Y		.											.	.	.	0			c.G1003T						.						84.0	87.0	86.0					11																	67049787		2200	4295	6495	SO:0001583	missense	156	exon12			ATCTCGGACCTGG	X61157	CCDS8156.1	11q13	2013-01-10			ENSG00000173020	ENSG00000173020		"""Pleckstrin homology (PH) domain containing"""	289	protein-coding gene	gene with protein product		109635				2037065	Standard	NM_001619		Approved	GRK2, BARK1	uc009yrn.1	P25098	OTTHUMG00000167104	ENST00000308595.5:c.1003G>T	11.37:g.67049787G>T	ENSP00000312262:p.Asp335Tyr	Somatic	57	0		WXS	Illumina HiSeq	.	71	4	NM_001619	B0ZBE1|Q13837|Q6GTT3	Missense_Mutation	SNP	ENST00000308595.5	37	CCDS8156.1	.	.	.	.	.	.	.	.	.	.	G	19.05	3.751289	0.69533	.	.	ENSG00000173020	ENST00000308595;ENST00000526285	D;D	0.93076	-3.16;-3.16	5.21	5.21	0.72293	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000004	D	0.98124	0.9381	H	0.97491	4.015	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99368	1.0919	10	0.87932	D	0	-17.0997	19.1477	0.93475	0.0:0.0:1.0:0.0	.	335;335	P25098;E9PRV7	ARBK1_HUMAN;.	Y	335	ENSP00000312262:D335Y;ENSP00000434126:D335Y	ENSP00000312262:D335Y	D	+	1	0	ADRBK1	66806363	1.000000	0.71417	0.987000	0.45799	0.335000	0.28730	9.476000	0.97823	2.606000	0.88127	0.655000	0.94253	GAC	.		0.652	ADRBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393153.1	NM_001619	
ZNF14	7561	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	19822519	19822519	+	Missense_Mutation	SNP	A	A	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr19:19822519A>T	ENST00000344099.3	-	4	1709	c.1571T>A	c.(1570-1572)aTt>aAt	p.I524N		NM_021030.2	NP_066358.2	P17017	ZNF14_HUMAN	zinc finger protein 14	524					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(2)|endometrium(1)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32		Renal(1328;0.0474)				TCCAGTGTGAATTTTTTCATG	0.408																																					p.I524N		.											.	.	.	0			c.T1571A						.						101.0	96.0	98.0					19																	19822519		2203	4300	6503	SO:0001583	missense	7561	exon4			GTGTGAATTTTTT	AA286756	CCDS12409.1	19p13.11	2013-01-08	2006-05-10					"""Zinc fingers, C2H2-type"", ""-"""	12924	protein-coding gene	gene with protein product		194556	"""zinc finger protein 14 (KOX 6)"""				Standard	NM_021030		Approved	KOX6, GIOT-4	uc002nnk.1	P17017		ENST00000344099.3:c.1571T>A	19.37:g.19822519A>T	ENSP00000340514:p.Ile524Asn	Somatic	37	0		WXS	Illumina HiSeq	.	40	12	NM_021030	B9EGA4|Q9ULZ5	Missense_Mutation	SNP	ENST00000344099.3	37	CCDS12409.1	.	.	.	.	.	.	.	.	.	.	A	12.74	2.029708	0.35797	.	.	ENSG00000105708	ENST00000344099	T	0.07567	3.18	1.8	-0.102	0.13613	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.11623	0.0283	L	0.58810	1.83	0.09310	N	1	P	0.41080	0.737	P	0.45971	0.499	T	0.18935	-1.0321	9	0.72032	D	0.01	.	4.6844	0.12750	0.691:0.0:0.309:0.0	.	524	P17017	ZNF14_HUMAN	N	524	ENSP00000340514:I524N	ENSP00000340514:I524N	I	-	2	0	ZNF14	19683519	0.002000	0.14202	0.003000	0.11579	0.649000	0.38597	0.231000	0.17872	-0.248000	0.09583	0.383000	0.25322	ATT	.		0.408	ZNF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460775.1	NM_021030	
SYT10	341359	hgsc.bcm.edu;bcgsc.ca	37	12	33579333	33579333	+	Silent	SNP	G	G	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr12:33579333G>A	ENST00000228567.3	-	2	545	c.249C>T	c.(247-249)tgC>tgT	p.C83C	SYT10_ENST00000535526.1_5'UTR|SYT10_ENST00000567656.1_5'Flank	NM_198992.3	NP_945343.1	Q6XYQ8	SYT10_HUMAN	synaptotagmin X	83					regulation of calcium ion-dependent exocytosis (GO:0017158)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(3)|skin(4)|urinary_tract(1)	42	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)					TGCTTTTCCAGCATGGCCAAC	0.433																																					p.C83C		.											.	.	.	0			c.C249T						.						72.0	70.0	71.0					12																	33579333		2203	4300	6503	SO:0001819	synonymous_variant	341359	exon2			TTTCCAGCATGGC	AY198413	CCDS8732.1	12p11	2013-01-21			ENSG00000110975	ENSG00000110975		"""Synaptotagmins"""	19266	protein-coding gene	gene with protein product							Standard	NM_198992		Approved		uc001rll.1	Q6XYQ8	OTTHUMG00000169269	ENST00000228567.3:c.249C>T	12.37:g.33579333G>A		Somatic	52	0		WXS	Illumina HiSeq	.	56	4	NM_198992	Q495U2	Silent	SNP	ENST00000228567.3	37	CCDS8732.1																																																																																			.		0.433	SYT10-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403222.1	NM_198992	
OLFM3	118427	hgsc.bcm.edu	37	1	102269877	102269877	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr1:102269877C>T	ENST00000338858.5	-	6	1353	c.1354G>A	c.(1354-1356)Gct>Act	p.A452T	OLFM3_ENST00000536598.1_3'UTR|OLFM3_ENST00000370103.4_Missense_Mutation_p.A432T|OLFM3_ENST00000462354.1_5'UTR			Q96PB7	NOE3_HUMAN	olfactomedin 3	452	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				eye photoreceptor cell development (GO:0042462)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)		p.A432T(1)|p.A452T(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(24)|ovary(3)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	43		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)		GCATAGAGAGCTCGATCTCTT	0.428																																					p.A432T		.											OLFM3_ENST00000338858,caecum,carcinoma,0,2	OLFM3_ENST00000338858	0	2	Substitution - Missense(2)	large_intestine(2)	c.G1294A						.						204.0	190.0	195.0					1																	102269877		2203	4300	6503	SO:0001583	missense	118427	exon6			AGAGAGCTCGATC	AF397392	CCDS30781.1, CCDS72832.1	1p22	2008-05-23			ENSG00000118733	ENSG00000118733			17990	protein-coding gene	gene with protein product	"""optimedin"""	607567				12019210, 16115881	Standard	NM_001288821		Approved	NOE3	uc001dug.2	Q96PB7	OTTHUMG00000010941	ENST00000338858.5:c.1354G>A	1.37:g.102269877C>T	ENSP00000345192:p.Ala452Thr	Somatic	36	0		WXS	Illumina HiSeq	.	24	2	NM_058170	Q5T3V6|Q6IMI7|Q6IMI8|Q6IMI9|Q6IMJ1|Q8TBG1|Q96PB2|Q96PB3|Q96PB4|Q96PB5|Q96PB6	Missense_Mutation	SNP	ENST00000338858.5	37		.	.	.	.	.	.	.	.	.	.	C	24.7	4.564098	0.86335	.	.	ENSG00000118733	ENST00000370103;ENST00000338858	D;D	0.89552	-2.53;-2.53	5.77	5.77	0.91146	Olfactomedin-like (3);	0.000000	0.85682	D	0.000000	D	0.94341	0.8181	M	0.80982	2.52	0.80722	D	1	P;D	0.69078	0.624;0.997	B;D	0.80764	0.3;0.994	D	0.93640	0.6964	10	0.54805	T	0.06	.	19.9831	0.97336	0.0:1.0:0.0:0.0	.	432;452	Q5T3V6;Q96PB7	.;NOE3_HUMAN	T	432;452	ENSP00000359121:A432T;ENSP00000345192:A452T	ENSP00000345192:A452T	A	-	1	0	OLFM3	102042465	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.487000	0.81328	2.728000	0.93425	0.650000	0.86243	GCT	.		0.428	OLFM3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000030142.1		
PDCD2L	84306	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	34916999	34916999	+	Missense_Mutation	SNP	G	G	A	rs372339509		TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr19:34916999G>A	ENST00000246535.3	+	7	1098	c.1051G>A	c.(1051-1053)Gac>Aac	p.D351N	UBA2_ENST00000246548.4_5'Flank|PDCD2L_ENST00000587065.2_Missense_Mutation_p.D49N|CTD-2588C8.8_ENST00000592220.1_RNA|UBA2_ENST00000439527.2_5'Flank	NM_032346.1	NP_115722.1	Q9BRP1	PDD2L_HUMAN	programmed cell death 2-like	351					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|membrane (GO:0016020)				breast(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			TATACAAGAAGACCCAGATGA	0.308																																					p.D351N		.											.	.	.	0			c.G1051A						.	G	ASN/ASP	1,4405	2.1+/-5.4	0,1,2202	63.0	65.0	64.0		1051	5.6	1.0	19		64	0,8600		0,0,4300	no	missense	PDCD2L	NM_032346.1	23	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	351/359	34916999	1,13005	2203	4300	6503	SO:0001583	missense	84306	exon7			CAAGAAGACCCAG	BC006146	CCDS12438.1	19q13.11	2008-02-05				ENSG00000126249			28194	protein-coding gene	gene with protein product		615661				16311922	Standard	NM_032346		Approved	MGC13096	uc002nvj.3	Q9BRP1		ENST00000246535.3:c.1051G>A	19.37:g.34916999G>A	ENSP00000246535:p.Asp351Asn	Somatic	73	0		WXS	Illumina HiSeq	.	84	16	NM_032346		Missense_Mutation	SNP	ENST00000246535.3	37	CCDS12438.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.950010	0.92660	2.27E-4	0.0	ENSG00000126249	ENST00000246535	.	.	.	5.56	5.56	0.83823	Programmed cell death protein 2, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.79528	0.4461	M	0.74881	2.28	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	T	0.78755	-0.2080	9	0.44086	T	0.13	-22.0659	18.297	0.90150	0.0:0.0:1.0:0.0	.	351	Q9BRP1	PDD2L_HUMAN	N	351	.	ENSP00000246535:D351N	D	+	1	0	PDCD2L	39608839	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.238000	0.78173	2.624000	0.88883	0.650000	0.86243	GAC	.		0.308	PDCD2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459251.3	NM_032346	
ST6GALNAC3	256435	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	76540564	76540564	+	Missense_Mutation	SNP	C	C	G			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr1:76540564C>G	ENST00000328299.3	+	1	161	c.13C>G	c.(13-15)Ctg>Gtg	p.L5V		NM_152996.2	NP_694541.2	Q8NDV1	SIA7C_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3	5					glycoprotein metabolic process (GO:0009100)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide metabolic process (GO:0006677)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sialyltransferase activity (GO:0008373)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|ovary(3)|prostate(1)|skin(2)	36						GGCCTGCATCCTGAAGGTAAC	0.697																																					p.L5V		.											.	.	.	0			c.C13G						.						48.0	41.0	43.0					1																	76540564		2200	4296	6496	SO:0001583	missense	256435	exon1			TGCATCCTGAAGG		CCDS672.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000184005	ENSG00000184005		"""Sialyltransferases"""	19343	protein-coding gene	gene with protein product	"""ST6GALNAC III"""	610133	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) C"""	SIAT7C			Standard	NM_152996		Approved		uc001dhh.2	Q8NDV1	OTTHUMG00000009615	ENST00000328299.3:c.13C>G	1.37:g.76540564C>G	ENSP00000329214:p.Leu5Val	Somatic	49	0		WXS	Illumina HiSeq	.	44	7	NM_001160011	Q6PCE0|Q6UX29|Q8N259	Missense_Mutation	SNP	ENST00000328299.3	37	CCDS672.1	.	.	.	.	.	.	.	.	.	.	C	18.53	3.643988	0.67244	.	.	ENSG00000184005	ENST00000394994;ENST00000328299	T	0.31510	1.49	4.91	3.98	0.46160	.	0.608005	0.16500	N	0.211681	T	0.23014	0.0556	N	0.24115	0.695	0.26966	N	0.965702	P;P;B	0.46578	0.574;0.88;0.011	B;P;B	0.62184	0.123;0.899;0.057	T	0.08106	-1.0738	10	0.52906	T	0.07	-26.1666	11.0102	0.47659	0.1858:0.8142:0.0:0.0	.	5;5;5	B4DM98;Q8NDV1;Q8NDV1-2	.;SIA7C_HUMAN;.	V	5	ENSP00000329214:L5V	ENSP00000329214:L5V	L	+	1	2	ST6GALNAC3	76313152	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	0.949000	0.29109	1.184000	0.42957	0.561000	0.74099	CTG	.		0.697	ST6GALNAC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026501.1	NM_152996	
PRKD1	5587	hgsc.bcm.edu	37	14	30068808	30068808	+	Intron	SNP	G	G	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr14:30068808G>A	ENST00000331968.5	-	14	2297				PRKD1_ENST00000415220.2_Intron	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1						angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		GTTAAACAGTGATAACATTTG	0.333																																					.		.											.	.	.	0			.						.																																			SO:0001627	intron_variant	100616347	.			AACAGTGATAACA		CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.2067+53C>T	14.37:g.30068808G>A		Somatic	31	0		WXS	Illumina HiSeq	.	37	13	.	A6NL64|B2RAF6	RNA	SNP	ENST00000331968.5	37	CCDS9637.1																																																																																			.		0.333	PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276611.2	NM_002742	
GRIA2	2891	hgsc.bcm.edu	37	4	158257613	158257613	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr4:158257613G>T	ENST00000264426.9	+	11	1837	c.1558G>T	c.(1558-1560)Ggg>Tgg	p.G520W	GRIA2_ENST00000296526.7_Missense_Mutation_p.G520W|GRIA2_ENST00000393815.2_Missense_Mutation_p.G473W|GRIA2_ENST00000507898.1_Missense_Mutation_p.G473W|GRIA2_ENST00000449365.1_Missense_Mutation_p.G473W	NM_001083619.1	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2	520					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.G520W(3)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(2)|lung(32)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	79	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	CATGAGCCTCGGGATATCTAT	0.408																																					p.G520W		.											GRIA2_ENST00000264426,colon,carcinoma,0,3	GRIA2_ENST00000264426	0	3	Substitution - Missense(3)	lung(2)|breast(1)	c.G1558T						.						188.0	185.0	186.0					4																	158257613		2203	4300	6503	SO:0001583	missense	2891	exon11			AGCCTCGGGATAT		CCDS3797.1, CCDS43274.1, CCDS43275.1	4q32.1	2012-08-29			ENSG00000120251	ENSG00000120251		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4572	protein-coding gene	gene with protein product		138247		GLUR2		1311100	Standard	NM_001083619		Approved	GluA2, GLURB	uc003ipl.4	P42262	OTTHUMG00000133836	ENST00000264426.9:c.1558G>T	4.37:g.158257613G>T	ENSP00000264426:p.Gly520Trp	Somatic	65	0		WXS	Illumina HiSeq	.	67	3	NM_000826	A8MT92|I6L997|Q96FP6	Missense_Mutation	SNP	ENST00000264426.9	37	CCDS43274.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.100065	0.76983	.	.	ENSG00000120251	ENST00000507898;ENST00000393815;ENST00000296526;ENST00000264426;ENST00000449365	T;T;T;T;T	0.48836	0.8;0.8;0.8;0.8;0.8	5.46	5.46	0.80206	Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	T	0.82259	0.4998	H	0.98594	4.275	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.986;1.0;0.999	D	0.88996	0.3418	10	0.87932	D	0	.	19.6634	0.95882	0.0:0.0:1.0:0.0	.	520;520;473	P42262;P42262-2;A8MT92	GRIA2_HUMAN;.;.	W	473;473;520;520;473	ENSP00000426845:G473W;ENSP00000377403:G473W;ENSP00000296526:G520W;ENSP00000264426:G520W;ENSP00000389837:G473W	ENSP00000264426:G520W	G	+	1	0	GRIA2	158477063	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.813000	0.99286	2.720000	0.93068	0.655000	0.94253	GGG	.		0.408	GRIA2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000258367.2		
C22orf42	150297	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	22	32555003	32555003	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr22:32555003G>T	ENST00000382097.3	-	1	272	c.200C>A	c.(199-201)cCg>cAg	p.P67Q	RP1-90G24.8_ENST00000426354.1_lincRNA	NM_001010859.1	NP_001010859.1	Q6IC83	CV042_HUMAN	chromosome 22 open reading frame 42	67										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(2)	24						CGGCGTCTTCGGGAGGCTGAG	0.557																																					p.P67Q		.											.	.	.	0			c.C200A						.						181.0	175.0	177.0					22																	32555003		2203	4300	6503	SO:0001583	missense	150297	exon1			GTCTTCGGGAGGC	BC040263	CCDS33639.1	22q12.3	2009-03-05			ENSG00000205856	ENSG00000205856			27160	protein-coding gene	gene with protein product						12477932	Standard	XM_005261369		Approved		uc003amd.3	Q6IC83	OTTHUMG00000030380	ENST00000382097.3:c.200C>A	22.37:g.32555003G>T	ENSP00000371529:p.Pro67Gln	Somatic	33	0		WXS	Illumina HiSeq	.	28	4	NM_001010859	A4QPH5	Missense_Mutation	SNP	ENST00000382097.3	37	CCDS33639.1	.	.	.	.	.	.	.	.	.	.	G	2.942	-0.218719	0.06101	.	.	ENSG00000205856	ENST00000382097	T	0.21932	1.98	.	.	.	.	.	.	.	.	T	0.18635	0.0447	N	0.08118	0	0.09310	N	1	D	0.64830	0.994	D	0.66716	0.946	T	0.25537	-1.0129	7	0.22109	T	0.4	.	.	.	.	.	67	Q6IC83	CV042_HUMAN	Q	67	ENSP00000371529:P67Q	ENSP00000371529:P67Q	P	-	2	0	C22orf42	30885003	0.003000	0.15002	0.025000	0.17156	0.029000	0.11900	0.226000	0.17776	0.064000	0.16427	0.064000	0.15345	CCG	.		0.557	C22orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075268.2	NM_001010859	
MAP4K4	9448	hgsc.bcm.edu	37	2	102490597	102490597	+	Silent	SNP	C	C	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr2:102490597C>A	ENST00000347699.4	+	23	2689	c.2689C>A	c.(2689-2691)Cgg>Agg	p.R897R	MAP4K4_ENST00000324219.4_Silent_p.R978R|MAP4K4_ENST00000350198.4_Silent_p.R816R|MAP4K4_ENST00000302217.5_Silent_p.R700R|MAP4K4_ENST00000456652.1_Silent_p.R696R|MAP4K4_ENST00000425019.1_Silent_p.R930R|MAP4K4_ENST00000350878.4_Silent_p.R937R|MAP4K4_ENST00000413150.2_Silent_p.R812R	NM_001242559.1|NM_145687.3	NP_001229488.1|NP_663720.1	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase kinase 4	897	Mediates interaction with RAP2A.				intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of JNK cascade (GO:0046328)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.R978W(1)		breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						AGATCCTACCCGGAAAGGCTC	0.428																																					p.R931R		.											MAP4K4,NS,carcinoma,0,2	MAP4K4	0	1	Substitution - Missense(1)	endometrium(1)	c.C2791A						.						106.0	106.0	106.0					2																	102490597		1932	4130	6062	SO:0001819	synonymous_variant	9448	exon24			CCTACCCGGAAAG	AF096300	CCDS56130.1, CCDS74546.1	2q11.2-q12	2011-06-09			ENSG00000071054	ENSG00000071054		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6866	protein-coding gene	gene with protein product	"""HPK/GCK-like kinase"", ""hepatocyte progenitor kinase-like/germinal center kinase-like kinase"""	604666				9890973, 9734811, 9135144	Standard	NM_004834		Approved	HGK, NIK, FLH21957	uc002tbf.3	O95819	OTTHUMG00000155394	ENST00000347699.4:c.2689C>A	2.37:g.102490597C>A		Somatic	44	0		WXS	Illumina HiSeq	.	50	2	NM_145686	O75172|Q9NST7	Silent	SNP	ENST00000347699.4	37	CCDS56130.1	.	.	.	.	.	.	.	.	.	.	C	9.831	1.188408	0.21954	.	.	ENSG00000071054	ENST00000421882	.	.	.	5.22	4.32	0.51571	.	.	.	.	.	T	0.63920	0.2552	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62210	-0.6902	4	.	.	.	.	12.7915	0.57537	0.2977:0.7022:0.0:0.0	.	.	.	.	Q	713	.	.	P	+	2	0	MAP4K4	101857029	0.913000	0.31002	1.000000	0.80357	0.998000	0.95712	1.636000	0.37144	1.155000	0.42497	0.655000	0.94253	CCG	.		0.428	MAP4K4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339839.1	NM_004834	
CACNA1E	777	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	181767937	181767937	+	Silent	SNP	G	G	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr1:181767937G>A	ENST00000367573.2	+	48	6909	c.6909G>A	c.(6907-6909)ctG>ctA	p.L2303L	CACNA1E_ENST00000358338.5_Silent_p.L2192L|CACNA1E_ENST00000357570.5_Silent_p.L2254L|CACNA1E_ENST00000367570.1_Silent_p.L2260L|CACNA1E_ENST00000367567.4_Silent_p.L1867L|CACNA1E_ENST00000360108.3_Silent_p.L2284L|CACNA1E_ENST00000526775.1_Silent_p.L2241L	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	2303					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						TCAACAACCTGCTAAGTGACA	0.597																																					p.L2303L		.											.	.	.	0			c.G6909A						.						22.0	26.0	25.0					1																	181767937		2027	4169	6196	SO:0001819	synonymous_variant	777	exon48			CAACCTGCTAAGT	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.6909G>A	1.37:g.181767937G>A		Somatic	33	0		WXS	Illumina HiSeq	.	67	7	NM_001205293	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Silent	SNP	ENST00000367573.2	37	CCDS55664.1																																																																																			.		0.597	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
PBRM1	55193	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	52651334	52651334	+	Nonsense_Mutation	SNP	C	C	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr3:52651334C>A	ENST00000296302.7	-	14	1763	c.1762G>T	c.(1762-1764)Gaa>Taa	p.E588*	PBRM1_ENST00000409114.3_Nonsense_Mutation_p.E603*|PBRM1_ENST00000409767.1_Nonsense_Mutation_p.E603*|PBRM1_ENST00000410007.1_Nonsense_Mutation_p.E588*|PBRM1_ENST00000394830.3_Nonsense_Mutation_p.E588*|PBRM1_ENST00000356770.4_Nonsense_Mutation_p.E556*|PBRM1_ENST00000409057.1_Nonsense_Mutation_p.E588*|PBRM1_ENST00000337303.4_Nonsense_Mutation_p.E588*			Q86U86	PB1_HUMAN	polybromo 1	588	Bromo 4. {ECO:0000255|PROSITE- ProRule:PRU00035}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TTCATGTCTTCTATCATTCCC	0.453			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																p.E588X		.		Rec	yes		3	3p21	55193	polybromo 1		E	.	.	.	0			c.G1762T						.						113.0	102.0	106.0					3																	52651334		2203	4300	6503	SO:0001587	stop_gained	55193	exon15			TGTCTTCTATCAT	BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.1762G>T	3.37:g.52651334C>A	ENSP00000296302:p.Glu588*	Somatic	49	0		WXS	Illumina HiSeq	.	25	6	NM_018313	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Nonsense_Mutation	SNP	ENST00000296302.7	37		.	.	.	.	.	.	.	.	.	.	C	39	7.671659	0.98425	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	.	.	.	5.84	5.84	0.93424	.	0.207947	0.49916	D	0.000139	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	-10.6922	20.139	0.98050	0.0:1.0:0.0:0.0	.	.	.	.	X	556;588;588;588;588;588;603;603;588;547	.	ENSP00000296302:E588X	E	-	1	0	PBRM1	52626374	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.764000	0.94973	0.655000	0.94253	GAA	.		0.453	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1	NM_018165	
CDC7	8317	hgsc.bcm.edu	37	1	91967356	91967356	+	Nonsense_Mutation	SNP	T	T	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr1:91967356T>A	ENST00000428239.1	+	2	342	c.83T>A	c.(82-84)tTa>tAa	p.L28*	CDC7_ENST00000497611.1_3'UTR|CDC7_ENST00000430031.2_Nonsense_Mutation_p.L28*|CDC7_ENST00000234626.6_Nonsense_Mutation_p.L28*	NM_001134420.1	NP_001127892.1	O00311	CDC7_HUMAN	cell division cycle 7	28					cell cycle phase transition (GO:0044770)|cell division (GO:0051301)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|stomach(2)	23		all_lung(203;0.0165)|Lung NSC(277;0.0562)		all cancers(265;0.00108)|Epithelial(280;0.0184)|KIRC - Kidney renal clear cell carcinoma(1967;0.124)		GAAGGCTCTTTAAAAAAAAAC	0.403																																					p.L28X		.											CDC7,NS,carcinoma,0,4	CDC7	0	0			c.T83A						.						89.0	96.0	94.0					1																	91967356		2203	4300	6503	SO:0001587	stop_gained	8317	exon2			GCTCTTTAAAAAA	AF015592	CCDS734.1	1p22	2013-01-17	2013-01-17	2003-07-23	ENSG00000097046	ENSG00000097046			1745	protein-coding gene	gene with protein product		603311	"""CDC7 (cell division cycle 7, S. cerevisiae, homolog)-like 1"", ""CDC7 cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 homolog (S. cerevisiae)"""	CDC7L1		9405610, 9250678	Standard	NM_003503		Approved	Hsk1, huCdc7, HsCdc7	uc001dof.3	O00311	OTTHUMG00000047810	ENST00000428239.1:c.83T>A	1.37:g.91967356T>A	ENSP00000393139:p.Leu28*	Somatic	30	1		WXS	Illumina HiSeq	.	48	3	NM_001134419	D3DT31|O00558|Q5T5U5	Nonsense_Mutation	SNP	ENST00000428239.1	37	CCDS734.1	.	.	.	.	.	.	.	.	.	.	T	19.94	3.919905	0.73098	.	.	ENSG00000097046	ENST00000430031;ENST00000234626;ENST00000428239;ENST00000426137	.	.	.	5.22	2.9	0.33743	.	1.340040	0.04577	N	0.394259	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.7639	5.0268	0.14389	0.0:0.1687:0.1674:0.6639	.	.	.	.	X	28	.	ENSP00000234626:L28X	L	+	2	0	CDC7	91739944	0.004000	0.15560	0.151000	0.22473	0.174000	0.22865	0.295000	0.19065	0.391000	0.25143	-0.346000	0.07831	TTA	.		0.403	CDC7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027928.1	NM_003503	
OR4D2	124538	hgsc.bcm.edu	37	17	56247070	56247070	+	Silent	SNP	G	G	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr17:56247070G>A	ENST00000545221.1	+	1	54	c.54G>A	c.(52-54)tcG>tcA	p.S18S		NM_001004707.3	NP_001004707.1	P58180	OR4D2_HUMAN	olfactory receptor, family 4, subfamily D, member 2	18						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S18S(1)		breast(1)|kidney(1)|large_intestine(1)|lung(19)|ovary(1)|skin(2)|stomach(1)	26						TGGGGCTCTCGCAGACTCGGG	0.468																																					p.S18S		.											OR4D2,NS,carcinoma,0,1	OR4D2	0	1	Substitution - coding silent(1)	lung(1)	c.G54A						.						122.0	113.0	116.0					17																	56247070		2203	4300	6503	SO:0001819	synonymous_variant	124538	exon1			GCTCTCGCAGACT		CCDS32688.1	17q22	2013-09-23			ENSG00000255713	ENSG00000255713		"""GPCR / Class A : Olfactory receptors"""	8294	protein-coding gene	gene with protein product							Standard	NM_001004707		Approved		uc010wnp.2	P58180	OTTHUMG00000178801	ENST00000545221.1:c.54G>A	17.37:g.56247070G>A		Somatic	40	0		WXS	Illumina HiSeq	.	47	2	NM_001004707	Q6IFN8|Q96R75	Silent	SNP	ENST00000545221.1	37	CCDS32688.1																																																																																			.		0.468	OR4D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443366.1		
ZNF534	147658	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	52941195	52941195	+	Missense_Mutation	SNP	A	A	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr19:52941195A>T	ENST00000332323.6	+	4	582	c.521A>T	c.(520-522)aAt>aTt	p.N174I	ZNF534_ENST00000432303.2_Intron|ZNF534_ENST00000301085.4_Intron|ZNF534_ENST00000433050.1_Missense_Mutation_p.N161I	NM_001143939.1	NP_001137411.1	Q76KX8	ZN534_HUMAN	zinc finger protein 534	174					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	4						CATATTTTTAATAACTACAGA	0.318																																					p.N174I		.											.	.	.	0			c.A521T						.						75.0	69.0	71.0					19																	52941195		1568	3582	5150	SO:0001583	missense	147658	exon4			TTTTTAATAACTA	AK058073	CCDS46165.1, CCDS46166.1	19q13.41	2013-01-08	2004-02-06	2004-02-11	ENSG00000198633	ENSG00000198633		"""Zinc fingers, C2H2-type"", ""-"""	26337	protein-coding gene	gene with protein product			"""KRAB domain only 3"""	KRBO3			Standard	NM_001143938		Approved	FLJ25344	uc002pzk.3	Q76KX8	OTTHUMG00000156493	ENST00000332323.6:c.521A>T	19.37:g.52941195A>T	ENSP00000327538:p.Asn174Ile	Somatic	29	0		WXS	Illumina HiSeq	.	28	6	NM_001143939	Q76KX9	Missense_Mutation	SNP	ENST00000332323.6	37	CCDS46165.1	.	.	.	.	.	.	.	.	.	.	A	13.41	2.228027	0.39399	.	.	ENSG00000198633	ENST00000332323;ENST00000433050;ENST00000391790	T;T	0.08193	3.12;3.19	1.61	1.61	0.23674	.	.	.	.	.	T	0.22437	0.0541	M	0.84511	2.7	0.47476	D	0.999438	P;D	0.63880	0.921;0.993	P;P	0.59288	0.498;0.855	T	0.01578	-1.1320	9	0.56958	D	0.05	.	6.5079	0.22206	1.0:0.0:0.0:0.0	.	161;174	Q76KX8-2;Q76KX8	.;ZN534_HUMAN	I	174;161;173	ENSP00000327538:N174I;ENSP00000391358:N161I	ENSP00000327538:N174I	N	+	2	0	ZNF534	57633007	0.015000	0.18098	0.010000	0.14722	0.048000	0.14542	1.654000	0.37334	0.712000	0.32039	0.164000	0.16699	AAT	.		0.318	ZNF534-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460877.1	NM_182512	
ZNF543	125919	hgsc.bcm.edu	37	19	57840047	57840047	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr19:57840047G>A	ENST00000321545.4	+	4	1562	c.1217G>A	c.(1216-1218)cGt>cAt	p.R406H		NM_213598.3	NP_998763.2	Q08ER8	ZN543_HUMAN	zinc finger protein 543	406					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R406H(1)		breast(1)|kidney(2)|large_intestine(8)|lung(11)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	28		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		GCGTTCAACCGTAGGTCACAC	0.498																																					p.R406H		.											ZNF543,colon,carcinoma,0,1	ZNF543	0	1	Substitution - Missense(1)	large_intestine(1)	c.G1217A						.						104.0	78.0	87.0					19																	57840047		2203	4300	6503	SO:0001583	missense	125919	exon4			TCAACCGTAGGTC	AL834534	CCDS33130.1	19q13.43	2013-01-08				ENSG00000178229		"""Zinc fingers, C2H2-type"", ""-"""	25281	protein-coding gene	gene with protein product							Standard	NM_213598		Approved	DKFZp434H055	uc002qoi.2	Q08ER8		ENST00000321545.4:c.1217G>A	19.37:g.57840047G>A	ENSP00000322545:p.Arg406His	Somatic	35	0		WXS	Illumina HiSeq	.	46	2	NM_213598	Q495U9|Q495V0|Q6ZMP4|Q8NCX4	Missense_Mutation	SNP	ENST00000321545.4	37	CCDS33130.1	.	.	.	.	.	.	.	.	.	.	G	0.902	-0.722049	0.03182	.	.	ENSG00000178229	ENST00000321545	T	0.07327	3.2	2.89	-1.9	0.07665	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04363	0.0120	N	0.25485	0.75	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.46512	-0.9186	9	0.02654	T	1	.	7.6687	0.28447	0.715:0.0:0.285:0.0	.	406	Q08ER8	ZN543_HUMAN	H	406	ENSP00000322545:R406H	ENSP00000322545:R406H	R	+	2	0	ZNF543	62531859	0.000000	0.05858	0.004000	0.12327	0.559000	0.35586	-1.887000	0.01617	-0.191000	0.10448	-0.291000	0.09656	CGT	.		0.498	ZNF543-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465780.1	XM_064865	
THAP4	51078	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	242572711	242572711	+	Silent	SNP	T	T	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr2:242572711T>A	ENST00000407315.1	-	2	1292	c.861A>T	c.(859-861)tcA>tcT	p.S287S		NM_015963.5	NP_057047.4	Q8WY91	THAP4_HUMAN	THAP domain containing 4	287							DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	9		all_cancers(19;2.09e-34)|all_epithelial(40;2.09e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Ovarian(221;0.069)|Lung NSC(271;0.0886)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.2)		Epithelial(32;2.3e-33)|all cancers(36;8.99e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.68e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0844)		CGGTAAGTGATGAGCTGGGAG	0.642																																					p.S287S		.											.	.	.	0			c.A861T						.						78.0	84.0	82.0					2																	242572711		2203	4296	6499	SO:0001819	synonymous_variant	51078	exon2			AAGTGATGAGCTG	AF258556	CCDS2551.1, CCDS54440.1	2q37.3	2013-01-25			ENSG00000176946	ENSG00000176946		"""THAP (C2CH-type zinc finger) domain containing"""	23187	protein-coding gene	gene with protein product		612533				12575992, 10810093	Standard	NM_015963		Approved	CGI-36	uc002wbt.3	Q8WY91	OTTHUMG00000133410	ENST00000407315.1:c.861A>T	2.37:g.242572711T>A		Somatic	7	0		WXS	Illumina HiSeq	.	19	5	NM_015963	Q53NU7|Q6GRN0|Q6IPJ3|Q9NW26|Q9Y325	Silent	SNP	ENST00000407315.1	37	CCDS2551.1																																																																																			.		0.642	THAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257267.3	NM_015963	
BCAN	63827	hgsc.bcm.edu	37	1	156616887	156616887	+	Missense_Mutation	SNP	C	C	G			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr1:156616887C>G	ENST00000329117.5	+	3	722	c.386C>G	c.(385-387)cCc>cGc	p.P129R	RP11-284F21.7_ENST00000448869.1_RNA|RP11-284F21.10_ENST00000605886.1_RNA|BCAN_ENST00000361588.5_Missense_Mutation_p.P129R	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican	129	Ig-like V-type.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GAGCTGCGCCCCAACGACTCA	0.642																																					p.P129R		.											BCAN,NS,carcinoma,0,1	BCAN	0	0			c.C386G						.						46.0	33.0	38.0					1																	156616887		2203	4300	6503	SO:0001583	missense	63827	exon3			TGCGCCCCAACGA	BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	ENST00000329117.5:c.386C>G	1.37:g.156616887C>G	ENSP00000331210:p.Pro129Arg	Somatic	19	0		WXS	Illumina HiSeq	.	37	2	NM_198427	D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	Missense_Mutation	SNP	ENST00000329117.5	37	CCDS1149.1	.	.	.	.	.	.	.	.	.	.	C	15.57	2.872647	0.51695	.	.	ENSG00000132692	ENST00000441358;ENST00000255029;ENST00000329117;ENST00000457777;ENST00000361588	T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16	4.61	4.61	0.57282	Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin V-set, subgroup (1);Immunoglobulin-like fold (1);	0.092642	0.43579	D	0.000554	T	0.31199	0.0789	N	0.08118	0	0.34112	D	0.663154	B;B	0.20368	0.044;0.028	B;B	0.27076	0.076;0.039	T	0.34378	-0.9831	10	0.56958	D	0.05	-8.3629	16.1664	0.81759	0.0:1.0:0.0:0.0	.	129;129	Q96GW7;Q96GW7-2	PGCB_HUMAN;.	R	129	ENSP00000392731:P129R;ENSP00000331210:P129R;ENSP00000389898:P129R;ENSP00000354925:P129R	ENSP00000255029:P129R	P	+	2	0	BCAN	154883511	0.846000	0.29590	1.000000	0.80357	0.948000	0.59901	1.955000	0.40372	2.379000	0.81126	0.455000	0.32223	CCC	.		0.642	BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081844.2	NM_021948	
EML5	161436	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	89124692	89124692	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr14:89124692G>A	ENST00000380664.5	-	26	3715	c.3716C>T	c.(3715-3717)aCa>aTa	p.T1239I	EML5_ENST00000352093.5_Missense_Mutation_p.T1201I|EML5_ENST00000554922.1_Missense_Mutation_p.T1239I			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	1239						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)			breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						TGTGACATGTGTACTATGGGC	0.373																																					p.T1239I		.											.	.	.	0			c.C3716T						.						138.0	124.0	128.0					14																	89124692		1871	4109	5980	SO:0001583	missense	161436	exon26			ACATGTGTACTAT	AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.3716C>T	14.37:g.89124692G>A	ENSP00000370039:p.Thr1239Ile	Somatic	60	0		WXS	Illumina HiSeq	.	71	14	NM_183387	B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Missense_Mutation	SNP	ENST00000380664.5	37	CCDS45148.1	.	.	.	.	.	.	.	.	.	.	G	17.31	3.357935	0.61403	.	.	ENSG00000165521	ENST00000554922;ENST00000352093;ENST00000380664	T;T;T	0.39406	1.08;1.58;1.08	4.61	4.61	0.57282	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.39911	0.1096	L	0.29908	0.895	0.42876	D	0.994153	B;P	0.36465	0.115;0.554	B;B	0.41088	0.326;0.347	T	0.45760	-0.9239	10	0.72032	D	0.01	-16.5219	17.9931	0.89175	0.0:0.0:1.0:0.0	.	1239;1239	Q05BV3-5;Q05BV3	.;EMAL5_HUMAN	I	1239;1201;1239	ENSP00000451998:T1239I;ENSP00000298315:T1201I;ENSP00000370039:T1239I	ENSP00000298315:T1201I	T	-	2	0	EML5	88194445	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.527000	0.81931	2.550000	0.86006	0.557000	0.71058	ACA	.		0.373	EML5-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410491.1		
FAM208A	23272	hgsc.bcm.edu	37	3	56667432	56667432	+	Silent	SNP	G	G	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr3:56667432G>A	ENST00000493960.2	-	18	3397	c.3387C>T	c.(3385-3387)aaC>aaT	p.N1129N	FAM208A_ENST00000431842.2_Silent_p.N692N|FAM208A_ENST00000355628.5_Silent_p.N1068N	NM_001112736.1	NP_001106207.1	Q9UK61	F208A_HUMAN	family with sequence similarity 208, member A	1129				N -> S (in Ref. 1; AAD55098). {ECO:0000305}.			poly(A) RNA binding (GO:0044822)	p.N1068K(1)|p.S692R(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(11)|prostate(3)|skin(1)	32						GATGTTTATTGTTGAAGTCAC	0.438																																					p.N1129N		.											FAM208A,NS,carcinoma,0,2	FAM208A	0	2	Substitution - Missense(2)	kidney(2)	c.C3387T						.						139.0	134.0	136.0					3																	56667432		2203	4300	6503	SO:0001819	synonymous_variant	23272	exon18			TTTATTGTTGAAG	AF180425	CCDS2877.1, CCDS46853.1	3p14.3	2011-09-14	2011-09-14	2011-09-14	ENSG00000163946	ENSG00000163946			30314	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 63"""	C3orf63		10470851, 11149944	Standard	NM_015224		Approved	se89-1, RAP140, KIAA1105	uc003die.4	Q9UK61	OTTHUMG00000158827	ENST00000493960.2:c.3387C>T	3.37:g.56667432G>A		Somatic	21	0		WXS	Illumina HiSeq	.	23	2	NM_001112736	A1L3A4|B5ME28|Q9H2F7|Q9UPP7	Silent	SNP	ENST00000493960.2	37	CCDS46853.1																																																																																			.		0.438	FAM208A-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352352.2	NM_015224	
MYH2	4620	hgsc.bcm.edu	37	17	10426863	10426863	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr17:10426863G>T	ENST00000245503.5	-	37	5806	c.5422C>A	c.(5422-5424)Cag>Aag	p.Q1808K	MYH2_ENST00000397183.2_Missense_Mutation_p.Q1808K|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|MYH2_ENST00000532183.2_Intron	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1808					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						AGGGCCAGCTGCTCAGCCTCA	0.557																																					p.Q1808K		.											.	.	.	0			c.C5422A						.						100.0	103.0	102.0					17																	10426863		2203	4300	6503	SO:0001583	missense	4620	exon37			CCAGCTGCTCAGC		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.5422C>A	17.37:g.10426863G>T	ENSP00000245503:p.Gln1808Lys	Somatic	50	0		WXS	Illumina HiSeq	.	46	4	NM_017534	A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	ENST00000245503.5	37	CCDS11156.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.351450	0.82132	.	.	ENSG00000125414	ENST00000245503;ENST00000397183	T;T	0.79454	-1.27;-1.27	5.5	5.5	0.81552	Myosin tail (1);	0.000000	0.37483	U	0.002063	D	0.92381	0.7582	H	0.96430	3.82	0.46901	D	0.999244	D	0.71674	0.998	D	0.87578	0.998	D	0.93965	0.7244	10	0.72032	D	0.01	.	19.5916	0.95514	0.0:0.0:1.0:0.0	.	1808	Q9UKX2	MYH2_HUMAN	K	1808	ENSP00000245503:Q1808K;ENSP00000380367:Q1808K	ENSP00000245503:Q1808K	Q	-	1	0	MYH2	10367588	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	6.252000	0.72447	2.861000	0.98227	0.655000	0.94253	CAG	.		0.557	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534	
RMDN3	55177	hgsc.bcm.edu	37	15	41030190	41030190	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr15:41030190G>T	ENST00000260385.6	-	8	2165	c.1098C>A	c.(1096-1098)caC>caA	p.H366Q	RMDN3_ENST00000558560.1_5'UTR|RMDN3_ENST00000338376.3_Missense_Mutation_p.H366Q			Q96TC7	RMD3_HUMAN	regulator of microtubule dynamics 3	366					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|cellular calcium ion homeostasis (GO:0006874)	integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.H366Q(1)									CAAGAAGAAAGTGAGCCATGG	0.458																																					p.H366Q		.											FAM82A2,NS,carcinoma,0,1	FAM82A2	0	1	Substitution - Missense(1)	endometrium(1)	c.C1098A						.						186.0	186.0	186.0					15																	41030190		2203	4300	6503	SO:0001583	missense	55177	exon9			AAGAAAGTGAGCC	AK001441	CCDS10063.1	15q15.1	2013-01-11	2013-01-11	2013-01-11	ENSG00000137824	ENSG00000137824			25550	protein-coding gene	gene with protein product		611873	"""family with sequence similarity 82, member A2"""	FAM82C, FAM82A2		12975309	Standard	XM_005254531		Approved	FLJ10579, PTPIP51, RMD3	uc001zmp.1	Q96TC7	OTTHUMG00000130066	ENST00000260385.6:c.1098C>A	15.37:g.41030190G>T	ENSP00000260385:p.His366Gln	Somatic	36	0		WXS	Illumina HiSeq	.	34	3	NM_018145	A9UMZ9|B3KRR3|Q6ZWE9|Q96H23|Q96SD6|Q9H6G1|Q9NVQ6	Missense_Mutation	SNP	ENST00000260385.6	37	CCDS10063.1	.	.	.	.	.	.	.	.	.	.	G	16.53	3.150025	0.57151	.	.	ENSG00000137824	ENST00000260385;ENST00000338376;ENST00000426872	T;T	0.30448	1.53;1.53	5.37	3.51	0.40186	Tetratricopeptide-like helical (1);	0.217443	0.48767	D	0.000162	T	0.46600	0.1401	M	0.76574	2.34	0.34748	D	0.731469	D	0.60160	0.987	P	0.59761	0.863	T	0.59198	-0.7499	10	0.54805	T	0.06	-9.4798	7.7554	0.28921	0.2581:0.0:0.7419:0.0	.	366	Q96TC7	RMD3_HUMAN	Q	366;366;303	ENSP00000260385:H366Q;ENSP00000342493:H366Q	ENSP00000260385:H366Q	H	-	3	2	FAM82A2	38817482	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	2.097000	0.41748	0.666000	0.31087	-0.812000	0.03155	CAC	.		0.458	RMDN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252357.1	NM_018145	
WDR92	116143	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	68371715	68371715	+	Splice_Site	SNP	A	A	C			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr2:68371715A>C	ENST00000295121.6	-	3	532		c.e3+1		WDR92_ENST00000409164.1_Splice_Site|WDR92_ENST00000406245.2_Splice_Site|RP11-474G23.1_ENST00000406334.3_Splice_Site|WDR92_ENST00000492039.2_Splice_Site	NM_138458.3	NP_612467.1	Q96MX6	WDR92_HUMAN	WD repeat domain 92						apoptotic process (GO:0006915)|histone lysine methylation (GO:0034968)		methylated histone binding (GO:0035064)			endometrium(1)|kidney(3)|large_intestine(4)|lung(3)|stomach(1)	12						ACAGGGACTCACCATCTCGGC	0.398																																					.		.											.	.	.	0			c.415+2T>G						.						109.0	110.0	110.0					2																	68371715		2203	4300	6503	SO:0001630	splice_region_variant	116143	exon4			GGACTCACCATCT	AK056303	CCDS1884.1, CCDS58712.1	2p14	2013-01-09			ENSG00000243667	ENSG00000243667		"""WD repeat domain containing"""	25176	protein-coding gene	gene with protein product		610729				16487927	Standard	NM_138458		Approved	FLJ31741, Monad	uc002see.2	Q96MX6	OTTHUMG00000152561	ENST00000295121.6:c.415+1T>G	2.37:g.68371715A>C		Somatic	35	0		WXS	Illumina HiSeq	.	50	14	NM_138458	Q96CR6	Splice_Site	SNP	ENST00000295121.6	37	CCDS1884.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.057108	0.76074	.	.	ENSG00000243667	ENST00000295121;ENST00000406245;ENST00000409164	.	.	.	5.98	5.98	0.97165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4781	0.84144	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	WDR92	68225219	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	6.973000	0.76116	2.288000	0.76882	0.528000	0.53228	.	.		0.398	WDR92-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251754.2	NM_138458	Intron
HELQ	113510	hgsc.bcm.edu	37	4	84374566	84374566	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr4:84374566G>A	ENST00000295488.3	-	2	992	c.830C>T	c.(829-831)gCg>gTg	p.A277V	MRPS18C_ENST00000295491.4_5'Flank|HELQ_ENST00000510985.1_Missense_Mutation_p.A277V|MRPS18C_ENST00000507349.1_5'Flank|HELQ_ENST00000440639.2_5'Flank|MRPS18C_ENST00000507019.1_5'Flank	NM_133636.2	NP_598375	Q8TDG4	HELQ_HUMAN	helicase, POLQ-like	277					double-strand break repair via homologous recombination (GO:0000724)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(10)|lung(17)|ovary(2)|skin(2)	38						CTGGGCCTTCGCATTTCCAGT	0.368								Other identified genes with known or suspected DNA repair function																													p.A277V		.											HELQ,NS,carcinoma,0,1	HELQ	0	0			c.C830T						.						165.0	171.0	169.0					4																	84374566		2203	4300	6503	SO:0001583	missense	113510	exon2			GCCTTCGCATTTC	AF436845	CCDS3603.1, CCDS75158.1	4q21.23	2009-02-26			ENSG00000163312	ENSG00000163312			18536	protein-coding gene	gene with protein product		606769				11751861	Standard	XM_005262711		Approved	Hel308	uc003hom.3	Q8TDG4	OTTHUMG00000130423	ENST00000295488.3:c.830C>T	4.37:g.84374566G>A	ENSP00000295488:p.Ala277Val	Somatic	71	0		WXS	Illumina HiSeq	.	72	3	NM_133636	Q05DF9|Q502W9|Q659B8|Q6ZQX4|Q6ZTS4|Q96EX7	Missense_Mutation	SNP	ENST00000295488.3	37	CCDS3603.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.753721	0.89753	.	.	ENSG00000163312	ENST00000295488;ENST00000510985	T;T	0.60672	0.17;1.34	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	T	0.75361	0.3839	M	0.67953	2.075	0.31001	N	0.720335	D;D;D;D	0.89917	1.0;0.997;1.0;0.983	D;P;D;P	0.97110	0.996;0.723;1.0;0.521	T	0.71434	-0.4594	10	0.29301	T	0.29	-24.8151	20.2566	0.98424	0.0:0.0:1.0:0.0	.	277;277;240;277	E3W980;E3W982;Q8TDG4-2;Q8TDG4	.;.;.;HELQ_HUMAN	V	277	ENSP00000295488:A277V;ENSP00000424539:A277V	ENSP00000295488:A277V	A	-	2	0	HELQ	84593590	1.000000	0.71417	1.000000	0.80357	0.726000	0.41606	9.058000	0.93896	2.793000	0.96121	0.561000	0.74099	GCG	.		0.368	HELQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252810.1	NM_133636	
OTOF	9381	hgsc.bcm.edu;ucsc.edu	37	2	26712145	26712145	+	Missense_Mutation	SNP	G	G	T	rs146051471		TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr2:26712145G>T	ENST00000272371.2	-	11	1105	c.979C>A	c.(979-981)Ctg>Atg	p.L327M	OTOF_ENST00000403946.3_Missense_Mutation_p.L327M	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	327	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGCGCAGCAGGTTCTTGGAG	0.612																																					p.L327M	GBM(102;732 1451 20652 24062 31372)	.											.	.	.	0			c.C979A						.						58.0	48.0	51.0					2																	26712145		2203	4300	6503	SO:0001583	missense	9381	exon11			GCAGCAGGTTCTT	AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.979C>A	2.37:g.26712145G>T	ENSP00000272371:p.Leu327Met	Somatic	14	0		WXS	Illumina HiSeq	.	16	4	NM_194248	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	ENST00000272371.2	37	CCDS1725.1	.	.	.	.	.	.	.	.	.	.	G	19.39	3.817514	0.70912	.	.	ENSG00000115155	ENST00000272371;ENST00000403946	T;T	0.73047	-0.71;-0.71	5.37	5.37	0.77165	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.127524	0.53938	D	0.000045	T	0.77751	0.4177	L	0.48877	1.53	0.47065	D	0.999305	P	0.42483	0.781	P	0.54965	0.765	T	0.77256	-0.2655	10	0.49607	T	0.09	-6.8896	17.7299	0.88374	0.0:0.0:1.0:0.0	.	327	Q9HC10	OTOF_HUMAN	M	327	ENSP00000272371:L327M;ENSP00000385255:L327M	ENSP00000272371:L327M	L	-	1	2	OTOF	26565649	1.000000	0.71417	1.000000	0.80357	0.681000	0.39784	5.701000	0.68325	2.555000	0.86185	0.456000	0.33151	CTG	.		0.612	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3		
CAMLG	819	hgsc.bcm.edu	37	5	134074424	134074424	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr5:134074424G>T	ENST00000297156.2	+	1	234	c.114G>T	c.(112-114)atG>atT	p.M38I	CAMLG_ENST00000514518.1_Missense_Mutation_p.M38I	NM_001745.3	NP_001736.1	P49069	CAMLG_HUMAN	calcium modulating ligand	38					defense response (GO:0006952)|epidermal growth factor receptor signaling pathway (GO:0007173)|receptor recycling (GO:0001881)|signal transduction (GO:0007165)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|cervix(1)|kidney(3)|lung(3)|prostate(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Cyclosporine(DB00091)	AGCTGCTCATGAACTCGGAAC	0.672																																					p.M38I		.											CAMLG,colon,carcinoma,0,1	CAMLG	0	0			c.G114T						.						39.0	41.0	40.0					5																	134074424		2203	4300	6503	SO:0001583	missense	819	exon1			GCTCATGAACTCG	AF068179.1	CCDS4178.1	5q23	2008-07-18			ENSG00000164615	ENSG00000164615			1471	protein-coding gene	gene with protein product	"""calcium-modulating cyclophilin ligand"", ""calcium-signal modulating cyclophilin ligand"", ""cyclophilin B-binding protein"""	601118				8824814	Standard	NM_001745		Approved	CAML	uc003kzt.3	P49069	OTTHUMG00000129116	ENST00000297156.2:c.114G>T	5.37:g.134074424G>T	ENSP00000297156:p.Met38Ile	Somatic	29	0		WXS	Illumina HiSeq	.	49	2	NM_001745	A1L3Y3	Missense_Mutation	SNP	ENST00000297156.2	37	CCDS4178.1	.	.	.	.	.	.	.	.	.	.	G	16.02	3.004278	0.54254	.	.	ENSG00000164615	ENST00000297156;ENST00000514518	T;T	0.31510	1.49;1.49	5.93	5.93	0.95920	.	0.281606	0.49305	D	0.000155	T	0.32164	0.0820	M	0.62723	1.935	0.44677	D	0.997666	B;B	0.33171	0.328;0.4	B;B	0.28011	0.048;0.085	T	0.07195	-1.0785	10	0.51188	T	0.08	-12.9891	14.7471	0.69496	0.0:0.0:0.8553:0.1447	.	38;38	D6RIW3;P49069	.;CAMLG_HUMAN	I	38	ENSP00000297156:M38I;ENSP00000427331:M38I	ENSP00000297156:M38I	M	+	3	0	CAMLG	134102323	1.000000	0.71417	1.000000	0.80357	0.637000	0.38172	5.137000	0.64789	2.815000	0.96918	0.561000	0.74099	ATG	.		0.672	CAMLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251161.1	NM_001745	
CSE1L	1434	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	47683047	47683047	+	Splice_Site	SNP	G	G	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr20:47683047G>A	ENST00000262982.2	+	5	599	c.476G>A	c.(475-477)aGa>aAa	p.R159K	CSE1L_ENST00000542325.1_Intron|CSE1L_ENST00000396192.3_Splice_Site_p.R159K	NM_001256135.1|NM_001316.3	NP_001243064.1|NP_001307.2	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like (yeast)	159					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	importin-alpha export receptor activity (GO:0008262)			breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	35			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			TTATTTAAAAGGTATTGATGC	0.338																																					p.R159K		.											.	.	.	0			c.G476A						.						70.0	67.0	68.0					20																	47683047		2203	4300	6503	SO:0001630	splice_region_variant	1434	exon5			TTAAAAGGTATTG	U33286	CCDS13412.1, CCDS58773.1	20q13	2013-05-01	2001-11-28		ENSG00000124207	ENSG00000124207		"""Exportins"""	2431	protein-coding gene	gene with protein product	"""cellular apoptosis susceptibility"""	601342	"""chromosome segregation 1 (yeast homolog)-like"""			8963895, 7479798	Standard	NM_001316		Approved	CAS, XPO2, CSE1	uc002xty.4	P55060	OTTHUMG00000033046	ENST00000262982.2:c.476+1G>A	20.37:g.47683047G>A		Somatic	32	0		WXS	Illumina HiSeq	.	49	20	NM_001256135	A3RLL6|B2R5T4|E1P5Y0|F8W904|O75432|Q32M40|Q9H5B7|Q9NTS0|Q9UP98|Q9UP99|Q9UPA0	Missense_Mutation	SNP	ENST00000262982.2	37	CCDS13412.1	.	.	.	.	.	.	.	.	.	.	G	18.19	3.569886	0.65765	.	.	ENSG00000124207	ENST00000262982;ENST00000396192	T;T	0.66099	-0.19;-0.19	5.03	5.03	0.67393	Armadillo-like helical (1);Armadillo-type fold (1);Exportin/Importin, Cse1-like (1);	0.000000	0.85682	D	0.000000	T	0.51941	0.1704	L	0.33792	1.035	0.80722	D	1	B;P	0.40476	0.296;0.718	B;B	0.39771	0.101;0.309	T	0.48906	-0.8993	10	0.09338	T	0.73	-15.2296	18.7192	0.91687	0.0:0.0:1.0:0.0	.	159;159	F8W904;P55060	.;XPO2_HUMAN	K	159	ENSP00000262982:R159K;ENSP00000379495:R159K	ENSP00000262982:R159K	R	+	2	0	CSE1L	47116454	1.000000	0.71417	1.000000	0.80357	0.682000	0.39822	9.768000	0.98965	2.481000	0.83766	0.455000	0.32223	AGA	.		0.338	CSE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080345.2	NM_001316	Missense_Mutation
MIR4255	100422898	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	37627229	37627229	+	RNA	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr1:37627229G>T	ENST00000579351.1	+	0	66					NR_036217.1				microRNA 4255																		CAAAGAGGCAGCATCATGCTG	0.458																																					.		.											.	.	.	0			.						.																																					100422898	.			GAGGCAGCATCAT			1	2011-09-12				ENSG00000264698		"""ncRNAs / Micro RNAs"""	38187	non-coding RNA	RNA, micro							Standard	NR_036217		Approved	hsa-mir-4255	uc021oll.1				1.37:g.37627229G>T		Somatic	34	0		WXS	Illumina HiSeq	.	39	4	.		RNA	SNP	ENST00000579351.1	37																																																																																				.		0.458	MIR4255-201	KNOWN	basic	miRNA	miRNA		NR_036217	
DDR2	4921	hgsc.bcm.edu	37	1	162737043	162737043	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr1:162737043G>A	ENST00000367922.3	+	12	1625	c.1187G>A	c.(1186-1188)aGc>aAc	p.S396N	DDR2_ENST00000367921.3_Missense_Mutation_p.S396N	NM_001014796.1	NP_001014796.1	Q16832	DDR2_HUMAN	discoidin domain receptor tyrosine kinase 2	396					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|chondrocyte proliferation (GO:0035988)|collagen fibril organization (GO:0030199)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|endochondral bone growth (GO:0003416)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autophosphorylation (GO:0046777)|regulation of bone mineralization (GO:0030500)|regulation of extracellular matrix disassembly (GO:0010715)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(2)|kidney(1)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)		Regorafenib(DB08896)	GTTGATGACAGCAACACTCGG	0.468																																					p.S396N	NSCLC(161;314 2006 8283 19651 23192)	.											DDR2_ENST00000367922,NS,carcinoma,0,2	DDR2_ENST00000367922	0	0			c.G1187A						.						257.0	233.0	241.0					1																	162737043		2203	4300	6503	SO:0001583	missense	4921	exon12			ATGACAGCAACAC	AK095975	CCDS1241.1	1q12-q23	2009-07-10	2008-01-23		ENSG00000162733	ENSG00000162733	2.7.10.1		2731	protein-coding gene	gene with protein product		191311	"""discoidin domain receptor family, member 2"""	TYRO10, NTRKR3		9659899	Standard	XM_005245221		Approved	TKT	uc001gcg.3	Q16832	OTTHUMG00000034423	ENST00000367922.3:c.1187G>A	1.37:g.162737043G>A	ENSP00000356899:p.Ser396Asn	Somatic	23	0		WXS	Illumina HiSeq	.	43	2	NM_001014796	Q7Z730	Missense_Mutation	SNP	ENST00000367922.3	37	CCDS1241.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.718081	0.89205	.	.	ENSG00000162733	ENST00000367922;ENST00000367921;ENST00000458105	D;D;T	0.84800	-1.9;-1.9;0.78	5.26	5.26	0.73747	.	0.074661	0.85682	D	0.000000	T	0.76962	0.4061	L	0.52126	1.63	0.35513	D	0.800835	B	0.12013	0.005	B	0.12156	0.007	T	0.74902	-0.3506	9	0.56958	D	0.05	.	17.6163	0.88068	0.0:0.0:1.0:0.0	.	396	Q16832	DDR2_HUMAN	N	396;396;6	ENSP00000356899:S396N;ENSP00000356898:S396N;ENSP00000417030:S6N	ENSP00000356898:S396N	S	+	2	0	DDR2	161003667	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.083000	0.94067	2.733000	0.93635	0.655000	0.94253	AGC	.		0.468	DDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083213.2	NM_006182	
DHX9	1660	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	182846025	182846025	+	Missense_Mutation	SNP	A	A	G			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr1:182846025A>G	ENST00000367549.3	+	19	2295	c.2185A>G	c.(2185-2187)Att>Gtt	p.I729V		NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	729	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						TGTTTATGTCATTGACTCCTG	0.333																																					p.I729V	Colon(69;210 1162 3697 13559 39565)	.											.	.	.	0			c.A2185G						.						70.0	63.0	65.0					1																	182846025		1839	4103	5942	SO:0001583	missense	1660	exon19			TATGTCATTGACT	L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.2185A>G	1.37:g.182846025A>G	ENSP00000356520:p.Ile729Val	Somatic	31	0		WXS	Illumina HiSeq	.	89	36	NM_001357	B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Missense_Mutation	SNP	ENST00000367549.3	37	CCDS41444.1	.	.	.	.	.	.	.	.	.	.	A	15.06	2.720701	0.48728	.	.	ENSG00000135829	ENST00000367549	T	0.80653	-1.4	5.91	3.45	0.39498	Helicase, C-terminal (3);	0.106722	0.64402	D	0.000012	T	0.75664	0.3880	L	0.45228	1.405	0.45930	D	0.998766	B	0.21753	0.06	B	0.36766	0.232	T	0.73020	-0.4114	10	0.44086	T	0.13	.	8.7036	0.34340	0.7932:0.132:0.0748:0.0	.	729	Q08211	DHX9_HUMAN	V	729	ENSP00000356520:I729V	ENSP00000356520:I729V	I	+	1	0	DHX9	181112648	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.645000	0.54389	2.263000	0.75096	0.528000	0.53228	ATT	.		0.333	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085522.2	NM_030588	
CELF4	56853	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	34853025	34853025	+	Silent	SNP	G	G	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr18:34853025G>A	ENST00000591282.1	-	7	902	c.903C>T	c.(901-903)gcC>gcT	p.A301A	CELF4_ENST00000412753.1_Silent_p.A300A|CELF4_ENST00000591287.1_Silent_p.A300A|CELF4_ENST00000361795.5_Silent_p.A299A|CELF4_ENST00000420428.2_Silent_p.A301A|RP11-797E24.3_ENST00000588766.1_RNA|CELF4_ENST00000334919.5_Silent_p.A291A|CELF4_ENST00000603232.1_Silent_p.A300A|CELF4_ENST00000588597.1_Silent_p.A290A|CELF4_ENST00000601019.1_Silent_p.A299A|RP11-797E24.3_ENST00000586610.1_RNA			Q9BZC1	CELF4_HUMAN	CUGBP, Elav-like family member 4	301	Ala-rich.				alternative mRNA splicing, via spliceosome (GO:0000380)|embryo development (GO:0009790)|germ cell development (GO:0007281)|mRNA splice site selection (GO:0006376)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of translation (GO:0017148)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	BRE binding (GO:0042835)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	44						TCATGTTGAGGGCCGCCATCT	0.667																																					p.A301A		.											.	.	.	0			c.C903T						.						30.0	33.0	32.0					18																	34853025		2203	4298	6501	SO:0001819	synonymous_variant	56853	exon7			GTTGAGGGCCGCC	AF248651	CCDS32818.1, CCDS45857.1, CCDS45858.1	18q12	2013-02-12	2010-02-19	2010-02-19				"""RNA binding motif (RRM) containing"""	14015	protein-coding gene	gene with protein product		612679	"""Bruno (Drosophila) -like 4, RNA binding protein"", ""bruno-like 4, RNA binding protein (Drosophila)"""	BRUNOL4		10893231	Standard	NM_020180		Approved		uc002lae.2	Q9BZC1		ENST00000591282.1:c.903C>T	18.37:g.34853025G>A		Somatic	45	0		WXS	Illumina HiSeq	.	45	15	NM_020180	Q59EN7|Q86XB9|Q8N2M6|Q9BQ96|Q9NR84|Q9NR85	Silent	SNP	ENST00000591282.1	37	CCDS32818.1																																																																																			.		0.667	CELF4-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000440892.1	NM_020180	
PRPF38B	55119	hgsc.bcm.edu	37	1	109238706	109238706	+	Silent	SNP	T	T	C			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr1:109238706T>C	ENST00000370025.4	+	3	656	c.387T>C	c.(385-387)ttT>ttC	p.F129F	PRPF38B_ENST00000370021.1_Silent_p.F18F|PRPF38B_ENST00000370022.5_Silent_p.F129F|PRPF38B_ENST00000467302.1_3'UTR	NM_018061.2	NP_060531.2	Q5VTL8	PR38B_HUMAN	pre-mRNA processing factor 38B	129					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			NS(1)|kidney(3)|large_intestine(5)|lung(8)|prostate(1)|skin(1)	19		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0149)|Lung(183;0.0888)|COAD - Colon adenocarcinoma(174;0.113)|Epithelial(280;0.161)		CTACAGCATTTTGCCTGTTAT	0.368																																					p.F129F		.											PRPF38B,NS,carcinoma,0,1	PRPF38B	0	0			c.T387C						.						126.0	123.0	124.0					1																	109238706		2203	4300	6503	SO:0001819	synonymous_variant	55119	exon3			AGCATTTTGCCTG	AL833950	CCDS788.1	1p13.3	2013-10-03	2013-10-03		ENSG00000134186	ENSG00000134186			25512	protein-coding gene	gene with protein product			"""PRP38 pre-mRNA processing factor 38 (yeast) domain containing B"""				Standard	NM_018061		Approved	FLJ10330, NET1	uc001dvv.4	Q5VTL8	OTTHUMG00000010991	ENST00000370025.4:c.387T>C	1.37:g.109238706T>C		Somatic	47	0		WXS	Illumina HiSeq	.	46	2	NM_018061	Q05DD6|Q32Q58|Q5VTL9|Q6PK39|Q7Z6E2|Q86WF3|Q8IWG9|Q9NW40	Silent	SNP	ENST00000370025.4	37	CCDS788.1																																																																																			.		0.368	PRPF38B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030231.1	NM_018061	
LRRC52	440699	hgsc.bcm.edu;broad.mit.edu	37	1	165513993	165513993	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr1:165513993T>C	ENST00000294818.1	+	1	750	c.460T>C	c.(460-462)Tac>Cac	p.Y154H	RP11-280O1.2_ENST00000421273.1_RNA|RP11-280O1.2_ENST00000438275.1_RNA|RP11-280O1.2_ENST00000416424.1_RNA	NM_001005214.3	NP_001005214.2	Q8N7C0	LRC52_HUMAN	leucine rich repeat containing 52	154					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)	18	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)					CTCTTTGAGGTACCTGGACCT	0.522																																					p.Y154H		.											.	.	.	0			c.T460C						.						187.0	180.0	182.0					1																	165513993		2203	4300	6503	SO:0001583	missense	440699	exon1			TTGAGGTACCTGG	AK098677	CCDS30930.1	1q23.3	2008-02-05			ENSG00000162763	ENSG00000162763			32156	protein-coding gene	gene with protein product		615218					Standard	NM_001005214		Approved	FLJ25811	uc001gde.2	Q8N7C0	OTTHUMG00000034625	ENST00000294818.1:c.460T>C	1.37:g.165513993T>C	ENSP00000294818:p.Tyr154His	Somatic	43	0		WXS	Illumina HiSeq	.	78	4	NM_001005214	A2RUN7|Q5T9K5	Missense_Mutation	SNP	ENST00000294818.1	37	CCDS30930.1	.	.	.	.	.	.	.	.	.	.	T	11.49	1.653688	0.29425	.	.	ENSG00000162763	ENST00000294818	T	0.02472	4.28	5.39	-0.641	0.11490	.	0.466234	0.24678	N	0.036492	T	0.00468	0.0015	N	0.05280	-0.08	0.31975	N	0.606582	B	0.06786	0.001	B	0.15052	0.012	T	0.43798	-0.9369	9	0.15499	T	0.54	.	9.3571	0.38173	0.0:0.5141:0.0:0.4859	.	154	Q8N7C0	LRC52_HUMAN	H	154	ENSP00000294818:Y154H	ENSP00000294818:Y154H	Y	+	1	0	LRRC52	163780617	1.000000	0.71417	0.153000	0.22517	0.985000	0.73830	0.525000	0.22956	0.065000	0.16485	0.460000	0.39030	TAC	.		0.522	LRRC52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083793.1	NM_001005214	
NT5DC3	51559	hgsc.bcm.edu	37	12	104171793	104171793	+	Silent	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr12:104171793G>T	ENST00000392876.3	-	14	1501	c.1461C>A	c.(1459-1461)acC>acA	p.T487T		NM_001031701.2	NP_001026871.1	Q86UY8	NT5D3_HUMAN	5'-nucleotidase domain containing 3	487						cytosol (GO:0005829)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(15)|ovary(2)|skin(1)|stomach(2)	30						TTAGGAAGTAGGTTGGGTTCT	0.512																																					p.T487T		.											.	.	.	0			c.C1461A						.						84.0	84.0	84.0					12																	104171793		2203	4300	6503	SO:0001819	synonymous_variant	51559	exon14			GAAGTAGGTTGGG	AB032786	CCDS41824.1	12q22-q23.1	2006-02-03			ENSG00000111696	ENSG00000111696			30826	protein-coding gene	gene with protein product		611076					Standard	NM_001031701		Approved	TU12B1-TY, FLJ11266	uc010swe.1	Q86UY8	OTTHUMG00000157017	ENST00000392876.3:c.1461C>A	12.37:g.104171793G>T		Somatic	47	0		WXS	Illumina HiSeq	.	56	4	NM_001031701	Q9NUM7|Q9P2T2|Q9P2T3	Silent	SNP	ENST00000392876.3	37	CCDS41824.1																																																																																			.		0.512	NT5DC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347118.2	NM_016575	
EPN2	22905	hgsc.bcm.edu	37	17	19232056	19232056	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr17:19232056G>T	ENST00000314728.5	+	8	1664	c.1180G>T	c.(1180-1182)Ggg>Tgg	p.G394W	EPN2_ENST00000395618.3_Missense_Mutation_p.G109W|EPN2_ENST00000575595.1_Missense_Mutation_p.G102W|EPN2_ENST00000395620.2_Missense_Mutation_p.G337W|EPN2_ENST00000571254.1_Missense_Mutation_p.G330W|EPN2_ENST00000395626.1_Missense_Mutation_p.G394W|EPN2_ENST00000347697.2_Missense_Mutation_p.G337W	NM_014964.4	NP_055779.2	O95208	EPN2_HUMAN	epsin 2	394	6 X 3 AA repeats of [DE]-P-W.				embryonic organ development (GO:0048568)|endocytosis (GO:0006897)|in utero embryonic development (GO:0001701)|Notch signaling pathway (GO:0007219)	clathrin coat of endocytic vesicle (GO:0030128)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	lipid binding (GO:0008289)	p.G394W(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	19	all_cancers(12;3.11e-05)|all_epithelial(12;0.00121)|Hepatocellular(7;0.00345)|Breast(13;0.143)					TGACCCATGGGGGGTGCCCAC	0.607																																					p.G394W		.											EPN2,NS,carcinoma,0,1	EPN2	0	1	Substitution - Missense(1)	lung(1)	c.G1180T						.						57.0	53.0	54.0					17																	19232056		2203	4300	6503	SO:0001583	missense	22905	exon8			CCATGGGGGGTGC	AB028988	CCDS11203.1, CCDS11204.1, CCDS42277.1	17p11.2	2012-11-19			ENSG00000072134	ENSG00000072134			18639	protein-coding gene	gene with protein product	"""Eps15 binding protein"""	607263				10567358	Standard	NM_014964		Approved	KIAA1065, EHB21	uc002gvd.4	O95208	OTTHUMG00000178447	ENST00000314728.5:c.1180G>T	17.37:g.19232056G>T	ENSP00000320543:p.Gly394Trp	Somatic	41	0		WXS	Illumina HiSeq	.	67	3	NM_014964	A8MTV8|B3KRX8|E9PBC2|O95207|Q52LD0|Q9H7Z2|Q9UPT7	Missense_Mutation	SNP	ENST00000314728.5	37	CCDS11203.1	.	.	.	.	.	.	.	.	.	.	G	16.43	3.121657	0.56613	.	.	ENSG00000072134	ENST00000347697;ENST00000395618;ENST00000314728;ENST00000395628;ENST00000395620;ENST00000395626	T;T;T;T;T;T	0.37915	2.15;1.96;2.16;1.19;2.15;1.17	5.14	4.16	0.48862	.	0.521279	0.14840	U	0.295329	T	0.62514	0.2434	M	0.80746	2.51	0.58432	D	0.999999	D;D;D;D;D;D;D	0.89917	0.996;0.986;1.0;1.0;1.0;0.996;0.999	P;P;D;D;D;P;D	0.83275	0.855;0.695;0.996;0.996;0.992;0.855;0.989	T	0.66097	-0.6008	10	0.87932	D	0	-8.9187	14.5474	0.68041	0.0749:0.0:0.9251:0.0	.	337;330;102;109;394;337;394	Q52LD0;B7ZKM5;B7Z3A5;A8MTV8;E9PBC1;E9PBC2;O95208	.;.;.;.;.;.;EPN2_HUMAN	W	337;109;394;337;337;394	ENSP00000261495:G337W;ENSP00000378980:G109W;ENSP00000320543:G394W;ENSP00000378990:G337W;ENSP00000378982:G337W;ENSP00000378988:G394W	ENSP00000320543:G394W	G	+	1	0	EPN2	19172649	1.000000	0.71417	0.978000	0.43139	0.088000	0.18126	6.546000	0.73887	2.546000	0.85860	0.561000	0.74099	GGG	.		0.607	EPN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132283.3	NM_014964	
FERD3L	222894	hgsc.bcm.edu	37	7	19184746	19184746	+	Silent	SNP	C	C	T	rs34966908|rs199985178|rs71017023	byFrequency	TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr7:19184746C>T	ENST00000275461.3	-	1	298	c.240G>A	c.(238-240)gaG>gaA	p.E80E	AC003986.5_ENST00000452700.1_RNA	NM_152898.2	NP_690862.1	Q96RJ6	FER3L_HUMAN	Fer3-like bHLH transcription factor	80	Poly-Glu.				cell development (GO:0048468)|floor plate development (GO:0033504)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of neurogenesis (GO:0050767)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.E81_R82insE(1)		breast(1)|endometrium(4)|large_intestine(8)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	35						ttccgcgctcctcttcctcct	0.622																																					p.E80E		.											.,2	.	63	1	Insertion - In frame(1)	ovary(1)	c.G240A						.						72.0	54.0	60.0					7																	19184746		2203	4300	6503	SO:0001819	synonymous_variant	222894	exon1			GCGCTCCTCTTCC	AF369897	CCDS5368.1	7p21.3	2013-10-17	2013-10-17		ENSG00000146618	ENSG00000146618		"""Basic helix-loop-helix proteins"""	16660	protein-coding gene	gene with protein product			"""Fer3-like (Drosophila)"""			11472856, 12217327	Standard	NM_152898		Approved	NATO3, N-TWIST, bHLHa31	uc003suo.1	Q96RJ6	OTTHUMG00000090823	ENST00000275461.3:c.240G>A	7.37:g.19184746C>T		Somatic	14	1		WXS	Illumina HiSeq	.	17	0	NM_152898	Q495K0	Silent	SNP	ENST00000275461.3	37	CCDS5368.1																																																																																			.		0.622	FERD3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207627.1		
MEF2A	4205	hgsc.bcm.edu	37	15	100211761	100211761	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr15:100211761C>T	ENST00000354410.5	+	5	924	c.295C>T	c.(295-297)Cca>Tca	p.P99S	MEF2A_ENST00000338042.6_Intron|MEF2A_ENST00000453228.2_Intron|MEF2A_ENST00000557942.1_Intron|MEF2A_ENST00000557785.1_Intron|MEF2A_ENST00000449277.2_Intron|MEF2A_ENST00000558812.1_Intron	NM_005587.2	NP_005578.2	Q02078	MEF2A_HUMAN	myocyte enhancer factor 2A	99					apoptotic process (GO:0006915)|cardiac conduction (GO:0061337)|cellular response to calcium ion (GO:0071277)|dendrite morphogenesis (GO:0048813)|ERK5 cascade (GO:0070375)|heart development (GO:0007507)|innate immune response (GO:0045087)|MAPK cascade (GO:0000165)|mitochondrial genome maintenance (GO:0000002)|mitochondrion distribution (GO:0048311)|muscle cell differentiation (GO:0042692)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac myofibril assembly (GO:0055005)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)	p.P99S(3)		endometrium(2)|large_intestine(2)|lung(7)|ovary(1)	12	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00085)			GTGCGACAGCCCAGACCCTGA	0.333																																					p.P99S		.											MEF2A_ENST00000354410,NS,carcinoma,0,3	MEF2A_ENST00000354410	0	3	Substitution - Missense(3)	lung(1)|kidney(1)|central_nervous_system(1)	c.C295T						.						82.0	69.0	73.0					15																	100211761		1843	4079	5922	SO:0001583	missense	4205	exon5			GACAGCCCAGACC		CCDS45362.1, CCDS45363.1, CCDS53978.1, CCDS58401.1	15q26	2008-02-05	2007-04-24			ENSG00000068305		"""Myocyte enhancer factors"""	6993	protein-coding gene	gene with protein product		600660				1516833	Standard	NM_005587		Approved	RSRFC4, RSRFC9	uc002bvf.3	Q02078		ENST00000354410.5:c.295C>T	15.37:g.100211761C>T	ENSP00000346389:p.Pro99Ser	Somatic	80	0		WXS	Illumina HiSeq	.	90	4	NM_005587	B4DFQ7|F6XG23|O43814|Q14223|Q14224|Q59GX4|Q7Z6C9|Q96D14	Missense_Mutation	SNP	ENST00000354410.5	37	CCDS45362.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.814941	0.90790	.	.	ENSG00000068305	ENST00000354410	T	0.63255	-0.03	5.42	5.42	0.78866	Holliday junction regulator protein family C-terminal repeat (1);	0.000000	0.85682	D	0.000000	D	0.82866	0.5130	M	0.87456	2.885	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.85220	0.1026	10	0.72032	D	0.01	-16.5447	19.5673	0.95398	0.0:1.0:0.0:0.0	.	99;99	Q02078;Q02078-5	MEF2A_HUMAN;.	S	99	ENSP00000346389:P99S	ENSP00000346389:P99S	P	+	1	0	MEF2A	98029284	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.445000	0.80570	2.706000	0.92434	0.462000	0.41574	CCA	.		0.333	MEF2A-001	KNOWN	overlapping_uORF|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000415980.1		
PREPL	9581	hgsc.bcm.edu;bcgsc.ca	37	2	44550432	44550432	+	Missense_Mutation	SNP	C	C	T	rs375292548		TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr2:44550432C>T	ENST00000409936.1	-	12	2302	c.1865G>A	c.(1864-1866)cGt>cAt	p.R622H	PREPL_ENST00000541738.1_Missense_Mutation_p.R533H|PREPL_ENST00000409957.1_Missense_Mutation_p.R533H|PREPL_ENST00000378520.3_Missense_Mutation_p.R556H|PREPL_ENST00000378511.3_Missense_Mutation_p.R560H|PREPL_ENST00000260648.6_Missense_Mutation_p.R622H|PREPL_ENST00000409411.1_Missense_Mutation_p.R533H|PREPL_ENST00000409272.1_Missense_Mutation_p.R622H|PREPL_ENST00000410081.1_Missense_Mutation_p.R622H	NM_001171606.1	NP_001165077.1	Q4J6C6	PPCEL_HUMAN	prolyl endopeptidase-like	622						cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(19)|ovary(1)|prostate(1)|skin(2)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				GGGACAGTAACGTTTTATGTA	0.333																																					p.R622H		.											.	.	.	0			c.G1865A						.						207.0	195.0	199.0					2																	44550432		2203	4300	6503	SO:0001583	missense	9581	exon12			CAGTAACGTTTTA	AB007896	CCDS33190.1, CCDS42675.1, CCDS42676.1, CCDS54353.1	2p22.1	2008-02-05			ENSG00000138078	ENSG00000138078			30228	protein-coding gene	gene with protein product		609557				11524703	Standard	NM_006036		Approved	KIAA0436	uc002ruk.2	Q4J6C6	OTTHUMG00000152791	ENST00000409936.1:c.1865G>A	2.37:g.44550432C>T	ENSP00000386543:p.Arg622His	Somatic	63	0		WXS	Illumina HiSeq	.	60	4	NM_001171603	A7E2X6|D6W5A3|O43163|Q4J6C3|Q4J6C4|Q4ZG39|Q6ZMW7|Q96DW7	Missense_Mutation	SNP	ENST00000409936.1	37	CCDS33190.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.11|13.11	2.140660|2.140660	0.37825|0.37825	.|.	.|.	ENSG00000138078|ENSG00000138078	ENST00000541738;ENST00000409411;ENST00000409957;ENST00000409936;ENST00000444696;ENST00000260648;ENST00000409272;ENST00000410081;ENST00000378520;ENST00000378511|ENST00000420756	T;T;T;T;T;T;T;T;T|.	0.30182|.	1.54;1.54;1.54;1.54;1.54;1.54;1.54;1.54;1.54|.	5.5|5.5	2.63|2.63	0.31362|0.31362	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);|.	0.457515|.	0.24925|.	N|.	0.034506|.	T|T	0.24005|0.24005	0.0581|0.0581	L|L	0.27053|0.27053	0.805|0.805	0.27154|0.27154	N|N	0.961331|0.961331	B;B;B|.	0.12013|.	0.001;0.002;0.005|.	B;B;B|.	0.15484|.	0.001;0.006;0.013|.	T|T	0.22068|0.22068	-1.0227|-1.0227	10|5	0.56958|.	D|.	0.05|.	-1.0027|-1.0027	4.4133|4.4133	0.11443|0.11443	0.2608:0.4903:0.0:0.2488|0.2608:0.4903:0.0:0.2488	.|.	560;556;622|.	Q4J6C6-3;Q4J6C6-2;Q4J6C6|.	.;.;PPCEL_HUMAN|.	H|I	533;533;533;622;17;622;622;622;556;560|4	ENSP00000439626:R533H;ENSP00000387095:R533H;ENSP00000387241:R533H;ENSP00000386543:R622H;ENSP00000260648:R622H;ENSP00000386909:R622H;ENSP00000386509:R622H;ENSP00000367781:R556H;ENSP00000367772:R560H|.	ENSP00000260648:R622H|.	R|V	-|-	2|1	0|0	PREPL|PREPL	44403936|44403936	0.979000|0.979000	0.34478|0.34478	0.996000|0.996000	0.52242|0.52242	0.996000|0.996000	0.88848|0.88848	0.723000|0.723000	0.25939|0.25939	0.240000|0.240000	0.21263|0.21263	-0.126000|-0.126000	0.14955|0.14955	CGT|GTT	.		0.333	PREPL-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327900.1	NM_006036	
MYBL2	4605	hgsc.bcm.edu;bcgsc.ca	37	20	42311453	42311453	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr20:42311453G>T	ENST00000217026.4	+	4	333	c.206G>T	c.(205-207)tGc>tTc	p.C69F	MYBL2_ENST00000396863.4_Missense_Mutation_p.C45F	NM_002466.2	NP_002457.1	P10244	MYBB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 2	69	HTH myb-type 1. {ECO:0000255|PROSITE- ProRule:PRU00625}.				G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|spindle assembly involved in mitosis (GO:0090307)	Myb complex (GO:0031523)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	46		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			GACCAGCAATGCCAGTACAGG	0.517																																					p.C69F		.											.	.	.	0			c.G206T						.						230.0	225.0	227.0					20																	42311453		2203	4300	6503	SO:0001583	missense	4605	exon4			AGCAATGCCAGTA		CCDS13322.1, CCDS63276.1	20q13.1	2013-07-09	2013-07-09		ENSG00000101057	ENSG00000101057			7548	protein-coding gene	gene with protein product		601415				8812502	Standard	NM_002466		Approved	BMYB, B-MYB	uc002xlb.1	P10244	OTTHUMG00000033062	ENST00000217026.4:c.206G>T	20.37:g.42311453G>T	ENSP00000217026:p.Cys69Phe	Somatic	45	0		WXS	Illumina HiSeq	.	72	4	NM_002466	B2RBS5|B7Z8D9|F8W6N6|Q53F07	Missense_Mutation	SNP	ENST00000217026.4	37	CCDS13322.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.587195	0.86851	.	.	ENSG00000101057	ENST00000396863;ENST00000217026	T;T	0.24723	2.1;1.84	5.3	5.3	0.74995	Transcription regulator HTH, Myb-type, DNA-binding (1);Myb, DNA-binding (1);SANT domain, DNA binding (1);Homeodomain-related (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	T	0.71787	0.3381	H	0.99498	4.595	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.85115	0.0965	10	0.87932	D	0	-27.6446	18.1122	0.89539	0.0:0.0:1.0:0.0	.	45;69	F8W6N6;P10244	.;MYBB_HUMAN	F	45;69	ENSP00000380072:C45F;ENSP00000217026:C69F	ENSP00000217026:C69F	C	+	2	0	MYBL2	41744867	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.652000	0.98499	2.661000	0.90470	0.650000	0.86243	TGC	.		0.517	MYBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080408.1	NM_002466	
APOBR	55911	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	16	28507458	28507458	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr16:28507458G>A	ENST00000431282.1	+	3	1079	c.1069G>A	c.(1069-1071)Gcc>Acc	p.A357T	CLN3_ENST00000567160.1_5'Flank|CLN3_ENST00000569430.1_5'Flank|APOBR_ENST00000328423.5_Missense_Mutation_p.A357T|APOBR_ENST00000564831.1_Missense_Mutation_p.A366T			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor	357	Glu-rich.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						GGCCGGGACAGCCTCAGGAGG	0.667																																					p.A366T		.											.	.	.	0			c.G1096A						.						16.0	19.0	18.0					16																	28507458		1959	4109	6068	SO:0001583	missense	55911	exon2			GGGACAGCCTCAG	AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83		ENST00000431282.1:c.1069G>A	16.37:g.28507458G>A	ENSP00000416094:p.Ala357Thr	Somatic	23	0		WXS	Illumina HiSeq	.	18	4	NM_018690	H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Missense_Mutation	SNP	ENST00000431282.1	37		.	.	.	.	.	.	.	.	.	.	G	13.61	2.288719	0.40494	.	.	ENSG00000184730	ENST00000328423;ENST00000431282	T;T	0.60299	0.2;0.2	3.92	-4.9	0.03094	.	.	.	.	.	T	0.34395	0.0896	N	0.19112	0.55	0.09310	N	1	B	0.30146	0.27	B	0.29524	0.103	T	0.20371	-1.0277	9	0.34782	T	0.22	6.3641	6.5262	0.22303	0.3857:0.1261:0.4882:0.0	.	357	Q9NS13	.	T	357	ENSP00000327669:A357T;ENSP00000416094:A357T	ENSP00000327669:A357T	A	+	1	0	APOBR	28414959	0.000000	0.05858	0.000000	0.03702	0.068000	0.16541	-2.026000	0.01434	-0.919000	0.03803	-0.382000	0.06688	GCC	.		0.667	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_182804	
KRTAP5-4	387267	hgsc.bcm.edu	37	11	1643279	1643279	+	Silent	SNP	C	C	T	rs551852315	byFrequency	TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr11:1643279C>T	ENST00000399682.1	-	1	89	c.45G>A	c.(43-45)ggG>ggA	p.G15G		NM_001012709.1	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	0						keratin filament (GO:0045095)				NS(1)|endometrium(9)|kidney(2)|lung(2)|pancreas(1)|prostate(3)|skin(2)	20		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		agccacagcccccacagccgg	0.682																																					p.G15G		.											KRTAP5-4,NS,carcinoma,0,1	KRTAP5-4	0	0			c.G45A						.																																			SO:0001819	synonymous_variant	387267	exon1			ACAGCCCCCACAG	AB126073		11p15.5	2012-04-19			ENSG00000241598	ENSG00000241598		"""Keratin associated proteins"""	23599	protein-coding gene	gene with protein product						15144888	Standard	NM_001012709		Approved	KRTAP5.4	uc009ycy.1	Q6L8H1	OTTHUMG00000057553	ENST00000399682.1:c.45G>A	11.37:g.1643279C>T		Somatic	84	0		WXS	Illumina HiSeq	.	102	5	NM_001012709		Silent	SNP	ENST00000399682.1	37																																																																																				.		0.682	KRTAP5-4-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000127918.1	NM_001012709	
PCDH7	5099	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	30723183	30723183	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr4:30723183C>T	ENST00000361762.2	+	1	1147	c.139C>T	c.(139-141)Cgc>Tgc	p.R47C	PCDH7_ENST00000543491.1_Missense_Mutation_p.R47C	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	47	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						CGCCGACGTCCGCATCGGCAA	0.672																																					p.R47C		.											.	.	.	0			c.C139T						.						32.0	32.0	32.0					4																	30723183		2203	4300	6503	SO:0001583	missense	5099	exon1			GACGTCCGCATCG	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.139C>T	4.37:g.30723183C>T	ENSP00000355243:p.Arg47Cys	Somatic	26	0		WXS	Illumina HiSeq	.	32	5	NM_032457	O60246|O60247|Q4W5C4	Missense_Mutation	SNP	ENST00000361762.2	37	CCDS33971.1	.	.	.	.	.	.	.	.	.	.	C	18.47	3.631759	0.67015	.	.	ENSG00000169851	ENST00000361762;ENST00000543491;ENST00000333135	T;T	0.27256	1.68;1.68	5.08	5.08	0.68730	Cadherin, N-terminal (1);Cadherin (1);	.	.	.	.	T	0.46229	0.1382	L	0.58101	1.795	0.53688	D	0.999975	D;D;D	0.71674	0.998;0.998;0.998	P;P;P	0.61800	0.894;0.894;0.86	T	0.45804	-0.9236	9	0.72032	D	0.01	.	18.0704	0.89404	0.0:1.0:0.0:0.0	.	47;47;47	F5GWJ1;O60245-3;O60245	.;.;PCDH7_HUMAN	C	47	ENSP00000355243:R47C;ENSP00000441802:R47C	ENSP00000330302:R47C	R	+	1	0	PCDH7	30332281	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	3.189000	0.50965	2.364000	0.80123	0.305000	0.20034	CGC	.		0.672	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360366.1	NM_032457, NM_002589	
KTN1	3895	hgsc.bcm.edu	37	14	56079169	56079169	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr14:56079169G>T	ENST00000395314.3	+	2	471	c.403G>T	c.(403-405)Gca>Tca	p.A135S	KTN1_ENST00000438792.2_Missense_Mutation_p.A135S|KTN1_ENST00000416613.1_Missense_Mutation_p.A135S|KTN1_ENST00000395309.3_Missense_Mutation_p.A135S|KTN1_ENST00000395308.1_Missense_Mutation_p.A135S|KTN1_ENST00000395311.1_Missense_Mutation_p.A135S|KTN1_ENST00000413890.2_Missense_Mutation_p.A135S	NM_001079521.1	NP_001072989.1	Q86UP2	KTN1_HUMAN	kinectin 1 (kinesin receptor)	135					microtubule-based movement (GO:0007018)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.A135T(1)		breast(4)|central_nervous_system(1)|large_intestine(8)|lung(1)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	19						AGAAAGTGACGCATCAAAGAT	0.438			T	RET	papillary thryoid																																p.A135S		.		Dom	yes		14	14q22.1	3895	kinectin 1 (kinesin receptor)		E	KTN1_ENST00000416613,colon,carcinoma,0,1	KTN1_ENST00000416613	0	1	Substitution - Missense(1)	large_intestine(1)	c.G403T						.						89.0	94.0	92.0					14																	56079169		2203	4300	6503	SO:0001583	missense	3895	exon2			AGTGACGCATCAA		CCDS41957.1, CCDS41958.1, CCDS41959.1	14q22.1	2008-05-02			ENSG00000126777	ENSG00000126777			6467	protein-coding gene	gene with protein product		600381				9605849	Standard	NM_001079521		Approved	KIAA0004, CG1	uc001xcc.3	Q86UP2	OTTHUMG00000140312	ENST00000395314.3:c.403G>T	14.37:g.56079169G>T	ENSP00000378725:p.Ala135Ser	Somatic	89	0		WXS	Illumina HiSeq	.	95	4	NM_004986	B4DZ88|Q13999|Q14707|Q15387|Q17RZ5|Q5GGW3|Q86W57	Missense_Mutation	SNP	ENST00000395314.3	37	CCDS41957.1	.	.	.	.	.	.	.	.	.	.	G	2.149	-0.395056	0.04899	.	.	ENSG00000126777	ENST00000413890;ENST00000395309;ENST00000438792;ENST00000395314;ENST00000395308;ENST00000395311;ENST00000416613	D;D;D;D;D;D;D	0.98090	-4.71;-4.71;-4.71;-4.71;-4.71;-4.71;-4.71	5.9	2.03	0.26663	.	1.194940	0.06186	N	0.680486	D	0.94525	0.8237	N	0.22421	0.69	0.18873	N	0.999988	B;B;B;B	0.23128	0.037;0.064;0.037;0.08	B;B;B;B	0.30716	0.082;0.119;0.082;0.119	D	0.87312	0.2312	10	0.31617	T	0.26	0.0309	7.7204	0.28729	0.1919:0.118:0.6901:0.0	.	135;135;135;135	B4DZ88;Q86UP2-2;Q17RZ5;Q86UP2	.;.;.;KTN1_HUMAN	S	135	ENSP00000394992:A135S;ENSP00000378720:A135S;ENSP00000391964:A135S;ENSP00000378725:A135S;ENSP00000378719:A135S;ENSP00000378722:A135S;ENSP00000388807:A135S	ENSP00000378719:A135S	A	+	1	0	KTN1	55148922	0.998000	0.40836	0.161000	0.22692	0.006000	0.05464	0.928000	0.28831	0.103000	0.17682	-0.948000	0.02665	GCA	.		0.438	KTN1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276912.2		
PSPC1	55269	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	20277436	20277436	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr13:20277436C>T	ENST00000338910.4	-	9	1610	c.1451G>A	c.(1450-1452)gGt>gAt	p.G484D		NM_001042414.2	NP_001035879.1	Q8WXF1	PSPC1_HUMAN	paraspeckle component 1	484	Gly-rich.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23		all_cancers(29;1.25e-22)|all_lung(29;1.97e-20)|all_epithelial(30;2.29e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;4.63e-06)|Epithelial(112;2.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00256)|Lung(94;0.00975)|LUSC - Lung squamous cell carcinoma(192;0.0483)		GGTTTCAGAACCTGTTCTACT	0.483																																					p.G484D		.											.	.	.	0			c.G1451A						.						57.0	67.0	64.0					13																	20277436		1922	4132	6054	SO:0001583	missense	55269	exon10			TCAGAACCTGTTC	AK001817	CCDS41870.1	13q11	2013-02-12			ENSG00000121390	ENSG00000121390		"""RNA binding motif (RRM) containing"""	20320	protein-coding gene	gene with protein product		612408				11790299	Standard	NM_001042414		Approved	PSP1, FLJ10955	uc021rgx.1	Q8WXF1	OTTHUMG00000016502	ENST00000338910.4:c.1451G>A	13.37:g.20277436C>T	ENSP00000343966:p.Gly484Asp	Somatic	151	0		WXS	Illumina HiSeq	.	120	18	NM_001042414	Q5JTQ3|Q8NCZ9|Q8WXE8|Q9NV36	Missense_Mutation	SNP	ENST00000338910.4	37	CCDS41870.1	.	.	.	.	.	.	.	.	.	.	C	15.62	2.886921	0.52014	.	.	ENSG00000121390	ENST00000338910;ENST00000422828	T	0.16196	2.36	5.4	5.4	0.78164	.	0.246703	0.39687	N	0.001286	T	0.30759	0.0775	N	0.24115	0.695	0.58432	D	0.999995	D	0.89917	1.0	D	0.79108	0.992	T	0.06534	-1.0821	10	0.54805	T	0.06	-11.9055	19.1702	0.93574	0.0:1.0:0.0:0.0	.	484	Q8WXF1	PSPC1_HUMAN	D	484;424	ENSP00000343966:G484D	ENSP00000343966:G484D	G	-	2	0	PSPC1	19175436	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.912000	0.69948	2.529000	0.85273	0.484000	0.47621	GGT	.		0.483	PSPC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044037.2		
SPTBN2	6712	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	66463945	66463945	+	Silent	SNP	G	G	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr11:66463945G>A	ENST00000533211.1	-	21	4412	c.4081C>T	c.(4081-4083)Ctg>Ttg	p.L1361L	SPTBN2_ENST00000529997.1_Silent_p.L1361L|SPTBN2_ENST00000309996.2_Silent_p.L1361L			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	1361					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						CGCCTGTGCAGGTCTCTCAGC	0.602																																					p.L1361L		.											.	.	.	0			c.C4081T						.						101.0	111.0	108.0					11																	66463945		2200	4295	6495	SO:0001819	synonymous_variant	6712	exon20			TGTGCAGGTCTCT	AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.4081C>T	11.37:g.66463945G>A		Somatic	17	0		WXS	Illumina HiSeq	.	18	9	NM_006946	O14872|O14873	Silent	SNP	ENST00000533211.1	37	CCDS8150.1																																																																																			.		0.602	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393892.2	NM_006946	
CCDC62	84660	hgsc.bcm.edu	37	12	123262119	123262119	+	Nonsense_Mutation	SNP	C	C	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr12:123262119C>T	ENST00000253079.6	+	2	462	c.118C>T	c.(118-120)Cga>Tga	p.R40*	CCDC62_ENST00000537566.1_5'UTR|CCDC62_ENST00000392441.4_Nonsense_Mutation_p.R40*	NM_201435.4	NP_958843.2	Q6P9F0	CCD62_HUMAN	coiled-coil domain containing 62	40					cellular response to estradiol stimulus (GO:0071392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)			breast(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(1)	20	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.51e-06)|Epithelial(86;2.65e-05)|BRCA - Breast invasive adenocarcinoma(302;0.206)		ATTAAAAGATCGAGATAAAGA	0.448																																					p.R40X		.											CCDC62_ENST00000253079,NS,carcinoma,0,2	CCDC62_ENST00000253079	0	0			c.C118T						.						82.0	77.0	78.0					12																	123262119		2203	4300	6503	SO:0001587	stop_gained	84660	exon2			AAAGATCGAGATA		CCDS9238.1	12q24.31	2009-08-18			ENSG00000130783	ENSG00000130783			30723	protein-coding gene	gene with protein product	"""cancer/testis antigen 109"""	613481				18563714, 19126643	Standard	NM_201435		Approved	TSP-NY, FLJ40344, CT109, ERAP75	uc001udc.3	Q6P9F0	OTTHUMG00000168764	ENST00000253079.6:c.118C>T	12.37:g.123262119C>T	ENSP00000253079:p.Arg40*	Somatic	31	0		WXS	Illumina HiSeq	.	28	2	NM_201435	A8K8V1|B3KUP3|Q6ZVF2|Q86VJ0|Q9BYZ5	Nonsense_Mutation	SNP	ENST00000253079.6	37	CCDS9238.1	.	.	.	.	.	.	.	.	.	.	C	37	6.588276	0.97684	.	.	ENSG00000130783	ENST00000253079;ENST00000392441	.	.	.	5.87	5.87	0.94306	.	0.000000	0.56097	D	0.000023	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.9273	14.0517	0.64742	0.1508:0.8492:0.0:0.0	.	.	.	.	X	40	.	ENSP00000253079:R40X	R	+	1	2	CCDC62	121828072	1.000000	0.71417	0.918000	0.36340	0.933000	0.57130	3.171000	0.50824	2.941000	0.99782	0.655000	0.94253	CGA	.		0.448	CCDC62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400930.1	NM_032573	
KMT2C	58508	hgsc.bcm.edu	37	7	151921114	151921114	+	Nonsense_Mutation	SNP	A	A	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr7:151921114A>T	ENST00000262189.6	-	20	3527	c.3309T>A	c.(3307-3309)tgT>tgA	p.C1103*	KMT2C_ENST00000355193.2_Nonsense_Mutation_p.C1103*	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1103					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.C1103*(10)									CACATTGTCTACATTGCAGAA	0.338																																					p.C1103X		.											MLL3_ENST00000355193,NS,carcinoma,0,10	MLL3_ENST00000355193	0	10	Substitution - Nonsense(10)	kidney(6)|endometrium(4)	c.T3309A						.						56.0	51.0	52.0					7																	151921114		2203	4300	6503	SO:0001587	stop_gained	58508	exon20			TTGTCTACATTGC	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.3309T>A	7.37:g.151921114A>T	ENSP00000262189:p.Cys1103*	Somatic	93	1		WXS	Illumina HiSeq	.	74	3	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Nonsense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	A	41	8.814636	0.98964	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	.	.	.	5.39	-2.79	0.05841	.	0.000000	0.50627	D	0.000105	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.2367	0.59972	0.4373:0.0:0.5627:0.0	rs4024337	.	.	.	X	1103	.	ENSP00000262189:C1103X	C	-	3	2	MLL3	151552047	0.735000	0.28153	0.983000	0.44433	0.992000	0.81027	-0.154000	0.10130	-0.431000	0.07307	0.528000	0.53228	TGT	.		0.338	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
HIVEP2	3097	hgsc.bcm.edu	37	6	143091902	143091902	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr6:143091902G>T	ENST00000367604.1	-	4	4613	c.3974C>A	c.(3973-3975)tCt>tAt	p.S1325Y	HIVEP2_ENST00000367603.2_Missense_Mutation_p.S1325Y|HIVEP2_ENST00000012134.2_Missense_Mutation_p.S1325Y			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	1325					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		GGACTGCAAAGACCCAGCATT	0.488																																					p.S1325Y	Esophageal Squamous(107;843 1510 13293 16805 42198)	.											HIVEP2,NS,carcinoma,0,1	HIVEP2	0	0			c.C3974A						.						80.0	82.0	81.0					6																	143091902		1907	4132	6039	SO:0001583	missense	3097	exon5			TGCAAAGACCCAG	M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.3974C>A	6.37:g.143091902G>T	ENSP00000356576:p.Ser1325Tyr	Somatic	24	0		WXS	Illumina HiSeq	.	12	2	NM_006734	Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	ENST00000367604.1	37	CCDS43510.1	.	.	.	.	.	.	.	.	.	.	G	13.31	2.199856	0.38905	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.02552	4.25;4.25;4.25	6.08	6.08	0.98989	.	0.253885	0.47455	D	0.000233	T	0.02688	0.0081	L	0.53249	1.67	0.09310	N	0.999999	P	0.36789	0.57	B	0.36885	0.235	T	0.21999	-1.0229	10	0.87932	D	0	-3.0365	20.6634	0.99662	0.0:0.0:1.0:0.0	.	1325	P31629	ZEP2_HUMAN	Y	1325	ENSP00000356576:S1325Y;ENSP00000356575:S1325Y;ENSP00000012134:S1325Y	ENSP00000012134:S1325Y	S	-	2	0	HIVEP2	143133595	1.000000	0.71417	0.194000	0.23346	0.671000	0.39405	6.510000	0.73729	2.894000	0.99253	0.655000	0.94253	TCT	.		0.488	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042495.1		
FBXW7	55294	hgsc.bcm.edu	37	4	153250882	153250882	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr4:153250882C>T	ENST00000281708.4	-	8	2407	c.1178G>A	c.(1177-1179)cGa>cAa	p.R393Q	FBXW7_ENST00000296555.5_Missense_Mutation_p.R275Q|FBXW7_ENST00000603548.1_Missense_Mutation_p.R393Q|FBXW7_ENST00000393956.3_Missense_Mutation_p.R217Q|FBXW7_ENST00000263981.5_Missense_Mutation_p.R313Q|FBXW7_ENST00000603841.1_Missense_Mutation_p.R393Q	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	393					cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.?(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				ACTAACTATTCGGTTACCACA	0.343			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																p.R393Q		.		Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	FBXW7_NM_018315_2,NS,carcinoma,-1,5	FBXW7_NM_018315_2	-1	1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)	c.G1178A						.						119.0	108.0	112.0					4																	153250882		2203	4300	6503	SO:0001583	missense	55294	exon8			ACTATTCGGTTAC	AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1178G>A	4.37:g.153250882C>T	ENSP00000281708:p.Arg393Gln	Somatic	47	0		WXS	Illumina HiSeq	.	44	2	NM_033632	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	ENST00000281708.4	37	CCDS3777.1	.	.	.	.	.	.	.	.	.	.	C	16.19	3.052681	0.55218	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.60299	0.2;0.2;0.2;0.2	5.99	5.99	0.97316	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.053576	0.85682	D	0.000000	T	0.35595	0.0937	N	0.03983	-0.305	0.80722	D	1	P;P;B;P	0.43701	0.485;0.815;0.43;0.552	B;B;B;B	0.33295	0.099;0.161;0.06;0.06	T	0.47407	-0.9120	10	0.54805	T	0.06	-12.7554	20.5373	0.99239	0.0:1.0:0.0:0.0	.	217;393;275;313	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	Q	393;275;313;217	ENSP00000281708:R393Q;ENSP00000296555:R275Q;ENSP00000263981:R313Q;ENSP00000377528:R217Q	ENSP00000263981:R313Q	R	-	2	0	FBXW7	153470332	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.768000	0.85345	2.857000	0.98124	0.650000	0.86243	CGA	.		0.343	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1		
WDR11	55717	hgsc.bcm.edu	37	10	122661797	122661797	+	Nonsense_Mutation	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr10:122661797G>T	ENST00000263461.6	+	22	2962	c.2716G>T	c.(2716-2718)Gaa>Taa	p.E906*	WDR11_ENST00000604509.1_3'UTR	NM_018117.11	NP_060587.8	Q8WWQ0	PHIP_HUMAN	WD repeat domain 11	0	Lys-rich.				cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)	p.E906*(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(9)|prostate(2)|skin(2)|stomach(5)	38						GCTTGATCCAGAATTCACTCT	0.358																																					p.E906X		.											WDR11,NS,carcinoma,0,1	WDR11	0	1	Substitution - Nonsense(1)	kidney(1)	c.G2716T						.						104.0	100.0	102.0					10																	122661797		2203	4300	6503	SO:0001587	stop_gained	55717	exon22			GATCCAGAATTCA	AF320223	CCDS7619.1	10q26	2013-01-21	2010-01-06	2010-01-06	ENSG00000120008	ENSG00000120008		"""WD repeat domain containing"""	13831	protein-coding gene	gene with protein product		606417	"""bromodomain and WD repeat domain containing 2"""	BRWD2		10718198, 11536051	Standard	NM_018117		Approved	KIAA1351, FLJ10506, WDR15, HH14, DR11	uc021pzt.1	Q9BZH6	OTTHUMG00000019171	ENST00000263461.6:c.2716G>T	10.37:g.122661797G>T	ENSP00000263461:p.Glu906*	Somatic	79	1		WXS	Illumina HiSeq	.	59	3	NM_018117	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Nonsense_Mutation	SNP	ENST00000263461.6	37	CCDS7619.1	.	.	.	.	.	.	.	.	.	.	G	42	9.407145	0.99161	.	.	ENSG00000120008	ENST00000263461	.	.	.	5.77	5.77	0.91146	.	0.141517	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12103	T	0.63	-13.5085	20.3473	0.98799	0.0:0.0:1.0:0.0	.	.	.	.	X	906	.	ENSP00000263461:E906X	E	+	1	0	WDR11	122651787	1.000000	0.71417	0.972000	0.41901	0.959000	0.62525	6.435000	0.73412	2.884000	0.98904	0.655000	0.94253	GAA	.		0.358	WDR11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050707.2		
LMNB1	4001	hgsc.bcm.edu	37	5	126140499	126140499	+	Missense_Mutation	SNP	G	G	T	rs373303194		TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr5:126140499G>T	ENST00000261366.5	+	2	752	c.391G>T	c.(391-393)Gcc>Tcc	p.A131S	LMNB1_ENST00000460265.1_3'UTR|LMNB1_ENST00000395354.1_Missense_Mutation_p.A131S	NM_001198557.1|NM_005573.3	NP_001185486.1|NP_005564.1	P20700	LMNB1_HUMAN	lamin B1	131	Coil 1B.|Rod.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	lamin filament (GO:0005638)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear inner membrane (GO:0005637)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(142;0.103)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.033)|OV - Ovarian serous cystadenocarcinoma(64;0.0398)|all cancers(49;0.0903)		TCTTAATGGCGCCCAGATCAA	0.418																																					p.A131S		.											LMNB1,NS,carcinoma,0,1	LMNB1	0	0			c.G391T						.						117.0	112.0	113.0					5																	126140499		2203	4300	6503	SO:0001583	missense	4001	exon2			AATGGCGCCCAGA	L37737	CCDS4140.1	5q23.2	2013-01-16			ENSG00000113368	ENSG00000113368		"""Intermediate filaments type V, lamins"""	6637	protein-coding gene	gene with protein product		150340				7557986, 8838815	Standard	NM_005573		Approved		uc003kud.2	P20700	OTTHUMG00000128969	ENST00000261366.5:c.391G>T	5.37:g.126140499G>T	ENSP00000261366:p.Ala131Ser	Somatic	38	0		WXS	Illumina HiSeq	.	27	2	NM_005573	B2R6J6|Q3SYN7|Q96EI6	Missense_Mutation	SNP	ENST00000261366.5	37	CCDS4140.1	.	.	.	.	.	.	.	.	.	.	G	19.51	3.840507	0.71488	.	.	ENSG00000113368	ENST00000261366;ENST00000395354	D;D	0.83506	-1.73;-1.73	5.15	4.27	0.50696	Filament (1);	0.054186	0.64402	D	0.000001	T	0.82250	0.4996	L	0.50333	1.59	0.80722	D	1	P	0.36010	0.532	B	0.42593	0.392	T	0.81088	-0.1091	10	0.39692	T	0.17	.	15.2845	0.73816	0.0:0.0:0.8586:0.1414	.	131	P20700	LMNB1_HUMAN	S	131	ENSP00000261366:A131S;ENSP00000378761:A131S	ENSP00000261366:A131S	A	+	1	0	LMNB1	126168398	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.173000	0.65010	1.298000	0.44778	0.655000	0.94253	GCC	.		0.418	LMNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250956.2	NM_005573	
B4GALNT3	283358	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	665927	665927	+	Missense_Mutation	SNP	A	A	G	rs544102330	byFrequency	TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr12:665927A>G	ENST00000266383.5	+	15	2288	c.2275A>G	c.(2275-2277)Aac>Gac	p.N759D		NM_173593.3	NP_775864.3	Q6L9W6	B4GN3_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 3	759					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)			GGACCCACACAACCGTAGGAG	0.637																																					p.N759D		.											.	.	.	0			c.A2275G						.						49.0	43.0	45.0					12																	665927		2203	4300	6503	SO:0001583	missense	283358	exon15			CCACACAACCGTA	AB089940	CCDS8504.1	12p13.33	2013-02-19			ENSG00000139044	ENSG00000139044	2.4.1.-	"""Beta 4-glycosyltransferases"""	24137	protein-coding gene	gene with protein product		612220				12966086	Standard	NM_173593		Approved	B4GalNac-T3, FLJ16224, FLJ40362	uc001qii.1	Q6L9W6	OTTHUMG00000129283	ENST00000266383.5:c.2275A>G	12.37:g.665927A>G	ENSP00000266383:p.Asn759Asp	Somatic	48	0		WXS	Illumina HiSeq	.	41	10	NM_173593	Q6ZNC1|Q8N7T6	Missense_Mutation	SNP	ENST00000266383.5	37	CCDS8504.1	.	.	.	.	.	.	.	.	.	.	A	0.055	-1.240153	0.01493	.	.	ENSG00000139044	ENST00000266383	T	0.05081	3.5	5.52	-3.43	0.04810	.	1.881860	0.01998	N	0.046034	T	0.03520	0.0101	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.40572	-0.9556	10	0.09084	T	0.74	-2.7588	7.4294	0.27118	0.2404:0.5025:0.2571:0.0	.	759	Q6L9W6	B4GN3_HUMAN	D	759	ENSP00000266383:N759D	ENSP00000266383:N759D	N	+	1	0	B4GALNT3	536188	0.000000	0.05858	0.000000	0.03702	0.039000	0.13416	-0.008000	0.12788	-0.187000	0.10516	-1.156000	0.01807	AAC	.		0.637	B4GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251406.2	NM_173593	
WNK2	65268	hgsc.bcm.edu;bcgsc.ca	37	9	96070761	96070761	+	Silent	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr9:96070761G>T	ENST00000297954.4	+	28	6522	c.6522G>T	c.(6520-6522)gtG>gtT	p.V2174V	WNK2_ENST00000395477.2_Silent_p.V2137V|WNK2_ENST00000349097.3_Silent_p.V1786V|WNK2_ENST00000356055.3_3'UTR|WNK2_ENST00000427277.2_Silent_p.V1749V|WNK2_ENST00000395475.2_3'UTR	NM_001282394.1	NP_001269323.1	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	2174					intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(11)|kidney(4)|large_intestine(5)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)	54						GCAAGACGGTGGGGGCCGCGC	0.647																																					p.V2137V		.											.	.	.	0			c.G6411T						.						82.0	55.0	64.0					9																	96070761		2199	4296	6495	SO:0001819	synonymous_variant	65268	exon27			GACGGTGGGGGCC	AJ242724	CCDS75858.1	9q22.3	2008-02-05	2003-06-23	2005-01-22	ENSG00000165238	ENSG00000165238			14542	protein-coding gene	gene with protein product		606249	"""serologically defined colon cancer antigen 43"""	SDCCAG43, PRKWNK2		9610721, 11571656	Standard	NM_006648		Approved	NY-CO-43, KIAA1760	uc004atj.3	Q9Y3S1	OTTHUMG00000020247	ENST00000297954.4:c.6522G>T	9.37:g.96070761G>T		Somatic	28	0		WXS	Illumina HiSeq	.	31	4	NM_006648	Q5VWF1|Q5VWF2|Q8IY36|Q9C0A3|Q9H3P4	Silent	SNP	ENST00000297954.4	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.898|8.898	0.955697|0.955697	0.18507|0.18507	.|.	.|.	ENSG00000165238|ENSG00000165238	ENST00000411624|ENST00000432730;ENST00000448251;ENST00000453718	.|.	.|.	.|.	5.37|5.37	-1.1|-1.1	0.09872|0.09872	.|.	.|.	.|.	.|.	.|.	T|T	0.39306|0.39306	0.1073|0.1073	.|.	.|.	.|.	0.50039|0.50039	D|D	0.999843|0.999843	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.25047|0.25047	-1.0143|-1.0143	4|4	.|.	.|.	.|.	.|.	1.0116|1.0116	0.01498|0.01498	0.1876:0.1884:0.3117:0.3123|0.1876:0.1884:0.3117:0.3123	.|.	.|.	.|.	.|.	W|L	1629|2133;934;611	.|.	.|.	G|W	+|+	1|2	0|0	WNK2|WNK2	95110582|95110582	0.661000|0.661000	0.27430|0.27430	0.233000|0.233000	0.24025|0.24025	0.996000|0.996000	0.88848|0.88848	-0.079000|-0.079000	0.11357|0.11357	-0.227000|-0.227000	0.09884|0.09884	0.655000|0.655000	0.94253|0.94253	GGG|TGG	.		0.647	WNK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000317359.1	NM_006648	
TECPR1	25851	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	97852437	97852437	+	Silent	SNP	G	G	C			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr7:97852437G>C	ENST00000447648.2	-	21	3092	c.2793C>G	c.(2791-2793)ccC>ccG	p.P931P	TECPR1_ENST00000379795.3_Silent_p.P933P|TECPR1_ENST00000479975.1_5'UTR			Q7Z6L1	TCPR1_HUMAN	tectonin beta-propeller repeat containing 1	931					autophagic vacuole fusion (GO:0000046)|autophagy (GO:0006914)	autophagic vacuole membrane (GO:0000421)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	phosphatidylinositol-3-phosphate binding (GO:0032266)			central_nervous_system(2)|endometrium(8)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						TGAGGGCGATGGGGGGCACCT	0.672																																					p.P931P		.											.,1	.	77	0			c.C2793G						.						20.0	26.0	24.0					7																	97852437		2014	4158	6172	SO:0001819	synonymous_variant	25851	exon21			GGCGATGGGGGGC		CCDS47648.1	7q21.3	2009-01-30			ENSG00000205356	ENSG00000205356			22214	protein-coding gene	gene with protein product		614781					Standard	NM_015395		Approved	DKFZP434B0335, FLJ23419, FLJ90593, KIAA1358	uc003upg.4	Q7Z6L1	OTTHUMG00000154273	ENST00000447648.2:c.2793C>G	7.37:g.97852437G>C		Somatic	25	0		WXS	Illumina HiSeq	.	31	13	NM_015395	A8KAD1|B3KPZ1|C9J024|F5GX57|Q96EB0|Q9P2I9|Q9UFR6	Silent	SNP	ENST00000447648.2	37	CCDS47648.1																																																																																			.		0.672	TECPR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000334661.1	NM_015395	
FPR1	2357	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	52249678	52249678	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr19:52249678C>A	ENST00000595042.1	-	3	711	c.570G>T	c.(568-570)agG>agT	p.R190S	FPR1_ENST00000304748.4_Missense_Mutation_p.R190S	NM_001193306.1	NP_001180235.1	P21462	FPR1_HUMAN	formyl peptide receptor 1	190			R -> W (in dbSNP:rs5030880).		activation of MAPK activity (GO:0000187)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|nitric oxide mediated signal transduction (GO:0007263)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|signal transduction (GO:0007165)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	N-formyl peptide receptor activity (GO:0004982)|receptor activity (GO:0004872)			endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(3)	20		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00106)|OV - Ovarian serous cystadenocarcinoma(262;0.018)	Nedocromil(DB00716)	CCACATTTATCCTCTCTTTAG	0.498																																					p.R190S		.											.	.	.	0			c.G570T						.						114.0	106.0	109.0					19																	52249678		2203	4300	6503	SO:0001583	missense	2357	exon3			ATTTATCCTCTCT	M60627	CCDS12839.1	19q13.41	2014-09-17				ENSG00000171051		"""GPCR / Class A : Formyl peptide receptors"""	3826	protein-coding gene	gene with protein product		136537				2161213, 12595898	Standard	NM_001193306		Approved	FPR, FMLP	uc002pxq.3	P21462		ENST00000595042.1:c.570G>T	19.37:g.52249678C>A	ENSP00000471493:p.Arg190Ser	Somatic	36	0		WXS	Illumina HiSeq	.	44	13	NM_001193306	Q14939|Q7Z6A4|Q86U52|Q9NS48	Missense_Mutation	SNP	ENST00000595042.1	37	CCDS12839.1	.	.	.	.	.	.	.	.	.	.	.	8.077	0.771621	0.16051	.	.	ENSG00000171051	ENST00000304748	T	0.61510	0.1	3.66	1.46	0.22682	GPCR, rhodopsin-like superfamily (1);	0.659654	0.12541	N	0.459864	T	0.49304	0.1549	L	0.45137	1.4	0.09310	N	1	B	0.23316	0.083	B	0.36186	0.219	T	0.45948	-0.9226	10	0.23302	T	0.38	.	6.247	0.20825	0.0:0.6532:0.0:0.3467	.	190	P21462	FPR1_HUMAN	S	190	ENSP00000302707:R190S	ENSP00000302707:R190S	R	-	3	2	FPR1	56941490	0.000000	0.05858	0.003000	0.11579	0.001000	0.01503	0.246000	0.18160	0.300000	0.22699	0.655000	0.94253	AGG	.		0.498	FPR1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466905.1	NM_002029	
ANK2	287	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	114282026	114282026	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr4:114282026G>A	ENST00000357077.4	+	39	10782	c.10729G>A	c.(10729-10731)Gct>Act	p.A3577T	ANK2_ENST00000394537.3_Missense_Mutation_p.A1492T|ANK2_ENST00000509550.1_Missense_Mutation_p.A668T|ANK2_ENST00000510275.2_Missense_Mutation_p.A144T|ANK2_ENST00000264366.6_Missense_Mutation_p.A3544T|ANK2_ENST00000506722.1_Missense_Mutation_p.A1483T	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	3577	Death 2. {ECO:0000255|PROSITE- ProRule:PRU00064}.				atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GGCTTATATTGCTGATCACCT	0.458																																					p.A3577T		.											.	.	.	0			c.G10729A						.						144.0	125.0	131.0					4																	114282026		2203	4300	6503	SO:0001583	missense	287	exon39			TATATTGCTGATC	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.10729G>A	4.37:g.114282026G>A	ENSP00000349588:p.Ala3577Thr	Somatic	30	0		WXS	Illumina HiSeq	.	29	6	NM_001148	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.419079|5.419079	0.96092|0.96092	.|.	.|.	ENSG00000145362|ENSG00000145362	ENST00000506722;ENST00000431447;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056;ENST00000509550;ENST00000510275;ENST00000505342|ENST00000514960;ENST00000504415	D;D;D;D;D;D;D|.	0.86164|.	-2.08;-2.08;-2.08;-2.08;-2.08;-2.08;-2.08|.	5.43|5.43	5.43|5.43	0.79202|0.79202	.|.	0.233767|.	0.29515|.	N|.	0.011925|.	T|T	0.77110|0.77110	0.4082|0.4082	M|M	0.73962|0.73962	2.25|2.25	0.54753|0.54753	D|D	0.999988|0.999988	P;P;D;P;D;P|.	0.76494|.	0.849;0.566;0.97;0.673;0.999;0.721|.	P;B;P;B;D;P|.	0.81914|.	0.543;0.39;0.675;0.248;0.995;0.476|.	T|T	0.76391|0.76391	-0.2976|-0.2976	10|5	0.72032|.	D|.	0.01|.	.|.	19.2227|19.2227	0.93805|0.93805	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	668;527;493;1492;3577;1483|.	E9PCH6;F8W694;Q7Z344;Q01484-2;Q01484-4;Q01484-5|.	.;.;.;.;.;.|.	T|Y	1483;527;1492;3577;3544;1483;668;144;587|493;144	ENSP00000421067:A1483T;ENSP00000378044:A1492T;ENSP00000349588:A3577T;ENSP00000264366:A3544T;ENSP00000426944:A668T;ENSP00000421023:A144T;ENSP00000422498:A587T|.	ENSP00000264366:A3544T|.	A|C	+|+	1|2	0|0	ANK2|ANK2	114501475|114501475	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.997000|0.997000	0.91878|0.91878	7.634000|7.634000	0.83273|0.83273	2.547000|2.547000	0.85894|0.85894	0.557000|0.557000	0.71058|0.71058	GCT|TGC	.		0.458	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
BIRC2	329	hgsc.bcm.edu	37	11	102221671	102221671	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr11:102221671C>A	ENST00000227758.2	+	3	2391	c.992C>A	c.(991-993)cCa>cAa	p.P331Q	BIRC2_ENST00000532672.1_Missense_Mutation_p.P310Q|BIRC2_ENST00000530675.1_Missense_Mutation_p.P282Q|BIRC2_ENST00000527910.1_3'UTR	NM_001166.4|NM_001256163.1	NP_001157.1|NP_001243092.1	Q13490	BIRC2_HUMAN	baculoviral IAP repeat containing 2	331					apoptotic process (GO:0006915)|cell surface receptor signaling pathway (GO:0007166)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein K48-linked ubiquitination (GO:1902524)|positive regulation of protein K63-linked ubiquitination (GO:1902523)|positive regulation of protein monoubiquitination (GO:1902527)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cell cycle (GO:0051726)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|regulation of cysteine-type endopeptidase activity (GO:2000116)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of necroptotic process (GO:0060544)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|regulation of RIG-I signaling pathway (GO:0039535)|regulation of toll-like receptor signaling pathway (GO:0034121)|regulation of transcription, DNA-templated (GO:0006355)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|protein N-terminus binding (GO:0047485)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P331Q(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|liver(2)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(8;0.00044)|all_epithelial(12;0.00348)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0093)	Lung(13;0.109)|Epithelial(9;0.11)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0144)		AAGTGGTTTCCAAGGTAATTG	0.373																																					p.P331Q		.											BIRC2,NS,carcinoma,0,1	BIRC2	0	1	Substitution - Missense(1)	lung(1)	c.C992A						.						269.0	255.0	259.0					11																	102221671		2203	4299	6502	SO:0001583	missense	329	exon3			GGTTTCCAAGGTA	L49431	CCDS8316.1, CCDS58169.1	11q22	2011-01-25	2011-01-25		ENSG00000110330	ENSG00000110330		"""Baculoviral IAP repeat containing"", ""RING-type (C3HC4) zinc fingers"""	590	protein-coding gene	gene with protein product	"""NFR2-TRAF signalling complex protein"", ""apoptosis inhibitor 1"""	601712	"""baculoviral IAP repeat-containing 2"""	API1		8552191, 8548810	Standard	NM_001166		Approved	cIAP1, hiap-2, MIHB, RNF48, c-IAP1	uc010ruq.3	Q13490	OTTHUMG00000167325	ENST00000227758.2:c.992C>A	11.37:g.102221671C>A	ENSP00000227758:p.Pro331Gln	Somatic	60	0		WXS	Illumina HiSeq	.	50	2	NM_001256163	B4E026|Q16516|Q4TTG0	Missense_Mutation	SNP	ENST00000227758.2	37	CCDS8316.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.728437	0.89390	.	.	ENSG00000110330	ENST00000530675;ENST00000227758;ENST00000541741;ENST00000532672	T;T;T	0.06528	3.29;3.29;3.29	5.86	5.86	0.93980	Baculoviral inhibition of apoptosis protein repeat (5);	0.000000	0.85682	D	0.000000	T	0.40595	0.1123	H	0.95079	3.62	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.55205	-0.8177	10	0.87932	D	0	-33.2712	20.2019	0.98263	0.0:1.0:0.0:0.0	.	331	Q13490	BIRC2_HUMAN	Q	282;331;331;310	ENSP00000431723:P282Q;ENSP00000227758:P331Q;ENSP00000434979:P310Q	ENSP00000227758:P331Q	P	+	2	0	BIRC2	101726881	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.487000	0.81328	2.776000	0.95493	0.655000	0.94253	CCA	.		0.373	BIRC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394170.1	NM_001166	
ELF3	1999	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	201984393	201984393	+	Missense_Mutation	SNP	A	A	C			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr1:201984393A>C	ENST00000359651.3	+	8	4250	c.1058A>C	c.(1057-1059)aAg>aCg	p.K353T	ELF3_ENST00000367284.5_Missense_Mutation_p.K353T|RP11-510N19.5_ENST00000504773.1_RNA|ELF3_ENST00000367283.3_Missense_Mutation_p.K353T					E74-like factor 3 (ets domain transcription factor, epithelial-specific )											breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	20						CTCGTCTACAAGTTTGGCAAA	0.542																																					p.K353T		.											.	.	.	0			c.A1058C						.						83.0	84.0	84.0					1																	201984393		2203	4300	6503	SO:0001583	missense	1999	exon9			TCTACAAGTTTGG	AF016295	CCDS1419.1	1q32.2	2008-02-05			ENSG00000163435	ENSG00000163435			3318	protein-coding gene	gene with protein product		602191		ESX		9395241, 9129154	Standard	NM_001114309		Approved	EPR-1, ESE-1, ERT	uc001gxh.4	P78545	OTTHUMG00000035867	ENST00000359651.3:c.1058A>C	1.37:g.201984393A>C	ENSP00000352673:p.Lys353Thr	Somatic	56	0		WXS	Illumina HiSeq	.	117	25	NM_001114309		Missense_Mutation	SNP	ENST00000359651.3	37	CCDS1419.1	.	.	.	.	.	.	.	.	.	.	A	26.3	4.727343	0.89390	.	.	ENSG00000163435	ENST00000359651;ENST00000367284;ENST00000367283;ENST00000310044	T;T;T	0.17370	2.28;2.28;2.28	4.61	4.61	0.57282	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (4);	0.000000	0.85682	D	0.000000	T	0.45458	0.1343	M	0.85777	2.775	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.52852	-0.8520	10	0.87932	D	0	.	13.1767	0.59630	1.0:0.0:0.0:0.0	.	353	P78545	ELF3_HUMAN	T	353;353;353;330	ENSP00000352673:K353T;ENSP00000356253:K353T;ENSP00000356252:K353T	ENSP00000311348:K330T	K	+	2	0	ELF3	200251016	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.101000	0.94219	1.961000	0.56991	0.454000	0.30748	AAG	.		0.542	ELF3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087360.1	NM_004433	
EEA1	8411	hgsc.bcm.edu	37	12	93226362	93226362	+	Nonsense_Mutation	SNP	C	C	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr12:93226362C>A	ENST00000322349.8	-	11	1444	c.1180G>T	c.(1180-1182)Gag>Tag	p.E394*		NM_003566.3	NP_003557	Q15075	EEA1_HUMAN	early endosome antigen 1	394					early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|synaptic vesicle to endosome fusion (GO:0016189)|vesicle fusion (GO:0006906)	axonal spine (GO:0044308)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|recycling endosome (GO:0055037)|serine-pyruvate aminotransferase complex (GO:0005969)	1-phosphatidylinositol binding (GO:0005545)|calmodulin binding (GO:0005516)|GTP-dependent protein binding (GO:0030742)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(11)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	36						TGCTTAAACTCCGCCTTTAGA	0.368																																					p.E394X		.											.	.	.	0			c.G1180T						.						175.0	164.0	167.0					12																	93226362		2203	4300	6503	SO:0001587	stop_gained	8411	exon11			TAAACTCCGCCTT	L40157	CCDS31874.1	12q22	2007-02-23	2007-02-23			ENSG00000102189		"""Zinc fingers, FYVE domain containing"""	3185	protein-coding gene	gene with protein product		605070	"""early endosome antigen 1, 162kD"""			7768953, 9697774	Standard	NM_003566		Approved	ZFYVE2	uc001tck.3	Q15075	OTTHUMG00000170110	ENST00000322349.8:c.1180G>T	12.37:g.93226362C>A	ENSP00000317955:p.Glu394*	Somatic	81	0		WXS	Illumina HiSeq	.	80	4	NM_003566	Q14221	Nonsense_Mutation	SNP	ENST00000322349.8	37	CCDS31874.1	.	.	.	.	.	.	.	.	.	.	C	37	6.571795	0.97671	.	.	ENSG00000102189	ENST00000322349	.	.	.	5.52	5.52	0.82312	.	0.000000	0.53938	D	0.000049	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	19.4513	0.94869	0.0:1.0:0.0:0.0	.	.	.	.	X	394	.	ENSP00000317955:E394X	E	-	1	0	EEA1	91750493	1.000000	0.71417	0.967000	0.41034	0.315000	0.28087	6.625000	0.74248	2.577000	0.86979	0.655000	0.94253	GAG	.		0.368	EEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407304.1	NM_003566	
HUNK	30811	hgsc.bcm.edu	37	21	33362484	33362484	+	Missense_Mutation	SNP	G	G	T	rs367545209		TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr21:33362484G>T	ENST00000270112.2	+	9	1660	c.1300G>T	c.(1300-1302)Gtg>Ttg	p.V434L	HUNK_ENST00000465574.1_3'UTR	NM_014586.1	NP_055401.1	P57058	HUNK_HUMAN	hormonally up-regulated Neu-associated kinase	434					multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(2)|stomach(1)	30						ATTCCATGCCGTGCAGGTAAG	0.438																																					p.V434L		.											HUNK,NS,carcinoma,0,1	HUNK	0	0			c.G1300T						.						120.0	112.0	115.0					21																	33362484		2203	4300	6503	SO:0001583	missense	30811	exon9			CATGCCGTGCAGG	AJ271722	CCDS13610.1	21q22.1	2008-06-05	2008-06-05		ENSG00000142149	ENSG00000142149			13326	protein-coding gene	gene with protein product		606532	"""hormonally upregulated Neu-associated kinase"""			10662544, 10830953	Standard	NM_014586		Approved		uc002yph.3	P57058	OTTHUMG00000085019	ENST00000270112.2:c.1300G>T	21.37:g.33362484G>T	ENSP00000270112:p.Val434Leu	Somatic	35	0		WXS	Illumina HiSeq	.	33	2	NM_014586		Missense_Mutation	SNP	ENST00000270112.2	37	CCDS13610.1	.	.	.	.	.	.	.	.	.	.	G	8.464	0.856084	0.17106	.	.	ENSG00000142149	ENST00000270112;ENST00000439107	T	0.66638	-0.22	4.0	2.13	0.27403	.	0.613740	0.15215	N	0.274279	T	0.47021	0.1423	N	0.14661	0.345	0.29457	N	0.858058	B	0.09022	0.002	B	0.06405	0.002	T	0.41270	-0.9518	10	0.38643	T	0.18	-10.6358	10.3216	0.43769	0.0:0.391:0.609:0.0	.	434	P57058	HUNK_HUMAN	L	434;48	ENSP00000270112:V434L	ENSP00000270112:V434L	V	+	1	0	HUNK	32284355	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.569000	0.45973	0.611000	0.30052	0.655000	0.94253	GTG	.		0.438	HUNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192782.1	NM_014586	
MIA	8190	hgsc.bcm.edu	37	19	41281791	41281791	+	Splice_Site	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr19:41281791G>T	ENST00000263369.3	+	2	427		c.e2+1		RAB4B-EGLN2_ENST00000594136.1_5'Flank|MIA-RAB4B_ENST00000600729.1_Splice_Site|RAB4B_ENST00000594800.1_5'Flank|MIA_ENST00000597784.1_Splice_Site|RAB4B_ENST00000357052.2_5'Flank|MIA_ENST00000594436.1_Splice_Site	NM_006533.3	NP_006524.1	Q16674	MIA_HUMAN	melanoma inhibitory activity						cell proliferation (GO:0008283)	extracellular space (GO:0005615)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)	4			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)	GBM - Glioblastoma multiforme(1328;0.0199)		GGGAGGCAGCGTGAGTCTTGG	0.562																																					.		.											.	.	.	0			c.261+1G>T						.						43.0	47.0	46.0					19																	41281791		2203	4300	6503	SO:0001630	splice_region_variant	8190	exon3			GGCAGCGTGAGTC	X75450	CCDS12566.1	19q13.2	2012-10-15			ENSG00000261857	ENSG00000261857			7076	protein-coding gene	gene with protein product		601340				7923218, 8661134	Standard	NM_006533		Approved	CD-RAP	uc021uuu.1	Q16674		ENST00000263369.3:c.261+1G>T	19.37:g.41281791G>T		Somatic	77	0		WXS	Illumina HiSeq	.	63	4	NM_001202553	Q6FHV3	Splice_Site	SNP	ENST00000263369.3	37	CCDS12566.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.952922	0.73787	.	.	ENSG00000167578	ENST00000419646;ENST00000263369	.	.	.	5.01	5.01	0.66863	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.0974	0.86639	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RAB4B	45973631	1.000000	0.71417	0.999000	0.59377	0.969000	0.65631	7.501000	0.81600	2.298000	0.77334	0.561000	0.74099	.	.		0.562	MIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463162.1		Intron
MROH9	80133	hgsc.bcm.edu	37	1	170934396	170934396	+	Splice_Site	SNP	C	C	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr1:170934396C>T	ENST00000367758.3	+	7	579	c.480C>T	c.(478-480)taC>taT	p.Y160Y	MROH9_ENST00000367759.4_Splice_Site_p.Y160Y	NM_025063.2	NP_079339.2	Q5TGP6	MROH9_HUMAN	maestro heat-like repeat family member 9	160			Y -> H (in dbSNP:rs16863872).					p.Y160Y(2)									TCAGAAAATACGTAAGTCACA	0.398																																					p.Y160Y		.											C1orf129_ENST00000367759,NS,carcinoma,0,2	C1orf129_ENST00000367759	0	2	Substitution - coding silent(2)	kidney(2)	c.C480T						.						117.0	110.0	112.0					1																	170934396		1911	4131	6042	SO:0001630	splice_region_variant	80133	exon7			AAAATACGTAAGT	AK027203	CCDS41436.1, CCDS53429.1	1q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000117501	ENSG00000117501		"""maestro heat-like repeat containing"""	26287	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 129"""	C1orf129			Standard	NM_025063		Approved	FLJ23550, ARMC11	uc010plz.2	Q5TGP6	OTTHUMG00000041456	ENST00000367758.3:c.480+1C>T	1.37:g.170934396C>T		Somatic	39	0		WXS	Illumina HiSeq	.	68	3	NM_025063	A0PJM0|A0PJM2|F5GWX6|Q9H5D7	Silent	SNP	ENST00000367758.3	37	CCDS41436.1																																																																																			.		0.398	MROH9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000099327.1	NM_025063	Silent
NPM1	4869	hgsc.bcm.edu	37	5	170819801	170819801	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr5:170819801G>T	ENST00000296930.5	+	5	741	c.440G>T	c.(439-441)gGt>gTt	p.G147V	NPM1_ENST00000351986.6_Missense_Mutation_p.G147V|NPM1_ENST00000517671.1_Missense_Mutation_p.G147V|NPM1_ENST00000393820.2_Missense_Mutation_p.G147V	NM_002520.6	NP_002511.1	P06748	NPM_HUMAN	nucleophosmin (nucleolar phosphoprotein B23, numatrin)	147	Required for interaction with SENP3.				cell aging (GO:0007569)|CENP-A containing nucleosome assembly (GO:0034080)|centrosome cycle (GO:0007098)|DNA repair (GO:0006281)|intracellular protein transport (GO:0006886)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of centrosome duplication (GO:0010826)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|nucleocytoplasmic transport (GO:0006913)|nucleosome assembly (GO:0006334)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of translation (GO:0045727)|protein localization (GO:0008104)|protein oligomerization (GO:0051259)|regulation of centriole replication (GO:0046599)|regulation of eIF2 alpha phosphorylation by dsRNA (GO:0060735)|regulation of endodeoxyribonuclease activity (GO:0032071)|regulation of endoribonuclease activity (GO:0060699)|response to stress (GO:0006950)|ribosome assembly (GO:0042255)|signal transduction (GO:0007165)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle pole centrosome (GO:0031616)	histone binding (GO:0042393)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)|ribosomal large subunit binding (GO:0043023)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|unfolded protein binding (GO:0051082)	p.G147D(2)	NPM1/ALK(632)	central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(4261)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	4269	Renal(175;0.000159)|Lung NSC(126;0.00576)|all_lung(126;0.00963)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GCCCCTGGAGGTGGTAGCAAG	0.408			"""T, F """	"""ALK, RARA, MLF1"""	"""NHL, APL, AML"""																																p.G147V		.		Dom	yes		5	5q35	4869	"""nucleophosmin (nucleolar phosphoprotein B23, numatrin)"""		L	NPM1_ENST00000393820,NS,carcinoma,0,2	NPM1_ENST00000393820	0	2	Substitution - Missense(2)	lung(2)	c.G440T						.						131.0	154.0	146.0					5																	170819801		2202	4300	6502	SO:0001583	missense	4869	exon5			CTGGAGGTGGTAG	M26697	CCDS4376.1, CCDS4377.1, CCDS43399.1	5q35.1	2014-09-17			ENSG00000181163	ENSG00000181163			7910	protein-coding gene	gene with protein product	"""nucleolar phosphoprotein B23"", ""numatrin"", ""nucleophosmin/nucleoplasmin family, member 1"""	164040				8471164, 8122112	Standard	NM_002520		Approved	B23, NPM	uc003mbi.3	P06748	OTTHUMG00000130465	ENST00000296930.5:c.440G>T	5.37:g.170819801G>T	ENSP00000296930:p.Gly147Val	Somatic	44	0		WXS	Illumina HiSeq	.	53	3	NM_199185	A8K3N7|B5BU00|D3DQL6|P08693|Q12826|Q13440|Q13441|Q14115|Q5EU94|Q5EU95|Q5EU96|Q5EU97|Q5EU98|Q5EU99|Q6V962|Q8WTW5|Q96AT6|Q96DC4|Q96EA5|Q9BYG9|Q9UDJ7	Missense_Mutation	SNP	ENST00000296930.5	37	CCDS4376.1	.	.	.	.	.	.	.	.	.	.	G	9.431	1.085506	0.20390	.	.	ENSG00000181163	ENST00000517671;ENST00000296930;ENST00000521672;ENST00000351986;ENST00000393820	T;T;T;T	0.46451	0.93;0.93;0.87;0.89	3.73	1.29	0.21616	.	1.477350	0.05053	U	0.478499	T	0.40272	0.1110	L	0.49126	1.545	0.42686	D	0.993564	B;B;B	0.15473	0.002;0.013;0.003	B;B;B	0.26693	0.018;0.072;0.021	T	0.24012	-1.0172	10	0.34782	T	0.22	.	8.1015	0.30859	0.0:0.3604:0.4553:0.1843	.	147;147;147	P06748-2;P06748;Q9BYG9	.;NPM_HUMAN;.	V	147;147;83;147;147	ENSP00000428755:G147V;ENSP00000296930:G147V;ENSP00000341168:G147V;ENSP00000377408:G147V	ENSP00000296930:G147V	G	+	2	0	NPM1	170752406	0.996000	0.38824	0.999000	0.59377	0.986000	0.74619	1.202000	0.32271	0.664000	0.31047	0.484000	0.47621	GGT	.		0.408	NPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252858.2	NM_002520	
KIF19	124602	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	72341086	72341086	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr17:72341086G>A	ENST00000389916.4	+	7	907	c.769G>A	c.(769-771)Gcc>Acc	p.A257T		NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	257	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						CTCAGAGCGCGCCTCGCAGGT	0.667																																					p.A257T		.											.	.	.	0			c.G769A						.						17.0	17.0	17.0					17																	72341086		2201	4294	6495	SO:0001583	missense	124602	exon7			GAGCGCGCCTCGC	AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.769G>A	17.37:g.72341086G>A	ENSP00000374566:p.Ala257Thr	Somatic	21	0		WXS	Illumina HiSeq	.	37	7	NM_153209	A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Missense_Mutation	SNP	ENST00000389916.4	37	CCDS32718.2	.	.	.	.	.	.	.	.	.	.	G	21.0	4.087855	0.76642	.	.	ENSG00000196169	ENST00000551294;ENST00000389916	T;T	0.73469	-0.75;-0.75	5.54	5.54	0.83059	Kinesin, motor domain (5);	.	.	.	.	D	0.86863	0.6035	M	0.78456	2.415	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.999;0.997	D	0.87882	0.2678	9	0.72032	D	0.01	.	18.3053	0.90179	0.0:0.0:1.0:0.0	.	257;215;215;257	Q2TAC6;F8VW50;Q2TAC6-3;Q2TAC6-2	KIF19_HUMAN;.;.;.	T	215;257	ENSP00000449134:A215T;ENSP00000374566:A257T	ENSP00000374566:A257T	A	+	1	0	KIF19	69852681	1.000000	0.71417	0.709000	0.30452	0.035000	0.12851	9.199000	0.95003	2.635000	0.89317	0.485000	0.47835	GCC	.		0.667	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319644.2	NM_153209	
FERMT1	55612	hgsc.bcm.edu;broad.mit.edu	37	20	6093271	6093271	+	Splice_Site	SNP	C	C	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr20:6093271C>T	ENST00000217289.4	-	4	1174		c.e4-1		FERMT1_ENST00000536936.1_Splice_Site	NM_017671.4	NP_060141.3	Q9BQL6	FERM1_HUMAN	fermitin family member 1						cell adhesion (GO:0007155)|establishment of epithelial cell polarity (GO:0090162)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	17						CTTCTAATATCTAGaaataaa	0.279																																					.		.											FERMT1_ENST00000339538,NS,adenocarcinoma,0,2	FERMT1_ENST00000339538	0	0			c.386-1G>A						.						29.0	31.0	30.0					20																	6093271		2165	4273	6438	SO:0001630	splice_region_variant	55612	exon5			TAATATCTAGAAA	AK000123	CCDS13098.1	20p12.3	2013-01-10	2010-06-24	2007-12-14	ENSG00000101311	ENSG00000101311		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	15889	protein-coding gene	gene with protein product	"""kindlin-1"", ""kinderlin"""	607900	"""chromosome 20 open reading frame 42"", ""fermitin family homolog 1 (Drosophila)"""	C20orf42		12697302, 12789646	Standard	NM_017671		Approved	FLJ20116, URP1, KIND1, UNC112A	uc002wmr.3	Q9BQL6	OTTHUMG00000031826	ENST00000217289.4:c.386-1G>A	20.37:g.6093271C>T		Somatic	52	0		WXS	Illumina HiSeq	.	43	4	NM_017671	D3DW10|Q8IX34|Q8IYH2|Q9NWM2|Q9NXQ3	Splice_Site	SNP	ENST00000217289.4	37	CCDS13098.1	.	.	.	.	.	.	.	.	.	.	C	18.37	3.608654	0.66558	.	.	ENSG00000101311	ENST00000217289;ENST00000339538;ENST00000378844	.	.	.	5.63	4.69	0.59074	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8469	0.70267	0.0:0.9308:0.0:0.0692	.	.	.	.	.	-1	.	.	.	-	.	.	FERMT1	6041271	1.000000	0.71417	0.998000	0.56505	0.917000	0.54804	7.011000	0.76359	1.515000	0.48885	0.655000	0.94253	.	.		0.279	FERMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077908.2	NM_017671	Intron
GATAD2A	54815	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	19576284	19576284	+	Missense_Mutation	SNP	G	G	A	rs527342598		TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr19:19576284G>A	ENST00000360315.3	+	2	442	c.130G>A	c.(130-132)Gga>Aga	p.G44R	GATAD2A_ENST00000358713.3_Missense_Mutation_p.G44R|GATAD2A_ENST00000537887.1_5'UTR|GATAD2A_ENST00000429563.2_5'Flank|GATAD2A_ENST00000404158.1_Missense_Mutation_p.G44R|GATAD2A_ENST00000252577.5_Missense_Mutation_p.G44R	NM_017660.3	NP_060130.3	Q86YP4	P66A_HUMAN	GATA zinc finger domain containing 2A	44					anterior neuropore closure (GO:0021506)|blood vessel development (GO:0001568)|DNA methylation (GO:0006306)|embryonic body morphogenesis (GO:0010172)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|neural fold formation (GO:0001842)|programmed cell death (GO:0012501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|NuRD complex (GO:0016581)	protein binding, bridging (GO:0030674)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	13						AAACACTGACGGAGACATGAG	0.547													G|||	1	0.000199681	0.0	0.0	5008	,	,		20086	0.0		0.001	False		,,,				2504	0.0				p.G44R		.											.	.	.	0			c.G130A						.						88.0	88.0	88.0					19																	19576284		1568	3582	5150	SO:0001583	missense	54815	exon2			ACTGACGGAGACA	AL390164	CCDS12402.2	19p13.11	2013-01-25			ENSG00000167491	ENSG00000167491		"""GATA zinc finger domain containing"""	29989	protein-coding gene	gene with protein product	"""p66 alpha"""	614997				12183469	Standard	NM_017660		Approved	p66alpha	uc010xqt.2	Q86YP4	OTTHUMG00000152541	ENST00000360315.3:c.130G>A	19.37:g.19576284G>A	ENSP00000353463:p.Gly44Arg	Somatic	42	0		WXS	Illumina HiSeq	.	45	13	NM_017660	B5MC40|Q7L3J2|Q96F28|Q9NPU2|Q9NXS1	Missense_Mutation	SNP	ENST00000360315.3	37	CCDS12402.2	.	.	.	.	.	.	.	.	.	.	G	14.27	2.484631	0.44147	.	.	ENSG00000167491	ENST00000417582;ENST00000360315;ENST00000252577;ENST00000457895;ENST00000432704;ENST00000404158;ENST00000429242;ENST00000358713;ENST00000444839	T;T;T;T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02;1.02;1.02;1.02	5.52	2.23	0.28157	.	0.386750	0.29537	N	0.011877	T	0.34308	0.0893	L	0.47716	1.5	0.51482	D	0.999928	D;D	0.57257	0.979;0.977	B;B	0.42319	0.383;0.383	T	0.19582	-1.0301	10	0.66056	D	0.02	-24.331	9.6	0.39598	0.232:0.0:0.768:0.0	.	63;44	B5MC40;Q86YP4	.;P66A_HUMAN	R	44;44;44;44;44;63;44;44;44	ENSP00000403703:G44R;ENSP00000353463:G44R;ENSP00000252577:G44R;ENSP00000404212:G44R;ENSP00000390495:G44R;ENSP00000414252:G44R;ENSP00000351552:G44R;ENSP00000407293:G44R	ENSP00000252577:G44R	G	+	1	0	GATAD2A	19437284	0.808000	0.29022	0.022000	0.16811	0.955000	0.61496	1.437000	0.34991	0.708000	0.31955	0.655000	0.94253	GGA	.		0.547	GATAD2A-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326671.4	NM_017660	
DAPK1	1612	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	90254352	90254352	+	Missense_Mutation	SNP	C	C	G	rs369801129		TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr9:90254352C>G	ENST00000408954.3	+	5	842	c.507C>G	c.(505-507)gaC>gaG	p.D169E	DAPK1_ENST00000472284.1_Missense_Mutation_p.D169E|DAPK1_ENST00000469640.2_Missense_Mutation_p.D169E|DAPK1_ENST00000358077.5_Missense_Mutation_p.D169E|DAPK1_ENST00000491893.1_Missense_Mutation_p.D169E	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1	169	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						ATAAAATTGACTTTGGAAATG	0.373									Chronic Lymphocytic Leukemia, Familial Clustering of																												p.D169E		.											.	.	.	0			c.C507G						.	C	GLU/ASP	1,3629		0,1,1814	103.0	99.0	101.0		507	4.2	1.0	9		101	0,8146		0,0,4073	no	missense	DAPK1	NM_004938.2	45	0,1,5887	GG,GC,CC		0.0,0.0275,0.0085	benign	169/1431	90254352	1,11775	1815	4073	5888	SO:0001583	missense	1612	exon5	Familial Cancer Database	Familial CLL	AATTGACTTTGGA	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.507C>G	9.37:g.90254352C>G	ENSP00000386135:p.Asp169Glu	Somatic	62	0		WXS	Illumina HiSeq	.	61	9	NM_004938	B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	Missense_Mutation	SNP	ENST00000408954.3	37	CCDS43842.1	.	.	.	.	.	.	.	.	.	.	C	3.699	-0.061993	0.07317	2.75E-4	0.0	ENSG00000196730	ENST00000358077;ENST00000472284;ENST00000469640;ENST00000408954;ENST00000491893	T;T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05;-0.05	5.12	4.22	0.49857	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.53938	D	0.000041	T	0.43853	0.1266	N	0.25144	0.715	0.54753	D	0.999985	B;B;B	0.17852	0.002;0.001;0.024	B;B;B	0.19391	0.025;0.005;0.024	T	0.27054	-1.0085	10	0.07990	T	0.79	.	11.9098	0.52733	0.0:0.8542:0.0:0.1458	.	169;169;169	B7ZLE7;B7Z454;P53355	.;.;DAPK1_HUMAN	E	169	ENSP00000350785:D169E;ENSP00000417076:D169E;ENSP00000418885:D169E;ENSP00000386135:D169E;ENSP00000419026:D169E	ENSP00000350785:D169E	D	+	3	2	DAPK1	89444172	0.529000	0.26322	1.000000	0.80357	0.987000	0.75469	-0.226000	0.09139	1.512000	0.48834	0.563000	0.77884	GAC	.		0.373	DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356843.1	NM_004938	
ISY1	57461	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	128853021	128853021	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr3:128853021C>T	ENST00000393295.3	-	9	876	c.559G>A	c.(559-561)Gaa>Aaa	p.E187K	ISY1_ENST00000393292.3_Missense_Mutation_p.G188E|ISY1_ENST00000471497.1_Intron|ISY1-RAB43_ENST00000418265.1_Missense_Mutation_p.E187K|ISY1_ENST00000273541.8_Missense_Mutation_p.E209K	NM_001199469.1|NM_020701.3	NP_001186398.1|NP_065752.1	Q9ULR0	ISY1_HUMAN	ISY1 splicing factor homolog (S. cerevisiae)	187					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(1)|lung(10)|prostate(1)|skin(1)	15						TTCCACTTTTCCACTAACTCG	0.478																																					p.E209K		.											.	.	.	0			c.G625A						.						149.0	142.0	144.0					3																	128853021		1923	4148	6071	SO:0001583	missense	57461	exon10			ACTTTTCCACTAA		CCDS43149.1, CCDS56277.1	3q21.3	2008-11-25			ENSG00000240682	ENSG00000240682			29201	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 33"""	612764				16103217	Standard	NM_020701		Approved	KIAA1160, fSAP33		Q9ULR0	OTTHUMG00000137365	ENST00000393295.3:c.559G>A	3.37:g.128853021C>T	ENSP00000376973:p.Glu187Lys	Somatic	22	0		WXS	Illumina HiSeq	.	32	8	NM_001199469	Q96IL2|Q9BT05	Missense_Mutation	SNP	ENST00000393295.3	37	CCDS43149.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.99|15.99	2.994721|2.994721	0.54041|0.54041	.|.	.|.	ENSG00000240682|ENSG00000240682	ENST00000418265;ENST00000393295;ENST00000273541|ENST00000393292	T|.	0.32753|.	1.44|.	5.64|5.64	5.64|5.64	0.86602|0.86602	.|.	0.112845|.	0.64402|.	D|.	0.000014|.	T|T	0.36248|0.36248	0.0960|0.0960	L|L	0.39397|0.39397	1.21|1.21	0.19945|0.19945	N|N	0.999948|0.999948	B;B;B|.	0.23185|.	0.004;0.009;0.081|.	B;B;B|.	0.21708|.	0.008;0.016;0.036|.	T|T	0.30504|0.30504	-0.9976|-0.9976	10|6	0.17369|0.02654	T|T	0.5|1	.|.	15.1929|15.1929	0.73060|0.73060	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	209;187;187|.	Q9ULR0-2;Q9ULR0;Q9ULR0-1|.	.;ISY1_HUMAN;.|.	K|E	187;187;209|188	ENSP00000273541:E209K|.	ENSP00000273541:E209K|ENSP00000376970:G188E	E|G	-|-	1|2	0|0	ISY1|ISY1	130335711|130335711	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.847000|0.847000	0.48162|0.48162	4.137000|4.137000	0.58010|0.58010	2.650000|2.650000	0.89964|0.89964	0.585000|0.585000	0.79938|0.79938	GAA|GGA	.		0.478	ISY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000267856.1	NM_020701	
SDK1	221935	hgsc.bcm.edu	37	7	3678685	3678685	+	Missense_Mutation	SNP	G	G	A	rs549922689		TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr7:3678685G>A	ENST00000404826.2	+	3	647	c.508G>A	c.(508-510)Gtg>Atg	p.V170M	SDK1_ENST00000389531.3_Missense_Mutation_p.V170M	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	170	Ig-like C2-type 1.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		TTACCGCTGCGTGGTGCGAAA	0.408													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17665	0.0		0.0	False		,,,				2504	0.0				p.V170M		.											SDK1,colon,carcinoma,0,1	SDK1	0	0			c.G508A						.						79.0	69.0	72.0					7																	3678685		2203	4300	6503	SO:0001583	missense	221935	exon3			CGCTGCGTGGTGC	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.508G>A	7.37:g.3678685G>A	ENSP00000385899:p.Val170Met	Somatic	28	0		WXS	Illumina HiSeq	.	35	2	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	37	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	G	14.98	2.697881	0.48307	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.12361	2.69;2.69	4.89	4.0	0.46444	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);	0.203960	0.24628	N	0.036912	T	0.24774	0.0601	L	0.56280	1.765	0.31490	N	0.666094	D	0.64830	0.994	P	0.58780	0.845	T	0.12837	-1.0532	10	0.52906	T	0.07	.	9.4304	0.38606	0.1726:0.0:0.8274:0.0	.	170	Q7Z5N4	SDK1_HUMAN	M	170	ENSP00000385899:V170M;ENSP00000374182:V170M	ENSP00000374182:V170M	V	+	1	0	SDK1	3645211	0.902000	0.30710	0.971000	0.41717	0.995000	0.86356	1.310000	0.33551	1.165000	0.42670	0.563000	0.77884	GTG	.		0.408	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
ABCC11	85320	hgsc.bcm.edu	37	16	48249190	48249190	+	Silent	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr16:48249190G>T	ENST00000394747.1	-	7	1366	c.1017C>A	c.(1015-1017)atC>atA	p.I339I	ABCC11_ENST00000356608.2_Silent_p.I339I|ABCC11_ENST00000537808.1_Silent_p.I339I|ABCC11_ENST00000394748.1_Silent_p.I339I|ABCC11_ENST00000353782.5_Silent_p.I339I	NM_033151.3	NP_149163.2	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 11	339	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				organic anion transport (GO:0015711)|purine nucleotide transport (GO:0015865)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)|purine nucleotide transmembrane transporter activity (GO:0015216)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(3)|prostate(2)|skin(5)|urinary_tract(2)	83		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)			Conjugated Estrogens(DB00286)|Folic Acid(DB00158)|Indomethacin(DB00328)|Methotrexate(DB00563)|Probenecid(DB01032)	TGGTCACACGGATGCGCTGGT	0.438																																					p.I339I		.											ABCC11,right_upper_lobe,carcinoma,0,1	ABCC11	0	0			c.C1017A						.						138.0	129.0	132.0					16																	48249190		2201	4300	6501	SO:0001819	synonymous_variant	85320	exon7			CACACGGATGCGC	AF367202	CCDS10732.1, CCDS10733.1	16q12	2012-03-14			ENSG00000121270	ENSG00000121270		"""ATP binding cassette transporters / subfamily C"""	14639	protein-coding gene	gene with protein product		607040				11483364, 11435397	Standard	NM_033151		Approved	MRP8	uc002efg.1	Q96J66	OTTHUMG00000133146	ENST00000394747.1:c.1017C>A	16.37:g.48249190G>T		Somatic	24	0		WXS	Illumina HiSeq	.	23	2	NM_033151	Q8TDJ0|Q96JA6|Q9BX80	Silent	SNP	ENST00000394747.1	37	CCDS10732.1																																																																																			.		0.438	ABCC11-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429984.1	NM_032583	
MINA	84864	hgsc.bcm.edu	37	3	97668828	97668828	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr3:97668828C>A	ENST00000333396.7	-	7	1502	c.920G>T	c.(919-921)cGa>cTa	p.R307L	MINA_ENST00000360258.4_Missense_Mutation_p.R306L|MINA_ENST00000394198.2_Missense_Mutation_p.R307L	NM_001042533.2|NM_032778.5	NP_001035998.1|NP_116167.3			MYC induced nuclear antigen											breast(2)|endometrium(1)|large_intestine(1)|lung(8)|ovary(1)	13						GCCACTTAATCGTCTTGTAGC	0.512																																					p.R307L		.											.	.	.	0			c.G920T						.						99.0	90.0	93.0					3																	97668828		2203	4300	6503	SO:0001583	missense	84864	exon7			CTTAATCGTCTTG	AB083189	CCDS2929.1, CCDS43114.1	3q22.1	2005-07-22			ENSG00000170854	ENSG00000170854			19441	protein-coding gene	gene with protein product		612049				12091391	Standard	NM_001042533		Approved	MINA53, FLJ14393, mdig	uc003dsb.1	Q8IUF8	OTTHUMG00000160107	ENST00000333396.7:c.920G>T	3.37:g.97668828C>A	ENSP00000328251:p.Arg307Leu	Somatic	24	0		WXS	Illumina HiSeq	.	52	4	NM_001042533		Missense_Mutation	SNP	ENST00000333396.7	37	CCDS43114.1	.	.	.	.	.	.	.	.	.	.	C	16.57	3.159278	0.57368	.	.	ENSG00000170854	ENST00000442492;ENST00000333396;ENST00000394198;ENST00000360258	T;T;T	0.16196	3.05;3.05;2.36	5.6	-1.97	0.07503	Cupin, JmjC-type (1);	0.461581	0.25558	N	0.029851	T	0.12860	0.0312	L	0.43152	1.355	0.09310	N	1	B;B	0.31256	0.27;0.316	B;B	0.35727	0.132;0.209	T	0.24012	-1.0172	10	0.29301	T	0.29	-1.991	7.8975	0.29715	0.0:0.2117:0.1295:0.6588	.	306;307	Q8IUF8-4;Q8IUF8	.;MINA_HUMAN	L	53;307;307;306	ENSP00000328251:R307L;ENSP00000377748:R307L;ENSP00000353395:R306L	ENSP00000328251:R307L	R	-	2	0	MINA	99151518	0.000000	0.05858	0.000000	0.03702	0.444000	0.32077	-0.689000	0.05144	-0.465000	0.06953	-0.302000	0.09304	CGA	.		0.512	MINA-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359244.3	NM_032778	
CNTN5	53942	hgsc.bcm.edu	37	11	100095501	100095501	+	Silent	SNP	C	C	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr11:100095501C>A	ENST00000524871.1	+	16	2252	c.1962C>A	c.(1960-1962)acC>acA	p.T654T	CNTN5_ENST00000279463.3_Silent_p.T654T|CNTN5_ENST00000528682.1_Silent_p.T654T|CNTN5_ENST00000524560.1_Intron|CNTN5_ENST00000418526.2_Silent_p.T580T|CNTN5_ENST00000527185.1_Silent_p.T654T	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	654	Ig-like C2-type 6.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.T654T(2)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		GGGTACAGACCACAGCAGACA	0.453																																					p.T654T		.											CNTN5_ENST00000524871,NS,carcinoma,0,2	CNTN5_ENST00000524871	0	2	Substitution - coding silent(2)	lung(2)	c.C1962A						.						119.0	118.0	118.0					11																	100095501		2005	4187	6192	SO:0001819	synonymous_variant	53942	exon15			ACAGACCACAGCA	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.1962C>A	11.37:g.100095501C>A		Somatic	18	0		WXS	Illumina HiSeq	.	20	2	NM_001243270	A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Silent	SNP	ENST00000524871.1	37	CCDS53696.1																																																																																			.		0.453	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361	
DMXL2	23312	hgsc.bcm.edu	37	15	51780309	51780309	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr15:51780309G>T	ENST00000251076.5	-	22	5346	c.5059C>A	c.(5059-5061)Cat>Aat	p.H1687N	RP11-707P17.1_ENST00000561007.1_RNA|DMXL2_ENST00000543779.2_Missense_Mutation_p.H1687N|DMXL2_ENST00000449909.3_Missense_Mutation_p.H1051N	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	1687						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		TTTTCATCATGCTGTGACCTG	0.318																																					p.H1687N		.											.	.	.	0			c.C5059A						.						84.0	84.0	84.0					15																	51780309		2196	4293	6489	SO:0001583	missense	23312	exon22			CATCATGCTGTGA	AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.5059C>A	15.37:g.51780309G>T	ENSP00000251076:p.His1687Asn	Somatic	59	0		WXS	Illumina HiSeq	.	65	4	NM_001174116	B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	ENST00000251076.5	37	CCDS10141.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.073458	0.76415	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909	T;T;T	0.40225	1.04;1.04;1.04	5.27	5.27	0.74061	.	0.045744	0.85682	D	0.000000	T	0.46737	0.1408	L	0.35414	1.06	0.50813	D	0.999894	B;P;P	0.43231	0.185;0.801;0.608	B;P;B	0.48952	0.1;0.596;0.382	T	0.48468	-0.9033	10	0.72032	D	0.01	.	18.8702	0.92309	0.0:0.0:1.0:0.0	.	1687;1051;1687	F5GWF1;B2RTR3;Q8TDJ6	.;.;DMXL2_HUMAN	N	1687;1687;1051	ENSP00000251076:H1687N;ENSP00000441858:H1687N;ENSP00000400855:H1051N	ENSP00000251076:H1687N	H	-	1	0	DMXL2	49567601	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.538000	0.60650	2.442000	0.82660	0.585000	0.79938	CAT	.		0.318	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263	
ANGEL1	23357	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	77274347	77274347	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr14:77274347T>C	ENST00000251089.2	-	3	906	c.794A>G	c.(793-795)tAt>tGt	p.Y265C	ANGEL1_ENST00000554941.1_5'Flank	NM_015305.3	NP_056120.2	Q9UNK9	ANGE1_HUMAN	angel homolog 1 (Drosophila)	265										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	22			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0285)		GCAATGTAGATAGAGCTCTGA	0.522																																					p.Y265C		.											.	.	.	0			c.A794G						.						112.0	99.0	103.0					14																	77274347		2203	4300	6503	SO:0001583	missense	23357	exon3			TGTAGATAGAGCT	AF111169	CCDS9852.1	14q24.3	2014-06-17		2005-08-04	ENSG00000013523	ENSG00000013523			19961	protein-coding gene	gene with protein product				KIAA0759		11943475	Standard	NM_015305		Approved	Ccr4e	uc001xsv.3	Q9UNK9	OTTHUMG00000171494	ENST00000251089.2:c.794A>G	14.37:g.77274347T>C	ENSP00000251089:p.Tyr265Cys	Somatic	32	0		WXS	Illumina HiSeq	.	23	5	NM_015305	B4DWL7|O94859|Q8NCS9	Missense_Mutation	SNP	ENST00000251089.2	37	CCDS9852.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.256556	0.80246	.	.	ENSG00000013523	ENST00000251089	T	0.50277	0.75	5.43	5.43	0.79202	Endonuclease/exonuclease/phosphatase (2);	0.000000	0.85682	D	0.000000	T	0.75975	0.3923	M	0.92880	3.355	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82780	-0.0288	10	0.87932	D	0	-4.5631	15.4858	0.75564	0.0:0.0:0.0:1.0	.	265	Q9UNK9	ANGE1_HUMAN	C	265	ENSP00000251089:Y265C	ENSP00000251089:Y265C	Y	-	2	0	ANGEL1	76344100	1.000000	0.71417	0.994000	0.49952	0.988000	0.76386	8.040000	0.89188	2.070000	0.61991	0.459000	0.35465	TAT	.		0.522	ANGEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413712.2	NM_015305	
ZNF716	441234	hgsc.bcm.edu;bcgsc.ca	37	7	57528453	57528453	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr7:57528453G>T	ENST00000420713.1	+	4	398	c.286G>T	c.(286-288)Gac>Tac	p.D96Y		NM_001159279.1	NP_001152751.1	A6NP11	ZN716_HUMAN	zinc finger protein 716	96					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(1)|lung(20)|ovary(2)	24						TTTCACCCAAGACCTTCAGTC	0.328																																					p.D96Y		.											ZNF716_ENST00000420713,NS,carcinoma,0,2	ZNF716_ENST00000420713	0	0			c.G286T						.						62.0	61.0	62.0					7																	57528453		692	1591	2283	SO:0001583	missense	441234	exon4			ACCCAAGACCTTC	AK131575	CCDS55112.1	7p11.1	2013-01-08			ENSG00000182111	ENSG00000182111		"""Zinc fingers, C2H2-type"", ""-"""	32458	protein-coding gene	gene with protein product							Standard	NM_001159279		Approved	FLJ46189	uc011kdi.1	A6NP11	OTTHUMG00000156689	ENST00000420713.1:c.286G>T	7.37:g.57528453G>T	ENSP00000394248:p.Asp96Tyr	Somatic	54	0		WXS	Illumina HiSeq	.	78	4	NM_001159279		Missense_Mutation	SNP	ENST00000420713.1	37	CCDS55112.1	.	.	.	.	.	.	.	.	.	.	G	8.861	0.947001	0.18356	.	.	ENSG00000182111	ENST00000420713;ENST00000418732	T	0.05786	3.39	0.195	0.195	0.15151	.	.	.	.	.	T	0.13927	0.0337	M	0.67569	2.06	0.09310	N	0.99999	D	0.71674	0.998	P	0.60173	0.87	T	0.15065	-1.0450	9	0.59425	D	0.04	.	2.6947	0.05130	0.4409:0.0:0.5591:0.0	.	84	A6NP11	ZN716_HUMAN	Y	96;84	ENSP00000394248:D96Y	ENSP00000387687:D84Y	D	+	1	0	ZNF716	57532395	0.000000	0.05858	0.055000	0.19348	0.056000	0.15407	-0.062000	0.11674	0.300000	0.22699	0.306000	0.20318	GAC	.		0.328	ZNF716-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345309.1	NM_001159279	
TRERF1	55809	hgsc.bcm.edu	37	6	42196196	42196196	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr6:42196196C>T	ENST00000372922.4	-	18	4052	c.3490G>A	c.(3490-3492)Gac>Aac	p.D1164N	TRERF1_ENST00000541110.1_Missense_Mutation_p.D1184N|TRERF1_ENST00000340840.2_Missense_Mutation_p.D1093N|TRERF1_ENST00000354325.2_Missense_Mutation_p.D1081N|TRERF1_ENST00000372917.4_Missense_Mutation_p.D1093N	NM_033502.2	NP_277037.1	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	1164	Interacts with CREBBP.				cholesterol catabolic process (GO:0006707)|homeostatic process (GO:0042592)|multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone biosynthetic process (GO:0046885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|steroid biosynthetic process (GO:0006694)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.D1164N(1)		breast(1)|central_nervous_system(2)|endometrium(7)|kidney(1)|large_intestine(12)|lung(13)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(2)	45	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			ACGACGTCGTCGTCGAGGATG	0.577																																					p.D1164N		.											TRERF1,colon,carcinoma,+1,2	TRERF1	+1	1	Substitution - Missense(1)	ovary(1)	c.G3490A						.						150.0	143.0	145.0					6																	42196196		2203	4300	6503	SO:0001583	missense	55809	exon18			CGTCGTCGTCGAG	AF297872	CCDS4867.1, CCDS75455.1	6p21.1-p12.1	2012-09-25			ENSG00000124496	ENSG00000124496			18273	protein-coding gene	gene with protein product		610322	"""breast cancer anti-estrogen resistance 2"""	BCAR2		11349124	Standard	XM_005249223		Approved	TReP-132, HSA277276, RAPA, dJ139D8.5	uc003osd.2	Q96PN7	OTTHUMG00000014698	ENST00000372922.4:c.3490G>A	6.37:g.42196196C>T	ENSP00000362013:p.Asp1164Asn	Somatic	18	0		WXS	Illumina HiSeq	.	30	3	NM_033502	Q05GC6|Q7Z6T2|Q7Z6T3|Q9NQ72|Q9NQ73|Q9NUN9	Missense_Mutation	SNP	ENST00000372922.4	37	CCDS4867.1	.	.	.	.	.	.	.	.	.	.	C	15.34	2.803405	0.50315	.	.	ENSG00000124496	ENST00000541110;ENST00000372917;ENST00000372922;ENST00000340840;ENST00000354325	T;T;T;T;T	0.12879	2.82;2.64;2.84;2.64;2.64	5.78	4.89	0.63831	.	0.529823	0.18083	N	0.152222	T	0.03011	0.0089	N	0.14661	0.345	0.09310	N	1	B;B;B;B;P	0.51791	0.013;0.007;0.007;0.013;0.948	B;B;B;B;B	0.42771	0.003;0.001;0.001;0.003;0.397	T	0.28138	-1.0053	10	0.37606	T	0.19	-4.353	7.4591	0.27285	0.0:0.7183:0.1413:0.1405	.	1081;1184;1164;920;932	Q96PN7-4;Q05GC8;Q96PN7;Q96PN7-2;Q96PN7-3	.;.;TREF1_HUMAN;.;.	N	1184;1093;1164;1093;1081	ENSP00000439689:D1184N;ENSP00000362008:D1093N;ENSP00000362013:D1164N;ENSP00000339438:D1093N;ENSP00000346285:D1081N	ENSP00000339438:D1093N	D	-	1	0	TRERF1	42304174	0.038000	0.19896	0.003000	0.11579	0.602000	0.36980	2.109000	0.41863	1.411000	0.46957	0.563000	0.77884	GAC	.		0.577	TRERF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040551.2	NM_033502	
DHRS13	147015	hgsc.bcm.edu	37	17	27228176	27228176	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr17:27228176C>T	ENST00000378895.4	-	4	640	c.514G>A	c.(514-516)Gcc>Acc	p.A172T	DHRS13_ENST00000426464.2_Missense_Mutation_p.A91T|DHRS13_ENST00000581974.1_5'Flank|DHRS13_ENST00000394901.3_Missense_Mutation_p.A122T|RP11-20B24.4_ENST00000580603.1_RNA|RP11-20B24.4_ENST00000579187.1_RNA	NM_144683.3	NP_653284.2	Q6UX07	DHR13_HUMAN	dehydrogenase/reductase (SDR family) member 13	172						extracellular region (GO:0005576)|membrane (GO:0016020)	oxidoreductase activity (GO:0016491)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	9	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)		Epithelial(11;1.59e-06)|all cancers(11;9.27e-06)|BRCA - Breast invasive adenocarcinoma(11;5.78e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.0602)			CGACAGTGGGCAGCTGAGGCT	0.612																																					p.A172T		.											DHRS13,NS,carcinoma,0,1	DHRS13	0	0			c.G514A						.						74.0	77.0	76.0					17																	27228176		2203	4300	6503	SO:0001583	missense	147015	exon4			AGTGGGCAGCTGA	BC015582	CCDS11246.2	17q11.2	2011-09-14			ENSG00000167536	ENSG00000167536	1.1.-.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	28326	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 5"""					12975309, 19027726	Standard	NM_144683		Approved	MGC23280, SDR7C5	uc002hde.4	Q6UX07	OTTHUMG00000132678	ENST00000378895.4:c.514G>A	17.37:g.27228176C>T	ENSP00000368173:p.Ala172Thr	Somatic	32	0		WXS	Illumina HiSeq	.	29	2	NM_144683	Q96BH7	Missense_Mutation	SNP	ENST00000378895.4	37	CCDS11246.2	.	.	.	.	.	.	.	.	.	.	C	19.72	3.879456	0.72294	.	.	ENSG00000167536	ENST00000378895;ENST00000394901;ENST00000426464	D;D;D	0.91521	-2.59;-2.59;-2.86	5.31	5.31	0.75309	NAD(P)-binding domain (1);	0.100382	0.64402	D	0.000002	D	0.94918	0.8357	M	0.70275	2.135	0.47308	D	0.999381	D;D	0.89917	1.0;1.0	D;D	0.75484	0.982;0.986	D	0.95253	0.8361	10	0.72032	D	0.01	.	17.9707	0.89112	0.0:1.0:0.0:0.0	.	91;172	B4DJC5;Q6UX07	.;DHR13_HUMAN	T	172;122;91	ENSP00000368173:A172T;ENSP00000378361:A122T;ENSP00000412826:A91T	ENSP00000368173:A172T	A	-	1	0	DHRS13	24252302	0.845000	0.29573	1.000000	0.80357	0.374000	0.29953	1.994000	0.40757	2.475000	0.83589	0.561000	0.74099	GCC	.		0.612	DHRS13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255952.1	NM_144683	
ARID1B	57492	hgsc.bcm.edu	37	6	157099423	157099423	+	Silent	SNP	G	G	A	rs587779743		TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr6:157099423G>A	ENST00000350026.5	+	1	361	c.360G>A	c.(358-360)caG>caA	p.Q120Q	RP11-230C9.3_ENST00000604792.1_RNA|MIR4466_ENST00000606121.1_RNA|ARID1B_ENST00000346085.5_Silent_p.Q120Q|RP11-230C9.2_ENST00000603191.1_lincRNA|ARID1B_ENST00000367148.1_Silent_p.Q120Q|ARID1B_ENST00000275248.4_Silent_p.Q62Q	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	120	Gln-rich.|Poly-Gln.				chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)	p.Q62Q(1)|p.Q120Q(1)		NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		agcagcagcagcaacagcagc	0.647																																					p.Q120Q		.											ARID1B_ENST00000346085,NS,carcinoma,0,2	ARID1B_ENST00000346085	0	2	Substitution - coding silent(2)	endometrium(2)	c.G360A						.						4.0	8.0	6.0					6																	157099423		1665	3315	4980	SO:0001819	synonymous_variant	57492	exon1			GCAGCAGCAACAG	AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.360G>A	6.37:g.157099423G>A		Somatic	8	0		WXS	Illumina HiSeq	.	6	2	NM_017519	Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Silent	SNP	ENST00000350026.5	37	CCDS5251.2																																																																																			.		0.647	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372723.1	NM_020732	
TACC3	10460	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	1729639	1729639	+	Silent	SNP	T	T	C			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr4:1729639T>C	ENST00000313288.4	+	4	616	c.510T>C	c.(508-510)tcT>tcC	p.S170S		NM_006342.2	NP_006333.1	Q9Y6A5	TACC3_HUMAN	transforming, acidic coiled-coil containing protein 3	170					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|cytoplasmic sequestering of transcription factor (GO:0042994)|hemopoiesis (GO:0030097)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of cell cycle (GO:0051726)|regulation of microtubule-based process (GO:0032886)|response to hypoxia (GO:0001666)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(4)|large_intestine(1)|lung(10)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	25		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.00765)|Epithelial(3;0.0126)			AAATGGTGTCTCCAGGAAAAG	0.567																																					p.S170S	Ovarian(120;482 2294 11894 35824)	.											.	.	.	0			c.T510C						.						68.0	79.0	75.0					4																	1729639		2203	4300	6503	SO:0001819	synonymous_variant	10460	exon4			GGTGTCTCCAGGA	AF093543	CCDS3352.1	4p16.3	2008-07-29			ENSG00000013810	ENSG00000013810			11524	protein-coding gene	gene with protein product		605303				17675670	Standard	NM_006342		Approved	ERIC1	uc003gdo.3	Q9Y6A5	OTTHUMG00000089535	ENST00000313288.4:c.510T>C	4.37:g.1729639T>C		Somatic	39	0		WXS	Illumina HiSeq	.	59	8	NM_006342	Q2NKK4|Q3KQS5|Q9UMQ1	Silent	SNP	ENST00000313288.4	37	CCDS3352.1																																																																																			.		0.567	TACC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000203730.2		
NETO1	81832	hgsc.bcm.edu	37	18	70450978	70450978	+	Missense_Mutation	SNP	C	C	T	rs370635787		TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr18:70450978C>T	ENST00000327305.6	-	7	1460	c.803G>A	c.(802-804)cGc>cAc	p.R268H	NETO1_ENST00000299430.2_Missense_Mutation_p.R267H|NETO1_ENST00000583169.1_Missense_Mutation_p.R268H	NM_138966.3	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 1	268	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				memory (GO:0007613)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|receptor localization to synapse (GO:0097120)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|visual learning (GO:0008542)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)		p.R268H(1)		NS(3)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(36)|ovary(2)|prostate(3)|skin(3)|stomach(1)	63		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		TGCCCACATGCGGATCACCCC	0.478																																					p.R268H		.											NETO1,colon,carcinoma,0,1	NETO1	0	1	Substitution - Missense(1)	large_intestine(1)	c.G803A						.	C	HIS/ARG,HIS/ARG	0,4406		0,0,2203	182.0	156.0	165.0		803,803	5.5	1.0	18		165	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	NETO1	NM_001201465.1,NM_138966.3	29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	268/534,268/534	70450978	1,13005	2203	4300	6503	SO:0001583	missense	81832	exon7			CACATGCGGATCA	AF448838	CCDS12000.1, CCDS42444.1	18q22.2	2008-08-01			ENSG00000166342	ENSG00000166342			13823	protein-coding gene	gene with protein product		607973				11943477, 12810072	Standard	NM_138999		Approved	BTCL1, BCTL1	uc002lkw.3	Q8TDF5	OTTHUMG00000132834	ENST00000327305.6:c.803G>A	18.37:g.70450978C>T	ENSP00000313088:p.Arg268His	Somatic	32	0		WXS	Illumina HiSeq	.	40	3	NM_001201465	Q86W85|Q8ND78|Q8TDF4	Missense_Mutation	SNP	ENST00000327305.6	37	CCDS12000.1	.	.	.	.	.	.	.	.	.	.	C	36	5.741754	0.96873	0.0	1.16E-4	ENSG00000166342	ENST00000327305;ENST00000299430	T;T	0.18960	2.18;2.18	5.54	5.54	0.83059	CUB (5);	0.000000	0.64402	D	0.000011	T	0.51007	0.1649	M	0.78637	2.42	0.80722	D	1	D;D	0.76494	0.999;0.976	D;P	0.80764	0.994;0.642	T	0.52540	-0.8562	10	0.87932	D	0	-34.3662	19.8487	0.96730	0.0:1.0:0.0:0.0	.	267;268	Q8TDF5-2;Q8TDF5	.;NETO1_HUMAN	H	268;267	ENSP00000313088:R268H;ENSP00000299430:R267H	ENSP00000299430:R267H	R	-	2	0	NETO1	68601958	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.776000	0.85560	2.748000	0.94277	0.650000	0.86243	CGC	.		0.478	NETO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256301.2	NM_138999	
KCTD3	51133	hgsc.bcm.edu	37	1	215753330	215753330	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr1:215753330C>T	ENST00000259154.4	+	8	908	c.614C>T	c.(613-615)gCt>gTt	p.A205V		NM_016121.3	NP_057205.2	Q9Y597	KCTD3_HUMAN	potassium channel tetramerization domain containing 3	205					protein homooligomerization (GO:0051260)					breast(4)|endometrium(2)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)	33				all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)		GCCCATTTTGCTGTGTGTTAC	0.343																																					p.A205V		.											.	.	.	0			c.C614T						.						141.0	138.0	139.0					1																	215753330		2203	4300	6503	SO:0001583	missense	51133	exon8			ATTTTGCTGTGTG	AK024547	CCDS1515.1	1q41	2013-06-20	2013-06-20		ENSG00000136636	ENSG00000136636			21305	protein-coding gene	gene with protein product		613272	"""potassium channel tetramerisation domain containing 3"""			10508479	Standard	NM_016121		Approved	NY-REN-45	uc001hks.3	Q9Y597	OTTHUMG00000037019	ENST00000259154.4:c.614C>T	1.37:g.215753330C>T	ENSP00000259154:p.Ala205Val	Somatic	60	0		WXS	Illumina HiSeq	.	88	3	NM_016121	A0AV15|D3DTA6|Q49AG7|Q504Q9|Q6PJN6|Q8ND58|Q8NDJ0|Q8WX16	Missense_Mutation	SNP	ENST00000259154.4	37	CCDS1515.1	.	.	.	.	.	.	.	.	.	.	C	5.235	0.228922	0.09916	.	.	ENSG00000136636	ENST00000259154;ENST00000366945	T	0.27104	1.69	5.54	4.63	0.57726	.	0.054665	0.64402	D	0.000001	T	0.04227	0.0117	N	0.00088	-2.19	0.34001	D	0.650241	B;B	0.06786	0.001;0.0	B;B	0.09377	0.004;0.0	T	0.25363	-1.0134	10	0.02654	T	1	-24.9174	9.4847	0.38922	0.0:0.8373:0.0:0.1627	.	205;205	Q9Y597-2;Q9Y597	.;KCTD3_HUMAN	V	205	ENSP00000259154:A205V	ENSP00000259154:A205V	A	+	2	0	KCTD3	213819953	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	5.592000	0.67543	1.330000	0.45394	0.563000	0.77884	GCT	.		0.343	KCTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089871.2	NM_016121	
KIAA1109	84162	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	123210346	123210346	+	Splice_Site	SNP	T	T	C			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr4:123210346T>C	ENST00000264501.4	+	54	9760	c.9387T>C	c.(9385-9387)tcT>tcC	p.S3129S	KIAA1109_ENST00000388738.3_Splice_Site_p.S3129S|KIAA1109_ENST00000455637.1_Splice_Site_p.S3129S			Q2LD37	K1109_HUMAN	KIAA1109	3129					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						AAAAAGTTTCTGGTAAGATGA	0.328																																					p.S3129S		.											.	.	.	0			c.T9387C						.						90.0	82.0	84.0					4																	123210346		1835	4081	5916	SO:0001630	splice_region_variant	84162	exon52			AGTTTCTGGTAAG	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.9388+1T>C	4.37:g.123210346T>C		Somatic	38	0		WXS	Illumina HiSeq	.	67	6	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Silent	SNP	ENST00000264501.4	37	CCDS43267.1	.	.	.	.	.	.	.	.	.	.	T	10.88	1.474669	0.26511	.	.	ENSG00000138688	ENST00000419325	.	.	.	5.78	3.03	0.35002	.	.	.	.	.	T	0.54663	0.1872	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48614	-0.9020	4	.	.	.	.	6.2962	0.21087	0.5089:0.0:0.1176:0.3735	.	.	.	.	R	1087	.	.	W	+	1	0	KIAA1109	123429796	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.991000	0.49409	0.873000	0.35799	0.528000	0.53228	TGG	.		0.328	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	Silent
PHTF1	10745	hgsc.bcm.edu	37	1	114247312	114247312	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr1:114247312C>A	ENST00000369604.1	-	14	2262	c.1779G>T	c.(1777-1779)tgG>tgT	p.W593C	PHTF1_ENST00000369600.1_Missense_Mutation_p.W540C|PHTF1_ENST00000393357.2_Missense_Mutation_p.W593C|PHTF1_ENST00000369598.1_Missense_Mutation_p.W548C|PHTF1_ENST00000474926.1_5'UTR|PHTF1_ENST00000357783.2_Missense_Mutation_p.W593C|PHTF1_ENST00000369596.2_Missense_Mutation_p.W540C			Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1	593					transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.W593*(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCAGTGATAACCATATTTTAA	0.358																																					p.W593C		.											PHTF1,colon,carcinoma,0,1	PHTF1	0	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1779T						.						81.0	86.0	84.0					1																	114247312		2203	4300	6503	SO:0001583	missense	10745	exon13			TGATAACCATATT	AJ011863	CCDS861.1	1p13-p11	2008-07-18			ENSG00000116793	ENSG00000116793			8939	protein-coding gene	gene with protein product		604950		PHTF		10395808	Standard	NM_006608		Approved		uc009wgp.1	Q9UMS5	OTTHUMG00000011800	ENST00000369604.1:c.1779G>T	1.37:g.114247312C>A	ENSP00000358617:p.Trp593Cys	Somatic	48	0		WXS	Illumina HiSeq	.	49	2	NM_006608	Q5VWP7|Q5VWP8|Q9BUP2|Q9H1X8	Missense_Mutation	SNP	ENST00000369604.1	37	CCDS861.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.443682	0.83993	.	.	ENSG00000116793	ENST00000369597;ENST00000393357;ENST00000369596;ENST00000369598;ENST00000369600;ENST00000369604;ENST00000357783	.	.	.	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.77287	0.4108	M	0.73962	2.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.79125	-0.1932	9	0.87932	D	0	-11.0138	19.6271	0.95682	0.0:1.0:0.0:0.0	.	593;593	Q9UMS5;Q9UMS5-2	PHTF1_HUMAN;.	C	548;593;540;548;540;593;593	.	ENSP00000350428:W593C	W	-	3	0	PHTF1	114048835	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.487000	0.81328	2.645000	0.89757	0.591000	0.81541	TGG	.		0.358	PHTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032666.1	NM_006608	
KIAA1211L	343990	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	99411049	99411049	+	Silent	SNP	T	T	C			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr2:99411049T>C	ENST00000397899.2	-	10	3166	c.2835A>G	c.(2833-2835)gaA>gaG	p.E945E		NM_207362.2	NP_997245.2	Q6NV74	K121L_HUMAN	KIAA1211-like	945																	TTCTGGCAAGTTCCATCCAGG	0.493																																					p.E945E		.											.	.	.	0			c.A2835G						.						132.0	129.0	130.0					2																	99411049		1940	4152	6092	SO:0001819	synonymous_variant	343990	exon10			GGCAAGTTCCATC	BC068277	CCDS42720.1	2q11.2	2012-08-03	2012-08-03	2012-08-03	ENSG00000196872	ENSG00000196872			33454	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 55"""	C2orf55			Standard	NM_207362		Approved	MGC42367	uc002szf.1	Q6NV74	OTTHUMG00000153171	ENST00000397899.2:c.2835A>G	2.37:g.99411049T>C		Somatic	24	0		WXS	Illumina HiSeq	.	38	9	NM_207362		Silent	SNP	ENST00000397899.2	37	CCDS42720.1																																																																																			.		0.493	KIAA1211L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329933.1	NM_207362	
SPATA22	84690	hgsc.bcm.edu	37	17	3370841	3370841	+	Silent	SNP	C	C	T	rs80115425		TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr17:3370841C>T	ENST00000573128.1	-	3	534	c.51G>A	c.(49-51)ttG>ttA	p.L17L	SPATA22_ENST00000572969.1_Silent_p.L17L|SPATA22_ENST00000355380.4_Intron|SPATA22_ENST00000268981.5_Silent_p.L17L|SPATA22_ENST00000541913.1_Silent_p.L17L|SPATA22_ENST00000397168.3_Silent_p.L17L|SPATA22_ENST00000575375.1_Silent_p.L17L			Q8NHS9	SPT22_HUMAN	spermatogenesis associated 22	17					fertilization (GO:0009566)|gamete generation (GO:0007276)|meiotic DNA repair synthesis (GO:0000711)|regulation of meiotic cell cycle (GO:0051445)|reproductive system development (GO:0061458)|synapsis (GO:0007129)	chromosome (GO:0005694)				breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|skin(2)	19						ACGGAACAGGCAAACAGCCTA	0.318																																					p.L17L		.											.	.	.	0			c.G51A						.						85.0	85.0	85.0					17																	3370841		2203	4300	6503	SO:0001819	synonymous_variant	84690	exon3			AACAGGCAAACAG	AY035868	CCDS11027.1, CCDS54066.1, CCDS54067.1	17p13.3	2005-12-19							30705	protein-coding gene	gene with protein product						12477932	Standard	NM_001170696		Approved	NYD-SP20	uc002fvn.3	Q8NHS9		ENST00000573128.1:c.51G>A	17.37:g.3370841C>T		Somatic	89	0		WXS	Illumina HiSeq	.	95	4	NM_032598	B4DXB1|D3DTI9|J3KN63|Q969H3|Q96JT4	Silent	SNP	ENST00000573128.1	37	CCDS11027.1																																																																																			.		0.318	SPATA22-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438067.2	NM_032598	
JMJD4	65094	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	227922428	227922428	+	Missense_Mutation	SNP	A	A	G			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr1:227922428A>G	ENST00000366758.3	-	2	489	c.490T>C	c.(490-492)Tac>Cac	p.Y164H	JMJD4_ENST00000438896.2_Missense_Mutation_p.Y164H|JMJD4_ENST00000485807.1_5'Flank|SNAP47_ENST00000366760.1_Intron|SNAP47_ENST00000315781.5_5'Flank|SNAP47_ENST00000366759.4_5'Flank	NM_023007.2	NP_075383.2	Q9H9V9	JMJD4_HUMAN	jumonji domain containing 4	164										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	9		Prostate(94;0.0885)				TCTTTCCAGTAGGTGATGTAG	0.522																																					p.Y164H		.											.	.	.	0			c.T490C						.						259.0	211.0	227.0					1																	227922428		2203	4300	6503	SO:0001583	missense	65094	exon2			TCCAGTAGGTGAT	AK022579	CCDS1561.1, CCDS59203.1	1q42.13	2008-02-05			ENSG00000081692	ENSG00000081692			25724	protein-coding gene	gene with protein product						12477932	Standard	NM_023007		Approved	FLJ12517	uc001hrb.3	Q9H9V9	OTTHUMG00000037698	ENST00000366758.3:c.490T>C	1.37:g.227922428A>G	ENSP00000355720:p.Tyr164His	Somatic	25	0		WXS	Illumina HiSeq	.	29	7	NM_023007	Q5TBZ1|Q5TBZ6|Q9H970	Missense_Mutation	SNP	ENST00000366758.3	37	CCDS1561.1	.	.	.	.	.	.	.	.	.	.	.	15.26	2.779456	0.49891	.	.	ENSG00000081692	ENST00000366758	T	0.55588	0.51	4.55	3.41	0.39046	.	0.000000	0.85682	D	0.000000	T	0.50888	0.1642	M	0.78344	2.41	0.44123	D	0.996905	B;B	0.12630	0.005;0.006	B;B	0.17979	0.012;0.02	T	0.57394	-0.7819	10	0.66056	D	0.02	-46.2879	7.8015	0.29176	0.8993:0.0:0.1007:0.0	.	164;164	Q9H9V9-2;Q9H9V9	.;JMJD4_HUMAN	H	164	ENSP00000355720:Y164H	ENSP00000355720:Y164H	Y	-	1	0	JMJD4	225989051	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	6.742000	0.74843	1.811000	0.52892	0.454000	0.30748	TAC	.		0.522	JMJD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091970.1	NM_023007	
RELN	5649	hgsc.bcm.edu	37	7	103124180	103124180	+	Silent	SNP	G	G	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr7:103124180G>A	ENST00000428762.1	-	62	10260	c.10101C>T	c.(10099-10101)aaC>aaT	p.N3367N	RELN_ENST00000343529.5_Silent_p.N3367N|CTB-107G13.1_ENST00000422488.1_RNA|RELN_ENST00000424685.2_Silent_p.N3367N|RN7SKP86_ENST00000410454.1_RNA|RELN_ENST00000473945.1_5'UTR	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	3367					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		AGGTGATCCCGTTGTTGACGC	0.552																																					p.N3367N	NSCLC(146;835 1944 15585 22231 52158)	.											RELN,NS,carcinoma,0,1	RELN	0	0			c.C10101T						.						241.0	201.0	215.0					7																	103124180		2203	4300	6503	SO:0001819	synonymous_variant	5649	exon62			GATCCCGTTGTTG		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.10101C>T	7.37:g.103124180G>A		Somatic	28	1		WXS	Illumina HiSeq	.	28	2	NM_173054	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Silent	SNP	ENST00000428762.1	37	CCDS47680.1																																																																																			.		0.552	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
BAI1	575	hgsc.bcm.edu;bcgsc.ca	37	8	143558848	143558848	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr8:143558848G>T	ENST00000517894.1	+	6	2219	c.1325G>T	c.(1324-1326)gGg>gTg	p.G442V	BAI1_ENST00000323289.5_Missense_Mutation_p.G442V			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	442	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					CCCCAGTTTGGGGGCAACCCC	0.657																																					p.G442V		.											.	.	.	0			c.G1325T						.						44.0	52.0	49.0					8																	143558848		1981	4153	6134	SO:0001583	missense	575	exon5			AGTTTGGGGGCAA	AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.1325G>T	8.37:g.143558848G>T	ENSP00000430945:p.Gly442Val	Somatic	37	0		WXS	Illumina HiSeq	.	50	4	NM_001702		Missense_Mutation	SNP	ENST00000517894.1	37		.	.	.	.	.	.	.	.	.	.	G	24.3	4.511245	0.85389	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	T;T	0.63744	-0.06;-0.06	4.18	4.18	0.49190	.	0.072231	0.56097	U	0.000040	T	0.81418	0.4818	M	0.87900	2.915	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85834	0.1393	10	0.87932	D	0	.	15.816	0.78599	0.0:0.0:1.0:0.0	.	442	E9PBK0	.	V	442	ENSP00000430945:G442V;ENSP00000313046:G442V	ENSP00000313046:G442V	G	+	2	0	BAI1	143555850	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	9.592000	0.98245	2.000000	0.58554	0.491000	0.48974	GGG	.		0.657	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379963.3	NM_001702	
KCNT2	343450	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	196295911	196295911	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr1:196295911G>A	ENST00000294725.9	-	19	3127	c.2212C>T	c.(2212-2214)Cct>Tct	p.P738S	KCNT2_ENST00000498426.1_Intron|KCNT2_ENST00000451324.2_Missense_Mutation_p.P349S|KCNT2_ENST00000609185.1_Missense_Mutation_p.P688S|KCNT2_ENST00000367433.5_Missense_Mutation_p.P738S|KCNT2_ENST00000367431.4_Missense_Mutation_p.P688S			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	738					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						GCCCTGAGAGGAACAATAAAG	0.318																																					p.P738S		.											.	.	.	0			c.C2212T						.						79.0	82.0	81.0					1																	196295911		2203	4294	6497	SO:0001583	missense	343450	exon19			TGAGAGGAACAAT	BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.2212C>T	1.37:g.196295911G>A	ENSP00000294725:p.Pro738Ser	Somatic	53	0		WXS	Illumina HiSeq	.	127	19	NM_198503	Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	ENST00000294725.9	37	CCDS1384.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.484894	0.84854	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000451324;ENST00000294725	T;T;T;T	0.76709	-1.04;-1.04;-1.04;-1.04	5.28	5.28	0.74379	.	0.000000	0.64402	D	0.000011	D	0.89259	0.6664	M	0.82193	2.58	0.80722	D	1	D;D;D;D;D	0.89917	0.986;1.0;1.0;1.0;0.986	D;D;D;D;D	0.97110	0.975;1.0;1.0;1.0;0.975	D	0.89443	0.3725	10	0.51188	T	0.08	-16.876	19.2671	0.93993	0.0:0.0:1.0:0.0	.	738;720;738;688;738	A9LNM6;Q6UVM3-4;Q6UVM3-2;Q6UVM3-3;Q6UVM3	.;.;.;.;KCNT2_HUMAN	S	738;688;349;738	ENSP00000356403:P738S;ENSP00000356401:P688S;ENSP00000405474:P349S;ENSP00000294725:P738S	ENSP00000294725:P738S	P	-	1	0	KCNT2	194562534	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.813000	0.99286	2.608000	0.88229	0.650000	0.86243	CCT	.		0.318	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086418.2	NM_198503	
PTPRE	5791	hgsc.bcm.edu	37	10	129875976	129875976	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr10:129875976G>T	ENST00000254667.3	+	19	2100	c.1821G>T	c.(1819-1821)atG>atT	p.M607I	PTPRE_ENST00000306042.5_Missense_Mutation_p.M549I|PTPRE_ENST00000419012.2_Missense_Mutation_p.M607I	NM_006504.4	NP_006495.1	P23469	PTPRE_HUMAN	protein tyrosine phosphatase, receptor type, E	607	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				negative regulation of insulin receptor signaling pathway (GO:0046627)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of mast cell activation (GO:0033003)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	22		all_epithelial(44;1.66e-05)|all_lung(145;0.00456)|Lung NSC(174;0.0066)|all_neural(114;0.0936)|Colorectal(57;0.141)|Breast(234;0.166)|Melanoma(40;0.203)			Alendronate(DB00630)	GCAAAGGCATGATTGACCTCA	0.652																																					p.M607I	Colon(52;977 1184 20575 41685)	.											.	.	.	0			c.G1821T						.						76.0	69.0	71.0					10																	129875976		2203	4300	6503	SO:0001583	missense	5791	exon19			AGGCATGATTGAC	AF406557	CCDS7657.1, CCDS7658.1	10q26	2011-06-09			ENSG00000132334	ENSG00000132334		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9669	protein-coding gene	gene with protein product		600926				8595895	Standard	NM_130435		Approved	PTPE	uc001lkb.3	P23469	OTTHUMG00000019254	ENST00000254667.3:c.1821G>T	10.37:g.129875976G>T	ENSP00000254667:p.Met607Ile	Somatic	64	0		WXS	Illumina HiSeq	.	46	3	NM_006504	Q13345|Q5VWH3|Q5VWH4|Q96KQ6	Missense_Mutation	SNP	ENST00000254667.3	37	CCDS7657.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.416704	0.83449	.	.	ENSG00000132334	ENST00000254667;ENST00000439034;ENST00000419012;ENST00000306042	T;T;T	0.09911	2.93;2.93;2.93	4.44	4.44	0.53790	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.85682	D	0.000000	T	0.17534	0.0421	N	0.11789	0.175	0.80722	D	1	D;P;P;P	0.59357	0.985;0.888;0.863;0.888	D;P;P;P	0.71414	0.973;0.576;0.497;0.576	T	0.22487	-1.0215	10	0.49607	T	0.09	.	17.2389	0.87007	0.0:0.0:1.0:0.0	.	585;607;549;607	F5H0X4;Q5VWH4;P23469-2;P23469	.;.;.;PTPRE_HUMAN	I	607;585;607;549	ENSP00000254667:M607I;ENSP00000402337:M607I;ENSP00000303350:M549I	ENSP00000254667:M607I	M	+	3	0	PTPRE	129765966	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	9.654000	0.98509	2.315000	0.78130	0.561000	0.74099	ATG	.		0.652	PTPRE-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050990.1		
CLDN16	10686	hgsc.bcm.edu	37	3	190106072	190106072	+	Missense_Mutation	SNP	G	G	T	rs386669518|rs201380153|rs56086318|rs368234054	byFrequency	TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr3:190106072G>T	ENST00000264734.2	+	1	412	c.164G>T	c.(163-165)aGg>aTg	p.R55M	CLDN16_ENST00000456423.1_Missense_Mutation_p.R55M|CLDN16_ENST00000468220.1_Intron	NM_006580.3	NP_006571.1	Q9Y5I7	CLD16_HUMAN	claudin 16	55					calcium-independent cell-cell adhesion (GO:0016338)|cellular metal ion homeostasis (GO:0006875)|excretion (GO:0007588)|magnesium ion transport (GO:0015693)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|magnesium ion transmembrane transporter activity (GO:0015095)|structural molecule activity (GO:0005198)			breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|skin(1)	19	all_cancers(143;3.61e-10)|Ovarian(172;0.0991)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.018)		AGTGGGGCCAGGGCTGGTGTC	0.512																																					p.R55M		.											.,1	.	59	0			c.G164T						.						145.0	107.0	120.0					3																	190106072		2203	4291	6494	SO:0001583	missense	10686	exon1			GGGCCAGGGCTGG	AF152101	CCDS3296.1	3q28	2008-12-10			ENSG00000113946	ENSG00000113946		"""Claudins"""	2037	protein-coding gene	gene with protein product	"""paracellin-1"", ""hypomagnesemia 3, with hypercalciuria and nephrocalcinosis"""	603959				10390358	Standard	NM_006580		Approved	PCLN1, HOMG3	uc003fsi.3	Q9Y5I7	OTTHUMG00000156215	ENST00000264734.2:c.164G>T	3.37:g.190106072G>T	ENSP00000264734:p.Arg55Met	Somatic	23	0		WXS	Illumina HiSeq	.	31	2	NM_006580		Missense_Mutation	SNP	ENST00000264734.2	37	CCDS3296.1	.	.	.	.	.	.	.	.	.	.	G	3.899	-0.022372	0.07634	.	.	ENSG00000113946	ENST00000264734;ENST00000456423	D;D	0.93763	-2.92;-3.28	5.61	1.57	0.23409	.	1.365350	0.04318	N	0.350134	D	0.91192	0.7225	N	0.19112	0.55	0.09310	N	1	D;B	0.54207	0.965;0.41	P;B	0.53313	0.723;0.204	T	0.82362	-0.0495	10	0.56958	D	0.05	-18.8536	6.6557	0.22986	0.1665:0.3355:0.498:0.0	.	55;55	A0SDD8;Q9Y5I7	.;CLD16_HUMAN	M	55	ENSP00000264734:R55M;ENSP00000414136:R55M	ENSP00000264734:R55M	R	+	2	0	CLDN16	191588766	0.000000	0.05858	0.000000	0.03702	0.042000	0.13812	0.492000	0.22435	0.324000	0.23333	0.460000	0.39030	AGG	.		0.512	CLDN16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343519.1	NM_006580	
ZCCHC5	203430	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	77912769	77912769	+	Silent	SNP	A	A	G			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chrX:77912769A>G	ENST00000321110.1	-	2	1444	c.1149T>C	c.(1147-1149)tcT>tcC	p.S383S		NM_152694.2	NP_689907.1	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	383							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)|prostate(1)|skin(1)	37						TGATGAGATCAGATAGGTTGG	0.493																																					p.S383S		.											.	.	.	0			c.T1149C						.						109.0	95.0	100.0					X																	77912769		2203	4300	6503	SO:0001819	synonymous_variant	203430	exon2			GAGATCAGATAGG	AK096184	CCDS14440.1	Xq13.3	2008-02-05			ENSG00000179300	ENSG00000179300		"""Zinc fingers, CCHC domain containing"""	22997	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_152694		Approved	FLJ38865, Mar3, Mart3, ZHC5	uc004edc.1	Q8N8U3	OTTHUMG00000021892	ENST00000321110.1:c.1149T>C	X.37:g.77912769A>G		Somatic	12	0		WXS	Illumina HiSeq	.	15	7	NM_152694	B2RMZ0|Q5JQE9	Silent	SNP	ENST00000321110.1	37	CCDS14440.1																																																																																			.		0.493	ZCCHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057319.1	NM_152694	
LRRK1	79705	hgsc.bcm.edu	37	15	101566296	101566296	+	Missense_Mutation	SNP	G	G	T	rs367783860		TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr15:101566296G>T	ENST00000388948.3	+	17	2718	c.2359G>T	c.(2359-2361)Ggc>Tgc	p.G787C	LRRK1_ENST00000284395.5_Missense_Mutation_p.G784C	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1									p.G787S(1)|p.G799S(1)		breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CTCCCCCTCCGGCTCCAGGGC	0.597																																					p.G787C		.											LRRK1_ENST00000388948,NS,carcinoma,0,2	LRRK1_ENST00000388948	0	2	Substitution - Missense(2)	endometrium(2)	c.G2359T						.						62.0	71.0	68.0					15																	101566296		2098	4222	6320	SO:0001583	missense	79705	exon17			CCCTCCGGCTCCA	AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.2359G>T	15.37:g.101566296G>T	ENSP00000373600:p.Gly787Cys	Somatic	23	0		WXS	Illumina HiSeq	.	46	2	NM_024652		Missense_Mutation	SNP	ENST00000388948.3	37	CCDS42086.1	.	.	.	.	.	.	.	.	.	.	G	16.84	3.232880	0.58777	.	.	ENSG00000154237	ENST00000388948;ENST00000284395	T;T	0.73363	-0.71;-0.74	4.71	4.71	0.59529	ROC GTPase (1);	0.000000	0.85682	D	0.000000	D	0.83147	0.5191	L	0.50333	1.59	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.85291	0.1067	10	0.72032	D	0.01	.	17.6842	0.88252	0.0:0.0:1.0:0.0	.	787	Q38SD2	LRRK1_HUMAN	C	787;784	ENSP00000373600:G787C;ENSP00000284395:G784C	ENSP00000284395:G784C	G	+	1	0	LRRK1	99383819	1.000000	0.71417	0.697000	0.30258	0.096000	0.18686	9.290000	0.96065	2.158000	0.67659	0.462000	0.41574	GGC	.		0.597	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2	NM_024652	
CXorf57	55086	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	105876175	105876175	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chrX:105876175G>T	ENST00000372548.4	+	5	1211	c.1102G>T	c.(1102-1104)Gat>Tat	p.D368Y	CXorf57_ENST00000372544.2_Missense_Mutation_p.D368Y	NM_018015.5	NP_060485.4	Q6NSI4	CX057_HUMAN	chromosome X open reading frame 57	368							poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(6)|lung(11)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	31						AGAACTGGATGATATGCCAGA	0.284																																					p.D368Y		.											.	.	.	0			c.G1102T						.						100.0	101.0	101.0					X																	105876175		2203	4299	6502	SO:0001583	missense	55086	exon5			CTGGATGATATGC	AK024253	CCDS14519.1, CCDS55470.1	Xq22.3	2008-02-05			ENSG00000147231	ENSG00000147231			25486	protein-coding gene	gene with protein product							Standard	NM_018015		Approved	FLJ14191, FLJ10178	uc004emi.4	Q6NSI4	OTTHUMG00000022150	ENST00000372548.4:c.1102G>T	X.37:g.105876175G>T	ENSP00000361628:p.Asp368Tyr	Somatic	113	0		WXS	Illumina HiSeq	.	140	13	NM_018015	H7BY89|Q4G0L7|Q5JQS1|Q5JRF9|Q6PHY5|Q6PII9|Q6PJU8|Q9H7W5|Q9NWA6	Missense_Mutation	SNP	ENST00000372548.4	37	CCDS14519.1	.	.	.	.	.	.	.	.	.	.	G	13.58	2.280782	0.40294	.	.	ENSG00000147231	ENST00000372544;ENST00000372548;ENST00000421550	T;T;T	0.46451	0.87;0.87;0.88	4.53	-0.35	0.12606	.	0.975378	0.08492	N	0.937821	T	0.43831	0.1265	L	0.36672	1.1	0.09310	N	0.99999	B;B;P	0.46142	0.002;0.002;0.873	B;B;P	0.52267	0.014;0.014;0.694	T	0.43814	-0.9368	10	0.72032	D	0.01	-6.0936	9.147	0.36939	0.4378:0.0:0.5622:0.0	.	368;368;368	A8K6R5;Q6NSI4;Q6NSI4-2	.;CX057_HUMAN;.	Y	368;368;176	ENSP00000361623:D368Y;ENSP00000361628:D368Y;ENSP00000405866:D176Y	ENSP00000361623:D368Y	D	+	1	0	CXorf57	105762831	0.000000	0.05858	0.888000	0.34837	0.962000	0.63368	-0.071000	0.11505	-0.122000	0.11766	-0.197000	0.12766	GAT	.		0.284	CXorf57-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057800.2	NM_018015	
ADRBK1	156	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	67051372	67051372	+	Silent	SNP	C	C	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr11:67051372C>T	ENST00000308595.5	+	17	1733	c.1443C>T	c.(1441-1443)gaC>gaT	p.D481D	ADRBK1_ENST00000527176.1_3'UTR|ADRBK1_ENST00000526285.1_Intron	NM_001619.3	NP_001610.2	P25098	ARBK1_HUMAN	adrenergic, beta, receptor kinase 1	481	AGC-kinase C-terminal.				activation of phospholipase C activity (GO:0007202)|cardiac muscle contraction (GO:0060048)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of striated muscle contraction (GO:0045988)|negative regulation of the force of heart contraction by chemical signal (GO:0003108)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of catecholamine secretion (GO:0033605)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|tachykinin receptor signaling pathway (GO:0007217)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|ATP binding (GO:0005524)|beta-adrenergic receptor kinase activity (GO:0047696)|Edg-2 lysophosphatidic acid receptor binding (GO:0031755)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)	p.D481D(1)		cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|liver(2)|lung(8)|prostate(2)	22			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)		Adenosine triphosphate(DB00171)	ACGCGGCCGACGCCTTCGACA	0.627																																					p.D481D		.											ADRBK1,NS,carcinoma,0,1	ADRBK1	0	1	Substitution - coding silent(1)	endometrium(1)	c.C1443T						.						29.0	30.0	30.0					11																	67051372		2200	4295	6495	SO:0001819	synonymous_variant	156	exon17			GGCCGACGCCTTC	X61157	CCDS8156.1	11q13	2013-01-10			ENSG00000173020	ENSG00000173020		"""Pleckstrin homology (PH) domain containing"""	289	protein-coding gene	gene with protein product		109635				2037065	Standard	NM_001619		Approved	GRK2, BARK1	uc009yrn.1	P25098	OTTHUMG00000167104	ENST00000308595.5:c.1443C>T	11.37:g.67051372C>T		Somatic	15	0		WXS	Illumina HiSeq	.	36	4	NM_001619	B0ZBE1|Q13837|Q6GTT3	Silent	SNP	ENST00000308595.5	37	CCDS8156.1																																																																																			.		0.627	ADRBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393153.1	NM_001619	
SCCPDH	51097	hgsc.bcm.edu	37	1	246929442	246929442	+	Splice_Site	SNP	G	G	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr1:246929442G>A	ENST00000366510.3	+	11	1560		c.e11+1			NM_016002.2	NP_057086.2	Q8NBX0	SCPDL_HUMAN	saccharopine dehydrogenase (putative)							lipid particle (GO:0005811)|membrane (GO:0016020)|midbody (GO:0030496)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(9)|ovary(1)	17	all_cancers(71;6.8e-05)|all_epithelial(71;7.93e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0545)|Lung NSC(105;0.0618)	all_cancers(173;0.0343)	OV - Ovarian serous cystadenocarcinoma(106;0.00323)	GBM - Glioblastoma multiforme(49;0.0896)		TGCCTAAGGCGTAAGTTTGGT	0.388																																					.		.											.	.	.	0			c.1184+1G>A						.						171.0	180.0	177.0					1																	246929442		2203	4300	6503	SO:0001630	splice_region_variant	51097	exon11			TAAGGCGTAAGTT		CCDS31084.1	1q44	2009-11-06			ENSG00000143653	ENSG00000143653			24275	protein-coding gene	gene with protein product						10810093	Standard	NM_016002		Approved	CGI-49, NET11	uc001ibr.3	Q8NBX0	OTTHUMG00000040221	ENST00000366510.3:c.1184+1G>A	1.37:g.246929442G>A		Somatic	46	0		WXS	Illumina HiSeq	.	61	4	NM_016002	Q8TAR0|Q9Y363	Splice_Site	SNP	ENST00000366510.3	37	CCDS31084.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.136778	0.77662	.	.	ENSG00000143653	ENST00000366510;ENST00000366509	.	.	.	5.88	5.88	0.94601	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4085	0.90542	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SCCPDH	244996065	1.000000	0.71417	0.960000	0.40013	0.772000	0.43724	8.461000	0.90372	2.778000	0.95560	0.655000	0.94253	.	.		0.388	SCCPDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096902.2	NM_016002	Intron
OR52E8	390079	hgsc.bcm.edu	37	11	5878458	5878458	+	Silent	SNP	G	G	A	rs549924845	byFrequency	TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr11:5878458G>A	ENST00000537935.1	-	1	506	c.475C>T	c.(475-477)Ctg>Ttg	p.L159L	TRIM5_ENST00000380027.1_Intron	NM_001005168.1	NP_001005168.1	Q6IFG1	O52E8_HUMAN	olfactory receptor, family 52, subfamily E, member 8	159						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	20		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.114)		Epithelial(150;2.37e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACCATGTACAGGCTCCTCAGG	0.507													G|||	10	0.00199681	0.0068	0.0	5008	,	,		18808	0.0		0.0	False		,,,				2504	0.001				p.L159L		.											OR52E8,NS,carcinoma,0,1	OR52E8	0	0			c.C475T						.						135.0	147.0	143.0					11																	5878458		2154	4296	6450	SO:0001819	synonymous_variant	390079	exon1			TGTACAGGCTCCT	BK004301	CCDS31400.1	11p15.4	2012-08-09	2003-12-15		ENSG00000183269	ENSG00000183269		"""GPCR / Class A : Olfactory receptors"""	15217	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily E, member 8 pseudogene"""				Standard	NM_001005168		Approved		uc010qzr.2	Q6IFG1	OTTHUMG00000168803	ENST00000537935.1:c.475C>T	11.37:g.5878458G>A		Somatic	28	1		WXS	Illumina HiSeq	.	39	2	NM_001005168	B9EH38	Silent	SNP	ENST00000537935.1	37	CCDS31400.1																																																																																			.		0.507	OR52E8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401145.1	NM_001005168	
FAM209A	200232	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	20	55100881	55100881	+	Nonsense_Mutation	SNP	C	C	T	rs368902169		TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr20:55100881C>T	ENST00000371328.3	+	2	594	c.271C>T	c.(271-273)Cga>Tga	p.R91*	FAM209A_ENST00000481560.1_3'UTR|GCNT7_ENST00000243913.4_5'UTR	NM_001012971.3	NP_001012989.2	Q5JX71	F209A_HUMAN	family with sequence similarity 209, member A	91						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)											TCCTGGCCTTCGAGGCGGCCA	0.438													C|||	1	0.000199681	0.0	0.0	5008	,	,		21663	0.0		0.0	False		,,,				2504	0.001				p.R91X		.											C20orf106,NS,carcinoma,0,1	C20orf106	0	0			c.C271T						.	C	stop/ARG,	0,4406		0,0,2203	131.0	138.0	136.0		271,	2.7	0.0	20		136	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained,utr-5	GCNT7,C20orf106	NM_001012971.3,NM_080615.1	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	91/172,	55100881	1,13005	2203	4300	6503	SO:0001587	stop_gained	200232	exon2			GGCCTTCGAGGCG	AL109806	CCDS33493.1	20q13.31	2011-11-24	2011-11-24	2011-11-24	ENSG00000124103	ENSG00000124103			16100	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 106"""	C20orf106			Standard	NM_001012971		Approved	dJ1153D9.3		Q5JX71	OTTHUMG00000032799	ENST00000371328.3:c.271C>T	20.37:g.55100881C>T	ENSP00000360379:p.Arg91*	Somatic	31	0		WXS	Illumina HiSeq	.	31	6	NM_001012971	Q05C43	Nonsense_Mutation	SNP	ENST00000371328.3	37	CCDS33493.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.713820	0.89112	0.0	1.16E-4	ENSG00000124103	ENST00000371328	.	.	.	3.7	2.67	0.31697	.	0.682160	0.12082	N	0.501260	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.8967	9.5912	0.39548	0.0:0.7846:0.2154:0.0	.	.	.	.	X	91	.	ENSP00000360379:R91X	R	+	1	2	C20orf106	54534288	0.167000	0.22975	0.005000	0.12908	0.029000	0.11900	1.117000	0.31234	1.796000	0.52611	0.411000	0.27672	CGA	.		0.438	FAM209A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079815.2		
OR8B8	26493	hgsc.bcm.edu	37	11	124310958	124310958	+	Missense_Mutation	SNP	G	G	C			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr11:124310958G>C	ENST00000328064.2	-	1	96	c.24C>G	c.(22-24)ttC>ttG	p.F8L		NM_012378.1	NP_036510.1	Q15620	OR8B8_HUMAN	olfactory receptor, family 8, subfamily B, member 8	8					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		ACTGTGTCACGAAGGAGGAAT	0.507																																					p.F8L		.											OR8B8,NS,chondrosarcoma,0,1	OR8B8	0	0			c.C24G						.						37.0	38.0	37.0					11																	124310958		2201	4299	6500	SO:0001583	missense	26493	exon1			TGTCACGAAGGAG	AF238488	CCDS8446.1	11q24.2	2012-08-09			ENSG00000197125	ENSG00000197125		"""GPCR / Class A : Olfactory receptors"""	8477	protein-coding gene	gene with protein product						9119360	Standard	NM_012378		Approved	TPCR85	uc010sal.2	Q15620	OTTHUMG00000165917	ENST00000328064.2:c.24C>G	11.37:g.124310958G>C	ENSP00000330280:p.Phe8Leu	Somatic	27	0		WXS	Illumina HiSeq	.	16	2	NM_012378	A1L446|Q96RC8	Missense_Mutation	SNP	ENST00000328064.2	37	CCDS8446.1	.	.	.	.	.	.	.	.	.	.	g	0	-2.771589	0.00081	.	.	ENSG00000197125	ENST00000328064	T	0.00340	8.04	1.73	-3.45	0.04781	.	0.936256	0.08635	U	0.916494	T	0.00073	0.0002	N	0.02842	-0.48	0.09310	N	1	B	0.14805	0.011	B	0.15484	0.013	T	0.26395	-1.0104	10	0.09590	T	0.72	.	1.2335	0.01948	0.391:0.2583:0.2212:0.1295	.	8	Q15620	OR8B8_HUMAN	L	8	ENSP00000330280:F8L	ENSP00000330280:F8L	F	-	3	2	OR8B8	123816168	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-6.586000	0.00060	-2.628000	0.00436	-1.450000	0.01041	TTC	.		0.507	OR8B8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387056.1	NM_012378	
ACBD3	64746	broad.mit.edu	37	1	226349273	226349296	+	In_Frame_Del	DEL	CCTTTCCTCTTCCTCCCGTCGAAG	CCTTTCCTCTTCCTCCCGTCGAAG	-	rs374978330|rs371678655|rs77727776|rs78919255		TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr1:226349273_226349296delCCTTTCCTCTTCCTCCCGTCGAAG	ENST00000366812.5	-	4	718_741	c.664_687delCTTCGACGGGAGGAAGAGGAAAGG	c.(664-687)cttcgacgggaggaagaggaaaggdel	p.LRREEEER222del	ACBD3_ENST00000464927.1_5'UTR	NM_022735.3	NP_073572.2	Q9H3P7	GCP60_HUMAN	acyl-CoA binding domain containing 3	222	Arg-rich.|Glu-rich.				steroid biosynthetic process (GO:0006694)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	fatty-acyl-CoA binding (GO:0000062)	p.R224L(2)		breast(2)|endometrium(3)|large_intestine(5)|lung(7)|skin(1)|urinary_tract(2)	20	Breast(184;0.158)			GBM - Glioblastoma multiforme(131;0.121)		ctatccgtctcctttcctcttcctcccgtcgaagcctttcctct	0.424																																					p.222_229del													.	ACBD3	38	2	Substitution - Missense(2)	lung(2)	c.664_687del						.																																			SO:0001651	inframe_deletion	64746	exon4			CCGTCTCCTTTCC	AB043587	CCDS1551.1	1q41	2013-10-16	2010-04-30	2003-11-12	ENSG00000182827	ENSG00000182827		"""A-kinase anchor proteins"""	15453	protein-coding gene	gene with protein product	"""PBR- and PKA-associated protein 7"""	606809	"""golgi complex associated protein 1, 60kDa"", ""acyl-Coenzyme A binding domain containing 3"""	GOLPH1, GOCAP1		12692076, 20150326	Standard	NM_022735		Approved	GCP60, PAP7	uc001hpy.3	Q9H3P7	OTTHUMG00000037560	ENST00000366812.5:c.664_687delCTTCGACGGGAGGAAGAGGAAAGG	1.37:g.226349273_226349296delCCTTTCCTCTTCCTCCCGTCGAAG	ENSP00000355777:p.Leu222_Arg229del	Somatic	51	0		WXS	Illumina GAIIx	Phase_I	55	6	NM_022735	B2RB29|Q5VTJ0|Q6P9F1|Q8IZC5|Q8N4D6|Q9H6U3	In_Frame_Del	DEL	ENST00000366812.5	37	CCDS1551.1																																																																																			.		0.424	ACBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091528.1	NM_022735	
ADCY10	55811	broad.mit.edu	37	1	167873153	167873153	+	Silent	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr1:167873153G>T	ENST00000367851.4	-	3	409	c.225C>A	c.(223-225)ctC>ctA	p.L75L	ADCY10_ENST00000367848.1_5'UTR|ADCY10_ENST00000545172.1_Intron	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	75	Guanylate cyclase 1. {ECO:0000255|PROSITE-ProRule:PRU00099}.				cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						TGTGGTAGTTGAGGATCTCCA	0.413																																					p.L75L													ADCY10,NS,carcinoma,-1,1	ADCY10	175	0			c.C225A						.						163.0	145.0	151.0					1																	167873153		2203	4300	6503	SO:0001819	synonymous_variant	55811	exon3			GTAGTTGAGGATC	AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.225C>A	1.37:g.167873153G>T		Somatic	40	0		WXS	Illumina GAIIx	Phase_I	87	3	NM_018417	B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Silent	SNP	ENST00000367851.4	37	CCDS1265.1																																																																																			.		0.413	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083663.1	NM_018417	
KLHL20	27252	broad.mit.edu	37	1	173722361	173722361	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr1:173722361C>T	ENST00000209884.4	+	5	902	c.766C>T	c.(766-768)Cat>Tat	p.H256Y	KLHL20_ENST00000546011.1_Missense_Mutation_p.H67Y	NM_014458.3	NP_055273.2	Q9Y2M5	KLH20_HUMAN	kelch-like family member 20	256	BACK.				cytoskeleton organization (GO:0007010)|Golgi to endosome transport (GO:0006895)|negative regulation of apoptotic process (GO:0043066)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K33-linked ubiquitination (GO:1990390)|protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|response to interferon-alpha (GO:0035455)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|PML body (GO:0016605)|trans-Golgi network (GO:0005802)	interferon-gamma binding (GO:0019964)|ubiquitin-protein transferase activity (GO:0004842)			breast(3)|endometrium(6)|kidney(1)|large_intestine(8)|lung(14)|ovary(1)|upper_aerodigestive_tract(1)	34						GGTGCTGCAGCATGTTCGTTT	0.433																																					p.H256Y	GBM(159;862 2695 6559 23041)												.	KLHL20	54	0			c.C766T						.						83.0	79.0	80.0					1																	173722361		2203	4300	6503	SO:0001583	missense	27252	exon5			CTGCAGCATGTTC	AB026190	CCDS1310.1	1q25.1	2013-01-30	2013-01-30		ENSG00000076321	ENSG00000076321		"""Kelch-like"", ""BTB/POZ domain containing"""	25056	protein-coding gene	gene with protein product			"""kelch-like 20 (Drosophila)"""			14668487, 20389280	Standard	NM_014458		Approved	KLEIP, KHLHX	uc001gjc.3	Q9Y2M5	OTTHUMG00000040548	ENST00000209884.4:c.766C>T	1.37:g.173722361C>T	ENSP00000209884:p.His256Tyr	Somatic	26	0		WXS	Illumina GAIIx	Phase_I	43	4	NM_014458	B3KMA0|B4DUR0|Q5TZF2|Q5ZF45|Q9H457	Missense_Mutation	SNP	ENST00000209884.4	37	CCDS1310.1	.	.	.	.	.	.	.	.	.	.	C	15.14	2.745909	0.49151	.	.	ENSG00000076321	ENST00000546011;ENST00000209884	T;T	0.68903	-0.36;-0.36	6.08	6.08	0.98989	BTB/Kelch-associated (2);	0.045499	0.85682	D	0.000000	T	0.73273	0.3566	L	0.47190	1.495	0.80722	D	1	D;P	0.89917	1.0;0.721	D;P	0.97110	1.0;0.601	T	0.67268	-0.5713	10	0.33141	T	0.24	.	19.4349	0.94788	0.0:1.0:0.0:0.0	.	67;256	B4DUR0;Q9Y2M5	.;KLH20_HUMAN	Y	67;256	ENSP00000443121:H67Y;ENSP00000209884:H256Y	ENSP00000209884:H256Y	H	+	1	0	KLHL20	171988984	1.000000	0.71417	0.999000	0.59377	0.420000	0.31355	7.476000	0.81055	2.894000	0.99253	0.655000	0.94253	CAT	.		0.433	KLHL20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097582.1	NM_014458	
PADI6	353238	broad.mit.edu	37	1	17725155	17725162	+	RNA	DEL	CCCCCCCA	CCCCCCCA	-	rs3094884|rs564160445		TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr1:17725155_17725162delCCCCCCCA	ENST00000434762.2	+	0	1740							Q6TGC4	PADI6_HUMAN	peptidyl arginine deiminase, type VI						cytoplasm organization (GO:0007028)|cytoskeleton organization (GO:0007010)|protein citrullination (GO:0018101)|regulation of translation by machinery localization (GO:0043143)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(2)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;7.59e-06)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.0134)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	CCcccgcccccccccccacccacccacc	0.572																																					.													.	PADI6	51	0			.						.			157,111		75,7,52							0.0		dbSNP_130	1	208,336		102,4,166	no	intron	PADI6	NM_207421.3		177,11,218	A1A1,A1R,RR		38.2353,41.4179,44.9507				365,447						353238	.			CGCCCCCCCCCCC	AY422079	CCDS72715.1	1p36.13	2014-07-10			ENSG00000256049	ENSG00000276747	3.5.3.15	"""Peptidyl arginine deiminases"""	20449	protein-coding gene	gene with protein product		610363				15087120	Standard	NM_207421		Approved		uc001bak.1	Q6TGC4	OTTHUMG00000002372		1.37:g.17725155_17725162delCCCCCCCA		Somatic	7	0		WXS	Illumina GAIIx	Phase_I	13	3	.	Q330K5|Q70SX3	RNA	DEL	ENST00000434762.2	37																																																																																				.		0.572	PADI6-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000006804.4	NM_207421	
PTGER3	5733	broad.mit.edu	37	1	71512790	71512790	+	Silent	SNP	C	C	G			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr1:71512790C>G	ENST00000306666.5	-	1	681	c.471G>C	c.(469-471)ctG>ctC	p.L157L	PTGER3_ENST00000351052.5_Silent_p.L157L|PTGER3_ENST00000370931.3_Silent_p.L157L|PTGER3_ENST00000414819.1_Silent_p.L157L|PTGER3_ENST00000356595.4_Silent_p.L157L|PTGER3_ENST00000354608.5_Silent_p.L157L|PTGER3_ENST00000460330.1_Silent_p.L157L|PTGER3_ENST00000370932.2_Silent_p.L157L|PTGER3_ENST00000370924.4_Silent_p.L157L|ZRANB2-AS1_ENST00000450461.1_RNA	NM_198719.1	NP_942012.1	P43115	PE2R3_HUMAN	prostaglandin E receptor 3 (subtype EP3)	157					cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of fever generation (GO:0031622)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|prostaglandin E receptor activity (GO:0004957)			endometrium(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25					Bimatoprost(DB00905)|Dinoprostone(DB00917)|Misoprostol(DB00929)	CCCTGATGGCCAGCGCCCGCT	0.682																																					p.L157L													.	PTGER3	246	0			c.G471C						.						9.0	11.0	10.0					1																	71512790		2185	4270	6455	SO:0001819	synonymous_variant	5733	exon1			GATGGCCAGCGCC	X83863	CCDS652.1, CCDS655.1, CCDS656.1, CCDS657.1, CCDS658.1	1p31.2	2012-08-08			ENSG00000050628	ENSG00000050628		"""GPCR / Class A : Prostanoid receptors"""	9595	protein-coding gene	gene with protein product		176806				7759114, 9073510	Standard	NM_001126044		Approved	EP3	uc001dfo.3	P43115	OTTHUMG00000009399	ENST00000306666.5:c.471G>C	1.37:g.71512790C>G		Somatic	32	0		WXS	Illumina GAIIx	Phase_I	44	6	NM_001126044	B0AZN4|B1AK19|B5BUP5|O00326|Q12943|Q12944|Q12945|Q16546|Q5CZ59|Q5CZ61|Q5CZ62|Q5CZ63|Q5CZ64	Silent	SNP	ENST00000306666.5	37	CCDS657.1																																																																																			.		0.682	PTGER3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000026076.1	NM_000957	
NBPF10	100132406	broad.mit.edu	37	1	145323666	145323666	+	Missense_Mutation	SNP	A	A	G			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr1:145323666A>G	ENST00000342960.5	+	27	3538	c.3503A>G	c.(3502-3504)gAc>gGc	p.D1168G	NBPF10_ENST00000369338.1_Intron|NBPF10_ENST00000369339.3_Intron	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	755						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.D1168G(2)		NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		ATTAAAAAGGACGAAGAAGAG	0.468																																					p.D1168G													NBPF10,NS,carcinoma,-1,6	NBPF10	221	2	Substitution - Missense(2)	endometrium(1)|kidney(1)	c.A3503G						.																																			SO:0001583	missense	100132406	exon27			AAAAGGACGAAGA	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.3503A>G	1.37:g.145323666A>G	ENSP00000345684:p.Asp1168Gly	Somatic	100	0		WXS	Illumina GAIIx	Phase_I	136	5	NM_001039703	Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000342960.5	37	CCDS53355.1	.	.	.	.	.	.	.	.	.	.	.	8.978	0.974738	0.18736	.	.	ENSG00000163386	ENST00000342960	T	0.03524	3.9	.	.	.	.	.	.	.	.	T	0.02380	0.0073	L	0.60455	1.87	0.09310	N	1	.	.	.	.	.	.	T	0.42965	-0.9420	5	0.45353	T	0.12	.	.	.	.	.	.	.	.	G	1168	ENSP00000345684:D1168G	ENSP00000345684:D1168G	D	+	2	0	NBPF10	144035023	0.002000	0.14202	0.003000	0.11579	0.095000	0.18619	-0.338000	0.07842	0.386000	0.24997	0.128000	0.15822	GAC	.		0.468	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001039703	
LAX1	54900	broad.mit.edu	37	1	203743058	203743058	+	Missense_Mutation	SNP	A	A	G			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr1:203743058A>G	ENST00000442561.2	+	5	836	c.446A>G	c.(445-447)gAg>gGg	p.E149G	LAX1_ENST00000367217.5_Missense_Mutation_p.E133G|LAX1_ENST00000367215.1_3'UTR	NM_017773.3	NP_060243.2	Q8IWV1	LAX1_HUMAN	lymphocyte transmembrane adaptor 1	149					antigen receptor-mediated signaling pathway (GO:0050851)|B cell activation (GO:0042113)|immune response (GO:0006955)|immunoglobulin secretion (GO:0048305)|inactivation of MAPK activity (GO:0000188)|intracellular signal transduction (GO:0035556)|negative regulation of T cell activation (GO:0050868)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)			central_nervous_system(2)|endometrium(3)|large_intestine(2)|lung(13)|prostate(1)|stomach(1)|urinary_tract(2)	24	all_cancers(21;0.0915)		BRCA - Breast invasive adenocarcinoma(75;0.109)			CATGCCACAGAGTACGCGGTG	0.542																																					p.E149G													.	LAX1	48	0			c.A446G						.						81.0	74.0	76.0					1																	203743058		2203	4300	6503	SO:0001583	missense	54900	exon5			CCACAGAGTACGC	AK000347	CCDS1441.2, CCDS44297.1	1q32.1	2008-02-05			ENSG00000122188	ENSG00000122188			26005	protein-coding gene	gene with protein product	"""LAT-like membrane associated protein"", ""linker for activation of x cells"""					12359715	Standard	NM_017773		Approved	LAX, FLJ20340	uc001haa.3	Q8IWV1	OTTHUMG00000035908	ENST00000442561.2:c.446A>G	1.37:g.203743058A>G	ENSP00000406970:p.Glu149Gly	Somatic	12	0		WXS	Illumina GAIIx	Phase_I	13	3	NM_017773	B7Z744|J3KP69|Q6NSZ6|Q9NXB4	Missense_Mutation	SNP	ENST00000442561.2	37	CCDS1441.2	.	.	.	.	.	.	.	.	.	.	A	3.709	-0.059872	0.07317	.	.	ENSG00000122188	ENST00000442561;ENST00000367217	.	.	.	5.34	2.18	0.27775	.	0.763950	0.11948	N	0.513966	T	0.13586	0.0329	N	0.03115	-0.41	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.29212	-1.0019	9	0.17832	T	0.49	-8.5359	4.007	0.09605	0.2397:0.1942:0.5661:0.0	.	133;149	B7Z744;Q8IWV1	.;LAX1_HUMAN	G	149;133	.	ENSP00000356186:E133G	E	+	2	0	LAX1	202009681	0.000000	0.05858	0.003000	0.11579	0.010000	0.07245	-0.081000	0.11321	0.538000	0.28769	0.533000	0.62120	GAG	.		0.542	LAX1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087468.3	NM_017773	
TBCE	6905	broad.mit.edu	37	1	235602123	235602123	+	Silent	SNP	C	C	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr1:235602123C>A	ENST00000366601.3	+	13	1332	c.1156C>A	c.(1156-1158)Cga>Aga	p.R386R	TBCE_ENST00000543662.1_Silent_p.R437R|TBCE_ENST00000472011.1_3'UTR|TBCE_ENST00000406207.1_Silent_p.R386R			Q15813	TBCE_HUMAN	tubulin folding cofactor E	386					'de novo' posttranslational protein folding (GO:0051084)|adult locomotory behavior (GO:0008344)|cellular protein metabolic process (GO:0044267)|developmental growth (GO:0048589)|microtubule cytoskeleton organization (GO:0000226)|muscle atrophy (GO:0014889)|peripheral nervous system neuron axonogenesis (GO:0048936)|post-chaperonin tubulin folding pathway (GO:0007023)|post-embryonic development (GO:0009791)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	chaperone binding (GO:0051087)			NS(1)|endometrium(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	14	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00192)|Prostate(94;0.0294)|all_epithelial(177;0.155)|Lung SC(1967;0.238)	OV - Ovarian serous cystadenocarcinoma(106;2.56e-05)			GCTTGACTACCGAAAAGCTTT	0.448																																					p.R386R													TBCE,NS,carcinoma,-1,3	TBCE	40	0			c.C1156A						.						103.0	102.0	102.0					1																	235602123		2203	4300	6503	SO:0001819	synonymous_variant	6905	exon13			GACTACCGAAAAG	U61232	CCDS1605.1, CCDS73052.1	1q42.3	2014-02-04	2006-11-21		ENSG00000116957	ENSG00000116957			11582	protein-coding gene	gene with protein product		604934	"""tubulin-specific chaperone e"", ""Kenny-Caffey syndrome"", ""hypoparathyroidism, growth and mental retardation, and dysmorphism"""	KCS, HRD		8706133, 9806825, 12389028	Standard	NM_001079515		Approved	KCS1, pac2	uc001hxa.1	Q15813	OTTHUMG00000039987	ENST00000366601.3:c.1156C>A	1.37:g.235602123C>A		Somatic	43	0		WXS	Illumina GAIIx	Phase_I	77	3	NM_003193	A8K8C2|B7Z3P1	Silent	SNP	ENST00000366601.3	37	CCDS1605.1																																																																																			.		0.448	TBCE-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000096458.3	NM_003193	
ANK3	288	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	61900193	61900193	+	Intron	SNP	A	A	C			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr10:61900193A>C	ENST00000280772.2	-	24	2806				ANK3_ENST00000373827.2_Intron|ANK3_ENST00000355288.2_De_novo_Start_OutOfFrame|ANK3_ENST00000460468.1_Intron|ANK3_ENST00000503366.1_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)						axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						AGTGATTTAGAATCAACCTCC	0.433																																					.													.	ANK3	703	0			.						.						106.0	87.0	93.0					10																	61900193		692	1591	2283	SO:0001627	intron_variant	288	.			ATTTAGAATCAAC	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.2615-1348T>G	10.37:g.61900193A>C		Somatic	38	0		WXS	Illumina GAIIx	Phase_I	34	4	.	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Translation_Start_Site	SNP	ENST00000280772.2	37	CCDS7258.1																																																																																			.		0.433	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
CAPRIN1	4076	broad.mit.edu	37	11	34101180	34101180	+	Missense_Mutation	SNP	G	G	C			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr11:34101180G>C	ENST00000341394.4	+	7	883	c.694G>C	c.(694-696)Gtt>Ctt	p.V232L	CAPRIN1_ENST00000532820.1_Missense_Mutation_p.V232L|CAPRIN1_ENST00000389645.3_Missense_Mutation_p.V232L|CAPRIN1_ENST00000529307.1_Missense_Mutation_p.V151L|CAPRIN1_ENST00000530820.1_Missense_Mutation_p.V232L	NM_005898.4	NP_005889.3	Q14444	CAPR1_HUMAN	cell cycle associated protein 1	232					negative regulation of translation (GO:0017148)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	18		Acute lymphoblastic leukemia(5;0.00045)|all_hematologic(20;0.0016)				CTTAGATAAAGTTCTAAAGGA	0.373																																					p.V232L													.	CAPRIN1	110	0			c.G694C						.						71.0	74.0	73.0					11																	34101180		2202	4298	6500	SO:0001583	missense	4076	exon7			GATAAAGTTCTAA	BC001731	CCDS31453.1, CCDS31454.1	11p13	2010-08-03	2007-03-27	2007-03-27	ENSG00000135387	ENSG00000135387			6743	protein-coding gene	gene with protein product	"""cytoplasmic activation/proliferation-associated protein-1"""	601178	"""membrane component, chromosome 11, surface marker 1"", ""GPI-anchored membrane protein 1"""	M11S1, GPIAP1		7657653, 16177067, 17210633, 14764709, 15471883	Standard	NM_005898		Approved	caprin-1, RNG105	uc001mvh.1	Q14444	OTTHUMG00000166248	ENST00000341394.4:c.694G>C	11.37:g.34101180G>C	ENSP00000340329:p.Val232Leu	Somatic	35	0		WXS	Illumina GAIIx	Phase_I	40	3	NM_203364	A6NMY7|D3DR06|Q15074|Q6IMN4|Q6IMN7|Q9BV09	Missense_Mutation	SNP	ENST00000341394.4	37	CCDS31453.1	.	.	.	.	.	.	.	.	.	.	G	12.44	1.938832	0.34189	.	.	ENSG00000135387	ENST00000341394;ENST00000389645;ENST00000532820;ENST00000530820;ENST00000529307	T;T;T;T;T	0.30981	1.51;1.51;1.51;1.51;1.51	5.56	4.65	0.58169	.	0.309004	0.39544	N	0.001328	T	0.19248	0.0462	N	0.22421	0.69	0.36895	D	0.890095	B;B	0.21225	0.053;0.049	B;B	0.18871	0.009;0.023	T	0.13737	-1.0498	10	0.23891	T	0.37	-0.3464	9.6275	0.39759	0.0705:0.0:0.787:0.1425	.	232;232	Q14444;Q14444-2	CAPR1_HUMAN;.	L	232;232;232;232;151	ENSP00000340329:V232L;ENSP00000374296:V232L;ENSP00000434150:V232L;ENSP00000434204:V232L;ENSP00000431581:V151L	ENSP00000340329:V232L	V	+	1	0	CAPRIN1	34057756	1.000000	0.71417	1.000000	0.80357	0.406000	0.30931	4.428000	0.59894	1.476000	0.48215	-0.190000	0.12839	GTT	.		0.373	CAPRIN1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000388680.2	NM_005898	
CAPRIN1	4076	broad.mit.edu	37	11	34110974	34110974	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr11:34110974C>A	ENST00000341394.4	+	12	1453	c.1264C>A	c.(1264-1266)Caa>Aaa	p.Q422K	CAPRIN1_ENST00000532820.1_Missense_Mutation_p.Q422K|CAPRIN1_ENST00000389645.3_Missense_Mutation_p.Q422K|CAPRIN1_ENST00000529307.1_Missense_Mutation_p.Q341K|CAPRIN1_ENST00000530820.1_Missense_Mutation_p.Q422K	NM_005898.4	NP_005889.3	Q14444	CAPR1_HUMAN	cell cycle associated protein 1	422					negative regulation of translation (GO:0017148)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	18		Acute lymphoblastic leukemia(5;0.00045)|all_hematologic(20;0.0016)				TCAGCCTAATCAAGTTCCTGT	0.388																																					p.Q422K													.	CAPRIN1	110	0			c.C1264A						.						97.0	88.0	91.0					11																	34110974		2202	4298	6500	SO:0001583	missense	4076	exon12			CCTAATCAAGTTC	BC001731	CCDS31453.1, CCDS31454.1	11p13	2010-08-03	2007-03-27	2007-03-27	ENSG00000135387	ENSG00000135387			6743	protein-coding gene	gene with protein product	"""cytoplasmic activation/proliferation-associated protein-1"""	601178	"""membrane component, chromosome 11, surface marker 1"", ""GPI-anchored membrane protein 1"""	M11S1, GPIAP1		7657653, 16177067, 17210633, 14764709, 15471883	Standard	NM_005898		Approved	caprin-1, RNG105	uc001mvh.1	Q14444	OTTHUMG00000166248	ENST00000341394.4:c.1264C>A	11.37:g.34110974C>A	ENSP00000340329:p.Gln422Lys	Somatic	44	0		WXS	Illumina GAIIx	Phase_I	44	3	NM_203364	A6NMY7|D3DR06|Q15074|Q6IMN4|Q6IMN7|Q9BV09	Missense_Mutation	SNP	ENST00000341394.4	37	CCDS31453.1	.	.	.	.	.	.	.	.	.	.	C	11.34	1.609915	0.28712	.	.	ENSG00000135387	ENST00000341394;ENST00000389645;ENST00000532820;ENST00000530820;ENST00000529307	T;T;T;T;T	0.22539	1.95;1.95;1.95;1.95;1.95	5.45	5.45	0.79879	.	0.316455	0.35262	N	0.003333	T	0.20700	0.0498	L	0.44542	1.39	0.34456	D	0.701256	B;B	0.23854	0.092;0.075	B;B	0.24541	0.054;0.032	T	0.17137	-1.0379	10	0.10636	T	0.68	.	19.2816	0.94054	0.0:1.0:0.0:0.0	.	422;422	Q14444;Q14444-2	CAPR1_HUMAN;.	K	422;422;422;422;341	ENSP00000340329:Q422K;ENSP00000374296:Q422K;ENSP00000434150:Q422K;ENSP00000434204:Q422K;ENSP00000431581:Q341K	ENSP00000340329:Q422K	Q	+	1	0	CAPRIN1	34067550	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	2.703000	0.47110	2.539000	0.85634	0.563000	0.77884	CAA	.		0.388	CAPRIN1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000388680.2	NM_005898	
BRF1	2972	broad.mit.edu;bcgsc.ca	37	14	105722744	105722744	+	Intron	SNP	C	C	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr14:105722744C>T	ENST00000546474.1	-	4	15431				BRF1_ENST00000440513.3_Intron|BRF1_ENST00000379937.2_Intron|BRF1_ENST00000548421.1_Silent_p.P194P|BRF1_ENST00000327359.3_Intron	NM_001242787.1|NM_001519.3	NP_001229716.1|NP_001510.2	Q92994	TF3B_HUMAN	BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit						gene expression (GO:0010467)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase III promoter (GO:0006384)|tRNA transcription (GO:0009304)	nucleoplasm (GO:0005654)|transcription factor TFIIIB complex (GO:0000126)	zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	24		all_cancers(154;0.0231)|all_epithelial(191;0.0694)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00753)|all cancers(16;0.00925)|Epithelial(46;0.0221)	Epithelial(152;0.14)		CAGCACAGACCGGCCACTGAG	0.612																																					p.P194P													.	BRF1	102	0			c.G582A						.																																			SO:0001627	intron_variant	2972	exon4			ACAGACCGGCCAC	U28838	CCDS10001.1, CCDS42001.1, CCDS55949.1, CCDS55950.1, CCDS55951.1, CCDS55952.1, CCDS55953.1	14q32.33	2014-04-02	2013-05-29	2001-12-07	ENSG00000185024	ENSG00000185024		"""General transcription factors"""	11551	protein-coding gene	gene with protein product		604902	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 2"", ""BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae)"""	TAF3B2, TAF3C, GTF3B		7624363, 8943358	Standard	NM_145685		Approved	TFIIIB90, BRF, hBRF	uc001yqp.2	Q92994	OTTHUMG00000029884	ENST00000546474.1:c.471+110G>A	14.37:g.105722744C>T		Somatic	50	0		WXS	Illumina GAIIx	Phase_I	54	5	NM_001242790	B3KU36|B4DIG5|B7Z2N3|F5H5Z7|F8WA46|Q13223|Q3SYD9|Q5PR24|Q6IQ02|Q96KX3|Q9HCW6|Q9HCW7|Q9HCW8	Silent	SNP	ENST00000546474.1	37	CCDS10001.1	.	.	.	.	.	.	.	.	.	.	C	1.536	-0.543063	0.04053	.	.	ENSG00000185024	ENST00000345053	.	.	.	0.837	-0.139	0.13460	.	.	.	.	.	T	0.21881	0.0527	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24440	-1.0160	5	0.27785	T	0.31	.	3.1476	0.06477	0.0:0.6638:0.0:0.3362	.	.	.	.	S	194	.	ENSP00000339442:G194S	G	-	1	0	BRF1	104793789	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-1.052000	0.03503	-0.070000	0.12908	-0.218000	0.12543	GGT	.		0.612	BRF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074548.4	NM_001519	
KDM6B	23135	broad.mit.edu	37	17	7750178	7750186	+	In_Frame_Del	DEL	ACCACCACC	ACCACCACC	-	rs576442057|rs537249930	byFrequency	TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr17:7750178_7750186delACCACCACC	ENST00000448097.2	+	9	1084_1092	c.753_761delACCACCACC	c.(751-762)ttaccaccacca>tta	p.PPP261del	KDM6B_ENST00000254846.5_In_Frame_Del_p.PPP261del			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	261	Pro-rich.				cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						caccaccattaccaccaccaccaccacca	0.608																																					p.251_254del													.	KDM6B	95	0			c.753_761del						.																																			SO:0001651	inframe_deletion	23135	exon9			ACCATTACCACCA	AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		ENST00000448097.2:c.753_761delACCACCACC	17.37:g.7750187_7750195delACCACCACC	ENSP00000412513:p.Pro261_Pro263del	Somatic	9	0		WXS	Illumina GAIIx	Phase_I	8	3	NM_001080424	C9IZ40|Q96G33	In_Frame_Del	DEL	ENST00000448097.2	37																																																																																				.		0.608	KDM6B-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000440248.1	XM_043272	
KRT16P3	644945	broad.mit.edu	37	17	20407305	20407305	+	RNA	SNP	C	C	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr17:20407305C>T	ENST00000580113.1	-	0	334									keratin 16 pseudogene 3																		ACTTCCAGGTCGGCGTTGGCC	0.597																																					.													.	.	.	0			.						.																																					0	.			CCAGGTCGGCGTT	BC110641		17p11.2	2014-06-12			ENSG00000214822	ENSG00000214822			37808	pseudogene	pseudogene			"""cytokeratin, Smith Magenis syndrome chromosome region"""	KERSMCR			Standard	NR_029393		Approved	MGC102966	uc002gxb.3		OTTHUMG00000130724		17.37:g.20407305C>T		Somatic	116	0		WXS	Illumina GAIIx	Phase_I	98	15	.		RNA	SNP	ENST00000580113.1	37																																																																																				.		0.597	KRT16P3-004	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000443764.1	NR_029393	
KRTAP4-7	100132476	broad.mit.edu	37	17	39240627	39240627	+	Missense_Mutation	SNP	T	T	C	rs189343211		TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr17:39240627T>C	ENST00000391417.4	+	1	169	c.169T>C	c.(169-171)Tct>Cct	p.S57P		NM_033061.3	NP_149050.3	Q9BYR0	KRA47_HUMAN	keratin associated protein 4-7	57	31 X 5 AA repeats of C-C-[GIKRQVHEML]- [SPTRV]-[STVQRCP].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.S57P(4)		NS(1)|endometrium(3)|kidney(1)|lung(1)|prostate(2)|urinary_tract(1)	9						GTGCTGCCAGTCTGTGTGCTG	0.667																																					p.S57P													KRTAP4-9_ENST00000377734,NS,carcinoma,0,22	KRTAP4-7	49	4	Substitution - Missense(4)	urinary_tract(2)|kidney(2)	c.T169C						.						18.0	28.0	25.0					17																	39240627		691	1590	2281	SO:0001583	missense	100132476	exon1			TGCCAGTCTGTGT	AJ406939	CCDS45673.1	17q21.2	2013-06-25			ENSG00000240871	ENSG00000240871		"""Keratin associated proteins"""	18898	protein-coding gene	gene with protein product						11279113	Standard	NM_033061		Approved	KAP4.7	uc010wfn.2	Q9BYR0	OTTHUMG00000133582	ENST00000391417.4:c.169T>C	17.37:g.39240627T>C	ENSP00000375236:p.Ser57Pro	Somatic	112	2		WXS	Illumina GAIIx	Phase_I	99	5	NM_033061	A0AVM6|A8MQ08|A8MTL4	Missense_Mutation	SNP	ENST00000391417.4	37	CCDS45673.1	.	.	.	.	.	.	.	.	.	.	.	0.387	-0.925721	0.02377	.	.	ENSG00000240871;ENSG00000212722	ENST00000391417;ENST00000377734	T	0.01272	5.07	3.6	-0.386	0.12466	.	1.254490	0.05892	N	0.628448	T	0.00695	0.0023	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.43572	-0.9383	9	0.02654	T	1	.	4.4551	0.11639	0.0:0.4346:0.1731:0.3923	.	57	Q9BYR0	KRA47_HUMAN	P	57	ENSP00000375236:S57P	ENSP00000375236:S57P	S	+	1	0	KRTAP4-9;KRTAP4-7	36494153	0.000000	0.05858	0.033000	0.17914	0.157000	0.22087	-0.806000	0.04525	0.004000	0.14682	0.374000	0.22700	TCT	.		0.667	KRTAP4-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257686.1		
SERTAD1	29950	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	40929001	40929001	+	Silent	SNP	G	G	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr19:40929001G>A	ENST00000357949.4	-	2	611	c.453C>T	c.(451-453)agC>agT	p.S151S		NM_013376.3	NP_037508.2	Q9UHV2	SRTD1_HUMAN	SERTA domain containing 1	151					positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription, DNA-templated (GO:0006351)					endometrium(2)|lung(1)|prostate(1)|skin(1)	5			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AGGCACCCAGGCTGGGCGCTG	0.622																																					p.S151S													.	SERTAD1	18	0			c.C453T						.						14.0	13.0	14.0					19																	40929001		2191	4288	6479	SO:0001819	synonymous_variant	29950	exon2			ACCCAGGCTGGGC	AF117959	CCDS12557.1	19q13.1-q13.2	2008-02-05				ENSG00000197019			17932	protein-coding gene	gene with protein product	"""CDK4-binding protein p34SEI"", ""transcriptional regulator interacting with the PHD-bromodomain 1"""					6434876, 10580009	Standard	NM_013376		Approved	SEI1, TRIP-Br1	uc002ont.4	Q9UHV2		ENST00000357949.4:c.453C>T	19.37:g.40929001G>A		Somatic	37	0		WXS	Illumina GAIIx	Phase_I	29	4	NM_013376	Q9BUE7	Silent	SNP	ENST00000357949.4	37	CCDS12557.1																																																																																			.		0.622	SERTAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462571.1	NM_013376	
ANKRD36C	400986	broad.mit.edu	37	2	96643871	96643871	+	Splice_Site	SNP	T	T	C	rs201215924		TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr2:96643871T>C	ENST00000456556.1	-	6	882	c.798A>G	c.(796-798)ccA>ccG	p.P266P				Q5JPF3	AN36C_HUMAN	ankyrin repeat domain 36C	266							ion channel inhibitor activity (GO:0008200)	p.P266P(2)		breast(1)|endometrium(8)|kidney(5)|lung(4)	18						AAATCTTACCTGGATTGCTAT	0.239																																					.													ENSG00000174501,NS,carcinoma,0,2	.	.	2	Substitution - coding silent(2)	endometrium(1)|kidney(1)	.						.																																			SO:0001630	splice_region_variant	400986	.			CTTACCTGGATTG	AL832836		2q11.1	2013-01-10			ENSG00000174501	ENSG00000174501		"""Ankyrin repeat domain containing"""	32946	protein-coding gene	gene with protein product	"""protein immuno-reactive with anti-PTH polyclonal antibodies"""						Standard	XR_251121		Approved	DKFZp667P0924	uc002suz.1	Q5JPF3	OTTHUMG00000155211	ENST00000456556.1:c.799+1A>G	2.37:g.96643871T>C		Somatic	76	1		WXS	Illumina GAIIx	Phase_I	98	5	.	C9JZ08|Q15694|Q53S06|Q658V2	Splice_Site	SNP	ENST00000456556.1	37																																																																																				.		0.239	ANKRD36C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000338799.2	NM_001010914	Silent
AMMECR1L	83607	broad.mit.edu	37	2	128628430	128628430	+	Silent	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr2:128628430G>T	ENST00000272647.5	-	5	851	c.591C>A	c.(589-591)ctC>ctA	p.L197L	AMMECR1L_ENST00000393001.1_Silent_p.L197L	NM_001199140.1	NP_001186069.1	Q6DCA0	AMERL_HUMAN	AMMECR1-like	197	AMMECR1. {ECO:0000255|PROSITE- ProRule:PRU00467}.									central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)	9	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.07)		AGTTAGTAAGGAGGGAGACAG	0.517																																					p.L197L													.	AMMECR1L	22	0			c.C591A						.						63.0	58.0	60.0					2																	128628430		2203	4300	6503	SO:0001819	synonymous_variant	83607	exon5			AGTAAGGAGGGAG		CCDS2152.1	2q21	2012-11-15	2012-11-15		ENSG00000144233	ENSG00000144233			28658	protein-coding gene	gene with protein product			"""AMME chromosomal region gene 1-like"""				Standard	NM_001199140		Approved	MGC4268	uc002tpl.3	Q6DCA0	OTTHUMG00000131535	ENST00000272647.5:c.591C>A	2.37:g.128628430G>T		Somatic	26	0		WXS	Illumina GAIIx	Phase_I	35	3	NM_031445	B4E276	Silent	SNP	ENST00000272647.5	37	CCDS2152.1																																																																																			.		0.517	AMMECR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254392.1	NM_031445	
NOA1	84273	broad.mit.edu	37	4	57843464	57843464	+	Silent	SNP	T	T	C			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr4:57843464T>C	ENST00000264230.4	-	1	1525	c.288A>G	c.(286-288)caA>caG	p.Q96Q	POLR2B_ENST00000381227.1_5'Flank|POLR2B_ENST00000441246.2_5'Flank|POLR2B_ENST00000314595.5_5'Flank|POLR2B_ENST00000431623.2_5'Flank	NM_032313.2	NP_115689.1	Q8NC60	NOA1_HUMAN	nitric oxide associated 1	96					apoptotic process (GO:0006915)|GTP catabolic process (GO:0006184)|mitochondrial translation (GO:0032543)|regulation of cell death (GO:0010941)|regulation of cellular respiration (GO:0043457)|ribosome biogenesis (GO:0042254)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)										cctcctgctgttgctggagct	0.657																																					p.Q96Q													.	.	.	0			c.A288G						.						37.0	37.0	37.0					4																	57843464		2203	4296	6499	SO:0001819	synonymous_variant	84273	exon1			CTGCTGTTGCTGG	AK098215	CCDS3510.1	4q12	2013-05-24	2011-10-19	2011-10-19	ENSG00000084092	ENSG00000084092			28473	protein-coding gene	gene with protein product	"""nitric oxide synthase, mitochondrial (putative)"", ""mitochondrial GTPase 3 homolog (S. cerevisiae)"""	614919	"""chromosome 4 open reading frame 14"""	C4orf14		16380119, 2118999, 21771794, 22447445	Standard	NM_032313		Approved	MGC3232, hAtNOS1, hNOA1, MTG3	uc003hck.3	Q8NC60	OTTHUMG00000128773	ENST00000264230.4:c.288A>G	4.37:g.57843464T>C		Somatic	19	0		WXS	Illumina GAIIx	Phase_I	27	3	NM_032313	Q8N7L6|Q9BSQ9	Silent	SNP	ENST00000264230.4	37	CCDS3510.1																																																																																			.		0.657	NOA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250694.2	NM_032313	
TBC1D9	23158	broad.mit.edu	37	4	141677078	141677080	+	In_Frame_Del	DEL	CCG	CCG	-			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr4:141677078_141677080delCCG	ENST00000442267.2	-	1	194_196	c.120_122delCGG	c.(118-123)ggcgga>gga	p.40_41GG>G	RP11-102N12.3_ENST00000609937.1_lincRNA	NM_015130.2	NP_055945.2	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	40							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	31	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				ACCCGCCAGTCCGCCGCCGCCGC	0.739																																					p.40_41del													.	TBC1D9	198	0			c.120_122del						.																																			SO:0001651	inframe_deletion	23158	exon1			GCCAGTCCGCCGC	AB020689	CCDS47136.1	4q31.1	2013-01-10	2006-07-12		ENSG00000109436	ENSG00000109436		"""EF-hand domain containing"""	21710	protein-coding gene	gene with protein product			"""TBC1 domain family, member 9"""			12970790	Standard	NM_015130		Approved	KIAA0882, MDR1	uc010ioj.3	Q6ZT07	OTTHUMG00000161405	ENST00000442267.2:c.120_122delCGG	4.37:g.141677087_141677089delCCG	ENSP00000411197:p.Gly41del	Somatic	7	0		WXS	Illumina GAIIx	Phase_I	6	2	NM_015130	A6H8U8|D3DNZ1|O94958	In_Frame_Del	DEL	ENST00000442267.2	37	CCDS47136.1																																																																																			.		0.739	TBC1D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364806.1	NM_015130	
PTCD2	79810	broad.mit.edu	37	5	71630907	71630907	+	Missense_Mutation	SNP	C	C	G			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr5:71630907C>G	ENST00000380639.5	+	5	547	c.531C>G	c.(529-531)atC>atG	p.I177M	PTCD2_ENST00000503868.1_Intron|PTCD2_ENST00000543322.1_Intron|PTCD2_ENST00000536805.1_Intron	NM_024754.3	NP_079030.3	Q8WV60	PTCD2_HUMAN	pentatricopeptide repeat domain 2	177					kidney development (GO:0001822)|liver development (GO:0001889)|mitochondrion organization (GO:0007005)|mRNA processing (GO:0006397)|muscle fiber development (GO:0048747)|regulation of mRNA processing (GO:0050684)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(6)|lung(1)|skin(1)	11		Lung NSC(167;0.00237)|Ovarian(174;0.0175)|Prostate(461;0.141)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.73e-53)		TGTTATTTATCAAAGGCAAAT	0.328																																					p.I177M													.	PTCD2	31	0			c.C531G						.						68.0	67.0	67.0					5																	71630907		2202	4296	6498	SO:0001583	missense	79810	exon5			ATTTATCAAAGGC	BC018720	CCDS4014.2, CCDS68891.1, CCDS68892.1, CCDS75258.1	5q13.2	2008-02-05			ENSG00000049883	ENSG00000049883			25734	protein-coding gene	gene with protein product		615484				12477932	Standard	XM_005248601		Approved	FLJ12598	uc003kcb.3	Q8WV60	OTTHUMG00000100953	ENST00000380639.5:c.531C>G	5.37:g.71630907C>G	ENSP00000370013:p.Ile177Met	Somatic	46	0		WXS	Illumina GAIIx	Phase_I	45	5	NM_024754	B7Z5D0|B7Z8L7|E9PFV7|Q6IA65|Q9H9R0	Missense_Mutation	SNP	ENST00000380639.5	37	CCDS4014.2	.	.	.	.	.	.	.	.	.	.	C	16.50	3.140241	0.56936	.	.	ENSG00000049883	ENST00000380639;ENST00000510676	T;T	0.50277	0.99;0.75	6.04	3.22	0.36961	.	0.660669	0.16488	N	0.212225	T	0.43523	0.1251	M	0.62723	1.935	0.80722	D	1	B	0.26002	0.139	B	0.24701	0.055	T	0.29882	-0.9997	10	0.56958	D	0.05	.	8.0375	0.30502	0.0:0.7172:0.1302:0.1526	.	177	Q8WV60	PTCD2_HUMAN	M	177;6	ENSP00000370013:I177M;ENSP00000426295:I6M	ENSP00000308948:I177M	I	+	3	3	PTCD2	71666663	0.987000	0.35691	0.993000	0.49108	0.943000	0.58893	0.672000	0.25187	0.391000	0.25143	0.563000	0.77884	ATC	.		0.328	PTCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218562.6	NM_024754	
NSD1	64324	broad.mit.edu	37	5	176721680	176721680	+	Silent	SNP	A	A	G			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr5:176721680A>G	ENST00000439151.2	+	23	7356	c.7311A>G	c.(7309-7311)aaA>aaG	p.K2437K	NSD1_ENST00000347982.4_Silent_p.K2168K|NSD1_ENST00000361032.4_Silent_p.K2334K|NSD1_ENST00000354179.4_Silent_p.K2168K	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	2437					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		CTAAAGAAAAAGCACTGAGGC	0.502			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																											p.K2437K				Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	.	NSD1	416	0			c.A7311G						.						52.0	58.0	56.0					5																	176721680		2203	4300	6503	SO:0001819	synonymous_variant	64324	exon23	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AGAAAAAGCACTG	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.7311A>G	5.37:g.176721680A>G		Somatic	30	0		WXS	Illumina GAIIx	Phase_I	35	3	NM_022455	Q96PD8|Q96RN7	Silent	SNP	ENST00000439151.2	37	CCDS4412.1																																																																																			.		0.502	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253412.2	NM_172349	
ZNF184	7738	broad.mit.edu	37	6	27420368	27420368	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr6:27420368G>T	ENST00000211936.6	-	6	1254	c.970C>A	c.(970-972)Cat>Aat	p.H324N	ZNF184_ENST00000377419.1_Missense_Mutation_p.H324N	NM_007149.2	NP_009080.2	Q99676	ZN184_HUMAN	zinc finger protein 184	324					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|kidney(9)|large_intestine(13)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						ATTCTCTGATGCTGAACAAGA	0.398																																					p.H324N													.	ZNF184	89	0			c.C970A						.						51.0	52.0	52.0					6																	27420368		2203	4300	6503	SO:0001583	missense	7738	exon6			TCTGATGCTGAAC	U66561	CCDS4624.1	6p21.3	2013-01-08	2006-06-28		ENSG00000096654	ENSG00000096654		"""Zinc fingers, C2H2-type"", ""-"""	12975	protein-coding gene	gene with protein product		602277	"""zinc finger protein 184 (Kruppel-like)"""				Standard	NM_007149		Approved		uc003nji.3	Q99676	OTTHUMG00000014478	ENST00000211936.6:c.970C>A	6.37:g.27420368G>T	ENSP00000211936:p.His324Asn	Somatic	47	0		WXS	Illumina GAIIx	Phase_I	52	4	NM_007149	B2R715|O60792|Q8TBA9	Missense_Mutation	SNP	ENST00000211936.6	37	CCDS4624.1	.	.	.	.	.	.	.	.	.	.	G	16.53	3.149936	0.57151	.	.	ENSG00000096654	ENST00000211936;ENST00000377419;ENST00000341087;ENST00000538681	D;D	0.86865	-2.18;-2.18	4.8	4.8	0.61643	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.49305	D	0.000156	D	0.94683	0.8285	H	0.96576	3.845	0.36536	D	0.871022	D	0.89917	1.0	D	0.91635	0.999	D	0.95530	0.8602	10	0.87932	D	0	.	10.7451	0.46177	0.0:0.0:0.8102:0.1898	.	324	Q99676	ZN184_HUMAN	N	324;324;324;12	ENSP00000211936:H324N;ENSP00000366636:H324N	ENSP00000211936:H324N	H	-	1	0	ZNF184	27528347	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.402000	0.79972	2.660000	0.90430	0.557000	0.71058	CAT	.		0.398	ZNF184-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040146.1	NM_007149	
GTF2I	2969	broad.mit.edu	37	7	74148279	74148279	+	Missense_Mutation	SNP	A	A	G			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr7:74148279A>G	ENST00000324896.4	+	16	1708	c.1319A>G	c.(1318-1320)aAt>aGt	p.N440S	GTF2I_ENST00000346152.4_Missense_Mutation_p.N419S|GTF2I_ENST00000353920.4_Missense_Mutation_p.N420S|GTF2I_ENST00000416070.1_Missense_Mutation_p.N399S	NM_032999.2	NP_127492.1	P78347	GTF2I_HUMAN	general transcription factor IIi	440					negative regulation of angiogenesis (GO:0016525)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.N440S(7)		NS(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19						GAGCTTCTGAATTCAACACGT	0.358																																					p.N440S													GTF2I,NS,carcinoma,0,7	GTF2I	40	7	Substitution - Missense(7)	endometrium(7)	c.A1319G						.						111.0	102.0	105.0					7																	74148279		2201	4300	6501	SO:0001583	missense	2969	exon16			TTCTGAATTCAAC	U77948	CCDS5573.1, CCDS5574.1, CCDS5575.1, CCDS47614.1, CCDS64680.1	7q11.23	2011-05-25	2009-07-23			ENSG00000263001		"""General transcription factors"""	4659	protein-coding gene	gene with protein product		601679	"""general transcription factor II, i"""	WBSCR6		9334314, 9012831	Standard	NM_032999		Approved	TFII-I, BAP-135, SPIN, BTKAP1, DIWS, IB291	uc003uau.3	P78347		ENST00000324896.4:c.1319A>G	7.37:g.74148279A>G	ENSP00000322542:p.Asn440Ser	Somatic	259	1		WXS	Illumina GAIIx	Phase_I	258	5	NM_032999	O14743|O15359|O43546|O43588|O43589|Q75M85|Q75M86|Q75M87|Q75M88|Q86U51|Q9BSZ4	Missense_Mutation	SNP	ENST00000324896.4	37	CCDS5573.1	.	.	.	.	.	.	.	.	.	.	A	16.30	3.085752	0.55861	.	.	ENSG00000077809	ENST00000324896;ENST00000539339;ENST00000353920;ENST00000346152;ENST00000416070	T;T;T;T	0.35236	1.34;1.32;1.32;1.32	4.07	4.07	0.47477	.	0.000000	0.64402	D	0.000002	T	0.40670	0.1126	N	0.16368	0.405	0.80722	D	1	D;D;D;D;D	0.71674	0.997;0.971;0.99;0.998;0.982	D;P;D;D;D	0.76071	0.97;0.717;0.979;0.987;0.952	T	0.31052	-0.9957	10	0.45353	T	0.12	-19.2887	11.2081	0.48782	1.0:0.0:0.0:0.0	.	418;399;420;419;440	Q499G6;P78347-2;P78347-3;P78347-4;P78347	.;.;.;.;GTF2I_HUMAN	S	440;435;420;419;399	ENSP00000322542:N440S;ENSP00000322671:N420S;ENSP00000322599:N419S;ENSP00000387651:N399S	ENSP00000322542:N440S	N	+	2	0	GTF2I	73786215	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.703000	0.54808	1.839000	0.53478	0.477000	0.44152	AAT	.		0.358	GTF2I-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252708.1	NM_032999	
RPS6KA3	6197	broad.mit.edu	37	X	20179855	20179855	+	Silent	SNP	A	A	G			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chrX:20179855A>G	ENST00000379565.3	-	20	2073	c.1866T>C	c.(1864-1866)ccT>ccC	p.P622P	RPS6KA3_ENST00000479809.1_5'UTR|RPS6KA3_ENST00000544447.1_Silent_p.P594P|RPS6KA3_ENST00000540702.1_Silent_p.P593P|RPS6KA3_ENST00000379548.4_Silent_p.P592P	NM_004586.2	NP_004577.1	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 3	622	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|central nervous system development (GO:0007417)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(14)|lung(7)|ovary(1)|stomach(1)	41					Acetylsalicylic acid(DB00945)	GTGTATCATCAGGACCATTTG	0.323																																					p.P622P													.	RPS6KA3	110	0			c.T1866C						.						119.0	93.0	102.0					X																	20179855		2203	4300	6503	SO:0001819	synonymous_variant	6197	exon20			ATCATCAGGACCA	U08316	CCDS14197.1	Xp22.2-p22.1	2013-06-03	2002-08-29		ENSG00000177189	ENSG00000177189			10432	protein-coding gene	gene with protein product		300075	"""ribosomal protein S6 kinase, 90kD, polypeptide 3"", ""mental retardation, X-linked 19"", ""Coffin-Lowry syndrome"""	MRX19, CLS		8141249, 11896450, 16879200	Standard	XM_005274573		Approved	RSK, RSK2, HU-3	uc004czu.3	P51812	OTTHUMG00000021231	ENST00000379565.3:c.1866T>C	X.37:g.20179855A>G		Somatic	39	0		WXS	Illumina GAIIx	Phase_I	70	4	NM_004586	B2R9V4|Q4VAP3|Q59H26|Q5JPK8|Q7Z3Z7	Silent	SNP	ENST00000379565.3	37	CCDS14197.1																																																																																			.		0.323	RPS6KA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056011.3	NM_004586	
ACTR3B	57180	ucsc.edu	37	7	152497656	152497656	+	Silent	SNP	T	T	C	rs201991209		TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr7:152497656T>C	ENST00000256001.8	+	3	275	c.141T>C	c.(139-141)gcT>gcC	p.A47A	ACTR3B_ENST00000537264.1_Intron|ACTR3B_ENST00000377776.3_Silent_p.A47A|ACTR3B_ENST00000397282.2_5'UTR	NM_020445.5	NP_065178.1	Q9P1U1	ARP3B_HUMAN	ARP3 actin-related protein 3 homolog B (yeast)	47						cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(1)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	13		all_hematologic(28;0.0592)|Prostate(32;0.191)	OV - Ovarian serous cystadenocarcinoma(82;0.0287)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0434)		TTGACCAAGCTCAAAGGAGAG	0.383																																					p.A47A													ACTR3B,NS,carcinoma,+1,1	ACTR3B	50	0			c.T141C						.						134.0	124.0	128.0					7																	152497656		2203	4300	6503	SO:0001819	synonymous_variant	57180	exon3			CCAAGCTCAAAGG		CCDS5934.1, CCDS34782.1	7q36.1	2010-07-20			ENSG00000133627	ENSG00000133627			17256	protein-coding gene	gene with protein product						10806390	Standard	NM_001040135		Approved	ARP11, ARP3beta	uc003wle.2	Q9P1U1	OTTHUMG00000151463	ENST00000256001.8:c.141T>C	7.37:g.152497656T>C		Somatic	57	1		WXS	Illumina HiSeq		68	10	NM_020445	A8MTG1|B4DFW4|Q7Z526|Q96BT2	Silent	SNP	ENST00000256001.8	37	CCDS5934.1																																																																																			.		0.383	ACTR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322803.1	NM_020445	
FZD10	11211	ucsc.edu	37	12	130648884	130648884	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr12:130648884G>A	ENST00000229030.4	+	1	1881	c.1397G>A	c.(1396-1398)cGc>cAc	p.R466H	FZD10_ENST00000539839.1_Silent_p.T433T|FZD10-AS1_ENST00000505807.2_RNA			Q9ULW2	FZD10_HUMAN	frizzled class receptor 10	466					brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|gonad development (GO:0008406)|negative regulation of Rho GTPase activity (GO:0034259)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of actin cytoskeleton organization (GO:0032956)|vasculature development (GO:0001944)	cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|pancreas(1)|prostate(3)|urinary_tract(1)	35	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)		TTTTACGAACGCCTCAACATG	0.557																																					p.R466H													.	FZD10	95	0			c.G1397A						.						106.0	104.0	105.0					12																	130648884		2203	4300	6503	SO:0001583	missense	11211	exon1			ACGAACGCCTCAA	AB027464	CCDS9267.1	12q24.33	2014-01-29	2014-01-29			ENSG00000111432		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4039	protein-coding gene	gene with protein product		606147	"""frizzled (Drosophila) homolog 10"", ""frizzled homolog 10 (Drosophila)"", ""frizzled 10, seven transmembrane spanning receptor"", ""frizzled family receptor 10"""			10448064	Standard	NM_007197		Approved	CD350	uc001uii.3	Q9ULW2		ENST00000229030.4:c.1397G>A	12.37:g.130648884G>A	ENSP00000229030:p.Arg466His	Somatic	27	0		WXS	Illumina HiSeq		33	4	NM_007197		Missense_Mutation	SNP	ENST00000229030.4	37	CCDS9267.1	.	.	.	.	.	.	.	.	.	.	G	16.62	3.173209	0.57584	.	.	ENSG00000111432	ENST00000229030	D	0.81996	-1.56	5.1	4.21	0.49690	GPCR, family 2-like (1);	0.000000	0.64402	U	0.000001	T	0.70789	0.3264	L	0.28504	0.86	0.51767	D	0.999933	P	0.36483	0.555	B	0.29862	0.108	T	0.67413	-0.5677	10	0.24483	T	0.36	.	13.375	0.60732	0.0765:0.0:0.9235:0.0	.	466	Q9ULW2	FZD10_HUMAN	H	466	ENSP00000229030:R466H	ENSP00000229030:R466H	R	+	2	0	FZD10	129214837	1.000000	0.71417	0.997000	0.53966	0.946000	0.59487	6.629000	0.74267	1.140000	0.42260	0.561000	0.74099	CGC	.		0.557	FZD10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
ACTC1	70	ucsc.edu	37	15	35084309	35084309	+	Missense_Mutation	SNP	A	A	G			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr15:35084309A>G	ENST00000290378.4	-	5	1445	c.790T>C	c.(790-792)Ttc>Ctc	p.F264L	RP11-814P5.1_ENST00000503496.1_RNA|RP11-814P5.1_ENST00000558707.1_RNA|ACTC1_ENST00000557860.1_5'UTR	NM_005159.4	NP_005150.1	P68032	ACTC_HUMAN	actin, alpha, cardiac muscle 1	264					actin filament-based movement (GO:0030048)|actin-myosin filament sliding (GO:0033275)|actomyosin structure organization (GO:0031032)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|heart contraction (GO:0060047)|muscle filament sliding (GO:0030049)|negative regulation of apoptotic process (GO:0043066)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|skeletal muscle thin filament assembly (GO:0030240)	actin filament (GO:0005884)|actomyosin, actin portion (GO:0042643)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|I band (GO:0031674)|membrane (GO:0016020)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|myosin binding (GO:0017022)			central_nervous_system(1)|endometrium(5)|kidney(1)|lung(14)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	31		all_lung(180;2.3e-08)		all cancers(64;5.83e-19)|GBM - Glioblastoma multiforme(113;1.98e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		GAGGGCTGGAAGAGTGTCTCA	0.522																																					p.F264L													.	ACTC1	75	0			c.T790C						.						76.0	75.0	75.0					15																	35084309		2201	4298	6499	SO:0001583	missense	70	exon5			GCTGGAAGAGTGT	BC009978	CCDS10041.1	15q14	2014-09-17	2006-08-24	2006-08-24	ENSG00000159251	ENSG00000159251			143	protein-coding gene	gene with protein product		102540	"""actin, alpha, cardiac muscle"""	ACTC		1639426	Standard	NM_005159		Approved	CMD1R	uc001ziu.1	P68032	OTTHUMG00000129675	ENST00000290378.4:c.790T>C	15.37:g.35084309A>G	ENSP00000290378:p.Phe264Leu	Somatic	23	0		WXS	Illumina HiSeq		32	4	NM_005159	P04270	Missense_Mutation	SNP	ENST00000290378.4	37	CCDS10041.1	.	.	.	.	.	.	.	.	.	.	A	14.95	2.687331	0.48097	.	.	ENSG00000159251	ENST00000290378;ENST00000544062	D	0.98135	-4.74	4.48	4.48	0.54585	.	0.000000	0.56097	U	0.000030	D	0.99108	0.9693	H	0.98542	4.26	0.58432	D	0.999996	B	0.29037	0.231	P	0.48873	0.593	D	0.99915	1.1220	10	0.87932	D	0	.	14.2454	0.65986	1.0:0.0:0.0:0.0	.	264	P68032	ACTC_HUMAN	L	264;229	ENSP00000290378:F264L	ENSP00000290378:F264L	F	-	1	0	ACTC1	32871601	1.000000	0.71417	0.999000	0.59377	0.900000	0.52787	7.325000	0.79124	2.008000	0.58898	0.533000	0.62120	TTC	.		0.522	ACTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251876.3	NM_005159	
LRRC45	201255	ucsc.edu;bcgsc.ca	37	17	79987031	79987031	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr17:79987031G>T	ENST00000306688.3	+	13	1713	c.1371G>T	c.(1369-1371)agG>agT	p.R457S	RAC3_ENST00000306897.4_5'Flank	NM_144999.2	NP_659436.1	Q96CN5	LRC45_HUMAN	leucine rich repeat containing 45	457						centrosome (GO:0005813)				lung(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	5	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)			GGGTGCAGAGGCTGGAGGCGG	0.662																																					p.R457S													.	LRRC45	22	0			c.G1371T						.						38.0	39.0	39.0					17																	79987031		2192	4296	6488	SO:0001583	missense	201255	exon13			GCAGAGGCTGGAG	BC014109	CCDS11797.1	17q25.3	2005-08-09				ENSG00000169683			28302	protein-coding gene	gene with protein product						12477932	Standard	NM_144999		Approved	MGC20806	uc002kde.3	Q96CN5		ENST00000306688.3:c.1371G>T	17.37:g.79987031G>T	ENSP00000306760:p.Arg457Ser	Somatic	26	0		WXS	Illumina HiSeq		25	4	NM_144999		Missense_Mutation	SNP	ENST00000306688.3	37	CCDS11797.1	.	.	.	.	.	.	.	.	.	.	G	15.67	2.900906	0.52227	.	.	ENSG00000169683	ENST00000306688	T	0.40756	1.02	4.27	2.24	0.28232	.	0.171615	0.50627	D	0.000108	T	0.34193	0.0889	M	0.67953	2.075	0.42146	D	0.991538	P	0.37781	0.608	B	0.34590	0.186	T	0.07462	-1.0771	9	.	.	.	-16.3437	5.4204	0.16398	0.1709:0.0:0.6697:0.1594	.	457	Q96CN5	LRC45_HUMAN	S	457	ENSP00000306760:R457S	.	R	+	3	2	LRRC45	77580320	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	1.736000	0.38187	0.370000	0.24538	-0.140000	0.14226	AGG	.		0.662	LRRC45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442058.1	NM_144999	
DDX53	168400	ucsc.edu;bcgsc.ca	37	X	23018970	23018970	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chrX:23018970G>A	ENST00000327968.5	+	1	884	c.796G>A	c.(796-798)Gca>Aca	p.A266T	RP11-40F8.2_ENST00000455399.1_lincRNA	NM_182699.3	NP_874358.2	Q86TM3	DDX53_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 53	266	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|RNA binding (GO:0003723)			breast(2)|endometrium(5)|kidney(4)|large_intestine(3)|lung(15)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	35						TATAGTAGTTGCACAAACCGG	0.408																																					p.A266T													.	DDX53	76	0			c.G796A						.						77.0	73.0	75.0					X																	23018970		2203	4300	6503	SO:0001583	missense	168400	exon1			GTAGTTGCACAAA	AY039237	CCDS35214.1	Xp22.13	2009-03-25			ENSG00000184735	ENSG00000184735		"""DEAD-boxes"""	20083	protein-coding gene	gene with protein product	"""cancer associated gene"", ""cancer/testis antigen 26"""						Standard	NM_182699		Approved	CAGE, CT26	uc004daj.3	Q86TM3	OTTHUMG00000021248	ENST00000327968.5:c.796G>A	X.37:g.23018970G>A	ENSP00000368667:p.Ala266Thr	Somatic	56	0		WXS	Illumina HiSeq		36	4	NM_182699	Q0D2N2|Q6NVV4	Missense_Mutation	SNP	ENST00000327968.5	37	CCDS35214.1	.	.	.	.	.	.	.	.	.	.	G	12.56	1.973458	0.34848	.	.	ENSG00000184735	ENST00000327968	T	0.22539	1.95	4.07	1.12	0.20585	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.58104	0.2099	H	0.99379	4.54	0.33876	D	0.635575	D	0.76494	0.999	D	0.71184	0.972	T	0.65611	-0.6126	10	0.87932	D	0	-3.475	5.4464	0.16537	0.1029:0.0:0.5485:0.3486	.	266	Q86TM3	DDX53_HUMAN	T	266	ENSP00000368667:A266T	ENSP00000368667:A266T	A	+	1	0	DDX53	22928891	1.000000	0.71417	0.001000	0.08648	0.015000	0.08874	5.004000	0.63966	-0.000000	0.14550	0.600000	0.82982	GCA	.		0.408	DDX53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056043.1	NM_182699	
CRYZ	1429	bcgsc.ca	37	1	75172874	75172874	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr1:75172874C>A	ENST00000340866.5	-	7	732	c.645G>T	c.(643-645)gaG>gaT	p.E215D	CRYZ_ENST00000370872.3_Missense_Mutation_p.E78D|CRYZ_ENST00000492102.1_5'UTR|CRYZ_ENST00000417775.1_Missense_Mutation_p.E215D|CRYZ_ENST00000370871.3_Intron	NM_001889.3	NP_001880.2	Q08257	QOR_HUMAN	crystallin, zeta (quinone reductase)	215					protein homotetramerization (GO:0051289)|visual perception (GO:0007601)|xenobiotic catabolic process (GO:0042178)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)	mRNA 3'-UTR binding (GO:0003730)|NADPH binding (GO:0070402)|NADPH:quinone reductase activity (GO:0003960)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|kidney(1)|large_intestine(2)|lung(5)	10					Dicoumarol(DB00266)	CAATTCCTTTCTCACCAACAT	0.289																																					p.E215D													.	CRYZ	28	0			c.G645T						.						59.0	69.0	66.0					1																	75172874		2186	4279	6465	SO:0001583	missense	1429	exon7			TCCTTTCTCACCA		CCDS665.1, CCDS44162.1, CCDS44163.1	1p31.1	2013-02-14			ENSG00000116791	ENSG00000116791			2419	protein-coding gene	gene with protein product		123691					Standard	NM_001889		Approved		uc001dgj.3	Q08257	OTTHUMG00000009620	ENST00000340866.5:c.645G>T	1.37:g.75172874C>A	ENSP00000339399:p.Glu215Asp	Somatic	53	0		WXS	Illumina HiSeq	Phase_1	67	4	NM_001889	A6NN60|D3DQ76|Q53FT0|Q59EU7|Q5HYE7|Q6NSK9	Missense_Mutation	SNP	ENST00000340866.5	37	CCDS665.1	.	.	.	.	.	.	.	.	.	.	C	9.353	1.066085	0.20067	.	.	ENSG00000116791	ENST00000340866;ENST00000370872;ENST00000417775;ENST00000370870	T;T;T;T	0.03831	3.79;3.79;3.79;3.79	5.54	-1.41	0.08941	Alcohol dehydrogenase, C-terminal (1);NAD(P)-binding domain (1);	0.406299	0.28736	N	0.014312	T	0.00967	0.0032	L	0.35593	1.075	0.20821	N	0.999842	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.45131	-0.9282	10	0.48119	T	0.1	-11.8392	1.9659	0.03396	0.1143:0.2276:0.339:0.3191	.	78;215	Q5HYE7;Q08257	.;QOR_HUMAN	D	215;78;215;215	ENSP00000339399:E215D;ENSP00000359909:E78D;ENSP00000399805:E215D;ENSP00000359907:E215D	ENSP00000339399:E215D	E	-	3	2	CRYZ	74945462	0.417000	0.25432	0.982000	0.44146	0.907000	0.53573	-0.763000	0.04740	-0.428000	0.07339	0.591000	0.81541	GAG	.		0.289	CRYZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026514.1		
RBMS1	5937	bcgsc.ca	37	2	161157164	161157164	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr2:161157164G>T	ENST00000348849.3	-	6	1068	c.638C>A	c.(637-639)tCt>tAt	p.S213Y	RBMS1_ENST00000409289.2_Missense_Mutation_p.S180Y|RBMS1_ENST00000474820.1_5'UTR|RBMS1_ENST00000392753.3_Missense_Mutation_p.S213Y|RBMS1_ENST00000409972.1_Missense_Mutation_p.S180Y|RBMS1_ENST00000409075.1_Missense_Mutation_p.S180Y	NM_002897.4|NM_016836.3	NP_002888.1|NP_058520.1	P29558	RBMS1_HUMAN	RNA binding motif, single stranded interacting protein 1	213	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				DNA replication (GO:0006260)|RNA processing (GO:0006396)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)		PLA2R1/RBMS1(2)								CAACATACCAGAAACTCCTGG	0.303																																					p.S213Y													.	RBMS1	34	0			c.C638A						.						62.0	65.0	64.0					2																	161157164		2202	4296	6498	SO:0001583	missense	5937	exon6			ATACCAGAAACTC	D28482	CCDS2213.1	2q24.2	2013-02-12			ENSG00000153250	ENSG00000153250		"""RNA binding motif (RRM) containing"""	9907	protein-coding gene	gene with protein product	"""suppressor of cdc 2 (cdc13) with RNA binding motif 2"", ""c-myc gene single strand binding protein 2"""	602310	"""chromosome 2 open reading frame 12"""	C2orf12		8041632, 8134115, 7838710	Standard	NM_016836		Approved	SCR2, MSSP-1, MSSP-2, MSSP-3, YC1, HCC-4, DKFZp564H0764	uc002ubo.3	P29558	OTTHUMG00000132031	ENST00000348849.3:c.638C>A	2.37:g.161157164G>T	ENSP00000294904:p.Ser213Tyr	Somatic	67	0		WXS	Illumina HiSeq	Phase_1	70	4	NM_016836	Q14869|Q15433|Q53P46|Q53QX8|Q53RG6|Q8WV20	Missense_Mutation	SNP	ENST00000348849.3	37	CCDS2213.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.949819	0.73787	.	.	ENSG00000153250	ENST00000348849;ENST00000409075;ENST00000409289;ENST00000392753;ENST00000409972	T;T;T;T;T	0.26067	1.77;1.97;1.97;1.76;1.97	5.03	5.03	0.67393	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.120197	0.64402	D	0.000017	T	0.35480	0.0933	L	0.34521	1.04	0.58432	D	0.999995	P;P;P;P;P;P	0.47106	0.697;0.56;0.87;0.89;0.56;0.56	B;B;P;P;B;B	0.53146	0.37;0.437;0.719;0.492;0.437;0.437	T	0.12967	-1.0527	10	0.87932	D	0	.	18.7142	0.91670	0.0:0.0:1.0:0.0	.	79;213;213;79;180;213	Q5CZ65;P29558;P29558-2;Q5CZ66;E7ETU5;B4DN88	.;RBMS1_HUMAN;.;.;.;.	Y	213;180;180;213;180	ENSP00000294904:S213Y;ENSP00000386347:S180Y;ENSP00000386571:S180Y;ENSP00000376508:S213Y;ENSP00000387280:S180Y	ENSP00000294904:S213Y	S	-	2	0	RBMS1	160865410	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.040000	0.64191	2.501000	0.84356	0.585000	0.79938	TCT	.		0.303	RBMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255043.4	NM_016836	
TTN	7273	bcgsc.ca	37	2	179615544	179615544	+	Intron	SNP	C	C	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr2:179615544C>T	ENST00000591111.1	-	45	10585				TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000360870.5_Silent_p.K3861K|TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000589042.1_Intron|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATACTTCCTCCTTCTCACATA	0.373																																					p.K3861K													.	TTN	18412	0			c.G11583A						.						88.0	87.0	87.0					2																	179615544		2203	4299	6502	SO:0001627	intron_variant	7273	exon46			TTCCTCCTTCTCA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+2306G>A	2.37:g.179615544C>T		Somatic	32	0		WXS	Illumina HiSeq	Phase_1	27	3	NM_133379	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																				.		0.373	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
WWP1P1	339843	bcgsc.ca	37	3	98378947	98378947	+	IGR	SNP	G	G	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr3:98378947G>A								AC021660.1 (36059 upstream) : ST3GAL6-AS1 (54226 downstream)																							TTTTTCTCGAGGAGTACAAGA	0.378																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			TCTCGAGGAGTAC																													3.37:g.98378947G>A		Somatic	45	0		WXS	Illumina HiSeq	Phase_1	52	16	.		RNA	SNP		37																																																																																				.	0	0.378								
DDX60	55601	bcgsc.ca	37	4	169169372	169169372	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr4:169169372G>T	ENST00000393743.3	-	29	4221	c.3930C>A	c.(3928-3930)aaC>aaA	p.N1310K		NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	1310	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		GATAGACTGAGTTTTGAGCAA	0.363																																					p.N1310K													.	DDX60	304	0			c.C3930A						.						125.0	117.0	119.0					4																	169169372		2203	4300	6503	SO:0001583	missense	55601	exon29			GACTGAGTTTTGA	AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.3930C>A	4.37:g.169169372G>T	ENSP00000377344:p.Asn1310Lys	Somatic	41	0		WXS	Illumina HiSeq	Phase_1	41	4	NM_017631	Q6PK35|Q9NVE3	Missense_Mutation	SNP	ENST00000393743.3	37	CCDS34097.1	.	.	.	.	.	.	.	.	.	.	G	16.88	3.243900	0.58995	.	.	ENSG00000137628	ENST00000393743	T	0.75050	-0.9	4.84	-2.5	0.06384	Helicase, C-terminal (3);	0.177646	0.39407	N	0.001375	T	0.75466	0.3853	L	0.48877	1.53	0.33797	D	0.626196	D	0.53462	0.96	P	0.57244	0.816	T	0.79960	-0.1583	10	0.72032	D	0.01	.	13.4794	0.61326	0.7606:0.0:0.2394:0.0	.	1310	Q8IY21	DDX60_HUMAN	K	1310	ENSP00000377344:N1310K	ENSP00000377344:N1310K	N	-	3	2	DDX60	169405947	0.994000	0.37717	0.338000	0.25549	0.939000	0.58152	0.153000	0.16323	-0.515000	0.06479	-0.259000	0.10710	AAC	.		0.363	DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364622.1	NM_017631	
OPRM1	4988	bcgsc.ca	37	6	154360621	154360621	+	5'UTR	SNP	G	G	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr6:154360621G>A	ENST00000330432.7	+	0	179				OPRM1_ENST00000435918.2_5'Flank|OPRM1_ENST00000229768.5_5'Flank|OPRM1_ENST00000414028.2_5'Flank|OPRM1_ENST00000518759.1_Intron|OPRM1_ENST00000337049.4_5'Flank|OPRM1_ENST00000523520.1_3'UTR|OPRM1_ENST00000419506.2_5'Flank|OPRM1_ENST00000434900.2_Missense_Mutation_p.R74Q|OPRM1_ENST00000452687.2_5'UTR|OPRM1_ENST00000524163.1_5'Flank|OPRM1_ENST00000428397.2_5'UTR|OPRM1_ENST00000360422.4_5'UTR|OPRM1_ENST00000520708.1_Intron	NM_000914.3	NP_000905.3	P35372	OPRM_HUMAN	opioid receptor, mu 1						adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral response to ethanol (GO:0048149)|calcium ion transmembrane transport (GO:0070588)|cellular response to stress (GO:0033554)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|locomotory behavior (GO:0007626)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of Wnt protein secretion (GO:0061358)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neurogenesis (GO:0050769)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-endorphin receptor activity (GO:0004979)|G-protein alpha-subunit binding (GO:0001965)|G-protein coupled receptor activity (GO:0004930)|morphine receptor activity (GO:0038047)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(15)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	33		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;9.26e-11)|BRCA - Breast invasive adenocarcinoma(81;0.0154)	Alfentanil(DB00802)|Alvimopan(DB06274)|Amitriptyline(DB00321)|Anileridine(DB00913)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Diphenoxylate(DB01081)|Ethylmorphine(DB01466)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levallorphan(DB00504)|Levomethadyl Acetate(DB01227)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Methadyl Acetate(DB01433)|Methylnaltrexone(DB06800)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Ondansetron(DB00904)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Pentazocine(DB00652)|Pethidine(DB00454)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	CTTGGAACCCGAAAAGTCTCG	0.632																																					p.R74Q													.	OPRM1	241	0			c.G221A						.						48.0	63.0	58.0					6																	154360621		692	1591	2283	SO:0001623	5_prime_UTR_variant	4988	exon3			GAACCCGAAAAGT	L29301	CCDS43517.1, CCDS43518.1, CCDS47503.1, CCDS47504.1, CCDS47505.1, CCDS47506.1, CCDS47507.1, CCDS47508.1, CCDS55071.1, CCDS55068.1, CCDS55069.1, CCDS55070.1	6q24-q25	2012-08-08			ENSG00000112038	ENSG00000112038		"""GPCR / Class A : Opioid receptors"""	8156	protein-coding gene	gene with protein product		600018					Standard	NM_001145285		Approved	MOR1	uc003qpo.1	P35372	OTTHUMG00000015870	ENST00000330432.7:c.-59G>A	6.37:g.154360621G>A		Somatic	39	0		WXS	Illumina HiSeq	Phase_1	53	4	NM_001145279	B0FXJ1|B2R9S7|B8Q1L7|B8Q1L8|B8Q1L9|E7EWZ3|G8XRH6|G8XRH8|Q12930|Q4VWM1|Q4VWM2|Q4VWM3|Q4VWM4|Q4VWM6|Q4VWX6|Q5TDA1|Q6UPP1|Q6UQ80|Q7Z2D8|Q86V80|Q8IWW3|Q8IWW4|Q9UCZ4|Q9UN57	Missense_Mutation	SNP	ENST00000330432.7	37	CCDS55070.1	.	.	.	.	.	.	.	.	.	.	G	14.74	2.626757	0.46840	.	.	ENSG00000112038	ENST00000520282;ENST00000434900	T;T	0.71103	3.86;-0.54	4.75	-0.621	0.11564	.	4.366230	0.00824	N	0.001608	T	0.26340	0.0643	N	0.08118	0	0.18873	N	0.999987	B	0.26708	0.157	B	0.14578	0.011	T	0.08597	-1.0714	10	0.26408	T	0.33	.	9.1623	0.37030	0.0728:0.0:0.3123:0.6149	.	74	P35372-10	.	Q	29;74	ENSP00000430247:R29Q;ENSP00000394624:R74Q	ENSP00000394624:R74Q	R	+	2	0	OPRM1	154402314	0.004000	0.15560	0.002000	0.10522	0.426000	0.31534	0.596000	0.24044	-0.229000	0.09854	0.650000	0.86243	CGA	.		0.632	OPRM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042786.2	NM_000914	
TCP1P1	647047	bcgsc.ca	37	7	42834653	42834653	+	IGR	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr7:42834653G>T								AC027269.2 (88607 upstream) : AC010132.10 (34617 downstream)																							GATGATATTGGTGATGTATCC	0.443																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	647047	.			ATATTGGTGATGT																													7.37:g.42834653G>T		Somatic	30	0		WXS	Illumina HiSeq	Phase_1	21	4	.		RNA	SNP		37																																																																																				.	0	0.443								
Unknown	0	bcgsc.ca	37	7	65305498	65305498	+	IGR	SNP	G	G	A			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr7:65305498G>A								RNU6-912P (25736 upstream) : RNU6-973P (19148 downstream)																							AACTACTGCCGGCCTTTGTAG	0.542																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			ACTGCCGGCCTTT																													7.37:g.65305498G>A		Somatic	26	0		WXS	Illumina HiSeq	Phase_1	20	4	.		RNA	SNP		37																																																																																				.	0	0.542								
PRKRIRP3	399774	bcgsc.ca	37	10	54172539	54172539	+	IGR	SNP	A	A	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr10:54172539A>T								DKK1 (95122 upstream) : RP11-346D6.6 (38094 downstream)																							CACTCAACGAAGTGATGGAAA	0.408																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	399774	.			CAACGAAGTGATG																													10.37:g.54172539A>T		Somatic	75	0		WXS	Illumina HiSeq	Phase_1	60	14	.		RNA	SNP		37																																																																																				.	0	0.408								
CHEK1	1111	bcgsc.ca	37	11	125514458	125514458	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr11:125514458G>T	ENST00000534070.1	+	11	1408	c.1153G>T	c.(1153-1155)Gat>Tat	p.D385Y	CHEK1_ENST00000428830.2_Missense_Mutation_p.D385Y|CHEK1_ENST00000544373.1_Missense_Mutation_p.D385Y|CHEK1_ENST00000427383.2_Missense_Mutation_p.D401Y|CHEK1_ENST00000532449.1_3'UTR|CHEK1_ENST00000438015.1_Missense_Mutation_p.D385Y|CHEK1_ENST00000524737.1_Missense_Mutation_p.D385Y|CHEK1_ENST00000278916.3_Intron	NM_001274.5	NP_001265.2	O14757	CHK1_HUMAN	checkpoint kinase 1	385					cellular response to caffeine (GO:0071313)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to mechanical stimulus (GO:0071260)|chromatin-mediated maintenance of transcription (GO:0048096)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|G2 DNA damage checkpoint (GO:0031572)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of mitosis (GO:0045839)|peptidyl-threonine phosphorylation (GO:0018107)|regulation of cell proliferation (GO:0042127)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of histone H3-K9 acetylation (GO:2000615)|regulation of mitotic centrosome separation (GO:0046602)|regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage (GO:0010767)|replicative senescence (GO:0090399)	centrosome (GO:0005813)|chromatin (GO:0000785)|condensed nuclear chromosome (GO:0000794)|cytosol (GO:0005829)|extracellular space (GO:0005615)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	ATP binding (GO:0005524)|histone kinase activity (H3-T11 specific) (GO:0035402)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(3)|endometrium(3)|large_intestine(2)|lung(16)|skin(1)|upper_aerodigestive_tract(1)	26	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0748)		TACCAAATTGGATGCAGACAA	0.378								Other conserved DNA damage response genes																													p.D385Y													.	CHEK1	44	0			c.G1153T						.						122.0	121.0	121.0					11																	125514458		2201	4299	6500	SO:0001583	missense	1111	exon11			AAATTGGATGCAG	AF016582, BC017575	CCDS8459.1, CCDS58191.1	11q24.2	2011-11-11	2011-11-11		ENSG00000149554	ENSG00000149554			1925	protein-coding gene	gene with protein product		603078	"""CHK1 (checkpoint, S.pombe) homolog"", ""CHK1 checkpoint homolog (S. pombe)"""			9278511, 9382850	Standard	NM_001114121		Approved	CHK1	uc001qcg.4	O14757	OTTHUMG00000165853	ENST00000534070.1:c.1153G>T	11.37:g.125514458G>T	ENSP00000435371:p.Asp385Tyr	Somatic	60	0		WXS	Illumina HiSeq	Phase_1	55	4	NM_001244846	A8K934|B4DDD0|B4DSK3|B5BTY6|F5H7S4|H2BI51	Missense_Mutation	SNP	ENST00000534070.1	37	CCDS8459.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.977321	0.74360	.	.	ENSG00000149554	ENST00000438015;ENST00000427383;ENST00000428830;ENST00000544373;ENST00000534070;ENST00000524737	T;T;T;T;T;T	0.73363	-0.71;-0.39;-0.71;-0.74;-0.71;-0.71	5.63	5.63	0.86233	.	0.107097	0.64402	D	0.000006	T	0.82226	0.4991	L	0.50333	1.59	0.58432	D	0.999992	D;D;P	0.62365	0.991;0.978;0.939	P;P;P	0.61722	0.893;0.862;0.781	T	0.83324	-0.0016	10	0.72032	D	0.01	-21.4368	18.4811	0.90812	0.0:0.0:1.0:0.0	.	385;401;385	F5H7S4;E7EPP6;O14757	.;.;CHK1_HUMAN	Y	385;401;385;385;385;385	ENSP00000388648:D385Y;ENSP00000391090:D401Y;ENSP00000412504:D385Y;ENSP00000442317:D385Y;ENSP00000435371:D385Y;ENSP00000432890:D385Y	ENSP00000391090:D401Y	D	+	1	0	CHEK1	125019668	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.192000	0.65115	2.652000	0.90054	0.655000	0.94253	GAT	.		0.378	CHEK1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386714.1	NM_001274	
GJC1	10052	bcgsc.ca	37	17	42882468	42882468	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr17:42882468C>T	ENST00000426548.1	-	3	987	c.718G>A	c.(718-720)Ggc>Agc	p.G240S	GJC1_ENST00000590758.1_Missense_Mutation_p.G240S|GJC1_ENST00000592524.1_Missense_Mutation_p.G240S|GJC1_ENST00000330514.4_Missense_Mutation_p.G240S	NM_001080383.1|NM_005497.3	NP_001073852.1|NP_005488.2	P36383	CXG1_HUMAN	gap junction protein, gamma 1, 45kDa	240					atrial cardiac muscle cell action potential (GO:0086014)|cardiac muscle tissue development (GO:0048738)|cell development (GO:0048468)|cell-cell junction assembly (GO:0007043)|gap junction assembly (GO:0016264)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vasculogenesis (GO:0001570)|visual perception (GO:0007601)	connexon complex (GO:0005922)|endoplasmic reticulum membrane (GO:0005789)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)|ion channel activity (GO:0005216)			NS(1)|kidney(1)|large_intestine(5)|liver(1)|lung(10)|prostate(1)	19		Prostate(33;0.0959)				AGGCAAAGGCCTGTAACACCA	0.433																																					p.G240S													.	GJC1	45	0			c.G718A						.						118.0	116.0	117.0					17																	42882468		2203	4300	6503	SO:0001583	missense	10052	exon3			AAAGGCCTGTAAC	U03493	CCDS11487.1	17q21.31	2008-02-04	2007-11-06	2007-11-06		ENSG00000182963		"""Ion channels / Gap junction proteins (connexins)"""	4280	protein-coding gene	gene with protein product	"""connexin 45"""	608655	"""gap junction protein, alpha 7, 45kDa"""	GJA7		7966354	Standard	NM_005497		Approved	CX45	uc002ihl.3	P36383		ENST00000426548.1:c.718G>A	17.37:g.42882468C>T	ENSP00000411528:p.Gly240Ser	Somatic	22	0		WXS	Illumina HiSeq	Phase_1	21	3	NM_005497	B3KW68|Q4VAY0	Missense_Mutation	SNP	ENST00000426548.1	37	CCDS11487.1	.	.	.	.	.	.	.	.	.	.	C	11.79	1.745046	0.30865	.	.	ENSG00000182963	ENST00000426548;ENST00000330514	D;D	0.95342	-3.68;-3.68	5.28	5.28	0.74379	Gap junction protein, cysteine-rich domain (1);	0.120010	0.56097	D	0.000030	D	0.92737	0.7691	L	0.48218	1.51	0.42665	D	0.99349	B	0.26547	0.152	B	0.36766	0.232	D	0.90183	0.4244	10	0.33141	T	0.24	.	13.513	0.61524	0.1664:0.8336:0.0:0.0	.	240	P36383	CXG1_HUMAN	S	240	ENSP00000411528:G240S;ENSP00000333193:G240S	ENSP00000333193:G240S	G	-	1	0	GJC1	40237994	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	3.059000	0.49947	2.465000	0.83290	0.514000	0.50259	GGC	.		0.433	GJC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448661.1	NM_005497	
HEATR6	63897	bcgsc.ca	37	17	58137371	58137371	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr17:58137371G>T	ENST00000184956.6	-	10	1519	c.1503C>A	c.(1501-1503)caC>caA	p.H501Q	HEATR6_ENST00000585976.1_Missense_Mutation_p.H501Q	NM_022070.4	NP_071353.4	Q6AI08	HEAT6_HUMAN	HEAT repeat containing 6	501							poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	44	all_cancers(5;2.25e-13)|Breast(5;4.84e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		BRCA - Breast invasive adenocarcinoma(1;5.93e-19)|Epithelial(12;7.59e-12)|all cancers(12;1.26e-10)			AAGCCCTTCTGTGGTCACTGG	0.473																																					p.H501Q													.	HEATR6	98	0			c.C1503A						.						161.0	157.0	159.0					17																	58137371		2203	4300	6503	SO:0001583	missense	63897	exon10			CCTTCTGTGGTCA	BX640819	CCDS11623.1	17q23.2	2007-05-01				ENSG00000068097			24076	protein-coding gene	gene with protein product	"""amplified in breast cancer 1"""					12755490	Standard	NM_022070		Approved	ABC1, FLJ22087	uc002iyk.1	Q6AI08		ENST00000184956.6:c.1503C>A	17.37:g.58137371G>T	ENSP00000184956:p.His501Gln	Somatic	39	0		WXS	Illumina HiSeq	Phase_1	52	4	NM_022070	B3KXP3|Q6MZX1|Q6MZY2|Q8TDM9|Q9H6B3|Q9H6M7	Missense_Mutation	SNP	ENST00000184956.6	37	CCDS11623.1	.	.	.	.	.	.	.	.	.	.	G	16.28	3.078194	0.55753	.	.	ENSG00000068097	ENST00000184956;ENST00000393017	T	0.31247	1.5	5.68	5.68	0.88126	Armadillo-like helical (1);Armadillo-type fold (1);	0.047496	0.85682	D	0.000000	T	0.40956	0.1138	N	0.25647	0.755	0.38687	D	0.952675	D;D	0.71674	0.998;0.998	D;P	0.66351	0.943;0.867	T	0.08006	-1.0743	10	0.15066	T	0.55	-17.347	19.2306	0.93839	0.0:0.0:1.0:0.0	.	348;501	E7ESB9;Q6AI08	.;HEAT6_HUMAN	Q	501;348	ENSP00000184956:H501Q	ENSP00000184956:H501Q	H	-	3	2	HEATR6	55492153	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.773000	0.47686	2.869000	0.98440	0.558000	0.71614	CAC	.		0.473	HEATR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449165.1	NM_022070	
PPIAP21	170536	bcgsc.ca	37	20	41859856	41859856	+	IGR	SNP	A	A	G			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr20:41859856A>G								RN7SL666P (8709 upstream) : SCARNA15 (73338 downstream)																							TGGCAAGACCAGCAAGAAGAT	0.473																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	170536	.			AAGACCAGCAAGA																													20.37:g.41859856A>G		Somatic	26	0		WXS	Illumina HiSeq	Phase_1	42	10	.		RNA	SNP		37																																																																																				.	0	0.473								
ARSH	347527	bcgsc.ca	37	X	2945415	2945415	+	Silent	SNP	G	G	T	rs373570475		TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chrX:2945415G>T	ENST00000381130.2	+	7	1098	c.1098G>T	c.(1096-1098)ccG>ccT	p.P366P		NM_001011719.1	NP_001011719.1	Q5FYA8	ARSH_HUMAN	arylsulfatase family, member H	366					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			breast(3)|endometrium(8)|kidney(2)|large_intestine(6)|lung(13)|skin(1)|stomach(1)	34		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				TCCGGTGGCCGTCAGTCTTGG	0.507																																					p.P366P													.	ARSH	72	0			c.G1098T						.						182.0	141.0	155.0					X																	2945415		2203	4300	6503	SO:0001819	synonymous_variant	347527	exon7			GTGGCCGTCAGTC	AY875940	CCDS35198.1	Xp22.33	2013-02-14	2006-03-07		ENSG00000205667	ENSG00000205667		"""Arylsulfatase family"""	32488	protein-coding gene	gene with protein product		300586	"""arylsulfatase H"""			16174644	Standard	NM_001011719		Approved		uc011mhj.2	Q5FYA8	OTTHUMG00000159612	ENST00000381130.2:c.1098G>T	X.37:g.2945415G>T		Somatic	33	0		WXS	Illumina HiSeq	Phase_1	21	3	NM_001011719		Silent	SNP	ENST00000381130.2	37	CCDS35198.1																																																																																			.		0.507	ARSH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356489.1	NM_001011719	
PRKDC	5591	hgsc.bcm.edu	37	8	48842481	48842481	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA30-01A-31D-A417-09	TCGA-W5-AA30-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4b80ae99-7f0c-43af-b383-7d6939cdf3e8	223d9406-0f92-4953-b37e-0fffb0ccbe9a	g.chr8:48842481G>T	ENST00000314191.2	-	18	2040	c.1984C>A	c.(1984-1986)Ctc>Atc	p.L662I	PRKDC_ENST00000523565.1_5'UTR|PRKDC_ENST00000338368.3_Missense_Mutation_p.L662I	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	662					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	CCACTGATGAGGGGCAACCTT	0.348								Non-homologous end-joining																													.	Esophageal Squamous(79;1091 1253 12329 31680 40677)	.											.	.	.	0			.						.						66.0	65.0	65.0					8																	48842481		1803	4068	5871	SO:0001583	missense	5591	p.L662I			TGATGAGGGGCAA		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.1984C>A	8.37:g.48842481G>T	ENSP00000313420:p.Leu662Ile	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	67	3	.	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Missense_Mutation	SNP	ENST00000314191.2	37		.	.	.	.	.	.	.	.	.	.	G	22.5	4.298861	0.81025	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	T;T	0.04234	3.73;3.67	5.54	5.54	0.83059	Armadillo-type fold (1);	0.000000	0.64402	D	0.000001	T	0.16811	0.0404	.	.	.	0.58432	D	0.999996	D;D;D	0.63046	0.992;0.987;0.987	P;P;P	0.58928	0.848;0.708;0.708	T	0.00024	-1.2328	9	0.87932	D	0	.	13.7514	0.62910	0.0737:0.0:0.9263:0.0	.	662;662;662	P78527-2;E7EUY0;P78527	.;.;PRKDC_HUMAN	I	662	ENSP00000313420:L662I;ENSP00000345182:L662I	ENSP00000313420:L662I	L	-	1	0	PRKDC	49005034	1.000000	0.71417	0.998000	0.56505	0.755000	0.42902	5.426000	0.66476	2.608000	0.88229	0.467000	0.42956	CTC	.		0.348	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001081640	
