#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVarCov_SOL	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PIGS	94005	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	26898172	26898174	+	In_Frame_Del	DEL	GAA	GAA	-			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	GAA	GAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr17:26898172_26898174delGAA	ENST00000308360.7	-	2	442_444	c.67_69delTTC	c.(67-69)ttcdel	p.F23del	RP11-192H23.5_ENST00000585189.1_RNA|PIGS_ENST00000395346.2_In_Frame_Del_p.F15del|PIGS_ENST00000543734.1_Intron	NM_033198.3	NP_149975.1	Q96S52	PIGS_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class S	23					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)	endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|membrane (GO:0016020)	GPI-anchor transamidase activity (GO:0003923)			breast(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	Lung NSC(42;0.00431)					CCACCGCAGCGAAGAAGAGGGCG	0.685																																					p.23_24del		.											.	.	.	0			c.68_70del						.																																			SO:0001651	inframe_deletion	94005	exon2			CGCAGCGAAGAAG		CCDS11235.1	17p13.2	2013-02-26	2006-06-28		ENSG00000087111	ENSG00000087111		"""Phosphatidylinositol glycan anchor biosynthesis"""	14937	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	610271	"""phosphatidylinositol glycan, class S"""				Standard	NM_033198		Approved		uc002hbo.2	Q96S52	OTTHUMG00000132604	ENST00000308360.7:c.67_69delTTC	17.37:g.26898175_26898177delGAA	ENSP00000309430:p.Phe23del	Somatic	52	0		WXS	Illumina HiSeq	.	58	16	NM_033198	Q6UVX6	In_Frame_Del	DEL	ENST00000308360.7	37	CCDS11235.1																																																																																			.		0.685	PIGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255833.3	NM_033198	
IRF5	3663	hgsc.bcm.edu	37	7	128587352	128587381	+	In_Frame_Del	DEL	ACTCTGCAGCCGCCCACTCTGCGGCCGCCT	ACTCTGCAGCCGCCCACTCTGCGGCCGCCT	-	rs199508964|rs113806178|rs60344245|rs566635242|rs202130620|rs375983447|rs534043449|rs79724471	byFrequency	TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	ACTCTGCAGCCGCCCACTCTGCGGCCGCCT	ACTCTGCAGCCGCCCACTCTGCGGCCGCCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr7:128587352_128587381delACTCTGCAGCCGCCCACTCTGCGGCCGCCT	ENST00000402030.2	+	6	574_603	c.502_531delACTCTGCAGCCGCCCACTCTGCGGCCGCCT	c.(502-531)actctgcagccgcccactctgcggccgcctdel	p.TLQPPTLRPP168del	IRF5_ENST00000473745.1_In_Frame_Del_p.TLQPPTLRPP168del|IRF5_ENST00000357234.5_In_Frame_Del_p.TLQPPTLRPP184del|IRF5_ENST00000249375.4_In_Frame_Del_p.TLQPPTLRPP168del|IRF5_ENST00000477535.1_Intron	NM_001098629.1|NM_001098630.1	NP_001092099.1|NP_001092100.1	Q13568	IRF5_HUMAN	interferon regulatory factor 5	168					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to muramyl dipeptide (GO:0032495)|response to peptidoglycan (GO:0032494)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(1)|prostate(1)	15						GTGGCCGCCCACTCTGCAGCCGCCCACTCTGCGGCCGCCTACTCTGCAGC	0.652														2428	0.484824	0.534	0.366	5008	,	,		17245	0.4425		0.5338	False		,,,				2504	0.4959				p.183_193del		.											.	.	.	1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)	c.549_578del						.		,,,,	1942,1932		603,736,598					,,,,	0.1	0.9		dbSNP_129	14	3856,4082		1083,1690,1196	no	coding,intron,coding,coding,coding	IRF5	NM_032643.3,NM_001242452.1,NM_001098630.1,NM_001098629.1,NM_001098627.2	,,,,	1686,2426,1794	A1A1,A1R,RR		48.5765,49.8709,49.0857	,,,,	,,,,		5798,6014				SO:0001651	inframe_deletion	3663	exon6			CCGCCCACTCTGC		CCDS5808.1, CCDS43645.1, CCDS56512.1	7q32	2008-07-18			ENSG00000128604	ENSG00000128604			6120	protein-coding gene	gene with protein product		607218					Standard	XM_005250317		Approved		uc003vog.3	Q13568	OTTHUMG00000158410	ENST00000402030.2:c.502_531delACTCTGCAGCCGCCCACTCTGCGGCCGCCT	7.37:g.128587352_128587381delACTCTGCAGCCGCCCACTCTGCGGCCGCCT	ENSP00000385352:p.Thr168_Pro177del	Somatic	7	2		WXS	Illumina HiSeq	.	10	3	NM_001098629	A4D1J8|A8DUA8|A8DUA9|E7EQ16|E7EW54|Q1A7B4|Q64GA9|Q64GB1|Q64GB2|Q6RCM8|Q9BQF0	In_Frame_Del	DEL	ENST00000402030.2	37	CCDS5808.1																																																																																			.		0.652	IRF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350934.1	NM_001098627	
ADAMTS7	11173	hgsc.bcm.edu	37	15	79051846	79051846	+	Missense_Mutation	SNP	T	T	C	rs199524707		TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr15:79051846T>C	ENST00000388820.4	-	24	5188	c.4978A>G	c.(4978-4980)Atc>Gtc	p.I1660V		NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	1660	PLAC. {ECO:0000255|PROSITE- ProRule:PRU00233}.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						TGGGTGCGGATGGTGGGCAGC	0.721																																					p.I1660V		.											ADAMTS7,NS,neuroblastoma,0,1	ADAMTS7	0	0			c.A4978G						.						9.0	11.0	10.0					15																	79051846		2122	4204	6326	SO:0001583	missense	11173	exon24			TGCGGATGGTGGG	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.4978A>G	15.37:g.79051846T>C	ENSP00000373472:p.Ile1660Val	Somatic	22	1		WXS	Illumina HiSeq	.	22	2	NM_014272	Q14F51|Q6P7J9	Missense_Mutation	SNP	ENST00000388820.4	37	CCDS32303.1	.	.	.	.	.	.	.	.	.	.	t	0.003	-2.471801	0.00167	.	.	ENSG00000136378	ENST00000388820	T	0.56941	0.43	2.92	-0.818	0.10833	PLAC (1);	0.176997	0.36002	N	0.002857	T	0.17066	0.0410	N	0.01874	-0.695	0.24807	N	0.992664	B	0.02656	0.0	B	0.01281	0.0	T	0.33292	-0.9874	10	0.02654	T	1	.	7.4446	0.27203	0.0:0.6997:0.0:0.3003	.	1660	Q9UKP4	ATS7_HUMAN	V	1660	ENSP00000373472:I1660V	ENSP00000373472:I1660V	I	-	1	0	ADAMTS7	76838901	0.463000	0.25799	0.157000	0.22605	0.002000	0.02628	0.822000	0.27352	-0.289000	0.09038	-0.830000	0.03078	ATC	.		0.721	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
ZBTB44	29068	hgsc.bcm.edu	37	11	130108461	130108461	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr11:130108461G>T	ENST00000357899.4	-	4	1417	c.1145C>A	c.(1144-1146)cCt>cAt	p.P382H	ZBTB44_ENST00000530205.1_Missense_Mutation_p.P382H|ZBTB44_ENST00000525842.1_Missense_Mutation_p.P382H|ZBTB44_ENST00000397753.1_Missense_Mutation_p.P382H			Q8NCP5	ZBT44_HUMAN	zinc finger and BTB domain containing 44	382					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)	15	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0192)|Lung(977;0.235)		GCTGGTGGAAGGAGCAATGTA	0.448																																					p.P382H		.											.	.	.	0			c.C1145A						.						84.0	78.0	80.0					11																	130108461		1912	4138	6050	SO:0001583	missense	29068	exon4			GTGGAAGGAGCAA	AK024659	CCDS44776.1, CCDS73414.1, CCDS73415.1	11q24.3	2013-01-08	2006-09-19	2006-09-19		ENSG00000196323		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	25001	protein-coding gene	gene with protein product			"""BTB (POZ) domain containing 15"""	BTBD15		11042152	Standard	NM_014155		Approved	HSPC063, ZNF851	uc001qgb.4	Q8NCP5		ENST00000357899.4:c.1145C>A	11.37:g.130108461G>T	ENSP00000350574:p.Pro382His	Somatic	46	0		WXS	Illumina HiSeq	.	61	4	NM_014155	Q6IPT8|Q86VJ7|Q86XX5	Missense_Mutation	SNP	ENST00000357899.4	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	31|31	5.063006|5.063006	0.93898|0.93898	.|.	.|.	ENSG00000196323|ENSG00000196323	ENST00000529982|ENST00000525842;ENST00000397753;ENST00000445008;ENST00000357899;ENST00000530205	.|T;T;T;T;T	.|0.16743	.|2.32;2.66;2.38;2.66;2.32	5.9|5.9	5.9|5.9	0.94986|0.94986	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.31575|0.31575	0.0801|0.0801	N|N	0.24115|0.24115	0.695|0.695	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;0.999;1.0	.|D;D;D	.|0.91635	.|0.998;0.99;0.999	T|T	0.02184|0.02184	-1.1199|-1.1199	5|10	.|0.44086	.|T	.|0.13	.|.	20.2626|20.2626	0.98452|0.98452	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|382;382;382	.|Q8NCP5-3;Q8NCP5;Q8NCP5-2	.|.;ZBT44_HUMAN;.	I|H	236|382	.|ENSP00000433457:P382H;ENSP00000380861:P382H;ENSP00000408079:P382H;ENSP00000350574:P382H;ENSP00000434177:P382H	.|ENSP00000350574:P382H	L|P	-|-	1|2	0|0	ZBTB44|ZBTB44	129613671|129613671	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.434000|9.434000	0.97515|0.97515	2.802000|2.802000	0.96397|0.96397	0.650000|0.650000	0.86243|0.86243	CTT|CCT	.		0.448	ZBTB44-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000386126.1	NM_014155	
LRRC66	339977	hgsc.bcm.edu	37	4	52860592	52860592	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr4:52860592G>T	ENST00000343457.3	-	4	2602	c.2596C>A	c.(2596-2598)Cct>Act	p.P866T		NM_001024611.1	NP_001019782.1	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	866						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(8)|lung(34)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	58						GCCTTATCAGGATCTGAGGGA	0.368																																					p.P866T		.											.	.	.	0			c.C2596A						.						87.0	81.0	83.0					4																	52860592		1865	4104	5969	SO:0001583	missense	339977	exon4			TATCAGGATCTGA	BC040414	CCDS43229.1	4q12	2008-08-08			ENSG00000188993	ENSG00000188993			34299	protein-coding gene	gene with protein product							Standard	XM_005265739		Approved		uc003gzi.3	Q68CR7	OTTHUMG00000160623	ENST00000343457.3:c.2596C>A	4.37:g.52860592G>T	ENSP00000341944:p.Pro866Thr	Somatic	53	0		WXS	Illumina HiSeq	.	99	4	NM_001024611		Missense_Mutation	SNP	ENST00000343457.3	37	CCDS43229.1	.	.	.	.	.	.	.	.	.	.	G	7.657	0.684109	0.14907	.	.	ENSG00000188993	ENST00000343457	T	0.35421	1.31	4.67	-0.515	0.11954	.	0.432066	0.20056	N	0.100195	T	0.21841	0.0526	L	0.36672	1.1	0.09310	N	1	B	0.27997	0.197	B	0.24269	0.052	T	0.14531	-1.0469	10	0.87932	D	0	-2.2637	3.9782	0.09484	0.1861:0.0:0.3346:0.4793	.	866	Q68CR7	LRC66_HUMAN	T	866	ENSP00000341944:P866T	ENSP00000341944:P866T	P	-	1	0	LRRC66	52555349	0.005000	0.15991	0.001000	0.08648	0.006000	0.05464	-0.129000	0.10515	0.018000	0.15052	0.655000	0.94253	CCT	.		0.368	LRRC66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361473.1	NM_001024611	
ANK1	286	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	41525850	41525850	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr8:41525850G>A	ENST00000347528.4	-	39	5412	c.5329C>T	c.(5329-5331)Cgg>Tgg	p.R1777W	ANK1_ENST00000396945.1_Missense_Mutation_p.R1777W|ANK1_ENST00000352337.4_Missense_Mutation_p.R1777W|ANK1_ENST00000396942.1_Missense_Mutation_p.R1777W|ANK1_ENST00000289734.7_Missense_Mutation_p.R1777W|ANK1_ENST00000379758.2_Missense_Mutation_p.R1777W|ANK1_ENST00000265709.8_Missense_Mutation_p.R1818W|RP11-930P14.1_ENST00000522388.1_RNA	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	1777	55 kDa regulatory domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			TGCTGCCTCCGGTCCCTGTCG	0.627																																					p.R1818W		.											.	.	.	0			c.C5452T						.						115.0	91.0	99.0					8																	41525850		2203	4300	6503	SO:0001583	missense	286	exon40			GCCTCCGGTCCCT	M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.5329C>T	8.37:g.41525850G>A	ENSP00000339620:p.Arg1777Trp	Somatic	22	0		WXS	Illumina HiSeq	.	47	22	NM_001142446	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	ENST00000347528.4	37	CCDS6119.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.18|13.18	2.161302|2.161302	0.38119|0.38119	.|.	.|.	ENSG00000029534|ENSG00000029534	ENST00000520299|ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709	.|T;T;T;T;T;T;T	.|0.65549	.|-0.15;-0.16;-0.13;-0.15;-0.13;-0.11;-0.15	4.09|4.09	-0.114|-0.114	0.13564|0.13564	.|.	.|0.817374	.|0.10985	.|N	.|0.612232	T|T	0.46718|0.46718	0.1407|0.1407	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	1|1	.|D;B;P;D;D;B	.|0.58620	.|0.983;0.001;0.951;0.978;0.968;0.001	.|P;B;B;B;B;B	.|0.46362	.|0.514;0.0;0.394;0.436;0.335;0.0	T|T	0.38045|0.38045	-0.9679|-0.9679	5|10	.|0.66056	.|D	.|0.02	.|.	4.1683|4.1683	0.10317|0.10317	0.3069:0.3322:0.3609:0.0|0.3069:0.3322:0.3609:0.0	.|.	.|1818;1615;1777;1777;1777;931	.|P16157-21;P16157-4;P16157;P16157-5;P16157-3;B3KX39	.|.;.;ANK1_HUMAN;.;.;.	L|W	936|1777;1777;1777;1777;1777;1777;1818	.|ENSP00000339620:R1777W;ENSP00000289734:R1777W;ENSP00000369082:R1777W;ENSP00000380149:R1777W;ENSP00000380147:R1777W;ENSP00000309131:R1777W;ENSP00000265709:R1818W	.|ENSP00000265709:R1818W	P|R	-|-	2|1	0|2	ANK1|ANK1	41645007|41645007	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.002000|0.002000	0.02628|0.02628	0.446000|0.446000	0.21694|0.21694	-0.115000|-0.115000	0.11915|0.11915	-0.671000|-0.671000	0.03813|0.03813	CCG|CGG	.		0.627	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475	
PSD	5662	hgsc.bcm.edu;bcgsc.ca	37	10	104172214	104172214	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr10:104172214C>T	ENST00000020673.5	-	6	2198	c.1672G>A	c.(1672-1674)Gcg>Acg	p.A558T	PSD_ENST00000406432.1_Missense_Mutation_p.A558T	NM_001270966.1|NM_002779.4	NP_001257895.1|NP_002770.3	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	558	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		AGGCGCTGCGCAGCCTCCAGG	0.622																																					p.A558T		.											.	.	.	0			c.G1672A						.						57.0	47.0	51.0					10																	104172214		2203	4300	6503	SO:0001583	missense	5662	exon7			GCTGCGCAGCCTC	X99688	CCDS31272.1, CCDS73187.1	10q24	2013-01-10	2004-04-28		ENSG00000059915	ENSG00000059915		"""Pleckstrin homology (PH) domain containing"""	9507	protein-coding gene	gene with protein product		602327	"""pleckstrin and Sec7 domain protein"""			9417912	Standard	NM_002779		Approved	KIAA2011, TYL, PSD1	uc009xxd.2	A5PKW4	OTTHUMG00000018954	ENST00000020673.5:c.1672G>A	10.37:g.104172214C>T	ENSP00000020673:p.Ala558Thr	Somatic	34	0		WXS	Illumina HiSeq	.	61	4	NM_001270965	B1AKX7|D3DR87|Q15673|Q8IVG0	Missense_Mutation	SNP	ENST00000020673.5	37	CCDS31272.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.664742	0.88251	.	.	ENSG00000059915	ENST00000020673;ENST00000541902;ENST00000406432	T;T	0.45276	0.9;0.9	5.77	5.77	0.91146	SEC7-like (4);	0.000000	0.85682	D	0.000000	T	0.76004	0.3927	H	0.94542	3.55	0.80722	D	1	D	0.71674	0.998	D	0.76575	0.988	T	0.82388	-0.0482	10	0.87932	D	0	.	19.9961	0.97386	0.0:1.0:0.0:0.0	.	558	A5PKW4	PSD1_HUMAN	T	558;461;558	ENSP00000020673:A558T;ENSP00000384830:A558T	ENSP00000020673:A558T	A	-	1	0	PSD	104162204	1.000000	0.71417	0.879000	0.34478	0.234000	0.25298	7.487000	0.81328	2.744000	0.94065	0.561000	0.74099	GCG	.		0.622	PSD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050041.2		
ACVR1C	130399	hgsc.bcm.edu	37	2	158443750	158443750	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr2:158443750C>T	ENST00000243349.8	-	2	613	c.253G>A	c.(253-255)Gaa>Aaa	p.E85K	ACVR1C_ENST00000409680.3_Missense_Mutation_p.E35K|ACVR1C_ENST00000348328.5_Missense_Mutation_p.E85K|ACVR1C_ENST00000335450.7_Missense_Mutation_p.E85K	NM_001111032.1|NM_145259.2	NP_001104502.1|NP_660302.2			activin A receptor, type IC											NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	42						AAGCAGCATTCGGTTTTGGTA	0.403																																					p.E85K		.											.	.	.	0			c.G253A						.						239.0	226.0	230.0					2																	158443750		2203	4300	6503	SO:0001583	missense	130399	exon2			AGCATTCGGTTTT	BC022530	CCDS2205.1, CCDS46432.1, CCDS46433.1, CCDS46434.1	2q24.2	2008-02-05			ENSG00000123612	ENSG00000123612			18123	protein-coding gene	gene with protein product		608981					Standard	NM_145259		Approved	ALK7, ACVRLK7	uc002tzk.4	Q8NER5	OTTHUMG00000131964	ENST00000243349.8:c.253G>A	2.37:g.158443750C>T	ENSP00000243349:p.Glu85Lys	Somatic	54	0		WXS	Illumina HiSeq	.	94	4	NM_145259		Missense_Mutation	SNP	ENST00000243349.8	37	CCDS2205.1	.	.	.	.	.	.	.	.	.	.	C	19.85	3.904139	0.72754	.	.	ENSG00000123612	ENST00000243349;ENST00000409680;ENST00000348328;ENST00000335450	T;T;D;D	0.90133	0.42;0.42;-2.62;-2.62	5.55	5.55	0.83447	TGF-beta receptor/activin receptor, type I/II (1);	0.000000	0.56097	D	0.000038	D	0.88851	0.6549	M	0.76727	2.345	0.26600	N	0.973046	P;P;B	0.41313	0.745;0.745;0.057	B;B;B	0.28465	0.09;0.09;0.066	D	0.83937	0.0309	10	0.37606	T	0.19	.	19.5066	0.95118	0.0:1.0:0.0:0.0	.	85;85;85	Q8NER5-2;Q8NER5-3;Q8NER5	.;.;ACV1C_HUMAN	K	85;35;85;85	ENSP00000243349:E85K;ENSP00000387168:E35K;ENSP00000335139:E85K;ENSP00000335178:E85K	ENSP00000243349:E85K	E	-	1	0	ACVR1C	158151996	0.997000	0.39634	0.954000	0.39281	0.788000	0.44548	3.425000	0.52771	2.628000	0.89032	0.650000	0.86243	GAA	.		0.403	ACVR1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254924.2	NM_145259	
CELF6	60677	hgsc.bcm.edu;bcgsc.ca	37	15	72582500	72582500	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr15:72582500G>A	ENST00000569547.1	-	4	562	c.491C>T	c.(490-492)aCg>aTg	p.T164M	CELF6_ENST00000395258.2_Missense_Mutation_p.T51M|RP11-106M3.3_ENST00000570175.1_RNA|CELF6_ENST00000567083.1_Missense_Mutation_p.T164M|RP11-106M3.2_ENST00000379915.4_RNA|CELF6_ENST00000543764.2_Missense_Mutation_p.T49M|CELF6_ENST00000287202.5_Missense_Mutation_p.T164M|CELF6_ENST00000569311.1_5'UTR|CELF6_ENST00000539635.1_Missense_Mutation_p.T25M			Q96J87	CELF6_HUMAN	CUGBP, Elav-like family member 6	164	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(2)	13						CCGCAGGACCGTGCACTCCTC	0.607																																					p.T164M		.											CELF6,NS,carcinoma,0,1	CELF6	0	0			c.C491T						.						81.0	68.0	73.0					15																	72582500		2199	4297	6496	SO:0001583	missense	60677	exon4			AGGACCGTGCACT	AF425606	CCDS10242.1, CCDS53955.1, CCDS53956.1	15q24	2013-02-12	2010-02-19	2010-02-19	ENSG00000140488	ENSG00000140488		"""RNA binding motif (RRM) containing"""	14059	protein-coding gene	gene with protein product		612681	"""Bruno (Drosophila) -like 6, RNA binding protein"", ""bruno-like 6, RNA binding protein (Drosophila)"""	BRUNOL6		10893231	Standard	NM_052840		Approved		uc002auh.2	Q96J87	OTTHUMG00000133444	ENST00000569547.1:c.491C>T	15.37:g.72582500G>A	ENSP00000454749:p.Thr164Met	Somatic	64	0		WXS	Illumina HiSeq	.	61	4	NM_001172684	B4DG28|B4DJB6|Q6PII4|Q6ZNJ7|Q8N607	Missense_Mutation	SNP	ENST00000569547.1	37	CCDS10242.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.0|21.0	4.081825|4.081825	0.76528|0.76528	.|.	.|.	ENSG00000140488|ENSG00000140488	ENST00000379915|ENST00000287202;ENST00000437872;ENST00000543764;ENST00000395258;ENST00000539635	.|T;T;T;T	.|0.16597	.|2.33;2.33;2.33;2.33	5.25|5.25	5.25|5.25	0.73442|0.73442	.|Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	.|0.000000	.|0.64402	.|U	.|0.000001	T|T	0.33411|0.33411	0.0862|0.0862	L|L	0.34521|0.34521	1.04|1.04	0.53005|0.53005	D|D	0.999968|0.999968	.|D;P;D;D;D	.|0.89917	.|1.0;0.916;1.0;1.0;1.0	.|D;P;D;D;D	.|0.91635	.|0.947;0.727;0.938;0.989;0.999	T|T	0.06607|0.06607	-1.0817|-1.0817	6|10	0.72032|0.87932	D|D	0.01|0	-14.6692|-14.6692	17.8368|17.8368	0.88700|0.88700	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|164;49;51;25;164	.|B4DJB6;B4DG28;Q96J87-2;B3KWE6;Q96J87	.|.;.;.;.;CELF6_HUMAN	W|M	42|164;164;49;51;25	.|ENSP00000287202:T164M;ENSP00000439956:T49M;ENSP00000378677:T51M;ENSP00000443162:T25M	ENSP00000369247:R42W|ENSP00000287202:T164M	R|T	-|-	1|2	2|0	CELF6|CELF6	70369554|70369554	1.000000|1.000000	0.71417|0.71417	0.982000|0.982000	0.44146|0.44146	0.993000|0.993000	0.82548|0.82548	9.476000|9.476000	0.97823|0.97823	2.469000|2.469000	0.83416|0.83416	0.561000|0.561000	0.74099|0.74099	CGG|ACG	.		0.607	CELF6-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000420180.1	NM_052840	
THEG	51298	hgsc.bcm.edu	37	19	367205	367205	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr19:367205G>T	ENST00000342640.4	-	7	815	c.773C>A	c.(772-774)gCa>gAa	p.A258E	THEG_ENST00000346878.2_Missense_Mutation_p.A234E	NM_016585.4	NP_057669.1	Q9P2T0	THEG_HUMAN	theg spermatid protein	258					cell differentiation (GO:0030154)|chaperone-mediated protein complex assembly (GO:0051131)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)				NS(1)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|skin(2)|soft_tissue(1)	29		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CATTTGGGCTGCCCTGGATAC	0.592																																					p.A258E		.											THEG,NS,carcinoma,0,1	THEG	0	0			c.C773A						.						65.0	68.0	67.0					19																	367205		2203	4300	6503	SO:0001583	missense	51298	exon7			TGGGCTGCCCTGG	AF268610	CCDS12025.1, CCDS12026.1	19p13.3	2012-02-24	2012-02-24		ENSG00000105549	ENSG00000105549			13706	protein-coding gene	gene with protein product	"""cancer/testis antigen 56"""	609503	"""Theg homolog (mouse)"""			11173852	Standard	NM_016585		Approved	CT56, THEG1	uc002lol.3	Q9P2T0	OTTHUMG00000165491	ENST00000342640.4:c.773C>A	19.37:g.367205G>T	ENSP00000340088:p.Ala258Glu	Somatic	31	0		WXS	Illumina HiSeq	.	40	2	NM_016585	A6NMJ8	Missense_Mutation	SNP	ENST00000342640.4	37	CCDS12025.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.71|15.71	2.914204|2.914204	0.52546|0.52546	.|.	.|.	ENSG00000105549|ENSG00000105549	ENST00000342640;ENST00000346878|ENST00000530711	T;T|.	0.32988|.	1.43;1.43|.	3.32|3.32	3.32|3.32	0.38043|0.38043	.|.	1.282010|.	0.05316|.	N|.	0.525702|.	T|T	0.67031|0.67031	0.2850|0.2850	M|M	0.70275|0.70275	2.135|2.135	0.40234|0.40234	D|D	0.977882|0.977882	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.87578|.	0.998;0.998|.	T|T	0.71899|0.71899	-0.4453|-0.4453	10|6	0.87932|0.87932	D|D	0|0	-18.7739|-18.7739	10.4202|10.4202	0.44346|0.44346	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	234;258|.	Q9P2T0-2;Q9P2T0|.	.;THEG_HUMAN|.	E|K	258;234|36	ENSP00000340088:A258E;ENSP00000264820:A234E|.	ENSP00000340088:A258E|ENSP00000431699:Q36K	A|Q	-|-	2|1	0|0	THEG|THEG	318205|318205	1.000000|1.000000	0.71417|0.71417	0.988000|0.988000	0.46212|0.46212	0.527000|0.527000	0.34593|0.34593	3.214000|3.214000	0.51161|0.51161	2.149000|2.149000	0.67028|0.67028	0.555000|0.555000	0.69702|0.69702	GCA|CAG	.		0.592	THEG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384431.2		
ATCAY	85300	hgsc.bcm.edu	37	19	3910859	3910859	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr19:3910859G>T	ENST00000450849.2	+	8	1305	c.838G>T	c.(838-840)Gtg>Ttg	p.V280L	ATCAY_ENST00000398448.3_Missense_Mutation_p.V286L|ATCAY_ENST00000301260.6_Missense_Mutation_p.V280L|ATCAY_ENST00000600960.1_Missense_Mutation_p.V280L	NM_033064.4	NP_149053.1	Q86WG3	ATCAY_HUMAN	ataxia, cerebellar, Cayman type	280	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.|Mediates interaction with GLS.				apoptotic process (GO:0006915)|mitochondrion distribution (GO:0048311)|negative regulation of glutamate metabolic process (GO:2000212)|neuron projection development (GO:0031175)|regulation of protein localization (GO:0032880)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrial membrane (GO:0031966)|neuron projection (GO:0043005)|synapse (GO:0045202)	kinesin binding (GO:0019894)			breast(1)|endometrium(2)|kidney(2)|lung(2)	7		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00485)|STAD - Stomach adenocarcinoma(1328;0.183)		CATTCGGACTGTGCTGGCCAT	0.582																																					p.V280L		.											.	.	.	0			c.G838T						.						115.0	123.0	120.0					19																	3910859		2146	4252	6398	SO:0001583	missense	85300	exon8			CGGACTGTGCTGG		CCDS45923.1	19p13.3	2014-06-24	2008-07-18		ENSG00000167654	ENSG00000167654			779	protein-coding gene	gene with protein product	"""Cayman ataxia"", ""caytaxin"""	608179				8845847, 14556008	Standard	NM_033064		Approved		uc002lyy.4	Q86WG3	OTTHUMG00000181836	ENST00000450849.2:c.838G>T	19.37:g.3910859G>T	ENSP00000390941:p.Val280Leu	Somatic	13	0		WXS	Illumina HiSeq	.	43	4	NM_033064	Q8NAQ2|Q8TAQ3|Q96HC6|Q96JF5	Missense_Mutation	SNP	ENST00000450849.2	37	CCDS45923.1	.	.	.	.	.	.	.	.	.	.	G	10.04	1.241720	0.22711	.	.	ENSG00000167654	ENST00000450849;ENST00000301260;ENST00000357694;ENST00000398448;ENST00000539301	T;T;T	0.61274	0.12;0.12;0.12	4.35	4.35	0.52113	Cellular retinaldehyde-binding/triple function, C-terminal (4);	0.255981	0.37955	N	0.001879	T	0.31231	0.0790	N	0.02973	-0.45	0.51233	D	0.999911	B;B;B	0.21225	0.015;0.053;0.032	B;B;B	0.26614	0.071;0.043;0.071	T	0.30563	-0.9974	10	0.02654	T	1	-1.7376	15.9307	0.79656	0.0:0.0:1.0:0.0	.	286;280;280	B4DS11;Q86WG3-3;Q86WG3	.;.;ATCAY_HUMAN	L	280;280;280;286;258	ENSP00000390941:V280L;ENSP00000301260:V280L;ENSP00000381466:V286L	ENSP00000301260:V280L	V	+	1	0	ATCAY	3861859	1.000000	0.71417	0.997000	0.53966	0.979000	0.70002	5.363000	0.66104	1.970000	0.57323	0.456000	0.33151	GTG	.		0.582	ATCAY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457872.2		
GPR64	10149	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	19021009	19021009	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chrX:19021009T>C	ENST00000379869.3	-	24	2348	c.2185A>G	c.(2185-2187)Act>Gct	p.T729A	GPR64_ENST00000360279.4_Missense_Mutation_p.T707A|GPR64_ENST00000340581.3_Missense_Mutation_p.T610A|GPR64_ENST00000357544.3_Missense_Mutation_p.T699A|GPR64_ENST00000379873.2_Missense_Mutation_p.T729A|GPR64_ENST00000356606.4_Missense_Mutation_p.T715A|GPR64_ENST00000354791.3_Missense_Mutation_p.T713A|GPR64_ENST00000379876.1_Missense_Mutation_p.T705A|GPR64_ENST00000379878.3_Missense_Mutation_p.T713A|GPR64_ENST00000357991.3_Missense_Mutation_p.T726A	NM_001079858.2|NM_005756.3	NP_001073327.1|NP_005747.2	Q8IZP9	GPR64_HUMAN	G protein-coupled receptor 64	729					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)|spermatogenesis (GO:0007283)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(18)|stomach(1)|urinary_tract(1)	42	Hepatocellular(33;0.183)					CGGATGTAAGTATTAAATACT	0.413																																					p.T729A		.											.	.	.	0			c.A2185G						.						103.0	100.0	101.0					X																	19021009		2203	4300	6503	SO:0001583	missense	10149	exon24			TGTAAGTATTAAA	X81892	CCDS14191.1, CCDS43921.1, CCDS43922.1, CCDS43923.1, CCDS55376.1, CCDS55377.1, CCDS55378.1, CCDS55379.1	Xp22.13	2014-08-08			ENSG00000173698	ENSG00000173698		"""-"", ""GPCR / Class B : Orphans"""	4516	protein-coding gene	gene with protein product	"""epididymal protein 6"""	300572				9739419, 9150425	Standard	NM_005756		Approved	HE6, TM7LN2, EDDM6	uc004cyx.3	Q8IZP9	OTTHUMG00000021223	ENST00000379869.3:c.2185A>G	X.37:g.19021009T>C	ENSP00000369198:p.Thr729Ala	Somatic	78	0		WXS	Illumina HiSeq	.	122	37	NM_001184834	B1AWB3|B1AWB4|B1AWB6|B1AWB7|O00406|Q14CE0|Q8IWT2|Q8IZE4|Q8IZE5|Q8IZE6|Q8IZE7|Q8IZP3|Q8IZP4	Missense_Mutation	SNP	ENST00000379869.3	37	CCDS43923.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.284301	0.80803	.	.	ENSG00000173698	ENST00000379873;ENST00000379878;ENST00000354791;ENST00000379876;ENST00000357544;ENST00000379869;ENST00000360279;ENST00000357991;ENST00000356606;ENST00000340581	T;T;T;T;T;T;T;T;T;T	0.38077	1.16;1.16;1.16;1.16;1.16;1.16;1.16;1.16;1.16;1.16	5.36	5.36	0.76844	GPCR, family 2-like (1);	0.000000	0.53938	D	0.000048	T	0.50786	0.1636	L	0.39326	1.205	0.44359	D	0.997257	P;P;D;D;D;D;D;D;D;D;D	0.76494	0.869;0.508;0.999;0.968;0.968;0.999;0.999;0.994;0.994;0.987;0.999	P;B;D;D;D;D;D;D;D;D;D	0.76071	0.853;0.316;0.978;0.922;0.922;0.978;0.978;0.941;0.941;0.953;0.987	T	0.50381	-0.8835	10	0.51188	T	0.08	.	14.4356	0.67279	0.0:0.0:0.0:1.0	.	610;691;699;705;713;729;707;715;726;729;713	Q14CE0;Q8IZP9-8;Q8IZP9-7;Q8IZP9-5;Q8IZP9-3;Q8IZP9-9;Q8IZP9-6;Q8IZP9-4;Q8IZP9-2;Q8IZP9;Q14CE1	.;.;.;.;.;.;.;.;.;GPR64_HUMAN;.	A	729;713;713;705;699;729;707;726;715;610	ENSP00000369202:T729A;ENSP00000369207:T713A;ENSP00000346845:T713A;ENSP00000369205:T705A;ENSP00000350152:T699A;ENSP00000369198:T729A;ENSP00000353421:T707A;ENSP00000350680:T726A;ENSP00000349015:T715A;ENSP00000344972:T610A	ENSP00000344972:T610A	T	-	1	0	GPR64	18930930	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.755000	0.62198	1.788000	0.52465	0.441000	0.28932	ACT	.		0.413	GPR64-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055970.2		
MGAT4C	25834	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	86373133	86373133	+	Silent	SNP	C	C	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr12:86373133C>T	ENST00000604798.1	-	8	2575	c.1371G>A	c.(1369-1371)agG>agA	p.R457R	MGAT4C_ENST00000332156.1_Silent_p.R457R|MGAT4C_ENST00000548651.1_Silent_p.R457R|MGAT4C_ENST00000552808.2_Silent_p.R457R|MGAT4C_ENST00000393205.2_Silent_p.R486R|MGAT4C_ENST00000549405.2_Silent_p.R457R			Q9UBM8	MGT4C_HUMAN	MGAT4 family, member C	457					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						TGACATATATCCTCATACAAT	0.313																																					p.R457R		.											.	.	.	0			c.G1371A						.						82.0	82.0	82.0					12																	86373133		2203	4299	6502	SO:0001819	synonymous_variant	25834	exon7			ATATATCCTCATA		CCDS9030.1	12q21	2014-07-14	2014-07-14		ENSG00000182050	ENSG00000182050		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	30871	protein-coding gene	gene with protein product		607385	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)"""			10570912	Standard	NM_013244		Approved	HGNT-IV-H	uc001tal.4	Q9UBM8	OTTHUMG00000169846	ENST00000604798.1:c.1371G>A	12.37:g.86373133C>T		Somatic	39	0		WXS	Illumina HiSeq	.	96	30	NM_013244	B4DRH2|Q4G199|Q9UIU5	Silent	SNP	ENST00000604798.1	37	CCDS9030.1																																																																																			.		0.313	MGAT4C-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406212.2	NM_013244	
H2AFV	94239	hgsc.bcm.edu	37	7	44874113	44874113	+	Missense_Mutation	SNP	T	T	C	rs1802437		TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr7:44874113T>C	ENST00000308153.4	-	5	465	c.374A>G	c.(373-375)cAg>cGg	p.Q125R	H2AFV_ENST00000437072.1_Intron|H2AFV_ENST00000521529.1_3'UTR|H2AFV_ENST00000222690.6_Intron|H2AFV_ENST00000381124.5_3'UTR|H2AFV_ENST00000350771.3_Missense_Mutation_p.Q99R|H2AFV_ENST00000349299.3_Missense_Mutation_p.Q87R	NM_012412.4	NP_036544.1	Q71UI9	H2AV_HUMAN	H2A histone family, member V	125			Q -> R (in dbSNP:rs1802437).			extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|urinary_tract(1)	9						AGCAGTTTTCTGCTGTCCCTT	0.373																																					p.Q125R		.											.	.	.	0			c.A374G						.						90.0	79.0	83.0					7																	44874113		2203	4300	6503	SO:0001583	missense	94239	exon5			GTTTTCTGCTGTC	AF081192	CCDS5495.1, CCDS5496.1, CCDS5497.1, CCDS5498.1, CCDS47581.1	7p13	2011-01-27		2004-03-26	ENSG00000105968	ENSG00000105968		"""Histones / Replication-independent"""	20664	protein-coding gene	gene with protein product				H2AV			Standard	NM_012412		Approved	MGC10170, MGC10831, MGC1947	uc003tma.2	Q71UI9	OTTHUMG00000129217	ENST00000308153.4:c.374A>G	7.37:g.44874113T>C	ENSP00000308405:p.Gln125Arg	Somatic	81	0		WXS	Illumina HiSeq	.	88	4	NM_012412	A6NFA8|A6NKY0|A6NN01|A8MQC5|Q59GV8|Q6PK98	Missense_Mutation	SNP	ENST00000308153.4	37	CCDS5496.1	.	.	.	.	.	.	.	.	.	.	T	17.73	3.461982	0.63513	.	.	ENSG00000105968	ENST00000349299;ENST00000308153;ENST00000350771	T;D;T	0.82619	0.93;-1.63;0.94	5.91	5.91	0.95273	Histone-fold (1);Histone H2A (1);	.	.	.	.	T	0.71600	0.3359	N	0.17474	0.49	0.80722	D	1	B;B;P	0.41673	0.0;0.029;0.759	B;B;B	0.37267	0.001;0.009;0.245	T	0.76405	-0.2971	9	0.59425	D	0.04	-19.8855	14.2973	0.66321	0.0:0.0:0.0:1.0	rs1802437	99;87;125	A6NKY0;A6NFA8;Q71UI9	.;.;H2AV_HUMAN	R	87;125;99	ENSP00000342714:Q87R;ENSP00000308405:Q125R;ENSP00000340708:Q99R	ENSP00000308405:Q125R	Q	-	2	0	H2AFV	44840638	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.465000	0.80898	2.261000	0.74972	0.533000	0.62120	CAG	0.001		0.373	H2AFV-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251305.1	NM_012412	
RAD54L2	23132	hgsc.bcm.edu	37	3	51675865	51675865	+	Nonsense_Mutation	SNP	C	C	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr3:51675865C>T	ENST00000409535.2	+	14	2457	c.2332C>T	c.(2332-2334)Cga>Tga	p.R778*	RAD54L2_ENST00000296477.3_Nonsense_Mutation_p.R472*	NM_015106.2	NP_055921.2	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2 (S. cerevisiae)	778	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|transcription cofactor activity (GO:0003712)			NS(2)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|liver(2)|lung(9)|ovary(4)|skin(2)	31				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		GAAGTGGGTTCGAAACATCAG	0.493																																					p.R778X		.											RAD54L2,NS,carcinoma,0,1	RAD54L2	0	0			c.C2332T						.						198.0	143.0	162.0					3																	51675865		2203	4299	6502	SO:0001587	stop_gained	23132	exon14			TGGGTTCGAAACA	AB018352	CCDS33765.2	3p21.2	2006-01-17			ENSG00000164080	ENSG00000164080			29123	protein-coding gene	gene with protein product						9872452	Standard	NM_015106		Approved	KIAA0809, SRISNF2L	uc011bdt.2	Q9Y4B4	OTTHUMG00000152936	ENST00000409535.2:c.2332C>T	3.37:g.51675865C>T	ENSP00000386520:p.Arg778*	Somatic	36	0		WXS	Illumina HiSeq	.	48	2	NM_015106	Q8TB57|Q9BV54	Nonsense_Mutation	SNP	ENST00000409535.2	37	CCDS33765.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	41|41	9.125044|9.125044	0.99073|0.99073	.|.	.|.	ENSG00000164080|ENSG00000164080	ENST00000409535;ENST00000296477|ENST00000432863	.|.	.|.	.|.	5.96|5.96	5.1|5.1	0.69264|0.69264	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.71443	.|0.3340	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.74309	.|-0.3707	.|3	0.02654|.	T|.	1|.	-6.082|-6.082	15.9017|15.9017	0.79384|0.79384	0.1363:0.8636:0.0:0.0|0.1363:0.8636:0.0:0.0	.|.	.|.	.|.	.|.	X|L	778;472|606	.|.	ENSP00000296477:R472X|.	R|S	+|+	1|2	2|0	RAD54L2|RAD54L2	51650905|51650905	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.801000|0.801000	0.45260|0.45260	4.497000|4.497000	0.60367|0.60367	1.549000|1.549000	0.49425|0.49425	-0.121000|-0.121000	0.15023|0.15023	CGA|TCG	.		0.493	RAD54L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328700.2	NM_015106	
DCXR	51181	hgsc.bcm.edu	37	17	79994159	79994159	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr17:79994159G>T	ENST00000306869.2	-	7	588	c.539C>A	c.(538-540)aCa>aAa	p.T180K	RP13-650J16.1_ENST00000582558.1_RNA|RP13-650J16.1_ENST00000584705.1_RNA|DCXR_ENST00000584318.1_5'Flank	NM_001195218.1|NM_016286.3	NP_001182147.1|NP_057370.1	Q7Z4W1	DCXR_HUMAN	dicarbonyl/L-xylulose reductase	180					D-xylose metabolic process (GO:0042732)|glucose metabolic process (GO:0006006)|NADP metabolic process (GO:0006739)|oxidation-reduction process (GO:0055114)|protein homotetramerization (GO:0051289)|xylulose metabolic process (GO:0005997)	brush border (GO:0005903)|cytoplasmic microtubule (GO:0005881)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microvillus (GO:0005902)|nucleus (GO:0005634)	L-xylulose reductase (NADP+) activity (GO:0050038)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)			kidney(1)|lung(3)	4	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)			CATCACCACTGTGGGGTTTAC	0.597																																					p.T180K		.											DCXR,NS,carcinoma,0,1	DCXR	0	0			c.C539A						.						78.0	72.0	74.0					17																	79994159		2203	4300	6503	SO:0001583	missense	51181	exon7			ACCACTGTGGGGT	AB013846	CCDS11799.1	17q25.3	2011-09-14				ENSG00000169738	1.1.1.10	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	18985	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 20C, member 1"""	608347				11882650, 19027726	Standard	NM_016286		Approved	KIDCR, DCR, SDR20C1	uc002kdg.3	Q7Z4W1		ENST00000306869.2:c.539C>A	17.37:g.79994159G>T	ENSP00000303356:p.Thr180Lys	Somatic	11	0		WXS	Illumina HiSeq	.	27	2	NM_016286	Q9BTZ3|Q9UHY9	Missense_Mutation	SNP	ENST00000306869.2	37	CCDS11799.1	.	.	.	.	.	.	.	.	.	.	G	9.742	1.165039	0.21538	.	.	ENSG00000169738	ENST00000306869	T	0.44482	0.92	5.02	4.05	0.47172	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.68274	0.2983	M	0.88979	2.995	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	T	0.74970	-0.3482	9	.	.	.	.	13.6938	0.62564	0.0754:0.0:0.9246:0.0	.	180	Q7Z4W1	DCXR_HUMAN	K	180	ENSP00000303356:T180K	.	T	-	2	0	DCXR	77587448	1.000000	0.71417	0.873000	0.34254	0.005000	0.04900	9.000000	0.93564	1.334000	0.45468	-0.163000	0.13421	ACA	.		0.597	DCXR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442153.2		
PREX1	57580	hgsc.bcm.edu	37	20	47258999	47258999	+	Silent	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr20:47258999G>T	ENST00000371941.3	-	28	3652	c.3630C>A	c.(3628-3630)atC>atA	p.I1210I	PREX1_ENST00000496915.1_5'UTR|PREX1_ENST00000396220.1_Silent_p.I1210I	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	1210					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			TGTCAGATGGGATCCGCATGT	0.567																																					p.I1210I		.											PREX1_ENST00000396220,NS,carcinoma,0,2	PREX1_ENST00000396220	0	0			c.C3630A						.						76.0	70.0	72.0					20																	47258999		2203	4300	6503	SO:0001819	synonymous_variant	57580	exon28			AGATGGGATCCGC	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.3630C>A	20.37:g.47258999G>T		Somatic	16	0		WXS	Illumina HiSeq	.	49	2	NM_020820	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Silent	SNP	ENST00000371941.3	37	CCDS13410.1																																																																																			.		0.567	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820	
OTOP1	133060	hgsc.bcm.edu	37	4	4204211	4204211	+	Missense_Mutation	SNP	G	G	A	rs200612216		TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr4:4204211G>A	ENST00000296358.4	-	4	718	c.694C>T	c.(694-696)Cgg>Tgg	p.R232W		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	232					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)		p.R232W(2)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GTGATGAGCCGTTCCTTGTGC	0.507																																					p.R232W		.											OTOP1,NS,carcinoma,0,3	OTOP1	0	2	Substitution - Missense(2)	prostate(1)|liver(1)	c.C694T						.						144.0	123.0	130.0					4																	4204211		2203	4300	6503	SO:0001583	missense	133060	exon4			TGAGCCGTTCCTT	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.694C>T	4.37:g.4204211G>A	ENSP00000296358:p.Arg232Trp	Somatic	24	0		WXS	Illumina HiSeq	.	49	5	NM_177998	A1L476	Missense_Mutation	SNP	ENST00000296358.4	37	CCDS3372.1	.	.	.	.	.	.	.	.	.	.	G	11.92	1.781817	0.31502	.	.	ENSG00000163982	ENST00000296358	T	0.09817	2.94	5.28	4.35	0.52113	.	0.000000	0.85682	D	0.000000	T	0.06690	0.0171	N	0.14661	0.345	0.80722	D	1	P	0.35328	0.495	B	0.32583	0.148	T	0.26224	-1.0109	10	0.72032	D	0.01	.	10.6877	0.45852	0.0:0.0:0.5681:0.4319	.	232	Q7RTM1	OTOP1_HUMAN	W	232	ENSP00000296358:R232W	ENSP00000296358:R232W	R	-	1	2	OTOP1	4255112	1.000000	0.71417	0.547000	0.28179	0.267000	0.26476	2.487000	0.45268	2.462000	0.83206	0.603000	0.83216	CGG	.		0.507	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
C4orf17	84103	hgsc.bcm.edu	37	4	100460497	100460497	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr4:100460497C>A	ENST00000326581.4	+	7	1168	c.806C>A	c.(805-807)aCc>aAc	p.T269N	C4orf17_ENST00000514652.1_Missense_Mutation_p.T269N	NM_032149.2	NP_115525.2	Q53FE4	CD017_HUMAN	chromosome 4 open reading frame 17	269										central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|prostate(1)|urinary_tract(3)	18				OV - Ovarian serous cystadenocarcinoma(123;2.08e-08)		AAAGTGCTGACCAGAGATACA	0.448																																					p.T269N		.											C4orf17,NS,carcinoma,0,1	C4orf17	0	0			c.C806A						.						80.0	82.0	81.0					4																	100460497		2203	4300	6503	SO:0001583	missense	84103	exon7			TGCTGACCAGAGA	AL136838	CCDS3649.1	4q23	2008-02-05			ENSG00000138813	ENSG00000138813			25274	protein-coding gene	gene with protein product						11230166	Standard	NM_032149		Approved	DKFZP434G072	uc003huw.3	Q53FE4	OTTHUMG00000131027	ENST00000326581.4:c.806C>A	4.37:g.100460497C>A	ENSP00000322582:p.Thr269Asn	Somatic	23	0		WXS	Illumina HiSeq	.	31	2	NM_032149	Q6FI84|Q6IS77|Q8NA78|Q9H0D9	Missense_Mutation	SNP	ENST00000326581.4	37	CCDS3649.1	.	.	.	.	.	.	.	.	.	.	C	10.74	1.436123	0.25813	.	.	ENSG00000138813	ENST00000326581;ENST00000514652	T;T	0.18960	2.18;2.18	5.03	1.15	0.20763	.	0.945349	0.08836	N	0.886494	T	0.20455	0.0492	L	0.60455	1.87	0.09310	N	1	P	0.43701	0.815	B	0.43251	0.413	T	0.18366	-1.0339	10	0.22706	T	0.39	0.3243	3.848	0.08943	0.1572:0.4511:0.3051:0.0866	.	269	Q53FE4	CD017_HUMAN	N	269	ENSP00000322582:T269N;ENSP00000427663:T269N	ENSP00000322582:T269N	T	+	2	0	C4orf17	100679520	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.224000	0.17738	0.060000	0.16281	-0.165000	0.13383	ACC	.		0.448	C4orf17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253670.2	NM_032149	
FAT1	2195	hgsc.bcm.edu;broad.mit.edu	37	4	187525601	187525601	+	Missense_Mutation	SNP	G	G	A	rs200357548		TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr4:187525601G>A	ENST00000441802.2	-	18	10687	c.10478C>T	c.(10477-10479)cCg>cTg	p.P3493L		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	3493	Cadherin 32. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						GACTCCTTGCGGGTTAACTTC	0.438										HNSCC(5;0.00058)																											p.P3493L	Colon(197;1040 2055 4143 4984 49344)	.											FAT1,bladder,carcinoma,+1,2	FAT1	+1	0			c.C10478T						.	G	LEU/PRO	1,3843		0,1,1921	105.0	102.0	103.0		10478	4.0	1.0	4		103	8,8254		0,8,4123	yes	missense	FAT1	NM_005245.3	98	0,9,6044	AA,AG,GG		0.0968,0.026,0.0743	benign	3493/4589	187525601	9,12097	1922	4131	6053	SO:0001583	missense	2195	exon18			CCTTGCGGGTTAA	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.10478C>T	4.37:g.187525601G>A	ENSP00000406229:p.Pro3493Leu	Somatic	59	0		WXS	Illumina HiSeq	.	92	4	NM_005245		Missense_Mutation	SNP	ENST00000441802.2	37	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	G	9.499	1.102719	0.20632	2.6E-4	9.68E-4	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.01685	4.69	5.21	4.03	0.46877	Cadherin (4);Cadherin-like (1);	0.332899	0.32703	N	0.005751	T	0.03695	0.0105	M	0.86573	2.825	0.36855	D	0.8881	P	0.35507	0.506	B	0.27608	0.081	T	0.36286	-0.9754	10	0.29301	T	0.29	.	12.5639	0.56297	0.0:0.0:0.1394:0.8605	.	3493	Q14517	FAT1_HUMAN	L	3493;3495	ENSP00000406229:P3493L	ENSP00000260147:P3495L	P	-	2	0	FAT1	187762595	1.000000	0.71417	0.990000	0.47175	0.011000	0.07611	4.535000	0.60629	1.005000	0.39183	-0.375000	0.07067	CCG	.		0.438	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
KCNH2	3757	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	150644044	150644044	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr7:150644044G>A	ENST00000262186.5	-	14	3652	c.3251C>T	c.(3250-3252)cCg>cTg	p.P1084L	KCNH2_ENST00000392968.2_Missense_Mutation_p.P988L|KCNH2_ENST00000330883.4_Missense_Mutation_p.P744L	NM_000238.3	NP_000229.1	Q12809	KCNH2_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 2	1084					cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			NS(1)|cervix(1)|endometrium(10)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	42	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	GCCAGGCCCCGGGGTGGTCAC	0.662																																					p.P1084L	GBM(137;110 1844 13671 20123 45161)	.											.	.	.	0			c.C3251T						.						54.0	56.0	56.0					7																	150644044		2203	4300	6503	SO:0001583	missense	3757	exon14			GGCCCCGGGGTGG	U04270	CCDS5910.1, CCDS5911.1	7q36.1	2014-09-17			ENSG00000055118	ENSG00000055118		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6251	protein-coding gene	gene with protein product		152427		LQT2		18616963, 7842012, 8159766, 16382104	Standard	NM_000238		Approved	Kv11.1, HERG, erg1	uc003wic.3	Q12809	OTTHUMG00000158341	ENST00000262186.5:c.3251C>T	7.37:g.150644044G>A	ENSP00000262186:p.Pro1084Leu	Somatic	23	0		WXS	Illumina HiSeq	.	27	12	NM_000238	A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Missense_Mutation	SNP	ENST00000262186.5	37	CCDS5910.1	.	.	.	.	.	.	.	.	.	.	G	15.21	2.764549	0.49574	.	.	ENSG00000055118	ENST00000330883;ENST00000392968;ENST00000262186	D;D;D	0.86627	-2.15;-2.15;-2.15	4.89	3.98	0.46160	.	0.144412	0.46145	D	0.000311	D	0.85860	0.5795	L	0.38175	1.15	0.80722	D	1	D;D;D	0.64830	0.99;0.99;0.994	P;P;P	0.52481	0.505;0.505;0.7	D	0.85817	0.1383	10	0.52906	T	0.07	.	12.3675	0.55236	0.0:0.0:0.8299:0.1701	.	988;1084;744	C4PFH9;Q12809;Q12809-2	.;KCNH2_HUMAN;.	L	744;988;1084	ENSP00000328531:P744L;ENSP00000376695:P988L;ENSP00000262186:P1084L	ENSP00000262186:P1084L	P	-	2	0	KCNH2	150274977	0.970000	0.33590	0.991000	0.47740	0.740000	0.42216	1.575000	0.36493	1.146000	0.42352	0.484000	0.47621	CCG	.		0.662	KCNH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350741.2	NM_000238	
EFTUD2	9343	hgsc.bcm.edu	37	17	42937901	42937901	+	Nonsense_Mutation	SNP	C	C	A			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr17:42937901C>A	ENST00000426333.2	-	17	1915	c.1618G>T	c.(1618-1620)Gag>Tag	p.E540*	EFTUD2_ENST00000591382.1_Nonsense_Mutation_p.E540*|EFTUD2_ENST00000402521.3_Nonsense_Mutation_p.E505*|EFTUD2_ENST00000592576.1_Nonsense_Mutation_p.E530*	NM_001142605.1|NM_001258354.1|NM_004247.3	NP_001136077.1|NP_001245283.1|NP_004238.3	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain containing 2	540					gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)	p.E540*(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	32		Prostate(33;0.109)				CGGTTCACCTCGATGTGGTAC	0.433																																					p.E540X	Ovarian(10;65 485 10258 29980 30707)	.											EFTUD2,NS,carcinoma,0,1	EFTUD2	0	1	Substitution - Nonsense(1)	lung(1)	c.G1618T						.						128.0	105.0	113.0					17																	42937901		2203	4300	6503	SO:0001587	stop_gained	9343	exon17			TCACCTCGATGTG	D21163	CCDS11489.1, CCDS45707.1, CCDS59295.1	17q21.31	2014-08-12			ENSG00000108883	ENSG00000108883			30858	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 116 kD"""	603892				9233818	Standard	NM_004247		Approved	U5-116KD, Snrp116, Snu114, SNRNP116	uc002ihn.2	Q15029	OTTHUMG00000179865	ENST00000426333.2:c.1618G>T	17.37:g.42937901C>A	ENSP00000392094:p.Glu540*	Somatic	23	0		WXS	Illumina HiSeq	.	63	3	NM_004247	B4DK30|B4DMC0|D3DX58|K7EJ81|Q9BUR0	Nonsense_Mutation	SNP	ENST00000426333.2	37	CCDS11489.1	.	.	.	.	.	.	.	.	.	.	C	40	8.300126	0.98750	.	.	ENSG00000108883	ENST00000426333;ENST00000262414;ENST00000402521	.	.	.	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-2.0E-4	18.8158	0.92076	0.0:1.0:0.0:0.0	.	.	.	.	X	540;530;505	.	ENSP00000262414:E530X	E	-	1	0	EFTUD2	40293427	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.583000	0.82559	2.776000	0.95493	0.650000	0.86243	GAG	.		0.433	EFTUD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448672.1	NM_004247	
LILRB4	11006	hgsc.bcm.edu	37	19	55179365	55179365	+	Silent	SNP	G	G	A			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr19:55179365G>A	ENST00000391736.1	+	14	1557	c.1242G>A	c.(1240-1242)caG>caA	p.Q414Q	LILRB4_ENST00000391734.3_Silent_p.Q361Q|LILRB4_ENST00000270452.2_Silent_p.Q414Q|LILRB4_ENST00000430952.2_Silent_p.Q413Q|LILRB4_ENST00000391733.3_Silent_p.Q415Q	NM_001278426.2|NM_001278428.2|NM_001278429.2|NM_001278430.2	NP_001265355.1|NP_001265357.1|NP_001265358.1|NP_001265359.1	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4	414			Q -> R (in dbSNP:rs1048801). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:9548455}.		immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)	p.Q414Q(1)		breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(20)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	39				GBM - Glioblastoma multiforme(193;0.035)		CCTACGCCCAGCTGCACAGCT	0.647																																					p.Q414Q		.											LILRB4,NS,carcinoma,0,1	LILRB4	0	1	Substitution - coding silent(1)	lung(1)	c.G1242A						.						85.0	89.0	88.0					19																	55179365		2203	4300	6503	SO:0001819	synonymous_variant	11006	exon12			CGCCCAGCTGCAC	U82979	CCDS12902.1, CCDS42618.1	19q13.4	2013-01-11				ENSG00000186818		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6608	protein-coding gene	gene with protein product		604821				9151699, 9079806	Standard	XM_005277050		Approved	LIR-5, ILT3, HM18, LIR5, CD85k	uc002qgp.3	Q8NHJ6		ENST00000391736.1:c.1242G>A	19.37:g.55179365G>A		Somatic	61	0		WXS	Illumina HiSeq	.	93	3	NM_006847	A8MVL8|O15468|O75021|Q6FGQ9|Q8N1C7|Q8NHL5	Silent	SNP	ENST00000391736.1	37	CCDS12902.1																																																																																			.		0.647	LILRB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000141127.3		
IKBKAP	8518	hgsc.bcm.edu	37	9	111681574	111681574	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr9:111681574T>C	ENST00000374647.5	-	7	915	c.608A>G	c.(607-609)gAt>gGt	p.D203G	IKBKAP_ENST00000537196.1_Intron	NM_003640.3	NP_003631.2	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein	203					chromatin organization (GO:0006325)|immune response (GO:0006955)|positive regulation of cell migration (GO:0030335)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|nucleolus (GO:0005730)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						AAACTGTCCATCCCCCCGCCA	0.388																																					p.D203G		.											.	.	.	0			c.A608G						.						60.0	52.0	55.0					9																	111681574		2203	4300	6503	SO:0001583	missense	8518	exon7			TGTCCATCCCCCC	AF044195	CCDS6773.1	9q31	2014-09-17	2003-12-02		ENSG00000070061	ENSG00000070061		"""Elongator acetyltransferase complex subunits"""	5959	protein-coding gene	gene with protein product	"""elongator acetyltransferase complex subunit 1"""	603722	"""dysautonomia (Riley-Day syndrome, hereditary sensory autonomic neuropathy type III)"""	DYS		9751059, 11179008	Standard	NM_003640		Approved	IKAP, TOT1, ELP1, IKI3	uc004bdm.4	O95163	OTTHUMG00000020465	ENST00000374647.5:c.608A>G	9.37:g.111681574T>C	ENSP00000363779:p.Asp203Gly	Somatic	105	0		WXS	Illumina HiSeq	.	86	4	NM_003640	Q5JSV2|Q9H327|Q9UG87	Missense_Mutation	SNP	ENST00000374647.5	37	CCDS6773.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.617338	0.87359	.	.	ENSG00000070061	ENST00000374647	T	0.70399	-0.48	5.25	5.25	0.73442	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.87815	0.6272	H	0.94847	3.59	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90869	0.4744	10	0.87932	D	0	-8.9712	13.1124	0.59281	0.0:0.0:0.0:1.0	.	203	O95163	ELP1_HUMAN	G	203	ENSP00000363779:D203G	ENSP00000363779:D203G	D	-	2	0	IKBKAP	110721395	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.395000	0.79876	1.999000	0.58509	0.533000	0.62120	GAT	.		0.388	IKBKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053574.1		
CDC27	996	hgsc.bcm.edu	37	17	45234708	45234708	+	Missense_Mutation	SNP	A	A	G			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr17:45234708A>G	ENST00000066544.3	-	6	611	c.518T>C	c.(517-519)tTa>tCa	p.L173S	CDC27_ENST00000527547.1_Missense_Mutation_p.L173S|CDC27_ENST00000528748.1_5'UTR|CDC27_ENST00000446365.2_Missense_Mutation_p.L112S|CDC27_ENST00000531206.1_Missense_Mutation_p.L173S	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	173					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.L173S(1)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						AAAGTTCTGTAAAGATGTGAA	0.383																																					p.L173S		.											CDC27,NS,malignant_melanoma,0,1	CDC27	0	1	Substitution - Missense(1)	NS(1)	c.T518C						.						77.0	77.0	77.0					17																	45234708		2203	4300	6503	SO:0001583	missense	996	exon6			TTCTGTAAAGATG	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.518T>C	17.37:g.45234708A>G	ENSP00000066544:p.Leu173Ser	Somatic	43	0		WXS	Illumina HiSeq	.	76	4	NM_001114091	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	A	15.40	2.822437	0.50739	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.69175	-0.37;-0.34;-0.17;-0.38;0.74	5.39	5.39	0.77823	.	0.250879	0.32328	N	0.006250	T	0.52980	0.1768	L	0.29908	0.895	0.50313	D	0.99986	P;B;B;B	0.38250	0.624;0.119;0.057;0.072	B;B;B;B	0.34590	0.186;0.143;0.083;0.062	T	0.54241	-0.8323	10	0.33141	T	0.24	-12.8267	13.3763	0.60741	1.0:0.0:0.0:0.0	.	112;173;173;173	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	S	173;173;112;173;173	ENSP00000066544:L173S;ENSP00000434614:L173S;ENSP00000392802:L112S;ENSP00000437339:L173S;ENSP00000432105:L173S	ENSP00000066544:L173S	L	-	2	0	CDC27	42589707	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.315000	0.89983	2.053000	0.61076	0.528000	0.53228	TTA	.		0.383	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
PPP1R3A	5506	hgsc.bcm.edu	37	7	113518127	113518127	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr7:113518127G>T	ENST00000284601.3	-	4	3088	c.3020C>A	c.(3019-3021)tCt>tAt	p.S1007Y		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	1007					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						TGGCCCTAGAGATTTTTCCAC	0.378																																					p.S1007Y		.											.	.	.	0			c.C3020A						.						125.0	123.0	124.0					7																	113518127		2203	4298	6501	SO:0001583	missense	5506	exon4			CCTAGAGATTTTT	AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.3020C>A	7.37:g.113518127G>T	ENSP00000284601:p.Ser1007Tyr	Somatic	23	0		WXS	Illumina HiSeq	.	59	4	NM_002711	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	ENST00000284601.3	37	CCDS5759.1	.	.	.	.	.	.	.	.	.	.	G	10.24	1.294684	0.23564	.	.	ENSG00000154415	ENST00000284601	T	0.23348	1.91	5.71	2.89	0.33648	.	0.417563	0.23180	N	0.051040	T	0.39279	0.1072	M	0.66939	2.045	0.09310	N	1	D	0.61080	0.989	P	0.57283	0.817	T	0.19451	-1.0305	10	0.87932	D	0	-2.7386	8.1705	0.31252	0.1328:0.2444:0.6228:0.0	.	1007	Q16821	PPR3A_HUMAN	Y	1007	ENSP00000284601:S1007Y	ENSP00000284601:S1007Y	S	-	2	0	PPP1R3A	113305363	0.561000	0.26578	0.014000	0.15608	0.397000	0.30659	1.764000	0.38471	0.319000	0.23209	0.650000	0.86243	TCT	.		0.378	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711	
AHNAK	79026	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	62289154	62289154	+	Missense_Mutation	SNP	G	G	C			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr11:62289154G>C	ENST00000378024.4	-	5	13009	c.12735C>G	c.(12733-12735)ttC>ttG	p.F4245L	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	4245					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				CAGGCATCTTGAATTTAGGGC	0.488																																					p.F4245L		.											.	.	.	0			c.C12735G						.						210.0	219.0	216.0					11																	62289154		2202	4299	6501	SO:0001583	missense	79026	exon5			CATCTTGAATTTA	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.12735C>G	11.37:g.62289154G>C	ENSP00000367263:p.Phe4245Leu	Somatic	104	0		WXS	Illumina HiSeq	.	136	56	NM_001620	A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	g	9.682	1.149460	0.21288	.	.	ENSG00000124942	ENST00000378024	T	0.11821	2.74	4.88	-0.47	0.12131	.	0.000000	0.42964	D	0.000639	T	0.26919	0.0659	M	0.77313	2.365	0.37360	D	0.911171	D	0.76494	0.999	D	0.71184	0.972	T	0.46596	-0.9180	10	0.07482	T	0.82	.	9.5772	0.39465	0.4355:0.0:0.5645:0.0	.	4245	Q09666	AHNK_HUMAN	L	4245	ENSP00000367263:F4245L	ENSP00000367263:F4245L	F	-	3	2	AHNAK	62045730	0.354000	0.24912	0.991000	0.47740	0.000000	0.00434	-2.739000	0.00800	-0.091000	0.12440	-1.049000	0.02347	TTC	.		0.488	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
PAX4	5078	hgsc.bcm.edu	37	7	127253566	127253566	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr7:127253566G>T	ENST00000341640.2	-	5	764	c.559C>A	c.(559-561)Cct>Act	p.P187T	PAX4_ENST00000463946.1_Missense_Mutation_p.P185T|PAX4_ENST00000338516.3_Missense_Mutation_p.P195T|PAX4_ENST00000378740.2_Missense_Mutation_p.P187T	NM_006193.2	NP_006184.2	O43316	PAX4_HUMAN	paired box 4	195					cell differentiation (GO:0030154)|circadian rhythm (GO:0007623)|endocrine pancreas development (GO:0031018)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|positive regulation of cell differentiation (GO:0045597)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)	p.P187T(1)		cervix(1)|kidney(2)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						ACTGAATCAGGATACTGCCCA	0.582																																					p.P187T	Ovarian(113;737 1605 7858 27720 34092)	.											PAX4,NS,carcinoma,0,1	PAX4	0	1	Substitution - Missense(1)	lung(1)	c.C559A						.						64.0	65.0	65.0					7																	127253566		2203	4300	6503	SO:0001583	missense	5078	exon5			AATCAGGATACTG		CCDS5797.1	7q32.1	2011-06-20	2007-07-12		ENSG00000106331	ENSG00000106331		"""Paired boxes"", ""Homeoboxes / PRD class"""	8618	protein-coding gene	gene with protein product		167413	"""paired box gene 4"""				Standard	NM_006193		Approved	MODY9	uc010lld.1	O43316	OTTHUMG00000157562	ENST00000341640.2:c.559C>A	7.37:g.127253566G>T	ENSP00000339906:p.Pro187Thr	Somatic	29	0		WXS	Illumina HiSeq	.	46	2	NM_006193	O95161|Q6B0H0	Missense_Mutation	SNP	ENST00000341640.2	37	CCDS5797.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.936995	0.73557	.	.	ENSG00000106331	ENST00000341640;ENST00000338516;ENST00000378740;ENST00000463946	D;D;D	0.98666	-5.06;-5.06;-5.06	4.9	4.9	0.64082	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.144455	0.46145	D	0.000314	D	0.99369	0.9778	H	0.94423	3.535	0.50467	D	0.999874	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;0.999;1.0;0.999	D	0.98595	1.0656	10	0.87932	D	0	.	16.3858	0.83504	0.0:0.0:1.0:0.0	.	187;185;195;185	O43316-4;Q1W386;O43316;G3V4Q1	.;.;PAX4_HUMAN;.	T	187;195;195;185	ENSP00000339906:P187T;ENSP00000344297:P195T;ENSP00000451923:P185T	ENSP00000344297:P195T	P	-	1	0	PAX4	127040802	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.893000	0.56243	2.661000	0.90470	0.650000	0.86243	CCT	.		0.582	PAX4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349165.1		
UNC5D	137970	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	35579781	35579781	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr8:35579781G>A	ENST00000404895.2	+	9	1499	c.1171G>A	c.(1171-1173)Gtg>Atg	p.V391M	UNC5D_ENST00000453357.2_Missense_Mutation_p.V386M|UNC5D_ENST00000420357.1_Missense_Mutation_p.V324M|UNC5D_ENST00000287272.2_Missense_Mutation_p.V335M|UNC5D_ENST00000449677.1_5'Flank|UNC5D_ENST00000416672.1_Missense_Mutation_p.V396M	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	391					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		TGCTGCCGTCGTGGCCGTTGC	0.522																																					p.V391M		.											.	.	.	0			c.G1171A						.						266.0	234.0	245.0					8																	35579781		2203	4300	6503	SO:0001583	missense	137970	exon9			GCCGTCGTGGCCG	AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.1171G>A	8.37:g.35579781G>A	ENSP00000385143:p.Val391Met	Somatic	32	0		WXS	Illumina HiSeq	.	47	5	NM_080872	Q8WYP7	Missense_Mutation	SNP	ENST00000404895.2	37	CCDS6093.2	.	.	.	.	.	.	.	.	.	.	G	16.46	3.129393	0.56721	.	.	ENSG00000156687	ENST00000404895;ENST00000420357;ENST00000287272;ENST00000416672;ENST00000453357	T;T;T;T;T	0.60040	0.25;0.86;0.66;0.29;0.22	5.71	4.72	0.59763	.	0.154756	0.56097	D	0.000026	T	0.44603	0.1301	N	0.17764	0.52	0.80722	D	1	D;D;D	0.56521	0.968;0.976;0.96	P;P;P	0.49421	0.565;0.61;0.483	T	0.47837	-0.9086	10	0.72032	D	0.01	-17.1098	3.9909	0.09537	0.3204:0.0:0.6796:0.0	.	396;386;391	C9J2B6;Q6UXZ4-2;Q6UXZ4	.;.;UNC5D_HUMAN	M	391;324;335;396;386	ENSP00000385143:V391M;ENSP00000392739:V324M;ENSP00000287272:V335M;ENSP00000412652:V396M;ENSP00000394303:V386M	ENSP00000287272:V335M	V	+	1	0	UNC5D	35699323	0.956000	0.32656	0.931000	0.37212	0.583000	0.36354	1.871000	0.39539	2.694000	0.91930	0.650000	0.86243	GTG	.		0.522	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347586.2		
SLC37A1	54020	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	43959624	43959624	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr21:43959624G>T	ENST00000352133.2	+	6	1335	c.353G>T	c.(352-354)gGc>gTc	p.G118V	SLC37A1_ENST00000398341.3_Missense_Mutation_p.G118V			P57057	GLPT_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 1	118					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	transporter activity (GO:0005215)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(3)	15						CACCTCAGTGGCATCATTGGG	0.512																																					p.G118V		.											.	.	.	0			c.G353T						.						104.0	96.0	99.0					21																	43959624		2203	4300	6503	SO:0001583	missense	54020	exon7			TCAGTGGCATCAT	AJ269529	CCDS13689.1	21q22.3	2013-07-17	2013-07-17		ENSG00000160190	ENSG00000160190		"""Solute carriers"""	11024	protein-coding gene	gene with protein product		608094	"""solute carrier family 37 (glycerol-3-phosphate transporter), member 1"""			11112347	Standard	NM_018964		Approved		uc002zbi.3	P57057	OTTHUMG00000086803	ENST00000352133.2:c.353G>T	21.37:g.43959624G>T	ENSP00000344648:p.Gly118Val	Somatic	48	0		WXS	Illumina HiSeq	.	38	4	NM_018964	D3DSJ7|Q9HAQ1	Missense_Mutation	SNP	ENST00000352133.2	37	CCDS13689.1	.	.	.	.	.	.	.	.	.	.	G	16.43	3.121479	0.56613	.	.	ENSG00000160190	ENST00000398341;ENST00000352133	T;T	0.73258	-0.73;-0.73	4.8	4.8	0.61643	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.88570	0.6472	H	0.94542	3.55	0.80722	D	1	D	0.63046	0.992	D	0.72338	0.977	D	0.92156	0.5732	10	0.87932	D	0	-7.2059	17.8856	0.88852	0.0:0.0:1.0:0.0	.	118	P57057	GLPT_HUMAN	V	118	ENSP00000381383:G118V;ENSP00000344648:G118V	ENSP00000344648:G118V	G	+	2	0	SLC37A1	42832693	1.000000	0.71417	0.987000	0.45799	0.029000	0.11900	9.507000	0.97996	2.223000	0.72356	0.555000	0.69702	GGC	.		0.512	SLC37A1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195377.1		
HLA-DOA	3111	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	32975954	32975954	+	Missense_Mutation	SNP	T	T	A			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr6:32975954T>A	ENST00000229829.5	-	2	242	c.167A>T	c.(166-168)cAg>cTg	p.Q56L	HLA-DOA_ENST00000495532.1_5'Flank|HLA-DOA_ENST00000450833.2_Missense_Mutation_p.Q26L	NM_002119.3	NP_002110.1	P06340	DOA_HUMAN	major histocompatibility complex, class II, DO alpha	56	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|immune response (GO:0006955)|negative regulation of antigen processing and presentation of peptide antigen via MHC class II (GO:0002587)|regulation of T cell differentiation (GO:0045580)|signal transduction (GO:0007165)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)	MHC class II protein complex binding (GO:0023026)|MHC class II receptor activity (GO:0032395)			NS(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(1)	9						AGAGAACAGCTGTTCCTCATC	0.597																																					p.Q56L		.											.	.	.	0			c.A167T						.						58.0	48.0	52.0					6																	32975954		1511	2709	4220	SO:0001583	missense	3111	exon2			AACAGCTGTTCCT	M31525	CCDS4763.1	6p21.3	2013-01-11		2001-10-05	ENSG00000204252	ENSG00000204252		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4936	protein-coding gene	gene with protein product		142930		HLA-DZA, HLA-DNA		2370084	Standard	XM_005272804		Approved	HLA-D0-alpha	uc003ocr.3	P06340	OTTHUMG00000031211	ENST00000229829.5:c.167A>T	6.37:g.32975954T>A	ENSP00000229829:p.Gln56Leu	Somatic	32	0		WXS	Illumina HiSeq	.	61	21	NM_002119	Q58HU0|Q58HU1|Q5STC7|Q9TQC6|Q9TQC7|Q9TQC8|Q9TQC9|Q9TQD0|Q9TQD1|Q9TQD2|Q9TQD3	Missense_Mutation	SNP	ENST00000229829.5	37	CCDS4763.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.8|24.8	4.566240|4.566240	0.86439|0.86439	.|.	.|.	ENSG00000204252|ENSG00000204252	ENST00000229829;ENST00000450833|ENST00000432150	T;T|.	0.00760|.	5.73;5.73|.	4.49|4.49	4.49|4.49	0.54785|0.54785	MHC class II, alpha/beta chain, N-terminal (1);MHC classes I/II-like antigen recognition protein (1);MHC class II, alpha chain, N-terminal (2);|.	0.135690|.	0.47852|.	D|.	0.000207|.	T|T	0.47078|0.47078	0.1426|0.1426	L|L	0.60455|0.60455	1.87|1.87	0.32763|0.32763	N|N	0.50482|0.50482	D;D|.	0.61697|.	0.99;0.979|.	P;P|.	0.60173|.	0.87;0.87|.	T|T	0.54873|0.54873	-0.8228|-0.8228	10|6	0.87932|0.87932	D|D	0|0	.|.	10.4022|10.4022	0.44235|0.44235	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	26;56|.	B4DW77;P06340|.	.;DOA_HUMAN|.	L|C	56;26|56	ENSP00000229829:Q56L;ENSP00000403896:Q26L|.	ENSP00000229829:Q56L|ENSP00000412819:S56C	Q|S	-|-	2|1	0|0	HLA-DOA|HLA-DOA	33083932|33083932	0.951000|0.951000	0.32395|0.32395	0.988000|0.988000	0.46212|0.46212	0.996000|0.996000	0.88848|0.88848	1.365000|1.365000	0.34182|0.34182	2.017000|2.017000	0.59298|0.59298	0.454000|0.454000	0.30748|0.30748	CAG|AGC	.		0.597	HLA-DOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076426.2	NM_002119	
HTT	3064	hgsc.bcm.edu	37	4	3076659	3076659	+	Missense_Mutation	SNP	A	A	C			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr4:3076659A>C	ENST00000355072.5	+	1	252	c.107A>C	c.(106-108)cAg>cCg	p.Q36P	HTT-AS_ENST00000503893.1_RNA	NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	36	Poly-Gln.				anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		cagcagcagcagcaacagccg	0.706																																					p.Q36P		.											.	.	.	0			c.A107C						.						1.0	2.0	2.0					4																	3076659		405	1354	1759	SO:0001583	missense	3064	exon1			AGCAGCAGCAACA	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.107A>C	4.37:g.3076659A>C	ENSP00000347184:p.Gln36Pro	Somatic	7	0		WXS	Illumina HiSeq	.	16	4	NM_002111	Q9UQB7	Missense_Mutation	SNP	ENST00000355072.5	37	CCDS43206.1	.	.	.	.	.	.	.	.	.	.	-	0.013	-1.614452	0.00835	.	.	ENSG00000197386	ENST00000355072	T	0.20738	2.05	0.538	-0.648	0.11464	.	.	.	.	.	T	0.08714	0.0216	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33879	-0.9851	8	0.30078	T	0.28	.	.	.	.	.	36	P42858	HD_HUMAN	P	36	ENSP00000347184:Q36P	ENSP00000347184:Q36P	Q	+	2	0	HTT	3046457	0.992000	0.36948	0.001000	0.08648	0.032000	0.12392	0.173000	0.16724	-0.308000	0.08792	0.138000	0.15974	CAG	.		0.706	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
CUBN	8029	hgsc.bcm.edu	37	10	16990489	16990489	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr10:16990489C>T	ENST00000377833.4	-	35	5262	c.5197G>A	c.(5197-5199)Gca>Aca	p.A1733T		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	1733	CUB 11. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GACACTGATGCGGTGACCGTG	0.517																																					p.A1733T		.											CUBN,NS,carcinoma,0,1	CUBN	0	0			c.G5197A						.						77.0	66.0	70.0					10																	16990489		2203	4300	6503	SO:0001583	missense	8029	exon35			CTGATGCGGTGAC	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.5197G>A	10.37:g.16990489C>T	ENSP00000367064:p.Ala1733Thr	Somatic	56	0		WXS	Illumina HiSeq	.	64	3	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.206767	0.79127	.	.	ENSG00000107611	ENST00000377833	T	0.37411	1.2	5.55	5.55	0.83447	CUB (4);	0.362765	0.20187	N	0.097399	T	0.40398	0.1115	L	0.53617	1.68	0.80722	D	1	D	0.58620	0.983	B	0.43478	0.421	T	0.22800	-1.0206	10	0.34782	T	0.22	.	19.5027	0.95103	0.0:1.0:0.0:0.0	.	1733	O60494	CUBN_HUMAN	T	1733	ENSP00000367064:A1733T	ENSP00000367064:A1733T	A	-	1	0	CUBN	17030495	1.000000	0.71417	0.120000	0.21714	0.002000	0.02628	4.698000	0.61789	2.601000	0.87937	0.655000	0.94253	GCA	.		0.517	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
LHFPL3	375612	hgsc.bcm.edu	37	7	104440319	104440319	+	Intron	SNP	C	C	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr7:104440319C>T	ENST00000401970.2	+	3	762				LHFPL3_ENST00000424859.1_Intron|LHFPL3-AS1_ENST00000434579.2_RNA|LHFPL3_ENST00000535008.1_Intron|LHFPL3_ENST00000543266.1_Intron|LHFPL3-AS1_ENST00000417290.2_RNA|LHFPL3-AS1_ENST00000416376.2_RNA|LHFPL3-AS1_ENST00000411448.1_RNA|LHFPL3-AS1_ENST00000449764.1_RNA			Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 3							integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(6)	9						GCAGCCACTGCCCAAGCACGC	0.498																																					.		.											.	.	.	0			.						.																																			SO:0001627	intron_variant	645591	.			CCACTGCCCAAGC	AY260763		7q22.2	2006-06-13			ENSG00000187416	ENSG00000187416			6589	protein-coding gene	gene with protein product		609719	"""lipoma HMGIC fusion partner-like 4"""	LHFPL4		10329012	Standard	NM_199000		Approved		uc003vce.3	Q86UP9	OTTHUMG00000157273	ENST00000401970.2:c.641-45510C>T	7.37:g.104440319C>T		Somatic	33	0		WXS	Illumina HiSeq	.	55	4	.	A1L383|A4D0Q5	RNA	SNP	ENST00000401970.2	37																																																																																				.		0.498	LHFPL3-002	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000348284.1	NM_199000	
CXADRP3	440224	hgsc.bcm.edu;bcgsc.ca	37	18	14478921	14478921	+	lincRNA	SNP	C	C	A			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr18:14478921C>A	ENST00000581457.1	-	0	987					NR_024076.1				coxsackie virus and adenovirus receptor pseudogene 3																		TGATCTGTGCCAATATCTGAC	0.373																																					.		.											.	.	.	0			.						.																																					440224	.			CTGTGCCAATATC			18p11.21	2013-09-19			ENSG00000265766	ENSG00000265766			33974	pseudogene	pseudogene							Standard	NR_024076		Approved		uc010xai.2		OTTHUMG00000178700		18.37:g.14478921C>A		Somatic	42	0		WXS	Illumina HiSeq	.	88	4	.		RNA	SNP	ENST00000581457.1	37																																																																																				.		0.373	CXADRP3-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000443008.1	NR_024076	
NXPE3	91775	hgsc.bcm.edu	37	3	101535686	101535686	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr3:101535686G>T	ENST00000491511.2	+	7	1926	c.970G>T	c.(970-972)Ggg>Tgg	p.G324W	NXPE3_ENST00000273347.5_Missense_Mutation_p.G324W|NXPE3_ENST00000422132.1_Missense_Mutation_p.G324W|NXPE3_ENST00000477909.1_Missense_Mutation_p.G324W	NM_001134456.1	NP_001127928.1	Q969Y0	NXPE3_HUMAN	neurexophilin and PC-esterase domain family, member 3	324						extracellular region (GO:0005576)											TTTTCCTTCTGGGTATTATTA	0.358																																					p.G324W		.											.	.	.	0			c.G970T						.						73.0	76.0	75.0					3																	101535686		2203	4300	6503	SO:0001583	missense	91775	exon7			CCTTCTGGGTATT	AK054664	CCDS2945.1	3q12.3	2012-06-14	2012-06-11	2012-06-11	ENSG00000144815	ENSG00000144815			28238	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member C"""	FAM55C		12975309	Standard	NM_001134456		Approved	MGC15606	uc003dvn.3	Q969Y0	OTTHUMG00000159179	ENST00000491511.2:c.970G>T	3.37:g.101535686G>T	ENSP00000417485:p.Gly324Trp	Somatic	57	0		WXS	Illumina HiSeq	.	92	4	NM_145037	A8K0X4|D3DN53|Q7Z2S8	Missense_Mutation	SNP	ENST00000491511.2	37	CCDS2945.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.007193	0.93287	.	.	ENSG00000144815	ENST00000273347;ENST00000491511;ENST00000477909;ENST00000422132	T;T;T;T	0.47177	0.85;0.85;0.85;0.85	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.77301	0.4110	M	0.92026	3.265	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.80892	-0.1179	10	0.87932	D	0	-15.5128	20.5632	0.99335	0.0:0.0:1.0:0.0	.	324	Q969Y0	FA55C_HUMAN	W	324	ENSP00000273347:G324W;ENSP00000417485:G324W;ENSP00000418369:G324W;ENSP00000396421:G324W	ENSP00000273347:G324W	G	+	1	0	FAM55C	103018376	1.000000	0.71417	0.999000	0.59377	0.952000	0.60782	9.772000	0.98984	2.937000	0.99478	0.650000	0.86243	GGG	.		0.358	NXPE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353711.2	NM_145037	
PPM1J	333926	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	113253388	113253388	+	Missense_Mutation	SNP	G	G	C			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr1:113253388G>C	ENST00000309276.6	-	8	1371	c.1196C>G	c.(1195-1197)cCc>cGc	p.P399R	RP11-426L16.10_ENST00000606505.1_Silent_p.A80A|RP11-426L16.10_ENST00000471038.2_5'UTR|PPM1J_ENST00000464951.1_Missense_Mutation_p.P193R|PPM1J_ENST00000359994.4_Missense_Mutation_p.P193R	NM_005167.5	NP_005158.5	Q5JR12	PPM1J_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1J	399	PP2C-like.				protein dephosphorylation (GO:0006470)		protein serine/threonine phosphatase activity (GO:0004722)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	14	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GGAGAGAAAGGGCTTGATGGG	0.567																																					p.P399R		.											.	.	.	0			c.C1196G						.						117.0	113.0	114.0					1																	113253388		2203	4300	6503	SO:0001583	missense	333926	exon8			AGAAAGGGCTTGA	AK093270	CCDS855.2	1p13.1	2012-04-17	2010-03-05		ENSG00000155367	ENSG00000155367	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	20785	protein-coding gene	gene with protein product	"""protein phosphatase 2C zeta"""	609957	"""protein phosphatase 1J (PP2C domain containing)"""			12633878	Standard	NM_005167		Approved	FLJ35951, MGC19531, DKFZp434P1514, PP2Czeta, PPP2CZ	uc001ect.1	Q5JR12	OTTHUMG00000012019	ENST00000309276.6:c.1196C>G	1.37:g.113253388G>C	ENSP00000308926:p.Pro399Arg	Somatic	37	0		WXS	Illumina HiSeq	.	96	7	NM_005167	B3KSB7|Q6DKJ7|Q96EZ7|Q9UF84	Missense_Mutation	SNP	ENST00000309276.6	37	CCDS855.2	.	.	.	.	.	.	.	.	.	.	G	19.60	3.858801	0.71834	.	.	ENSG00000155367	ENST00000309276;ENST00000359994	T;T	0.11277	2.79;2.79	5.17	5.17	0.71159	Protein phosphatase 2C-like (5);	0.053622	0.85682	D	0.000000	T	0.27697	0.0681	M	0.76170	2.325	0.80722	D	1	D;D	0.89917	0.994;1.0	D;D	0.97110	0.913;1.0	T	0.03807	-1.1002	10	0.87932	D	0	-6.2262	18.3021	0.90167	0.0:0.0:1.0:0.0	.	399;193	Q5JR12;Q5JR12-2	PPM1J_HUMAN;.	R	399;193	ENSP00000308926:P399R;ENSP00000353088:P193R	ENSP00000308926:P399R	P	-	2	0	PPM1J	113054911	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	9.763000	0.98947	2.432000	0.82394	0.485000	0.47835	CCC	.		0.567	PPM1J-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033251.1	NM_005167	
CHD7	55636	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	61654449	61654449	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr8:61654449C>A	ENST00000423902.2	+	2	937	c.458C>A	c.(457-459)cCa>cAa	p.P153Q	CHD7_ENST00000524602.1_Missense_Mutation_p.P153Q|CHD7_ENST00000525508.1_Missense_Mutation_p.P153Q	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	153	Gln-rich.				adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			GTTCAGGTACCAGACCAGATA	0.657																																					p.P153Q		.											.	.	.	0			c.C458A						.						26.0	32.0	30.0					8																	61654449		2069	4236	6305	SO:0001583	missense	55636	exon2			AGGTACCAGACCA	AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.458C>A	8.37:g.61654449C>A	ENSP00000392028:p.Pro153Gln	Somatic	23	0		WXS	Illumina HiSeq	.	31	10	NM_017780	D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	SNP	ENST00000423902.2	37	CCDS47865.1	.	.	.	.	.	.	.	.	.	.	C	13.38	2.220840	0.39201	.	.	ENSG00000171316	ENST00000307121;ENST00000423902;ENST00000524602;ENST00000525508	D;T;T	0.81659	-1.52;1.85;-1.15	5.24	4.36	0.52297	.	0.000000	0.40302	N	0.001132	T	0.78304	0.4262	L	0.43152	1.355	0.49299	D	0.999775	D	0.55385	0.971	P	0.47299	0.543	T	0.80379	-0.1407	10	0.72032	D	0.01	-8.5422	13.5328	0.61631	0.0:0.9246:0.0:0.0754	.	153	Q9P2D1	CHD7_HUMAN	Q	153	ENSP00000392028:P153Q;ENSP00000437061:P153Q;ENSP00000436027:P153Q	ENSP00000307304:P153Q	P	+	2	0	CHD7	61817003	1.000000	0.71417	0.986000	0.45419	0.997000	0.91878	6.491000	0.73649	1.220000	0.43490	0.655000	0.94253	CCA	.		0.657	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2	XM_098762	
SLC25A26	115286	hgsc.bcm.edu	37	3	66293723	66293723	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr3:66293723C>A	ENST00000413054.1	+	1	97	c.23C>A	c.(22-24)tCt>tAt	p.S8Y	SLC25A26_ENST00000336733.6_Missense_Mutation_p.S8Y|SLC25A26_ENST00000354883.6_Missense_Mutation_p.S96Y|SLC25A26_ENST00000536651.1_3'UTR			Q70HW3	SAMC_HUMAN	solute carrier family 25 (S-adenosylmethionine carrier), member 26	96					S-adenosyl-L-methionine transmembrane transport (GO:1901962)|S-adenosyl-L-methionine transport (GO:0015805)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	S-adenosyl-L-methionine transmembrane transporter activity (GO:0000095)	p.S96F(1)		endometrium(1)|large_intestine(1)|lung(2)|pancreas(1)|stomach(2)|urinary_tract(1)	8		Lung NSC(201;0.00774)		BRCA - Breast invasive adenocarcinoma(55;0.00046)|KIRC - Kidney renal clear cell carcinoma(15;0.0515)|Kidney(15;0.0648)		TTGGCTGCCTCTGCTGGAGAA	0.318																																					p.S96Y		.											SLC25A26,bladder,carcinoma,0,1	SLC25A26	0	1	Substitution - Missense(1)	urinary_tract(1)	c.C287A						.						130.0	131.0	131.0					3																	66293723		2203	4300	6503	SO:0001583	missense	115286	exon4			CTGCCTCTGCTGG	AJ580932	CCDS54604.1, CCDS2905.2	3p14.2	2013-05-22	2012-03-29		ENSG00000144741	ENSG00000144741		"""Solute carriers"""	20661	protein-coding gene	gene with protein product		611037	"""solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 26"""			14674884	Standard	NM_173471		Approved		uc011bfq.2	Q70HW3	OTTHUMG00000149917	ENST00000413054.1:c.23C>A	3.37:g.66293723C>A	ENSP00000415304:p.Ser8Tyr	Somatic	19	0		WXS	Illumina HiSeq	.	27	2	NM_173471	A8K758|B3KRZ7|Q7Z786|Q96E68	Missense_Mutation	SNP	ENST00000413054.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.3|23.3	4.405184|4.405184	0.83230|0.83230	.|.	.|.	ENSG00000144741|ENSG00000144741	ENST00000413054|ENST00000354883;ENST00000336733	.|T;T	.|0.80033	.|-1.33;-1.33	5.8|5.8	5.8|5.8	0.92144|0.92144	.|Mitochondrial carrier domain (2);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.92747|0.92747	0.7694|0.7694	H|H	0.95679|0.95679	3.705|3.705	0.80722|0.80722	D|D	1|1	.|D;D	.|0.58970	.|0.984;0.978	.|P;D	.|0.63033	.|0.88;0.91	D|D	0.93989|0.93989	0.7265|0.7265	5|10	.|0.66056	.|D	.|0.02	-18.1295|-18.1295	20.051|20.051	0.97627|0.97627	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|96;96	.|F8WAB8;Q70HW3	.|.;SAMC_HUMAN	M|Y	33|96;8	.|ENSP00000346955:S96Y;ENSP00000336801:S8Y	.|ENSP00000336801:S8Y	L|S	+|+	1|2	2|0	SLC25A26|SLC25A26	66376414|66376414	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.920000|0.920000	0.55202|0.55202	5.949000|5.949000	0.70257|0.70257	2.740000|2.740000	0.93945|0.93945	0.650000|0.650000	0.86243|0.86243	CTG|TCT	.		0.318	SLC25A26-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000313895.2	NM_173471	
REV3L	5980	hgsc.bcm.edu;bcgsc.ca	37	6	111697468	111697468	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr6:111697468G>T	ENST00000358835.3	-	14	2544	c.2090C>A	c.(2089-2091)cCt>cAt	p.P697H	REV3L_ENST00000368802.3_Missense_Mutation_p.P697H|REV3L_ENST00000435970.1_Missense_Mutation_p.P619H|REV3L_ENST00000368805.1_Missense_Mutation_p.P697H			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	697					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		ATTCTCGTTAGGGTGACGGTG	0.323								DNA polymerases (catalytic subunits)																													p.P697H		.											.	.	.	0			c.C2090A						.						61.0	66.0	64.0					6																	111697468		2203	4298	6501	SO:0001583	missense	5980	exon13			TCGTTAGGGTGAC	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.2090C>A	6.37:g.111697468G>T	ENSP00000351697:p.Pro697His	Somatic	37	0		WXS	Illumina HiSeq	.	73	4	NM_002912	O43214|Q5TC33	Missense_Mutation	SNP	ENST00000358835.3	37	CCDS5091.2	.	.	.	.	.	.	.	.	.	.	G	6.903	0.536152	0.13188	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970	T;T;T;T	0.01430	4.99;4.99;4.99;4.9	5.53	0.926	0.19430	Ribonuclease H-like (1);	0.683335	0.14403	N	0.321750	T	0.00271	0.0008	N	0.08118	0	0.09310	N	0.999997	B	0.20988	0.05	B	0.22386	0.039	T	0.44907	-0.9297	10	0.34782	T	0.22	-17.4562	0.2981	0.00269	0.3413:0.2155:0.2532:0.19	.	697	O60673	DPOLZ_HUMAN	H	697;697;697;619	ENSP00000357792:P697H;ENSP00000357795:P697H;ENSP00000351697:P697H;ENSP00000402003:P619H	ENSP00000351697:P697H	P	-	2	0	REV3L	111804161	0.975000	0.34042	0.447000	0.26932	0.876000	0.50452	1.168000	0.31859	0.244000	0.21351	0.563000	0.77884	CCT	.		0.323	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912	
NCAM1	4684	hgsc.bcm.edu	37	11	113105856	113105856	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr11:113105856G>A	ENST00000533760.1	+	13	2010	c.1411G>A	c.(1411-1413)Gcg>Acg	p.A471T	NCAM1_ENST00000397957.4_3'UTR|NCAM1_ENST00000401611.2_Missense_Mutation_p.A598T|NCAM1_ENST00000316851.7_Missense_Mutation_p.A589T	NM_001242608.1	NP_001229537.1	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1	599	Ig-like C2-type 5.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		TGAGATCAGCGCGGCCTCCGA	0.627																																					p.A625T		.											NCAM1_ENST00000433634,colon,carcinoma,0,4	NCAM1_ENST00000433634	0	0			c.G1873A						.						29.0	33.0	31.0					11																	113105856		2019	4154	6173	SO:0001583	missense	4684	exon16			ATCAGCGCGGCCT		CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000533760.1:c.1411G>A	11.37:g.113105856G>A	ENSP00000473281:p.Ala471Thr	Somatic	41	0		WXS	Illumina HiSeq	.	45	2	NM_001242607	A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	Missense_Mutation	SNP	ENST00000533760.1	37		.	.	.	.	.	.	.	.	.	.	G	10.20	1.283918	0.23392	.	.	ENSG00000149294	ENST00000531044;ENST00000401611;ENST00000316851;ENST00000433634	T;T	0.54479	1.05;0.57	5.84	0.714	0.18180	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.397140	0.24141	N	0.041176	T	0.23649	0.0572	.	.	.	0.21950	N	0.999452	P;P;B;B	0.38473	0.577;0.633;0.282;0.427	B;B;B;B	0.29176	0.077;0.072;0.033;0.099	T	0.12941	-1.0528	9	0.19590	T	0.45	-48.1	2.5037	0.04639	0.4333:0.1226:0.3306:0.1136	.	599;589;599;589	P13591-5;P13591-1;P13591;P13591-3	.;.;NCAM1_HUMAN;.	T	471;598;589;33	ENSP00000384055:A598T;ENSP00000318472:A589T	ENSP00000318472:A589T	A	+	1	0	NCAM1	112611066	0.000000	0.05858	0.137000	0.22149	0.878000	0.50629	-0.176000	0.09811	-0.108000	0.12066	-0.218000	0.12543	GCG	.		0.627	NCAM1-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000394068.2	NM_000615	
INTS12	57117	hgsc.bcm.edu	37	4	106614585	106614585	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr4:106614585G>T	ENST00000451321.2	-	4	847	c.368C>A	c.(367-369)cCa>cAa	p.P123Q	INTS12_ENST00000340139.5_Missense_Mutation_p.P123Q|INTS12_ENST00000394735.1_Missense_Mutation_p.P123Q	NM_001142471.1	NP_001135943.1	Q96CB8	INT12_HUMAN	integrator complex subunit 12	123					snRNA processing (GO:0016180)	integrator complex (GO:0032039)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(123;5.12e-07)		CTGTGTTTCTGGTTTCTCCAA	0.393																																					p.P123Q		.											.	.	.	0			c.C368A						.						242.0	246.0	245.0					4																	106614585		2203	4300	6503	SO:0001583	missense	57117	exon5			GTTTCTGGTTTCT		CCDS3671.1	4q24	2013-01-28	2006-03-15	2006-03-15	ENSG00000138785	ENSG00000138785		"""Zinc fingers, PHD-type"""	25067	protein-coding gene	gene with protein product	"""hypothetical nuclear factor SBBI22"""	611355	"""PHD finger protein 22"""	PHF22		16239144	Standard	NM_020395		Approved	SBBI22, INT12	uc010ilr.3	Q96CB8	OTTHUMG00000131215	ENST00000451321.2:c.368C>A	4.37:g.106614585G>T	ENSP00000415433:p.Pro123Gln	Somatic	61	0		WXS	Illumina HiSeq	.	100	4	NM_020395	B2RC48|Q3B6Z3|Q9HD71	Missense_Mutation	SNP	ENST00000451321.2	37	CCDS3671.1	.	.	.	.	.	.	.	.	.	.	G	11.19	1.566145	0.27915	.	.	ENSG00000138785	ENST00000394735;ENST00000340139;ENST00000451321;ENST00000503746;ENST00000420368	T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02	5.93	5.02	0.67125	.	0.486270	0.24287	N	0.039851	T	0.19287	0.0463	N	0.01576	-0.805	0.28182	N	0.928115	B	0.10296	0.003	B	0.06405	0.002	T	0.03514	-1.1029	10	0.16420	T	0.52	-6.9692	18.0153	0.89238	0.0:0.0:0.8454:0.1546	.	123	Q96CB8	INT12_HUMAN	Q	123	ENSP00000378221:P123Q;ENSP00000340737:P123Q;ENSP00000415433:P123Q;ENSP00000423618:P123Q;ENSP00000412317:P123Q	ENSP00000340737:P123Q	P	-	2	0	INTS12	106834034	1.000000	0.71417	0.961000	0.40146	0.971000	0.66376	1.336000	0.33850	2.814000	0.96858	0.591000	0.81541	CCA	.		0.393	INTS12-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318624.1	NM_020395	
VWF	7450	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	6153555	6153555	+	Missense_Mutation	SNP	G	G	A	rs61748471		TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr12:6153555G>A	ENST00000261405.5	-	18	2598	c.2344C>T	c.(2344-2346)Cgg>Tgg	p.R782W		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	782	Amino-terminal.|TIL 3.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	CCTTCAGCCCGCAGGTTGTCA	0.577																																					p.R782W		.											.	.	.	0			c.C2344T	GRCh37	CM910391	VWF	M	rs61748471	.	G	TRP/ARG	2,4404	4.2+/-10.8	0,2,2201	89.0	74.0	79.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	2344	0.9	0.0	12	dbSNP_129	79	1,8599	1.2+/-3.3	0,1,4299	no	missense	VWF	NM_000552.3	101	0,3,6500	AA,AG,GG		0.0116,0.0454,0.0231	possibly-damaging	782/2814	6153555	3,13003	2203	4300	6503	SO:0001583	missense	7450	exon18			CAGCCCGCAGGTT		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.2344C>T	12.37:g.6153555G>A	ENSP00000261405:p.Arg782Trp	Somatic	46	0		WXS	Illumina HiSeq	.	93	32	NM_000552	Q8TCE8|Q99806	Missense_Mutation	SNP	ENST00000261405.5	37	CCDS8539.1	.	.	.	.	.	.	.	.	.	.	G	13.47	2.246859	0.39697	4.54E-4	1.16E-4	ENSG00000110799	ENST00000261405	T	0.79141	-1.24	4.19	0.939	0.19506	Protease inhibitor I8, cysteine-rich trypsin inhibitor-like (1);	0.743551	0.10988	N	0.611961	D	0.84215	0.5423	M	0.74881	2.28	0.09310	N	0.999999	D	0.69078	0.997	P	0.57846	0.828	T	0.74309	-0.3707	10	0.45353	T	0.12	.	12.9082	0.58164	0.0:0.0:0.394:0.6059	rs61748471	782	P04275	VWF_HUMAN	W	782	ENSP00000261405:R782W	ENSP00000261405:R782W	R	-	1	2	VWF	6023816	0.730000	0.28100	0.020000	0.16555	0.477000	0.33069	0.967000	0.29344	-0.021000	0.14009	0.563000	0.77884	CGG	0.000		0.577	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552	
PRSS23	11098	hgsc.bcm.edu	37	11	86568090	86568090	+	Intron	SNP	A	A	G			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr11:86568090A>G	ENST00000533902.2	+	2	348							O95084	PRS23_HUMAN	protease, serine, 23							extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(9)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	18		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				CTCACACAAGAGAAAGGATGG	0.428																																					.		.											.	.	.	0			.						.																																			SO:0001627	intron_variant	8587	.			CACAAGAGAAAGG	AF015287	CCDS8278.1	11q14.2	2010-05-12			ENSG00000150687	ENSG00000150687		"""Serine peptidases / Serine peptidases"""	14370	protein-coding gene	gene with protein product							Standard	XM_005273727		Approved	SPUVE, SIG13	uc001pcb.3	O95084		ENST00000533902.2:c.206+33455A>G	11.37:g.86568090A>G		Somatic	16	0		WXS	Illumina HiSeq	.	12	6	.	B2RDJ1|B4E2J3|Q6IBI0	RNA	SNP	ENST00000533902.2	37																																																																																				.		0.428	PRSS23-004	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000393807.2	NM_007173	
MUC4	4585	hgsc.bcm.edu	37	3	195511156	195511156	+	Missense_Mutation	SNP	C	C	G			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr3:195511156C>G	ENST00000463781.3	-	2	7754	c.7295G>C	c.(7294-7296)cGt>cCt	p.R2432P	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.R2432P|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GACAGGAAGACGGGTGGTGTC	0.587																																					p.R2432P		.											MUC4_ENST00000463781,colon,carcinoma,0,1	MUC4_ENST00000463781	0	0			c.G7295C						.						56.0	56.0	56.0					3																	195511156		645	1577	2222	SO:0001583	missense	4585	exon2			GGAAGACGGGTGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.7295G>C	3.37:g.195511156C>G	ENSP00000417498:p.Arg2432Pro	Somatic	100	0		WXS	Illumina HiSeq	.	229	10	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	G	3.770	-0.047854	0.07407	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32272	1.48;1.46	.	.	.	.	.	.	.	.	T	0.14098	0.0341	N	0.19112	0.55	0.09310	N	1	B	0.23249	0.082	B	0.08055	0.003	T	0.25537	-1.0129	7	.	.	.	.	2.1272	0.03741	0.3245:0.3489:0.3265:0.0	.	2432	E7ESK3	.	P	2432	ENSP00000417498:R2432P;ENSP00000420243:R2432P	.	R	-	2	0	MUC4	196995551	.	.	0.076000	0.20297	0.000000	0.00434	.	.	-0.000000	0.14550	0.000000	0.15137	CGT	.		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
LCOR	84458	hgsc.bcm.edu	37	10	98708964	98708964	+	Silent	SNP	C	C	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr10:98708964C>T	ENST00000371097.4	+	6	696	c.150C>T	c.(148-150)aaC>aaT	p.N50N	LCOR_ENST00000356016.3_Silent_p.N50N|LCOR_ENST00000540664.1_Silent_p.N50N|LCOR_ENST00000371103.3_Silent_p.N50N|LCOR_ENST00000498444.1_3'UTR			Q96JN0	LCOR_HUMAN	ligand dependent nuclear receptor corepressor	50					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(1)|large_intestine(3)|lung(1)|ovary(3)|prostate(1)|urinary_tract(1)	13		Colorectal(252;0.162)		Epithelial(162;4.43e-09)|all cancers(201;2.96e-07)		CTACTCAGAACCCTGTGCTCA	0.522																																					p.N50N		.											.	.	.	0			c.C150T						.						163.0	147.0	153.0					10																	98708964		2203	4300	6503	SO:0001819	synonymous_variant	84458	exon6			TCAGAACCCTGTG		CCDS7451.1, CCDS53561.1	10q24	2006-06-28			ENSG00000196233	ENSG00000196233			29503	protein-coding gene	gene with protein product		607698				12535528, 15193453	Standard	NM_001170765		Approved	MLR2, FLJ38026, KIAA1795		Q96JN0	OTTHUMG00000018841	ENST00000371097.4:c.150C>T	10.37:g.98708964C>T		Somatic	53	0		WXS	Illumina HiSeq	.	76	4	NM_001170766	D3DR47|Q5VW16|Q7Z723|Q86T32|Q86T33|Q8N3L6	Silent	SNP	ENST00000371097.4	37	CCDS7451.1																																																																																			.		0.522	LCOR-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049628.2		
OR10G3	26533	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	22038258	22038258	+	Silent	SNP	C	C	A			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr14:22038258C>A	ENST00000303532.1	-	1	617	c.618G>T	c.(616-618)gtG>gtT	p.V206V		NM_001005465.1	NP_001005465.1	Q8NGC4	O10G3_HUMAN	olfactory receptor, family 10, subfamily G, member 3	206						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)	15	all_cancers(95;0.000987)			GBM - Glioblastoma multiforme(265;0.0139)		TGGCAACCACCACCCCAATGT	0.527																																					p.V206V		.											OR10G3,NS,carcinoma,0,1	OR10G3	0	0			c.G618T						.						188.0	181.0	183.0					14																	22038258		2203	4300	6503	SO:0001819	synonymous_variant	26533	exon1			AACCACCACCCCA		CCDS32046.1	14q11.2	2013-09-24			ENSG00000169208	ENSG00000169208		"""GPCR / Class A : Olfactory receptors"""	8171	protein-coding gene	gene with protein product						8188290	Standard	NM_001005465		Approved		uc010tmb.2	Q8NGC4	OTTHUMG00000168886	ENST00000303532.1:c.618G>T	14.37:g.22038258C>A		Somatic	42	0		WXS	Illumina HiSeq	.	50	15	NM_001005465	Q6IET7|Q96R77	Silent	SNP	ENST00000303532.1	37	CCDS32046.1																																																																																			.		0.527	OR10G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401521.1		
FNDC3A	22862	hgsc.bcm.edu;broad.mit.edu	37	13	49688844	49688844	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr13:49688844G>T	ENST00000492622.2	+	4	534	c.229G>T	c.(229-231)Gtg>Ttg	p.V77L	FNDC3A_ENST00000398316.3_Missense_Mutation_p.V21L|FNDC3A_ENST00000541916.1_Missense_Mutation_p.V77L	NM_001079673.1	NP_001073141.1	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A	77	Pro-rich.				fertilization (GO:0009566)|Sertoli cell development (GO:0060009)|single organismal cell-cell adhesion (GO:0016337)|spermatid development (GO:0007286)	acrosomal vesicle (GO:0001669)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|prostate(5)|skin(2)|urinary_tract(1)	41		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)		TCCTATCTATGTGCCTCCTGG	0.368																																					p.V77L		.											.	.	.	0			c.G229T						.						312.0	299.0	303.0					13																	49688844		2203	4300	6503	SO:0001583	missense	22862	exon4			ATCTATGTGCCTC	AB023187	CCDS9413.2, CCDS41886.1	13q14.12	2013-02-11	2005-01-20	2005-01-22	ENSG00000102531	ENSG00000102531		"""Fibronectin type III domain containing"""	20296	protein-coding gene	gene with protein product		615794	"""fibronectin type III domain containing 3"""	FNDC3			Standard	NM_001079673		Approved	bA203I16.5, KIAA0970	uc001vcm.3	Q9Y2H6	OTTHUMG00000016911	ENST00000492622.2:c.229G>T	13.37:g.49688844G>T	ENSP00000417257:p.Val77Leu	Somatic	45	0		WXS	Illumina HiSeq	.	54	4	NM_001079673	B4DYG1|Q5HYC9|Q5JVF8|Q5JVF9|Q6EVH3|Q6EVH4|Q6N020|Q6P9D5|Q6ZME4|Q9H1W1	Missense_Mutation	SNP	ENST00000492622.2	37	CCDS41886.1	.	.	.	.	.	.	.	.	.	.	G	15.19	2.759926	0.49468	.	.	ENSG00000102531	ENST00000492622;ENST00000337156;ENST00000541916;ENST00000398316	T;T;T	0.80994	-1.44;-1.44;1.38	5.05	4.21	0.49690	.	0.371356	0.22147	N	0.063964	T	0.74405	0.3712	L	0.45352	1.415	0.48185	D	0.999605	B;B;B	0.16166	0.016;0.002;0.003	B;B;B	0.18263	0.021;0.011;0.009	T	0.71616	-0.4539	10	0.72032	D	0.01	-2.5122	12.2972	0.54854	0.083:0.0:0.917:0.0	.	21;77;77	Q9Y2H6-2;G5E9X3;Q9Y2H6	.;.;FND3A_HUMAN	L	77;13;77;21	ENSP00000417257:V77L;ENSP00000441831:V77L;ENSP00000381362:V21L	ENSP00000338579:V13L	V	+	1	0	FNDC3A	48586845	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.151000	0.77411	1.152000	0.42452	0.551000	0.68910	GTG	.		0.368	FNDC3A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354845.2	NM_014923	
DNAJC19	131118	hgsc.bcm.edu	37	3	180702477	180702477	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr3:180702477G>T	ENST00000382564.2	-	6	472	c.302C>A	c.(301-303)gCc>gAc	p.A101D	DNAJC19_ENST00000486355.1_3'UTR|DNAJC19_ENST00000491873.1_Missense_Mutation_p.A76D|DNAJC19_ENST00000479269.1_Missense_Mutation_p.A76D	NM_145261.3	NP_660304.1	Q96DA6	TIM14_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 19	101	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				cellular protein metabolic process (GO:0044267)|genitalia development (GO:0048806)|protein folding (GO:0006457)|protein targeting to mitochondrion (GO:0006626)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				large_intestine(2)|lung(1)	3	all_cancers(143;3.12e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-36)|OV - Ovarian serous cystadenocarcinoma(80;1.55e-22)			ATTGATTTTGGCTGCTATATA	0.303																																					p.A101D		.											.	.	.	0			c.C302A						.						51.0	49.0	50.0					3																	180702477		2198	4289	6487	SO:0001583	missense	131118	exon6			ATTTTGGCTGCTA		CCDS33895.1, CCDS54684.1	3q26.33	2014-09-17			ENSG00000205981	ENSG00000205981		"""Heat shock proteins / DNAJ (HSP40)"""	30528	protein-coding gene	gene with protein product		608977				19564938	Standard	NM_145261		Approved	TIMM14, Tim14, Pam18	uc003fkt.3	Q96DA6	OTTHUMG00000158180	ENST00000382564.2:c.302C>A	3.37:g.180702477G>T	ENSP00000372005:p.Ala101Asp	Somatic	24	0		WXS	Illumina HiSeq	.	69	4	NM_145261	B2R4B1|C9JBV1	Missense_Mutation	SNP	ENST00000382564.2	37	CCDS33895.1	.	.	.	.	.	.	.	.	.	.	G	32	5.167213	0.94768	.	.	ENSG00000205981	ENST00000382564;ENST00000491873;ENST00000479269	T;T;T	0.31247	1.5;1.5;1.5	5.97	5.97	0.96955	Heat shock protein DnaJ, N-terminal (5);	0.195142	0.53938	D	0.000048	T	0.51160	0.1658	L	0.56199	1.76	0.80722	D	1	D	0.60575	0.988	D	0.63283	0.913	T	0.46034	-0.9220	10	0.87932	D	0	-1.931	18.6193	0.91316	0.0:0.0:1.0:0.0	.	101	Q96DA6	TIM14_HUMAN	D	101;76;76	ENSP00000372005:A101D;ENSP00000420767:A76D;ENSP00000419191:A76D	ENSP00000372005:A101D	A	-	2	0	DNAJC19	182185171	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.481000	0.81124	2.836000	0.97738	0.655000	0.94253	GCC	.		0.303	DNAJC19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350336.1	NM_145261	
Unknown	0	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	11	5989177	5989177	+	IGR	SNP	G	G	A			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr11:5989177G>A								OR56A3 (19586 upstream) : OR52L1 (17944 downstream)																							AGACACGTTAGTACAGATGCA	0.458																																					p.T183I		.											.	.	.	0			c.C548T						.						107.0	87.0	93.0					11																	5989177		692	1591	2283	SO:0001628	intergenic_variant	390084	exon1			ACGTTAGTACAGA																													11.37:g.5989177G>A		Somatic	51	0		WXS	Illumina HiSeq	.	52	8	NM_001146033		Missense_Mutation	SNP		37																																																																																				.	0	0.458								
CHERP	10523	hgsc.bcm.edu	37	19	16640580	16640580	+	Silent	SNP	T	T	C	rs528619775	byFrequency	TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr19:16640580T>C	ENST00000198939.6	-	8	1077	c.1041A>G	c.(1039-1041)caA>caG	p.Q347Q	CHERP_ENST00000546361.2_Silent_p.Q336Q|CTD-3222D19.2_ENST00000409035.1_Intron					calcium homeostasis endoplasmic reticulum protein									p.Q336Q(2)		endometrium(3)|kidney(2)|large_intestine(4)|lung(9)|ovary(2)|stomach(1)|urinary_tract(3)	24						gctgctgctgttgctgctgct	0.667													T|||	23	0.00459265	0.0129	0.0043	5008	,	,		16097	0.001		0.001	False		,,,				2504	0.001				p.Q336Q		.											CHERP,NS,carcinoma,0,2	CHERP	0	2	Substitution - coding silent(2)	lung(2)	c.A1008G						.						21.0	29.0	26.0					19																	16640580		2193	4293	6486	SO:0001819	synonymous_variant	10523	exon8			CTGCTGTTGCTGC	U94836	CCDS42518.1	19p13.1	2013-01-28				ENSG00000085872		"""G patch domain containing"""	16930	protein-coding gene	gene with protein product						8896557, 10794731	Standard	NM_006387		Approved	ERPROT213-21, DAN16	uc002nei.1	Q8IWX8	OTTHUMG00000169304	ENST00000198939.6:c.1041A>G	19.37:g.16640580T>C		Somatic	40	0		WXS	Illumina HiSeq	.	37	2	NM_006387		Silent	SNP	ENST00000198939.6	37																																																																																				.		0.667	CHERP-003	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000403372.1	NM_006387	
TRPC5	7224	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	111155791	111155791	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chrX:111155791C>A	ENST00000262839.2	-	3	1546	c.628G>T	c.(628-630)Gcc>Tcc	p.A210S		NM_012471.2	NP_036603.1	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel, subfamily C, member 5	210					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			biliary_tract(1)|breast(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(38)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						CTTGATAAGGCAATGAGTGAG	0.547																																					p.A210S		.											.	.	.	0			c.G628T						.						142.0	131.0	135.0					X																	111155791		2203	4300	6503	SO:0001583	missense	7224	exon3			ATAAGGCAATGAG	AF054568	CCDS14561.1	Xq23	2014-06-13			ENSG00000072315	ENSG00000072315		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12337	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 159"""	300334				10493832, 16382100	Standard	NM_012471		Approved	PPP1R159	uc004epl.1	Q9UL62	OTTHUMG00000022212	ENST00000262839.2:c.628G>T	X.37:g.111155791C>A	ENSP00000262839:p.Ala210Ser	Somatic	12	0		WXS	Illumina HiSeq	.	30	18	NM_012471	B2RP53|O75233|Q5JXY8|Q9Y514	Missense_Mutation	SNP	ENST00000262839.2	37	CCDS14561.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.554132	0.86231	.	.	ENSG00000072315	ENST00000262839	T	0.74209	-0.82	5.79	5.79	0.91817	Transient receptor potential II (1);	0.000000	0.85682	D	0.000000	T	0.76891	0.4051	N	0.20530	0.585	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.81914	0.983;0.995	T	0.71866	-0.4463	10	0.13470	T	0.59	-14.4456	19.0181	0.92902	0.0:1.0:0.0:0.0	.	211;210	Q59G51;Q9UL62	.;TRPC5_HUMAN	S	210	ENSP00000262839:A210S	ENSP00000262839:A210S	A	-	1	0	TRPC5	111042447	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.815000	0.86186	2.440000	0.82611	0.529000	0.55759	GCC	.		0.547	TRPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057945.1	NM_012471	
EPHA7	2045	hgsc.bcm.edu	37	6	93953157	93953157	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr6:93953157C>T	ENST00000369303.4	-	17	3168	c.2984G>A	c.(2983-2985)gGc>gAc	p.G995D		NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	995					brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)	p.G995D(1)		NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		CACTTGAATGCCAGTTCCATG	0.408																																					p.G995D		.											EPHA7,caecum,carcinoma,0,1	EPHA7	0	1	Substitution - Missense(1)	large_intestine(1)	c.G2984A						.						261.0	216.0	231.0					6																	93953157		2203	4300	6503	SO:0001583	missense	2045	exon17			TGAATGCCAGTTC	L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.2984G>A	6.37:g.93953157C>T	ENSP00000358309:p.Gly995Asp	Somatic	42	0		WXS	Illumina HiSeq	.	50	3	NM_004440	A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Missense_Mutation	SNP	ENST00000369303.4	37	CCDS5031.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.111595	0.77210	.	.	ENSG00000135333	ENST00000369303	T	0.06449	3.3	5.79	5.79	0.91817	Sterile alpha motif/pointed domain (1);	0.000000	0.85682	D	0.000000	T	0.15782	0.0380	L	0.55743	1.74	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.996;1.0;0.999	T	0.00812	-1.1556	10	0.42905	T	0.14	.	20.0368	0.97565	0.0:1.0:0.0:0.0	.	991;990;995	Q15375-4;Q15375-2;Q15375	.;.;EPHA7_HUMAN	D	995	ENSP00000358309:G995D	ENSP00000358309:G995D	G	-	2	0	EPHA7	94009878	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.954000	0.70298	2.727000	0.93392	0.591000	0.81541	GGC	.		0.408	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041545.1		
CALHM3	119395	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	105238524	105238524	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr10:105238524C>T	ENST00000369783.4	-	1	473	c.266G>A	c.(265-267)aGg>aAg	p.R89K	RP11-225H22.5_ENST00000453753.1_RNA	NM_001129742.1	NP_001123214.1	Q86XJ0	CAHM3_HUMAN	calcium homeostasis modulator 3	89					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)	2						TGGGTCCTTCCTCCGGTGCCC	0.677																																					p.R89K		.											.	.	.	0			c.G266A						.						19.0	23.0	22.0					10																	105238524		692	1591	2283	SO:0001583	missense	119395	exon1			TCCTTCCTCCGGT	BC043367	CCDS44476.1	10q24.33	2008-07-02	2008-07-02	2008-07-02	ENSG00000183128	ENSG00000183128			23458	protein-coding gene	gene with protein product			"""family with sequence similarity 26, member A"""	FAM26A		18585350	Standard	NM_001129742		Approved	bA225H22.7	uc001kxg.4	Q86XJ0	OTTHUMG00000018989	ENST00000369783.4:c.266G>A	10.37:g.105238524C>T	ENSP00000358798:p.Arg89Lys	Somatic	21	0		WXS	Illumina HiSeq	.	27	7	NM_001129742	Q5W090|Q8IXR2	Missense_Mutation	SNP	ENST00000369783.4	37	CCDS44476.1	.	.	.	.	.	.	.	.	.	.	C	7.837	0.721100	0.15372	.	.	ENSG00000183128	ENST00000369783	T	0.17370	2.28	5.65	1.23	0.21249	.	0.563411	0.20253	N	0.096034	T	0.07413	0.0187	N	0.21448	0.665	0.30241	N	0.79495	B	0.02656	0.0	B	0.06405	0.002	T	0.37798	-0.9690	10	0.02654	T	1	-1.3297	4.9336	0.13930	0.0:0.4171:0.3036:0.2792	.	89	Q86XJ0-2	.	K	89	ENSP00000358798:R89K	ENSP00000358798:R89K	R	-	2	0	CALHM3	105228514	0.880000	0.30214	0.997000	0.53966	0.988000	0.76386	0.854000	0.27791	0.741000	0.32674	0.561000	0.74099	AGG	.		0.677	CALHM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050157.1	NM_182494	
SEMA5A	9037	hgsc.bcm.edu	37	5	9202072	9202072	+	Silent	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr5:9202072G>T	ENST00000382496.5	-	9	1592	c.927C>A	c.(925-927)acC>acA	p.T309T		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	309	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						CATACACATTGGTGGTAAAGA	0.398																																					p.T309T		.											.	.	.	0			c.C927A						.						57.0	57.0	57.0					5																	9202072		2203	4300	6503	SO:0001819	synonymous_variant	9037	exon9			CACATTGGTGGTA	U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.927C>A	5.37:g.9202072G>T		Somatic	26	0		WXS	Illumina HiSeq	.	51	4	NM_003966	D3DTC6|O60408|Q1RLL9	Silent	SNP	ENST00000382496.5	37	CCDS3875.1																																																																																			.		0.398	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206989.2		
SMARCA4	6597	hgsc.bcm.edu	37	19	11097625	11097625	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr19:11097625C>T	ENST00000429416.3	+	6	1086	c.805C>T	c.(805-807)Ccc>Tcc	p.P269S	SMARCA4_ENST00000590574.1_Missense_Mutation_p.P269S|SMARCA4_ENST00000589677.1_Missense_Mutation_p.P269S|SMARCA4_ENST00000358026.2_Missense_Mutation_p.P269S|SMARCA4_ENST00000444061.3_Missense_Mutation_p.P269S|SMARCA4_ENST00000541122.2_Missense_Mutation_p.P269S|SMARCA4_ENST00000450717.3_Missense_Mutation_p.P269S|SMARCA4_ENST00000344626.4_Missense_Mutation_p.P269S|SMARCA4_ENST00000413806.3_Missense_Mutation_p.P269S	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	269	Necessary for interaction with SS18L1/CREST. {ECO:0000250}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.P270fs*16(1)|p.M272fs*31(1)|p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				CTCGGGCGTGCCCCCCGGGAT	0.632			"""F, N, Mis"""		NSCLC																																p.P269S		.		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	.,1	.	502	3	Deletion - Frameshift(2)|Unknown(1)	lung(3)	c.C805T						.						44.0	47.0	46.0					19																	11097625		2203	4299	6502	SO:0001583	missense	6597	exon5			GGCGTGCCCCCCG	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.805C>T	19.37:g.11097625C>T	ENSP00000395654:p.Pro269Ser	Somatic	14	0		WXS	Illumina HiSeq	.	33	3	NM_003072	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	37	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	C	19.83	3.901060	0.72754	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	D;D;D;D;D;D;D	0.86230	-2.09;-2.09;-2.09;-2.09;-2.09;-2.09;-2.09	4.23	4.23	0.50019	.	0.000000	0.85682	D	0.000000	D	0.89684	0.6786	L	0.40543	1.245	0.54753	D	0.999986	P;P;P;D;P;P;P	0.63880	0.516;0.516;0.516;0.993;0.516;0.759;0.516	B;B;B;D;B;B;B	0.70227	0.245;0.245;0.245;0.968;0.245;0.245;0.245	D	0.88742	0.3244	10	0.35671	T	0.21	-29.135	15.5536	0.76173	0.0:1.0:0.0:0.0	.	269;269;269;269;269;269;269	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;A7E2E1;P51532	.;.;.;.;.;.;SMCA4_HUMAN	S	269	ENSP00000395654:P269S;ENSP00000350720:P269S;ENSP00000343896:P269S;ENSP00000445036:P269S;ENSP00000392837:P269S;ENSP00000397783:P269S;ENSP00000414727:P269S	ENSP00000343896:P269S	P	+	1	0	SMARCA4	10958625	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	3.750000	0.55157	2.195000	0.70347	0.462000	0.41574	CCC	.		0.632	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072	
HYAL3	8372	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	50332983	50332983	+	Silent	SNP	C	C	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr3:50332983C>T	ENST00000336307.1	-	2	323	c.51G>A	c.(49-51)ctG>ctA	p.L17L	IFRD2_ENST00000417626.2_5'Flank|HYAL3_ENST00000359051.3_Silent_p.L17L|HYAL3_ENST00000415204.1_Intron|HYAL3_ENST00000450982.1_Silent_p.L17L|HYAL3_ENST00000513170.1_Intron|IFRD2_ENST00000436390.1_5'Flank|IFRD2_ENST00000336089.4_5'Flank	NM_001200029.1|NM_003549.3	NP_001186958.1|NP_003540.2	O43820	HYAL3_HUMAN	hyaluronoglucosaminidase 3	17					carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to UV-B (GO:0071493)|hyaluronan catabolic process (GO:0030214)|inflammatory response (GO:0006954)|response to antibiotic (GO:0046677)|response to virus (GO:0009615)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|lysosome (GO:0005764)	hyaluronoglucuronidase activity (GO:0033906)|hyalurononglucosaminidase activity (GO:0004415)			central_nervous_system(1)|endometrium(2)|kidney(1)|lung(5)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		GGCCACAACCCAGGCACAGGG	0.627																																					p.L17L		.											.	.	.	0			c.G51A						.						28.0	29.0	29.0					3																	50332983		2152	4159	6311	SO:0001819	synonymous_variant	8372	exon2			ACAACCCAGGCAC	AF040710	CCDS2815.1, CCDS56259.1, CCDS56260.1, CCDS56257.1	3p21.3	2004-03-12			ENSG00000186792	ENSG00000186792			5322	protein-coding gene	gene with protein product		604038				10493834	Standard	NM_003549		Approved	LUCA-3, LUCA14, Minna14	uc021wyn.1	O43820	OTTHUMG00000156936	ENST00000336307.1:c.51G>A	3.37:g.50332983C>T		Somatic	29	0		WXS	Illumina HiSeq	.	13	9	NM_001200030	O60540|Q8NFK2|Q8NFK3|Q8NFK4|Q96E56|Q9BRW9	Silent	SNP	ENST00000336307.1	37	CCDS2815.1																																																																																			.		0.627	HYAL3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000346664.1	NM_003549	
QPCT	25797	hgsc.bcm.edu	37	2	37586829	37586829	+	Missense_Mutation	SNP	G	G	T	rs372851223		TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr2:37586829G>T	ENST00000338415.3	+	3	532	c.374G>T	c.(373-375)aGc>aTc	p.S125I	QPCT_ENST00000537448.1_Missense_Mutation_p.S76I	NM_012413.3	NP_036545.1	Q16769	QPCT_HUMAN	glutaminyl-peptide cyclotransferase	125					cellular protein modification process (GO:0006464)|peptidyl-pyroglutamic acid biosynthetic process, using glutaminyl-peptide cyclotransferase (GO:0017186)	extracellular vesicular exosome (GO:0070062)	glutaminyl-peptide cyclotransferase activity (GO:0016603)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|stomach(2)	17		Ovarian(717;0.051)|all_hematologic(82;0.21)				AATATCATCAGCACCCTCAAT	0.483																																					p.S125I		.											.	.	.	0			c.G374T						.						115.0	92.0	100.0					2																	37586829		2203	4300	6503	SO:0001583	missense	25797	exon3			TCATCAGCACCCT	X71125	CCDS1790.1	2p22	2008-07-31	2008-07-31		ENSG00000115828	ENSG00000115828	2.3.2.5		9753	protein-coding gene	gene with protein product	"""glutaminyl cyclase"""	607065				7999256	Standard	NM_012413		Approved	QC, GCT	uc002rqg.3	Q16769	OTTHUMG00000100963	ENST00000338415.3:c.374G>T	2.37:g.37586829G>T	ENSP00000344829:p.Ser125Ile	Somatic	46	0		WXS	Illumina HiSeq	.	79	3	NM_012413	Q16770|Q3KRG6|Q53TR4	Missense_Mutation	SNP	ENST00000338415.3	37	CCDS1790.1	.	.	.	.	.	.	.	.	.	.	G	15.73	2.918469	0.52546	.	.	ENSG00000115828	ENST00000338415;ENST00000404976;ENST00000537448	T;T;T	0.21191	2.02;2.02;2.02	5.53	4.59	0.56863	.	0.179421	0.64402	D	0.000009	T	0.41811	0.1175	L	0.61036	1.89	0.47737	D	0.9995	D;D	0.71674	0.998;0.996	D;P	0.63877	0.919;0.831	T	0.30880	-0.9963	10	0.72032	D	0.01	-10.198	15.8291	0.78739	0.0:0.1359:0.8641:0.0	.	76;125	Q16769-2;Q16769	.;QPCT_HUMAN	I	125;76;76	ENSP00000344829:S125I;ENSP00000385391:S76I;ENSP00000441606:S76I	ENSP00000344829:S125I	S	+	2	0	QPCT	37440333	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.836000	0.69375	2.587000	0.87381	0.655000	0.94253	AGC	.		0.483	QPCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218572.2		
LRP5	4041	hgsc.bcm.edu	37	11	68115583	68115583	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr11:68115583G>T	ENST00000294304.7	+	2	466	c.360G>T	c.(358-360)aaG>aaT	p.K120N		NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	120	Beta-propeller 1.				adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GGGTGGGCAAGAAGCTGTACT	0.632																																					p.K120N		.											.	.	.	0			c.G360T						.						115.0	103.0	107.0					11																	68115583		2200	4294	6494	SO:0001583	missense	4041	exon2			GGGCAAGAAGCTG	AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.360G>T	11.37:g.68115583G>T	ENSP00000294304:p.Lys120Asn	Somatic	44	0		WXS	Illumina HiSeq	.	55	4	NM_002335	Q96TD6|Q9UES7|Q9UP66	Missense_Mutation	SNP	ENST00000294304.7	37	CCDS8181.1	.	.	.	.	.	.	.	.	.	.	G	2.731	-0.264476	0.05754	.	.	ENSG00000162337	ENST00000294304	D	0.83992	-1.79	3.71	2.79	0.32731	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.50627	U	0.000110	T	0.57975	0.2090	N	0.02266	-0.62	0.41886	D	0.990342	B	0.12013	0.005	B	0.17979	0.02	T	0.47548	-0.9109	10	0.25751	T	0.34	.	6.7839	0.23662	0.283:0.0:0.717:0.0	.	120	O75197	LRP5_HUMAN	N	120	ENSP00000294304:K120N	ENSP00000294304:K120N	K	+	3	2	LRP5	67872159	0.748000	0.28294	1.000000	0.80357	0.494000	0.33585	0.053000	0.14184	0.900000	0.36469	0.561000	0.74099	AAG	.		0.632	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395088.1	NM_002335	
ZFYVE26	23503	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	68265039	68265039	+	Missense_Mutation	SNP	C	C	G			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr14:68265039C>G	ENST00000347230.4	-	11	2078	c.1940G>C	c.(1939-1941)aGc>aCc	p.S647T	ZFYVE26_ENST00000555452.1_Missense_Mutation_p.S647T	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	647					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		CTTCACATGGCTTGGCATTGT	0.498																																					p.S647T		.											.	.	.	0			c.G1940C						.						94.0	97.0	96.0					14																	68265039		2203	4300	6503	SO:0001583	missense	23503	exon11			ACATGGCTTGGCA	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.1940G>C	14.37:g.68265039C>G	ENSP00000251119:p.Ser647Thr	Somatic	70	0		WXS	Illumina HiSeq	.	48	6	NM_015346	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	ENST00000347230.4	37	CCDS9788.1	.	.	.	.	.	.	.	.	.	.	C	6.712	0.499987	0.12762	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000555452	T;T	0.29142	1.73;1.58	5.71	2.58	0.30949	.	0.501287	0.22387	N	0.060736	T	0.26882	0.0658	L	0.57536	1.79	0.09310	N	1	B;B;B	0.29301	0.241;0.241;0.01	B;B;B	0.30495	0.085;0.116;0.002	T	0.16867	-1.0388	10	0.29301	T	0.29	-1.0234	7.2639	0.26219	0.0:0.5293:0.0:0.4707	.	647;647;647	Q68DK2-4;G3V2D8;Q68DK2	.;.;ZFY26_HUMAN	T	647;626;647	ENSP00000251119:S647T;ENSP00000450603:S647T	ENSP00000251119:S647T	S	-	2	0	ZFYVE26	67334792	0.000000	0.05858	0.002000	0.10522	0.399000	0.30720	0.213000	0.17521	0.221000	0.20879	0.655000	0.94253	AGC	.		0.498	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346	
PTTG1IP	754	hgsc.bcm.edu	37	21	46271541	46271541	+	Splice_Site	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr21:46271541G>T	ENST00000330938.3	-	6	718	c.498C>A	c.(496-498)ggC>ggA	p.G166G	PTTG1IP_ENST00000397887.3_Splice_Site_p.G93G|PTTG1IP_ENST00000445724.2_Splice_Site_p.A57D|PTTG1IP_ENST00000397886.3_Splice_Site_p.G145G	NM_004339.3	NP_004330.1	P53801	PTTG_HUMAN	pituitary tumor-transforming 1 interacting protein	166					multicellular organismal development (GO:0007275)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	receptor activity (GO:0004872)			ovary(1)|prostate(1)	2				Colorectal(79;0.0659)		CTTTAAACAGGCCTGAAACAA	0.408																																					p.G166G		.											PTTG1IP_ENST00000445724,NS,carcinoma,0,2	PTTG1IP_ENST00000445724	0	0			c.C498A						.						120.0	120.0	120.0					21																	46271541		2203	4300	6503	SO:0001630	splice_region_variant	754	exon6			AAACAGGCCTGAA	AF149785	CCDS13715.1, CCDS68221.1	21q22.3	2008-07-04			ENSG00000183255	ENSG00000183255			13524	protein-coding gene	gene with protein product		603784		C21orf3, C21orf1		9570958, 10830953	Standard	NM_004339		Approved	PBF	uc002zgb.2	P53801	OTTHUMG00000090254	ENST00000330938.3:c.497-1C>A	21.37:g.46271541G>T		Somatic	59	0		WXS	Illumina HiSeq	.	31	2	NM_004339	B2RDP7|D3DSL9|Q9NS09	Silent	SNP	ENST00000330938.3	37	CCDS13715.1	.	.	.	.	.	.	.	.	.	.	G	10.01	1.234006	0.22626	.	.	ENSG00000183255	ENST00000445724	T	0.41400	1.0	5.03	-1.86	0.07760	.	.	.	.	.	T	0.26085	0.0636	.	.	.	0.21416	N	0.999691	B	0.20052	0.041	B	0.20184	0.028	T	0.33599	-0.9862	8	0.87932	D	0	.	1.9347	0.03334	0.5221:0.1255:0.2301:0.1223	.	57	B4DPZ0	.	D	57	ENSP00000395374:A57D	ENSP00000395374:A57D	A	-	2	0	PTTG1IP	45095969	1.000000	0.71417	0.941000	0.38009	0.811000	0.45836	0.708000	0.25719	0.019000	0.15079	-0.768000	0.03414	GCC	.		0.408	PTTG1IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206553.1		Silent
ANKRD17	26057	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	73962894	73962894	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr4:73962894G>T	ENST00000358602.4	-	27	5233	c.5117C>A	c.(5116-5118)aCa>aAa	p.T1706K	ANKRD17_ENST00000330838.6_Missense_Mutation_p.T1455K|ANKRD17_ENST00000509867.2_Missense_Mutation_p.T1593K	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	1706					blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			ACTTGCTACTGTTAACTTCCC	0.378																																					p.T1706K		.											.	.	.	0			c.C5117A						.						240.0	240.0	240.0					4																	73962894		2203	4300	6503	SO:0001583	missense	26057	exon27			GCTACTGTTAACT	AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.5117C>A	4.37:g.73962894G>T	ENSP00000351416:p.Thr1706Lys	Somatic	60	0		WXS	Illumina HiSeq	.	88	4	NM_032217	E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Missense_Mutation	SNP	ENST00000358602.4	37	CCDS34004.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.611952	0.87258	.	.	ENSG00000132466	ENST00000358602;ENST00000426990;ENST00000330838;ENST00000509867;ENST00000426917	T;T;T	0.21734	1.99;1.99;1.99	5.82	5.82	0.92795	.	0.000000	0.64402	D	0.000004	T	0.24928	0.0605	L	0.40543	1.245	0.40229	D	0.977827	P;P;P;P	0.42518	0.782;0.782;0.675;0.675	B;B;B;B	0.41174	0.349;0.349;0.19;0.19	T	0.01574	-1.1321	10	0.72032	D	0.01	.	20.0893	0.97812	0.0:0.0:1.0:0.0	.	1705;1455;1706;1593	O75179-2;G5E964;O75179;E7EUV3	.;.;ANR17_HUMAN;.	K	1706;1113;1455;1593;90	ENSP00000351416:T1706K;ENSP00000332265:T1455K;ENSP00000427151:T1593K	ENSP00000332265:T1455K	T	-	2	0	ANKRD17	74181758	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.223000	0.65283	2.761000	0.94854	0.655000	0.94253	ACA	.		0.378	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362475.1	NM_032217	
GIN1	54826	hgsc.bcm.edu	37	5	102440388	102440388	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr5:102440388C>A	ENST00000399004.2	-	4	590	c.496G>T	c.(496-498)Gat>Tat	p.D166Y	GIN1_ENST00000508629.1_Missense_Mutation_p.D166Y|GIN1_ENST00000511400.1_5'Flank	NM_017676.2	NP_060146.2	Q9NXP7	GIN1_HUMAN	gypsy retrotransposon integrase 1	166	Integrase catalytic. {ECO:0000255|PROSITE-ProRule:PRU00457}.				DNA integration (GO:0015074)		nucleic acid binding (GO:0003676)	p.D166N(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(142;3.23e-07)|all_epithelial(76;3.64e-10)|Prostate(80;0.00914)|Ovarian(225;0.0139)|Lung NSC(167;0.0212)|Colorectal(57;0.0249)|all_lung(232;0.0283)		Epithelial(69;3.57e-14)|COAD - Colon adenocarcinoma(37;0.00794)		GTGAACAAATCTGTCATGATT	0.358																																					p.D166Y		.											GIN1,mouth,carcinoma,0,1	GIN1	0	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.G496T						.						111.0	102.0	105.0					5																	102440388		1863	4097	5960	SO:0001583	missense	54826	exon4			ACAAATCTGTCAT	BC015325	CCDS43349.1	5q21.1	2008-02-11	2007-06-13	2007-06-13		ENSG00000145723			25959	protein-coding gene	gene with protein product	"""gypsy integrase 1"", ""Ty3/Gypsy integrase 1"""		"""zinc finger, H2C2 domain containing"""	ZH2C2		11470852	Standard	NM_017676		Approved	FLJ20125, GIN-1, TGIN1	uc003koa.1	Q9NXP7		ENST00000399004.2:c.496G>T	5.37:g.102440388C>A	ENSP00000381970:p.Asp166Tyr	Somatic	25	0		WXS	Illumina HiSeq	.	32	2	NM_017676	B2RXF7|B4DIV4|Q6AI03|Q96BR2	Missense_Mutation	SNP	ENST00000399004.2	37	CCDS43349.1	.	.	.	.	.	.	.	.	.	.	C	13.81	2.349346	0.41599	.	.	ENSG00000145723	ENST00000399004;ENST00000508629	T;T	0.69685	-0.42;-0.42	5.88	5.02	0.67125	Integrase, catalytic core (2);Ribonuclease H-like (1);	0.000000	0.56097	D	0.000024	D	0.82697	0.5093	M	0.85859	2.78	0.51482	D	0.999928	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.909	D	0.85522	0.1204	10	0.87932	D	0	0.0188	13.0877	0.59151	0.0:0.9265:0.0:0.0735	.	166;166	Q9NXP7-3;Q9NXP7	.;GIN1_HUMAN	Y	166	ENSP00000381970:D166Y;ENSP00000427162:D166Y	ENSP00000381970:D166Y	D	-	1	0	GIN1	102468287	1.000000	0.71417	1.000000	0.80357	0.220000	0.24768	3.264000	0.51553	1.499000	0.48617	0.555000	0.69702	GAT	.		0.358	GIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370478.3	NM_017676	
CASD1	64921	hgsc.bcm.edu	37	7	94173762	94173762	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr7:94173762G>T	ENST00000297273.4	+	11	1683	c.1396G>T	c.(1396-1398)Gca>Tca	p.A466S		NM_022900.4	NP_075051.4	Q96PB1	CASD1_HUMAN	CAS1 domain containing 1	466						integral component of membrane (GO:0016021)				NS(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	31	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			TCTGGTTGCTGCATATTTATT	0.358																																					p.A466S		.											.	.	.	0			c.G1396T						.						162.0	152.0	155.0					7																	94173762		2203	4300	6503	SO:0001583	missense	64921	exon11			GTTGCTGCATATT	AF355594	CCDS5636.1	7q22	2006-03-09			ENSG00000127995	ENSG00000127995			16014	protein-coding gene	gene with protein product	"""chromosome 7 open reading frame 12"""	611686				11703667, 11528394	Standard	NM_022900		Approved	FLJ21213, FLJ21879, C7orf12	uc003uni.4	Q96PB1	OTTHUMG00000023356	ENST00000297273.4:c.1396G>T	7.37:g.94173762G>T	ENSP00000297273:p.Ala466Ser	Somatic	27	0		WXS	Illumina HiSeq	.	95	4	NM_022900	B3KW13|O14574|Q3LIE2|Q6P4R4|Q9H6T9|Q9H770	Missense_Mutation	SNP	ENST00000297273.4	37	CCDS5636.1	.	.	.	.	.	.	.	.	.	.	G	16.81	3.226893	0.58668	.	.	ENSG00000127995	ENST00000297273	T	0.44482	0.92	4.78	4.78	0.61160	.	0.000000	0.85682	D	0.000000	T	0.57417	0.2052	L	0.42008	1.315	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.997	T	0.53954	-0.8365	10	0.34782	T	0.22	.	18.1737	0.89754	0.0:0.0:1.0:0.0	.	466;466	Q8WZ77;Q96PB1	.;CASD1_HUMAN	S	466	ENSP00000297273:A466S	ENSP00000297273:A466S	A	+	1	0	CASD1	94011698	1.000000	0.71417	1.000000	0.80357	0.634000	0.38068	9.822000	0.99363	2.377000	0.81083	0.455000	0.32223	GCA	.		0.358	CASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255216.1	NM_022900	
MYNN	55892	hgsc.bcm.edu	37	3	169504301	169504301	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr3:169504301G>T	ENST00000349841.5	+	8	2331	c.1668G>T	c.(1666-1668)aaG>aaT	p.K556N	MYNN_ENST00000544106.1_Missense_Mutation_p.K527N|MYNN_ENST00000356716.4_Missense_Mutation_p.K556N	NM_018657.4	NP_061127.1	Q9NPC7	MYNN_HUMAN	myoneurin	556					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_cancers(22;9.55e-22)|all_epithelial(15;2.04e-26)|all_lung(20;5.05e-16)|Lung NSC(18;2.19e-15)|Ovarian(172;0.000223)|Breast(254;0.197)		Epithelial(2;4.03e-64)|all cancers(2;2.19e-58)|Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00676)			TGGATGTGAAGCCTTCTGATA	0.423																																					p.K556N		.											MYNN,upper_leg,malignant_melanoma,0,1	MYNN	0	0			c.G1668T						.						146.0	142.0	143.0					3																	169504301		2203	4300	6503	SO:0001583	missense	55892	exon9			TGTGAAGCCTTCT	AF148848	CCDS3207.1, CCDS54671.1	3q26.31	2013-01-09			ENSG00000085274	ENSG00000085274		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	14955	protein-coding gene	gene with protein product		606042				10873615	Standard	NM_001185118		Approved	SBBIZ1, ZBTB31, ZNF902	uc010hwo.3	Q9NPC7		ENST00000349841.5:c.1668G>T	3.37:g.169504301G>T	ENSP00000326240:p.Lys556Asn	Somatic	35	0		WXS	Illumina HiSeq	.	52	2	NM_001185118	B2R6C9|Q6QHA6|Q6QHA7|Q6R3G1|Q6R3G2|Q6R4A0|Q7Z716|Q7Z717|Q86Z11|Q86Z12|Q9NS01|Q9UIW8	Missense_Mutation	SNP	ENST00000349841.5	37	CCDS3207.1	.	.	.	.	.	.	.	.	.	.	G	16.12	3.032630	0.54790	.	.	ENSG00000085274	ENST00000356716;ENST00000349841;ENST00000544106	T;T;T	0.10477	3.05;3.05;2.87	5.25	-6.46	0.01908	.	0.000000	0.64402	D	0.000001	T	0.16514	0.0397	L	0.27053	0.805	0.80722	D	1	D;D	0.89917	1.0;0.981	D;D	0.85130	0.997;0.95	T	0.00405	-1.1760	10	0.87932	D	0	.	16.1493	0.81602	0.6681:0.0:0.3319:0.0	.	527;556	Q9NPC7-2;Q9NPC7	.;MYNN_HUMAN	N	556;556;527	ENSP00000349150:K556N;ENSP00000326240:K556N;ENSP00000440637:K527N	ENSP00000326240:K556N	K	+	3	2	MYNN	170986995	0.948000	0.32251	0.791000	0.31998	0.840000	0.47671	-0.102000	0.10956	-1.327000	0.02264	-0.424000	0.05967	AAG	.		0.423	MYNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467801.1	NM_018657	
GBF1	8729	hgsc.bcm.edu	37	10	104123466	104123466	+	Splice_Site	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr10:104123466G>T	ENST00000369983.3	+	17	2274		c.e17-1			NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1						COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		CCTACTCCTAGCTGACAAAAA	0.428																																					.		.											.	.	.	0			c.2015-1G>T						.						111.0	117.0	115.0					10																	104123466		2203	4300	6503	SO:0001630	splice_region_variant	8729	exon17			CTCCTAGCTGACA	D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.2015-1G>T	10.37:g.104123466G>T		Somatic	71	0		WXS	Illumina HiSeq	.	82	4	NM_004193	Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Splice_Site	SNP	ENST00000369983.3	37	CCDS7533.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.936616	0.92458	.	.	ENSG00000107862	ENST00000369983	.	.	.	5.85	5.85	0.93711	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7681	0.96350	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GBF1	104113456	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	6.456000	0.73501	2.768000	0.95171	0.655000	0.94253	.	.		0.428	GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050051.1		Intron
FGFR2	2263	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	123279605	123279605	+	Missense_Mutation	SNP	A	A	C			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr10:123279605A>C	ENST00000358487.5	-	7	1099	c.827T>G	c.(826-828)tTt>tGt	p.F276C	FGFR2_ENST00000357555.5_Missense_Mutation_p.F187C|FGFR2_ENST00000356226.4_Missense_Mutation_p.F161C|FGFR2_ENST00000457416.2_Missense_Mutation_p.F276C|FGFR2_ENST00000490349.1_5'UTR|FGFR2_ENST00000369056.1_Missense_Mutation_p.F276C|FGFR2_ENST00000346997.2_Missense_Mutation_p.F276C|FGFR2_ENST00000369061.4_Intron|FGFR2_ENST00000351936.6_Missense_Mutation_p.F276C|FGFR2_ENST00000478859.1_Missense_Mutation_p.F48C|FGFR2_ENST00000360144.3_Missense_Mutation_p.F187C|FGFR2_ENST00000369059.1_Missense_Mutation_p.F161C|FGFR2_ENST00000369060.4_Missense_Mutation_p.F276C	NM_000141.4	NP_000132.3	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2	276	Ig-like C2-type 3.		F -> V (in CS). {ECO:0000269|PubMed:11173845, ECO:0000269|PubMed:11781872, ECO:0000269|PubMed:9521581}.		angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|bone development (GO:0060348)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|branch elongation involved in salivary gland morphogenesis (GO:0060667)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of a nerve (GO:0048755)|bud elongation involved in lung branching (GO:0060449)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|coronal suture morphogenesis (GO:0060365)|digestive tract development (GO:0048565)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic organ development (GO:0048568)|embryonic organ morphogenesis (GO:0048562)|embryonic pattern specification (GO:0009880)|endodermal digestive tract morphogenesis (GO:0061031)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis morphogenesis (GO:0048730)|epithelial cell differentiation (GO:0030855)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in hemopoiesis (GO:0035603)|fibroblast growth factor receptor signaling pathway involved in mammary gland specification (GO:0060595)|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptotic process in bone marrow (GO:0035602)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow (GO:0035604)|gland morphogenesis (GO:0022612)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lacrimal gland development (GO:0032808)|lateral sprouting from an epithelium (GO:0060601)|lens fiber cell development (GO:0070307)|limb bud formation (GO:0060174)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung lobe morphogenesis (GO:0060463)|lung-associated mesenchyme development (GO:0060484)|mammary gland bud formation (GO:0060615)|membranous septum morphogenesis (GO:0003149)|mesenchymal cell differentiation (GO:0048762)|mesenchymal cell differentiation involved in lung development (GO:0060915)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesodermal cell differentiation (GO:0048333)|midbrain development (GO:0030901)|morphogenesis of embryonic epithelium (GO:0016331)|multicellular organism growth (GO:0035264)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis (GO:0042476)|orbitofrontal cortex development (GO:0021769)|organ growth (GO:0035265)|organ morphogenesis (GO:0009887)|otic vesicle formation (GO:0030916)|outflow tract septum morphogenesis (GO:0003148)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|post-embryonic development (GO:0009791)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|prostate gland morphogenesis (GO:0060512)|protein autophosphorylation (GO:0046777)|pyramidal neuron development (GO:0021860)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell fate commitment (GO:0010453)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of morphogenesis of a branching structure (GO:0060688)|regulation of multicellular organism growth (GO:0040014)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoblast proliferation (GO:0033688)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of smoothened signaling pathway (GO:0008589)|reproductive structure development (GO:0048608)|skeletal system morphogenesis (GO:0048705)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|synaptic vesicle transport (GO:0048489)|ureteric bud development (GO:0001657)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular zone neuroblast division (GO:0021847)	cell cortex (GO:0005938)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)			breast(3)|central_nervous_system(3)|cervix(2)|endometrium(98)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|lung(21)|ovary(4)|skin(30)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(2)	181		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Thalidomide(DB01041)	CTTGCAGACAAACTCTACGTC	0.592		5	Mis		"""gastric. NSCLC, endometrial"""		"""Crouzon, Pfeiffer, and Apert syndromes"""		Saethre-Chotzen syndrome;Apert syndrome																												p.F276C		.		Dom	yes		10	10q26	2263	fibroblast growth factor receptor 2	yes	E	.	.	.	0			c.T827G						.						118.0	102.0	108.0					10																	123279605		2203	4300	6503	SO:0001583	missense	2263	exon7	Familial Cancer Database	Acrocephalosyndactyly type III;Acrocephalosyndactyly type I and II, ACS1. ACS2, incl Apert-Crouzon s.	CAGACAAACTCTA	AK026508	CCDS7620.2, CCDS31298.1, CCDS44485.1, CCDS44486.1, CCDS44487.1, CCDS44488.1, CCDS44489.1, CCDS53584.1, CCDS73210.1	10q25.3-q26	2013-01-11	2008-08-01		ENSG00000066468	ENSG00000066468		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3689	protein-coding gene	gene with protein product	"""Crouzon syndrome"", ""Pfeiffer syndrome"""	176943	"""bacteria-expressed kinase"", ""keratinocyte growth factor receptor"", ""craniofacial dysostosis 1"", ""Jackson-Weiss syndrome"""	KGFR, BEK, CFD1, JWS			Standard	NM_022970		Approved	CEK3, TK14, TK25, ECT1, K-SAM, CD332	uc021pzy.1	P21802	OTTHUMG00000019175	ENST00000358487.5:c.827T>G	10.37:g.123279605A>C	ENSP00000351276:p.Phe276Cys	Somatic	46	0		WXS	Illumina HiSeq	.	44	37	NM_022970	B4DFC2|E7EVR6|E9PCR0|P18443|Q01742|Q12922|Q14300|Q14301|Q14302|Q14303|Q14304|Q14305|Q14672|Q14718|Q14719|Q1KHY5|Q86YI4|Q8IXC7|Q96KL9|Q96KM0|Q96KM1|Q96KM2|Q9NZU2|Q9NZU3|Q9UD01|Q9UD02|Q9UIH3|Q9UIH4|Q9UIH5|Q9UIH6|Q9UIH7|Q9UIH8|Q9UM87|Q9UMC6|Q9UNS7|Q9UQH7|Q9UQH8|Q9UQH9|Q9UQI0	Missense_Mutation	SNP	ENST00000358487.5	37	CCDS31298.1	.	.	.	.	.	.	.	.	.	.	A	26.3	4.723371	0.89298	.	.	ENSG00000066468	ENST00000357555;ENST00000369062;ENST00000358487;ENST00000356226;ENST00000369060;ENST00000369059;ENST00000346997;ENST00000457416;ENST00000351936;ENST00000360144;ENST00000369056;ENST00000369058;ENST00000336553	T;T;T;D;T;T;T;T;T;T;T;T	0.96651	-0.87;-0.87;-0.87;-4.08;-0.87;-0.87;-0.87;-0.87;-0.87;-0.87;-0.87;-0.87	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	D	0.98823	0.9603	H	0.96576	3.845	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.997;0.992;1.0;0.998;1.0;0.998;1.0	D;D;D;D;D;D;D;D;D;D	0.91635	0.998;0.998;0.999;0.969;0.94;0.996;0.967;0.999;0.959;0.983	D	0.99659	1.0993	10	0.87932	D	0	.	16.1311	0.81442	1.0:0.0:0.0:0.0	.	295;161;276;295;276;187;161;295;187;276	D3DRD4;B5A963;B5A960;D3DRD5;P21802-18;P21802-21;P21802-20;D3DRE0;P21802-22;P21802-17	.;.;.;.;.;.;.;.;.;.	C	187;276;276;161;276;161;276;276;276;187;276;276;187	ENSP00000350166:F187C;ENSP00000351276:F276C;ENSP00000348559:F161C;ENSP00000358056:F276C;ENSP00000358055:F161C;ENSP00000263451:F276C;ENSP00000410294:F276C;ENSP00000309878:F276C;ENSP00000353262:F187C;ENSP00000358052:F276C;ENSP00000358054:F276C;ENSP00000337665:F187C	ENSP00000337665:F187C	F	-	2	0	FGFR2	123269595	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.332000	0.96446	2.208000	0.71279	0.460000	0.39030	TTT	.		0.592	FGFR2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000050715.1	NM_022976, NM_000141	
FRG1B	284802	hgsc.bcm.edu	37	20	29632806	29632806	+	Intron	SNP	T	T	C	rs6087300		TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr20:29632806T>C	ENST00000278882.3	+	8	916				FRG1B_ENST00000358464.4_Intron			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B											endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TAAATTACTGTAGTTTTCACA	0.308																																					.		.											.	.	.	0			.						.																																			SO:0001627	intron_variant	284802	.			TTACTGTAGTTTT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.536+85T>C	20.37:g.29632806T>C		Somatic	73	0		WXS	Illumina HiSeq	.	220	11	.	C4AME5	RNA	SNP	ENST00000278882.3	37																																																																																				.		0.308	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
HOXD9	3235	hgsc.bcm.edu	37	2	176988290	176988290	+	Missense_Mutation	SNP	C	C	A	rs200417886|rs529626130|rs397814627|rs56007470|rs559323002	byFrequency	TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr2:176988290C>A	ENST00000249499.6	+	1	1203	c.794C>A	c.(793-795)cCg>cAg	p.P265Q	HOXD-AS2_ENST00000440016.2_RNA	NM_014213.3	NP_055028.3	P28356	HXD9_HUMAN	homeobox D9	265					adult locomotory behavior (GO:0008344)|anterior/posterior pattern specification (GO:0009952)|embryonic forelimb morphogenesis (GO:0035115)|embryonic skeletal system morphogenesis (GO:0048704)|hindlimb morphogenesis (GO:0035137)|mammary gland development (GO:0030879)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(3)|lung(5)|prostate(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.195)	Colorectal(32;0.0226)|READ - Rectum adenocarcinoma(9;0.0556)		CATTCGCAGCCGCAGCAGCAG	0.557																																					p.P265Q	GBM(47;924 952 7959 9248 12176)	.											.,4	.	49	0			c.C794A						.						17.0	17.0	17.0					2																	176988290		2189	4254	6443	SO:0001583	missense	3235	exon1			CGCAGCCGCAGCA		CCDS2267.2	2q31.1	2011-06-20	2005-12-22		ENSG00000128709	ENSG00000128709		"""Homeoboxes / ANTP class : HOXL subclass"""	5140	protein-coding gene	gene with protein product		142982	"""homeo box D9"""	HOX4C, HOX4		1973146, 1358459	Standard	NM_014213		Approved		uc010zex.2	P28356	OTTHUMG00000132516	ENST00000249499.6:c.794C>A	2.37:g.176988290C>A	ENSP00000249499:p.Pro265Gln	Somatic	12	0		WXS	Illumina HiSeq	.	22	2	NM_014213	Q86ST1	Missense_Mutation	SNP	ENST00000249499.6	37	CCDS2267.2	.	.	.	.	.	.	.	.	.	.	C	4.351	0.064680	0.08388	.	.	ENSG00000128709	ENST00000249499	D	0.94457	-3.43	4.69	3.66	0.41972	Homeodomain-related (1);Homeodomain-like (1);	2.510250	0.01516	N	0.018178	D	0.93086	0.7799	M	0.64997	1.995	0.27793	N	0.942765	B	0.21381	0.055	B	0.10450	0.005	T	0.78687	-0.2107	10	0.25106	T	0.35	.	9.2906	0.37784	0.3607:0.6393:0.0:0.0	.	265	P28356	HXD9_HUMAN	Q	265	ENSP00000249499:P265Q	ENSP00000249499:P265Q	P	+	2	0	HOXD9	176696536	.	.	0.937000	0.37676	0.889000	0.51656	.	.	2.300000	0.77407	0.555000	0.69702	CCG	.		0.557	HOXD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255698.4		
OR6B3	150681	hgsc.bcm.edu;broad.mit.edu	37	2	240984497	240984497	+	Silent	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr2:240984497G>T	ENST00000319423.4	-	1	992	c.993C>A	c.(991-993)ctC>ctA	p.L331L	PRR21_ENST00000408934.1_5'Flank	NM_173351.1	NP_775486.1	Q8NGW1	OR6B3_HUMAN	olfactory receptor, family 6, subfamily B, member 3	331						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(10)|lung(4)|ovary(2)|prostate(1)	18		all_epithelial(40;1.64e-11)|Breast(86;0.000327)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)		Epithelial(121;1.05e-29)|all cancers(36;3.52e-28)|OV - Ovarian serous cystadenocarcinoma(60;4.63e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.56e-05)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)|Colorectal(34;0.019)|COAD - Colon adenocarcinoma(134;0.141)		GGCCTCCTCAGAGAGGCTGGC	0.423																																					p.L331L		.											.	.	.	0			c.C993A						.						68.0	69.0	69.0					2																	240984497		1831	4091	5922	SO:0001819	synonymous_variant	150681	exon1			TCCTCAGAGAGGC		CCDS42837.1	2q37.3	2013-09-23	2002-11-13	2002-11-15	ENSG00000178586	ENSG00000178586		"""GPCR / Class A : Olfactory receptors"""	15042	protein-coding gene	gene with protein product			"""olfactory receptor, family 6, subfamily B, member 3 pseudogene"""	OR6B3P			Standard	NM_173351		Approved	OR6B3Q	uc010zoe.2	Q8NGW1	OTTHUMG00000152399	ENST00000319423.4:c.993C>A	2.37:g.240984497G>T		Somatic	88	0		WXS	Illumina HiSeq	.	100	4	NM_173351	Q6IFH3	Silent	SNP	ENST00000319423.4	37	CCDS42837.1																																																																																			.		0.423	OR6B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326078.1		
MTM1	4534	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	149818340	149818340	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chrX:149818340G>T	ENST00000370396.2	+	10	1073	c.1019G>T	c.(1018-1020)aGt>aTt	p.S340I	MTM1_ENST00000306167.7_3'UTR|MTM1_ENST00000413012.2_Missense_Mutation_p.S303I|MTM1_ENST00000543350.1_Missense_Mutation_p.S225I|MTM1_ENST00000542741.1_Missense_Mutation_p.S245I	NM_000252.2	NP_000243.1	Q13496	MTM1_HUMAN	myotubularin 1	340	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				endosome to lysosome transport (GO:0008333)|intermediate filament organization (GO:0045109)|mitochondrion distribution (GO:0048311)|mitochondrion morphogenesis (GO:0070584)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|protein transport (GO:0015031)|regulation of vacuole organization (GO:0044088)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	intermediate filament binding (GO:0019215)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Acute lymphoblastic leukemia(192;6.56e-05)					TGGTTGTCCAGTTTGGAGTCT	0.299																																					p.S340I		.											.	.	.	0			c.G1019T						.						90.0	93.0	92.0					X																	149818340		2203	4298	6501	SO:0001583	missense	4534	exon10			TGTCCAGTTTGGA	U46024	CCDS14694.1	Xq27.3-q28	2014-09-17			ENSG00000171100	ENSG00000171100		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7448	protein-coding gene	gene with protein product		300415	"""myotubular myopathy 1"""				Standard	NM_000252		Approved		uc004fef.4	Q13496	OTTHUMG00000024158	ENST00000370396.2:c.1019G>T	X.37:g.149818340G>T	ENSP00000359423:p.Ser340Ile	Somatic	71	0		WXS	Illumina HiSeq	.	190	17	NM_000252	A6NDB1|B7Z491|F2Z330|Q8NEL1	Missense_Mutation	SNP	ENST00000370396.2	37	CCDS14694.1	.	.	.	.	.	.	.	.	.	.	G	15.43	2.832293	0.50845	.	.	ENSG00000171100	ENST00000370396;ENST00000542741;ENST00000543350;ENST00000413012	D;D;D;D	0.93488	-3.23;-3.23;-3.23;-3.23	5.75	5.75	0.90469	Myotubularin phosphatase domain (1);	0.000000	0.85682	D	0.000000	D	0.93631	0.7966	M	0.80183	2.485	0.53688	D	0.999975	B;B	0.23591	0.088;0.088	B;B	0.20384	0.029;0.029	D	0.91150	0.4952	10	0.49607	T	0.09	.	18.9742	0.92728	0.0:0.0:1.0:0.0	.	303;340	B7Z491;Q13496	.;MTM1_HUMAN	I	340;245;225;303	ENSP00000359423:S340I;ENSP00000444015:S245I;ENSP00000439784:S225I;ENSP00000389157:S303I	ENSP00000359423:S340I	S	+	2	0	MTM1	149568998	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.794000	0.62482	2.429000	0.82318	0.594000	0.82650	AGT	.		0.299	MTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060847.3	NM_000252	
DLGAP2	9228	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	1616583	1616583	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr8:1616583C>A	ENST00000421627.2	+	6	1793	c.1659C>A	c.(1657-1659)agC>agA	p.S553R		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	632					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		CGGCGCAGAGCAGCACCGAAT	0.617																																					p.S553R		.											.	.	.	0			c.C1659A						.						13.0	18.0	16.0					8																	1616583		2029	4172	6201	SO:0001583	missense	9228	exon6			GCAGAGCAGCACC	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.1659C>A	8.37:g.1616583C>A	ENSP00000400258:p.Ser553Arg	Somatic	70	0		WXS	Illumina HiSeq	.	103	52	NM_004745	A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Missense_Mutation	SNP	ENST00000421627.2	37	CCDS47760.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.8|26.8	4.772790|4.772790	0.90108|0.90108	.|.	.|.	ENSG00000198010|ENSG00000198010	ENST00000520901|ENST00000356067;ENST00000421627	.|T	.|0.18502	.|2.21	5.53|5.53	4.66|4.66	0.58398|0.58398	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.46541|0.46541	0.1398|0.1398	M|M	0.84585|0.84585	2.705|2.705	0.49915|0.49915	D|D	0.999835|0.999835	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.91635	.|0.999;0.997	T|T	0.55082|0.55082	-0.8196|-0.8196	5|10	.|0.87932	.|D	.|0	-13.446|-13.446	14.5123|14.5123	0.67797|0.67797	0.0:0.9291:0.0:0.0709|0.0:0.9291:0.0:0.0709	.|.	.|632;632	.|Q9P1A6-2;Q9P1A6	.|.;DLGP2_HUMAN	E|R	570|598;553	.|ENSP00000400258:S553R	.|ENSP00000348366:S598R	A|S	+|+	2|3	0|2	DLGAP2|DLGAP2	1603990|1603990	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	3.040000|3.040000	0.49799|0.49799	1.329000|1.329000	0.45376|0.45376	0.655000|0.655000	0.94253|0.94253	GCA|AGC	.		0.617	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745	
TTLL6	284076	hgsc.bcm.edu	37	17	46868791	46868791	+	Silent	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr17:46868791G>T	ENST00000393382.3	-	9	1314	c.1173C>A	c.(1171-1173)atC>atA	p.I391I	TTLL6_ENST00000433608.2_Silent_p.I84I	NM_001130918.1	NP_001124390.1			tubulin tyrosine ligase-like family, member 6											endometrium(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)	18						CAAAGCCCAGGATCTCAAAGC	0.542											OREG0024526	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I391I		.											TTLL6_ENST00000393382,right_upper_lobe,carcinoma,0,2	TTLL6_ENST00000393382	0	0			c.C1173A						.						189.0	154.0	166.0					17																	46868791		2203	4300	6503	SO:0001819	synonymous_variant	284076	exon9			GCCCAGGATCTCA	AK093127	CCDS11537.2, CCDS45724.1	17q21.32	2013-02-14			ENSG00000170703	ENSG00000170703		"""Tubulin tyrosine ligase-like family"""	26664	protein-coding gene	gene with protein product		610849				15890843	Standard	NM_173623		Approved	FLJ35808	uc021tzm.1	Q8N841	OTTHUMG00000156978	ENST00000393382.3:c.1173C>A	17.37:g.46868791G>T		Somatic	27	1	942	WXS	Illumina HiSeq	.	39	3	NM_001130918		Silent	SNP	ENST00000393382.3	37	CCDS45724.1																																																																																			.		0.542	TTLL6-003	KNOWN	downstream_ATG|non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346939.3	NM_173623	
OR4D2	124538	hgsc.bcm.edu	37	17	56247705	56247705	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr17:56247705G>T	ENST00000545221.1	+	1	689	c.689G>T	c.(688-690)gGg>gTg	p.G230V		NM_001004707.3	NP_001004707.1	P58180	OR4D2_HUMAN	olfactory receptor, family 4, subfamily D, member 2	230						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(1)|large_intestine(1)|lung(19)|ovary(1)|skin(2)|stomach(1)	26						TCACATCCAGGGGAGGCAAGA	0.527																																					p.G230V		.											OR4D2,colon,carcinoma,0,1	OR4D2	0	0			c.G689T						.						167.0	115.0	133.0					17																	56247705		2203	4300	6503	SO:0001583	missense	124538	exon1			ATCCAGGGGAGGC		CCDS32688.1	17q22	2013-09-23			ENSG00000255713	ENSG00000255713		"""GPCR / Class A : Olfactory receptors"""	8294	protein-coding gene	gene with protein product							Standard	NM_001004707		Approved		uc010wnp.2	P58180	OTTHUMG00000178801	ENST00000545221.1:c.689G>T	17.37:g.56247705G>T	ENSP00000441354:p.Gly230Val	Somatic	31	0		WXS	Illumina HiSeq	.	44	2	NM_001004707	Q6IFN8|Q96R75	Missense_Mutation	SNP	ENST00000545221.1	37	CCDS32688.1	.	.	.	.	.	.	.	.	.	.	G	11.54	1.669446	0.29693	.	.	ENSG00000255713	ENST00000545221	T	0.00069	8.77	5.71	-2.85	0.05734	GPCR, rhodopsin-like superfamily (1);	0.509049	0.18052	N	0.153221	T	0.00178	0.0005	N	0.25825	0.765	0.09310	N	0.999991	D	0.59767	0.986	D	0.67103	0.949	T	0.52668	-0.8545	10	0.40728	T	0.16	-6.7572	6.283	0.21017	0.5366:0.1387:0.3247:0.0	.	230	P58180	OR4D2_HUMAN	V	230	ENSP00000441354:G230V	ENSP00000441354:G230V	G	+	2	0	OR4D2	53602704	0.000000	0.05858	0.001000	0.08648	0.441000	0.31987	-0.007000	0.12810	-0.386000	0.07821	-0.174000	0.13273	GGG	.		0.527	OR4D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443366.1		
CDH6	1004	hgsc.bcm.edu	37	5	31317975	31317975	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr5:31317975C>T	ENST00000265071.2	+	11	2091	c.1826C>T	c.(1825-1827)aCg>aTg	p.T609M	CDH6_ENST00000514738.1_Missense_Mutation_p.T554M	NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)	609					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						ATCCACCCCACGGGACTGAGC	0.597																																					p.T609M		.											CDH6,NS,carcinoma,0,1	CDH6	0	0			c.C1826T						.						66.0	64.0	64.0					5																	31317975		2203	4300	6503	SO:0001583	missense	1004	exon11			ACCCCACGGGACT	D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.1826C>T	5.37:g.31317975C>T	ENSP00000265071:p.Thr609Met	Somatic	30	0		WXS	Illumina HiSeq	.	40	2	NM_004932	A8K5H5|Q9BWS0	Missense_Mutation	SNP	ENST00000265071.2	37	CCDS3894.1	.	.	.	.	.	.	.	.	.	.	C	13.65	2.300231	0.40694	.	.	ENSG00000113361	ENST00000514738;ENST00000265071	T;T	0.58358	0.5;0.34	5.29	5.29	0.74685	Cadherin (1);	0.152106	0.64402	D	0.000018	T	0.56077	0.1961	N	0.16368	0.405	0.49687	D	0.999812	D;D	0.67145	0.994;0.996	P;P	0.61275	0.715;0.886	T	0.56360	-0.7992	10	0.35671	T	0.21	.	19.309	0.94177	0.0:1.0:0.0:0.0	.	609;609	P55285;P55285-2	CADH6_HUMAN;.	M	554;609	ENSP00000424843:T554M;ENSP00000265071:T609M	ENSP00000265071:T609M	T	+	2	0	CDH6	31353732	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.944000	0.56629	2.625000	0.88918	0.655000	0.94253	ACG	.		0.597	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207355.2	NM_004932	
C16orf78	123970	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	49412407	49412407	+	Silent	SNP	C	C	T	rs143423404		TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr16:49412407C>T	ENST00000299191.3	+	3	414	c.297C>T	c.(295-297)gaC>gaT	p.D99D		NM_144602.2	NP_653203.1	Q8WTQ4	CP078_HUMAN	chromosome 16 open reading frame 78	99						nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|upper_aerodigestive_tract(1)	22						TCAGGAAGGACGCCGCCTCCT	0.572																																					p.D99D		.											.	.	.	0			c.C297T						.	C		0,4398		0,0,2199	42.0	37.0	39.0		297	-5.1	0.0	16	dbSNP_134	39	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	C16orf78	NM_144602.2		0,1,6498	TT,TC,CC		0.0116,0.0,0.0077		99/266	49412407	1,12997	2199	4300	6499	SO:0001819	synonymous_variant	123970	exon3			GAAGGACGCCGCC	BC021181	CCDS10738.1	16q12.1	2008-02-05			ENSG00000166152	ENSG00000166152			28479	protein-coding gene	gene with protein product						12477932	Standard	NM_144602		Approved	MGC33367	uc002efr.3	Q8WTQ4	OTTHUMG00000133149	ENST00000299191.3:c.297C>T	16.37:g.49412407C>T		Somatic	65	0		WXS	Illumina HiSeq	.	46	7	NM_144602		Silent	SNP	ENST00000299191.3	37	CCDS10738.1																																																																																			0.000		0.572	C16orf78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256846.1	NM_144602	
OR10X1	128367	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	158549641	158549641	+	Missense_Mutation	SNP	T	T	A			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr1:158549641T>A	ENST00000368150.1	-	1	48	c.49A>T	c.(49-51)Acg>Tcg	p.T17S		NM_001004477.1	NP_001004477.1	Q8NGY0	O10X1_HUMAN	olfactory receptor, family 10, subfamily X, member 1 (gene/pseudogene)	17						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(22)|ovary(2)|skin(2)|urinary_tract(1)	37	all_hematologic(112;0.0378)					ATCTTCATCGTTTGAATGTCT	0.333																																					p.T17S		.											.	.	.	0			c.A49T						.						107.0	105.0	106.0					1																	158549641		2203	4300	6503	SO:0001583	missense	128367	exon1			TCATCGTTTGAAT	BK004194	CCDS30900.1	1q23.1	2013-10-10	2013-10-10	2004-03-10	ENSG00000186400	ENSG00000186400		"""GPCR / Class A : Olfactory receptors"""	14995	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily X, member 1"""	OR10X1P			Standard	NM_001004477		Approved		uc010pin.2	Q8NGY0	OTTHUMG00000019635	ENST00000368150.1:c.49A>T	1.37:g.158549641T>A	ENSP00000357132:p.Thr17Ser	Somatic	31	0		WXS	Illumina HiSeq	.	88	8	NM_001004477	Q6IFR8	Missense_Mutation	SNP	ENST00000368150.1	37	CCDS30900.1	.	.	.	.	.	.	.	.	.	.	T	8.729	0.916285	0.17907	.	.	ENSG00000186400	ENST00000368150	T	0.00245	8.45	4.56	2.15	0.27550	.	0.822976	0.10014	U	0.726818	T	0.00039	0.0001	N	0.02539	-0.55	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.10636	-1.0621	10	0.52906	T	0.07	.	8.5585	0.33496	0.0:0.1676:0.0:0.8324	.	17	Q8NGY0	O10X1_HUMAN	S	17	ENSP00000357132:T17S	ENSP00000357132:T17S	T	-	1	0	OR10X1	156816265	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.145000	0.10265	0.319000	0.23209	-0.263000	0.10527	ACG	.		0.333	OR10X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051850.2	NM_001004477	
CTSD	1509	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	1776236	1776236	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr11:1776236C>T	ENST00000236671.2	-	6	859	c.727G>A	c.(727-729)Ggt>Agt	p.G243S	RP11-295K3.1_ENST00000427721.1_Silent_p.G113G	NM_001909.4	NP_001900.1	P07339	CATD_HUMAN	cathepsin D	243					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|autophagic vacuole assembly (GO:0000045)|cell death (GO:0008219)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|mitochondrion (GO:0005739)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(1)|large_intestine(4)|lung(8)	13		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	ATCAGCTCACCCCCAGGCTGC	0.592																																					p.G243S		.											.	.	.	0			c.G727A						.						97.0	89.0	91.0					11																	1776236		2202	4299	6501	SO:0001583	missense	1509	exon6			GCTCACCCCCAGG	M11233	CCDS7725.1	11p15.5	2009-06-26	2006-12-05		ENSG00000117984	ENSG00000117984	3.4.23.5	"""Cathepsins"""	2529	protein-coding gene	gene with protein product	"""ceroid-lipofuscinosis, neuronal 10"""	116840	"""cathepsin D (lysosomal aspartyl protease)"""	CPSD		3927292	Standard	NM_001909		Approved	CLN10	uc001luc.2	P07339	OTTHUMG00000044760	ENST00000236671.2:c.727G>A	11.37:g.1776236C>T	ENSP00000236671:p.Gly243Ser	Somatic	38	0		WXS	Illumina HiSeq	.	66	35	NM_001909	Q6IB57	Missense_Mutation	SNP	ENST00000236671.2	37	CCDS7725.1	.	.	.	.	.	.	.	.	.	.	c	21.0	4.076812	0.76415	.	.	ENSG00000117984	ENST00000236671;ENST00000438213	T;T	0.69175	-0.38;-0.38	4.25	4.25	0.50352	Peptidase aspartic (1);Peptidase aspartic, catalytic (1);	0.000000	0.85682	D	0.000000	T	0.74921	0.3780	M	0.75615	2.305	0.80722	D	1	D	0.56287	0.975	P	0.51016	0.656	T	0.79396	-0.1821	10	0.54805	T	0.06	.	17.2115	0.86931	0.0:1.0:0.0:0.0	.	243	P07339	CATD_HUMAN	S	243;228	ENSP00000236671:G243S;ENSP00000415036:G228S	ENSP00000236671:G243S	G	-	1	0	CTSD	1732812	0.999000	0.42202	0.538000	0.28064	0.203000	0.24098	5.235000	0.65348	2.373000	0.80994	0.455000	0.32223	GGT	.		0.592	CTSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104272.5	NM_001909	
MTUS2	23281	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	13	29599613	29599613	+	Missense_Mutation	SNP	C	C	G			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr13:29599613C>G	ENST00000431530.3	+	1	866	c.808C>G	c.(808-810)Caa>Gaa	p.Q270E		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	260						cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						CTCAGAGACCCAAACAGTGGG	0.522																																					p.Q270E		.											.	.	.	0			c.C808G						.						42.0	44.0	43.0					13																	29599613		2179	4283	6462	SO:0001583	missense	23281	exon1			GAGACCCAAACAG	AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.808C>G	13.37:g.29599613C>G	ENSP00000392057:p.Gln270Glu	Somatic	15	0		WXS	Illumina HiSeq	.	15	5	NM_001033602	A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	ENST00000431530.3	37	CCDS45022.1	.	.	.	.	.	.	.	.	.	.	c	10.35	1.324977	0.24080	.	.	ENSG00000132938	ENST00000431530	T	0.11169	2.8	5.49	3.7	0.42460	.	0.941231	0.08771	N	0.896271	T	0.09512	0.0234	L	0.36672	1.1	0.09310	N	0.999996	B	0.28291	0.206	B	0.28011	0.085	T	0.41251	-0.9519	9	.	.	.	.	6.4362	0.21825	0.3408:0.5746:0.0:0.0846	.	260	Q5JR59	MTUS2_HUMAN	E	270	ENSP00000392057:Q270E	.	Q	+	1	0	MTUS2	28497613	0.006000	0.16342	0.006000	0.13384	0.009000	0.06853	1.599000	0.36751	0.625000	0.30304	-0.310000	0.09108	CAA	.		0.522	MTUS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044336.3	XM_166270	
ZKSCAN5	23660	hgsc.bcm.edu;bcgsc.ca	37	7	99123689	99123689	+	Silent	SNP	C	C	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr7:99123689C>T	ENST00000394170.2	+	6	1277	c.1026C>T	c.(1024-1026)ggC>ggT	p.G342G	ZKSCAN5_ENST00000451158.1_Silent_p.G342G|ZKSCAN5_ENST00000326775.5_Silent_p.G342G	NM_014569.3	NP_055384.1	Q9Y2L8	ZKSC5_HUMAN	zinc finger with KRAB and SCAN domains 5	342					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|kidney(1)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	21	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					GCACACATGGCGAGAGAGGGC	0.502																																					p.G342G		.											.	.	.	0			c.C1026T						.						76.0	63.0	67.0					7																	99123689		2203	4300	6503	SO:0001819	synonymous_variant	23660	exon6			ACATGGCGAGAGA	AF170025	CCDS5667.1	7q22	2013-01-09	2007-02-20	2007-02-20	ENSG00000196652	ENSG00000196652		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12867	protein-coding gene	gene with protein product		611272	"""zinc finger protein homologous to Zfp95 in mouse"", ""zinc finger protein 95 homolog (mouse)"""	ZFP95		10585779	Standard	NM_014569		Approved	ZNF914, ZSCAN37	uc003uqv.3	Q9Y2L8	OTTHUMG00000156749	ENST00000394170.2:c.1026C>T	7.37:g.99123689C>T		Somatic	47	0		WXS	Illumina HiSeq	.	69	5	NM_145102	A4D280|D6W5S9	Silent	SNP	ENST00000394170.2	37	CCDS5667.1																																																																																			.		0.502	ZKSCAN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345597.1	NM_014569	
GRM8	2918	hgsc.bcm.edu	37	7	126086280	126086280	+	Silent	SNP	C	C	A			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr7:126086280C>A	ENST00000339582.2	-	10	3385	c.2577G>T	c.(2575-2577)gtG>gtT	p.V859V	GRM8_ENST00000444921.2_Silent_p.V859V|GRM8_ENST00000358373.3_Silent_p.V859V			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	859					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				CAGCTGTCACCACAGCCTTGA	0.423										HNSCC(24;0.065)																											p.V859V		.											GRM8,right_upper_lobe,carcinoma,0,1	GRM8	0	0			c.G2577T						.						179.0	161.0	167.0					7																	126086280		2203	4300	6503	SO:0001819	synonymous_variant	2918	exon9			TGTCACCACAGCC		CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.2577G>T	7.37:g.126086280C>A		Somatic	59	0		WXS	Illumina HiSeq	.	49	2	NM_000845	A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Silent	SNP	ENST00000339582.2	37	CCDS5794.1																																																																																			.		0.423	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059209.4		
KRTAP4-1	85285	hgsc.bcm.edu	37	17	39340729	39340729	+	Silent	SNP	G	G	A	rs373304706		TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr17:39340729G>A	ENST00000398472.1	-	1	865	c.378C>T	c.(376-378)tgC>tgT	p.C126C				Q9BYQ7	KRA41_HUMAN	keratin associated protein 4-1	126	18 X 5 AA repeats of C-C-[GRQC]-[SPT]- [VSTL].					keratin filament (GO:0045095)				kidney(1)|large_intestine(1)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	5		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			TGGTCTGACAGCAGAGTGGAC	0.602																																					p.C107C		.											.	.	.	0			c.C321T						.						86.0	94.0	92.0					17																	39340729		2171	4277	6448	SO:0001819	synonymous_variant	85285	exon2			CTGACAGCAGAGT	AC006070		17q21.2	2013-06-25			ENSG00000198443	ENSG00000198443		"""Keratin associated proteins"""	18907	protein-coding gene	gene with protein product			"""keratin associated protein 4-10"""	KRTAP4-10		11279113	Standard	NM_033060		Approved	KAP4.1, KAP4.10	uc002hwe.4	Q9BYQ7	OTTHUMG00000132081	ENST00000398472.1:c.378C>T	17.37:g.39340729G>A		Somatic	68	0		WXS	Illumina HiSeq	.	130	7	NM_033060	A8MWS7|Q3SYF2	Silent	SNP	ENST00000398472.1	37																																																																																				.		0.602	KRTAP4-1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000255108.1	NM_033060	
NELL1	4745	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	21135210	21135210	+	Missense_Mutation	SNP	G	G	T	rs368227389		TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr11:21135210G>T	ENST00000357134.5	+	13	1528	c.1376G>T	c.(1375-1377)cGc>cTc	p.R459L	NELL1_ENST00000298925.5_Missense_Mutation_p.R487L|NELL1_ENST00000325319.5_Missense_Mutation_p.R402L|NELL1_ENST00000532434.1_Missense_Mutation_p.R459L	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	459	EGF-like 1; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						GGGTTATATCGCTGTGACTGT	0.398																																					p.R459L		.											.	.	.	0			c.G1376T						.						350.0	298.0	316.0					11																	21135210		2203	4300	6503	SO:0001583	missense	4745	exon13			TATATCGCTGTGA	AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.1376G>T	11.37:g.21135210G>T	ENSP00000349654:p.Arg459Leu	Somatic	78	0		WXS	Illumina HiSeq	.	81	16	NM_006157	B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Missense_Mutation	SNP	ENST00000357134.5	37	CCDS7855.1	.	.	.	.	.	.	.	.	.	.	G	16.56	3.156326	0.57259	.	.	ENSG00000165973	ENST00000298925;ENST00000357134;ENST00000325319;ENST00000532434	D;D;D;D	0.92397	-3.03;-3.03;-3.03;-3.03	5.29	5.29	0.74685	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.92903	0.7742	L	0.37800	1.135	0.80722	D	1	D;D;B;P	0.76494	0.996;0.999;0.042;0.704	D;D;B;B	0.85130	0.992;0.997;0.096;0.367	D	0.89277	0.3609	10	0.08381	T	0.77	-23.5568	17.1145	0.86685	0.0:0.0:1.0:0.0	.	402;487;459;459	F5H6I3;B3KXR2;Q92832-2;Q92832	.;.;.;NELL1_HUMAN	L	487;459;402;459	ENSP00000298925:R487L;ENSP00000349654:R459L;ENSP00000317837:R402L;ENSP00000437170:R459L	ENSP00000298925:R487L	R	+	2	0	NELL1	21091786	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	7.264000	0.78432	2.470000	0.83445	0.591000	0.81541	CGC	.		0.398	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387588.1	NM_006157	
RAD54B	25788	hgsc.bcm.edu	37	8	95479633	95479633	+	Splice_Site	SNP	C	C	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr8:95479633C>T	ENST00000336148.5	-	2	259	c.135G>A	c.(133-135)gaG>gaA	p.E45E	RAD54B_ENST00000297592.5_Splice_Site_p.E45E	NM_012415.3	NP_036547.1	Q9Y620	RA54B_HUMAN	RAD54 homolog B (S. cerevisiae)	45					ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair via homologous recombination (GO:0000724)|mitotic recombination (GO:0006312)|reciprocal meiotic recombination (GO:0007131)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|RNA helicase activity (GO:0003724)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(10)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)			TTTGCCTTACCTCAAATAATT	0.308								Direct reversal of damage;Homologous recombination																													p.E45E		.											.	.	.	0			c.G135A						.						91.0	92.0	92.0					8																	95479633		2203	4300	6503	SO:0001630	splice_region_variant	25788	exon2			CCTTACCTCAAAT	AF112481	CCDS6262.1, CCDS56546.1, CCDS75768.1	8q22.1	2014-08-08			ENSG00000197275	ENSG00000197275			17228	protein-coding gene	gene with protein product		604289				10362364, 10851248	Standard	NM_012415		Approved	RDH54	uc003ygk.3	Q9Y620	OTTHUMG00000133658	ENST00000336148.5:c.135+1G>A	8.37:g.95479633C>T		Somatic	55	0		WXS	Illumina HiSeq	.	97	4	NM_001205262	F6WBS8	Silent	SNP	ENST00000336148.5	37	CCDS6262.1																																																																																			.		0.308	RAD54B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257806.3	NM_012415	Silent
BCL6B	255877	hgsc.bcm.edu	37	17	6928019	6928019	+	Missense_Mutation	SNP	C	C	G	rs146207245|rs55799550	byFrequency	TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr17:6928019C>G	ENST00000293805.5	+	4	793	c.701C>G	c.(700-702)tCc>tGc	p.S234C		NM_181844.3	NP_862827	Q8N143	BCL6B_HUMAN	B-cell CLL/lymphoma 6, member B	234	Ser-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			skin(1)	1						GACGAGGCCTCcagcagcagc	0.592																																					p.S234C		.											.,22	.	85	0			c.C701G						.						17.0	22.0	20.0					17																	6928019		2097	4186	6283	SO:0001583	missense	255877	exon4			AGGCCTCCAGCAG	AI672318	CCDS42248.1	17p13.1	2014-06-10	2010-04-14		ENSG00000161940	ENSG00000161940		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1002	protein-coding gene	gene with protein product		608992	"""zinc finger protein 62"", ""B-cell CLL/lymphoma 6, member B (zinc finger protein)"""	ZNF62		9632807	Standard	NM_181844		Approved	ZBTB28, BAZF	uc010clt.1	Q8N143	OTTHUMG00000177882	ENST00000293805.5:c.701C>G	17.37:g.6928019C>G	ENSP00000293805:p.Ser234Cys	Somatic	34	1		WXS	Illumina HiSeq	.	64	2	NM_181844	Q6PCB4	Missense_Mutation	SNP	ENST00000293805.5	37	CCDS42248.1	.	.	.	.	.	.	.	.	.	.	C	12.16	1.854566	0.32791	.	.	ENSG00000161940	ENST00000293805	T	0.08807	3.05	5.18	4.19	0.49359	.	0.565883	0.16303	N	0.220362	T	0.06872	0.0175	N	0.22421	0.69	0.23735	N	0.996983	B	0.02656	0.0	B	0.01281	0.0	T	0.26326	-1.0106	10	0.49607	T	0.09	.	11.2513	0.49028	0.0:0.8073:0.1927:0.0	.	234	Q8N143	BCL6B_HUMAN	C	234	ENSP00000293805:S234C	ENSP00000293805:S234C	S	+	2	0	BCL6B	6868743	0.071000	0.21146	0.857000	0.33713	0.641000	0.38312	1.290000	0.33319	1.368000	0.46115	0.655000	0.94253	TCC	.		0.592	BCL6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439455.2	NM_181844	
TET3	200424	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	74327840	74327840	+	Missense_Mutation	SNP	A	A	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr2:74327840A>T	ENST00000409262.3	+	9	3520	c.3520A>T	c.(3520-3522)Agt>Tgt	p.S1174C		NM_144993.1	NP_659430.1	O43151	TET3_HUMAN	tet methylcytosine dioxygenase 3	1174					DNA demethylation (GO:0080111)|DNA demethylation of male pronucleus (GO:0044727)|histone H3-K4 trimethylation (GO:0080182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methylcytosine dioxygenase activity (GO:0070579)			NS(1)|breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CTGGGGGCACAGTGGCAGCAG	0.602																																					p.S1174C		.											.	.	.	0			c.A3520T						.						45.0	48.0	47.0					2																	74327840		2084	4199	6283	SO:0001583	missense	200424	exon9			GGGCACAGTGGCA		CCDS46339.1, CCDS46339.2	2p13.1	2011-09-30	2011-09-30		ENSG00000187605	ENSG00000187605			28313	protein-coding gene	gene with protein product		613555	"""tet oncogene family member 3"""			9455477	Standard	XM_005264187		Approved	MGC22014, hCG_40738	uc031roi.1	O43151	OTTHUMG00000152823	ENST00000409262.3:c.3520A>T	2.37:g.74327840A>T	ENSP00000386869:p.Ser1174Cys	Somatic	24	0		WXS	Illumina HiSeq	.	33	8	NM_144993	A6NEI3|Q86Z24|Q8TBM9	Missense_Mutation	SNP	ENST00000409262.3	37	CCDS46339.1	.	.	.	.	.	.	.	.	.	.	A	14.08	2.427815	0.43122	.	.	ENSG00000187605	ENST00000409262;ENST00000233310	T	0.12465	2.68	5.44	-4.17	0.03857	Methylcytosine dioxygenase TET, double-stranded beta helix fold domain (1);	0.722243	0.13950	N	0.351632	T	0.10852	0.0265	L	0.29908	0.895	0.09310	N	1	P	0.49783	0.928	P	0.46758	0.526	T	0.21861	-1.0233	10	0.54805	T	0.06	.	9.3813	0.38316	0.3425:0.1201:0.5375:0.0	.	1174	O43151	TET3_HUMAN	C	1174	ENSP00000386869:S1174C	ENSP00000233310:S1174C	S	+	1	0	TET3	74181348	0.000000	0.05858	0.405000	0.26409	0.964000	0.63967	-0.011000	0.12721	-0.276000	0.09206	0.533000	0.62120	AGT	.		0.602	TET3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328141.4		
MMP20	9313	hgsc.bcm.edu	37	11	102465448	102465448	+	Missense_Mutation	SNP	G	G	A	rs148721639		TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr11:102465448G>A	ENST00000260228.2	-	7	1006	c.994C>T	c.(994-996)Cgg>Tgg	p.R332W	MMP20_ENST00000544938.1_5'UTR	NM_004771.3	NP_004762.2	Q9NPA2	MMP25_HUMAN	matrix metallopeptidase 20	352					hard palate development (GO:0060022)|inflammatory response (GO:0006954)|proteolysis (GO:0006508)	anchored component of membrane (GO:0031225)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R332G(1)		endometrium(1)|kidney(4)|large_intestine(3)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_cancers(8;8.95e-05)|all_epithelial(12;0.00227)|Lung NSC(15;0.139)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0216)|Lung(13;0.0711)|all cancers(10;0.0889)|LUSC - Lung squamous cell carcinoma(19;0.13)	BRCA - Breast invasive adenocarcinoma(274;0.0161)	Marimastat(DB00786)	GTGCTGGGCCGAATTCCTGTC	0.438																																					p.R332W		.											MMP20,mouth,carcinoma,0,1	MMP20	0	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.C994T						.	G	TRP/ARG	0,4406		0,0,2203	86.0	79.0	81.0		994	4.5	1.0	11	dbSNP_134	81	1,8597	1.2+/-3.3	0,1,4298	no	missense	MMP20	NM_004771.3	101	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	benign	332/484	102465448	1,13003	2203	4299	6502	SO:0001583	missense	9313	exon7			TGGGCCGAATTCC	Y12779	CCDS8318.1	11q22.3	2008-05-22	2008-05-22			ENSG00000137674			7167	protein-coding gene	gene with protein product	"""enamelysin"""	604629	"""matrix metalloproteinase 20 (enamelysin)"""			9398237	Standard	NM_004771		Approved		uc001phc.3	O60882		ENST00000260228.2:c.994C>T	11.37:g.102465448G>A	ENSP00000260228:p.Arg332Trp	Somatic	26	0		WXS	Illumina HiSeq	.	40	2	NM_004771	D3DUA8|Q9H3Q0	Missense_Mutation	SNP	ENST00000260228.2	37	CCDS8318.1	.	.	.	.	.	.	.	.	.	.	G	13.60	2.284352	0.40394	0.0	1.16E-4	ENSG00000137674	ENST00000260228	T	0.14266	2.52	5.44	4.47	0.54385	Hemopexin/matrixin (2);	0.772354	0.12481	N	0.465166	T	0.07369	0.0186	N	0.04508	-0.205	0.32882	D	0.510663	B	0.14805	0.011	B	0.04013	0.001	T	0.04005	-1.0985	10	0.66056	D	0.02	.	10.6375	0.45573	0.0:0.132:0.7177:0.1503	.	332	O60882	MMP20_HUMAN	W	332	ENSP00000260228:R332W	ENSP00000260228:R332W	R	-	1	2	MMP20	101970658	1.000000	0.71417	1.000000	0.80357	0.730000	0.41778	1.506000	0.35747	2.857000	0.98124	0.644000	0.83932	CGG	0.000		0.438	MMP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398012.1		
SLC5A1	6523	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	32482270	32482270	+	Missense_Mutation	SNP	C	C	G			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr22:32482270C>G	ENST00000266088.4	+	10	1335	c.1085C>G	c.(1084-1086)aCc>aGc	p.T362S	SLC5A1_ENST00000543737.1_Missense_Mutation_p.T235S	NM_000343.3	NP_000334.1	P13866	SC5A1_HUMAN	solute carrier family 5 (sodium/glucose cotransporter), member 1	362					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|intestinal absorption (GO:0050892)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glucose:sodium symporter activity (GO:0005412)			NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(2)|skin(4)|urinary_tract(1)	37					Canagliflozin(DB08907)	GTTGGCTGTACCAACATCGCC	0.488																																					p.T362S		.											.	.	.	0			c.C1085G						.						199.0	167.0	178.0					22																	32482270		2203	4300	6503	SO:0001583	missense	6523	exon10			GCTGTACCAACAT		CCDS13902.1, CCDS58805.1	22q12.3	2013-05-22			ENSG00000100170	ENSG00000100170		"""Solute carriers"""	11036	protein-coding gene	gene with protein product	"""sodium/glucose cotransporter 1"""	182380		SGLT1		8195156	Standard	NM_000343		Approved	D22S675, NAGT	uc003amc.3	P13866	OTTHUMG00000030768	ENST00000266088.4:c.1085C>G	22.37:g.32482270C>G	ENSP00000266088:p.Thr362Ser	Somatic	67	0		WXS	Illumina HiSeq	.	98	34	NM_000343	B2R7E2|B7Z4Q9|B7ZA69	Missense_Mutation	SNP	ENST00000266088.4	37	CCDS13902.1	.	.	.	.	.	.	.	.	.	.	C	5.934	0.356378	0.11239	.	.	ENSG00000100170	ENST00000266088;ENST00000543737	D;D	0.86366	-2.11;-2.11	5.33	3.08	0.35506	.	0.242480	0.47852	N	0.000213	T	0.72399	0.3455	N	0.11560	0.145	0.47441	D	0.999426	B	0.12013	0.005	B	0.17979	0.02	T	0.66586	-0.5886	10	0.02654	T	1	.	15.4734	0.75458	0.0:0.74:0.26:0.0	.	362	P13866	SC5A1_HUMAN	S	362;235	ENSP00000266088:T362S;ENSP00000444898:T235S	ENSP00000266088:T362S	T	+	2	0	SLC5A1	30812270	0.993000	0.37304	1.000000	0.80357	0.996000	0.88848	1.540000	0.36115	1.359000	0.45940	0.585000	0.79938	ACC	.		0.488	SLC5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075656.3	NM_000343	
P2RY11	5032	hgsc.bcm.edu;bcgsc.ca	37	19	10224342	10224342	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr19:10224342C>T	ENST00000321826.4	+	2	237	c.53C>T	c.(52-54)gCt>gTt	p.A18V	PPAN-P2RY11_ENST00000393796.4_Missense_Mutation_p.A438V|P2RY11_ENST00000471843.1_3'UTR|PPAN_ENST00000556468.1_Missense_Mutation_p.A438V|PPAN-P2RY11_ENST00000428358.1_Silent_p.L459L	NM_002566.4	NP_002557.2	Q96G91	P2Y11_HUMAN	purinergic receptor P2Y, G-protein coupled, 11	18					activation of adenylate cyclase activity (GO:0007190)|adenosine receptor signaling pathway (GO:0001973)|calcium-mediated signaling (GO:0019722)|cellular response to ATP (GO:0071318)|defense response (GO:0006952)|G-protein coupled receptor signaling pathway (GO:0007186)|neuronal signal transduction (GO:0023041)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP-activated nucleotide receptor activity (GO:0045031)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|neurotransmitter receptor activity (GO:0030594)|receptor activity (GO:0004872)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)	16			OV - Ovarian serous cystadenocarcinoma(20;3.53e-09)|Epithelial(33;4.91e-06)|all cancers(31;1.1e-05)			TTCTTGGCAGCTGCCGACGAC	0.617											OREG0025230	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A438V		.											.	.	.	0			c.C1313T						.						52.0	53.0	53.0					19																	10224342		2203	4300	6503	SO:0001583	missense	692312	exon13			TGGCAGCTGCCGA	AF030335	CCDS12226.1	19p13.2	2012-08-08			ENSG00000244165	ENSG00000244165		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8540	protein-coding gene	gene with protein product		602697				9405388	Standard	NM_002566		Approved	P2Y11		Q96G91	OTTHUMG00000150166	ENST00000321826.4:c.53C>T	19.37:g.10224342C>T	ENSP00000323872:p.Ala18Val	Somatic	48	0	663	WXS	Illumina HiSeq	.	72	4	NM_001040664	B2R8X9|O43190|Q9BYU4|Q9H170	Missense_Mutation	SNP	ENST00000321826.4	37	CCDS12226.1	.	.	.	.	.	.	.	.	.	.	C	15.65	2.896819	0.52121	.	.	ENSG00000243207;ENSG00000130810;ENSG00000244165	ENST00000393796;ENST00000556468;ENST00000321826	T;T;T	0.62364	0.05;0.05;0.03	4.28	0.643	0.17770	.	.	.	.	.	T	0.35451	0.0932	.	.	.	0.09310	N	1	B	0.20368	0.044	B	0.20384	0.029	T	0.18335	-1.0340	8	0.13853	T	0.58	.	2.3071	0.04177	0.1871:0.4925:0.2087:0.1117	.	18	Q96G91	P2Y11_HUMAN	V	438;438;18	ENSP00000377385:A438V;ENSP00000450710:A438V;ENSP00000323872:A18V	ENSP00000323872:A18V	A	+	2	0	PPAN;P2RY11;PPAN-P2RY11	10085342	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	0.102000	0.15272	0.454000	0.26884	0.555000	0.69702	GCT	.		0.617	P2RY11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316664.2	NM_002566	
AMPD1	270	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	115218557	115218557	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr1:115218557C>T	ENST00000520113.2	-	11	1570	c.1555G>A	c.(1555-1557)Gtg>Atg	p.V519M	AMPD1_ENST00000369538.3_Missense_Mutation_p.V515M|AMPD1_ENST00000353928.6_Missense_Mutation_p.V486M			P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1	519					IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(3)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	45	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	GCCTCAAACACTGGCATGAAA	0.448																																					p.V519M		.											.	.	.	0			c.G1555A						.						143.0	143.0	143.0					1																	115218557		2203	4300	6503	SO:0001583	missense	270	exon11			CAAACACTGGCAT	M60092	CCDS876.1, CCDS876.2, CCDS53349.1	1p13	2010-02-10	2010-02-10		ENSG00000116748	ENSG00000116748	3.5.4.6		468	protein-coding gene	gene with protein product	"""AMPD isoform M"", ""skeletal muscle AMPD"""	102770	"""adenosine monophosphate deaminase 1 (isoform M)"""			1400401	Standard	NM_001172626		Approved	MAD, MADA	uc001efe.2	P23109	OTTHUMG00000011892	ENST00000520113.2:c.1555G>A	1.37:g.115218557C>T	ENSP00000430075:p.Val519Met	Somatic	83	0		WXS	Illumina HiSeq	.	124	39	NM_000036	A8K5N4|B2RAM1|F2Z3B3|Q5TF00|Q5TF02	Missense_Mutation	SNP	ENST00000520113.2	37	CCDS876.2	.	.	.	.	.	.	.	.	.	.	C	19.94	3.919539	0.73098	.	.	ENSG00000116748	ENST00000520113;ENST00000369538;ENST00000353928	D;D;D	0.83075	-1.68;-1.68;-1.68	5.58	3.32	0.38043	Adenosine/AMP deaminase (1);	0.120626	0.64402	D	0.000018	T	0.80491	0.4633	L	0.50333	1.59	0.58432	D	0.999998	D;P	0.52996	0.957;0.612	P;P	0.59056	0.851;0.723	T	0.81360	-0.0968	10	0.87932	D	0	-5.344	9.7366	0.40392	0.0:0.8006:0.0:0.1994	.	515;486	Q5TF02;P23109	.;AMPD1_HUMAN	M	519;515;486	ENSP00000430075:V519M;ENSP00000358551:V515M;ENSP00000316520:V486M	ENSP00000316520:V486M	V	-	1	0	AMPD1	115020080	0.116000	0.22171	0.989000	0.46669	0.996000	0.88848	0.704000	0.25661	0.436000	0.26393	0.561000	0.74099	GTG	.		0.448	AMPD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032860.4		
FLT3	2322	hgsc.bcm.edu	37	13	28631553	28631553	+	Nonsense_Mutation	SNP	C	C	A			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr13:28631553C>A	ENST00000241453.7	-	4	496	c.415G>T	c.(415-417)Gga>Tga	p.G139*	FLT3_ENST00000537084.1_Nonsense_Mutation_p.G139*|FLT3_ENST00000380982.4_Nonsense_Mutation_p.G139*	NM_004119.2	NP_004110.2	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3	139					B cell differentiation (GO:0030183)|cellular response to cytokine stimulus (GO:0071345)|common myeloid progenitor cell proliferation (GO:0035726)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell differentiation (GO:0097028)|hemopoiesis (GO:0030097)|leukocyte homeostasis (GO:0001776)|lymphocyte proliferation (GO:0046651)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|pro-B cell differentiation (GO:0002328)|pro-T cell differentiation (GO:0002572)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor signaling pathway (GO:0038084)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|cytokine receptor activity (GO:0004896)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(12329)|kidney(2)|large_intestine(8)|lung(30)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12390	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Ponatinib(DB08901)|Sorafenib(DB00398)|Sunitinib(DB01268)	AGGTATTCTCCAGCTTGGGTT	0.363			"""Mis, O"""		"""AML, ALL"""																																p.G139X		.		Dom	yes		13	13q12	2322	fms-related tyrosine kinase 3		L	.	.	.	0			c.G415T						.						123.0	124.0	124.0					13																	28631553		2203	4300	6503	SO:0001587	stop_gained	2322	exon4			ATTCTCCAGCTTG	U02687	CCDS31953.1	13q12	2014-09-17			ENSG00000122025	ENSG00000122025	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3765	protein-coding gene	gene with protein product		136351				8394751	Standard	NM_004119		Approved	STK1, FLK2, CD135	uc001urw.3	P36888	OTTHUMG00000016646	ENST00000241453.7:c.415G>T	13.37:g.28631553C>A	ENSP00000241453:p.Gly139*	Somatic	45	0		WXS	Illumina HiSeq	.	59	4	NM_004119	A0AVG9|B7ZLT7|B7ZLT8|F5H0A0|Q13414	Nonsense_Mutation	SNP	ENST00000241453.7	37	CCDS31953.1	.	.	.	.	.	.	.	.	.	.	C	37	6.435022	0.97564	.	.	ENSG00000122025	ENST00000241453;ENST00000380982;ENST00000537084	.	.	.	5.8	5.8	0.92144	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	18.231	0.89934	0.0:1.0:0.0:0.0	.	.	.	.	X	139	.	ENSP00000241453:G139X	G	-	1	0	FLT3	27529553	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.672000	0.61597	2.739000	0.93911	0.561000	0.74099	GGA	.		0.363	FLT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044319.2		
NIPA1	123606	hgsc.bcm.edu	37	15	23049093	23049093	+	Silent	SNP	G	G	T	rs143840469		TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr15:23049093G>T	ENST00000337435.4	-	5	750	c.726C>A	c.(724-726)atC>atA	p.I242I	NIPA1_ENST00000561183.1_Silent_p.I167I|NIPA1_ENST00000538684.1_Silent_p.I72I|NIPA1_ENST00000437912.2_Silent_p.I167I	NM_001142275.1|NM_144599.4	NP_001135747.1|NP_653200.2	Q7RTP0	NIPA1_HUMAN	non imprinted in Prader-Willi/Angelman syndrome 1	242					cell death (GO:0008219)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	magnesium ion transmembrane transporter activity (GO:0015095)			endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|skin(1)	15		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;4.18e-06)|Epithelial(43;3.97e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00165)		TGAACTGGACGATGATGCTGC	0.602																																					p.I242I		.											NIPA1,NS,carcinoma,0,1	NIPA1	0	0			c.C726A						.						116.0	86.0	96.0					15																	23049093		2203	4300	6503	SO:0001819	synonymous_variant	123606	exon5			CTGGACGATGATG	BK001020	CCDS73691.1, CCDS73692.1	15q11.2	2006-10-06			ENSG00000170113	ENSG00000170113			17043	protein-coding gene	gene with protein product		608145	"""spastic paraplegia 6 (autosomal dominant)"""	SPG6		14508710	Standard	NM_144599		Approved	MGC35570	uc001yvc.3	Q7RTP0	OTTHUMG00000129099	ENST00000337435.4:c.726C>A	15.37:g.23049093G>T		Somatic	12	0		WXS	Illumina HiSeq	.	19	2	NM_144599	B2RA76|Q5HYA9|Q7KZB0|Q86XW4	Silent	SNP	ENST00000337435.4	37	CCDS10011.1																																																																																			.		0.602	NIPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251135.2	NM_144599	
CHFR	55743	hgsc.bcm.edu	37	12	133428224	133428224	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr12:133428224G>T	ENST00000432561.2	-	12	1581	c.1508C>A	c.(1507-1509)cCg>cAg	p.P503Q	CHFR_ENST00000450056.2_Missense_Mutation_p.P491Q|CHFR_ENST00000541837.2_5'UTR|CHFR_ENST00000315585.7_Missense_Mutation_p.P462Q|CHFR_ENST00000537522.1_Missense_Mutation_p.P125Q|CHFR_ENST00000266880.7_Missense_Mutation_p.P502Q|CHFR_ENST00000443047.2_Missense_Mutation_p.P411Q			Q96EP1	CHFR_HUMAN	checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase	503					mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|modification-dependent protein catabolic process (GO:0019941)|protein polyubiquitination (GO:0000209)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)|PML body (GO:0016605)	ligase activity (GO:0016874)|nucleotide binding (GO:0000166)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P462L(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.00552)|all_epithelial(31;0.226)		OV - Ovarian serous cystadenocarcinoma(86;2.59e-08)|Epithelial(86;6.38e-07)|all cancers(50;1.56e-05)		GGCGACACGCGGGTCCTGCTC	0.657																																					p.P503Q		.											CHFR,NS,carcinoma,+1,1	CHFR	+1	1	Substitution - Missense(1)	central_nervous_system(1)	c.C1508A						.						83.0	89.0	87.0					12																	133428224		2203	4299	6502	SO:0001583	missense	55743	exon12			ACACGCGGGTCCT	AK001658	CCDS31937.1, CCDS53847.1, CCDS53848.1, CCDS53849.1	12q24.33	2012-02-23	2012-02-23			ENSG00000072609		"""RING-type (C3HC4) zinc fingers"""	20455	protein-coding gene	gene with protein product		605209	"""checkpoint with forkhead and ring finger domains"""			10935642, 11807090	Standard	NM_001161344		Approved	FLJ10796, RNF196	uc001ulf.2	Q96EP1		ENST00000432561.2:c.1508C>A	12.37:g.133428224G>T	ENSP00000392395:p.Pro503Gln	Somatic	31	0		WXS	Illumina HiSeq	.	43	2	NM_001161344	A6NEN5|B4DZ77|B4E2L6|Q96SL3|Q9NRT4|Q9NT32|Q9NVD5	Missense_Mutation	SNP	ENST00000432561.2	37	CCDS53849.1	.	.	.	.	.	.	.	.	.	.	G	12.09	1.832310	0.32421	.	.	ENSG00000072609	ENST00000315585;ENST00000443047;ENST00000450056;ENST00000266880;ENST00000537522;ENST00000541228;ENST00000432561	T;T;T;T;T;T	0.33216	1.42;1.42;1.42;1.42;1.42;1.42	5.93	5.93	0.95920	.	0.114783	0.64402	D	0.000013	T	0.49389	0.1554	L	0.42245	1.32	0.45066	D	0.998085	D;B;B;B;B	0.54601	0.967;0.076;0.046;0.076;0.42	D;B;B;B;B	0.63033	0.91;0.076;0.034;0.076;0.201	T	0.38222	-0.9671	10	0.66056	D	0.02	-16.0612	20.3409	0.98764	0.0:0.0:1.0:0.0	.	411;502;503;491;462	Q96EP1-5;Q96EP1-4;Q96EP1;Q96EP1-2;Q96EP1-3	.;.;CHFR_HUMAN;.;.	Q	462;411;491;502;125;303;503	ENSP00000320557:P462Q;ENSP00000416431:P411Q;ENSP00000398735:P491Q;ENSP00000266880:P502Q;ENSP00000442327:P125Q;ENSP00000392395:P503Q	ENSP00000266880:P502Q	P	-	2	0	CHFR	131938297	1.000000	0.71417	0.958000	0.39756	0.022000	0.10575	4.310000	0.59141	2.814000	0.96858	0.655000	0.94253	CCG	.		0.657	CHFR-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397130.2		
OSBP	5007	hgsc.bcm.edu	37	11	59376002	59376002	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr11:59376002G>T	ENST00000263847.1	-	3	1256	c.777C>A	c.(775-777)aaC>aaA	p.N259K		NM_002556.2	NP_002547.1	P22059	OSBP1_HUMAN	oxysterol binding protein	259					lipid transport (GO:0006869)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	oxysterol binding (GO:0008142)			NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		all_epithelial(135;0.000236)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		TGGCTCGTTCGTTGACCTGTT	0.458																																					p.N259K		.											OSBP,caecum,carcinoma,0,1	OSBP	0	0			c.C777A						.						195.0	172.0	180.0					11																	59376002		2201	4295	6496	SO:0001583	missense	5007	exon3			TCGTTCGTTGACC	AF185696	CCDS7974.1	11q12-q13	2013-01-10			ENSG00000110048	ENSG00000110048		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	8503	protein-coding gene	gene with protein product		167040					Standard	NM_002556		Approved	OSBP1	uc001noc.1	P22059	OTTHUMG00000167422	ENST00000263847.1:c.777C>A	11.37:g.59376002G>T	ENSP00000263847:p.Asn259Lys	Somatic	15	0		WXS	Illumina HiSeq	.	43	2	NM_002556	Q6P524	Missense_Mutation	SNP	ENST00000263847.1	37	CCDS7974.1	.	.	.	.	.	.	.	.	.	.	G	15.19	2.761429	0.49468	.	.	ENSG00000110048	ENST00000263847	D	0.91351	-2.83	5.89	0.178	0.15058	.	0.046113	0.85682	D	0.000000	D	0.93232	0.7844	M	0.84683	2.71	0.48975	D	0.999737	D	0.58268	0.982	P	0.61874	0.895	D	0.90310	0.4336	10	0.16896	T	0.51	-29.8529	10.9182	0.47148	0.4336:0.0:0.5664:0.0	.	259	P22059	OSBP1_HUMAN	K	259	ENSP00000263847:N259K	ENSP00000263847:N259K	N	-	3	2	OSBP	59132578	0.274000	0.24191	0.999000	0.59377	0.998000	0.95712	-0.310000	0.08135	0.110000	0.17919	0.655000	0.94253	AAC	.		0.458	OSBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394555.1		
ZNF14	7561	hgsc.bcm.edu;bcgsc.ca	37	19	19824917	19824917	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr19:19824917G>T	ENST00000344099.3	-	3	312	c.174C>A	c.(172-174)aaC>aaA	p.N58K		NM_021030.2	NP_066358.2	P17017	ZNF14_HUMAN	zinc finger protein 14	58	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(2)|endometrium(1)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32		Renal(1328;0.0474)				TTTTCCCCTGGTTTCTGTGGT	0.368																																					p.N58K		.											.	.	.	0			c.C174A						.						116.0	108.0	111.0					19																	19824917		2203	4300	6503	SO:0001583	missense	7561	exon3			CCCCTGGTTTCTG	AA286756	CCDS12409.1	19p13.11	2013-01-08	2006-05-10					"""Zinc fingers, C2H2-type"", ""-"""	12924	protein-coding gene	gene with protein product		194556	"""zinc finger protein 14 (KOX 6)"""				Standard	NM_021030		Approved	KOX6, GIOT-4	uc002nnk.1	P17017		ENST00000344099.3:c.174C>A	19.37:g.19824917G>T	ENSP00000340514:p.Asn58Lys	Somatic	51	0		WXS	Illumina HiSeq	.	80	4	NM_021030	B9EGA4|Q9ULZ5	Missense_Mutation	SNP	ENST00000344099.3	37	CCDS12409.1	.	.	.	.	.	.	.	.	.	.	G	6.710	0.499649	0.12762	.	.	ENSG00000105708	ENST00000344099	T	0.05513	3.43	1.47	-0.889	0.10580	Krueppel-associated box (3);	.	.	.	.	T	0.02156	0.0067	N	0.02721	-0.515	0.09310	N	1	B	0.28291	0.206	B	0.30105	0.111	T	0.47812	-0.9088	9	0.11794	T	0.64	.	3.9765	0.09476	0.4552:0.0:0.5448:0.0	.	58	P17017	ZNF14_HUMAN	K	58	ENSP00000340514:N58K	ENSP00000340514:N58K	N	-	3	2	ZNF14	19685917	0.137000	0.22531	0.000000	0.03702	0.108000	0.19459	1.261000	0.32980	-0.202000	0.10268	0.467000	0.42956	AAC	.		0.368	ZNF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460775.1	NM_021030	
IDH1	3417	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	209113113	209113113	+	Missense_Mutation	SNP	G	G	A	rs121913499		TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr2:209113113G>A	ENST00000415913.1	-	4	775	c.394C>T	c.(394-396)Cgt>Tgt	p.R132C	IDH1_ENST00000446179.1_Missense_Mutation_p.R132C|IDH1_ENST00000345146.2_Missense_Mutation_p.R132C	NM_001282387.1	NP_001269316.1	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132			R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:19117336}.|R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation). {ECO:0000269|PubMed:19117336}.|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:19117336}.|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.		2-oxoglutarate metabolic process (GO:0006103)|cellular lipid metabolic process (GO:0044255)|female gonad development (GO:0008585)|glutathione metabolic process (GO:0006749)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|NADPH regeneration (GO:0006740)|response to oxidative stress (GO:0006979)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.R132C(446)|p.R132G(125)|p.R132S(106)|p.G131_R132>VL(1)|p.R132V(1)		NS(1)|autonomic_ganglia(2)|biliary_tract(24)|bone(237)|central_nervous_system(3764)|endometrium(3)|haematopoietic_and_lymphoid_tissue(794)|kidney(2)|large_intestine(7)|lung(7)|prostate(6)|skin(5)|soft_tissue(12)|thyroid(22)|urinary_tract(1)	4887				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		TAAGCATGACGACCTATGATG	0.398			Mis		gliobastoma																																p.R132C	Pancreas(158;264 1958 3300 35450 36047)	.		Dom	yes		2	2q33.3	3417	"""isocitrate dehydrogenase 1 (NADP+), soluble"""		O	IDH1,NS,haematopoietic_neoplasm,0,788	IDH1	0	679	Substitution - Missense(678)|Complex - compound substitution(1)	haematopoietic_and_lymphoid_tissue(280)|central_nervous_system(181)|bone(177)|biliary_tract(21)|soft_tissue(12)|large_intestine(2)|skin(2)|autonomic_ganglia(1)|endometrium(1)|NS(1)|prostate(1)	c.C394T						.						81.0	74.0	76.0					2																	209113113		2203	4300	6503	SO:0001583	missense	3417	exon4			CATGACGACCTAT		CCDS2381.1	2q34	2014-09-17			ENSG00000138413	ENSG00000138413	1.1.1.42		5382	protein-coding gene	gene with protein product		147700					Standard	NM_005896		Approved		uc002vcu.3	O75874	OTTHUMG00000132943	ENST00000415913.1:c.394C>T	2.37:g.209113113G>A	ENSP00000390265:p.Arg132Cys	Somatic	40	0		WXS	Illumina HiSeq	.	54	25	NM_005896	Q567U4|Q6FHQ6|Q7Z3V0|Q93090|Q9NTJ9|Q9UKW8	Missense_Mutation	SNP	ENST00000415913.1	37	CCDS2381.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.550898	0.86127	.	.	ENSG00000138413	ENST00000345146;ENST00000446179;ENST00000415913;ENST00000415282	D;D;D;D	0.87029	-2.2;-2.2;-2.2;-2.2	5.57	5.57	0.84162	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.94049	0.8093	H	0.99379	4.54	0.80722	D	1	B	0.29862	0.259	B	0.31245	0.126	D	0.94048	0.7315	10	0.87932	D	0	-20.0399	19.5341	0.95242	0.0:0.0:1.0:0.0	.	132	O75874	IDHC_HUMAN	C	132	ENSP00000260985:R132C;ENSP00000410513:R132C;ENSP00000390265:R132C;ENSP00000391075:R132C	ENSP00000260985:R132C	R	-	1	0	IDH1	208821358	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	7.074000	0.76791	2.616000	0.88540	0.555000	0.69702	CGT	.		0.398	IDH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336672.1		
WNK1	65125	hgsc.bcm.edu	37	12	989117	989117	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr12:989117G>A	ENST00000315939.6	+	11	3395	c.2752G>A	c.(2752-2754)Gca>Aca	p.A918T	WNK1_ENST00000537687.1_Intron|WNK1_ENST00000535572.1_Intron|WNK1_ENST00000530271.2_Missense_Mutation_p.A1416T|WNK1_ENST00000340908.4_Missense_Mutation_p.A511T	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	918					intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			CCTACAACCAGCAGTTCAGTC	0.512																																					p.A918T	Colon(19;451 567 6672 12618 28860)	.											WNK1,bladder,carcinoma,0,1	WNK1	0	0			c.G2752A						.						118.0	104.0	109.0					12																	989117		2203	4300	6503	SO:0001583	missense	65125	exon11			CAACCAGCAGTTC	AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.2752G>A	12.37:g.989117G>A	ENSP00000313059:p.Ala918Thr	Somatic	36	0		WXS	Illumina HiSeq	.	44	2	NM_018979	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Missense_Mutation	SNP	ENST00000315939.6	37	CCDS8506.1	.	.	.	.	.	.	.	.	.	.	G	11.42	1.632831	0.29068	.	.	ENSG00000060237	ENST00000315939;ENST00000530271;ENST00000340908;ENST00000535698	T;T;T;T	0.18016	2.24;2.24;2.24;2.24	5.1	3.24	0.37175	.	0.310296	0.27577	N	0.018749	T	0.08044	0.0201	N	0.17082	0.46	0.27397	N	0.954958	B	0.06786	0.001	B	0.04013	0.001	T	0.35276	-0.9795	10	0.12766	T	0.61	-5.8702	5.1545	0.15027	0.0739:0.1248:0.5449:0.2564	.	918	Q9H4A3	WNK1_HUMAN	T	918;1416;511;188	ENSP00000313059:A918T;ENSP00000433548:A1416T;ENSP00000341292:A511T;ENSP00000439552:A188T	ENSP00000313059:A918T	A	+	1	0	WNK1	859378	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	2.019000	0.41001	0.695000	0.31675	-0.319000	0.08680	GCA	.		0.512	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206683.1	NM_018979	
IGJ	3512	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	71522073	71522073	+	Missense_Mutation	SNP	T	T	G			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr4:71522073T>G	ENST00000254801.4	-	4	622	c.453A>C	c.(451-453)ttA>ttC	p.L151F	IGJ_ENST00000543780.1_Missense_Mutation_p.L167F|ENAM_ENST00000472903.1_Intron	NM_144646.3	NP_653247.1	P01591	IGJ_HUMAN	immunoglobulin J polypeptide, linker protein for immunoglobulin alpha and mu polypeptides	151					adaptive immune response (GO:0002250)|antibacterial humoral response (GO:0019731)|glomerular filtration (GO:0003094)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of respiratory burst (GO:0060267)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|dimeric IgA immunoglobulin complex (GO:0071750)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|monomeric IgA immunoglobulin complex (GO:0071748)|pentameric IgM immunoglobulin complex (GO:0071756)|secretory dimeric IgA immunoglobulin complex (GO:0071752)|secretory IgA immunoglobulin complex (GO:0071751)	antigen binding (GO:0003823)|IgA binding (GO:0019862)|protein homodimerization activity (GO:0042803)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	7			Lung(101;0.235)			CATCTGGGGTTAAGGCTGTTT	0.438																																					p.L151F		.											.	.	.	0			c.A453C						.						138.0	116.0	124.0					4																	71522073		2203	4300	6503	SO:0001583	missense	3512	exon4			TGGGGTTAAGGCT	M12759	CCDS3545.1	4q21	2012-10-02			ENSG00000132465	ENSG00000132465		"""Immunoglobulins / IGJ linker"""	5713	protein-coding gene	gene with protein product	"""immunoglobulin J chain"", ""IgJ chain"""	147790				3016707, 2984306	Standard	NM_144646		Approved	IGCJ, JCH	uc003hfn.4	P01591	OTTHUMG00000129909	ENST00000254801.4:c.453A>C	4.37:g.71522073T>G	ENSP00000254801:p.Leu151Phe	Somatic	49	0		WXS	Illumina HiSeq	.	71	18	NM_144646		Missense_Mutation	SNP	ENST00000254801.4	37	CCDS3545.1	.	.	.	.	.	.	.	.	.	.	T	15.09	2.730225	0.48939	.	.	ENSG00000132465	ENST00000254801;ENST00000510437;ENST00000543780	.	.	.	6.17	3.5	0.40072	.	0.000000	0.49916	D	0.000126	T	0.56396	0.1982	L	0.36672	1.1	0.36699	D	0.880026	D	0.89917	1.0	D	0.91635	0.999	T	0.61749	-0.6999	9	0.87932	D	0	.	3.6854	0.08326	0.1365:0.5854:0.1321:0.1461	.	151	P01591	IGJ_HUMAN	F	151;151;167	.	ENSP00000254801:L151F	L	-	3	2	IGJ	71740937	0.997000	0.39634	0.452000	0.26994	0.176000	0.22953	0.476000	0.22180	0.459000	0.27016	-0.242000	0.12053	TTA	.		0.438	IGJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252160.1	NM_144646	
KIAA1109	84162	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	123274248	123274248	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr4:123274248T>C	ENST00000264501.4	+	81	14412	c.14039T>C	c.(14038-14040)cTt>cCt	p.L4680P	KIAA1109_ENST00000388738.3_Missense_Mutation_p.L4680P			Q2LD37	K1109_HUMAN	KIAA1109	4680					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						TCTTGGGCCCTTTTTCATTTA	0.373																																					p.L4680P		.											.	.	.	0			c.T14039C						.						90.0	83.0	85.0					4																	123274248		1832	4082	5914	SO:0001583	missense	84162	exon79			GGGCCCTTTTTCA	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.14039T>C	4.37:g.123274248T>C	ENSP00000264501:p.Leu4680Pro	Somatic	33	0		WXS	Illumina HiSeq	.	73	4	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	37	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.3|20.3	3.966302|3.966302	0.74131|0.74131	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000306802|ENST00000264501;ENST00000388738;ENST00000438707;ENST00000431755	.|T;T;T	.|0.57436	.|0.4;0.4;0.4	5.83|5.83	4.66|4.66	0.58398|0.58398	.|Fragile site-associated protein, C-terminal (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.52725|0.52725	0.1752|0.1752	M|M	0.73217|0.73217	2.22|2.22	0.80722|0.80722	D|D	1|1	.|B;B	.|0.18013	.|0.015;0.025	.|B;B	.|0.20184	.|0.011;0.028	T|T	0.53358|0.53358	-0.8450|-0.8450	5|10	.|0.87932	.|D	.|0	.|.	11.6639|11.6639	0.51363|0.51363	0.0:0.069:0.0:0.931|0.0:0.069:0.0:0.931	.|.	.|4679;4680	.|Q2LD37-4;Q2LD37	.|.;K1109_HUMAN	L|P	1056|4680;4680;1349;281	.|ENSP00000264501:L4680P;ENSP00000373390:L4680P;ENSP00000410874:L1349P	.|ENSP00000264501:L4680P	F|L	+|+	1|2	0|0	KIAA1109|KIAA1109	123493698|123493698	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	6.295000|6.295000	0.72744|0.72744	1.053000|1.053000	0.40415|0.40415	0.477000|0.477000	0.44152|0.44152	TTT|CTT	.		0.373	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
MT-ND2	4536	hgsc.bcm.edu	37	M	5248	5248	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chrM:5248T>C	ENST00000361453.3	+	1	779	c.779T>C	c.(778-780)tTt>tCt	p.F260S	MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TC_ENST00000387405.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-CO1_ENST00000361624.2_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TQ_ENST00000387372.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2	260					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						GCTAACCGGCTTTTTGCCCAA	0.488																																					p.F260S		.											.	.	.	0			c.T779C						.																																			SO:0001583	missense	0	exon1			CCGGCTTTTTGCC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891		ENST00000361453.3:c.779T>C	M.37:g.5248T>C	ENSP00000355046:p.Phe260Ser	Somatic	27	0		WXS	Illumina HiSeq	.	65	32	ENST00000361453	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	Missense_Mutation	SNP	ENST00000361453.3	37																																																																																				.		0.488	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024027	
PLCE1	51196	hgsc.bcm.edu	37	10	96043701	96043701	+	Intron	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr10:96043701G>T	ENST00000371380.3	+	20	5152				PLCE1-AS1_ENST00000596633.1_RNA|PLCE1-AS1_ENST00000425267.3_RNA|PLCE1_ENST00000260766.3_Intron|PLCE1_ENST00000371385.3_Intron|PLCE1_ENST00000371375.1_Intron|PLCE1-AS1_ENST00000440198.1_RNA			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1						activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				ATGACACTTTGACCATGTGGT	0.423																																					.		.											.	.	.	0			.						.						87.0	87.0	87.0					10																	96043701		1927	4131	6058	SO:0001627	intron_variant	0	.			CACTTTGACCATG		CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.4917+33G>T	10.37:g.96043701G>T		Somatic	52	0		WXS	Illumina HiSeq	.	80	4	.	A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	RNA	SNP	ENST00000371380.3	37	CCDS41552.1																																																																																			.		0.423	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049469.3	NM_016341	
R3HDM2	22864	hgsc.bcm.edu	37	12	57663156	57663156	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr12:57663156G>A	ENST00000347140.3	-	16	2012	c.1622C>T	c.(1621-1623)gCc>gTc	p.A541V	R3HDM2_ENST00000402412.1_Missense_Mutation_p.A555V|R3HDM2_ENST00000441731.2_Missense_Mutation_p.A236V|R3HDM2_ENST00000358907.2_Missense_Mutation_p.A541V|R3HDM2_ENST00000413953.2_Missense_Mutation_p.A268V|RP11-123K3.4_ENST00000548184.1_3'UTR|R3HDM2_ENST00000546843.1_5'Flank|R3HDM2_ENST00000403821.2_Missense_Mutation_p.A575V			Q9Y2K5	R3HD2_HUMAN	R3H domain containing 2	541	Gln-rich.					nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	22						GGGGCTATAGGCCACCGGGTG	0.527																																					p.A541V		.											.	.	.	0			c.C1622T						.						97.0	101.0	99.0					12																	57663156		2203	4300	6503	SO:0001583	missense	22864	exon14			CTATAGGCCACCG	AB023219	CCDS8937.2	12q13.3	2012-11-19			ENSG00000179912	ENSG00000179912			29167	protein-coding gene	gene with protein product							Standard	NM_014925		Approved	KIAA1002	uc009zpm.1	Q9Y2K5	OTTHUMG00000171568	ENST00000347140.3:c.1622C>T	12.37:g.57663156G>A	ENSP00000317903:p.Ala541Val	Somatic	68	0		WXS	Illumina HiSeq	.	95	4	NM_014925	Q2M1T9|Q3ZCT5	Missense_Mutation	SNP	ENST00000347140.3	37	CCDS8937.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.0|23.0	4.366421|4.366421	0.82463|0.82463	.|.	.|.	ENSG00000179912|ENSG00000179912	ENST00000413953;ENST00000393811;ENST00000347140;ENST00000402412;ENST00000358907;ENST00000441731;ENST00000429355;ENST00000403821|ENST00000466401	T;T;T;T;T;T;T;T|.	0.42900|.	0.96;0.96;0.96;0.96;0.96;0.96;0.96;0.96|.	5.14|5.14	5.14|5.14	0.70334|0.70334	.|.	0.059240|.	0.64402|.	D|.	0.000002|.	T|T	0.54615|0.54615	0.1869|0.1869	N|N	0.22421|0.22421	0.69|0.69	0.53005|0.53005	D|D	0.999961|0.999961	B;B;B;B;B|.	0.31548|.	0.328;0.191;0.191;0.061;0.328|.	B;B;B;B;B|.	0.31101|.	0.124;0.049;0.049;0.03;0.079|.	T|T	0.47394|0.47394	-0.9121|-0.9121	10|5	0.12766|.	T|.	0.61|.	-11.1643|-11.1643	17.9125|17.9125	0.88938|0.88938	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	268;575;555;541;268|.	B4DDZ2;B5MCG9;B5MCU0;Q9Y2K5;E9PAL1|.	.;.;.;R3HD2_HUMAN;.|.	V|S	268;268;541;555;541;236;306;575|139	ENSP00000409146:A268V;ENSP00000377400:A268V;ENSP00000317903:A541V;ENSP00000385839:A555V;ENSP00000351784:A541V;ENSP00000408536:A236V;ENSP00000394676:A306V;ENSP00000385169:A575V|.	ENSP00000317903:A541V|.	A|P	-|-	2|1	0|0	R3HDM2|R3HDM2	55949423|55949423	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.855000|5.855000	0.69510|0.69510	2.840000|2.840000	0.97914|0.97914	0.655000|0.655000	0.94253|0.94253	GCC|CCT	.		0.527	R3HDM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326570.2	NM_014925	
IMP4	92856	hgsc.bcm.edu	37	2	131103674	131103674	+	Nonsense_Mutation	SNP	C	C	A			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr2:131103674C>A	ENST00000259239.3	+	7	1386	c.678C>A	c.(676-678)taC>taA	p.Y226*	IMP4_ENST00000409935.1_Nonsense_Mutation_p.Y226*	NM_033416.1	NP_219484.1	Q96G21	IMP4_HUMAN	IMP4, U3 small nucleolar ribonucleoprotein	226	Brix. {ECO:0000255|PROSITE- ProRule:PRU00034}.				rRNA processing (GO:0006364)	nucleolus (GO:0005730)|ribonucleoprotein complex (GO:0030529)				central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|skin(1)|urinary_tract(1)	18	Colorectal(110;0.1)					AGGACGACTACATATCATTCC	0.587																																					p.Y226X		.											IMP4,colon,carcinoma,+2,2	IMP4	+2	0			c.C678A						.						116.0	113.0	114.0					2																	131103674		2203	4300	6503	SO:0001587	stop_gained	92856	exon7			CGACTACATATCA	BC010042	CCDS2160.1	2q21.1	2014-02-19	2014-02-19		ENSG00000136718	ENSG00000136718			30856	protein-coding gene	gene with protein product		612981	"""IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast)"""			8619474, 9110174, 12655004	Standard	NM_033416		Approved	MGC19606, BXDC4	uc002tra.1	Q96G21	OTTHUMG00000131627	ENST00000259239.3:c.678C>A	2.37:g.131103674C>A	ENSP00000259239:p.Tyr226*	Somatic	31	0		WXS	Illumina HiSeq	.	42	2	NM_033416	Q3ZTT3	Nonsense_Mutation	SNP	ENST00000259239.3	37	CCDS2160.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	42|42	9.647995|9.647995	0.99229|0.99229	.|.	.|.	ENSG00000136718|ENSG00000136718	ENST00000452955|ENST00000259239;ENST00000409935;ENST00000409649;ENST00000428740	.|.	.|.	.|.	5.74|5.74	1.11|1.11	0.20524|0.20524	.|.	.|0.109673	.|0.64402	.|D	.|0.000005	T|.	0.16896|.	0.0406|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.38887|.	-0.9640|.	3|.	.|0.02654	.|T	.|1	-31.0834|-31.0834	8.0784|8.0784	0.30731|0.30731	0.0:0.4894:0.0:0.5106|0.0:0.4894:0.0:0.5106	.|.	.|.	.|.	.|.	K|X	215|226;226;141;171	.|.	.|ENSP00000259239:Y226X	T|Y	+|+	2|3	0|2	IMP4|IMP4	130820144|130820144	0.993000|0.993000	0.37304|0.37304	1.000000|1.000000	0.80357|0.80357	0.858000|0.858000	0.48976|0.48976	0.310000|0.310000	0.19356|0.19356	0.212000|0.212000	0.20703|0.20703	0.655000|0.655000	0.94253|0.94253	ACA|TAC	.		0.587	IMP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254520.2	NM_033416	
GRM5	2915	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	88323786	88323786	+	Missense_Mutation	SNP	G	G	C			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr11:88323786G>C	ENST00000305447.4	-	6	1822	c.1673C>G	c.(1672-1674)cCc>cGc	p.P558R	GRM5_ENST00000418177.2_Missense_Mutation_p.P558R|GRM5_ENST00000455756.2_Missense_Mutation_p.P558R|GRM5_ENST00000305432.5_Missense_Mutation_p.P558R|GRM5_ENST00000393297.1_Missense_Mutation_p.P558R	NM_001143831.2	NP_001137303.1	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5	558					activation of MAPKKK activity (GO:0000185)|cognition (GO:0050890)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of locomotion (GO:0040013)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(1)|breast(5)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(18)|lung(40)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)|Rufinamide(DB06201)	ATCATCAGTGGGCCAAGACCC	0.468																																					p.P558R		.											.	.	.	0			c.C1673G						.						130.0	99.0	109.0					11																	88323786		2201	4299	6500	SO:0001583	missense	2915	exon7			TCAGTGGGCCAAG	D28538	CCDS8283.1, CCDS44694.1	11q14.3	2014-06-12			ENSG00000168959	ENSG00000168959		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4597	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 86"""	604102				7908515	Standard	NM_001143831		Approved	MGLUR5, GPRC1E, mGlu5, PPP1R86	uc001pcq.3	P41594	OTTHUMG00000134306	ENST00000305447.4:c.1673C>G	11.37:g.88323786G>C	ENSP00000306138:p.Pro558Arg	Somatic	48	0		WXS	Illumina HiSeq	.	63	23	NM_000842	Q6J164	Missense_Mutation	SNP	ENST00000305447.4	37	CCDS44694.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.214082	0.79352	.	.	ENSG00000168959	ENST00000418177;ENST00000455756;ENST00000305432;ENST00000305447;ENST00000393297	D;D;D;D;D	0.91521	-2.86;-2.86;-2.86;-2.86;-2.86	5.06	5.06	0.68205	GPCR, family 3, nine cysteines domain (1);	0.000000	0.85682	D	0.000000	D	0.96932	0.8998	H	0.95745	3.715	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98212	1.0473	9	.	.	.	.	18.4206	0.90588	0.0:0.0:1.0:0.0	.	558;558	P41594-2;P41594	.;GRM5_HUMAN	R	558	ENSP00000402912:P558R;ENSP00000405690:P558R;ENSP00000305905:P558R;ENSP00000306138:P558R;ENSP00000376975:P558R	.	P	-	2	0	GRM5	87963434	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.437000	0.97535	2.363000	0.80096	0.655000	0.94253	CCC	.		0.468	GRM5-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259226.1	NM_000842	
URI1	8725	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	30476190	30476190	+	Silent	SNP	A	A	G			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr19:30476190A>G	ENST00000542441.2	+	3	510	c.213A>G	c.(211-213)aaA>aaG	p.K71K	URI1_ENST00000312051.6_Silent_p.K31K|URI1_ENST00000360605.4_Silent_p.K53K|URI1_ENST00000392271.1_5'UTR			O94763	RMP_HUMAN	URI1, prefoldin-like chaperone	71					cellular response to growth factor stimulus (GO:0071363)|cellular response to steroid hormone stimulus (GO:0071383)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of phosphatase activity (GO:0010923)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)|regulation of cell growth (GO:0001558)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to virus (GO:0009615)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, core complex (GO:0005665)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	chromatin binding (GO:0003682)|protein phosphatase inhibitor activity (GO:0004864)|RNA polymerase II transcription corepressor activity (GO:0001106)										TGCCTGATAAATTGTCTTATA	0.338																																					p.K71K		.											.	.	.	0			c.A213G						.						187.0	191.0	190.0					19																	30476190		2203	4300	6503	SO:0001819	synonymous_variant	8725	exon3			TGATAAATTGTCT	AF091095	CCDS12420.1, CCDS58658.1	19q12	2012-04-17	2011-11-21	2011-11-21	ENSG00000105176	ENSG00000105176		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	13236	protein-coding gene	gene with protein product	"""unconventional prefoldin RPB5 interactor"", ""RPB5-mediating protein"", ""protein phosphatase 1, regulatory subunit 19"""	603494	"""chromosome 19 open reading frame 2"""	C19orf2		9878255, 9819440	Standard	NM_003796		Approved	RMP, NNX3, FLJ10575, URI, PPP1R19	uc002nsr.3	O94763		ENST00000542441.2:c.213A>G	19.37:g.30476190A>G		Somatic	74	0		WXS	Illumina HiSeq	.	126	61	NM_003796	A8K805|H7BY42|Q8TC23|Q9UNU3	Silent	SNP	ENST00000542441.2	37	CCDS12420.1																																																																																			.		0.338	URI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439756.1	NM_134447	
FRG1B	284802	hgsc.bcm.edu	37	20	29627943	29627943	+	Intron	SNP	G	G	A	rs199660536		TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr20:29627943G>A	ENST00000278882.3	+	6	608				FRG1B_ENST00000358464.4_Intron|FRG1B_ENST00000439954.2_Intron			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B											endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						AATTTTCCAAGCAGAACTAAA	0.254																																					.		.											.	.	.	0			.						.																																			SO:0001627	intron_variant	284802	.			TTCCAAGCAGAAC			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.229-284G>A	20.37:g.29627943G>A		Somatic	7	0		WXS	Illumina HiSeq	.	21	5	.	C4AME5	RNA	SNP	ENST00000278882.3	37																																																																																				.		0.254	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
NSD1	64324	hgsc.bcm.edu	37	5	176709524	176709524	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr5:176709524G>T	ENST00000439151.2	+	19	5996	c.5951G>T	c.(5950-5952)cGa>cTa	p.R1984L	NSD1_ENST00000347982.4_Missense_Mutation_p.R1715L|NSD1_ENST00000354179.4_Missense_Mutation_p.R1715L|NSD1_ENST00000361032.4_Missense_Mutation_p.R1881L	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	1984	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.		R -> Q (in SOTOS1; loss of enzyme activity). {ECO:0000269|PubMed:12807965}.		gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.R1984Q(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		TGCAGAGCTCGAATTCGCTAT	0.373			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																											p.R1984L		.		Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	NSD1_ENST00000439151,bladder,carcinoma,0,3	NSD1_ENST00000439151	0	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.G5951T	GRCh37	CM031304	NSD1	M		.						212.0	208.0	209.0					5																	176709524		2203	4300	6503	SO:0001583	missense	64324	exon19	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	GAGCTCGAATTCG	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.5951G>T	5.37:g.176709524G>T	ENSP00000395929:p.Arg1984Leu	Somatic	35	0		WXS	Illumina HiSeq	.	49	2	NM_022455	Q96PD8|Q96RN7	Missense_Mutation	SNP	ENST00000439151.2	37	CCDS4412.1	.	.	.	.	.	.	.	.	.	.	G	35	5.415715	0.96092	.	.	ENSG00000165671	ENST00000354179;ENST00000439151;ENST00000347982;ENST00000361032	D;D;D;D	0.91894	-2.93;-2.93;-2.93;-2.93	5.77	5.77	0.91146	SET domain (3);	0.000000	0.48767	D	0.000166	D	0.97885	0.9305	H	0.98178	4.165	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.994	D	0.98593	1.0655	10	0.87932	D	0	.	19.9576	0.97228	0.0:0.0:1.0:0.0	.	1715;1984	Q96L73-2;Q96L73	.;NSD1_HUMAN	L	1715;1984;1715;1881	ENSP00000346111:R1715L;ENSP00000395929:R1984L;ENSP00000343209:R1715L;ENSP00000354310:R1881L	ENSP00000343209:R1715L	R	+	2	0	NSD1	176642130	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	8.021000	0.88750	2.884000	0.98904	0.655000	0.94253	CGA	.		0.373	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253412.2	NM_172349	
TIMP3	7078	hgsc.bcm.edu;bcgsc.ca	37	22	33254019	33254019	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr22:33254019G>T	ENST00000266085.6	+	4	633	c.332G>T	c.(331-333)gGc>gTc	p.G111V	SYN3_ENST00000332840.5_Intron|SYN3_ENST00000358763.2_Intron	NM_000362.4	NP_000353.1	P35625	TIMP3_HUMAN	TIMP metallopeptidase inhibitor 3	111	Mediates interaction with EFEMP1.|NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				cellular response to organic substance (GO:0071310)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)			endometrium(2)|large_intestine(3)|lung(1)|urinary_tract(1)	7						GTCTATGATGGCAAGATGTAC	0.527																																					p.G111V		.											.	.	.	0			c.G332T						.						114.0	101.0	105.0					22																	33254019		2203	4300	6503	SO:0001583	missense	7078	exon4			ATGATGGCAAGAT		CCDS13911.1	22q12.3	2013-01-08	2008-07-31		ENSG00000100234	ENSG00000100234			11822	protein-coding gene	gene with protein product		188826	"""tissue inhibitor of metalloproteinase 3 (Sorsby fundus dystrophy, pseudoinflammatory)"""	SFD		8188246, 12652295	Standard	NM_000362		Approved		uc003anb.3	P35625	OTTHUMG00000030784	ENST00000266085.6:c.332G>T	22.37:g.33254019G>T	ENSP00000266085:p.Gly111Val	Somatic	63	0		WXS	Illumina HiSeq	.	88	4	NM_000362	B2RBY9|Q5THV4|Q9UC74|Q9UGS2	Missense_Mutation	SNP	ENST00000266085.6	37	CCDS13911.1	.	.	.	.	.	.	.	.	.	.	G	13.92	2.381544	0.42207	.	.	ENSG00000100234	ENST00000266085;ENST00000538671;ENST00000382049	D	0.97209	-4.29	5.34	3.21	0.36854	Tissue inhibitor of metalloproteinases-like, OB-fold (1);Netrin domain (1);	0.219358	0.46758	N	0.000275	D	0.96540	0.8871	M	0.89095	3.005	0.80722	D	1	B	0.15141	0.012	B	0.19391	0.025	D	0.94157	0.7411	10	0.87932	D	0	-26.3324	10.0749	0.42355	0.0715:0.0:0.7906:0.1378	.	111	P35625	TIMP3_HUMAN	V	111;45;111	ENSP00000266085:G111V	ENSP00000266085:G111V	G	+	2	0	TIMP3	31584019	1.000000	0.71417	0.337000	0.25536	0.145000	0.21501	5.972000	0.70448	0.606000	0.29965	0.561000	0.74099	GGC	.		0.527	TIMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075672.2	NM_000362	
SLC17A6	57084	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	22381017	22381017	+	Missense_Mutation	SNP	G	G	A	rs201082803		TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr11:22381017G>A	ENST00000263160.3	+	4	954	c.517G>A	c.(517-519)Gcc>Acc	p.A173T	CTD-2140G10.4_ENST00000534543.1_RNA	NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	173					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						TCCATCAGCAGCCAGAGTGCA	0.403																																					p.A173T		.											.	.	.	0			c.G517A						.						150.0	136.0	141.0					11																	22381017		2203	4300	6503	SO:0001583	missense	57084	exon4			TCAGCAGCCAGAG	AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.517G>A	11.37:g.22381017G>A	ENSP00000263160:p.Ala173Thr	Somatic	57	0		WXS	Illumina HiSeq	.	76	27	NM_020346	A6NKS2	Missense_Mutation	SNP	ENST00000263160.3	37	CCDS7856.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.027283	0.93518	.	.	ENSG00000091664	ENST00000263160;ENST00000546171	T	0.61392	0.11	5.29	5.29	0.74685	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.68467	0.3004	M	0.73217	2.22	0.80722	D	1	P	0.34522	0.455	P	0.44811	0.461	T	0.69053	-0.5247	10	0.51188	T	0.08	.	19.2877	0.94085	0.0:0.0:1.0:0.0	.	173	Q9P2U8	VGLU2_HUMAN	T	173;61	ENSP00000263160:A173T	ENSP00000263160:A173T	A	+	1	0	SLC17A6	22337593	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.476000	0.97823	2.638000	0.89438	0.585000	0.79938	GCC	0.001		0.403	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387671.1	NM_020346	
SHANK2	22941	hgsc.bcm.edu	37	11	70332552	70332552	+	Silent	SNP	G	G	A			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr11:70332552G>A	ENST00000423696.2	-	15	2745	c.2709C>T	c.(2707-2709)taC>taT	p.Y903Y	SHANK2_ENST00000409161.1_Silent_p.Y686Y|SHANK2_ENST00000338508.4_Silent_p.Y1283Y|SHANK2_ENST00000449833.2_Silent_p.Y687Y			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	903					adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			GGTCGGTCTCGTACTTGTTCT	0.607																																					p.Y694Y		.											.	.	.	0			c.C2082T						.						100.0	99.0	99.0					11																	70332552		2200	4294	6494	SO:0001819	synonymous_variant	22941	exon10			GGTCTCGTACTTG	AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.2709C>T	11.37:g.70332552G>A		Somatic	34	0		WXS	Illumina HiSeq	.	50	3	NM_133266	C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Silent	SNP	ENST00000423696.2	37																																																																																				.		0.607	SHANK2-203	KNOWN	basic	protein_coding	protein_coding		NM_012309	
NOL4	8715	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	31803205	31803205	+	Missense_Mutation	SNP	G	G	C			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr18:31803205G>C	ENST00000261592.5	-	1	310	c.13C>G	c.(13-15)Cgc>Ggc	p.R5G	NOL4_ENST00000269185.4_5'UTR|NOL4_ENST00000589544.1_Missense_Mutation_p.R5G|NOL4_ENST00000538587.1_5'Flank|RP11-379L18.1_ENST00000587528.1_RNA|NOL4_ENST00000535475.1_5'Flank|NOL4_ENST00000590846.1_5'Flank	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	O94818	NOL4_HUMAN	nucleolar protein 4	5						nucleolus (GO:0005730)	RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	51						TACATGTCGCGCTCGCTCTCC	0.612																																					p.R5G		.											NOL4,NS,carcinoma,0,1	NOL4	0	0			c.C13G						.						81.0	85.0	83.0					18																	31803205		2057	4198	6255	SO:0001583	missense	8715	exon1			TGTCGCGCTCGCT	AB017800	CCDS11907.2, CCDS56058.1, CCDS56059.1, CCDS59308.1	18q12	2010-05-04			ENSG00000101746	ENSG00000101746			7870	protein-coding gene	gene with protein product	"""cancer/testis antigen 125"""	603577				9813152	Standard	NM_003787		Approved	NOLP, HRIHFB2255, CT125	uc010dmi.3	O94818	OTTHUMG00000132291	ENST00000261592.5:c.13C>G	18.37:g.31803205G>C	ENSP00000261592:p.Arg5Gly	Somatic	20	0		WXS	Illumina HiSeq	.	24	7	NM_003787	B4DSQ0|B7Z3Z7|F5H1E3|Q6IBS2|Q9BWF1	Missense_Mutation	SNP	ENST00000261592.5	37	CCDS11907.2	.	.	.	.	.	.	.	.	.	.	G	17.81	3.481633	0.63849	.	.	ENSG00000101746	ENST00000261592	D	0.83992	-1.79	5.7	5.7	0.88788	.	.	.	.	.	D	0.87103	0.6094	L	0.34521	1.04	0.80722	D	1	D;D	0.63046	0.992;0.992	D;D	0.70487	0.969;0.969	D	0.87633	0.2517	9	0.59425	D	0.04	-5.92	18.4166	0.90572	0.0:0.0:1.0:0.0	.	5;5	O94818;O94818-2	NOL4_HUMAN;.	G	5	ENSP00000261592:R5G	ENSP00000261592:R5G	R	-	1	0	NOL4	30057203	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.889000	0.75627	2.690000	0.91761	0.655000	0.94253	CGC	.		0.612	NOL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255386.1	NM_003787	
PLEKHG5	57449	hgsc.bcm.edu	37	1	6529206	6529206	+	Silent	SNP	C	C	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr1:6529206C>T	ENST00000400915.3	-	20	2379	c.2313G>A	c.(2311-2313)gaG>gaA	p.E771E	PLEKHG5_ENST00000377725.1_Silent_p.E715E|PLEKHG5_ENST00000537245.1_Silent_p.E794E|PLEKHG5_ENST00000340850.5_Silent_p.E715E|PLEKHG5_ENST00000377740.3_Silent_p.E792E|TNFRSF25_ENST00000377782.3_5'Flank|PLEKHG5_ENST00000377732.1_Silent_p.E752E|PLEKHG5_ENST00000377748.1_Silent_p.E792E|PLEKHG5_ENST00000535355.1_Silent_p.E784E|PLEKHG5_ENST00000377728.3_Silent_p.E715E|PLEKHG5_ENST00000400913.1_Silent_p.E715E|PLEKHG5_ENST00000377737.2_Silent_p.E715E|TNFRSF25_ENST00000356876.3_5'Flank|PLEKHG5_ENST00000544978.1_Silent_p.E715E|TNFRSF25_ENST00000351959.5_5'Flank	NM_001042663.1	NP_001036128.1	O94827	PKHG5_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 5	771	Glu-rich.				apoptotic signaling pathway (GO:0097190)|endothelial cell chemotaxis (GO:0035767)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			liver(1)	1	Ovarian(185;0.02)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;5.51e-35)|GBM - Glioblastoma multiforme(13;3.57e-27)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00159)|READ - Rectum adenocarcinoma(331;0.0419)		cctcctcctcctcttcctcct	0.637																																					p.E794E		.											PLEKHG5_ENST00000377748,colon,carcinoma,0,1	PLEKHG5_ENST00000377748	0	0			c.G2382A						.						75.0	76.0	76.0					1																	6529206		2203	4300	6503	SO:0001819	synonymous_variant	57449	exon20			CTCCTCCTCTTCC	AK024676	CCDS79.1, CCDS41240.1, CCDS41241.1, CCDS57967.1, CCDS57968.1, CCDS57969.1	1p36.31	2014-09-17		2005-08-09	ENSG00000171680	ENSG00000171680		"""Pleckstrin homology (PH) domain containing"""	29105	protein-coding gene	gene with protein product	"""synectin-binding guanine exchange factor"""	611101				17564964	Standard	NM_001042663		Approved	KIAA0720, Syx, GEF720, Tech	uc010nzr.1	O94827	OTTHUMG00000000905	ENST00000400915.3:c.2313G>A	1.37:g.6529206C>T		Somatic	18	0		WXS	Illumina HiSeq	.	12	2	NM_001265592	B3KU07|B7Z2M3|B7Z5X2|F5GZ21|F5H1I0|Q5SY17|Q5T8W5|Q5T8W9|Q6ZNM0|Q7Z436|Q86YD8|Q96BS1	Silent	SNP	ENST00000400915.3	37	CCDS41241.1																																																																																			.		0.637	PLEKHG5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000002631.1	NM_020631	
ANK3	288	hgsc.bcm.edu	37	10	61959898	61959898	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr10:61959898C>T	ENST00000280772.2	-	13	1671	c.1480G>A	c.(1480-1482)Gct>Act	p.A494T	ANK3_ENST00000373827.2_Missense_Mutation_p.A488T|ANK3_ENST00000503366.1_Missense_Mutation_p.A477T	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	494					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.A494S(1)		NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						TTAGCTTTAGCTTCTACCTGA	0.433																																					p.A494T		.											ANK3,colon,carcinoma,0,1	ANK3	0	1	Substitution - Missense(1)	large_intestine(1)	c.G1480A						.						92.0	82.0	86.0					10																	61959898		2203	4300	6503	SO:0001583	missense	288	exon13			CTTTAGCTTCTAC	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.1480G>A	10.37:g.61959898C>T	ENSP00000280772:p.Ala494Thr	Somatic	25	0		WXS	Illumina HiSeq	.	48	2	NM_020987	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	37	CCDS7258.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.167603	0.78339	.	.	ENSG00000151150	ENST00000280772;ENST00000373827;ENST00000503366;ENST00000395299;ENST00000395293;ENST00000395304;ENST00000536348	T;T;T	0.66280	-0.2;-0.2;-0.2	5.81	5.81	0.92471	Ankyrin repeat-containing domain (4);	0.000000	0.39985	N	0.001209	T	0.66557	0.2801	M	0.62723	1.935	0.80722	D	1	B;P;B;B;B	0.46142	0.259;0.873;0.013;0.126;0.092	B;B;B;B;B	0.43360	0.068;0.417;0.045;0.078;0.05	T	0.69650	-0.5088	10	0.59425	D	0.04	.	20.1454	0.98074	0.0:1.0:0.0:0.0	.	477;155;38;488;494	E9PE32;E7EMJ1;Q59G01;Q5CZH9;Q12955	.;.;.;.;ANK3_HUMAN	T	494;488;477;456;155;155;38	ENSP00000280772:A494T;ENSP00000362933:A488T;ENSP00000425236:A477T	ENSP00000280772:A494T	A	-	1	0	ANK3	61629904	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	3.900000	0.56295	2.749000	0.94314	0.650000	0.86243	GCT	.		0.433	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
UNC13A	23025	hgsc.bcm.edu	37	19	17756910	17756910	+	Silent	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr19:17756910G>T	ENST00000519716.2	-	18	2054	c.2055C>A	c.(2053-2055)gcC>gcA	p.A685A	UNC13A_ENST00000551649.1_Silent_p.A685A|UNC13A_ENST00000252773.7_Silent_p.A685A|UNC13A_ENST00000552293.1_Silent_p.A685A|UNC13A_ENST00000428389.2_Silent_p.A773A|UNC13A_ENST00000550896.1_Silent_p.A683A	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	685	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						GCAAGCCCTGGGCGCAGACCA	0.557																																					p.A685A		.											.	.	.	0			c.C2055A						.						68.0	66.0	67.0					19																	17756910		2075	4243	6318	SO:0001819	synonymous_variant	23025	exon17			GCCCTGGGCGCAG	AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.2055C>A	19.37:g.17756910G>T		Somatic	40	0		WXS	Illumina HiSeq	.	40	4	NM_001080421	E5RHY9	Silent	SNP	ENST00000519716.2	37	CCDS46013.2																																																																																			.		0.557	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376169.2	XM_038604	
ZNF345	25850	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	37367799	37367799	+	Missense_Mutation	SNP	C	C	G			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr19:37367799C>G	ENST00000529555.1	+	2	855	c.67C>G	c.(67-69)Cag>Gag	p.Q23E	ZNF345_ENST00000420450.1_Missense_Mutation_p.Q23E|ZNF345_ENST00000432005.2_Intron|ZNF345_ENST00000526123.1_Intron|ZNF345_ENST00000589046.1_Missense_Mutation_p.Q23E			Q14585	ZN345_HUMAN	zinc finger protein 345	23					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|ovary(2)|prostate(1)	24	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ATGTAAAAACCAGTTTGAGAG	0.373																																					p.Q23E		.											.	.	.	0			c.C67G						.						90.0	88.0	89.0					19																	37367799		2203	4300	6503	SO:0001583	missense	25850	exon4			AAAAACCAGTTTG	X78933	CCDS12497.1	19q13.12	2013-01-08			ENSG00000251247	ENSG00000251247		"""Zinc fingers, C2H2-type"""	16367	protein-coding gene	gene with protein product						7865130	Standard	NM_003419		Approved	HZF10	uc002oey.4	Q14585	OTTHUMG00000048162	ENST00000529555.1:c.67C>G	19.37:g.37367799C>G	ENSP00000431202:p.Gln23Glu	Somatic	44	0		WXS	Illumina HiSeq	.	93	5	NM_001242476		Missense_Mutation	SNP	ENST00000529555.1	37	CCDS12497.1	.	.	.	.	.	.	.	.	.	.	C	9.800	1.180366	0.21787	.	.	ENSG00000251247	ENST00000532141;ENST00000420450;ENST00000529555;ENST00000331800	T;T;T;T	0.07114	5.76;3.34;3.34;3.22	4.32	3.29	0.37713	.	.	.	.	.	T	0.08537	0.0212	L	0.58101	1.795	0.21822	N	0.999527	B	0.22851	0.076	B	0.15870	0.014	T	0.35201	-0.9798	9	0.14252	T	0.57	.	7.9816	0.30188	0.0:0.8906:0.0:0.1094	.	23	Q14585	ZN345_HUMAN	E	23	ENSP00000431289:Q23E;ENSP00000431216:Q23E;ENSP00000431202:Q23E;ENSP00000331120:Q23E	ENSP00000331120:Q23E	Q	+	1	0	ZNF345	42059639	0.002000	0.14202	1.000000	0.80357	0.990000	0.78478	0.509000	0.22707	1.381000	0.46364	0.655000	0.94253	CAG	.		0.373	ZNF345-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388258.1		
PEG3	5178	hgsc.bcm.edu	37	19	57324204	57324204	+	3'UTR	SNP	A	A	C			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr19:57324204A>C	ENST00000326441.9	-	0	5969				PEG3_ENST00000423103.2_3'UTR|ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000593711.1_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3						apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		AAAAAAACCCAGAACACAAAT	0.328																																					.		.											.	.	.	0			.						.																																			SO:0001624	3_prime_UTR_variant	100169890	.			AAACCCAGAACAC	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.*839T>G	19.37:g.57324204A>C		Somatic	63	0		WXS	Illumina HiSeq	.	134	9	.	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	RNA	SNP	ENST00000326441.9	37	CCDS12948.1																																																																																			.		0.328	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2		
LRRK2	120892	hgsc.bcm.edu	37	12	40668732	40668732	+	Silent	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr12:40668732G>T	ENST00000298910.7	+	16	1936	c.1878G>T	c.(1876-1878)ctG>ctT	p.L626L	LRRK2_ENST00000343742.2_Silent_p.L626L	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	626					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				CTGGACATCTGCTGGCAAAAA	0.333																																					p.L626L		.											.	.	.	0			c.G1878T						.						102.0	106.0	105.0					12																	40668732		2203	4300	6503	SO:0001819	synonymous_variant	120892	exon16			ACATCTGCTGGCA	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.1878G>T	12.37:g.40668732G>T		Somatic	33	0		WXS	Illumina HiSeq	.	97	4	NM_198578	A6NJU2|Q6ZS50|Q8NCX9	Silent	SNP	ENST00000298910.7	37	CCDS31774.1																																																																																			.		0.333	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513	
KRT74	121391	hgsc.bcm.edu	37	12	52961454	52961454	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr12:52961454G>T	ENST00000305620.2	-	8	1426	c.1379C>A	c.(1378-1380)tCt>tAt	p.S460Y	KRT74_ENST00000549343.1_Missense_Mutation_p.S474Y	NM_175053.3	NP_778223.2	Q7RTS7	K2C74_HUMAN	keratin 74	460	Tail.				intermediate filament cytoskeleton organization (GO:0045104)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	keratin filament binding (GO:1990254)|structural molecule activity (GO:0005198)			kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	28				BRCA - Breast invasive adenocarcinoma(357;0.191)		GATGCTCACAGAGGATGGATT	0.463																																					p.S460Y		.											.	.	.	0			c.C1379A						.						66.0	62.0	64.0					12																	52961454		2203	4300	6503	SO:0001583	missense	121391	exon8			CTCACAGAGGATG	BK000977	CCDS8832.1	12q13.13	2013-06-25			ENSG00000170484	ENSG00000170484		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28929	protein-coding gene	gene with protein product		608248				12648212, 16831889	Standard	NM_175053		Approved	K6IRS4, KRT5C, KRT6IRS4	uc001sap.1	Q7RTS7	OTTHUMG00000169658	ENST00000305620.2:c.1379C>A	12.37:g.52961454G>T	ENSP00000307240:p.Ser460Tyr	Somatic	40	0		WXS	Illumina HiSeq	.	64	4	NM_175053	B5MD61|Q86Y45	Missense_Mutation	SNP	ENST00000305620.2	37	CCDS8832.1	.	.	.	.	.	.	.	.	.	.	G	18.79	3.698897	0.68501	.	.	ENSG00000170484	ENST00000549343;ENST00000305620	D;D	0.83250	-1.7;-1.66	5.12	5.12	0.69794	.	0.000000	0.33309	N	0.005050	D	0.84642	0.5517	M	0.62723	1.935	0.80722	D	1	P	0.50943	0.94	P	0.48030	0.564	D	0.86934	0.2075	10	0.87932	D	0	.	15.8213	0.78648	0.0:0.0:1.0:0.0	.	460	Q7RTS7	K2C74_HUMAN	Y	474;460	ENSP00000447447:S474Y;ENSP00000307240:S460Y	ENSP00000307240:S460Y	S	-	2	0	KRT74	51247721	0.014000	0.17966	0.712000	0.30502	0.835000	0.47333	1.516000	0.35856	2.550000	0.86006	0.563000	0.77884	TCT	.		0.463	KRT74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405324.1	NM_175053	
ABCC2	1244	hgsc.bcm.edu	37	10	101567200	101567200	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr10:101567200G>T	ENST00000370449.4	+	12	1703	c.1590G>T	c.(1588-1590)aaG>aaT	p.K530N		NM_000392.3	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 2	530	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular chloride ion homeostasis (GO:0030644)|drug transmembrane transport (GO:0006855)|prostaglandin transport (GO:0015732)|response to arsenic-containing substance (GO:0046685)|response to estrogen (GO:0043627)|response to heat (GO:0009408)|response to methotrexate (GO:0031427)|response to oxidative stress (GO:0006979)|thyroid hormone transport (GO:0070327)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(5)|endometrium(9)|kidney(2)|large_intestine(20)|liver(1)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	67		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Aminohippurate(DB00345)|Arsenic trioxide(DB01169)|Atorvastatin(DB01076)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carboplatin(DB00958)|Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Eprosartan(DB00876)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Ezetimibe(DB00973)|Furosemide(DB00695)|Fusidic Acid(DB02703)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Leucovorin(DB00650)|Levetiracetam(DB01202)|Lomefloxacin(DB00978)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nifedipine(DB01115)|Norgestimate(DB00957)|Ofloxacin(DB01165)|Olmesartan(DB00275)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Ritonavir(DB00503)|Saquinavir(DB01232)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Sulfasalazine(DB00795)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Tenofovir(DB00300)|Tetrahydrofolic acid(DB00116)|Ursodeoxycholic acid(DB01586)|Vasopressin(DB00067)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	ACCTCCGGAAGAAAGAGCTCA	0.433																																					p.K530N		.											ABCC2,NS,carcinoma,0,1	ABCC2	0	0			c.G1590T						.						157.0	155.0	156.0					10																	101567200		2203	4300	6503	SO:0001583	missense	1244	exon12			CCGGAAGAAAGAG	U63970	CCDS7484.1	10q24	2012-03-14			ENSG00000023839	ENSG00000023839		"""ATP binding cassette transporters / subfamily C"""	53	protein-coding gene	gene with protein product		601107	"""canalicular multispecific organic anion transporter 1"""	CMOAT		8797578, 9284939	Standard	XM_006717630		Approved	DJS, MRP2, cMRP	uc001kqf.2	Q92887	OTTHUMG00000018895	ENST00000370449.4:c.1590G>T	10.37:g.101567200G>T	ENSP00000359478:p.Lys530Asn	Somatic	48	0		WXS	Illumina HiSeq	.	51	3	NM_000392	B2RMT8|Q14022|Q5T2B1|Q92500|Q92798|Q99663|Q9UMS2	Missense_Mutation	SNP	ENST00000370449.4	37	CCDS7484.1	.	.	.	.	.	.	.	.	.	.	G	7.116	0.577002	0.13686	.	.	ENSG00000023839	ENST00000370449	D	0.88975	-2.45	5.31	3.36	0.38483	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.270258	0.40728	N	0.001025	T	0.79137	0.4395	N	0.20807	0.61	0.80722	D	1	B	0.21381	0.055	B	0.28709	0.093	T	0.67518	-0.5650	10	0.22706	T	0.39	-13.2809	7.8024	0.29183	0.0774:0.0:0.5138:0.4087	.	530	Q92887	MRP2_HUMAN	N	530	ENSP00000359478:K530N	ENSP00000359478:K530N	K	+	3	2	ABCC2	101557190	0.809000	0.29036	1.000000	0.80357	0.180000	0.23129	0.347000	0.20014	0.655000	0.30866	0.561000	0.74099	AAG	.		0.433	ABCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049825.1	NM_000392	
BCL9	607	broad.mit.edu	37	1	147084715	147084715	+	Silent	SNP	T	T	C			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr1:147084715T>C	ENST00000234739.3	+	5	827	c.87T>C	c.(85-87)cgT>cgC	p.R29R	BCL9_ENST00000473292.1_3'UTR	NM_004326.2	NP_004317.2	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	29					canonical Wnt signaling pathway (GO:0060070)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|large_intestine(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	7	all_hematologic(923;0.115)					TGATGGTCCGTCCCCCTACAG	0.502			T	"""IGH@, IGL@"""	B-ALL																																p.R29R				Dom	yes		1	1q21	607	B-cell CLL/lymphoma 9		L	BCL9_ENST00000234739,right_upper_lobe,carcinoma,0,1	BCL9	150	0			c.T87C						.						87.0	90.0	89.0					1																	147084715		2203	4300	6503	SO:0001819	synonymous_variant	607	exon5			GGTCCGTCCCCCT	Y13620	CCDS30833.1	1q21	2008-02-05			ENSG00000116128	ENSG00000116128			1008	protein-coding gene	gene with protein product		602597				9490669	Standard	NM_004326		Approved		uc001epq.3	O00512	OTTHUMG00000014031	ENST00000234739.3:c.87T>C	1.37:g.147084715T>C		Somatic	64	0		WXS	Illumina GAIIx	Phase_I	116	5	NM_004326	Q5T489	Silent	SNP	ENST00000234739.3	37	CCDS30833.1																																																																																			.		0.502	BCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039468.1	NM_004326	
HERC4	26091	broad.mit.edu	37	10	69750950	69750950	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr10:69750950T>C	ENST00000395198.3	-	12	1525	c.1278A>G	c.(1276-1278)atA>atG	p.I426M	HERC4_ENST00000277817.6_Missense_Mutation_p.I316M|HERC4_ENST00000395187.2_3'UTR|HERC4_ENST00000412272.2_Missense_Mutation_p.I426M|HERC4_ENST00000373700.4_Missense_Mutation_p.I426M	NM_022079.2	NP_071362.1	Q5GLZ8	HERC4_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 4	426					cell differentiation (GO:0030154)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	27						ACGTTCCATCTATCTCACTAA	0.244																																					p.I426M													.	HERC4	78	0			c.A1278G						.						23.0	24.0	24.0					10																	69750950		2193	4272	6465	SO:0001583	missense	26091	exon12			TCCATCTATCTCA	AY221963	CCDS7274.1, CCDS41533.1, CCDS60541.1, CCDS60542.1	10q21.3	2013-09-20	2012-02-23		ENSG00000148634	ENSG00000148634			24521	protein-coding gene	gene with protein product		609248	"""hect domain and RLD 4"""			10997877	Standard	NM_022079		Approved	DKFZP564G092, KIAA1593	uc001jng.4	Q5GLZ8	OTTHUMG00000018343	ENST00000395198.3:c.1278A>G	10.37:g.69750950T>C	ENSP00000378624:p.Ile426Met	Somatic	121	0		WXS	Illumina GAIIx	Phase_I	441	4	NM_022079	Q5GC98|Q5GC99|Q5GCA0|Q8IXP9|Q9HCH9	Missense_Mutation	SNP	ENST00000395198.3	37	CCDS41533.1	.	.	.	.	.	.	.	.	.	.	T	12.92	2.083036	0.36758	.	.	ENSG00000148634	ENST00000277817;ENST00000412272;ENST00000395198;ENST00000373700	T;T;T;T	0.54675	0.84;0.56;0.61;0.59	5.53	2.87	0.33458	.	0.000000	0.85682	D	0.000000	T	0.64034	0.2562	M	0.71581	2.175	0.80722	D	1	D;P;B;P;B	0.67145	0.996;0.813;0.212;0.57;0.435	D;P;B;B;B	0.65010	0.931;0.49;0.094;0.39;0.218	T	0.62469	-0.6848	10	0.45353	T	0.12	.	7.4865	0.27437	0.2861:0.0:0.1016:0.6123	.	426;426;276;426;426	Q5GLZ8-3;A8K9U4;Q5VXS9;Q5GLZ8-2;Q5GLZ8	.;.;.;.;HERC4_HUMAN	M	316;426;426;426	ENSP00000277817:I316M;ENSP00000416504:I426M;ENSP00000378624:I426M;ENSP00000362804:I426M	ENSP00000277817:I316M	I	-	3	3	HERC4	69420956	0.978000	0.34361	1.000000	0.80357	0.989000	0.77384	0.078000	0.14761	0.905000	0.36596	0.533000	0.62120	ATA	.		0.244	HERC4-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359262.1	NM_015601	
DDX55	57696	broad.mit.edu	37	12	124103201	124103202	+	Intron	DEL	TG	TG	-			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr12:124103201_124103202delTG	ENST00000238146.4	+	12	1214				DDX55_ENST00000421670.3_De_novo_Start_InFrame|SNORA9_ENST00000384170.1_RNA|DDX55_ENST00000538744.1_Intron|DDX55_ENST00000541259.1_Intron	NM_020936.1	NP_065987.1	Q8NHQ9	DDX55_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 55							membrane (GO:0016020)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000142)|Epithelial(86;0.000637)|all cancers(50;0.00772)		GAATGTGGTATGTGTGTGTGTG	0.52											OREG0022230	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.													.	DDX55	51	0			.						.																																			SO:0001627	intron_variant	57696	.			GTGGTATGTGTGT	AB046815	CCDS9251.1	12q24.31	2003-06-13			ENSG00000111364	ENSG00000111364		"""DEAD-boxes"""	20085	protein-coding gene	gene with protein product						10997877	Standard	NM_020936		Approved	KIAA1595	uc001ufi.3	Q8NHQ9	OTTHUMG00000168695	ENST00000238146.4:c.1165-14TG>-	12.37:g.124103211_124103212delTG		Somatic	112	0	1531	WXS	Illumina GAIIx	Phase_I	119	7	.	Q658L6|Q8IYH0|Q9HCH7	Translation_Start_Site	DEL	ENST00000238146.4	37	CCDS9251.1																																																																																			.		0.520	DDX55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400616.2		
NCOR2	9612	broad.mit.edu	37	12	124887093	124887093	+	Silent	SNP	C	C	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr12:124887093C>T	ENST00000405201.1	-	14	1497	c.1497G>A	c.(1495-1497)caG>caA	p.Q499Q	NCOR2_ENST00000397355.1_Silent_p.Q499Q|NCOR2_ENST00000404121.2_Silent_p.Q69Q|NCOR2_ENST00000404621.1_Silent_p.Q498Q|NCOR2_ENST00000429285.2_Silent_p.Q498Q|NCOR2_ENST00000356219.3_Silent_p.Q499Q			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	499	Poly-Gln.				cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)	p.Q499Q(9)		breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		gctgctgctgctgttgttgct	0.617																																					p.Q499Q													NCOR2_ENST00000405201,NS,carcinoma,0,11	NCOR2	475	9	Substitution - coding silent(9)	endometrium(4)|large_intestine(3)|kidney(2)	c.G1497A						.						9.0	10.0	10.0					12																	124887093		2051	4183	6234	SO:0001819	synonymous_variant	9612	exon16			CTGCTGCTGTTGT	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.1497G>A	12.37:g.124887093C>T		Somatic	27	0		WXS	Illumina GAIIx	Phase_I	32	3	NM_006312	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Silent	SNP	ENST00000405201.1	37	CCDS41858.2																																																																																			.		0.617	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312	
ADAM21P1	145241	broad.mit.edu	37	14	70713782	70713782	+	RNA	SNP	A	A	G	rs200469187		TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr14:70713782A>G	ENST00000530196.1	-	0	736					NR_003951.1				ADAM metallopeptidase domain 21 pseudogene 1																		GTCACCAGCAAATTTTGGTTC	0.443																																					.													.	.	.	0			.						.																																					0	.			CCAGCAAATTTTG			14q24.2	2014-03-25	2010-01-12	2010-01-12	ENSG00000235812	ENSG00000235812			19822	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 21 pseudogene"", ""ADAM metallopeptidase domain 21 pseudogene"""	ADAM21P			Standard	NR_003951		Approved		uc010ttg.2		OTTHUMG00000166565		14.37:g.70713782A>G		Somatic	57	1		WXS	Illumina GAIIx	Phase_I	45	5	.		RNA	SNP	ENST00000530196.1	37																																																																																				A|0.994;G|0.006		0.443	ADAM21P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000390451.1	NG_002467	
IGHV3-16	28447	broad.mit.edu	37	14	106622150	106622150	+	RNA	SNP	T	T	C			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr14:106622150T>C	ENST00000390604.2	-	0	168									immunoglobulin heavy variable 3-16 (non-functional)																		CCCCCCAGGCTGTACCAAGCC	0.577																																					.													.	.	.	0			.						.						83.0	79.0	81.0					14																	106622150		1825	4051	5876			0	.			CCAGGCTGTACCA	M99655		14q32.33	2012-02-08	2008-08-22		ENSG00000211944	ENSG00000211944		"""Immunoglobulins / IGH locus"""	5583	other	immunoglobulin gene			"""immunoglobulin heavy variable 3-16"""				Standard	NG_001019		Approved				OTTHUMG00000152273		14.37:g.106622150T>C		Somatic	77	1		WXS	Illumina GAIIx	Phase_I	72	4	.		RNA	SNP	ENST00000390604.2	37																																																																																				.		0.577	IGHV3-16-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene	OTTHUMT00000325661.1	NG_001019	
IGHV3-16	28447	broad.mit.edu	37	14	106622157	106622157	+	RNA	SNP	A	A	C			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr14:106622157A>C	ENST00000390604.2	-	0	161									immunoglobulin heavy variable 3-16 (non-functional)																		GGCTGTACCAAGCCTCCCCCA	0.572																																					.													.	.	.	0			.						.						81.0	77.0	78.0					14																	106622157		1822	4040	5862			0	.			GTACCAAGCCTCC	M99655		14q32.33	2012-02-08	2008-08-22		ENSG00000211944	ENSG00000211944		"""Immunoglobulins / IGH locus"""	5583	other	immunoglobulin gene			"""immunoglobulin heavy variable 3-16"""				Standard	NG_001019		Approved				OTTHUMG00000152273		14.37:g.106622157A>C		Somatic	76	1		WXS	Illumina GAIIx	Phase_I	81	4	.		RNA	SNP	ENST00000390604.2	37																																																																																				.		0.572	IGHV3-16-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene	OTTHUMT00000325661.1	NG_001019	
DNM1P47	100216544	broad.mit.edu	37	15	102292809	102292809	+	RNA	SNP	C	C	A			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr15:102292809C>A	ENST00000561463.1	+	0	855									DNM1 pseudogene 47																		AACCTGCACTCGCGTGGGAAC	0.602																																					.													Q3ZCN4_HUMAN,NS,malignant_melanoma,0,1	.	.	0			.						.																																					0	.			TGCACTCGCGTGG	AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102292809C>A		Somatic	60	2		WXS	Illumina GAIIx	Phase_I	107	6	.		RNA	SNP	ENST00000561463.1	37																																																																																				.		0.602	DNM1P47-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417589.1	NG_009149	
DNM1P47	100216544	broad.mit.edu	37	15	102293062	102293064	+	RNA	DEL	CTC	CTC	-	rs4965539|rs62026972	byFrequency	TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr15:102293062_102293064delCTC	ENST00000561463.1	+	0	1108_1110									DNM1 pseudogene 47																		AGTTCATCTTCTCAGAGCTGCTG	0.576																																					.													.	.	.	0			.						.																																					0	.			CATCTTCTCAGAG	AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102293062_102293064delCTC		Somatic	37	0		WXS	Illumina GAIIx	Phase_I	91	9	.		RNA	DEL	ENST00000561463.1	37																																																																																				.		0.576	DNM1P47-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417589.1	NG_009149	
LINC00854	100874261	broad.mit.edu	37	17	41375508	41375509	+	RNA	DEL	CT	CT	-	rs111274735|rs386797199	byFrequency	TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr17:41375508_41375509delCT	ENST00000433702.2	-	0	799				LINC00854_ENST00000608223.1_RNA|LINC00854_ENST00000598128.1_RNA|LINC00854_ENST00000599491.1_RNA|LINC00854_ENST00000427995.1_RNA|LINC00854_ENST00000600764.1_RNA|LINC00854_ENST00000593624.1_RNA|LINC00854_ENST00000595400.1_RNA|LINC00854_ENST00000594691.1_RNA|LINC00854_ENST00000598568.1_RNA|LINC00854_ENST00000598934.1_RNA|LINC00854_ENST00000597948.1_RNA	NR_047479.1				long intergenic non-protein coding RNA 854																		cacactcacactctctctctct	0.446																																					.													.	.	.	0			.						.																																					0	.			CTCACACTCTCTC			17q21.31	2013-02-13	2013-02-13	2013-02-13	ENSG00000236383	ENSG00000236383		"""Long non-coding RNAs"""	43658	non-coding RNA	RNA, long non-coding			"""TMEM106A antisense RNA 1 (non-protein coding)"", ""TMEM106A antisense RNA 1"", ""TMEM106A antisense RNA 1 (tail to tail)"""	TMEM106A-AS1		22196729	Standard	NR_047479		Approved		uc031ras.1		OTTHUMG00000132641		17.37:g.41375518_41375519delCT		Somatic	7	0		WXS	Illumina GAIIx	Phase_I	6	2	.		RNA	DEL	ENST00000433702.2	37																																																																																				.		0.446	LINC00854-001	KNOWN	basic	antisense	processed_transcript	OTTHUMT00000255889.2		
POTEC	388468	broad.mit.edu	37	18	14542812	14542812	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr18:14542812T>C	ENST00000358970.5	-	1	333	c.334A>G	c.(334-336)Agc>Ggc	p.S112G	POTEC_ENST00000389891.4_5'UTR	NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	112										NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						CTCTTGCCGCTCCCCCTGCAG	0.592																																					p.S112G													POTEC,NS,carcinoma,+2,1	POTEC	129	0			c.A334G						.						30.0	41.0	37.0					18																	14542812		692	1590	2282	SO:0001583	missense	388468	exon1			TGCCGCTCCCCCT	BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.334A>G	18.37:g.14542812T>C	ENSP00000351856:p.Ser112Gly	Somatic	151	1		WXS	Illumina GAIIx	Phase_I	275	5	NM_001137671		Missense_Mutation	SNP	ENST00000358970.5	37	CCDS45835.1	.	.	.	.	.	.	.	.	.	.	T	6.775	0.512008	0.12944	.	.	ENSG00000183206	ENST00000358970;ENST00000389891	T	0.31769	1.48	0.458	0.458	0.16670	.	.	.	.	.	T	0.22360	0.0539	L	0.42245	1.32	0.09310	N	1	B	0.28378	0.209	B	0.24394	0.053	T	0.18777	-1.0326	8	0.45353	T	0.12	.	.	.	.	.	112	B2RU33	POTEC_HUMAN	G	112	ENSP00000351856:S112G	ENSP00000351856:S112G	S	-	1	0	POTEC	14532812	0.002000	0.14202	0.003000	0.11579	0.003000	0.03518	0.508000	0.22692	0.388000	0.25054	0.166000	0.16787	AGC	.		0.592	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371179.1	XM_496269	
ZNF521	25925	broad.mit.edu	37	18	22805339	22805339	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr18:22805339G>A	ENST00000361524.3	-	4	2691	c.2543C>T	c.(2542-2544)tCc>tTc	p.S848F	ZNF521_ENST00000584787.1_Missense_Mutation_p.S628F|ZNF521_ENST00000538137.2_Missense_Mutation_p.S848F|ZNF521_ENST00000579111.1_5'Flank	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	848					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					CACTTGCTCGGAAGCTCCATT	0.483			T	PAX5	ALL																																p.S848F				Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	.	ZNF521	269	0			c.C2543T						.						184.0	177.0	179.0					18																	22805339		2203	4300	6503	SO:0001583	missense	25925	exon4			TGCTCGGAAGCTC	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.2543C>T	18.37:g.22805339G>A	ENSP00000354794:p.Ser848Phe	Somatic	19	0		WXS	Illumina GAIIx	Phase_I	51	4	NM_015461	A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	ENST00000361524.3	37	CCDS32806.1	.	.	.	.	.	.	.	.	.	.	G	3.598	-0.082082	0.07141	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T;T	0.29917	2.97;1.55;2.99	5.93	5.93	0.95920	.	0.111713	0.64402	D	0.000007	T	0.18676	0.0448	N	0.08118	0	0.38061	D	0.936074	B	0.33073	0.396	B	0.32022	0.139	T	0.13710	-1.0499	10	0.41790	T	0.15	-18.2253	15.7911	0.78364	0.0:0.1353:0.8647:0.0	.	848	Q96K83	ZN521_HUMAN	F	848;882;848	ENSP00000354794:S848F;ENSP00000440768:S882F;ENSP00000382352:S848F	ENSP00000354794:S848F	S	-	2	0	ZNF521	21059337	0.966000	0.33281	0.341000	0.25589	0.156000	0.22039	3.907000	0.56348	2.826000	0.97356	0.655000	0.94253	TCC	.		0.483	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461	
CEACAM20	125931	broad.mit.edu	37	19	45017504	45017504	+	RNA	DEL	T	T	-	rs398034749		TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr19:45017504delT	ENST00000454753.1	-	0	1588							Q6UY09	CEA20_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 20							integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)	15		Prostate(69;0.0352)				ttggttttgcttttttttttt	0.458																																					.													.	CEACAM20	31	0			.						.																																					125931	.			TTTTGCTTTTTTT	AY358129	CCDS74390.1, CCDS74391.1, CCDS74392.1, CCDS74393.1	19q13.31	2013-01-30			ENSG00000176395	ENSG00000273777		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	24879	protein-coding gene	gene with protein product						12975309	Standard	NM_001102600		Approved	UNQ9366	uc010ejo.1	Q6UY09	OTTHUMG00000151532		19.37:g.45017504delT		Somatic	5	0		WXS	Illumina GAIIx	Phase_I	7	2	.		RNA	DEL	ENST00000454753.1	37																																																																																				.		0.458	CEACAM20-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000323032.1	NM_198444	
ALDH16A1	126133	broad.mit.edu	37	19	49973687	49973687	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr19:49973687C>T	ENST00000293350.4	+	17	2535	c.2372C>T	c.(2371-2373)gCg>gTg	p.A791V	ALDH16A1_ENST00000455361.2_Missense_Mutation_p.A740V|ALDH16A1_ENST00000433981.2_Missense_Mutation_p.A626V|CTD-3148I10.9_ENST00000599536.1_Intron|ALDH16A1_ENST00000540132.1_Missense_Mutation_p.A628V	NM_153329.3	NP_699160.2	Q8IZ83	A16A1_HUMAN	aldehyde dehydrogenase 16 family, member A1	791						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|skin(2)|urinary_tract(3)	20		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0251)		CTGCGAGTGGCGCGGACCAAG	0.682																																					p.A791V													.	ALDH16A1	54	0			c.C2372T						.						18.0	22.0	21.0					19																	49973687		2199	4294	6493	SO:0001583	missense	126133	exon17			GAGTGGCGCGGAC	AY007096	CCDS12766.1, CCDS46141.1	19q13.33	2014-08-12			ENSG00000161618	ENSG00000161618		"""Aldehyde dehydrogenases"""	28114	protein-coding gene	gene with protein product		613358					Standard	NM_153329		Approved	MGC10204	uc002pnt.3	Q8IZ83	OTTHUMG00000183163	ENST00000293350.4:c.2372C>T	19.37:g.49973687C>T	ENSP00000293350:p.Ala791Val	Somatic	33	0		WXS	Illumina GAIIx	Phase_I	36	3	NM_153329	B4DLQ1|C9JBH6|Q86YF0|Q8IYL4|Q8TEI8	Missense_Mutation	SNP	ENST00000293350.4	37	CCDS12766.1	.	.	.	.	.	.	.	.	.	.	C	11.52	1.661802	0.29515	.	.	ENSG00000161618	ENST00000293350;ENST00000455361;ENST00000540132;ENST00000433981	T;T;T;T	0.71579	-0.58;-0.32;-0.51;-0.51	5.02	5.02	0.67125	.	0.625587	0.15777	N	0.245154	T	0.63379	0.2506	N	0.02225	-0.63	0.33177	D	0.54911	P;D;P	0.89917	0.785;1.0;0.791	B;D;B	0.75484	0.127;0.986;0.167	T	0.64706	-0.6344	10	0.15499	T	0.54	-5.9073	14.2431	0.65971	0.0:1.0:0.0:0.0	.	628;740;791	F5H4B6;B4DLQ1;Q8IZ83	.;.;A16A1_HUMAN	V	791;740;628;626	ENSP00000293350:A791V;ENSP00000410142:A740V;ENSP00000445088:A628V;ENSP00000398675:A626V	ENSP00000293350:A791V	A	+	2	0	ALDH16A1	54665499	0.984000	0.35163	0.973000	0.42090	0.621000	0.37620	4.096000	0.57734	2.498000	0.84270	0.603000	0.83216	GCG	.		0.682	ALDH16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465358.1	NM_153329	
ANKRD36C	400986	broad.mit.edu	37	2	96525667	96525670	+	Frame_Shift_Del	DEL	TTTC	TTTC	-	rs374428964		TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr2:96525667_96525670delTTTC	ENST00000456556.1	-	61	3919_3922	c.3835_3838delGAAA	c.(3835-3840)gaaatafs	p.EI1279fs	ANKRD36C_ENST00000420871.2_Frame_Shift_Del_p.EI530fs|ANKRD36C_ENST00000419039.2_Frame_Shift_Del_p.EI306fs			Q5JPF3	AN36C_HUMAN	ankyrin repeat domain 36C	1279							ion channel inhibitor activity (GO:0008200)			breast(1)|endometrium(8)|kidney(5)|lung(4)	18						TGCGATTTTATTTCTTCTTTTTCA	0.294																																					.													.	.	.	0			.						.																																			SO:0001589	frameshift_variant	400986	.			ATTTTATTTCTTC	AL832836		2q11.1	2013-01-10			ENSG00000174501	ENSG00000174501		"""Ankyrin repeat domain containing"""	32946	protein-coding gene	gene with protein product	"""protein immuno-reactive with anti-PTH polyclonal antibodies"""						Standard	XR_251121		Approved	DKFZp667P0924	uc002suz.1	Q5JPF3	OTTHUMG00000155211	ENST00000456556.1:c.3835_3838delGAAA	2.37:g.96525667_96525670delTTTC	ENSP00000403302:p.Glu1279fs	Somatic	293	0		WXS	Illumina GAIIx	Phase_I	887	7	.	C9JZ08|Q15694|Q53S06|Q658V2	Frame_Shift_Del	DEL	ENST00000456556.1	37																																																																																				.		0.294	ANKRD36C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000338799.2	NM_001010914	
TTN	7273	broad.mit.edu	37	2	179453444	179453444	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr2:179453444T>C	ENST00000591111.1	-	254	58309	c.58085A>G	c.(58084-58086)aAg>aGg	p.K19362R	TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.K18435R|TTN_ENST00000342175.6_Missense_Mutation_p.K12130R|TTN_ENST00000460472.2_Missense_Mutation_p.K11938R|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.K12063R|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.K21003R|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592689.1_RNA			Q8WZ42	TITIN_HUMAN	titin	19362	Fibronectin type-III 40. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATGCTTTTCCTTTTTCTCCAA	0.418																																					p.K21003R													.	TTN	18412	0			c.A63008G						.						141.0	132.0	135.0					2																	179453444		1896	4119	6015	SO:0001583	missense	7273	exon304			TTTTCCTTTTTCT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.58085A>G	2.37:g.179453444T>C	ENSP00000465570:p.Lys19362Arg	Somatic	45	0		WXS	Illumina GAIIx	Phase_I	66	3	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	14.60	2.583411	0.46006	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.56444	0.46;0.46;0.46;0.46	6.1	6.1	0.99115	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.51719	0.1691	N	0.03000	-0.44	0.58432	D	0.999997	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.83275	0.996;0.996;0.996;0.996	T	0.67864	-0.5560	9	0.87932	D	0	.	16.686	0.85306	0.0:0.0:0.0:1.0	.	11938;12063;12130;19362	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	R	18435;11938;12130;12063;11936	ENSP00000343764:K18435R;ENSP00000434586:K11938R;ENSP00000340554:K12130R;ENSP00000352154:K12063R	ENSP00000340554:K12130R	K	-	2	0	TTN	179161690	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.186000	0.72026	2.340000	0.79590	0.528000	0.53228	AAG	.		0.418	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
PSMG1	8624	broad.mit.edu	37	21	40555233	40555235	+	In_Frame_Del	DEL	CCT	CCT	-			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr21:40555233_40555235delCCT	ENST00000331573.3	-	1	542_544	c.77_79delAGG	c.(76-81)gagggg>ggg	p.E26del	AF129408.17_ENST00000608767.1_RNA|PSMG1_ENST00000380900.2_In_Frame_Del_p.E26del	NM_001261824.1|NM_003720.3	NP_001248753.1|NP_003711.1	O95456	PSMG1_HUMAN	proteasome (prosome, macropain) assembly chaperone 1	26					cerebellar granule cell precursor proliferation (GO:0021930)|proteasome assembly (GO:0043248)|proteasome core complex assembly (GO:0080129)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)				autonomic_ganglia(1)|endometrium(2)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(2)	8		Prostate(19;8.44e-08)				tccctccgcccctcctcctcctc	0.695																																					p.26_27del													.	PSMG1	11	0			c.77_79del						.		,	99,4141		7,85,2028					,	0.8	0.0			23	264,7976		23,218,3879	no	coding,coding	PSMG1	NM_203433.1,NM_003720.2	,	30,303,5907	A1A1,A1R,RR		3.2039,2.3349,2.9087	,	,		363,12117				SO:0001651	inframe_deletion	8624	exon1			TCCGCCCCTCCTC	AJ006291	CCDS13660.1, CCDS13661.1	21q22.3	2007-10-23	2007-10-23	2007-10-23	ENSG00000183527	ENSG00000183527			3043	protein-coding gene	gene with protein product		605296	"""Down syndrome critical region gene 2"""	DSCR2		10872820, 17189198	Standard	NM_003720		Approved	c21-LRP, LRPC21, PAC1	uc002yxi.4	O95456	OTTHUMG00000066034	ENST00000331573.3:c.77_79delAGG	21.37:g.40555242_40555244delCCT	ENSP00000329915:p.Glu26del	Somatic	8	0		WXS	Illumina GAIIx	Phase_I	6	1	NM_203433	B5BUN2|Q6FHA3|Q6FHD3|Q6S713	In_Frame_Del	DEL	ENST00000331573.3	37	CCDS13660.1																																																																																			.		0.695	PSMG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141404.2	NM_003720	
HMGB1P5	10354	broad.mit.edu	37	3	22424366	22424366	+	RNA	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr3:22424366G>T	ENST00000451497.1	+	0	931									high mobility group box 1 pseudogene 5																		CTGTTTTGTTGACATTCTGAA	0.333																																					.													.	.	.	0			.						.																																					0	.			TTTGTTGACATTC	AF076677		3p24	2011-09-21	2011-04-05	2010-10-15	ENSG00000132967	ENSG00000132967		"""High mobility group / HMG-box pseudogenes"""	4997	pseudogene	pseudogene			"""high-mobility group (nonhistone chromosomal) protein 1-like 5"", ""high-mobility group (nonhistone chromosomal) protein 1-like 5 pseudogene"", ""high-mobility group box 1-like 5 pseudogene"", ""high-mobility group box 1-like 15"", ""high-mobility group box 1 pseudogene 2"", ""high-mobility group box 1-like 5"", ""high-mobility group box 1 pseudogene 5"""	HMG1L5, HMGB1L15, HMGB1P2, HMGB1L5		9925949	Standard	NG_000897		Approved				OTTHUMG00000155591		3.37:g.22424366G>T		Somatic	27	0		WXS	Illumina GAIIx	Phase_I	41	6	.		RNA	SNP	ENST00000451497.1	37																																																																																				.		0.333	HMGB1P5-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000340803.1	NG_000897	
KPNA4	3840	broad.mit.edu;ucsc.edu	37	3	160285775	160285775	+	5'Flank	SNP	G	G	A			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr3:160285775G>A	ENST00000334256.4	-	0	0				KRT8P12_ENST00000468527.1_RNA|KPNA4_ENST00000469804.1_5'Flank	NM_002268.4	NP_002259.1	O00629	IMA3_HUMAN	karyopherin alpha 4 (importin alpha 3)						cytokine-mediated signaling pathway (GO:0019221)|NLS-bearing protein import into nucleus (GO:0006607)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)	protein transporter activity (GO:0008565)			breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)	22			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			GAGCTTCACTGTGCAGCTTCT	0.627																																					.													.	.	.	0			.						.																																			SO:0001631	upstream_gene_variant	0	.			TTCACTGTGCAGC	AB002533	CCDS3191.1	3q25.33	2013-02-14			ENSG00000186432	ENSG00000186432		"""Importins"", ""Armadillo repeat containing"""	6397	protein-coding gene	gene with protein product		602970				9168958, 9395085	Standard	NM_002268		Approved	QIP1, SRP3, IPOA3, MGC12217, MGC26703	uc003fdn.3	O00629	OTTHUMG00000159033		3.37:g.160285775G>A	Exception_encountered	Somatic	19	0		WXS	Illumina GAIIx	Phase_I	34	15	.	A8K4S6|D3DNM2|O00190	RNA	SNP	ENST00000334256.4	37	CCDS3191.1																																																																																			.		0.627	KPNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352960.1	NM_002268	
MUC4	4585	broad.mit.edu;bcgsc.ca	37	3	195505960	195505960	+	Missense_Mutation	SNP	G	G	C	rs112020305	byFrequency	TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr3:195505960G>C	ENST00000463781.3	-	2	12950	c.12491C>G	c.(12490-12492)aCc>aGc	p.T4164S	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T4164S|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T4164S(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGAAGCGTCGGTGACAGGAAG	0.587													.|||	17	0.00339457	0.0129	0.0	5008	,	,		10875	0.0		0.0	False		,,,				2504	0.0				p.T4164S													MUC4_ENST00000463781,NS,carcinoma,0,3	MUC4	1505	2	Substitution - Missense(2)	kidney(1)|endometrium(1)	c.C12491G						.						19.0	12.0	14.0					3																	195505960		671	1528	2199	SO:0001583	missense	4585	exon2			GCGTCGGTGACAG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12491C>G	3.37:g.195505960G>C	ENSP00000417498:p.Thr4164Ser	Somatic	51	1		WXS	Illumina GAIIx	Phase_I	87	16	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	4.985	0.182849	0.09495	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35789	1.38;1.29	.	.	.	.	.	.	.	.	T	0.19248	0.0462	N	0.19112	0.55	0.09310	N	0.999997	P	0.37985	0.613	B	0.35899	0.213	T	0.14587	-1.0467	7	.	.	.	.	5.8529	0.18704	9.0E-4:0.0:0.9991:0.0	.	4036	E7ESK3	.	S	4164	ENSP00000417498:T4164S;ENSP00000420243:T4164S	.	T	-	2	0	MUC4	196990739	0.002000	0.14202	0.025000	0.17156	0.022000	0.10575	0.413000	0.21148	0.073000	0.16731	0.074000	0.15403	ACC	.		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
SMARCA5	8467	broad.mit.edu	37	4	144474311	144474311	+	Nonsense_Mutation	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr4:144474311G>T	ENST00000283131.3	+	24	3595	c.3133G>T	c.(3133-3135)Gga>Tga	p.G1045*	RP11-481K16.2_ENST00000512366.1_RNA	NM_003601.3	NP_003592.3	O60264	SMCA5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5	1045					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA-templated transcription, initiation (GO:0006352)|double-strand break repair (GO:0006302)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin silencing complex (GO:0005677)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NURF complex (GO:0016589)|RSF complex (GO:0031213)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)		EWSR1/SMARCA5(2)	endometrium(2)|kidney(2)|large_intestine(9)|lung(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_hematologic(180;0.158)					TGATGGTCGAGGAAGAAAAAA	0.333																																					p.G1045X													.	SMARCA5	73	0			c.G3133T						.						140.0	146.0	144.0					4																	144474311		2203	4300	6503	SO:0001587	stop_gained	8467	exon24			GGTCGAGGAAGAA	AB010882	CCDS3761.1	4q31.1-q31.2	2011-04-20			ENSG00000153147	ENSG00000153147			11101	protein-coding gene	gene with protein product		603375				9730600	Standard	NM_003601		Approved	hSNF2H, hISWI, ISWI	uc003ijg.3	O60264	OTTHUMG00000161474	ENST00000283131.3:c.3133G>T	4.37:g.144474311G>T	ENSP00000283131:p.Gly1045*	Somatic	61	0		WXS	Illumina GAIIx	Phase_I	118	4	NM_003601		Nonsense_Mutation	SNP	ENST00000283131.3	37	CCDS3761.1	.	.	.	.	.	.	.	.	.	.	G	45	11.499046	0.99568	.	.	ENSG00000153147	ENST00000283131;ENST00000536484;ENST00000535006	.	.	.	5.68	5.68	0.88126	.	0.147419	0.45361	D	0.000378	.	.	.	.	.	.	0.51482	D	0.999929	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-2.6025	17.9608	0.89084	0.0:0.0:1.0:0.0	.	.	.	.	X	1045;988;988	.	ENSP00000283131:G1045X	G	+	1	0	SMARCA5	144693761	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.588000	0.98232	2.686000	0.91538	0.555000	0.69702	GGA	.		0.333	SMARCA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365077.3		
SGCD	6444	broad.mit.edu	37	5	155935643	155935643	+	Silent	SNP	A	A	G			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr5:155935643A>G	ENST00000435422.3	+	3	709	c.222A>G	c.(220-222)aaA>aaG	p.K74K	SGCD_ENST00000517913.1_Silent_p.K75K|SGCD_ENST00000447401.1_Silent_p.K75K|SGCD_ENST00000337851.4_Silent_p.K75K	NM_001128209.1	NP_001121681.1	Q92629	SGCD_HUMAN	sarcoglycan, delta (35kDa dystrophin-associated glycoprotein)	74					muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)				breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(16)|prostate(1)	24	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TCACAGAAAAAGGTCTAAAGC	0.413																																					p.K75K													.	SGCD	52	0			c.A225G						.						98.0	89.0	92.0					5																	155935643		1841	4098	5939	SO:0001819	synonymous_variant	6444	exon4			AGAAAAAGGTCTA	BX537948	CCDS47325.1, CCDS47326.1, CCDS47327.1	5q33-q34	2014-09-17	2002-08-29						10807	protein-coding gene	gene with protein product		601411	"""sarcoglycan, delta (35kD dystrophin-associated glycoprotein)"""			8776597, 8841194, 10974018	Standard	NM_000337		Approved	DAGD, LGMD2F, CMD1L	uc003lwd.4	Q92629		ENST00000435422.3:c.222A>G	5.37:g.155935643A>G		Somatic	83	0		WXS	Illumina GAIIx	Phase_I	150	4	NM_000337	A8K9S9|Q53XA5|Q99644	Silent	SNP	ENST00000435422.3	37	CCDS47327.1																																																																																			.		0.413	SGCD-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000373469.3		
ZNF354B	117608	broad.mit.edu	37	5	178293259	178293259	+	Silent	SNP	C	C	T	rs530482815		TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr5:178293259C>T	ENST00000322434.3	+	3	274	c.48C>T	c.(46-48)ttC>ttT	p.F16F		NM_058230.2	NP_478137.1	Q96LW1	Z354B_HUMAN	zinc finger protein 354B	16	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|kidney(2)|large_intestine(7)|liver(2)|lung(2)|ovary(2)|stomach(3)|urinary_tract(1)	21	all_cancers(89;0.000639)|all_epithelial(37;0.000109)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CACTGACATTCGAGGACGTGG	0.557													C|||	1	0.000199681	0.0	0.0	5008	,	,		18000	0.0		0.0	False		,,,				2504	0.001				p.F16F													.	ZNF354B	67	0			c.C48T						.						133.0	123.0	126.0					5																	178293259		2203	4300	6503	SO:0001819	synonymous_variant	117608	exon3			GACATTCGAGGAC	AK057737	CCDS4439.1	5q35.3	2013-01-08			ENSG00000178338	ENSG00000178338		"""Zinc fingers, C2H2-type"", ""-"""	17197	protein-coding gene	gene with protein product							Standard	NM_058230		Approved	KID2, FLJ25008	uc003mjl.3	Q96LW1	OTTHUMG00000130896	ENST00000322434.3:c.48C>T	5.37:g.178293259C>T		Somatic	82	1		WXS	Illumina GAIIx	Phase_I	100	5	NM_058230	A8K0V2|Q5U5Z4	Silent	SNP	ENST00000322434.3	37	CCDS4439.1																																																																																			.		0.557	ZNF354B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253482.1	NM_058230	
CYP21A1P	1590	broad.mit.edu	37	6	31973481	31973483	+	IGR	DEL	CTG	CTG	-	rs372987663		TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr6:31973481_31973483delCTG	ENST00000594256.1	-	0	69				C4A-AS1_ENST00000458633.1_RNA|CYP21A1P_ENST00000342991.6_RNA																							gctcctgggcctgctgctgctgc	0.66																																					.													.	CYP21A2	42	0			.						.			59,3537		5,49,1744						0.7	0.9			4	127,6723		15,97,3313	no	intergenic				20,146,5057	A1A1,A1R,RR		1.854,1.6407,1.7806				186,10260				SO:0001628	intergenic_variant	0	.			CTGGGCCTGCTGC																													6.37:g.31973490_31973492delCTG		Somatic	66	0		WXS	Illumina GAIIx	Phase_I	149	8	.		RNA	DEL	ENST00000594256.1	37																																																																																				.		0.660	AL645922.1-201	NOVEL	basic|appris_principal	protein_coding	protein_coding			
NCAPG2	54892	broad.mit.edu	37	7	158478886	158478886	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr7:158478886T>C	ENST00000409423.1	-	9	987	c.815A>G	c.(814-816)aAg>aGg	p.K272R	NCAPG2_ENST00000409339.3_Missense_Mutation_p.K272R|NCAPG2_ENST00000449727.2_Missense_Mutation_p.K272R|NCAPG2_ENST00000356309.3_Missense_Mutation_p.K272R|NCAPG2_ENST00000275830.10_Missense_Mutation_p.K64R	NM_001281932.1	NP_001268861.1	Q86XI2	CNDG2_HUMAN	non-SMC condensin II complex, subunit G2	272					chromosome condensation (GO:0030261)|inner cell mass cell proliferation (GO:0001833)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	39	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)		CCCTGAAGCCTTTTTCCAAGC	0.244																																					p.K272R													.	NCAPG2	80	0			c.A815G						.						32.0	32.0	32.0					7																	158478886		1779	4041	5820	SO:0001583	missense	54892	exon8			GAAGCCTTTTTCC	BC043404	CCDS43686.1, CCDS64816.1	7q36.3	2006-09-04	2006-09-04	2006-09-04	ENSG00000146918	ENSG00000146918			21904	protein-coding gene	gene with protein product		608532	"""leucine zipper protein 5"""	LUZP5		14532007	Standard	NM_001281933		Approved	FLJ20311, MTB, CAP-G2, hCAP-G2	uc003wnv.1	Q86XI2	OTTHUMG00000151438	ENST00000409423.1:c.815A>G	7.37:g.158478886T>C	ENSP00000386569:p.Lys272Arg	Somatic	114	1		WXS	Illumina GAIIx	Phase_I	345	6	NM_017760	A4D228|Q7Z3J9|Q8WUG8|Q9BRX6|Q9H8S2|Q9H9K6	Missense_Mutation	SNP	ENST00000409423.1	37	CCDS43686.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.89|19.89	3.911524|3.911524	0.72983|0.72983	.|.	.|.	ENSG00000146918|ENSG00000146918	ENST00000356309;ENST00000409423;ENST00000275830;ENST00000409339;ENST00000449727|ENST00000441982	T;T;T;T;T|.	0.43294|.	0.95;0.95;0.95;0.95;0.95|.	5.24|5.24	5.24|5.24	0.73138|0.73138	Armadillo-like helical (1);Armadillo-type fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.71609|0.71609	0.3360|0.3360	M|M	0.68317|0.68317	2.08|2.08	0.51482|0.51482	D|D	0.999927|0.999927	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	0.999;0.998;1.0|.	T|T	0.71679|0.71679	-0.4520|-0.4520	10|5	0.46703|.	T|.	0.11|.	-32.5969|-32.5969	14.001|14.001	0.64433|0.64433	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	272;64;272|.	Q86XI2-2;E7EUH9;Q86XI2|.	.;.;CNDG2_HUMAN|.	R|G	272;272;64;272;272|74	ENSP00000348657:K272R;ENSP00000386569:K272R;ENSP00000275830:K64R;ENSP00000387007:K272R;ENSP00000388326:K272R|.	ENSP00000275830:K64R|.	K|R	-|-	2|1	0|2	NCAPG2|NCAPG2	158171647|158171647	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	5.407000|5.407000	0.66363|0.66363	2.107000|2.107000	0.64212|0.64212	0.533000|0.533000	0.62120|0.62120	AAG|AGG	.		0.244	NCAPG2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327111.1	NM_017760	
CYP4F59P	100132340	broad.mit.edu	37	9	43029805	43029805	+	lincRNA	SNP	C	C	G			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr9:43029805C>G	ENST00000453998.1	-	0	565									cytochrome P450, family 4, subfamily F, polypeptide 59, pseudogene																		TGGGCAGAACCACAGCCTGAT	0.532																																					.													.	.	.	0			.						.																																					0	.			CAGAACCACAGCC			9p12	2013-07-25			ENSG00000233244			"""Cytochrome P450s"""	39947	pseudogene	pseudogene							Standard	NG_031982		Approved	CYP4F-se14[6:8]			OTTHUMG00000013290		9.37:g.43029805C>G		Somatic	58	1		WXS	Illumina GAIIx	Phase_I	85	4	.		RNA	SNP	ENST00000453998.1	37																																																																																				.		0.532	CYP4F59P-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000037070.1		
TUBBP5	643224	broad.mit.edu	37	9	141069495	141069495	+	RNA	SNP	C	C	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr9:141069495C>T	ENST00000503395.1	+	0	1023									tubulin, beta pseudogene 5																		GCCTTGGCCACGAGGGAGCTT	0.701																																					.													.	.	.	0			.						.																																					0	.			TGGCCACGAGGGA	AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141069495C>T		Somatic	50	1		WXS	Illumina GAIIx	Phase_I	116	9	.		RNA	SNP	ENST00000503395.1	37																																																																																				.		0.701	TUBBP5-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000373087.1	NR_027156	
AC112778.1	0	broad.mit.edu	37	X	25224555	25224555	+	RNA	DEL	C	C	-	rs200377226|rs200133255		TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chrX:25224555delC	ENST00000390786.1	-	0	22																											ccgcaatttactttttgcacc	0.294																																					.													.	.	.	0			.						.																																					0	.			AATTTACTTTTTG																													X.37:g.25224555delC		Somatic	137	0		WXS	Illumina GAIIx	Phase_I	206	11	.		RNA	DEL	ENST00000390786.1	37																																																																																				.		0.294	AC112778.1-201	NOVEL	basic	miRNA	miRNA			
WDR13	64743	broad.mit.edu	37	X	48457849	48457849	+	Splice_Site	SNP	A	A	G			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chrX:48457849A>G	ENST00000218056.5	+	3	896	c.391A>G	c.(391-393)Agg>Ggg	p.R131G	WDR13_ENST00000376729.5_Splice_Site_p.R131G|WDR13_ENST00000492715.1_3'UTR	NM_001166426.1|NM_017883.4	NP_001159898.1|NP_060353	Q9H1Z4	WDR13_HUMAN	WD repeat domain 13	131						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|large_intestine(4)|lung(4)|ovary(2)	11						CTATGAGGACAGGTATGCACC	0.652																																					p.R131G													.	WDR13	96	0			c.A391G						.						31.0	25.0	27.0					X																	48457849		2203	4300	6503	SO:0001630	splice_region_variant	64743	exon3			GAGGACAGGTATG	AF329819	CCDS14302.1	Xp11.23	2013-01-09			ENSG00000101940	ENSG00000101940		"""WD repeat domain containing"""	14352	protein-coding gene	gene with protein product		300512					Standard	NM_017883		Approved		uc004dkj.2	Q9H1Z4	OTTHUMG00000024119	ENST00000218056.5:c.392+1A>G	X.37:g.48457849A>G		Somatic	60	0		WXS	Illumina GAIIx	Phase_I	114	3	NM_017883	Q06DW8|Q06DX0|Q06DX1|Q9BUL7|Q9NWW4	Splice_Site	SNP	ENST00000218056.5	37	CCDS14302.1	.	.	.	.	.	.	.	.	.	.	A	16.40	3.113315	0.56398	.	.	ENSG00000101940	ENST00000376729;ENST00000218056	T;T	0.72051	-0.62;-0.62	5.05	2.52	0.30459	.	0.000000	0.85682	D	0.000000	T	0.55752	0.1940	L	0.54323	1.7	0.58432	D	0.999992	P;B	0.48764	0.915;0.422	B;B	0.38500	0.275;0.078	T	0.50767	-0.8789	10	0.17369	T	0.5	-12.5651	5.6624	0.17676	0.7374:0.1675:0.0951:0.0	.	9;131	B4DVQ7;Q9H1Z4	.;WDR13_HUMAN	G	131	ENSP00000365919:R131G;ENSP00000218056:R131G	ENSP00000218056:R131G	R	+	1	2	WDR13	48342793	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	4.147000	0.58078	0.599000	0.29845	0.381000	0.24937	AGG	.		0.652	WDR13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060743.2		Missense_Mutation
LOC728660	728660	broad.mit.edu	37	X	139099848	139099848	+	lincRNA	SNP	T	T	A	rs376042212		TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chrX:139099848T>A	ENST00000417426.1	+	0	234																											CTTCAAAGGATTTCAAGAAAA	0.398													A|||	56	0.0148344	0.0038	0.0058	3775	,	,		10894	0.0427		0.0	False		,,,				2504	0.0041				.													.	.	.	0			.						.																																					0	.			AAAGGATTTCAAG																													X.37:g.139099848T>A		Somatic	118	0		WXS	Illumina GAIIx	Phase_I	184	6	.		RNA	SNP	ENST00000417426.1	37																																																																																				.		0.398	RP11-364B14.1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000058573.1		
SVILP1	645954	ucsc.edu;bcgsc.ca	37	10	30992597	30992597	+	IGR	SNP	T	T	C			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr10:30992597T>C								SVILP1 (5205 upstream) : RP11-14C22.6 (19582 downstream)																							CAGCACAAGGTATTCCAGTGA	0.453																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			ACAAGGTATTCCA																													10.37:g.30992597T>C		Somatic	53	0		WXS	Illumina HiSeq		78	27	.		Splice_Site	SNP		37																																																																																				.	0	0.453								
RAG1	5896	ucsc.edu	37	11	36597457	36597457	+	Missense_Mutation	SNP	C	C	T	rs193922462		TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr11:36597457C>T	ENST00000299440.5	+	2	2715	c.2603C>T	c.(2602-2604)gCa>gTa	p.A868V		NM_000448.2	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	868					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|DNA recombination (GO:0006310)|histone monoubiquitination (GO:0010390)|immune response (GO:0006955)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of thymocyte apoptotic process (GO:0070244)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|pre-B cell allelic exclusion (GO:0002331)|protein autoubiquitination (GO:0051865)|regulation of T cell differentiation (GO:0045580)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	65	all_lung(20;0.226)	all_hematologic(20;0.107)				ACTGTGGATGCAGTTTGTGAG	0.483									Familial Hemophagocytic Lymphohistiocytosis																												p.A868V	Pancreas(43;321 1249 3212 48200)|Esophageal Squamous(38;49 1003 17530 24363)												.	RAG1	151	0			c.C2603T						.						124.0	119.0	121.0					11																	36597457		2202	4298	6500	SO:0001583	missense	5896	exon2	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	TGGATGCAGTTTG	M29474	CCDS7902.1	11p13	2014-09-17				ENSG00000166349		"""RING-type (C3HC4) zinc fingers"""	9831	protein-coding gene	gene with protein product	"""recombination activating protein 1"", ""RING finger protein 74"", ""V(D)J recombination-activating protein 1"""	179615				1612612, 1283330	Standard	NM_000448		Approved	RNF74, MGC43321	uc001mwu.4	P15918		ENST00000299440.5:c.2603C>T	11.37:g.36597457C>T	ENSP00000299440:p.Ala868Val	Somatic	24	0		WXS	Illumina HiSeq		34	4	NM_000448	E9PPC4|Q8IY72|Q8NER2	Missense_Mutation	SNP	ENST00000299440.5	37	CCDS7902.1	.	.	.	.	.	.	.	.	.	.	C	14.40	2.523789	0.44866	.	.	ENSG00000166349	ENST00000534663;ENST00000299440	D;D	0.86030	-2.06;-2.06	5.94	5.94	0.96194	.	0.119116	0.56097	D	0.000035	D	0.90731	0.7091	L	0.48174	1.505	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.90702	0.4621	10	0.87932	D	0	.	20.4384	0.99098	0.0:1.0:0.0:0.0	.	868	P15918	RAG1_HUMAN	V	868	ENSP00000434610:A868V;ENSP00000299440:A868V	ENSP00000299440:A868V	A	+	2	0	RAG1	36554033	1.000000	0.71417	0.330000	0.25442	0.185000	0.23345	4.465000	0.60141	2.831000	0.97527	0.644000	0.83932	GCA	.		0.483	RAG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389535.1	NM_000448	
ANXA2	302	ucsc.edu;bcgsc.ca	37	15	60644601	60644601	+	Silent	SNP	G	G	A	rs529527729		TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr15:60644601G>A	ENST00000396024.3	-	10	822	c.663C>T	c.(661-663)agC>agT	p.S221S	ANXA2_ENST00000332680.4_Silent_p.S239S|ANXA2_ENST00000421017.2_Silent_p.S221S|ANXA2_ENST00000451270.2_Silent_p.S221S	NM_001136015.2	NP_001129487.1	P07355	ANXA2_HUMAN	annexin A2	221					angiogenesis (GO:0001525)|body fluid secretion (GO:0007589)|cellular response to acid chemical (GO:0071229)|collagen fibril organization (GO:0030199)|fibrinolysis (GO:0042730)|membrane budding (GO:0006900)|membrane raft assembly (GO:0001765)|negative regulation of catalytic activity (GO:0043086)|osteoclast development (GO:0036035)|positive regulation of binding (GO:0051099)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vesicle fusion (GO:0031340)|protein heterotetramerization (GO:0051290)|protein targeting to plasma membrane (GO:0072661)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell surface (GO:0009986)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|late endosome membrane (GO:0031902)|lipid particle (GO:0005811)|lysosomal membrane (GO:0005765)|macropinosome (GO:0044354)|membrane (GO:0016020)|midbody (GO:0030496)|myelin sheath adaxonal region (GO:0035749)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|sarcolemma (GO:0042383)|Schmidt-Lanterman incisure (GO:0043220)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phospholipase A2 inhibitor activity (GO:0019834)|poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)			kidney(1)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)	9					Tenecteplase(DB00031)	GGTGGGGCACGCTCCGCTCGG	0.577													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18487	0.0		0.0	False		,,,				2504	0.0				p.S239S													.	ANXA2	28	0			c.C717T						.						51.0	46.0	48.0					15																	60644601		2203	4300	6503	SO:0001819	synonymous_variant	302	exon9			GGGCACGCTCCGC	D00017	CCDS10175.1, CCDS32256.1	15q22.2	2012-10-02			ENSG00000182718	ENSG00000182718		"""Annexins"""	537	protein-coding gene	gene with protein product	"""annexin II"""	151740		ANX2, ANX2L4, CAL1H, LPC2D		7961821	Standard	NM_001136015		Approved	LIP2	uc002agm.3	P07355	OTTHUMG00000132763	ENST00000396024.3:c.663C>T	15.37:g.60644601G>A		Somatic	24	0		WXS	Illumina HiSeq		26	4	NM_001002858	Q567R4|Q6N0B3|Q8TBV2|Q96DD5|Q9UDH8	Silent	SNP	ENST00000396024.3	37	CCDS10175.1																																																																																			.		0.577	ANXA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256135.1	NM_001002857	
TTC39A	22996	bcgsc.ca	37	1	51777814	51777814	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr1:51777814G>T	ENST00000447632.2	-	4	383	c.335C>A	c.(334-336)cCc>cAc	p.P112H	TTC39A_ENST00000371747.3_Missense_Mutation_p.P111H|TTC39A_ENST00000451380.1_Missense_Mutation_p.P111H|TTC39A_ENST00000262676.5_Missense_Mutation_p.P108H|TTC39A_ENST00000413473.2_Missense_Mutation_p.P115H|TTC39A_ENST00000262675.7_Missense_Mutation_p.P84H|TTC39A_ENST00000371750.5_Missense_Mutation_p.P112H			Q5SRH9	TT39A_HUMAN	tetratricopeptide repeat domain 39A	112								p.0?(2)|p.P84L(1)|p.P112L(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(2)|prostate(2)|skin(3)|urinary_tract(1)	17						GCCCAGCGTGGGGCGGTTCAC	0.567																																					p.P115H													C1orf34,NS,carcinoma,0,1	TTC39A	40	4	Substitution - Missense(2)|Whole gene deletion(2)	endometrium(2)|thyroid(1)|central_nervous_system(1)	c.C344A						.						40.0	43.0	42.0					1																	51777814		1904	4124	6028	SO:0001583	missense	22996	exon4			AGCGTGGGGCGGT	AB007921	CCDS44143.1, CCDS44144.1, CCDS72789.1, CCDS72790.1	1p32.3	2013-01-11	2008-06-23	2008-06-23	ENSG00000085831	ENSG00000085831		"""Tetratricopeptide (TTC) repeat domain containing"""	18657	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 34"""	C1orf34		9455484, 9461476	Standard	XM_005270643		Approved	KIAA0452, DEME-6	uc010onf.2	Q5SRH9	OTTHUMG00000008193	ENST00000447632.2:c.335C>A	1.37:g.51777814G>T	ENSP00000393952:p.Pro112His	Somatic	39	0		WXS	Illumina HiSeq	Phase_1	59	4	NM_001144832	B7Z782|E7EQY9|G3XAF8|O43417|O75040|Q5SRH5|Q5SRH6|Q5SRH7|Q5SRH8|Q5SRI0|Q5SRI1|Q5SRI2|Q5T7S1|Q6PIU8|Q9BT24	Missense_Mutation	SNP	ENST00000447632.2	37		.	.	.	.	.	.	.	.	.	.	G	7.657	0.684216	0.14907	.	.	ENSG00000085831	ENST00000447632;ENST00000413473;ENST00000262675;ENST00000451380;ENST00000371750;ENST00000371747;ENST00000262676;ENST00000411642;ENST00000439482;ENST00000422925;ENST00000380849;ENST00000401051;ENST00000532836;ENST00000527205	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93;0.93;0.93;0.93;0.93;0.93;0.93;0.93;0.93;0.93	3.09	3.09	0.35607	.	0.778979	0.11529	N	0.554851	T	0.35068	0.0919	N	0.12182	0.205	0.09310	N	1	B;B;P;D;P;B;P	0.54047	0.003;0.003;0.586;0.964;0.783;0.007;0.531	B;B;B;P;P;B;P	0.54372	0.016;0.039;0.436;0.75;0.617;0.043;0.482	T	0.09271	-1.0682	10	0.42905	T	0.14	-0.8049	7.6124	0.28137	0.0:0.0:0.7462:0.2538	.	115;111;84;108;111;112;112	Q5SRH9-4;E7EQY9;D3DQ30;Q5SRH9-3;B7Z782;Q5SRH9;G3XAF8	.;.;.;.;.;TT39A_HUMAN;.	H	112;115;84;111;112;111;108;84;111;84;84;115;84;139	ENSP00000393952:P112H;ENSP00000406144:P115H;ENSP00000262675:P84H;ENSP00000397207:P111H;ENSP00000360815:P112H;ENSP00000360812:P111H;ENSP00000262676:P108H;ENSP00000408532:P84H;ENSP00000405803:P111H;ENSP00000388995:P84H;ENSP00000370230:P84H;ENSP00000383830:P115H;ENSP00000434483:P84H;ENSP00000432453:P139H	ENSP00000262675:P84H	P	-	2	0	TTC39A	51550402	1.000000	0.71417	0.518000	0.27811	0.840000	0.47671	2.163000	0.42377	1.729000	0.51567	0.313000	0.20887	CCC	.		0.567	TTC39A-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000022434.2		
RP11-353N4.5	0	bcgsc.ca	37	1	149648156	149648156	+	lincRNA	SNP	T	T	C			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr1:149648156T>C	ENST00000608683.1	-	0	1106																											AGAAACACAATACTGTTTCTG	0.413																																					.													.	.	.	0			.						.																																					0	.			ACACAATACTGTT																													1.37:g.149648156T>C		Somatic	109	8		WXS	Illumina HiSeq	Phase_1	227	32	.		RNA	SNP	ENST00000608683.1	37																																																																																				T|0.250;C|0.750		0.413	RP11-353N4.5-006	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000472690.1		
Unknown	0	bcgsc.ca	37	2	87607401	87607401	+	IGR	SNP	G	G	A			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr2:87607401G>A								IGKV3OR2-268 (41243 upstream) : LINC00152 (147485 downstream)																							CCAATACAGGGGCTGGATATG	0.463																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			TACAGGGGCTGGA																													2.37:g.87607401G>A		Somatic	40	1		WXS	Illumina HiSeq	Phase_1	56	12	.		RNA	SNP		37																																																																																				G|0.500;A|0.500	0	0.463								
IWS1	55677	bcgsc.ca	37	2	128284021	128284021	+	5'UTR	SNP	G	G	A			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr2:128284021G>A	ENST00000295321.4	-	0	23				IWS1_ENST00000486662.1_5'UTR|IWS1_ENST00000455721.2_5'UTR	NM_017969.2	NP_060439.2	Q96ST2	IWS1_HUMAN	IWS1 homolog (S. cerevisiae)						mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of histone H3-K36 trimethylation (GO:2001253)|regulation of histone H4 acetylation (GO:0090239)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|kidney(6)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)		CATGCGAGCCGGCGTTCTACT	0.652																																					.													.	IWS1	61	0			.						.																																			SO:0001623	5_prime_UTR_variant	55677	.			CGAGCCGGCGTTC	AK000868	CCDS2146.1	2q14.3	2006-03-17			ENSG00000163166	ENSG00000163166			25467	protein-coding gene	gene with protein product							Standard	NM_017969		Approved	DKFZp761G0123, FLJ10006, FLJ14655, FLJ32319	uc002ton.2	Q96ST2	OTTHUMG00000131527	ENST00000295321.4:c.-237C>T	2.37:g.128284021G>A		Somatic	23	0		WXS	Illumina HiSeq	Phase_1	24	12	.	Q2TB65|Q6P157|Q8N3E8|Q96MI7|Q9NV97|Q9NWH8	Missense_Mutation	SNP	ENST00000295321.4	37	CCDS2146.1																																																																																			.		0.652	IWS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254384.2	NM_017969	
LRCH3	84859	bcgsc.ca	37	3	197547212	197547212	+	Missense_Mutation	SNP	A	A	G			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr3:197547212A>G	ENST00000425562.2	+	4	551	c.551A>G	c.(550-552)gAa>gGa	p.E184G	LRCH3_ENST00000493726.1_3'UTR|LRCH3_ENST00000334859.4_Missense_Mutation_p.E184G|LRCH3_ENST00000414675.2_Missense_Mutation_p.E184G|LRCH3_ENST00000441090.2_Intron|LRCH3_ENST00000438796.2_Missense_Mutation_p.E184G			Q96II8	LRCH3_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 3	184						cytoplasm (GO:0005737)|extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;4.82e-24)|all cancers(36;3.61e-22)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.119)		AGCTGCAATGAAATTCAAACT	0.333																																					p.E184G													.	LRCH3	96	0			c.A551G						.						103.0	103.0	103.0					3																	197547212		2203	4300	6503	SO:0001583	missense	84859	exon4			GCAATGAAATTCA	AL137527	CCDS3330.1	3q29	2006-04-12			ENSG00000186001	ENSG00000186001			28637	protein-coding gene	gene with protein product						12477932	Standard	NM_032773		Approved	MGC4126	uc003fyj.1	Q96II8	OTTHUMG00000155378	ENST00000425562.2:c.551A>G	3.37:g.197547212A>G	ENSP00000393579:p.Glu184Gly	Somatic	74	2		WXS	Illumina HiSeq	Phase_1	156	60	NM_032773	B4E0T7|Q96FP9|Q9NT52	Missense_Mutation	SNP	ENST00000425562.2	37		.	.	.	.	.	.	.	.	.	.	A	12.27	1.887924	0.33348	.	.	ENSG00000186001	ENST00000438796;ENST00000414675;ENST00000334859;ENST00000425562	T;T;T;T	0.58797	0.31;0.31;0.31;0.31	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.65523	0.2699	N	0.25890	0.77	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.997	D;D;D	0.91635	0.994;0.999;0.979	T	0.70163	-0.4947	10	0.87932	D	0	-18.6597	15.5125	0.75795	1.0:0.0:0.0:0.0	.	184;184;184	B4E0T7;Q96II8-2;Q96II8-3	.;.;.	G	184	ENSP00000399751:E184G;ENSP00000394965:E184G;ENSP00000334375:E184G;ENSP00000393579:E184G	ENSP00000334375:E184G	E	+	2	0	LRCH3	199031609	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.683000	0.91236	2.137000	0.66172	0.454000	0.30748	GAA	.		0.333	LRCH3-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000339965.1	NM_032773	
NAF1	92345	bcgsc.ca	37	4	164050124	164050124	+	Silent	SNP	T	T	G			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr4:164050124T>G	ENST00000274054.2	-	8	1603	c.1410A>C	c.(1408-1410)ccA>ccC	p.P470P	NAF1_ENST00000422287.2_Intron|NAF1_ENST00000509434.1_Intron	NM_138386.2	NP_612395.2	Q96HR8	NAF1_HUMAN	nuclear assembly factor 1 ribonucleoprotein	470	Pro-rich.				pseudouridine synthesis (GO:0001522)|ribosome biogenesis (GO:0042254)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(3)|large_intestine(1)|lung(10)|ovary(2)	21	all_hematologic(180;0.166)	Prostate(90;0.109)				ggggagggggtgggggtaggg	0.522																																					p.P470P													.	NAF1	69	0			c.A1410C						.						10.0	10.0	10.0					4																	164050124		2188	4274	6462	SO:0001819	synonymous_variant	92345	exon8			AGGGGGTGGGGGT		CCDS3803.1, CCDS47159.1	4q32.2	2013-03-05	2013-03-05			ENSG00000145414			25126	protein-coding gene	gene with protein product			"""nuclear assembly factor 1 homolog (S. cerevisiae)"""			16618814, 16601202	Standard	NM_138386		Approved		uc003iqj.3	Q96HR8		ENST00000274054.2:c.1410A>C	4.37:g.164050124T>G		Somatic	36	1		WXS	Illumina HiSeq	Phase_1	52	21	NM_138386	D3DP28|E9PAZ2	Silent	SNP	ENST00000274054.2	37	CCDS3803.1																																																																																			.		0.522	NAF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364684.2	NM_138386	
FRG1	2483	bcgsc.ca	37	4	190876263	190876263	+	Missense_Mutation	SNP	A	A	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr4:190876263A>T	ENST00000226798.4	+	5	611	c.389A>T	c.(388-390)gAt>gTt	p.D130V	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	130					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		GGGCGTTCAGATGCAATTGGA	0.348																																					p.D130V													FRG1,NS,carcinoma,0,2	FRG1	76	0			c.A389T						.						92.0	92.0	92.0					4																	190876263		2203	4300	6503	SO:0001583	missense	2483	exon5			GTTCAGATGCAAT	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.389A>T	4.37:g.190876263A>T	ENSP00000226798:p.Asp130Val	Somatic	253	4		WXS	Illumina HiSeq	Phase_1	402	31	NM_004477	A8K775	Missense_Mutation	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	20.9	4.069168	0.76301	.	.	ENSG00000109536	ENST00000226798;ENST00000531991	T;T	0.53857	1.76;0.6	4.04	4.04	0.47022	Actin cross-linking (1);	0.000000	0.85682	D	0.000000	T	0.74465	0.3720	M	0.88031	2.925	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.79347	-0.1841	10	0.87932	D	0	-2.6764	11.3071	0.49342	1.0:0.0:0.0:0.0	.	130	Q14331	FRG1_HUMAN	V	130;67	ENSP00000226798:D130V;ENSP00000435943:D67V	ENSP00000226798:D130V	D	+	2	0	FRG1	191113257	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.720000	0.91442	1.599000	0.50093	0.462000	0.41574	GAT	.		0.348	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
PHC1P1	653441	bcgsc.ca	37	12	55805960	55805960	+	IGR	SNP	C	C	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr12:55805960C>T								OR6C65 (10671 upstream) : OR6C76 (14077 downstream)																							TCCACGCCTGCGAACGCGAGC	0.532																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	653441	.			CGCCTGCGAACGC																													12.37:g.55805960C>T		Somatic	62	0		WXS	Illumina HiSeq	Phase_1	118	66	.		RNA	SNP		37																																																																																				.	0	0.532								
CAB39L	81617	bcgsc.ca	37	13	49951237	49951237	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr13:49951237C>T	ENST00000355854.4	-	3	639	c.142G>A	c.(142-144)Gca>Aca	p.A48T	CAB39L_ENST00000409308.1_Missense_Mutation_p.A48T|CAB39L_ENST00000410043.1_Missense_Mutation_p.A48T|CAB39L_ENST00000347776.5_Missense_Mutation_p.A48T	NM_030925.2	NP_112187.2	Q9H9S4	CB39L_HUMAN	calcium binding protein 39-like	48					cell cycle arrest (GO:0007050)|insulin receptor signaling pathway (GO:0008286)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(2)|large_intestine(4)|lung(3)|pancreas(1)|stomach(1)	12		Lung NSC(96;2.11e-05)|Breast(56;0.00017)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;3.66e-09)|COAD - Colon adenocarcinoma(199;0.226)		TCTTTCATTGCTTGCAGTGAT	0.408																																					p.A48T													.	CAB39L	35	0			c.G142A						.						111.0	111.0	111.0					13																	49951237		2203	4300	6503	SO:0001583	missense	81617	exon3			TCATTGCTTGCAG	AK022639	CCDS9416.2	13q14.11	2008-02-05			ENSG00000102547	ENSG00000102547			20290	protein-coding gene	gene with protein product		612175					Standard	NM_030925		Approved	bA103J18.3, FLJ12577, MO2L	uc001vcw.3	Q9H9S4	OTTHUMG00000016914	ENST00000355854.4:c.142G>A	13.37:g.49951237C>T	ENSP00000348113:p.Ala48Thr	Somatic	54	0		WXS	Illumina HiSeq	Phase_1	24	3	NM_030925	Q5TAW6|Q6WG71|Q96FG1|Q9BZ33	Missense_Mutation	SNP	ENST00000355854.4	37	CCDS9416.2	.	.	.	.	.	.	.	.	.	.	C	14.76	2.631227	0.46944	.	.	ENSG00000102547	ENST00000355854;ENST00000347776;ENST00000378341;ENST00000409308;ENST00000425242;ENST00000410043;ENST00000457041;ENST00000413278;ENST00000409082	T;T;T;T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54;1.54;1.54;1.54	5.53	5.53	0.82687	Armadillo-type fold (1);	0.052374	0.85682	D	0.000000	T	0.32793	0.0841	L	0.50333	1.59	0.80722	D	1	P	0.34757	0.467	B	0.35931	0.214	T	0.03898	-1.0994	9	.	.	.	-6.818	18.4498	0.90699	0.0:1.0:0.0:0.0	.	48	Q9H9S4	CB39L_HUMAN	T	48;48;45;48;11;48;48;48;48	ENSP00000348113:A48T;ENSP00000261669:A48T;ENSP00000386375:A48T;ENSP00000416719:A11T;ENSP00000386328:A48T;ENSP00000409253:A48T;ENSP00000404028:A48T;ENSP00000386979:A48T	.	A	-	1	0	CAB39L	48849238	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.942000	0.63547	2.596000	0.87737	0.650000	0.86243	GCA	.		0.408	CAB39L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044908.3	NM_030925	
ARHGAP5	394	bcgsc.ca	37	14	32561340	32561340	+	Missense_Mutation	SNP	G	G	A	rs78337553		TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr14:32561340G>A	ENST00000345122.3	+	2	1780	c.1465G>A	c.(1465-1467)Gag>Aag	p.E489K	ARHGAP5_ENST00000556611.1_Missense_Mutation_p.E489K|ARHGAP5_ENST00000432921.1_Missense_Mutation_p.E489K|ARHGAP5_ENST00000539826.2_Missense_Mutation_p.E489K|ARHGAP5_ENST00000433497.1_Intron|ARHGAP5_ENST00000396582.2_Intron	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	489	FF 4.				cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)	p.E489K(1)		NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		AGCCAAAGAAGAGTTTCAAGA	0.343																																					p.E489K	NSCLC(9;77 350 3443 29227 41353)												ARHGAP5,NS,carcinoma,0,1	ARHGAP5	166	1	Substitution - Missense(1)	stomach(1)	c.G1465A						.						60.0	61.0	61.0					14																	32561340		2203	4298	6501	SO:0001583	missense	394	exon2			AAAGAAGAGTTTC	U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.1465G>A	14.37:g.32561340G>A	ENSP00000371897:p.Glu489Lys	Somatic	98	2		WXS	Illumina HiSeq	Phase_1	174	13	NM_001173	A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Missense_Mutation	SNP	ENST00000345122.3	37	CCDS32062.1	.	.	.	.	.	.	.	.	.	.	G	19.00	3.741262	0.69304	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000345122;ENST00000432921	T;T;T;T	0.32023	1.47;1.47;1.47;1.47	6.02	6.02	0.97574	FF domain (2);	0.044905	0.85682	D	0.000000	T	0.39009	0.1062	N	0.22421	0.69	0.80722	D	1	P;P	0.42296	0.734;0.775	P;P	0.52066	0.562;0.689	T	0.11060	-1.0603	10	0.62326	D	0.03	.	20.547	0.99278	0.0:0.0:1.0:0.0	.	489;489	Q13017-2;Q13017	.;RHG05_HUMAN	K	489	ENSP00000452222:E489K;ENSP00000441692:E489K;ENSP00000371897:E489K;ENSP00000393307:E489K	ENSP00000371897:E489K	E	+	1	0	ARHGAP5	31631091	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.850000	0.98022	0.650000	0.86243	GAG	G|0.999;A|0.001		0.343	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409735.1	NM_001030055	
NEO1	4756	bcgsc.ca	37	15	73541487	73541487	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr15:73541487G>T	ENST00000339362.5	+	11	2140	c.1693G>T	c.(1693-1695)Ggc>Tgc	p.G565C	NEO1_ENST00000558964.1_Missense_Mutation_p.G565C|NEO1_ENST00000261908.6_Missense_Mutation_p.G565C|NEO1_ENST00000560262.1_Missense_Mutation_p.G565C|NEO1_ENST00000560352.1_3'UTR			Q92859	NEO1_HUMAN	neogenin 1	565	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|iron ion homeostasis (GO:0055072)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of transcription, DNA-templated (GO:0006355)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.G565S(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(9)|lung(26)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	57						ACCAGTGTCTGGCAATGGGGA	0.433																																					p.G565C													.	NEO1	102	1	Substitution - Missense(1)	lung(1)	c.G1693T						.						101.0	101.0	101.0					15																	73541487		2198	4297	6495	SO:0001583	missense	4756	exon10			GTGTCTGGCAATG	U61262	CCDS10247.1, CCDS53957.1, CCDS58378.1	15q22.3-q23	2014-06-20	2010-06-24		ENSG00000067141	ENSG00000067141		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7754	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 2"""	601907	"""neogenin (chicken) homolog 1"""			9121761	Standard	NM_002499		Approved	NGN, HsT17534, IGDCC2, NTN1R2	uc002avm.4	Q92859	OTTHUMG00000133509	ENST00000339362.5:c.1693G>T	15.37:g.73541487G>T	ENSP00000341198:p.Gly565Cys	Somatic	60	0		WXS	Illumina HiSeq	Phase_1	73	5	NM_001172623	B7ZKM9|B7ZKN0|O00340|Q17RX1	Missense_Mutation	SNP	ENST00000339362.5	37	CCDS10247.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.853496	0.91355	.	.	ENSG00000067141	ENST00000339362;ENST00000379842;ENST00000261908	T;T	0.61859	0.07;0.07	5.52	5.52	0.82312	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.046152	0.85682	D	0.000000	T	0.73297	0.3569	L	0.55103	1.725	0.80722	D	1	D;D;D;D	0.89917	1.0;0.996;0.988;0.998	D;D;D;D	0.79108	0.992;0.939;0.911;0.939	T	0.73711	-0.3897	10	0.56958	D	0.05	-15.5033	19.0691	0.93125	0.0:0.0:1.0:0.0	.	565;565;303;565	B7ZKM9;B7ZKN0;E7EUX3;Q92859	.;.;.;NEO1_HUMAN	C	565;303;565	ENSP00000341198:G565C;ENSP00000261908:G565C	ENSP00000261908:G565C	G	+	1	0	NEO1	71328540	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.484000	0.97940	2.601000	0.87937	0.650000	0.86243	GGC	.		0.433	NEO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257472.2	NM_002499	
RPL18P13	441775	bcgsc.ca	37	16	76268971	76268971	+	lincRNA	SNP	G	G	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr16:76268971G>T	ENST00000568714.1	-	0	135																											TGTAGCCTCAGCTGGCCCGTC	0.493																																					.													.	.	.	0			.						.																																					441775	.			GCCTCAGCTGGCC																													16.37:g.76268971G>T		Somatic	26	0		WXS	Illumina HiSeq	Phase_1	29	5	.		RNA	SNP	ENST00000568714.1	37																																																																																				.		0.493	RP11-150D5.2-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000434958.1		
MED1	5469	bcgsc.ca	37	17	37565938	37565938	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr17:37565938C>T	ENST00000300651.6	-	17	2759	c.2536G>A	c.(2536-2538)Gct>Act	p.A846T	MED1_ENST00000394287.3_Intron	NM_004774.3	NP_004765.2	O95243	MBD4_HUMAN	mediator complex subunit 1	0					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)			NS(1)|breast(2)|cervix(3)|kidney(3)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(7)|urinary_tract(1)	59		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		GGGCTTCCAGCAGCATCTGCA	0.413										HNSCC(31;0.082)																											p.A846T	Pancreas(21;279 768 2492 4877 24026)												.	MED1	123	0			c.G2536A						.						61.0	64.0	63.0					17																	37565938		2203	4300	6503	SO:0001583	missense	5469	exon17			TTCCAGCAGCATC	L40366	CCDS11336.1	17q12	2007-07-30	2007-07-30	2007-07-30	ENSG00000125686	ENSG00000125686			9234	protein-coding gene	gene with protein product		604311	"""PPAR binding protein"""	TRIP2, PPARGBP, PPARBP		9325263, 10485914	Standard	NM_004774		Approved	PBP, TRAP220, RB18A, DRIP230, CRSP200, CRSP1	uc002hrv.4	Q15648	OTTHUMG00000133216	ENST00000300651.6:c.2536G>A	17.37:g.37565938C>T	ENSP00000300651:p.Ala846Thr	Somatic	36	0		WXS	Illumina HiSeq	Phase_1	46	4	NM_004774	B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Missense_Mutation	SNP	ENST00000300651.6	37	CCDS11336.1	.	.	.	.	.	.	.	.	.	.	C	9.548	1.115177	0.20795	.	.	ENSG00000125686	ENST00000300651	T	0.34275	1.37	6.03	2.19	0.27852	.	.	.	.	.	T	0.20941	0.0504	N	0.24115	0.695	0.37144	D	0.901847	B	0.06786	0.001	B	0.04013	0.001	T	0.09487	-1.0672	9	0.27785	T	0.31	-3.315	6.593	0.22658	0.0:0.5457:0.1268:0.3275	.	846	Q15648	MED1_HUMAN	T	846	ENSP00000300651:A846T	ENSP00000300651:A846T	A	-	1	0	MED1	34819464	0.663000	0.27448	1.000000	0.80357	0.998000	0.95712	0.462000	0.21956	0.687000	0.31509	0.655000	0.94253	GCT	.		0.413	MED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256943.3	NM_004774	
FRG1B	284802	bcgsc.ca	37	20	29625971	29625971	+	Missense_Mutation	SNP	C	C	A	rs145033899		TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr20:29625971C>A	ENST00000278882.3	+	5	595	c.215C>A	c.(214-216)cCa>cAa	p.P72Q	FRG1B_ENST00000358464.4_Missense_Mutation_p.P72Q|FRG1B_ENST00000439954.2_Missense_Mutation_p.P77Q			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	72										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						CAATGGGAACCAGTCTTTCAA	0.328																																					.													FRG1B,NS,carcinoma,0,6	FRG1B	181	0			.						.																																			SO:0001583	missense	284802	.			GGGAACCAGTCTT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.215C>A	20.37:g.29625971C>A	ENSP00000278882:p.Pro72Gln	Somatic	249	4		WXS	Illumina HiSeq	Phase_1	581	25	.	C4AME5	Missense_Mutation	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	c	12.14	1.847531	0.32606	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.49720	0.77	1.68	1.68	0.24146	.	0.112402	0.64402	D	0.000009	T	0.63271	0.2497	.	.	.	0.49483	D	0.999795	D	0.63046	0.992	D	0.79784	0.993	T	0.65948	-0.6044	9	0.66056	D	0.02	.	9.3557	0.38164	0.0:1.0:0.0:0.0	.	77	F5H5R5	.	Q	72;77;72	ENSP00000408863:P77Q	ENSP00000278882:P72Q	P	+	2	0	FRG1B	28239632	1.000000	0.71417	1.000000	0.80357	0.229000	0.25112	6.442000	0.73443	1.250000	0.43966	0.184000	0.17185	CCA	.		0.328	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRG1B	284802	bcgsc.ca	37	20	29628278	29628278	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr20:29628278G>A	ENST00000278882.3	+	6	660	c.280G>A	c.(280-282)Gca>Aca	p.A94T	FRG1B_ENST00000358464.4_Missense_Mutation_p.A94T|FRG1B_ENST00000439954.2_Missense_Mutation_p.A99T			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	94										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						ATGCAATGAAGCAGGGGACAT	0.373																																					.													FRG1B,NS,carcinoma,0,2	FRG1B	181	0			.						.																																			SO:0001583	missense	284802	.			AATGAAGCAGGGG			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.280G>A	20.37:g.29628278G>A	ENSP00000278882:p.Ala94Thr	Somatic	264	6		WXS	Illumina HiSeq	Phase_1	658	35	.	C4AME5	Missense_Mutation	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	g	9.994	1.231660	0.22626	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.44083	0.93	2.08	2.08	0.27032	Actin cross-linking (1);	0.286587	0.39083	N	0.001478	T	0.22898	0.0553	.	.	.	0.21290	N	0.99973	B;B	0.12630	0.0;0.006	B;B	0.12156	0.002;0.007	T	0.15407	-1.0438	9	0.16420	T	0.52	.	10.2211	0.43198	0.0:0.0:1.0:0.0	.	99;94	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	T	94;99;94	ENSP00000408863:A99T	ENSP00000278882:A94T	A	+	1	0	FRG1B	28241939	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	4.196000	0.58407	1.475000	0.48197	0.423000	0.28283	GCA	.		0.373	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
Unknown	0	bcgsc.ca	37	22	16404908	16404908	+	IGR	SNP	T	T	A			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr22:16404908T>A								LA16c-2F2.8 (27853 upstream) : LA16c-23H5.4 (12360 downstream)																							GGTGTGTATTTTGGGACCTTT	0.458																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			TGTATTTTGGGAC																													22.37:g.16404908T>A		Somatic	204	0		WXS	Illumina HiSeq	Phase_1	283	19	.		RNA	SNP		37																																																																																				.	0	0.458								
FAM230A	653203	bcgsc.ca	37	22	20710402	20710402	+	Missense_Mutation	SNP	A	A	T			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr22:20710402A>T	ENST00000434783.3	+	8	2318	c.2134A>T	c.(2134-2136)Acg>Tcg	p.T712S	USP41_ENST00000454608.2_Intron|USP41_ENST00000486536.2_Intron					family with sequence similarity 230, member A																		GCGAACGAGGACGCCGCCCAG	0.687																																					.													.	.	.	0			.						.																																			SO:0001583	missense	0	.			ACGAGGACGCCGC	JX456222		22q11.21	2014-08-13			ENSG00000188280	ENSG00000188280			45045	other	unknown							Standard	XM_006724099		Approved	DGCR15			OTTHUMG00000150686	ENST00000434783.3:c.2134A>T	22.37:g.20710402A>T	ENSP00000463576:p.Thr712Ser	Somatic	103	4		WXS	Illumina HiSeq	Phase_1	117	13	.		Missense_Mutation	SNP	ENST00000434783.3	37																																																																																				.		0.687	FAM230A-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000319609.4		
ZFYVE9P1	100289259	bcgsc.ca	37	X	136743277	136743277	+	IGR	SNP	A	A	C			TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chrX:136743277A>C								RN7SL325P (65567 upstream) : RNU6-985P (26772 downstream)																							TATATGTGACATCTACCTACC	0.458																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	100289259	.			TGTGACATCTACC																													X.37:g.136743277A>C		Somatic	52	0		WXS	Illumina HiSeq	Phase_1	95	47	.		RNA	SNP		37																																																																																				.	0	0.458								
ZNF676	163223	bcgsc.ca	37	19	22363736	22363737	+	Missense_Mutation	DNP	TC	TC	AG	rs559970266|rs572031376	byFrequency	TCGA-W5-AA34-01A-11D-A417-09	TCGA-W5-AA34-10A-01D-A41A-09	TC	TC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	302c8a32-f894-4f40-950b-07ce2146bd13	8a5426fa-9c13-470a-b1cf-31d9043405df	g.chr19:22363736_22363737TC>AG	ENST00000397121.2	-	3	1099_1100	c.782_783GA>CT	c.(781-783)gGA>gCT	p.G261A		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	261					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				CGCTACTAAATCCTTTGCCACA	0.391																																					p.G261A													.	ZNF676	146	0			c.G782C						.																																			SO:0001583	missense	163223	exon3			CTAAATCCTTTGC	AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.782_783delinsAG	19.37:g.22363736_22363737delinsAG	ENSP00000380310:p.Gly261Ala	Somatic	60	2		WXS	Illumina HiSeq	Phase_1	76	5	NM_001001411	A8MVX5	Missense_Mutation	DNP	ENST00000397121.2	37	CCDS42539.1																																																																																			.		0.391	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464392.1	NM_001001411	
