#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVarCov_SOL	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ARID1A	8289	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	27101387	27101394	+	Frame_Shift_Del	DEL	CCCTCTGC	CCCTCTGC	-			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	CCCTCTGC	CCCTCTGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr1:27101387_27101394delCCCTCTGC	ENST00000324856.7	+	18	5040_5047	c.4669_4676delCCCTCTGC	c.(4669-4677)ccctctgccfs	p.PSA1557fs	ARID1A_ENST00000457599.2_Intron|ARID1A_ENST00000374152.2_Frame_Shift_Del_p.PSA1174fs|ARID1A_ENST00000540690.1_Intron	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1557					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CCCATATGGTCCCTCTGCCCCTGTGCCC	0.606			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.1556_1559del		.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	.	.	0			c.4668_4675del						.																																			SO:0001589	frameshift_variant	8289	exon18			TATGGTCCCTCTG	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.4669_4676delCCCTCTGC	1.37:g.27101387_27101394delCCCTCTGC	ENSP00000320485:p.Pro1557fs	Somatic	79	0		WXS	Illumina HiSeq	.	67	12	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Frame_Shift_Del	DEL	ENST00000324856.7	37	CCDS285.1																																																																																			.		0.606	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
EP400	57634	hgsc.bcm.edu	37	12	132547093	132547094	+	In_Frame_Ins	INS	-	-	CAGCAGCAGCAG	rs10902490|rs113304321|rs528214697	byFrequency	TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr12:132547093_132547094insCAGCAGCAGCAG	ENST00000333577.4	+	48	8398_8399	c.8289_8290insCAGCAGCAGCAG	c.(8290-8292)cag>CAGCAGCAGCAGcag	p.2764_2764Q>QQQQQ	EP400_ENST00000389561.2_In_Frame_Ins_p.2728_2728Q>QQQQQ|EP400_ENST00000332482.4_In_Frame_Ins_p.2691_2691Q>QQQQQ|EP400_ENST00000330386.6_In_Frame_Ins_p.2647_2647Q>QQQQQ|EP400_ENST00000389562.2_In_Frame_Ins_p.2727_2727Q>QQQQQ			Q96L91	EP400_HUMAN	E1A binding protein p400	2764	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.Q2726Q(9)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcaacaacagcagcagca	0.564																																					p.Q2727delinsQQQQQ		.											EP400,NS,carcinoma,0,15	EP400	0	9	Substitution - coding silent(9)	lung(3)|kidney(2)|endometrium(2)|central_nervous_system(2)	c.8181_8182insCAGCAGCAGCAG						.																																			SO:0001652	inframe_insertion	57634	exon47			GCAACAACAGCAG	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8314_8325dupCAGCAGCAGCAG	12.37:g.132547093_132547094insCAGCAGCAGCAG	ENSP00000333602:p.GlnGlnGlnGln2784dup	Somatic	41	0		WXS	Illumina HiSeq	.	41	0	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	In_Frame_Ins	INS	ENST00000333577.4	37																																																																																				.		0.564	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
TXK	7294	hgsc.bcm.edu;broad.mit.edu	37	4	48096207	48096207	+	Missense_Mutation	SNP	G	G	A			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr4:48096207G>A	ENST00000264316.4	-	8	681	c.596C>T	c.(595-597)gCc>gTc	p.A199V	TXK_ENST00000510457.1_5'UTR	NM_003328.2	NP_003319.2	P42681	TXK_HUMAN	TXK tyrosine kinase	199	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cytokine production (GO:0001816)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|T cell receptor signaling pathway (GO:0050852)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|RNA polymerase II regulatory region DNA binding (GO:0001012)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|prostate(2)	25						ATGTTTTATGGCAGCCTCCGT	0.383																																					p.A199V		.											.	.	.	0			c.C596T						.						112.0	104.0	107.0					4																	48096207		2203	4300	6503	SO:0001583	missense	7294	exon8			TTTATGGCAGCCT	L27071	CCDS3480.1	4p12	2013-02-14	2003-04-01		ENSG00000074966	ENSG00000074966	2.7.10.1	"""SH2 domain containing"""	12434	protein-coding gene	gene with protein product		600058	"""PTK4 protein tyrosine kinase 4"""	PTK4		7951233, 7528718	Standard	NM_003328		Approved	TKL, PSCTK5, BTKL, RLK	uc003gxx.4	P42681	OTTHUMG00000102065	ENST00000264316.4:c.596C>T	4.37:g.48096207G>A	ENSP00000264316:p.Ala199Val	Somatic	53	0		WXS	Illumina HiSeq	.	62	4	NM_003328	Q14220	Missense_Mutation	SNP	ENST00000264316.4	37	CCDS3480.1	.	.	.	.	.	.	.	.	.	.	G	5.729	0.319052	0.10845	.	.	ENSG00000074966	ENST00000264316	D	0.88586	-2.4	5.23	4.35	0.52113	SH2 motif (5);	0.899231	0.09501	N	0.793599	T	0.75474	0.3854	N	0.11255	0.115	0.80722	D	1	B	0.06786	0.001	B	0.12156	0.007	T	0.65203	-0.6225	10	0.13108	T	0.6	.	4.7482	0.13047	0.1974:0.1775:0.6251:0.0	.	199	P42681	TXK_HUMAN	V	199	ENSP00000264316:A199V	ENSP00000264316:A199V	A	-	2	0	TXK	47790964	0.997000	0.39634	0.990000	0.47175	0.053000	0.15095	2.535000	0.45685	1.346000	0.45694	0.650000	0.86243	GCC	.		0.383	TXK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219869.7	NM_003328	
CCDC154	645811	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	1488640	1488640	+	Silent	SNP	T	T	C			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr16:1488640T>C	ENST00000389176.3	-	9	1198	c.1032A>G	c.(1030-1032)ctA>ctG	p.L344L	CCDC154_ENST00000409671.1_Silent_p.L190L	NM_001143980.1	NP_001137452.1	A6NI56	CC154_HUMAN	coiled-coil domain containing 154	344						endosome (GO:0005768)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)	5						CCTCGGCCAGTAGGACACGGT	0.672																																					p.L335L		.											.	.	.	0			c.A1005G						.						49.0	57.0	55.0					16																	1488640		692	1590	2282	SO:0001819	synonymous_variant	645811	exon9			GGCCAGTAGGACA			16p13.3	2012-12-13			ENSG00000197599	ENSG00000197599			34454	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 29"""	C16orf29			Standard	NM_001143980		Approved	LOC645811	uc010uve.2	A6NI56	OTTHUMG00000154097	ENST00000389176.3:c.1032A>G	16.37:g.1488640T>C		Somatic	30	0		WXS	Illumina HiSeq	.	30	9	NM_001143980	G9JV18	Silent	SNP	ENST00000389176.3	37																																																																																				.		0.672	CCDC154-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_001143980	
FCGBP	8857	hgsc.bcm.edu	37	19	40419710	40419710	+	Missense_Mutation	SNP	C	C	T	rs149288039		TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr19:40419710C>T	ENST00000221347.6	-	6	3291	c.3284G>A	c.(3283-3285)cGc>cAc	p.R1095H		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	1095						extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CAGCAGGCAGCGGTCATAGAC	0.642																																					p.R1095H		.											FCGBP,NS,carcinoma,0,1	FCGBP	0	0			c.G3284A						.	C	HIS/ARG	0,4406		0,0,2203	67.0	66.0	66.0		3284	-8.4	0.3	19	dbSNP_134	66	3,8597	3.0+/-9.4	0,3,4297	yes	missense	FCGBP	NM_003890.2	29	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	benign	1095/5406	40419710	3,13003	2203	4300	6503	SO:0001583	missense	8857	exon6			AGGCAGCGGTCAT	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.3284G>A	19.37:g.40419710C>T	ENSP00000221347:p.Arg1095His	Somatic	50	0		WXS	Illumina HiSeq	.	39	2	NM_003890	O95784	Missense_Mutation	SNP	ENST00000221347.6	37	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	C	8.235	0.805462	0.16467	0.0	3.49E-4	ENSG00000090920	ENST00000221347	T	0.76316	-1.01	5.33	-8.42	0.00957	Uncharacterised domain, cysteine-rich (2);	1.221790	0.05751	N	0.603218	T	0.59004	0.2162	L	0.28556	0.865	0.09310	N	1	B	0.29862	0.259	B	0.30179	0.112	T	0.47898	-0.9081	10	0.23302	T	0.38	.	6.1765	0.20447	0.4194:0.223:0.0:0.3576	.	1095	Q9Y6R7	FCGBP_HUMAN	H	1095	ENSP00000221347:R1095H	ENSP00000221347:R1095H	R	-	2	0	FCGBP	45111550	0.000000	0.05858	0.297000	0.24988	0.688000	0.40055	-1.688000	0.01925	-1.913000	0.01079	-0.224000	0.12420	CGC	0.000		0.642	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
CDC25C	995	hgsc.bcm.edu	37	5	137621497	137621497	+	Missense_Mutation	SNP	G	G	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr5:137621497G>T	ENST00000323760.6	-	14	1584	c.1306C>A	c.(1306-1308)Cat>Aat	p.H436N	CDC25C_ENST00000348983.3_Missense_Mutation_p.H363N|CDC25C_ENST00000513970.1_Missense_Mutation_p.H436N|CDC25C_ENST00000356505.3_Missense_Mutation_p.H406N|CDC25C_ENST00000514555.1_Missense_Mutation_p.H406N|CDC25C_ENST00000415130.2_Missense_Mutation_p.H363N|CDC25C_ENST00000357274.3_Missense_Mutation_p.H393N	NM_001790.3	NP_001781.2	P30307	MPIP3_HUMAN	cell division cycle 25C	436					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|peptidyl-tyrosine dephosphorylation (GO:0035335)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|WW domain binding (GO:0050699)			endometrium(2)|kidney(3)|large_intestine(5)|lung(5)|skin(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			TCCTGATGATGCATAGGGCAG	0.507																																					p.H436N		.											CDC25C,NS,carcinoma,0,1	CDC25C	0	0			c.C1306A						.						107.0	96.0	100.0					5																	137621497		2203	4300	6503	SO:0001583	missense	995	exon14			GATGATGCATAGG	M34065	CCDS4202.1, CCDS4203.1	5q31	2013-01-17	2013-01-17		ENSG00000158402	ENSG00000158402		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1727	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 60"""	157680	"""cell division cycle 25C"", ""cell division cycle 25 homolog C (S. cerevisiae)"", ""cell division cycle 25 homolog C (S. pombe)"""	CDC25		1703321	Standard	XM_005272145		Approved	PPP1R60	uc003lcp.1	P30307	OTTHUMG00000129203	ENST00000323760.6:c.1306C>A	5.37:g.137621497G>T	ENSP00000321656:p.His436Asn	Somatic	76	0		WXS	Illumina HiSeq	.	42	2	NM_001790	D3DQB8|Q96PL3|Q9H168|Q9H2E8|Q9H2E9|Q9H2F1	Missense_Mutation	SNP	ENST00000323760.6	37	CCDS4202.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.11|12.11	1.839451|1.839451	0.32513|0.32513	.|.	.|.	ENSG00000158402|ENSG00000158402	ENST00000514017|ENST00000323760;ENST00000356505;ENST00000357274;ENST00000348983;ENST00000415130;ENST00000513970;ENST00000534892;ENST00000514555	.|T;T;T;T;T;T;T	.|0.28255	.|1.62;1.62;1.62;1.62;1.62;1.62;1.62	5.32|5.32	3.51|3.51	0.40186|0.40186	.|Rhodanese-like (2);	.|0.322095	.|0.28665	.|N	.|0.014557	T|T	0.28499|0.28499	0.0705|0.0705	L|L	0.31578|0.31578	0.945|0.945	0.42466|0.42466	D|D	0.992806|0.992806	.|D;D;D;D	.|0.56746	.|0.977;0.977;0.974;0.961	.|P;P;P;B	.|0.51701	.|0.63;0.63;0.677;0.426	T|T	0.02196|0.02196	-1.1197|-1.1197	5|10	.|0.24483	.|T	.|0.36	-18.0561|-18.0561	9.3332|9.3332	0.38034|0.38034	0.0763:0.0:0.7793:0.1445|0.0763:0.0:0.7793:0.1445	.|.	.|453;406;363;436	.|G3V1P6;P30307-2;P30307-4;P30307	.|.;.;.;MPIP3_HUMAN	E|N	237|436;406;393;363;363;436;453;406	.|ENSP00000321656:H436N;ENSP00000348898:H406N;ENSP00000349821:H393N;ENSP00000345205:H363N;ENSP00000392631:H363N;ENSP00000424795:H436N;ENSP00000425470:H406N	.|ENSP00000321656:H436N	A|H	-|-	2|1	0|0	CDC25C|CDC25C	137649396|137649396	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	4.428000|4.428000	0.59894|0.59894	0.787000|0.787000	0.33731|0.33731	0.655000|0.655000	0.94253|0.94253	GCA|CAT	.		0.507	CDC25C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251280.1		
CELA2B	51032	hgsc.bcm.edu	37	1	15802636	15802636	+	Silent	SNP	C	C	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr1:15802636C>T	ENST00000375910.3	+	1	41	c.16C>T	c.(16-18)Ctg>Ttg	p.L6L	CELA2B_ENST00000494280.1_Intron	NM_015849.2	NP_056933	P08218	CEL2B_HUMAN	chymotrypsin-like elastase family, member 2B	6						extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.L6L(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)	8						TAGGACCCTGCTGCTGTCCAC	0.547																																					p.L6L		.											CELA2B,NS,carcinoma,0,1	CELA2B	0	1	Substitution - coding silent(1)	endometrium(1)	c.C16T						.						126.0	106.0	113.0					1																	15802636		2203	4300	6503	SO:0001819	synonymous_variant	51032	exon1			ACCCTGCTGCTGT		CCDS30605.1	1p36.21	2009-07-09			ENSG00000215704	ENSG00000215704			29995	protein-coding gene	gene with protein product	"""pancreatic elastase IIB"""	609444				3646943, 16327289	Standard	NM_015849		Approved	RP11-265F14.2, ELA2B	uc001awl.3	P08218	OTTHUMG00000002259	ENST00000375910.3:c.16C>T	1.37:g.15802636C>T		Somatic	69	0		WXS	Illumina HiSeq	.	39	2	NM_015849	Q14D16|Q6ISM5|Q96QV5	Silent	SNP	ENST00000375910.3	37	CCDS30605.1																																																																																			.		0.547	CELA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006448.1	NM_015849	
TYRO3	7301	hgsc.bcm.edu	37	15	41862869	41862869	+	Missense_Mutation	SNP	G	G	C			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr15:41862869G>C	ENST00000263798.3	+	12	1775	c.1551G>C	c.(1549-1551)caG>caC	p.Q517H	TYRO3_ENST00000559066.1_Missense_Mutation_p.Q472H	NM_006293.3	NP_006284.2	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase	517					apoptotic cell clearance (GO:0043277)|cell adhesion (GO:0007155)|forebrain cell migration (GO:0021885)|natural killer cell differentiation (GO:0001779)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|neuron cellular homeostasis (GO:0070050)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein autophosphorylation (GO:0046777)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(26)|ovary(3)|prostate(1)	43		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		CAGAGCAGCAGTTCACCCTGG	0.547																																					p.Q517H		.											TYRO3_ENST00000263798,lower_third,carcinoma,0,2	TYRO3_ENST00000263798	0	0			c.G1551C						.						85.0	82.0	83.0					15																	41862869		2203	4300	6503	SO:0001583	missense	7301	exon12			GCAGCAGTTCACC	D50479	CCDS10080.1	15q15.1-q21.1	2013-02-11			ENSG00000092445	ENSG00000092445	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12446	protein-coding gene	gene with protein product		600341		RSE		7851890	Standard	NM_006293		Approved	Dtk, Brt, Tif, Sky	uc001zof.2	Q06418	OTTHUMG00000130341	ENST00000263798.3:c.1551G>C	15.37:g.41862869G>C	ENSP00000263798:p.Gln517His	Somatic	56	0		WXS	Illumina HiSeq	.	48	2	NM_006293	O14953|Q86VR3	Missense_Mutation	SNP	ENST00000263798.3	37	CCDS10080.1	.	.	.	.	.	.	.	.	.	.	G	18.44	3.625285	0.66901	.	.	ENSG00000092445	ENST00000540218;ENST00000263798	T	0.62232	0.04	5.17	3.27	0.37495	Protein kinase-like domain (1);	0.000000	0.36778	N	0.002402	T	0.59224	0.2178	L	0.36672	1.1	0.44352	D	0.997241	P	0.51351	0.944	P	0.50490	0.642	T	0.61959	-0.6955	10	0.52906	T	0.07	-21.4534	11.836	0.52323	0.1443:0.0:0.8557:0.0	.	517	Q06418	TYRO3_HUMAN	H	449;517	ENSP00000263798:Q517H	ENSP00000263798:Q517H	Q	+	3	2	TYRO3	39650161	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.695000	0.37763	1.412000	0.46977	0.563000	0.77884	CAG	.		0.547	TYRO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252693.2		
FIG4	9896	hgsc.bcm.edu	37	6	110059612	110059612	+	Missense_Mutation	SNP	G	G	A			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr6:110059612G>A	ENST00000230124.3	+	7	855	c.731G>A	c.(730-732)cGt>cAt	p.R244H	FIG4_ENST00000368941.1_Intron|FIG4_ENST00000441478.2_Intron	NM_014845.5	NP_055660.1	Q92562	FIG4_HUMAN	FIG4 phosphoinositide 5-phosphatase	244	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				cell death (GO:0008219)|locomotory behavior (GO:0007626)|myelin assembly (GO:0032288)|negative regulation of myelination (GO:0031642)|neuron development (GO:0048666)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of neuron projection development (GO:0010976)|small molecule metabolic process (GO:0044281)|vacuole organization (GO:0007033)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)	phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphatidylinositol-4-phosphate phosphatase activity (GO:0043812)	p.R244H(1)		central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)	32		all_cancers(87;8.63e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000124)|all_lung(197;0.0187)|Colorectal(196;0.0492)|Lung SC(18;0.0548)		OV - Ovarian serous cystadenocarcinoma(136;0.0355)|Epithelial(106;0.038)|all cancers(137;0.0425)|BRCA - Breast invasive adenocarcinoma(108;0.079)		ACTGTGCATCGTGACTGGCTT	0.333																																					p.R244H		.											FIG4,NS,carcinoma,0,2	FIG4	0	1	Substitution - Missense(1)	lung(1)	c.G731A						.						153.0	154.0	154.0					6																	110059612		2203	4299	6502	SO:0001583	missense	9896	exon7			TGCATCGTGACTG	D87464	CCDS5078.1	6q21	2014-09-17	2014-08-04	2007-07-30	ENSG00000112367	ENSG00000112367			16873	protein-coding gene	gene with protein product		609390	"""KIAA0274"", ""FIG4 homolog (S. cerevisiae)"", ""FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)"""	KIAA0274		9039502, 11274189, 17572665	Standard	NM_014845		Approved	SAC3, hSac3, dJ249I4.1, ALS11, CMT4J	uc003ptt.2	Q92562	OTTHUMG00000015352	ENST00000230124.3:c.731G>A	6.37:g.110059612G>A	ENSP00000230124:p.Arg244His	Somatic	101	0		WXS	Illumina HiSeq	.	91	4	NM_014845	Q53H49|Q5TCS6	Missense_Mutation	SNP	ENST00000230124.3	37	CCDS5078.1	.	.	.	.	.	.	.	.	.	.	G	13.26	2.183886	0.38609	.	.	ENSG00000112367	ENST00000230124;ENST00000454215	T;T	0.56941	0.43;0.43	5.67	2.94	0.34122	Synaptojanin, N-terminal (2);	0.429330	0.26804	N	0.022407	T	0.13970	0.0338	N	0.04746	-0.17	0.80722	D	1	B	0.10296	0.003	B	0.09377	0.004	T	0.04440	-1.0951	10	0.34782	T	0.22	-3.9874	10.3077	0.43691	0.2706:0.0:0.7294:0.0	.	244	Q92562	FIG4_HUMAN	H	244;223	ENSP00000230124:R244H;ENSP00000412156:R223H	ENSP00000230124:R244H	R	+	2	0	FIG4	110166305	0.914000	0.31030	1.000000	0.80357	0.991000	0.79684	0.478000	0.22212	0.751000	0.32900	0.655000	0.94253	CGT	.		0.333	FIG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041768.1	NM_014845	
NSUN4	387338	hgsc.bcm.edu	37	1	46810541	46810541	+	Silent	SNP	G	G	A			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr1:46810541G>A	ENST00000474844.1	+	2	812	c.162G>A	c.(160-162)gtG>gtA	p.V54V	NSUN4_ENST00000537428.1_Silent_p.V5V|NSUN4_ENST00000536062.1_Silent_p.V5V|NSUN4_ENST00000498008.1_3'UTR	NM_199044.3	NP_950245.2	Q96CB9	NSUN4_HUMAN	NOP2/Sun domain family, member 4	54					rRNA methylation (GO:0031167)	mitochondrial large ribosomal subunit (GO:0005762)	methyltransferase activity (GO:0008168)|rRNA binding (GO:0019843)			endometrium(2)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)	8	Acute lymphoblastic leukemia(166;0.155)					CTTACAGTGTGCAGTTTGGAG	0.473																																					p.V54V		.											.	.	.	0			c.G162A						.						185.0	178.0	180.0					1																	46810541		2203	4300	6503	SO:0001819	synonymous_variant	387338	exon2			CAGTGTGCAGTTT	AK021577	CCDS534.1, CCDS57996.1	1p34	2012-02-24	2009-11-23		ENSG00000117481	ENSG00000117481		"""NOP2/Sun domain containing"""	31802	protein-coding gene	gene with protein product	"""sperm head and tail associated protein"""	615394	"""NOL1/NOP2/Sun domain family 4"", ""NOL1/NOP2/Sun domain family, member 4"""				Standard	NM_199044		Approved	MGC22960, SHTAP	uc001cpr.2	Q96CB9	OTTHUMG00000007808	ENST00000474844.1:c.162G>A	1.37:g.46810541G>A		Somatic	61	0		WXS	Illumina HiSeq	.	67	4	NM_199044	A8K6S6|B3KQ50|B4DHA4|Q5TDF7|Q96AN8|Q9HAJ8	Silent	SNP	ENST00000474844.1	37	CCDS534.1																																																																																			.		0.473	NSUN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021427.1	NM_199044	
YY1AP1	55249	hgsc.bcm.edu	37	1	155629657	155629657	+	Missense_Mutation	SNP	G	G	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr1:155629657G>T	ENST00000295566.4	-	11	2205	c.2182C>A	c.(2182-2184)Cca>Aca	p.P728T	MSTO1_ENST00000538143.1_Intron|YY1AP1_ENST00000347088.5_Missense_Mutation_p.P682T|YY1AP1_ENST00000355499.4_Missense_Mutation_p.P682T|YY1AP1_ENST00000407221.1_Missense_Mutation_p.P651T|MSTO1_ENST00000452804.2_Intron|YY1AP1_ENST00000359205.5_Missense_Mutation_p.P671T|YY1AP1_ENST00000368340.5_Missense_Mutation_p.P800T|YY1AP1_ENST00000404643.1_Missense_Mutation_p.P662T|YY1AP1_ENST00000361831.5_Missense_Mutation_p.P671T|YY1AP1_ENST00000535662.1_Missense_Mutation_p.P528T|YY1AP1_ENST00000368339.5_Missense_Mutation_p.P820T|YY1AP1_ENST00000368330.2_Missense_Mutation_p.P682T|YY1AP1_ENST00000311573.5_Missense_Mutation_p.P651T	NM_001198906.1|NM_139118.2	NP_001185835.1|NP_620829.1	Q9H869	YYAP1_HUMAN	YY1 associated protein 1	728					regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(7)|ovary(2)|skin(2)|urinary_tract(2)	31	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					TCGACTGGTGGAGGCCCTGGG	0.522																																					p.P820T		.											.	.	.	0			c.C2458A						.						134.0	123.0	127.0					1																	155629657		2203	4300	6503	SO:0001583	missense	55249	exon10			CTGGTGGAGGCCC	BC008766	CCDS1115.1, CCDS1116.1, CCDS55643.1, CCDS55644.1, CCDS55645.1	1q22	2009-05-07			ENSG00000163374	ENSG00000163374			30935	protein-coding gene	gene with protein product		607860				11710830	Standard	NM_139119		Approved	YY1AP, HCCA2, YAP		Q9H869	OTTHUMG00000035437	ENST00000295566.4:c.2182C>A	1.37:g.155629657G>T	ENSP00000295566:p.Pro728Thr	Somatic	63	0		WXS	Illumina HiSeq	.	72	4	NM_001198903	B0QZ54|B4DMP2|B4E0I0|D3DV96|D3DV98|H7BY62|Q5VYZ1|Q5VYZ4|Q5VYZ7|Q7L4C3|Q7L5E2|Q8IXA6|Q8TEW5|Q8TF04|Q96HB6|Q9BQ64|Q9NV84	Missense_Mutation	SNP	ENST00000295566.4	37	CCDS1115.1	.	.	.	.	.	.	.	.	.	.	g	0.019	-1.460595	0.01062	.	.	ENSG00000163374	ENST00000359205;ENST00000355499;ENST00000311573;ENST00000347088;ENST00000361831;ENST00000368340;ENST00000295566;ENST00000368330;ENST00000407221;ENST00000404643;ENST00000368339;ENST00000535662	T;T;T;T;T;T;T;T;T;T;T;T	0.23552	1.96;1.96;1.96;1.96;1.96;1.92;1.94;1.96;1.96;1.96;1.9;1.96	2.57	1.6	0.23607	.	1.381490	0.04449	N	0.372297	T	0.22551	0.0544	L	0.54323	1.7	0.09310	N	1	B;P;D;B;D	0.57899	0.003;0.688;0.981;0.012;0.961	B;B;D;B;P	0.67900	0.006;0.368;0.954;0.028;0.599	T	0.06481	-1.0824	10	0.46703	T	0.11	.	1.1528	0.01790	0.1507:0.2174:0.4112:0.2206	.	820;662;728;682;800	B4DMP2;Q9H869-4;Q9H869;Q9H869-2;Q5VYZ1	.;.;YYAP1_HUMAN;.;.	T	671;682;651;682;671;800;728;682;651;662;820;528	ENSP00000352134:P671T;ENSP00000347686:P682T;ENSP00000311138:P651T;ENSP00000316079:P682T;ENSP00000355298:P671T;ENSP00000357324:P800T;ENSP00000295566:P728T;ENSP00000357314:P682T;ENSP00000385791:P651T;ENSP00000385390:P662T;ENSP00000357323:P820T;ENSP00000437926:P528T	ENSP00000295566:P728T	P	-	1	0	YY1AP1	153896281	0.000000	0.05858	0.003000	0.11579	0.003000	0.03518	-0.570000	0.05895	0.366000	0.24427	0.313000	0.20887	CCA	.		0.522	YY1AP1-043	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000086027.1	NM_139118	
ZC3HAV1	56829	hgsc.bcm.edu;broad.mit.edu	37	7	138768749	138768749	+	Silent	SNP	C	C	T	rs368718217		TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr7:138768749C>T	ENST00000242351.5	-	3	790	c.474G>A	c.(472-474)cgG>cgA	p.R158R	ZC3HAV1_ENST00000464606.1_Silent_p.R158R|ZC3HAV1_ENST00000471652.1_Silent_p.R158R	NM_020119.3	NP_064504.2	Q7Z2W4	ZCCHV_HUMAN	zinc finger CCCH-type, antiviral 1	158	N-terminal domain.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of mRNA catabolic process (GO:0061014)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(4)|skin(1)	37						AAATCTGCTGCCGACCCTCTC	0.478																																					p.R158R		.											ZC3HAV1,colon,carcinoma,0,1	ZC3HAV1	0	0			c.G474A						.	C	,	0,4406		0,0,2203	94.0	91.0	92.0		474,474	-7.3	0.0	7		92	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	ZC3HAV1	NM_020119.3,NM_024625.3	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	158/903,158/700	138768749	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	56829	exon3			CTGCTGCCGACCC	BX571742	CCDS5851.1, CCDS55171.1	7q34	2012-07-05			ENSG00000105939	ENSG00000105939		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	23721	protein-coding gene	gene with protein product	"""zinc finger antiviral protein"", "" CCCH-type zinc finger antiviral protein"""	607312				12215647, 12851707	Standard	NM_024625		Approved	ZAP, FLB6421, FLJ13288, MGC48898, ZC3HDC2, ZC3H2, PARP13	uc003vun.3	Q7Z2W4	OTTHUMG00000157471	ENST00000242351.5:c.474G>A	7.37:g.138768749C>T		Somatic	67	0		WXS	Illumina HiSeq	.	47	3	NM_024625	A4D1R2|A4D1S4|Q8IW57|Q8TAJ3|Q96N79|Q9H8R9|Q9P0Y7	Silent	SNP	ENST00000242351.5	37	CCDS5851.1																																																																																			.		0.478	ZC3HAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348915.1	NM_020119	
TTC26	79989	hgsc.bcm.edu;bcgsc.ca	37	7	138819535	138819535	+	Missense_Mutation	SNP	G	G	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr7:138819535G>T	ENST00000464848.1	+	2	218	c.138G>T	c.(136-138)ttG>ttT	p.L46F	TTC26_ENST00000495038.1_Missense_Mutation_p.L46F|TTC26_ENST00000481482.1_3'UTR|TTC26_ENST00000478836.2_Missense_Mutation_p.L46F|TTC26_ENST00000343187.4_Missense_Mutation_p.L46F|TTC26_ENST00000474035.2_Missense_Mutation_p.L46F|TTC26_ENST00000430935.1_Missense_Mutation_p.L46F			A0AVF1	TTC26_HUMAN	tetratricopeptide repeat domain 26	46					cilium assembly (GO:0042384)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle B (GO:0030992)|primary cilium (GO:0072372)				breast(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	24						TTACCCTGTTGGAGGTAATGC	0.418																																					p.L46F		.											.	.	.	0			c.G138T						.						76.0	70.0	72.0					7																	138819535		2203	4300	6503	SO:0001583	missense	79989	exon2			CCTGTTGGAGGTA	AK022633	CCDS5852.1, CCDS55172.1, CCDS55173.1, CCDS75665.1	7q34	2013-01-11			ENSG00000105948	ENSG00000105948		"""Intraflagellar transport homologs"", ""Tetratricopeptide (TTC) repeat domain containing"""	21882	protein-coding gene	gene with protein product							Standard	NM_001144920		Approved	FLJ12571, dyf-13, DYF13	uc003vus.2	A0AVF1	OTTHUMG00000157472	ENST00000464848.1:c.138G>T	7.37:g.138819535G>T	ENSP00000419279:p.Leu46Phe	Somatic	91	0		WXS	Illumina HiSeq	.	58	4	NM_001144920	A4D1S3|B7Z5M0|C9J2N7|F8W724|Q9H9S8|Q9NTC0	Missense_Mutation	SNP	ENST00000464848.1	37	CCDS5852.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.976909	0.74360	.	.	ENSG00000105948	ENST00000430935;ENST00000495038;ENST00000474035;ENST00000478836;ENST00000464848;ENST00000343187	T;T;T;T;T	0.68331	-0.06;1.68;1.3;-0.05;-0.32	6.06	3.11	0.35812	Tetratricopeptide-like helical (1);	0.143826	0.43416	D	0.000564	T	0.80686	0.4670	M	0.91354	3.2	0.58432	D	0.999999	P;P;D;D;P;P;D	0.89917	0.745;0.9;0.999;0.987;0.745;0.826;1.0	B;P;D;P;B;B;D	0.70716	0.276;0.451;0.933;0.672;0.351;0.293;0.97	T	0.79132	-0.1929	10	0.87932	D	0	.	3.6621	0.08242	0.0774:0.2155:0.445:0.2621	.	46;46;46;46;46;46;46	B7Z2T3;F8W724;C9J2N7;B7Z6R6;A0AVF1;B7Z5M0;Q96CU4	.;.;.;.;TTC26_HUMAN;.;.	F	46	ENSP00000410655:L46F;ENSP00000418788:L46F;ENSP00000419178:L46F;ENSP00000419279:L46F;ENSP00000339135:L46F	ENSP00000339135:L46F	L	+	3	2	TTC26	138470075	1.000000	0.71417	0.978000	0.43139	0.995000	0.86356	1.751000	0.38339	0.869000	0.35703	0.650000	0.86243	TTG	.		0.418	TTC26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348919.2	NM_024926	
AGTR2	186	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	115304157	115304157	+	Silent	SNP	A	A	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chrX:115304157A>T	ENST00000371906.4	+	3	814	c.624A>T	c.(622-624)tcA>tcT	p.S208S		NM_000686.4	NP_000677.2	P50052	AGTR2_HUMAN	angiotensin II receptor, type 2	208					aldosterone secretion (GO:0035932)|angiotensin-activated signaling pathway (GO:0038166)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|brain renin-angiotensin system (GO:0002035)|cell growth involved in cardiac muscle cell development (GO:0061049)|cell surface receptor signaling pathway (GO:0007166)|cellular response to dexamethasone stimulus (GO:0071549)|cellular sodium ion homeostasis (GO:0006883)|cerebellar cortex development (GO:0021695)|dopamine biosynthetic process (GO:0042416)|exploration behavior (GO:0035640)|extracellular negative regulation of signal transduction (GO:1900116)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell growth (GO:0030308)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of heart rate (GO:0010459)|negative regulation of icosanoid secretion (GO:0032304)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of norepinephrine secretion (GO:0010700)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasodilation (GO:0045909)|regulation of blood pressure (GO:0008217)|regulation of metanephros size (GO:0035566)|regulation of systemic arterial blood pressure by circulatory renin-angiotensin (GO:0001991)|regulation of transcription factor import into nucleus (GO:0042990)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to organonitrogen compound (GO:0010243)|vasodilation by angiotensin involved in regulation of systemic arterial blood pressure (GO:0002033)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	angiotensin type II receptor activity (GO:0004945)|peptide hormone binding (GO:0017046)|receptor antagonist activity (GO:0048019)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|skin(1)	24					Tasosartan(DB01349)	CCCAATGGTCAGCTGGGATTG	0.363																																					p.S208S		.											.	.	.	0			c.A624T						.						112.0	100.0	104.0					X																	115304157		2203	4300	6503	SO:0001819	synonymous_variant	186	exon3			ATGGTCAGCTGGG	AY324607	CCDS14569.1	Xq22-q23	2012-08-08			ENSG00000180772	ENSG00000180772		"""GPCR / Class A : Angiotensin receptors"""	338	protein-coding gene	gene with protein product		300034	"""angiotensin receptor 2"""			1550596	Standard	NM_000686		Approved	AT2, MRX88	uc004eqh.4	P50052	OTTHUMG00000022243	ENST00000371906.4:c.624A>T	X.37:g.115304157A>T		Somatic	70	0		WXS	Illumina HiSeq	.	47	5	NM_000686	B2R9V1|Q13016|Q6FGY7	Silent	SNP	ENST00000371906.4	37	CCDS14569.1																																																																																			.		0.363	AGTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057984.1	NM_000686	
NID2	22795	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	52520801	52520801	+	Silent	SNP	A	A	G			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr14:52520801A>G	ENST00000216286.5	-	4	1005	c.1006T>C	c.(1006-1008)Ttg>Ctg	p.L336L	NID2_ENST00000541773.1_Silent_p.L283L	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)	336					basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)			NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					TGGCCATTCAATGCCTCCTCT	0.473																																					p.L336L		.											.	.	.	0			c.T1006C						.						102.0	96.0	98.0					14																	52520801		2203	4300	6503	SO:0001819	synonymous_variant	22795	exon4			CATTCAATGCCTC	AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.1006T>C	14.37:g.52520801A>G		Somatic	94	0		WXS	Illumina HiSeq	.	61	5	NM_007361	A8K6I7|B4DU19|O43710	Silent	SNP	ENST00000216286.5	37	CCDS9706.1																																																																																			.		0.473	NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276888.1		
CSH2	1443	hgsc.bcm.edu	37	17	61949936	61949936	+	Splice_Site	SNP	C	C	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr17:61949936C>T	ENST00000392886.2	-	4	608		c.e4+1		CSH2_ENST00000345366.7_Intron|CSH2_ENST00000560142.1_Splice_Site|CSH2_ENST00000336844.5_Missense_Mutation_p.V153M	NM_020991.3	NP_066271.1	P0DML3	CSH2_HUMAN	chorionic somatomammotropin hormone 2							extracellular region (GO:0005576)	metal ion binding (GO:0046872)			endometrium(2)|large_intestine(1)|lung(3)	6						GCCACCCTCACCCCCATCAGC	0.582																																					p.V153M		.											.	.	.	0			c.G457A						.						70.0	66.0	67.0					17																	61949936		2203	4300	6503	SO:0001630	splice_region_variant	1443	exon4			CCCTCACCCCCAT	V00573	CCDS11646.1, CCDS42368.1, CCDS42369.1	17q22-q24	2012-10-02							2441	protein-coding gene	gene with protein product	"""placental lactogen"", ""chorionic somatomammotropin B"""	118820				593368, 6208192	Standard	NM_020991		Approved	hCS-B, CSB, CS-2	uc002jch.3	P0DML3		ENST00000392886.2:c.456+1G>A	17.37:g.61949936C>T		Somatic	123	0		WXS	Illumina HiSeq	.	78	2	NM_022644	P01243|Q0VDB1|Q14407	Missense_Mutation	SNP	ENST00000392886.2	37	CCDS42369.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|c	9.172|9.172	1.021462|1.021462	0.19433|0.19433	.|.	.|.	ENSG00000213218|ENSG00000213218	ENST00000392886|ENST00000336844	.|D	.|0.86956	.|-2.19	3.77|3.77	3.77|3.77	0.43336|0.43336	.|.	.|.	.|.	.|.	.|.	.|D	.|0.91845	.|0.7419	M|M	0.65975|0.65975	2.015|2.015	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	.|D	.|0.91624	.|0.5313	.|8	.|.	.|.	.|.	.|.	14.3045|14.3045	0.66375|0.66375	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|153	.|A6NIT4	.|.	.|M	-1|153	.|ENSP00000338816:V153M	.|.	.|V	-|-	.|1	.|0	CSH2|CSH2	59303668|59303668	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.031000|0.031000	0.12232|0.12232	5.226000|5.226000	0.65299|0.65299	1.924000|1.924000	0.55735|0.55735	0.462000|0.462000	0.41574|0.41574	.|GTG	.		0.582	CSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417657.1	NM_020991	Intron
GLRA2	2742	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	14708892	14708892	+	Missense_Mutation	SNP	G	G	C			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chrX:14708892G>C	ENST00000218075.4	+	8	1521	c.991G>C	c.(991-993)Gcc>Ccc	p.A331P	GLRA2_ENST00000443437.2_Missense_Mutation_p.A242P|GLRA2_ENST00000355020.4_Missense_Mutation_p.A331P	NM_002063.3	NP_002054.1	P23416	GLRA2_HUMAN	glycine receptor, alpha 2	331					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)|synapse assembly (GO:0007416)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(22)|ovary(1)|prostate(1)|skin(2)	37	Hepatocellular(33;0.128)				Ethanol(DB00898)|Glycine(DB00145)|Lindane(DB00431)	TGTGTTTGCTGCCTTACTGGA	0.502																																					p.A331P		.											.	.	.	0			c.G991C						.						194.0	152.0	166.0					X																	14708892		2203	4300	6503	SO:0001583	missense	2742	exon9			TTTGCTGCCTTAC		CCDS14160.1, CCDS48085.1, CCDS55371.1	Xp22.2	2012-02-07			ENSG00000101958	ENSG00000101958		"""Ligand-gated ion channels / Glycine receptors"""	4327	protein-coding gene	gene with protein product		305990		GLR			Standard	NM_002063		Approved		uc010nep.3	P23416	OTTHUMG00000021166	ENST00000218075.4:c.991G>C	X.37:g.14708892G>C	ENSP00000218075:p.Ala331Pro	Somatic	59	0		WXS	Illumina HiSeq	.	45	8	NM_001118885	A8K0J6|B2R6I8|B7Z4F5|J3KQ59|Q53YX7|Q6ICQ0|Q99862	Missense_Mutation	SNP	ENST00000218075.4	37	CCDS14160.1	.	.	.	.	.	.	.	.	.	.	G	33	5.199469	0.94997	.	.	ENSG00000101958	ENST00000443437;ENST00000218075;ENST00000355020	D;D;D	0.85861	-2.04;-2.04;-2.04	5.15	5.15	0.70609	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.94850	0.8336	H	0.95437	3.67	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.81914	0.994;0.995;0.994	D	0.96440	0.9326	10	0.87932	D	0	.	17.9918	0.89171	0.0:0.0:1.0:0.0	.	315;331;331	B7Z4E9;P23416;P23416-2	.;GLRA2_HUMAN;.	P	242;331;331	ENSP00000387756:A242P;ENSP00000218075:A331P;ENSP00000347123:A331P	ENSP00000218075:A331P	A	+	1	0	GLRA2	14618813	1.000000	0.71417	0.999000	0.59377	0.986000	0.74619	9.715000	0.98748	2.270000	0.75569	0.422000	0.28245	GCC	.		0.502	GLRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055829.1		
PKHD1L1	93035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	110476496	110476496	+	Missense_Mutation	SNP	C	C	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr8:110476496C>T	ENST00000378402.5	+	49	7539	c.7435C>T	c.(7435-7437)Cac>Tac	p.H2479Y		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	2479					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AATACATTGGCACCTGCTTGG	0.428										HNSCC(38;0.096)																											p.H2479Y		.											.	.	.	0			c.C7435T						.						52.0	48.0	49.0					8																	110476496		1864	4121	5985	SO:0001583	missense	93035	exon49			CATTGGCACCTGC	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.7435C>T	8.37:g.110476496C>T	ENSP00000367655:p.His2479Tyr	Somatic	82	0		WXS	Illumina HiSeq	.	75	24	NM_177531	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.240811	0.79912	.	.	ENSG00000205038	ENST00000378402	D	0.93953	-3.32	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.97288	0.9113	M	0.90650	3.135	0.45704	D	0.998611	D	0.76494	0.999	D	0.87578	0.998	D	0.97887	1.0295	10	0.72032	D	0.01	.	16.9062	0.86128	0.0:1.0:0.0:0.0	.	2479	Q86WI1	PKHL1_HUMAN	Y	2479	ENSP00000367655:H2479Y	ENSP00000367655:H2479Y	H	+	1	0	PKHD1L1	110545672	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.675000	0.74493	2.595000	0.87683	0.555000	0.69702	CAC	.		0.428	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
ALPK2	115701	hgsc.bcm.edu;bcgsc.ca	37	18	56202476	56202476	+	Missense_Mutation	SNP	G	G	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr18:56202476G>T	ENST00000361673.3	-	5	5156	c.4943C>A	c.(4942-4944)tCc>tAc	p.S1648Y	RP11-1151B14.4_ENST00000591360.1_RNA	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	1648	Poly-Ser.					nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						CTTCGCTGAGGAGCTAGATGA	0.463																																					p.S1648Y		.											.	.	.	0			c.C4943A						.						74.0	78.0	77.0					18																	56202476		2203	4300	6503	SO:0001583	missense	115701	exon5			GCTGAGGAGCTAG	AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.4943C>A	18.37:g.56202476G>T	ENSP00000354991:p.Ser1648Tyr	Somatic	91	0		WXS	Illumina HiSeq	.	75	4	NM_052947	Q6ZUX0|Q8NAT5|Q96L95	Missense_Mutation	SNP	ENST00000361673.3	37	CCDS11966.2	.	.	.	.	.	.	.	.	.	.	G	15.55	2.865709	0.51588	.	.	ENSG00000198796	ENST00000361673	T	0.55588	0.51	5.74	2.91	0.33838	.	5.297280	0.00166	N	0.000005	T	0.68458	0.3003	L	0.54323	1.7	0.09310	N	1	D;D	0.89917	1.0;0.991	D;P	0.70935	0.971;0.862	T	0.32455	-0.9906	10	0.87932	D	0	0.0915	6.4782	0.22047	0.1684:0.1469:0.6847:0.0	.	1643;1648	Q86TB3-2;Q86TB3	.;ALPK2_HUMAN	Y	1648	ENSP00000354991:S1648Y	ENSP00000354991:S1648Y	S	-	2	0	ALPK2	54353456	0.002000	0.14202	0.000000	0.03702	0.002000	0.02628	1.091000	0.30915	0.309000	0.22966	0.655000	0.94253	TCC	.		0.463	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947	
EGFR	1956	hgsc.bcm.edu	37	7	55249155	55249155	+	Missense_Mutation	SNP	G	G	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr7:55249155G>T	ENST00000275493.2	+	20	2630	c.2453G>T	c.(2452-2454)tGt>tTt	p.C818F	EGFR_ENST00000454757.2_Missense_Mutation_p.C765F|EGFR-AS1_ENST00000442411.1_RNA|EGFR_ENST00000455089.1_Missense_Mutation_p.C773F|EGFR_ENST00000442591.1_Intron	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	818	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.C818Y(1)		NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	CTCAACTGGTGTGTGCAGATC	0.562		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																											p.C818F		.	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	EGFR,colon,carcinoma,+1,1	EGFR	+1	1	Substitution - Missense(1)	pancreas(1)	c.G2453T						.						79.0	70.0	73.0					7																	55249155		2203	4300	6503	SO:0001583	missense	1956	exon20	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	ACTGGTGTGTGCA		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.2453G>T	7.37:g.55249155G>T	ENSP00000275493:p.Cys818Phe	Somatic	68	0		WXS	Illumina HiSeq	.	52	3	NM_005228	O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	ENST00000275493.2	37	CCDS5514.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.627701	0.87560	.	.	ENSG00000146648	ENST00000455089;ENST00000395504;ENST00000275493;ENST00000454757	T;T;T	0.61040	0.14;0.14;0.14	5.92	5.92	0.95590	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.71533	0.3351	L	0.45422	1.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.964;1.0	T	0.72308	-0.4332	10	0.87932	D	0	.	18.8719	0.92319	0.0:0.0:1.0:0.0	.	773;818	Q504U8;P00533	.;EGFR_HUMAN	F	773;688;818;765	ENSP00000415559:C773F;ENSP00000275493:C818F;ENSP00000395243:C765F	ENSP00000275493:C818F	C	+	2	0	EGFR	55216649	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.834000	0.86773	2.795000	0.96236	0.655000	0.94253	TGT	.		0.562	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228	
STK36	27148	hgsc.bcm.edu	37	2	219563551	219563551	+	Missense_Mutation	SNP	G	G	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr2:219563551G>T	ENST00000295709.3	+	26	3563	c.3284G>T	c.(3283-3285)aGc>aTc	p.S1095I	STK36_ENST00000440309.1_Missense_Mutation_p.S1095I|STK36_ENST00000392105.3_Missense_Mutation_p.S1074I|STK36_ENST00000392106.2_Missense_Mutation_p.S1074I	NM_015690.4	NP_056505.2			serine/threonine kinase 36											biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(20)|ovary(4)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	52		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)		CTGTCTCCCAGCCACTTGTCC	0.587																																					p.S1095I		.											STK36,NS,carcinoma,0,1	STK36	0	0			c.G3284T						.						84.0	78.0	80.0					2																	219563551		2203	4300	6503	SO:0001583	missense	27148	exon26			CTCCCAGCCACTT	AB033104	CCDS2421.1, CCDS58750.1	2q35	2010-06-25	2010-06-25		ENSG00000163482	ENSG00000163482			17209	protein-coding gene	gene with protein product	"""fused homolog (Drosophila)"""	607652	"""serine/threonine kinase 36 (fused homolog, Drosophila)"""			10806483	Standard	NM_001243313		Approved	KIAA1278, FU	uc002viu.3	Q9NRP7	OTTHUMG00000133079	ENST00000295709.3:c.3284G>T	2.37:g.219563551G>T	ENSP00000295709:p.Ser1095Ile	Somatic	45	0		WXS	Illumina HiSeq	.	38	2	NM_015690		Missense_Mutation	SNP	ENST00000295709.3	37	CCDS2421.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.01|10.01	1.233687|1.233687	0.22626|0.22626	.|.	.|.	ENSG00000163482|ENSG00000163482	ENST00000431040|ENST00000295709;ENST00000392106;ENST00000392105;ENST00000440309	.|T;T;T;T	.|0.64085	.|0.7;0.7;-0.08;0.7	6.06|6.06	3.05|3.05	0.35203|0.35203	.|Armadillo-type fold (1);	.|0.123693	.|0.37219	.|N	.|0.002183	T|T	0.42177|0.42177	0.1191|0.1191	N|N	0.19112|0.19112	0.55|0.55	0.20403|0.20403	N|N	0.999902|0.999902	.|P;P;B	.|0.39216	.|0.664;0.573;0.437	.|B;B;B	.|0.36766	.|0.125;0.232;0.117	T|T	0.27226|0.27226	-1.0080|-1.0080	5|10	.|0.44086	.|T	.|0.13	-1.1486|-1.1486	7.7759|7.7759	0.29037|0.29037	0.1609:0.3511:0.488:0.0|0.1609:0.3511:0.488:0.0	.|.	.|1074;1074;1095	.|A8MU99;Q9NRP7-2;Q9NRP7	.|.;.;STK36_HUMAN	S|I	288|1095;1074;1074;1095	.|ENSP00000295709:S1095I;ENSP00000375955:S1074I;ENSP00000375954:S1074I;ENSP00000394095:S1095I	.|ENSP00000295709:S1095I	A|S	+|+	1|2	0|0	STK36|STK36	219271795|219271795	0.008000|0.008000	0.16893|0.16893	0.982000|0.982000	0.44146|0.44146	0.197000|0.197000	0.23852|0.23852	0.157000|0.157000	0.16402|0.16402	0.854000|0.854000	0.35336|0.35336	0.655000|0.655000	0.94253|0.94253	GCC|AGC	.		0.587	STK36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256723.2		
IREB2	3658	hgsc.bcm.edu;bcgsc.ca	37	15	78732192	78732192	+	Missense_Mutation	SNP	C	C	A			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr15:78732192C>A	ENST00000258886.8	+	2	224	c.75C>A	c.(73-75)ttC>ttA	p.F25L	IREB2_ENST00000560440.1_Missense_Mutation_p.F25L	NM_004136.2	NP_004127	P48200	IREB2_HUMAN	iron-responsive element binding protein 2	25					aging (GO:0007568)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|erythrocyte homeostasis (GO:0034101)|intestinal absorption (GO:0050892)|iron ion transport (GO:0006826)|osteoclast differentiation (GO:0030316)|post-embryonic development (GO:0009791)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to iron(II) ion (GO:0010040)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|translation repressor activity (GO:0030371)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	41				UCEC - Uterine corpus endometrioid carcinoma (272;0.232)		ATAAGAAGTTCTTCGATGTAT	0.308																																					p.F25L	NSCLC(200;764 2208 35157 49871 50830)	.											.	.	.	0			c.C75A						.						133.0	113.0	120.0					15																	78732192		2196	4293	6489	SO:0001583	missense	3658	exon2			GAAGTTCTTCGAT	M58511	CCDS10302.1	15q25.1	2013-09-20			ENSG00000136381	ENSG00000136381			6115	protein-coding gene	gene with protein product		147582				2172968	Standard	NM_004136		Approved	IRP2	uc002bdr.2	P48200	OTTHUMG00000143861	ENST00000258886.8:c.75C>A	15.37:g.78732192C>A	ENSP00000258886:p.Phe25Leu	Somatic	94	0		WXS	Illumina HiSeq	.	91	4	NM_004136	A8KAC7|E1CJT9|H0YKU0|Q13095|Q1HE21|Q59FQ7|Q8WVK6|Q9UF17	Missense_Mutation	SNP	ENST00000258886.8	37	CCDS10302.1	.	.	.	.	.	.	.	.	.	.	C	16.76	3.213559	0.58452	.	.	ENSG00000136381	ENST00000258886	T	0.20463	2.07	4.92	4.92	0.64577	Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha (1);	0.052076	0.85682	D	0.000000	T	0.25344	0.0616	M	0.72118	2.19	0.51233	D	0.999915	D;B	0.62365	0.991;0.15	B;B	0.40285	0.325;0.023	T	0.15321	-1.0441	10	0.72032	D	0.01	.	13.6487	0.62297	0.0:1.0:0.0:0.0	.	25;25	P48200;Q8WVK6	IREB2_HUMAN;.	L	25	ENSP00000258886:F25L	ENSP00000258886:F25L	F	+	3	2	IREB2	76519247	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	2.309000	0.43699	2.274000	0.75844	0.467000	0.42956	TTC	.		0.308	IREB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290109.3	NM_004136	
SNCAIP	9627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	121758570	121758570	+	Missense_Mutation	SNP	C	C	A			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr5:121758570C>A	ENST00000261368.8	+	4	400	c.138C>A	c.(136-138)agC>agA	p.S46R	SNCAIP_ENST00000504884.2_Intron|SNCAIP_ENST00000542191.1_Intron|SNCAIP_ENST00000414317.2_Intron|SNCAIP_ENST00000379536.2_Missense_Mutation_p.S46R|SNCAIP_ENST00000503116.2_Missense_Mutation_p.S93R|SNCAIP_ENST00000379533.2_Missense_Mutation_p.S93R|SNCAIP_ENST00000261367.7_Missense_Mutation_p.S93R|SNCAIP_ENST00000379538.3_Intron	NM_005460.2	NP_005451.2	Q9Y6H5	SNCAP_HUMAN	synuclein, alpha interacting protein	46					cell death (GO:0008219)|dopamine metabolic process (GO:0042417)|regulation of inclusion body assembly (GO:0090083)|regulation of neurotransmitter secretion (GO:0046928)	cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	identical protein binding (GO:0042802)|ubiquitin protein ligase binding (GO:0031625)			NS(3)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	39		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		CAGTTTCTAGCTCTAGCTGGA	0.393																																					p.S46R		.											.	.	.	0			c.C138A						.						45.0	47.0	47.0					5																	121758570		2203	4300	6503	SO:0001583	missense	9627	exon4			TTCTAGCTCTAGC	AF167306	CCDS4131.1, CCDS58964.1	5q23.2	2013-01-10	2008-07-31		ENSG00000064692	ENSG00000064692		"""Ankyrin repeat domain containing"""	11139	protein-coding gene	gene with protein product	"""synphilin"""	603779				10319874	Standard	NM_001242935		Approved	SYPH1	uc003ksw.1	Q9Y6H5	OTTHUMG00000128915	ENST00000261368.8:c.138C>A	5.37:g.121758570C>A	ENSP00000261368:p.Ser46Arg	Somatic	75	0		WXS	Illumina HiSeq	.	60	15	NM_005460	D3DSZ1|Q05BS1|Q1PSC2|Q49AC6|Q504U9|Q6L984|Q6L985|Q6L986|Q9HC59	Missense_Mutation	SNP	ENST00000261368.8	37	CCDS4131.1	.	.	.	.	.	.	.	.	.	.	C	19.44	3.828082	0.71143	.	.	ENSG00000064692	ENST00000514467;ENST00000506272;ENST00000508681;ENST00000509154;ENST00000261368;ENST00000379533;ENST00000379536;ENST00000261367;ENST00000503116	T;T;T;T;T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55	5.72	2.56	0.30785	.	0.133681	0.64402	D	0.000001	T	0.33789	0.0875	L	0.32530	0.975	0.80722	D	1	P;D;P;B	0.62365	0.895;0.991;0.925;0.437	B;P;P;B	0.53809	0.446;0.735;0.571;0.109	T	0.15009	-1.0452	10	0.87932	D	0	-2.4647	12.1876	0.54247	0.0:0.7828:0.0:0.2172	.	46;93;93;46	D6R9G8;Q9Y6H5-6;Q9Y6H5-3;Q9Y6H5	.;.;.;SNCAP_HUMAN	R	46;93;46;46;46;93;46;93;93	ENSP00000427090:S46R;ENSP00000426551:S93R;ENSP00000422610:S46R;ENSP00000422106:S46R;ENSP00000261368:S46R;ENSP00000368848:S93R;ENSP00000368851:S46R;ENSP00000261367:S93R;ENSP00000423199:S93R	ENSP00000261367:S93R	S	+	3	2	SNCAIP	121786469	1.000000	0.71417	0.998000	0.56505	0.978000	0.69477	1.627000	0.37050	0.779000	0.33543	0.655000	0.94253	AGC	.		0.393	SNCAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250888.1		
SATL1	340562	hgsc.bcm.edu	37	X	84362915	84362915	+	Nonsense_Mutation	SNP	G	G	A	rs374764586		TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chrX:84362915G>A	ENST00000395409.3	-	1	1059	c.499C>T	c.(499-501)Cga>Tga	p.R167*	SATL1_ENST00000509231.1_Nonsense_Mutation_p.R354*|SATL1_ENST00000332921.5_Nonsense_Mutation_p.R167*			Q86VE3	SATL1_HUMAN	spermidine/spermine N1-acetyl transferase-like 1	167	Gln-rich.						N-acetyltransferase activity (GO:0008080)			NS(1)|breast(5)|endometrium(2)|large_intestine(3)|lung(13)|skin(3)|stomach(1)|urinary_tract(1)	29						CTTGGGGCTCGTTGCGGTGGA	0.537																																					p.R354X		.											.	.	.	0			c.C1060T						.						193.0	127.0	150.0					X																	84362915		2203	4300	6503	SO:0001587	stop_gained	340562	exon1			GGGCTCGTTGCGG	BC043215	CCDS35343.1, CCDS35343.2	Xq21	2008-02-05			ENSG00000184788	ENSG00000184788			27992	protein-coding gene	gene with protein product						12477932	Standard	NM_001012980		Approved		uc004een.3	Q86VE3	OTTHUMG00000021931	ENST00000395409.3:c.499C>T	X.37:g.84362915G>A	ENSP00000378804:p.Arg167*	Somatic	109	0		WXS	Illumina HiSeq	.	105	4	NM_001012980	A0AVK7|E9PB72|Q5H8V9	Nonsense_Mutation	SNP	ENST00000395409.3	37		.	.	.	.	.	.	.	.	.	.	G	37	6.492086	0.97612	.	.	ENSG00000184788	ENST00000395409;ENST00000332921;ENST00000509231	.	.	.	2.67	-5.34	0.02705	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	.	5.5799	0.17245	0.2755:0.4243:0.3003:0.0	.	.	.	.	X	167;167;354	.	ENSP00000329115:R167X	R	-	1	2	SATL1	84249571	0.015000	0.18098	0.000000	0.03702	0.020000	0.10135	0.082000	0.14847	-1.632000	0.01541	0.384000	0.25694	CGA	.		0.537	SATL1-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_291339	
MYO1H	283446	hgsc.bcm.edu;bcgsc.ca	37	12	109877582	109877582	+	Missense_Mutation	SNP	G	G	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr12:109877582G>T	ENST00000431443.2	+	23	2423	c.2423G>T	c.(2422-2424)gGc>gTc	p.G808V	MYO1H_ENST00000310903.5_Missense_Mutation_p.G798V	NM_001101421.3	NP_001094891.3	Q8N1T3	MYO1H_HUMAN	myosin IH	808						myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(17)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	47						AGGCCTCCTGGCATCTTGGAA	0.473																																					p.G798V		.											.	.	.	0			c.G2393T						.						55.0	54.0	54.0					12																	109877582		1971	4164	6135	SO:0001583	missense	283446	exon23			CTCCTGGCATCTT		CCDS53826.1	12q24.11	2011-09-27			ENSG00000174527	ENSG00000174527		"""Myosins / Myosin superfamily : Class I"""	13879	protein-coding gene	gene with protein product		614636					Standard	NM_001101421		Approved	FLJ37587	uc010sxn.1	Q8N1T3	OTTHUMG00000169252	ENST00000431443.2:c.2423G>T	12.37:g.109877582G>T	ENSP00000444076:p.Gly808Val	Somatic	86	0		WXS	Illumina HiSeq	.	55	4	NM_001101421	F5H3C6	Missense_Mutation	SNP	ENST00000431443.2	37		.	.	.	.	.	.	.	.	.	.	G	1.214	-0.628759	0.03610	.	.	ENSG00000174527	ENST00000310903;ENST00000431443	D;D	0.87256	-2.21;-2.23	5.43	2.54	0.30619	.	.	.	.	.	T	0.72137	0.3423	N	0.17082	0.46	0.30197	N	0.798946	B	0.18461	0.028	B	0.16289	0.015	T	0.60105	-0.7328	9	0.16896	T	0.51	.	3.9811	0.09495	0.0937:0.3859:0.3861:0.1343	.	798	F5H3C6	.	V	798;808	ENSP00000439182:G798V;ENSP00000444076:G808V	ENSP00000439182:G798V	G	+	2	0	MYO1H	108361965	0.991000	0.36638	0.214000	0.23707	0.104000	0.19210	2.094000	0.41719	0.661000	0.30985	-0.136000	0.14681	GGC	.		0.473	MYO1H-201	KNOWN	basic	protein_coding	protein_coding		NM_173597	
MAML3	55534	hgsc.bcm.edu	37	4	140811114	140811114	+	Silent	SNP	C	C	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr4:140811114C>T	ENST00000509479.2	-	2	2332	c.1476G>A	c.(1474-1476)caG>caA	p.Q492Q	MAML3_ENST00000327122.5_Silent_p.Q336Q|MAML3_ENST00000398940.1_Silent_p.Q31Q	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					gctgctgctgctgctgctgtt	0.542																																					p.Q492Q		.											MAML3_ENST00000509479,colon,carcinoma,0,4	MAML3_ENST00000509479	0	0			c.G1476A						.						15.0	19.0	18.0					4																	140811114		2185	4284	6469	SO:0001819	synonymous_variant	55534	exon2			CTGCTGCTGCTGC	AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.1476G>A	4.37:g.140811114C>T		Somatic	25	0		WXS	Illumina HiSeq	.	19	2	NM_018717		Silent	SNP	ENST00000509479.2	37	CCDS54805.1																																																																																			.		0.542	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364934.2		
UMODL1	89766	hgsc.bcm.edu	37	21	43543114	43543114	+	Missense_Mutation	SNP	G	G	T	rs201855268|rs138728872	byFrequency	TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr21:43543114G>T	ENST00000408910.2	+	17	3001	c.3001G>T	c.(3001-3003)Gcc>Tcc	p.A1001S	UMODL1_ENST00000400427.1_Missense_Mutation_p.A1057S|UMODL1_ENST00000400423.2_3'UTR|UMODL1_ENST00000400424.2_Missense_Mutation_p.A929S|UMODL1_ENST00000408989.2_Missense_Mutation_p.A1129S	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1	1001	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)	p.A929T(1)		breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						GGTGGTTGTCGCCATCCAGAA	0.622																																					p.A1129S	Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	.											UMODL1,colon,carcinoma,0,1	UMODL1	0	1	Substitution - Missense(1)	large_intestine(1)	c.G3385T						.						84.0	91.0	89.0					21																	43543114		2169	4266	6435	SO:0001583	missense	89766	exon16			GTTGTCGCCATCC		CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.3001G>T	21.37:g.43543114G>T	ENSP00000386147:p.Ala1001Ser	Somatic	13	1		WXS	Illumina HiSeq	.	12	2	NM_173568	C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Missense_Mutation	SNP	ENST00000408910.2	37	CCDS42936.1	.	.	.	.	.	.	.	.	.	.	G	11.12	1.544317	0.27563	.	.	ENSG00000177398	ENST00000400427;ENST00000400424;ENST00000408989;ENST00000408910	D;D;D;D	0.81821	-1.54;-1.54;-1.54;-1.54	3.13	0.274	0.15654	Zona pellucida sperm-binding protein (3);	1.345410	0.05541	N	0.565800	T	0.70824	0.3268	L	0.29908	0.895	0.09310	N	0.999997	P;P	0.48230	0.907;0.867	B;B	0.42916	0.393;0.402	T	0.59904	-0.7366	9	.	.	.	-5.8068	6.8413	0.23965	0.4274:0.0:0.5726:0.0	.	1129;1001	Q5DID0-2;Q5DID0	.;UROL1_HUMAN	S	1057;929;1129;1001	ENSP00000383279:A1057S;ENSP00000383276:A929S;ENSP00000386126:A1129S;ENSP00000386147:A1001S	.	A	+	1	0	UMODL1	42416183	0.064000	0.20934	0.024000	0.17045	0.868000	0.49771	0.144000	0.16135	0.045000	0.15804	0.313000	0.20887	GCC	.		0.622	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195292.2		
GCN1L1	10985	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	120582444	120582444	+	Splice_Site	SNP	T	T	C			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr12:120582444T>C	ENST00000300648.6	-	41	5363	c.5351A>G	c.(5350-5352)aAa>aGa	p.K1784R		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	1784					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GGTACCTACTTTGAGGATACA	0.522																																					p.K1784R		.											.	.	.	0			c.A5351G						.						100.0	100.0	100.0					12																	120582444		1986	4163	6149	SO:0001630	splice_region_variant	10985	exon41			CCTACTTTGAGGA	U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.5352+1A>G	12.37:g.120582444T>C		Somatic	79	0		WXS	Illumina HiSeq	.	43	15	NM_006836	A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Missense_Mutation	SNP	ENST00000300648.6	37	CCDS41847.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.356438	0.82243	.	.	ENSG00000089154	ENST00000300648	T	0.65178	-0.14	6.17	6.17	0.99709	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.74935	0.3782	M	0.71581	2.175	0.80722	D	1	P	0.52316	0.952	P	0.55871	0.786	T	0.76531	-0.2925	10	0.56958	D	0.05	-12.7613	16.8222	0.85835	0.0:0.0:0.0:1.0	.	1784	Q92616	GCN1L_HUMAN	R	1784	ENSP00000300648:K1784R	ENSP00000300648:K1784R	K	-	2	0	GCN1L1	119066827	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.675000	0.84002	2.371000	0.80710	0.533000	0.62120	AAA	.		0.522	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1		Missense_Mutation
DZIP3	9666	hgsc.bcm.edu	37	3	108344792	108344792	+	Missense_Mutation	SNP	G	G	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr3:108344792G>T	ENST00000361582.3	+	7	787	c.557G>T	c.(556-558)gGt>gTt	p.G186V	DZIP3_ENST00000463306.1_Missense_Mutation_p.G186V	NM_014648.3	NP_055463.1	Q86Y13	DZIP3_HUMAN	DAZ interacting zinc finger protein 3	186					protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(21)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	45						TTTGGACGTGGTTTACTGCGA	0.353																																					p.G186V		.											.	.	.	0			c.G557T						.						126.0	127.0	126.0					3																	108344792		2203	4299	6502	SO:0001583	missense	9666	exon7			GACGTGGTTTACT	AF279370	CCDS2952.1	3q13.13	2013-05-22	2013-05-22		ENSG00000198919	ENSG00000198919		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30938	protein-coding gene	gene with protein product	"""human RNA-binding ubiquitin ligase of 138 kDa"", ""protein phosphatase 1, regulatory subunit 66"""	608672	"""DAZ interacting protein 3, zinc finger"""			9734811, 12538761	Standard	NM_014648		Approved	hRUL138, PPP1R66	uc003dxd.3	Q86Y13	OTTHUMG00000159232	ENST00000361582.3:c.557G>T	3.37:g.108344792G>T	ENSP00000355028:p.Gly186Val	Somatic	142	0		WXS	Illumina HiSeq	.	95	4	NM_014648	B3KN01|O75162|Q6P3R9|Q6PH82|Q86Y14|Q86Y15|Q86Y16|Q8IWI0|Q96RS9	Missense_Mutation	SNP	ENST00000361582.3	37	CCDS2952.1	.	.	.	.	.	.	.	.	.	.	G	12.97	2.096895	0.37048	.	.	ENSG00000198919	ENST00000393969;ENST00000361582;ENST00000486815;ENST00000479138;ENST00000463306	T;T	0.34667	1.35;1.35	4.95	4.95	0.65309	.	0.275088	0.27210	N	0.020401	T	0.29423	0.0733	N	0.19112	0.55	0.53005	D	0.999964	P	0.41313	0.745	B	0.42959	0.403	T	0.12785	-1.0534	10	0.87932	D	0	-2.2602	13.6011	0.62020	0.0:0.0:1.0:0.0	.	186	Q86Y13	DZIP3_HUMAN	V	186;186;102;186;186	ENSP00000355028:G186V;ENSP00000419981:G186V	ENSP00000355028:G186V	G	+	2	0	DZIP3	109827482	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	4.171000	0.58236	2.573000	0.86826	0.644000	0.83932	GGT	.		0.353	DZIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353968.1	NM_014648	
UNC79	57578	hgsc.bcm.edu	37	14	94088062	94088062	+	Missense_Mutation	SNP	C	C	T	rs267604102		TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr14:94088062C>T	ENST00000393151.2	+	30	4483	c.4483C>T	c.(4483-4485)Cgc>Tgc	p.R1495C	UNC79_ENST00000555664.1_Missense_Mutation_p.R1495C|UNC79_ENST00000553484.1_Missense_Mutation_p.R1517C|UNC79_ENST00000256339.4_Missense_Mutation_p.R1318C			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	1495					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						AAAAAAGCTACGCTCTTTCAA	0.413																																					p.R1318C		.											UNC79,colon,carcinoma,0,2	UNC79	0	0			c.C3952T						.						77.0	76.0	76.0					14																	94088062		2203	4300	6503	SO:0001583	missense	57578	exon30			AAGCTACGCTCTT	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.4483C>T	14.37:g.94088062C>T	ENSP00000376858:p.Arg1495Cys	Somatic	106	0		WXS	Illumina HiSeq	.	44	2	NM_020818	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	37		.	.	.	.	.	.	.	.	.	.	C	22.5	4.297500	0.81025	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.21543	2.03;2.0;2.03;2.03	5.98	5.98	0.97165	.	0.054193	0.85682	D	0.000000	T	0.33673	0.0871	L	0.27053	0.805	0.80722	D	1	D	0.76494	0.999	P	0.59703	0.862	T	0.02991	-1.1085	10	0.87932	D	0	-19.3587	20.4561	0.99145	0.0:1.0:0.0:0.0	.	1517	C9JQL1	.	C	1318;1495;1517;1495;1517	ENSP00000256339:R1318C;ENSP00000450868:R1495C;ENSP00000451360:R1517C;ENSP00000376858:R1495C	ENSP00000256339:R1318C	R	+	1	0	KIAA1409	93157815	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.487000	0.81328	2.847000	0.97988	0.591000	0.81541	CGC	.		0.413	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
GLIS3	169792	hgsc.bcm.edu;broad.mit.edu	37	9	4286060	4286060	+	Silent	SNP	A	A	G			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr9:4286060A>G	ENST00000381971.3	-	2	959	c.366T>C	c.(364-366)ccT>ccC	p.P122P		NM_001042413.1	NP_001035878.1	Q8NEA6	GLIS3_HUMAN	GLIS family zinc finger 3	0	Ser-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(12)|lung(4)|ovary(2)|prostate(1)|skin(1)	26		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)		TTGGAGGAAAAGGGCTTCCAA	0.473																																					p.P122P		.											.	.	.	0			c.T366C						.						90.0	91.0	91.0					9																	4286060		1908	4126	6034	SO:0001819	synonymous_variant	169792	exon2			AGGAAAAGGGCTT	BC033899	CCDS6451.1, CCDS43784.1	9p24.2	2008-05-02	2004-07-16	2004-07-16	ENSG00000107249	ENSG00000107249		"""Zinc fingers, C2H2-type"""	28510	protein-coding gene	gene with protein product		610192	"""zinc finger protein 515"""	ZNF515		14500813	Standard	NM_152629		Approved	MGC33662	uc003zhx.1	Q8NEA6	OTTHUMG00000019463	ENST00000381971.3:c.366T>C	9.37:g.4286060A>G		Somatic	85	0		WXS	Illumina HiSeq	.	65	4	NM_001042413	B1AL19|Q1PHK5	Silent	SNP	ENST00000381971.3	37	CCDS43784.1																																																																																			.		0.473	GLIS3-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354776.1	NM_152629	
INMT	11185	hgsc.bcm.edu;bcgsc.ca	37	7	30793366	30793366	+	Silent	SNP	G	G	A	rs199553396		TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr7:30793366G>A	ENST00000013222.5	+	2	190	c.174G>A	c.(172-174)acG>acA	p.T58T	INMT_ENST00000484180.1_3'UTR|INMT_ENST00000409539.1_Silent_p.T57T|INMT-FAM188B_ENST00000458257.1_Silent_p.T57T	NM_001199219.1|NM_006774.4	NP_001186148.1|NP_006765.4	O95050	INMT_HUMAN	indolethylamine N-methyltransferase	58					amine metabolic process (GO:0009308)|methylation (GO:0032259)|response to toxic substance (GO:0009636)	cytosol (GO:0005829)	amine N-methyltransferase activity (GO:0030748)|thioether S-methyltransferase activity (GO:0004790)	p.T58T(1)		kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|stomach(1)	23						AAGGGGACACGCTGATTGACA	0.542																																					p.T58T		.											INMT,NS,carcinoma,0,2	INMT	0	1	Substitution - coding silent(1)	large_intestine(1)	c.G174A						.						275.0	254.0	261.0					7																	30793366		2203	4300	6503	SO:0001819	synonymous_variant	11185	exon2			GGACACGCTGATT		CCDS5430.1, CCDS56479.1	7p14.3	2011-08-30			ENSG00000241644	ENSG00000241644	2.1.1.49		6069	protein-coding gene	gene with protein product		604854				10552930	Standard	NM_001199219		Approved		uc003tbs.1	O95050	OTTHUMG00000167163	ENST00000013222.5:c.174G>A	7.37:g.30793366G>A		Somatic	85	0		WXS	Illumina HiSeq	.	60	5	NM_006774	B8ZZ69|Q3KP49|Q9P1Y2|Q9UBY4|Q9UHQ0	Silent	SNP	ENST00000013222.5	37	CCDS5430.1																																																																																			0.001		0.542	INMT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214993.3	NM_006774	
ANPEP	290	hgsc.bcm.edu;bcgsc.ca	37	15	90336304	90336304	+	Silent	SNP	G	G	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr15:90336304G>T	ENST00000300060.6	-	16	2524	c.2211C>A	c.(2209-2211)acC>acA	p.T737T		NM_001150.2	NP_001141.2	P15144	AMPN_HUMAN	alanyl (membrane) aminopeptidase	737	Metalloprotease.				angiogenesis (GO:0001525)|angiotensin maturation (GO:0002003)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|viral process (GO:0016032)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|receptor activity (GO:0004872)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	57	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)|Icatibant(DB06196)	TCCAGTTGTTGGTATTATTTC	0.488																																					p.T737T	NSCLC(30;827 977 2459 19669 26125)	.											.	.	.	0			c.C2211A						.						194.0	194.0	194.0					15																	90336304		2200	4299	6499	SO:0001819	synonymous_variant	290	exon16			GTTGTTGGTATTA	M22324	CCDS10356.1	15q25-q26	2008-07-31	2008-07-31		ENSG00000166825	ENSG00000166825	3.4.11.2	"""CD molecules"""	500	protein-coding gene	gene with protein product	"""aminopeptidase N"", ""aminopeptidase M"", ""microsomal aminopeptidase"""	151530		CD13, PEPN		2428842, 1977688	Standard	NM_001150		Approved	LAP1, gp150, p150	uc002bop.4	P15144	OTTHUMG00000149814	ENST00000300060.6:c.2211C>A	15.37:g.90336304G>T		Somatic	101	0		WXS	Illumina HiSeq	.	69	4	NM_001150	Q16728|Q6GT90|Q8IUK3|Q8IVH3|Q9UCE0	Silent	SNP	ENST00000300060.6	37	CCDS10356.1																																																																																			.		0.488	ANPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313425.1		
C14orf178	283579	hgsc.bcm.edu	37	14	78236011	78236011	+	Missense_Mutation	SNP	C	C	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr14:78236011C>T	ENST00000355883.3	+	3	568	c.359C>T	c.(358-360)gCc>gTc	p.A120V	C14orf178_ENST00000557011.1_3'UTR|C14orf178_ENST00000556047.1_3'UTR|C14orf178_ENST00000439131.2_Missense_Mutation_p.A90V	NM_174943.3	NP_777603.1	Q8N769	CN178_HUMAN	chromosome 14 open reading frame 178	120										large_intestine(1)|lung(2)|ovary(1)|prostate(1)	5			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0273)		tgtgaggatgccatggggtaa	0.403																																					p.A120V		.											C14orf178,colon,carcinoma,-1,1	C14orf178	-1	0			c.C359T						.						79.0	67.0	71.0					14																	78236011		2203	4300	6503	SO:0001583	missense	283579	exon3			AGGATGCCATGGG	AK098842	CCDS9868.1, CCDS53906.1	14q24.3	2012-03-13			ENSG00000197734	ENSG00000197734			26385	protein-coding gene	gene with protein product						12477932	Standard	NM_001173978		Approved	FLJ25976	uc021rwv.1	Q8N769	OTTHUMG00000171528	ENST00000355883.3:c.359C>T	14.37:g.78236011C>T	ENSP00000348145:p.Ala120Val	Somatic	85	0		WXS	Illumina HiSeq	.	44	2	NM_174943	Q2HIX2|Q3KNR7	Missense_Mutation	SNP	ENST00000355883.3	37	CCDS9868.1	.	.	.	.	.	.	.	.	.	.	C	12.48	1.950346	0.34377	.	.	ENSG00000197734	ENST00000439131;ENST00000355883	T;T	0.56444	0.46;1.06	2.14	-4.29	0.03721	.	.	.	.	.	T	0.25382	0.0617	N	0.08118	0	0.09310	N	1	B	0.20052	0.041	B	0.20767	0.031	T	0.11743	-1.0575	9	0.87932	D	0	.	2.1715	0.03850	0.1937:0.4339:0.2346:0.1378	.	120	Q8N769	CN178_HUMAN	V	90;120	ENSP00000407405:A90V;ENSP00000348145:A120V	ENSP00000348145:A120V	A	+	2	0	C14orf178	77305764	0.000000	0.05858	0.000000	0.03702	0.160000	0.22226	-0.782000	0.04643	-2.314000	0.00647	-0.558000	0.04189	GCC	.		0.403	C14orf178-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000413920.1	NM_174943	
KPNA3	3839	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	50275983	50275983	+	Missense_Mutation	SNP	T	T	C			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr13:50275983T>C	ENST00000261667.3	-	17	1933	c.1519A>G	c.(1519-1521)Aat>Gat	p.N507D		NM_002267.3	NP_002258.2	O00505	IMA4_HUMAN	karyopherin alpha 3 (importin alpha 4)	507					cytokine-mediated signaling pathway (GO:0019221)|NLS-bearing protein import into nucleus (GO:0006607)|protein complex assembly (GO:0006461)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)	nuclear localization sequence binding (GO:0008139)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(4)	21		Lung NSC(96;2.46e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.42e-09)		GGATCAAAATTGTAGGTACCT	0.348																																					p.N507D		.											.	.	.	0			c.A1519G						.						164.0	181.0	175.0					13																	50275983		2203	4300	6503	SO:0001583	missense	3839	exon17			CAAAATTGTAGGT	D89618	CCDS9421.1	13q14.3	2013-02-14			ENSG00000102753	ENSG00000102753		"""Importins"", ""Armadillo repeat containing"""	6396	protein-coding gene	gene with protein product		601892				9154134, 9435235	Standard	NM_002267		Approved	SRP1gamma, SRP4, hSRP1, IPOA4	uc001vdj.2	O00505	OTTHUMG00000016922	ENST00000261667.3:c.1519A>G	13.37:g.50275983T>C	ENSP00000261667:p.Asn507Asp	Somatic	83	0		WXS	Illumina HiSeq	.	43	13	NM_002267	O00191|O43195|Q5JVM9|Q96AA7	Missense_Mutation	SNP	ENST00000261667.3	37	CCDS9421.1	.	.	.	.	.	.	.	.	.	.	T	12.81	2.050076	0.36181	.	.	ENSG00000102753	ENST00000261667	T	0.29142	1.58	6.17	6.17	0.99709	.	0.041287	0.85682	D	0.000000	T	0.17450	0.0419	N	0.12746	0.255	0.58432	D	0.999998	B	0.06786	0.001	B	0.14023	0.01	T	0.15350	-1.0440	10	0.12766	T	0.61	-15.9695	12.6398	0.56702	0.0:0.0:0.1377:0.8623	.	507	O00505	IMA3_HUMAN	D	507	ENSP00000261667:N507D	ENSP00000261667:N507D	N	-	1	0	KPNA3	49173984	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.988000	0.56951	2.371000	0.80710	0.533000	0.62120	AAT	.		0.348	KPNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044939.2	NM_002267	
ZNF33A	7581	hgsc.bcm.edu;bcgsc.ca	37	10	38343567	38343567	+	Missense_Mutation	SNP	C	C	T	rs368265542		TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr10:38343567C>T	ENST00000458705.2	+	5	670	c.512C>T	c.(511-513)gCc>gTc	p.A171V	ZNF33A_ENST00000469037.2_Intron|ZNF33A_ENST00000307441.9_Missense_Mutation_p.A171V|ZNF33A_ENST00000432900.2_Missense_Mutation_p.A178V|ZNF33A_ENST00000374618.3_Missense_Mutation_p.A172V			Q06730	ZN33A_HUMAN	zinc finger protein 33A	171					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(2)|large_intestine(8)|liver(2)|lung(27)|ovary(2)|prostate(1)|skin(2)	46						GAATTTAATGCCTGTGGGAAA	0.328																																					p.A172V		.											.	.	.	0			c.C515T						.						64.0	65.0	65.0					10																	38343567		2203	4299	6502	SO:0001583	missense	7581	exon5			TTAATGCCTGTGG	D31763	CCDS31182.1, CCDS60514.1, CCDS73088.1, CCDS73089.1	10p11.2	2013-01-08	2005-03-18		ENSG00000189180	ENSG00000189180		"""Zinc fingers, C2H2-type"", ""-"""	13096	protein-coding gene	gene with protein product	"""zinc finger and ZAK associated protein with KRAB domain"""	194521	"""zinc finger protein 33a (KOX 31)"", ""zinc finger protein 11A"""	ZNF33, ZNF11A		2014798, 8464732	Standard	NM_006974		Approved	KOX5, KOX31, KIAA0065, FLJ23404, ZZAPK	uc031pui.1	Q06730	OTTHUMG00000017983	ENST00000458705.2:c.512C>T	10.37:g.38343567C>T	ENSP00000387713:p.Ala171Val	Somatic	102	0		WXS	Illumina HiSeq	.	92	4	NM_006954	A8K9X9|B4E0M8|F6TH33|F8WAJ5|P17013|Q5VZ86	Missense_Mutation	SNP	ENST00000458705.2	37	CCDS31182.1	.	.	.	.	.	.	.	.	.	.	C	5.308	0.242252	0.10077	.	.	ENSG00000189180	ENST00000374618;ENST00000432900;ENST00000458705;ENST00000307441	T;T;T;T	0.26810	1.71;1.71;1.71;1.71	2.26	1.14	0.20703	.	0.452341	0.16463	N	0.213312	T	0.10121	0.0248	N	0.03608	-0.345	0.21386	N	0.999709	B;B;B	0.32781	0.347;0.115;0.384	B;B;B	0.36378	0.223;0.031;0.066	T	0.34403	-0.9830	10	0.15952	T	0.53	.	7.5468	0.27772	0.2526:0.7474:0.0:0.0	.	178;171;172	F6TH33;Q06730;F8WAJ5	.;ZN33A_HUMAN;.	V	172;178;171;171	ENSP00000363747:A172V;ENSP00000402467:A178V;ENSP00000387713:A171V;ENSP00000304268:A171V	ENSP00000304268:A171V	A	+	2	0	ZNF33A	38383573	0.000000	0.05858	0.996000	0.52242	0.518000	0.34316	-0.344000	0.07780	1.239000	0.43787	0.460000	0.39030	GCC	.		0.328	ZNF33A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047614.1	NM_006974	
BST2	684	hgsc.bcm.edu	37	19	17515240	17515240	+	Missense_Mutation	SNP	G	G	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr19:17515240G>T	ENST00000252593.6	-	2	364	c.292C>A	c.(292-294)Cta>Ata	p.L98I	BST2_ENST00000527220.1_Intron|CTD-2521M24.9_ENST00000500836.2_lincRNA	NM_004335.2	NP_004326.1	Q10589	BST2_HUMAN	bone marrow stromal cell antigen 2	98					B cell activation (GO:0042113)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of intracellular transport of viral material (GO:1901253)|negative regulation of plasmacytoid dendritic cell cytokine production (GO:0002737)|negative regulation of viral genome replication (GO:0045071)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of actin cytoskeleton organization (GO:0032956)|response to interferon-alpha (GO:0035455)|response to interferon-beta (GO:0035456)|response to interferon-gamma (GO:0034341)|response to virus (GO:0009615)|signal transduction (GO:0007165)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metalloendopeptidase inhibitor activity (GO:0008191)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			endometrium(1)|large_intestine(2)|lung(1)|ovary(3)|prostate(2)	9						GAAGCCATTAGGGCCATCTAA	0.597																																					p.L98I		.											.	.	.	0			c.C292A						.						96.0	101.0	100.0					19																	17515240		2203	4300	6503	SO:0001583	missense	684	exon2			CCATTAGGGCCAT		CCDS12358.1	19p13.2	2009-10-30				ENSG00000130303		"""CD molecules"""	1119	protein-coding gene	gene with protein product		600534				7607676	Standard	NM_004335		Approved	CD317, tetherin	uc002ngl.3	Q10589		ENST00000252593.6:c.292C>A	19.37:g.17515240G>T	ENSP00000252593:p.Leu98Ile	Somatic	85	0		WXS	Illumina HiSeq	.	86	4	NM_004335	A8K4Y4|Q53G07	Missense_Mutation	SNP	ENST00000252593.6	37	CCDS12358.1	.	.	.	.	.	.	.	.	.	.	G	15.23	2.770516	0.49680	.	.	ENSG00000130303	ENST00000416178;ENST00000252593	T	0.57595	0.39	2.59	2.59	0.31030	.	.	.	.	.	T	0.67850	0.2937	M	0.69823	2.125	0.09310	N	1	D	0.61697	0.99	D	0.78314	0.991	T	0.53472	-0.8434	9	0.87932	D	0	-16.3912	8.8239	0.35043	0.0:0.0:1.0:0.0	.	98	Q10589	BST2_HUMAN	I	98	ENSP00000252593:L98I	ENSP00000252593:L98I	L	-	1	2	BST2	17376240	0.137000	0.22531	0.015000	0.15790	0.012000	0.07955	0.870000	0.28010	1.787000	0.52448	0.561000	0.74099	CTA	.		0.597	BST2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387346.1	NM_004335	
COL15A1	1306	hgsc.bcm.edu	37	9	101801014	101801014	+	Splice_Site	SNP	C	C	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr9:101801014C>T	ENST00000375001.3	+	22	2897	c.2474C>T	c.(2473-2475)cCg>cTg	p.P825L		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	825	Collagen-like 3.|Triple-helical region 4 (COL4).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)	p.P825L(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				GTGGGGCCTCCGGTTGGTATC	0.468																																					p.P825L		.											COL15A1,NS,carcinoma,0,2	COL15A1	0	1	Substitution - Missense(1)	lung(1)	c.C2474T						.						160.0	154.0	156.0					9																	101801014		2203	4300	6503	SO:0001630	splice_region_variant	1306	exon22			GGCCTCCGGTTGG	L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.2475+1C>T	9.37:g.101801014C>T		Somatic	113	0		WXS	Illumina HiSeq	.	47	3	NM_001855	Q5T6J4|Q9UDC5|Q9Y4W4	Missense_Mutation	SNP	ENST00000375001.3	37	CCDS35081.1	.	.	.	.	.	.	.	.	.	.	C	13.06	2.125420	0.37533	.	.	ENSG00000204291	ENST00000375001	D	0.95980	-3.87	4.79	3.86	0.44501	.	0.330409	0.33834	N	0.004506	D	0.97102	0.9053	M	0.86805	2.84	0.58432	D	0.999999	D	0.76494	0.999	D	0.64776	0.929	D	0.95971	0.8970	10	0.30854	T	0.27	-5.2813	10.2053	0.43109	0.1986:0.8014:0.0:0.0	.	825	P39059	COFA1_HUMAN	L	825	ENSP00000364140:P825L	ENSP00000364140:P825L	P	+	2	0	COL15A1	100840835	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.796000	0.38794	1.308000	0.44962	0.655000	0.94253	CCG	.		0.468	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053386.3	NM_001855	Missense_Mutation
KIAA0232	9778	hgsc.bcm.edu	37	4	6863223	6863223	+	Nonsense_Mutation	SNP	G	G	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr4:6863223G>T	ENST00000307659.5	+	7	1569	c.1114G>T	c.(1114-1116)Gaa>Taa	p.E372*	KIAA0232_ENST00000425103.1_Nonsense_Mutation_p.E372*	NM_014743.2	NP_055558.2	Q92628	K0232_HUMAN	KIAA0232	372							ATP binding (GO:0005524)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(12)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	41						ACCTTTAAAAGAAATAGGGAG	0.458																																					p.E372X		.											KIAA0232,NS,carcinoma,0,1	KIAA0232	0	0			c.G1114T						.						70.0	73.0	72.0					4																	6863223		1854	4100	5954	SO:0001587	stop_gained	9778	exon7			TTAAAAGAAATAG	D86985	CCDS43209.1	4p16.1	2012-11-29			ENSG00000170871	ENSG00000170871			28992	protein-coding gene	gene with protein product						9039502	Standard	NM_014743		Approved		uc003gjq.4	Q92628	OTTHUMG00000160072	ENST00000307659.5:c.1114G>T	4.37:g.6863223G>T	ENSP00000303928:p.Glu372*	Somatic	50	0		WXS	Illumina HiSeq	.	49	2	NM_014743	A7E2D2	Nonsense_Mutation	SNP	ENST00000307659.5	37	CCDS43209.1	.	.	.	.	.	.	.	.	.	.	G	39	7.350488	0.98228	.	.	ENSG00000170871	ENST00000425103;ENST00000307659	.	.	.	5.84	5.84	0.93424	.	0.212673	0.48286	D	0.000184	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-24.6186	20.1511	0.98086	0.0:0.0:1.0:0.0	.	.	.	.	X	372	.	ENSP00000303928:E372X	E	+	1	0	KIAA0232	6914124	1.000000	0.71417	0.339000	0.25562	0.068000	0.16541	6.389000	0.73199	2.778000	0.95560	0.655000	0.94253	GAA	.		0.458	KIAA0232-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359102.2	NM_014743	
TEAD2	8463	hgsc.bcm.edu	37	19	49862735	49862735	+	Missense_Mutation	SNP	C	C	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr19:49862735C>T	ENST00000311227.2	-	3	344	c.254G>A	c.(253-255)cGc>cAc	p.R85H	AC010524.4_ENST00000596488.1_RNA|TEAD2_ENST00000539846.1_5'UTR|TEAD2_ENST00000598397.1_5'Flank|TEAD2_ENST00000377214.4_Missense_Mutation_p.R85H|DKKL1_ENST00000594268.1_5'Flank|TEAD2_ENST00000601519.1_Missense_Mutation_p.R85H|TEAD2_ENST00000593945.1_Missense_Mutation_p.R85H|TEAD2_ENST00000598810.1_Missense_Mutation_p.R85H	NM_001256659.1|NM_003598.1	NP_001243588.1|NP_003589.1	Q15562	TEAD2_HUMAN	TEA domain family member 2	85					gene expression (GO:0010467)|hippo signaling (GO:0035329)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R85H(1)		central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)	29		all_lung(116;7.65e-05)|Lung NSC(112;0.000132)|all_neural(266;0.0506)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00093)|GBM - Glioblastoma multiforme(486;0.0467)		CTTGATGTAGCGGGCGATCAG	0.507																																					p.R85H		.											TEAD2,NS,carcinoma,0,1	TEAD2	0	1	Substitution - Missense(1)	endometrium(1)	c.G254A						.						238.0	202.0	214.0					19																	49862735		2203	4300	6503	SO:0001583	missense	8463	exon3			ATGTAGCGGGCGA	X94440	CCDS12761.1, CCDS58670.1, CCDS58671.1, CCDS59406.1	19q13.3	2008-07-22							11715	protein-coding gene	gene with protein product		601729				9889009, 8702974	Standard	NM_003598		Approved	TEF-4, ETF, TEF4	uc031rls.1	Q15562		ENST00000311227.2:c.254G>A	19.37:g.49862735C>T	ENSP00000310701:p.Arg85His	Somatic	88	0		WXS	Illumina HiSeq	.	49	3	NM_001256658	B4DTJ6|M0R1T9|Q8NA25|Q96IG3	Missense_Mutation	SNP	ENST00000311227.2	37	CCDS12761.1	.	.	.	.	.	.	.	.	.	.	C	32	5.185500	0.94885	.	.	ENSG00000074219	ENST00000311227;ENST00000377214	T;T	0.34472	1.36;1.36	5.27	5.27	0.74061	.	0.180168	0.36815	N	0.002383	T	0.62332	0.2419	M	0.80616	2.505	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.995	T	0.66606	-0.5881	10	0.87932	D	0	-20.092	14.7836	0.69784	0.0:1.0:0.0:0.0	.	85;85	Q15562;Q8NA25	TEAD2_HUMAN;.	H	85	ENSP00000310701:R85H;ENSP00000366419:R85H	ENSP00000310701:R85H	R	-	2	0	TEAD2	54554547	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.745000	0.74860	2.636000	0.89361	0.655000	0.94253	CGC	.		0.507	TEAD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465465.1	NM_003598	
SLAMF8	56833	hgsc.bcm.edu	37	1	159799757	159799757	+	Missense_Mutation	SNP	G	G	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr1:159799757G>T	ENST00000289707.5	+	2	291	c.142G>T	c.(142-144)Gct>Tct	p.A48S	SLAMF8_ENST00000368104.4_Intron	NM_020125.2	NP_064510.1	Q9P0V8	SLAF8_HUMAN	SLAM family member 8	48					cellular response to drug (GO:0035690)|defense response to bacterium (GO:0042742)|phagosome acidification (GO:0090383)|regulation of kinase activity (GO:0043549)|regulation of NAD(P)H oxidase activity (GO:0033860)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			endometrium(2)|large_intestine(4)|lung(6)	12	all_hematologic(112;0.0597)					AGTCCGTGAGGCTATCTGGCG	0.612																																					p.A48S		.											SLAMF8,NS,carcinoma,0,1	SLAMF8	0	0			c.G142T						.						127.0	135.0	132.0					1																	159799757		2203	4300	6503	SO:0001583	missense	56833	exon2			CGTGAGGCTATCT	AF146761	CCDS1188.1	1q23.1	2013-01-11			ENSG00000158714	ENSG00000158714		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21391	protein-coding gene	gene with protein product		606620				11313408	Standard	NM_020125		Approved	BLAME, SBBI42, CD353	uc001fue.4	Q9P0V8	OTTHUMG00000035433	ENST00000289707.5:c.142G>T	1.37:g.159799757G>T	ENSP00000289707:p.Ala48Ser	Somatic	39	0		WXS	Illumina HiSeq	.	38	2	NM_020125	Q32MC6|Q5VU15	Missense_Mutation	SNP	ENST00000289707.5	37	CCDS1188.1	.	.	.	.	.	.	.	.	.	.	G	17.03	3.284698	0.59867	.	.	ENSG00000158714	ENST00000289707	T	0.22134	1.97	4.44	4.44	0.53790	.	0.211384	0.41194	D	0.000925	T	0.12178	0.0296	L	0.32530	0.975	0.80722	D	1	P	0.50819	0.939	P	0.46419	0.516	T	0.01781	-1.1275	10	0.52906	T	0.07	-12.461	12.4262	0.55548	0.0:0.0:1.0:0.0	.	48	Q9P0V8	SLAF8_HUMAN	S	48	ENSP00000289707:A48S	ENSP00000289707:A48S	A	+	1	0	SLAMF8	158066381	0.999000	0.42202	1.000000	0.80357	0.587000	0.36485	4.590000	0.61013	2.296000	0.77279	0.313000	0.20887	GCT	.		0.612	SLAMF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085983.1	NM_020125	
DTL	51514	hgsc.bcm.edu	37	1	212274368	212274368	+	Missense_Mutation	SNP	G	G	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr1:212274368G>T	ENST00000366991.4	+	14	2350	c.2036G>T	c.(2035-2037)aGt>aTt	p.S679I	DTL_ENST00000475419.1_3'UTR|RN7SKP98_ENST00000517070.1_RNA|DTL_ENST00000542077.1_Missense_Mutation_p.S637I	NM_016448.2	NP_057532.2	Q9NZJ0	DTL_HUMAN	denticleless E3 ubiquitin protein ligase homolog (Drosophila)	679					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|G2 DNA damage checkpoint (GO:0031572)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|regulation of cell cycle (GO:0051726)|response to UV (GO:0009411)|translesion synthesis (GO:0019985)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|chromosome (GO:0005694)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(81;0.00796)|all cancers(67;0.0385)|Epithelial(68;0.102)		TCTCCACGAAGTCCGTCATCC	0.483																																					p.S679I		.											DTL,NS,carcinoma,0,1	DTL	0	0			c.G2036T						.						44.0	44.0	44.0					1																	212274368		2203	4300	6503	SO:0001583	missense	51514	exon14			CACGAAGTCCGTC	AF195765	CCDS1502.1, CCDS65778.1	1q32	2013-01-10	2012-02-23		ENSG00000143476	ENSG00000143476		"""DDB1 and CUL4 associated factors"", ""WD repeat domain containing"""	30288	protein-coding gene	gene with protein product	"""RA regulated nuclear matrix associated protein"", ""DDB1 and CUL4 associated factor 2"""	610617	"""denticleless homolog (Drosophila)"""			11278750	Standard	NM_001286229		Approved	RAMP, L2DTL, DCAF2	uc009xdc.3	Q9NZJ0	OTTHUMG00000037133	ENST00000366991.4:c.2036G>T	1.37:g.212274368G>T	ENSP00000355958:p.Ser679Ile	Somatic	83	0		WXS	Illumina HiSeq	.	68	3	NM_016448	A8K8H8|D3DT98|Q5VT77|Q96SN0|Q9NW03|Q9NW34|Q9NWM5	Missense_Mutation	SNP	ENST00000366991.4	37	CCDS1502.1	.	.	.	.	.	.	.	.	.	.	G	16.32	3.088873	0.55968	.	.	ENSG00000143476	ENST00000366991;ENST00000542077;ENST00000420235	T;T	0.77750	-1.05;-1.12	5.71	4.79	0.61399	.	0.206627	0.56097	D	0.000023	T	0.70954	0.3283	L	0.27053	0.805	0.09310	N	0.999999	D;D;D	0.56521	0.976;0.96;0.96	P;B;B	0.49887	0.625;0.443;0.421	T	0.65199	-0.6226	10	0.87932	D	0	-10.3273	8.6992	0.34316	0.078:0.3138:0.6082:0.0	.	637;679;637	F5GZ90;Q9NZJ0;B4E0E6	.;DTL_HUMAN;.	I	679;637;358	ENSP00000355958:S679I;ENSP00000443870:S637I	ENSP00000355958:S679I	S	+	2	0	DTL	210340991	0.900000	0.30661	0.987000	0.45799	0.985000	0.73830	2.681000	0.46926	1.404000	0.46819	0.655000	0.94253	AGT	.		0.483	DTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090182.1	NM_016448	
OR4X1	390113	hgsc.bcm.edu	37	11	48285986	48285986	+	Missense_Mutation	SNP	T	T	A	rs76457745		TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr11:48285986T>A	ENST00000320048.1	+	1	574	c.574T>A	c.(574-576)Ttc>Atc	p.F192I		NM_001004726.1	NP_001004726.1	Q8NH49	OR4X1_HUMAN	olfactory receptor, family 4, subfamily X, member 1 (gene/pseudogene)	192						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|stomach(1)	28						AGACACCTTCTTCATTAGCCT	0.537																																					p.F192I		.											OR4X1,caecum,carcinoma,0,1	OR4X1	0	0			c.T574A						.						110.0	85.0	94.0					11																	48285986		2201	4298	6499	SO:0001583	missense	390113	exon1			ACCTTCTTCATTA	AB065544	CCDS31487.1	11p11.2	2013-10-10	2013-10-10		ENSG00000176567	ENSG00000176567		"""GPCR / Class A : Olfactory receptors"""	14854	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily X, member 1"""				Standard	NM_001004726		Approved		uc010rht.2	Q8NH49	OTTHUMG00000165301	ENST00000320048.1:c.574T>A	11.37:g.48285986T>A	ENSP00000321506:p.Phe192Ile	Somatic	26	0		WXS	Illumina HiSeq	.	23	3	NM_001004726	Q6IF74	Missense_Mutation	SNP	ENST00000320048.1	37	CCDS31487.1	.	.	.	.	.	.	.	.	.	.	T	4.614	0.114104	0.08831	.	.	ENSG00000176567	ENST00000320048	T	0.00030	8.9	4.4	2.51	0.30379	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00039	0.0001	N	0.01668	-0.77	0.22745	N	0.998789	B	0.25235	0.121	B	0.24394	0.053	T	0.00485	-1.1711	9	0.17369	T	0.5	.	3.9248	0.09259	0.1875:0.6133:0.0:0.1992	.	192	Q8NH49	OR4X1_HUMAN	I	192	ENSP00000321506:F192I	ENSP00000321506:F192I	F	+	1	0	OR4X1	48242562	0.000000	0.05858	0.999000	0.59377	0.059000	0.15707	-2.231000	0.01206	1.210000	0.43336	-0.318000	0.08688	TTC	.		0.537	OR4X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383373.1	NM_001004726	
ZBTB4	57659	hgsc.bcm.edu;broad.mit.edu	37	17	7369566	7369566	+	Nonsense_Mutation	SNP	C	C	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr17:7369566C>T	ENST00000311403.4	-	3	894	c.555G>A	c.(553-555)tgG>tgA	p.W185*	ZBTB4_ENST00000380599.4_Nonsense_Mutation_p.W185*	NM_020899.3	NP_065950.2	Q9P1Z0	ZBTB4_HUMAN	zinc finger and BTB domain containing 4	185					cellular response to DNA damage stimulus (GO:0006974)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)|methyl-CpNpG binding (GO:0010428)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|prostate(3)|skin(6)	36		Colorectal(1115;3.46e-05)|Myeloproliferative disorder(207;0.0255)		COAD - Colon adenocarcinoma(228;4.1e-06)|READ - Rectum adenocarcinoma(115;0.0642)		TAGGAGGTACCCAGGCATCAC	0.692																																					p.W185X		.											.	.	.	0			c.G555A						.						22.0	23.0	23.0					17																	7369566		2202	4297	6499	SO:0001587	stop_gained	57659	exon3			AGGTACCCAGGCA	AB040971	CCDS11107.1	17p13.2	2013-01-09			ENSG00000174282	ENSG00000174282		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	23847	protein-coding gene	gene with protein product		612308				12477932	Standard	NM_020899		Approved	KIAA1538, KAISO-L1, ZNF903	uc002ghd.4	Q9P1Z0	OTTHUMG00000108137	ENST00000311403.4:c.555G>A	17.37:g.7369566C>T	ENSP00000307858:p.Trp185*	Somatic	42	0		WXS	Illumina HiSeq	.	30	7	NM_001128833	B3KVL6|Q7Z697|Q86XJ4|Q8N4V8	Nonsense_Mutation	SNP	ENST00000311403.4	37	CCDS11107.1	.	.	.	.	.	.	.	.	.	.	C	37	6.460881	0.97585	.	.	ENSG00000174282	ENST00000311403;ENST00000380599	.	.	.	4.76	4.76	0.60689	.	0.099468	0.43579	D	0.000555	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	-12.3776	10.3135	0.43723	0.0:0.908:0.0:0.092	.	.	.	.	X	185	.	ENSP00000307858:W185X	W	-	3	0	ZBTB4	7310290	0.699000	0.27786	1.000000	0.80357	0.984000	0.73092	1.324000	0.33712	2.467000	0.83353	0.561000	0.74099	TGG	.		0.692	ZBTB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226940.2	NM_020899	
CACNA2D4	93589	hgsc.bcm.edu	37	12	1987537	1987537	+	Missense_Mutation	SNP	C	C	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr12:1987537C>T	ENST00000382722.5	-	16	2025	c.1663G>A	c.(1663-1665)Gcc>Acc	p.A555T	CACNA2D4_ENST00000587995.1_Intron|CACNA2D4_ENST00000586184.1_Missense_Mutation_p.A555T|CACNA2D4_ENST00000588077.1_Missense_Mutation_p.A491T|CACNA2D4_ENST00000585708.1_Missense_Mutation_p.A491T|CACNA2D4_ENST00000585732.1_Missense_Mutation_p.A440T	NM_172364.4	NP_758952.4	Q7Z3S7	CA2D4_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 4	555	Cache.				calcium ion transmembrane transport (GO:0070588)|detection of light stimulus involved in visual perception (GO:0050908)	voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			endometrium(3)|kidney(2)|large_intestine(1)|liver(1)|lung(27)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	39	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		TTCAGAAAGGCGTATCCGTGC	0.577																																					p.A555T	Colon(2;101 179 21030 23310 28141)	.											CACNA2D4_ENST00000382722,rectum,carcinoma,0,2	CACNA2D4_ENST00000382722	0	0			c.G1663A						.						65.0	71.0	69.0					12																	1987537		2078	4198	6276	SO:0001583	missense	93589	exon16			GAAAGGCGTATCC	AF516695	CCDS44785.1	12p13.33	2003-03-05			ENSG00000151062	ENSG00000151062		"""Calcium channel subunits"""	20202	protein-coding gene	gene with protein product		608171				12181424	Standard	NM_172364		Approved		uc021qsx.1	Q7Z3S7	OTTHUMG00000168111	ENST00000382722.5:c.1663G>A	12.37:g.1987537C>T	ENSP00000372169:p.Ala555Thr	Somatic	84	0		WXS	Illumina HiSeq	.	65	4	NM_172364	Q7Z3S8|Q86XZ5|Q8IZS9	Missense_Mutation	SNP	ENST00000382722.5	37	CCDS44785.1	.	.	.	.	.	.	.	.	.	.	C	35	5.458685	0.96240	.	.	ENSG00000151062	ENST00000456077;ENST00000280663;ENST00000382722	T	0.09630	2.96	5.6	5.6	0.85130	Cache (1);	0.000000	0.85682	D	0.000000	T	0.38799	0.1054	M	0.80982	2.52	0.80722	D	1	D;D	0.89917	0.992;1.0	P;D	0.97110	0.889;1.0	T	0.16928	-1.0386	10	0.66056	D	0.02	.	19.6224	0.95663	0.0:1.0:0.0:0.0	.	555;555	Q7Z3S7-2;Q7Z3S7	.;CA2D4_HUMAN	T	491;555;555	ENSP00000372169:A555T	ENSP00000280663:A555T	A	-	1	0	CACNA2D4	1857798	1.000000	0.71417	0.991000	0.47740	0.883000	0.51084	7.818000	0.86416	2.630000	0.89119	0.655000	0.94253	GCC	.		0.577	CACNA2D4-001	KNOWN	non_canonical_U12|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000398230.2		
CHRNE	1145	hgsc.bcm.edu	37	17	4799740	4799740	+	IGR	SNP	C	C	T	rs576676808		TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr17:4799740C>T	ENST00000293780.4	-	0	2455				MINK1_ENST00000347992.7_Missense_Mutation_p.T1182M|C17orf107_ENST00000521575.1_5'Flank|MINK1_ENST00000355280.6_Missense_Mutation_p.T1211M|MINK1_ENST00000453408.3_Missense_Mutation_p.T1191M	NM_000080.3	NP_000071.1	Q04844	ACHE_HUMAN	cholinergic receptor, nicotinic, epsilon (muscle)						cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|cation transmembrane transporter activity (GO:0008324)	p.T1211M(1)		central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|lung(3)|prostate(1)	12					Galantamine(DB00674)	AGCCAGATCACGCCCCATGCC	0.622													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18285	0.0		0.0	False		,,,				2504	0.0				p.T1211M		.											MINK1_ENST00000355280,NS,carcinoma,0,1	MINK1_ENST00000355280	0	1	Substitution - Missense(1)	prostate(1)	c.C3632T						.						149.0	161.0	157.0					17																	4799740		2145	4245	6390	SO:0001628	intergenic_variant	50488	exon30			AGATCACGCCCCA	X66403	CCDS11058.1	17p13.2	2012-02-11	2012-02-07		ENSG00000108556	ENSG00000108556		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1966	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, epsilon (muscle)"""	100725	"""cholinergic receptor, nicotinic, epsilon"""			7688301	Standard	NM_000080		Approved	ACHRE	uc002fzk.1	Q04844	OTTHUMG00000090778		17.37:g.4799740C>T		Somatic	51	0		WXS	Illumina HiSeq	.	33	2	NM_153827	D3DTK6	Missense_Mutation	SNP	ENST00000293780.4	37	CCDS11058.1	.	.	.	.	.	.	.	.	.	.	C	15.16	2.751173	0.49257	.	.	ENSG00000141503	ENST00000355280;ENST00000453408;ENST00000347992;ENST00000542906	T;T;T	0.05081	3.5;3.5;3.5	4.58	4.58	0.56647	Citron-like (3);	0.130853	0.49916	D	0.000123	T	0.06554	0.0168	L	0.43152	1.355	0.42926	D	0.994303	P;P;P;P	0.42649	0.653;0.786;0.469;0.786	B;B;B;B	0.37601	0.254;0.081;0.186;0.081	T	0.12708	-1.0537	10	0.72032	D	0.01	.	10.0344	0.42120	0.2009:0.7991:0.0:0.0	.	1174;1191;1211;1182	Q8N4C8-2;Q8N4C8-4;Q8N4C8;Q8N4C8-3	.;.;MINK1_HUMAN;.	M	1211;1191;1182;171	ENSP00000347427:T1211M;ENSP00000406487:T1191M;ENSP00000269296:T1182M	ENSP00000269296:T1182M	T	+	2	0	MINK1	4740516	0.930000	0.31532	0.975000	0.42487	0.987000	0.75469	1.984000	0.40658	2.378000	0.81104	0.561000	0.74099	ACG	.		0.622	CHRNE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207560.3		
LILRB5	10990	hgsc.bcm.edu	37	19	54760466	54760466	+	Missense_Mutation	SNP	C	C	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr19:54760466C>T	ENST00000316219.5	-	3	348	c.241G>A	c.(241-243)Gcc>Acc	p.A81T	LILRB5_ENST00000345866.6_Missense_Mutation_p.A81T|LILRB5_ENST00000449561.2_Missense_Mutation_p.A81T|LILRB5_ENST00000450632.1_Missense_Mutation_p.A81T	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5	81	Ig-like C2-type 1.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)	p.A81T(2)		NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TGGAACTTGGCCTTGGCTCCA	0.612																																					p.A81T		.											LILRB5_ENST00000450632,colon,carcinoma,0,2	LILRB5_ENST00000450632	0	2	Substitution - Missense(2)	large_intestine(2)	c.G241A						.						239.0	227.0	231.0					19																	54760466		2203	4300	6503	SO:0001583	missense	10990	exon3			ACTTGGCCTTGGC	AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.241G>A	19.37:g.54760466C>T	ENSP00000320390:p.Ala81Thr	Somatic	62	0		WXS	Illumina HiSeq	.	67	2	NM_001081442	Q8N760	Missense_Mutation	SNP	ENST00000316219.5	37	CCDS12885.1	.	.	.	.	.	.	.	.	.	.	C	14.67	2.604735	0.46423	.	.	ENSG00000105609	ENST00000316219;ENST00000450632;ENST00000449561;ENST00000345866	T;T;T;T	0.12879	2.64;2.64;2.64;2.64	3.29	1.1	0.20463	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.660669	0.13338	N	0.395404	T	0.27697	0.0681	M	0.67953	2.075	0.09310	N	1	P;D;D;D;D	0.71674	0.839;0.996;0.998;0.996;0.986	P;D;P;P;P	0.66847	0.552;0.947;0.905;0.9;0.807	T	0.06679	-1.0813	10	0.56958	D	0.05	.	5.1777	0.15143	0.0:0.7139:0.0:0.2861	.	81;72;81;81;81	C9JMK7;Q8NF80;O75023-2;O75023-3;O75023	.;.;.;.;LIRB5_HUMAN	T	81	ENSP00000320390:A81T;ENSP00000414225:A81T;ENSP00000406478:A81T;ENSP00000263430:A81T	ENSP00000320390:A81T	A	-	1	0	LILRB5	59452278	0.004000	0.15560	0.004000	0.12327	0.027000	0.11550	1.274000	0.33132	0.226000	0.20979	0.585000	0.79938	GCC	.		0.612	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142877.2		
TNIK	23043	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	170928989	170928989	+	Missense_Mutation	SNP	C	C	A			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr3:170928989C>A	ENST00000436636.2	-	4	566	c.222G>T	c.(220-222)aaG>aaT	p.K74N	TNIK_ENST00000460047.1_Missense_Mutation_p.K74N|TNIK_ENST00000470834.1_Missense_Mutation_p.K74N|TNIK_ENST00000538048.1_Missense_Mutation_p.K74N|TNIK_ENST00000369326.5_Missense_Mutation_p.K74N|TNIK_ENST00000488470.1_Missense_Mutation_p.K74N|TNIK_ENST00000341852.6_Missense_Mutation_p.K74N|TNIK_ENST00000284483.8_Missense_Mutation_p.K74N|TNIK_ENST00000357327.5_Missense_Mutation_p.K74N|TNIK_ENST00000475336.1_Missense_Mutation_p.K74N	NM_015028.2	NP_055843.1	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase	74	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|activation of JNKK activity (GO:0007256)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite morphogenesis (GO:0048814)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(22)|ovary(5)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)	62	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			GAGAATATTTCTTCAACATGT	0.358																																					p.K74N		.											.	.	.	0			c.G222T						.						140.0	133.0	135.0					3																	170928989		1822	4084	5906	SO:0001583	missense	23043	exon4			ATATTTCTTCAAC	AF172264	CCDS46956.1, CCDS54673.1, CCDS54674.1, CCDS54675.1, CCDS54676.1, CCDS54677.1, CCDS54678.1, CCDS54679.1	3q26.31	2008-01-23			ENSG00000154310	ENSG00000154310			30765	protein-coding gene	gene with protein product		610005				9628581, 10521462	Standard	NR_027767		Approved	KIAA0551	uc003fhh.2	Q9UKE5	OTTHUMG00000159036	ENST00000436636.2:c.222G>T	3.37:g.170928989C>A	ENSP00000399511:p.Lys74Asn	Somatic	122	0		WXS	Illumina HiSeq	.	119	27	NM_001161562	A7E2A3|A8K4U1|D3DNQ6|O60298|Q8WUY7|Q9UKD8|Q9UKD9|Q9UKE0|Q9UKE1|Q9UKE2|Q9UKE3|Q9UKE4	Missense_Mutation	SNP	ENST00000436636.2	37	CCDS46956.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.389996	0.82902	.	.	ENSG00000154310	ENST00000436636;ENST00000369326;ENST00000538048;ENST00000341852;ENST00000284483;ENST00000475336;ENST00000357327;ENST00000460047;ENST00000488470;ENST00000470834;ENST00000468757	T;T;T;T;T;T;T;T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28	6.16	5.24	0.73138	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.79393	0.4438	M	0.67625	2.065	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	0.998;0.998;1.0;0.999;0.998;0.998;1.0;0.998	P;D;D;D;D;D;D;D	0.83275	0.899;0.987;0.996;0.966;0.987;0.987;0.996;0.993	T	0.81353	-0.0971	10	0.87932	D	0	.	12.4171	0.55500	0.0:0.8531:0.0:0.1469	.	74;74;74;74;74;74;74;74	Q9UKE5-8;Q9UKE5-6;Q9UKE5-7;Q9UKE5-5;Q9UKE5-4;Q9UKE5-2;Q9UKE5-3;Q9UKE5	.;.;.;.;.;.;.;TNIK_HUMAN	N	74;74;74;74;74;74;74;74;74;74;48	ENSP00000399511:K74N;ENSP00000358332:K74N;ENSP00000443278:K74N;ENSP00000345352:K74N;ENSP00000284483:K74N;ENSP00000418156:K74N;ENSP00000349880:K74N;ENSP00000418916:K74N;ENSP00000418378:K74N;ENSP00000419990:K74N;ENSP00000417338:K48N	ENSP00000284483:K74N	K	-	3	2	TNIK	172411683	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.042000	0.57347	1.487000	0.48415	0.650000	0.86243	AAG	.		0.358	TNIK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352973.2	XM_039796	
SCN2A	6326	hgsc.bcm.edu	37	2	166231393	166231393	+	Nonsense_Mutation	SNP	G	G	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr2:166231393G>T	ENST00000375437.2	+	22	4461	c.4171G>T	c.(4171-4173)Gag>Tag	p.E1391*	SCN2A_ENST00000283256.6_Nonsense_Mutation_p.E1391*|SCN2A_ENST00000375427.2_Nonsense_Mutation_p.E1391*|SCN2A_ENST00000357398.3_Nonsense_Mutation_p.E1391*	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	1391					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AGCTCTCATTGAGAGCAATCA	0.378																																					p.E1391X		.											SCN2A_ENST00000375437,bladder,carcinoma,0,2	SCN2A_ENST00000375437	0	0			c.G4171T						.						85.0	82.0	83.0					2																	166231393		2203	4299	6502	SO:0001587	stop_gained	6326	exon21			CTCATTGAGAGCA	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.4171G>T	2.37:g.166231393G>T	ENSP00000364586:p.Glu1391*	Somatic	76	0		WXS	Illumina HiSeq	.	50	2	NM_001040143	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Nonsense_Mutation	SNP	ENST00000375437.2	37	CCDS33314.1	.	.	.	.	.	.	.	.	.	.	G	40	8.052331	0.98629	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	.	.	.	4.58	4.58	0.56647	.	0.476335	0.17418	N	0.174950	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	.	6.4646	0.21975	0.1603:0.1565:0.6832:0.0	.	.	.	.	X	1391	.	ENSP00000283256:E1391X	E	+	1	0	SCN2A	165939639	0.980000	0.34600	0.978000	0.43139	0.366000	0.29705	1.017000	0.29989	2.243000	0.73865	0.591000	0.81541	GAG	.		0.378	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007	
SLC4A11	83959	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	3214919	3214919	+	Missense_Mutation	SNP	G	G	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr20:3214919G>T	ENST00000380056.3	-	4	428	c.381C>A	c.(379-381)caC>caA	p.H127Q	SLC4A11_ENST00000539553.2_Missense_Mutation_p.H111Q|SLC4A11_ENST00000380059.3_Missense_Mutation_p.H154Q	NM_032034.3	NP_114423.1	Q8NBS3	S4A11_HUMAN	solute carrier family 4, sodium borate transporter, member 11	127					bicarbonate transport (GO:0015701)|borate transmembrane transport (GO:0035445)|borate transport (GO:0046713)|cellular cation homeostasis (GO:0030003)|fluid transport (GO:0042044)|proton transport (GO:0015992)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	bicarbonate transmembrane transporter activity (GO:0015106)|borate transmembrane transporter activity (GO:0046715)|hydrogen ion channel activity (GO:0015252)|inorganic anion exchanger activity (GO:0005452)|protein dimerization activity (GO:0046983)|sodium channel activity (GO:0005272)|symporter activity (GO:0015293)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(4)|soft_tissue(1)|urinary_tract(1)	40						CTAGGTCGCGGTGCGCACGGA	0.597																																					p.H154Q	NSCLC(190;922 2139 10266 10292 38692)	.											.	.	.	0			c.C462A						.						99.0	91.0	93.0					20																	3214919		2203	4300	6503	SO:0001583	missense	83959	exon5			GTCGCGGTGCGCA	AF336127	CCDS13052.1, CCDS54445.1, CCDS54446.1	20p13	2014-02-14	2007-08-03		ENSG00000088836	ENSG00000088836		"""Solute carriers"""	16438	protein-coding gene	gene with protein product		610206	"""corneal endothelial dystrophy 2 (autosomal recessive)"", ""solute carrier family 4, sodium bicarbonate transporter-like, member 11"", ""corneal dystrophy and perceptive deafness 1"""	CHED2, CDPD1		10843999, 11302728, 16767101	Standard	NM_001174089		Approved	dJ794I6.2, BTR1, NaBC1, FECD4	uc010zqe.2	Q8NBS3	OTTHUMG00000031740	ENST00000380056.3:c.381C>A	20.37:g.3214919G>T	ENSP00000369396:p.His127Gln	Somatic	20	0		WXS	Illumina HiSeq	.	17	7	NM_001174090	B4DKC8|B4DKX9|G3V1M3|Q2TB62|Q2TB63|Q9BXF4|Q9NTW9	Missense_Mutation	SNP	ENST00000380056.3	37	CCDS13052.1	.	.	.	.	.	.	.	.	.	.	G	13.06	2.124423	0.37533	.	.	ENSG00000088836	ENST00000380059;ENST00000380056;ENST00000539553;ENST00000437836	T;T;T;D	0.81499	-1.49;-1.47;-1.47;-1.5	5.2	4.23	0.50019	Phosphotransferase/anion transporter (1);	0.107760	0.64402	D	0.000006	T	0.76385	0.3980	M	0.64997	1.995	0.58432	D	0.999992	B;B;B	0.28512	0.214;0.136;0.136	B;B;B	0.28465	0.09;0.074;0.074	T	0.70702	-0.4799	10	0.13470	T	0.59	.	14.6266	0.68626	0.0:0.2757:0.7243:0.0	.	111;154;127	G3V1M3;B4DKC8;Q8NBS3	.;.;S4A11_HUMAN	Q	154;127;111;111	ENSP00000369399:H154Q;ENSP00000369396:H127Q;ENSP00000441370:H111Q;ENSP00000404271:H111Q	ENSP00000369396:H127Q	H	-	3	2	SLC4A11	3162919	1.000000	0.71417	0.991000	0.47740	0.941000	0.58515	3.771000	0.55318	1.151000	0.42436	0.655000	0.94253	CAC	.		0.597	SLC4A11-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077728.1		
MED13L	23389	hgsc.bcm.edu	37	12	116413011	116413011	+	Missense_Mutation	SNP	C	C	A			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr12:116413011C>A	ENST00000281928.3	-	25	5902	c.5696G>T	c.(5695-5697)gGg>gTg	p.G1899V		NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	1899						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.G1899V(1)		NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		CCCAAGTCGCCCGATTACAAC	0.443																																					p.G1899V		.											MED13L,right_upper_lobe,carcinoma,0,2	MED13L	0	1	Substitution - Missense(1)	lung(1)	c.G5696T						.						74.0	71.0	72.0					12																	116413011		2203	4300	6503	SO:0001583	missense	23389	exon25			AGTCGCCCGATTA	AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.5696G>T	12.37:g.116413011C>A	ENSP00000281928:p.Gly1899Val	Somatic	44	0		WXS	Illumina HiSeq	.	24	2	NM_015335	A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Missense_Mutation	SNP	ENST00000281928.3	37	CCDS9177.1	.	.	.	.	.	.	.	.	.	.	C	31	5.096359	0.94197	.	.	ENSG00000123066	ENST00000281928	D	0.83506	-1.73	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	D	0.92681	0.7674	M	0.86420	2.815	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92091	0.5680	10	0.51188	T	0.08	.	20.3754	0.98918	0.0:1.0:0.0:0.0	.	1899	Q71F56	MD13L_HUMAN	V	1899	ENSP00000281928:G1899V	ENSP00000281928:G1899V	G	-	2	0	MED13L	114897394	1.000000	0.71417	0.989000	0.46669	0.995000	0.86356	7.438000	0.80431	2.894000	0.99253	0.591000	0.81541	GGG	.		0.443	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403879.3		
UNC80	285175	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	210742794	210742794	+	Silent	SNP	G	G	A			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr2:210742794G>A	ENST00000439458.1	+	24	4043	c.3963G>A	c.(3961-3963)gaG>gaA	p.E1321E	UNC80_ENST00000272845.6_Silent_p.E1316E	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	1321					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						AGGATGAGGAGGAAGACTTTT	0.468																																					p.E1321E		.											.	.	.	0			c.G3963A						.						160.0	134.0	142.0					2																	210742794		692	1591	2283	SO:0001819	synonymous_variant	285175	exon24			TGAGGAGGAAGAC	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.3963G>A	2.37:g.210742794G>A		Somatic	52	0		WXS	Illumina HiSeq	.	27	5	NM_032504	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Silent	SNP	ENST00000439458.1	37	CCDS46504.1																																																																																			.		0.468	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	
DHDH	27294	hgsc.bcm.edu	37	19	49447641	49447641	+	Nonsense_Mutation	SNP	G	G	T	rs373524516		TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr19:49447641G>T	ENST00000221403.2	+	6	812	c.772G>T	c.(772-774)Gag>Tag	p.E258*	DHDH_ENST00000522614.1_Intron|DHDH_ENST00000523250.1_Nonsense_Mutation_p.E119*	NM_014475.3	NP_055290.1	Q9UQ10	DHDH_HUMAN	dihydrodiol dehydrogenase (dimeric)	258					carbohydrate metabolic process (GO:0005975)|D-xylose catabolic process (GO:0042843)		D-xylose 1-dehydrogenase (NADP+) activity (GO:0047837)|electron carrier activity (GO:0009055)|NAD(P)+ transhydrogenase activity (GO:0008746)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			central_nervous_system(1)|large_intestine(3)|lung(3)|ovary(1)|soft_tissue(1)	9		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000158)|all cancers(93;0.000258)|Epithelial(262;0.0173)|GBM - Glioblastoma multiforme(486;0.0179)		GTGCCCGACCGAGCTGGTGGT	0.602																																					p.E258X		.											.	.	.	0			c.G772T						.	G	stop/GLU	0,4406		0,0,2203	52.0	51.0	51.0		772	2.9	0.8	19		51	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained	DHDH	NM_014475.3		0,1,6502	TT,TG,GG		0.0116,0.0,0.0077		258/335	49447641	1,13005	2203	4300	6503	SO:0001587	stop_gained	27294	exon6			CCGACCGAGCTGG	AB021933	CCDS12741.1	19q13.3	2008-02-05			ENSG00000104808	ENSG00000104808	1.3.1.20		17887	protein-coding gene	gene with protein product		606377				10477285	Standard	NM_014475		Approved	HUM2DD	uc002ple.1	Q9UQ10	OTTHUMG00000165029	ENST00000221403.2:c.772G>T	19.37:g.49447641G>T	ENSP00000221403:p.Glu258*	Somatic	78	0		WXS	Illumina HiSeq	.	65	4	NM_014475		Nonsense_Mutation	SNP	ENST00000221403.2	37	CCDS12741.1	.	.	.	.	.	.	.	.	.	.	G	18.88	3.716870	0.68844	0.0	1.16E-4	ENSG00000104808	ENST00000221403;ENST00000523250	.	.	.	5.03	2.92	0.33932	.	0.380247	0.29424	N	0.012190	.	.	.	.	.	.	0.22954	N	0.998516	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	-35.4758	7.9701	0.30122	0.1852:0.0:0.8148:0.0	.	.	.	.	X	258;119	.	ENSP00000221403:E258X	E	+	1	0	DHDH	54139453	0.000000	0.05858	0.794000	0.32065	0.768000	0.43524	0.038000	0.13862	0.846000	0.35142	-0.424000	0.05967	GAG	.		0.602	DHDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381477.1	NM_014475	
FRG1B	284802	hgsc.bcm.edu	37	20	29632486	29632486	+	Intron	SNP	C	C	A	rs74693630		TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr20:29632486C>A	ENST00000278882.3	+	8	805				FRG1B_ENST00000358464.4_Intron			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B											endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						tgagccactgcacctggccTA	0.408																																					.		.											.	.	.	0			.						.																																			SO:0001627	intron_variant	284802	.			CCACTGCACCTGG			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.426-125C>A	20.37:g.29632486C>A		Somatic	137	0		WXS	Illumina HiSeq	.	118	5	.	C4AME5	RNA	SNP	ENST00000278882.3	37																																																																																				.		0.408	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
IFFO2	126917	hgsc.bcm.edu;bcgsc.ca	37	1	19237944	19237944	+	Silent	SNP	G	G	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr1:19237944G>T	ENST00000455833.2	-	7	1604	c.1251C>A	c.(1249-1251)atC>atA	p.I417I	RP13-279N23.2_ENST00000494072.3_Missense_Mutation_p.P196T	NM_001136265.1	NP_001129737.1	Q5TF58	IFFO2_HUMAN	intermediate filament family orphan 2	417						intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)	2						CGGTCTCATGGATCAAGTTGC	0.403																																					p.I417I		.											.	.	.	0			c.C1251A						.						115.0	100.0	105.0					1																	19237944		692	1591	2283	SO:0001819	synonymous_variant	126917	exon7			CTCATGGATCAAG	AK024480, AL080251	CCDS44076.1	1p36.13	2013-10-11			ENSG00000169991	ENSG00000169991		"""Intermediate filament family orphans"""	27006	protein-coding gene	gene with protein product						14702039	Standard	NM_001136265		Approved		uc001bbd.2	Q5TF58	OTTHUMG00000002499	ENST00000455833.2:c.1251C>A	1.37:g.19237944G>T		Somatic	144	0		WXS	Illumina HiSeq	.	80	4	NM_001136265	Q9H7K0	Silent	SNP	ENST00000455833.2	37	CCDS44076.1	.	.	.	.	.	.	.	.	.	.	G	10.20	1.285943	0.23478	.	.	ENSG00000169991	ENST00000416166	.	.	.	4.81	2.81	0.32909	.	.	.	.	.	T	0.59183	0.2175	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55685	-0.8102	4	.	.	.	.	9.8564	0.41088	0.1946:0.0:0.8054:0.0	.	.	.	.	Y	159	.	.	S	-	2	0	IFFO2	19110531	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.378000	0.44309	1.076000	0.40961	0.563000	0.77884	TCC	.		0.403	IFFO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007099.2	NM_001136265	
MT-ND1	4535	hgsc.bcm.edu	37	M	625	625	+	5'Flank	SNP	G	G	A			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chrM:625G>A	ENST00000361390.2	+	0	0				MT-TL1_ENST00000386347.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	AAATGTTTAGACGGGCTCACA	0.463																																					.		.											.	.	.	0			.						.																																			SO:0001631	upstream_gene_variant	0	.			TTAGACGGGCTCA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886			M.37:g.625G>A	Exception_encountered	Somatic	548	0		WXS	Illumina HiSeq	.	631	137	.	C0JKH6|Q37523	RNA	SNP	ENST00000361390.2	37																																																																																				.		0.463	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024026	
LCP1	3936	hgsc.bcm.edu	37	13	46732997	46732997	+	Missense_Mutation	SNP	G	G	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr13:46732997G>T	ENST00000398576.2	-	6	580	c.192C>A	c.(190-192)gaC>gaA	p.D64E	LCP1_ENST00000323076.2_Missense_Mutation_p.D64E|LCP1_ENST00000460190.1_5'Flank			P13796	PLSL_HUMAN	lymphocyte cytosolic protein 1 (L-plastin)	64	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|organ regeneration (GO:0031100)|protein kinase A signaling (GO:0010737)|regulation of intracellular protein transport (GO:0033157)|T cell activation involved in immune response (GO:0002286)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|actin filament bundle (GO:0032432)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)	p.D64D(1)		breast(2)|kidney(1)|large_intestine(6)|lung(18)|ovary(4)|prostate(2)|skin(1)	34		Lung NSC(96;1.27e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.39e-05)		TTCCATCTTGGTCCAGATCAC	0.403			T	BCL6	NHL																																p.D64E		.		Dom	yes		13	13q14.1-q14.3	3936	lymphocyte cytosolic protein 1 (L-plastin)		L	LCP1,NS,carcinoma,0,1	LCP1	0	1	Substitution - coding silent(1)	prostate(1)	c.C192A						.						214.0	199.0	204.0					13																	46732997		2203	4300	6503	SO:0001583	missense	3936	exon3			ATCTTGGTCCAGA	M22300	CCDS9403.1	13q14.3	2013-01-10			ENSG00000136167	ENSG00000136167		"""EF-hand domain containing"""	6528	protein-coding gene	gene with protein product	"""plastin 2"""	153430				2111166	Standard	NM_002298		Approved	PLS2, CP64, L-PLASTIN, LC64P	uc001vba.4	P13796	OTTHUMG00000016864	ENST00000398576.2:c.192C>A	13.37:g.46732997G>T	ENSP00000381581:p.Asp64Glu	Somatic	63	0		WXS	Illumina HiSeq	.	34	2	NM_002298	B2R613|B4DUA0|Q5TBN4	Missense_Mutation	SNP	ENST00000398576.2	37	CCDS9403.1	.	.	.	.	.	.	.	.	.	.	G	17.82	3.483937	0.63962	.	.	ENSG00000136167	ENST00000323076;ENST00000398576;ENST00000416500;ENST00000442275	T;T;T;T	0.75477	-0.94;-0.94;-0.94;-0.94	5.76	5.76	0.90799	EF-hand-like domain (1);	0.106971	0.64402	D	0.000011	T	0.68284	0.2984	L	0.33339	1.005	0.80722	D	1	B	0.14805	0.011	B	0.23419	0.046	T	0.62253	-0.6893	10	0.46703	T	0.11	-27.6526	17.8133	0.88623	0.0:0.0:1.0:0.0	.	64	P13796	PLSL_HUMAN	E	64	ENSP00000315757:D64E;ENSP00000381581:D64E;ENSP00000408052:D64E;ENSP00000402157:D64E	ENSP00000315757:D64E	D	-	3	2	LCP1	45630998	1.000000	0.71417	0.986000	0.45419	0.962000	0.63368	4.082000	0.57635	2.882000	0.98803	0.655000	0.94253	GAC	.		0.403	LCP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044800.3	NM_002298	
SOX3	6658	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	139586719	139586719	+	Silent	SNP	G	G	A			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chrX:139586719G>A	ENST00000370536.2	-	1	506	c.507C>T	c.(505-507)atC>atT	p.I169I		NM_005634.2	NP_005625.2	P41225	SOX3_HUMAN	SRY (sex determining region Y)-box 3	169					central nervous system development (GO:0007417)|face development (GO:0060324)|hypothalamus development (GO:0021854)|negative regulation of neuron differentiation (GO:0045665)|neuron development (GO:0048666)|organ morphogenesis (GO:0009887)|pituitary gland development (GO:0021983)|sensory organ development (GO:0007423)|Sertoli cell development (GO:0060009)|sex determination (GO:0007530)|spermatid differentiation (GO:0048515)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|pancreas(1)|skin(1)	10	Acute lymphoblastic leukemia(192;7.65e-05)					AGCGCTTGCTGATCTCAGAAT	0.602																																					p.I169I		.											.	.	.	0			c.C507T						.						69.0	67.0	68.0					X																	139586719		2203	4300	6503	SO:0001819	synonymous_variant	6658	exon1			CTTGCTGATCTCA		CCDS14669.1	Xq27.1	2013-10-17			ENSG00000134595	ENSG00000134595		"""SRY (sex determining region Y)-boxes"""	11199	protein-coding gene	gene with protein product		313430	"""panhypopituitarism"""	PHP		15800844	Standard	NM_005634		Approved		uc004fbd.1	P41225	OTTHUMG00000022544	ENST00000370536.2:c.507C>T	X.37:g.139586719G>A		Somatic	60	0		WXS	Illumina HiSeq	.	69	12	NM_005634	P35714|Q5JWI3|Q9NP49	Silent	SNP	ENST00000370536.2	37	CCDS14669.1																																																																																			.		0.602	SOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058577.1		
TUSC3	7991	hgsc.bcm.edu;bcgsc.ca	37	8	15531281	15531281	+	Missense_Mutation	SNP	G	G	A			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr8:15531281G>A	ENST00000503731.1	+	6	882	c.734G>A	c.(733-735)gGc>gAc	p.G245D	TUSC3_ENST00000506802.1_Missense_Mutation_p.G245D|TUSC3_ENST00000509380.1_Missense_Mutation_p.G245D|TUSC3_ENST00000382020.4_Missense_Mutation_p.G245D|TUSC3_ENST00000503191.1_3'UTR	NM_006765.3	NP_006756.2	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3	245					cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cognition (GO:0050890)|magnesium ion transport (GO:0015693)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|oligosaccharyltransferase complex (GO:0008250)	magnesium ion transmembrane transporter activity (GO:0015095)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(10)|ovary(2)	28				Colorectal(111;0.113)		ATGACTTCTGGCCAGATGTGG	0.378																																					p.G245D		.											.	.	.	0			c.G734A						.						162.0	136.0	145.0					8																	15531281		2203	4300	6503	SO:0001583	missense	7991	exon6			CTTCTGGCCAGAT	AK026149	CCDS5993.1, CCDS5994.1	8p22	2010-10-22			ENSG00000104723	ENSG00000104723			30242	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 3 homolog A (S. cerevisiae)"""	601385				8661104, 10097140	Standard	NM_178234		Approved	MGC13453, N33, OST3A, MRT7	uc003wwt.3	Q13454	OTTHUMG00000094803	ENST00000503731.1:c.734G>A	8.37:g.15531281G>A	ENSP00000424544:p.Gly245Asp	Somatic	76	0		WXS	Illumina HiSeq	.	53	4	NM_178234	A8MSM0|D3DSP2|Q14911|Q14912|Q96FW0	Missense_Mutation	SNP	ENST00000503731.1	37	CCDS5994.1	.	.	.	.	.	.	.	.	.	.	G	30	5.057694	0.93846	.	.	ENSG00000104723	ENST00000382020;ENST00000506802;ENST00000509380;ENST00000503731	D;D;D;D	0.89810	-2.57;-2.57;-2.57;-2.57	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	D	0.95098	0.8412	M	0.87097	2.86	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.998;0.999;0.998;0.999;0.998;1.0	D	0.95514	0.8588	10	0.87932	D	0	-11.927	16.8849	0.86073	0.0:0.0:1.0:0.0	.	245;245;245;245;245;245	D6RDV0;D6RIY7;Q13454-2;Q13454;D6RA37;A8MSM0	.;.;.;TUSC3_HUMAN;.;.	D	245	ENSP00000371450:G245D;ENSP00000425777:G245D;ENSP00000423426:G245D;ENSP00000424544:G245D	ENSP00000221167:G245D	G	+	2	0	TUSC3	15575652	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.955000	0.93058	2.768000	0.95171	0.655000	0.94253	GGC	.		0.378	TUSC3-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000365367.1	NM_006765	
BCL7C	9274	hgsc.bcm.edu	37	16	30904573	30904573	+	Missense_Mutation	SNP	C	C	T	rs138503357		TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr16:30904573C>T	ENST00000215115.4	-	2	1146	c.131G>A	c.(130-132)cGt>cAt	p.R44H	MIR4519_ENST00000565573.1_RNA|MIR762_ENST00000390236.1_RNA|MIR4519_ENST00000564901.1_RNA|MIR4519_ENST00000570025.1_RNA|BCL7C_ENST00000380317.4_Missense_Mutation_p.R44H|AC106782.20_ENST00000572471.1_RNA	NM_004765.2	NP_004756.2	Q8WUZ0	BCL7C_HUMAN	B-cell CLL/lymphoma 7C	44					apoptotic process (GO:0006915)					large_intestine(1)|lung(3)|prostate(1)|skin(1)	6			Colorectal(24;0.198)			CTTGAAGATACGAAGGGAAGT	0.632																																					p.R44H		.											BCL7C_ENST00000380317,NS,carcinoma,0,2	BCL7C_ENST00000380317	0	0			c.G131A						.		HIS/ARG	0,4394		0,0,2197	83.0	70.0	74.0		131	3.2	1.0	16	dbSNP_134	74	1,8599	1.2+/-3.3	0,1,4299	no	missense	BCL7C	NM_004765.2	29	0,1,6496	TT,TC,CC		0.0116,0.0,0.0077	benign	44/218	30904573	1,12993	2197	4300	6497	SO:0001583	missense	9274	exon2			AAGATACGAAGGG	AJ223980	CCDS10693.1, CCDS67012.1	16p11	2012-11-19			ENSG00000099385	ENSG00000099385			1006	protein-coding gene	gene with protein product		605847				9931421	Standard	NM_004765		Approved		uc002dzv.3	Q8WUZ0	OTTHUMG00000177719	ENST00000215115.4:c.131G>A	16.37:g.30904573C>T	ENSP00000215115:p.Arg44His	Somatic	15	0		WXS	Illumina HiSeq	.	22	3	NM_004765	O43770|Q6PD89	Missense_Mutation	SNP	ENST00000215115.4	37	CCDS10693.1	.	.	.	.	.	.	.	.	.	.	C	19.04	3.750853	0.69533	0.0	1.16E-4	ENSG00000099385	ENST00000380317;ENST00000215115	T;T	0.60797	0.18;0.16	5.21	3.19	0.36642	.	0.114600	0.37348	N	0.002121	T	0.65502	0.2697	M	0.61703	1.905	0.41573	D	0.988694	D;D	0.65815	0.995;0.994	P;P	0.57846	0.828;0.736	T	0.68588	-0.5369	10	0.87932	D	0	-28.1859	9.4712	0.38844	0.141:0.7808:0.0:0.0782	.	44;44	Q8WUZ0;Q8WUZ0-2	BCL7C_HUMAN;.	H	44	ENSP00000369674:R44H;ENSP00000215115:R44H	ENSP00000215115:R44H	R	-	2	0	BCL7C	30812074	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	4.497000	0.60367	1.179000	0.42884	0.561000	0.74099	CGT	0.000		0.632	BCL7C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255547.3	NM_004765	
AURKC	6795	hgsc.bcm.edu	37	19	57744038	57744038	+	Missense_Mutation	SNP	G	G	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr19:57744038G>T	ENST00000302804.7	+	4	611	c.425G>T	c.(424-426)cGc>cTc	p.R142L	AURKC_ENST00000598785.1_Missense_Mutation_p.R108L|AURKC_ENST00000599062.1_Missense_Mutation_p.R139L|AURKC_ENST00000415300.2_Missense_Mutation_p.R123L|AURKC_ENST00000448930.1_Missense_Mutation_p.R108L	NM_001015878.1	NP_001015878.1	Q9UQB9	AURKC_HUMAN	aurora kinase C	142	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				attachment of spindle microtubules to kinetochore (GO:0008608)|cytokinesis (GO:0000910)|histone modification (GO:0016570)|meiotic nuclear division (GO:0007126)|positive regulation of cytokinesis (GO:0032467)|protein phosphorylation (GO:0006468)|spindle midzone assembly involved in mitosis (GO:0051256)	chromosome passenger complex (GO:0032133)|chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)	p.R142H(1)|p.R108H(1)		breast(1)|endometrium(1)|large_intestine(9)|lung(9)|ovary(3)|prostate(1)|stomach(1)	25		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0122)		GATGAACAGCGCACAGCCACG	0.552																																					p.R142L		.											AURKC_ENST00000302804,NS,haematopoietic_neoplasm,+1,2	AURKC_ENST00000302804	+1	2	Substitution - Missense(2)	large_intestine(2)	c.G425T						.						66.0	64.0	65.0					19																	57744038		2203	4300	6503	SO:0001583	missense	6795	exon4			AACAGCGCACAGC		CCDS33128.1, CCDS46205.1, CCDS46206.1	19q13.43	2013-09-19	2003-07-21	2003-07-23	ENSG00000105146	ENSG00000105146			11391	protein-coding gene	gene with protein product		603495	"""serine/threonine kinase 13 (aurora/IPL1-like)"""	STK13		9799611	Standard	XR_430209		Approved	AurC, ARK3	uc002qoe.3	Q9UQB9	OTTHUMG00000183106	ENST00000302804.7:c.425G>T	19.37:g.57744038G>T	ENSP00000302898:p.Arg142Leu	Somatic	17	0		WXS	Illumina HiSeq	.	21	2	NM_001015878	O60681|O75442|Q6AZY8|Q6DLZ0|Q9UPK5	Missense_Mutation	SNP	ENST00000302804.7	37	CCDS33128.1	.	.	.	.	.	.	.	.	.	.	G	6.328	0.428543	0.11987	.	.	ENSG00000105146	ENST00000415300;ENST00000448930;ENST00000302804	T;T;T	0.64438	-0.1;-0.1;-0.1	3.81	-0.993	0.10228	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.184695	0.47093	D	0.000253	T	0.30572	0.0769	N	0.04669	-0.19	0.36994	D	0.894914	B;B;B	0.27351	0.021;0.176;0.017	B;B;B	0.22601	0.03;0.04;0.01	T	0.04053	-1.0981	10	0.51188	T	0.08	-1.1314	4.8159	0.13367	0.3083:0.1585:0.5333:0.0	.	139;142;123	Q5Y191;Q9UQB9;Q9UQB9-3	.;AURKC_HUMAN;.	L	123;108;142	ENSP00000407162:R123L;ENSP00000406798:R108L;ENSP00000302898:R142L	ENSP00000302898:R142L	R	+	2	0	AURKC	62435850	0.998000	0.40836	0.134000	0.22075	0.004000	0.04260	2.854000	0.48325	-0.063000	0.13065	-0.291000	0.09656	CGC	.		0.552	AURKC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465089.1	NM_003160	
MYOM3	127294	hgsc.bcm.edu	37	1	24384096	24384096	+	Missense_Mutation	SNP	C	C	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr1:24384096C>T	ENST00000374434.3	-	37	4234	c.4072G>A	c.(4072-4074)Gtc>Atc	p.V1358I	MYOM3_ENST00000330966.7_Missense_Mutation_p.V1361I|RP11-293P20.2_ENST00000439239.2_RNA|MYOM3_ENST00000338909.5_Missense_Mutation_p.V251I	NM_152372.3	NP_689585.3	Q5VTT5	MYOM3_HUMAN	myomesin 3	1358	Ig-like C2-type 4.					M band (GO:0031430)	protein homodimerization activity (GO:0042803)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(3)|lung(40)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	68		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		TCTCCTGAGACGATGCAAGTC	0.517																																					p.V1358I		.											MYOM3,NS,carcinoma,0,2	MYOM3	0	0			c.G4072A						.						69.0	70.0	70.0					1																	24384096		1965	4147	6112	SO:0001583	missense	127294	exon37			CTGAGACGATGCA	AK093280	CCDS41281.1	1p36	2013-02-11	2012-10-17		ENSG00000142661	ENSG00000142661		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	26679	protein-coding gene	gene with protein product			"""myomesin family, member 3"""			18177667	Standard	NM_152372		Approved	FLJ35961	uc001bin.4	Q5VTT5	OTTHUMG00000002969	ENST00000374434.3:c.4072G>A	1.37:g.24384096C>T	ENSP00000363557:p.Val1358Ile	Somatic	66	0		WXS	Illumina HiSeq	.	37	2	NM_152372	A6NF75|Q5VTT6|Q6AWC0|Q6AWC1|Q6NXF9|Q6ZRG7|Q7Z3G9|Q8NA11|Q96C54	Missense_Mutation	SNP	ENST00000374434.3	37	CCDS41281.1	.	.	.	.	.	.	.	.	.	.	C	7.702	0.693292	0.15039	.	.	ENSG00000142661	ENST00000338909;ENST00000374434;ENST00000330966;ENST00000374442	T;T;T	0.72051	-0.62;-0.62;-0.62	4.71	2.39	0.29439	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.264128	0.37095	N	0.002244	T	0.45776	0.1359	N	0.11427	0.14	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.11329	0.001;0.006	T	0.13098	-1.0522	10	0.13853	T	0.58	.	8.8073	0.34945	0.0:0.2275:0.0:0.7725	.	1358;251	Q5VTT5;Q5VTT5-3	MYOM3_HUMAN;.	I	251;1358;1361;252	ENSP00000342689:V251I;ENSP00000363557:V1358I;ENSP00000332670:V1361I	ENSP00000332670:V1361I	V	-	1	0	MYOM3	24256683	0.947000	0.32204	1.000000	0.80357	0.614000	0.37383	0.100000	0.15231	0.324000	0.23333	-0.238000	0.12139	GTC	.		0.517	MYOM3-001	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000008272.2	NM_152372	
ARID1A	8289	hgsc.bcm.edu	37	1	27100375	27100375	+	Missense_Mutation	SNP	C	C	A			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr1:27100375C>A	ENST00000324856.7	+	17	4458	c.4087C>A	c.(4087-4089)Caa>Aaa	p.Q1363K	ARID1A_ENST00000457599.2_Missense_Mutation_p.Q1363K|ARID1A_ENST00000374152.2_Missense_Mutation_p.Q980K|ARID1A_ENST00000540690.1_5'UTR	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1363	Gln-rich.				androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		TACAATGTATCAACAGCAACA	0.488			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.Q1363K		.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	ARID1A,bladder,carcinoma,0,1	ARID1A	0	0			c.C4087A						.						130.0	135.0	134.0					1																	27100375		2203	4300	6503	SO:0001583	missense	8289	exon17			ATGTATCAACAGC	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.4087C>A	1.37:g.27100375C>A	ENSP00000320485:p.Gln1363Lys	Somatic	39	0		WXS	Illumina HiSeq	.	29	2	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Missense_Mutation	SNP	ENST00000324856.7	37	CCDS285.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.87|13.87	2.366560|2.366560	0.41902|0.41902	.|.	.|.	ENSG00000117713|ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152|ENST00000430799	T;T;T|.	0.02280|.	4.55;4.36;4.36|.	5.67|5.67	5.67|5.67	0.87782|0.87782	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.60805|.	0.2297|.	L|L	0.34521|0.34521	1.04|1.04	0.80722|0.80722	D|D	1|1	P;B;B;B|.	0.36874|.	0.572;0.189;0.287;0.189|.	B;B;B;B|.	0.33960|.	0.173;0.051;0.167;0.081|.	T|.	0.53858|.	-0.8379|.	10|.	0.32370|.	T|.	0.25|.	.|.	19.7727|19.7727	0.96373|0.96373	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	980;1363;1363;1016|.	O14497-3;O14497;O14497-2;Q4LE49|.	.;ARI1A_HUMAN;.;.|.	K|X	1363;1363;980|259	ENSP00000320485:Q1363K;ENSP00000387636:Q1363K;ENSP00000363267:Q980K|.	ENSP00000320485:Q1363K|.	Q|S	+|+	1|2	0|0	ARID1A|ARID1A	26972962|26972962	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.933000|0.933000	0.57130|0.57130	4.561000|4.561000	0.60809|0.60809	2.688000|2.688000	0.91661|0.91661	0.655000|0.655000	0.94253|0.94253	CAA|TCA	.		0.488	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
DNAH8	1769	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	38840868	38840868	+	Missense_Mutation	SNP	G	G	A			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr6:38840868G>A	ENST00000359357.3	+	49	7027	c.6773G>A	c.(6772-6774)aGg>aAg	p.R2258K	DNAH8_ENST00000441566.1_Missense_Mutation_p.R2222K|DNAH8_ENST00000449981.2_Missense_Mutation_p.R2475K			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	2258	AAA 2. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						ACGGTTTCTAGGATGGGCATG	0.522																																					p.R2475K		.											.	.	.	0			c.G7424A						.						91.0	93.0	92.0					6																	38840868		2203	4300	6503	SO:0001583	missense	1769	exon51			TTTCTAGGATGGG	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.6773G>A	6.37:g.38840868G>A	ENSP00000352312:p.Arg2258Lys	Somatic	57	0		WXS	Illumina HiSeq	.	41	14	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	37		.	.	.	.	.	.	.	.	.	.	G	36	5.633736	0.96682	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.73258	-0.73;-0.73;-0.73	5.81	5.81	0.92471	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	0.000000	0.85682	D	0.000000	D	0.90480	0.7018	H	0.98295	4.195	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.93475	0.6822	10	0.87932	D	0	.	20.0621	0.97678	0.0:0.0:1.0:0.0	.	2258	Q96JB1	DYH8_HUMAN	K	2463;2463;2258;2222	ENSP00000333363:R2463K;ENSP00000352312:R2258K;ENSP00000402294:R2222K	ENSP00000333363:R2463K	R	+	2	0	DNAH8	38948846	1.000000	0.71417	0.962000	0.40283	0.983000	0.72400	9.869000	0.99810	2.750000	0.94351	0.655000	0.94253	AGG	.		0.522	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
ANKFN1	162282	hgsc.bcm.edu	37	17	54431318	54431318	+	Missense_Mutation	SNP	G	G	A			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr17:54431318G>A	ENST00000318698.2	+	5	556	c.521G>A	c.(520-522)gGc>gAc	p.G174D	ANKFN1_ENST00000566473.2_Missense_Mutation_p.G174D	NM_153228.2	NP_694960.2	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain containing 1	174								p.G174V(1)		NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(11)|lung(27)|ovary(1)|prostate(1)|skin(1)	53						AACAGCGAGGGCTTGACACCC	0.502																																					p.G174D		.											ANKFN1,colon,carcinoma,-1,1	ANKFN1	-1	1	Substitution - Missense(1)	lung(1)	c.G521A						.						198.0	139.0	159.0					17																	54431318		2203	4300	6503	SO:0001583	missense	162282	exon5			GCGAGGGCTTGAC	AK095654	CCDS32686.1	17q23.2	2014-02-12	2005-11-15		ENSG00000153930	ENSG00000153930		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	26766	protein-coding gene	gene with protein product							Standard	NM_153228		Approved	FLJ38335	uc002iun.1	Q8N957	OTTHUMG00000155010	ENST00000318698.2:c.521G>A	17.37:g.54431318G>A	ENSP00000321627:p.Gly174Asp	Somatic	91	0		WXS	Illumina HiSeq	.	71	3	NM_153228		Missense_Mutation	SNP	ENST00000318698.2	37	CCDS32686.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.960558	0.92791	.	.	ENSG00000153930	ENST00000318698	T	0.77358	-1.09	5.22	5.22	0.72569	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	D	0.88786	0.6531	M	0.81802	2.56	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	D	0.90237	0.4283	10	0.87932	D	0	-13.2516	18.7786	0.91922	0.0:0.0:1.0:0.0	.	174	Q8N957	ANKF1_HUMAN	D	174	ENSP00000321627:G174D	ENSP00000321627:G174D	G	+	2	0	ANKFN1	51786317	1.000000	0.71417	0.994000	0.49952	0.763000	0.43281	9.864000	0.99589	2.426000	0.82243	0.655000	0.94253	GGC	.		0.502	ANKFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338043.1	NM_153228	
NIPAL1	152519	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	48037901	48037901	+	Silent	SNP	A	A	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr4:48037901A>T	ENST00000295461.5	+	6	1011	c.945A>T	c.(943-945)acA>acT	p.T315T		NM_207330.1	NP_997213.1	Q6NVV3	NIPA3_HUMAN	NIPA-like domain containing 1	315						integral component of membrane (GO:0016021)	magnesium ion transmembrane transporter activity (GO:0015095)			endometrium(2)|large_intestine(1)|lung(3)|skin(2)	8						TATTCTTCACATCCATGGTAG	0.408																																					p.T315T		.											.	.	.	0			c.A945T						.						160.0	145.0	150.0					4																	48037901		2203	4300	6503	SO:0001819	synonymous_variant	152519	exon6			CTTCACATCCATG	BC067881	CCDS3479.1	4p12	2009-03-24		2009-03-24	ENSG00000163293	ENSG00000163293			27194	protein-coding gene	gene with protein product				NPAL1			Standard	NM_207330		Approved	DKFZp686A06115	uc003gxw.3	Q6NVV3	OTTHUMG00000128622	ENST00000295461.5:c.945A>T	4.37:g.48037901A>T		Somatic	79	0		WXS	Illumina HiSeq	.	48	13	NM_207330	B3KTB0|Q68DA9	Silent	SNP	ENST00000295461.5	37	CCDS3479.1																																																																																			.		0.408	NIPAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250491.4	NM_207330	
WDFY3	23001	hgsc.bcm.edu	37	4	85678262	85678262	+	Silent	SNP	G	G	A			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr4:85678262G>A	ENST00000295888.4	-	33	5648	c.5241C>T	c.(5239-5241)aaC>aaT	p.N1747N	WDFY3_ENST00000322366.6_Silent_p.N1747N	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	1747					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		AAGCATCTCGGTTAATCTCCC	0.448																																					p.N1747N		.											.	.	.	0			c.C5241T						.						140.0	132.0	134.0					4																	85678262		2203	4300	6503	SO:0001819	synonymous_variant	23001	exon33			ATCTCGGTTAATC	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.5241C>T	4.37:g.85678262G>A		Somatic	94	0		WXS	Illumina HiSeq	.	71	3	NM_014991	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Silent	SNP	ENST00000295888.4	37	CCDS3609.1																																																																																			.		0.448	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991	
TCHH	7062	hgsc.bcm.edu	37	1	152084531	152084531	+	Missense_Mutation	SNP	G	G	C	rs530429479	byFrequency	TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr1:152084531G>C	ENST00000368804.1	-	2	1161	c.1162C>G	c.(1162-1164)Cag>Gag	p.Q388E		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	388	8 X 6 AA tandem repeats of R-R-E-Q-Q-L.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			cgcctcagctgctgctcgcgc	0.721													-|||	107	0.0213658	0.003	0.1023	5008	,	,		16197	0.0298		0.001	False		,,,				2504	0.001				p.Q388E		.											.	.	.	0			c.C1162G						.						2.0	4.0	3.0					1																	152084531		541	1723	2264	SO:0001583	missense	7062	exon3			TCAGCTGCTGCTC	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.1162C>G	1.37:g.152084531G>C	ENSP00000357794:p.Gln388Glu	Somatic	30	0		WXS	Illumina HiSeq	.	32	6	NM_007113	Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	37	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	N	5.805	0.332821	0.11013	.	.	ENSG00000159450	ENST00000368804	T	0.04275	3.66	3.35	-0.432	0.12291	.	.	.	.	.	T	0.00695	0.0023	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.45571	-0.9252	9	0.02654	T	1	.	16.3773	0.83410	0.0:0.2058:0.7942:0.0	.	388	Q07283	TRHY_HUMAN	E	388	ENSP00000357794:Q388E	ENSP00000357794:Q388E	Q	-	1	0	TCHH	150351155	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.503000	0.00965	-0.501000	0.06605	-1.947000	0.00488	CAG	.		0.721	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
MYT1L	23040	hgsc.bcm.edu	37	2	1890332	1890332	+	Missense_Mutation	SNP	G	G	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr2:1890332G>T	ENST00000399161.2	-	18	3437	c.2690C>A	c.(2689-2691)gCc>gAc	p.A897D	MYT1L_ENST00000428368.2_Missense_Mutation_p.A895D	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	897					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GGAGCTGGTGGCCAGCATACT	0.458																																					p.A895D		.											.	.	.	0			c.C2684A						.						55.0	56.0	55.0					2																	1890332		1863	4106	5969	SO:0001583	missense	23040	exon18			CTGGTGGCCAGCA	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.2690C>A	2.37:g.1890332G>T	ENSP00000382114:p.Ala897Asp	Somatic	80	0		WXS	Illumina HiSeq	.	57	4	NM_015025	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	ENST00000399161.2	37		.	.	.	.	.	.	.	.	.	.	G	27.2	4.807151	0.90623	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	T;T	0.47528	0.84;0.84	5.66	5.66	0.87406	.	0.046039	0.85682	D	0.000000	T	0.65238	0.2672	L	0.50333	1.59	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.70227	0.964;0.968	T	0.64816	-0.6318	10	0.59425	D	0.04	-35.0603	19.7617	0.96321	0.0:0.0:1.0:0.0	.	897;895	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	D	897;843;895	ENSP00000382114:A897D;ENSP00000396103:A895D	ENSP00000295067:A843D	A	-	2	0	MYT1L	1869339	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.787000	0.99055	2.671000	0.90904	0.655000	0.94253	GCC	.		0.458	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025	
FHOD3	80206	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	34205526	34205526	+	Missense_Mutation	SNP	G	G	T	rs368210942		TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr18:34205526G>T	ENST00000359247.4	+	10	1010	c.1010G>T	c.(1009-1011)gGg>gTg	p.G337V	FHOD3_ENST00000591635.1_Missense_Mutation_p.G12C|FHOD3_ENST00000257209.4_Missense_Mutation_p.G337V|FHOD3_ENST00000445677.1_Missense_Mutation_p.G337V|FHOD3_ENST00000590592.1_Missense_Mutation_p.G337V	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	337	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				CCCCCCAGTGGGTGCCGGGAC	0.677																																					p.G337V		.											.	.	.	0			c.G1010T						.						38.0	43.0	41.0					18																	34205526		2203	4300	6503	SO:0001583	missense	80206	exon10			CCAGTGGGTGCCG	AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.1010G>T	18.37:g.34205526G>T	ENSP00000352186:p.Gly337Val	Somatic	68	0		WXS	Illumina HiSeq	.	58	16	NM_025135	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Missense_Mutation	SNP	ENST00000359247.4	37		.	.	.	.	.	.	.	.	.	.	G	19.51	3.840597	0.71488	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	T;T;T	0.25912	1.77;1.77;1.77	5.75	5.75	0.90469	GTPase-binding/formin homology 3 (1);Armadillo-type fold (1);	0.100762	0.64402	N	0.000002	T	0.41373	0.1156	L	0.59436	1.845	0.80722	D	1	B;P;D;D	0.57257	0.216;0.941;0.972;0.979	B;P;P;P	0.55161	0.188;0.77;0.536;0.593	T	0.04708	-1.0932	10	0.39692	T	0.17	.	16.6927	0.85326	0.0:0.0:1.0:0.0	.	337;337;337;337	Q2V2M9-2;Q2V2M9;Q2V2M9-3;E5F5Q0	.;FHOD3_HUMAN;.;.	V	337	ENSP00000257209:G337V;ENSP00000352186:G337V;ENSP00000411430:G337V	ENSP00000257209:G337V	G	+	2	0	FHOD3	32459524	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	5.163000	0.64948	2.716000	0.92895	0.655000	0.94253	GGG	.		0.677	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	XM_371114	
KIRREL2	84063	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	36352740	36352740	+	Missense_Mutation	SNP	G	G	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr19:36352740G>T	ENST00000360202.5	+	11	1522	c.1324G>T	c.(1324-1326)Ggg>Tgg	p.G442W	KIRREL2_ENST00000592409.1_Missense_Mutation_p.G442W|KIRREL2_ENST00000262625.7_Missense_Mutation_p.G442W|KIRREL2_ENST00000347900.6_Missense_Mutation_p.G392W|NPHS1_ENST00000591817.1_Intron	NM_032123.5|NM_199180.2	NP_115499.4|NP_954649.2	Q6UWL6	KIRR2_HUMAN	kin of IRRE like 2 (Drosophila)	442	Ig-like C2-type 5.				cell adhesion (GO:0007155)|negative regulation of protein phosphorylation (GO:0001933)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)				breast(2)|central_nervous_system(1)|endometrium(6)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	48	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CCTGGAGGCGGGGTCGCAGGG	0.647																																					p.G442W		.											.	.	.	0			c.G1324T						.						22.0	26.0	24.0					19																	36352740		2196	4289	6485	SO:0001583	missense	84063	exon11			GAGGCGGGGTCGC	AL136654	CCDS12479.1, CCDS12480.1, CCDS12481.1	19q13.13	2013-01-29				ENSG00000126259		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18816	protein-coding gene	gene with protein product		607762				12837264, 12504092	Standard	NM_199180		Approved	NLG1, NEPH3, FILTRIN, DKFZp564A1164, MGC15718	uc002ocb.4	Q6UWL6		ENST00000360202.5:c.1324G>T	19.37:g.36352740G>T	ENSP00000353331:p.Gly442Trp	Somatic	35	0		WXS	Illumina HiSeq	.	54	17	NM_199180	C9JHF1|C9JJ76|F1T0I2|Q6P1R1|Q7Z5P1|Q7Z5P2|Q96IQ8|Q9H0T1	Missense_Mutation	SNP	ENST00000360202.5	37	CCDS12481.1	.	.	.	.	.	.	.	.	.	.	G	11.82	1.753088	0.31046	.	.	ENSG00000126259	ENST00000262625;ENST00000347900;ENST00000360202;ENST00000341658	T;T;T	0.70986	-0.53;-0.29;-0.52	4.69	3.61	0.41365	Immunoglobulin-like (1);	0.000000	0.47093	D	0.000249	T	0.80082	0.4558	M	0.64997	1.995	0.09310	N	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.70695	-0.4801	10	0.87932	D	0	-19.9894	10.5306	0.44975	0.0:0.1973:0.8027:0.0	.	442;422;442;392;442	F1T0I2;Q6UWL6-4;Q6UWL6;Q6UWL6-3;Q6UWL6-2	.;.;KIRR2_HUMAN;.;.	W	442;392;442;422	ENSP00000262625:G442W;ENSP00000345067:G392W;ENSP00000353331:G442W	ENSP00000262625:G442W	G	+	1	0	KIRREL2	41044580	1.000000	0.71417	0.017000	0.16124	0.078000	0.17371	7.018000	0.76406	0.923000	0.37045	0.555000	0.69702	GGG	.		0.647	KIRREL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452561.1	NM_032123	
CHD5	26038	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	6194805	6194805	+	Missense_Mutation	SNP	G	G	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr1:6194805G>T	ENST00000262450.3	-	19	3084	c.2985C>A	c.(2983-2985)caC>caA	p.H995Q	CHD5_ENST00000378021.1_5'UTR	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		AGAGGTAGGGGTGGTTGCAGC	0.577																																					p.H995Q		.											.	.	.	0			c.C2985A						.						234.0	241.0	238.0					1																	6194805		2203	4300	6503	SO:0001583	missense	26038	exon19			GTAGGGGTGGTTG	AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.2985C>A	1.37:g.6194805G>T	ENSP00000262450:p.His995Gln	Somatic	72	0		WXS	Illumina HiSeq	.	40	5	NM_015557	A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	ENST00000262450.3	37	CCDS57.1	.	.	.	.	.	.	.	.	.	.	G	17.40	3.379097	0.61735	.	.	ENSG00000116254	ENST00000262450;ENST00000378006;ENST00000536802;ENST00000538279	T	0.79749	-1.3	4.48	1.44	0.22558	SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.91663	0.7365	H	0.98802	4.335	0.80722	D	1	D	0.63880	0.993	P	0.60345	0.873	D	0.91411	0.5151	10	0.87932	D	0	-30.8665	9.5895	0.39537	0.2381:0.0:0.7619:0.0	.	995	Q8TDI0	CHD5_HUMAN	Q	995;511;403;403	ENSP00000262450:H995Q	ENSP00000262450:H995Q	H	-	3	2	CHD5	6117392	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.077000	0.30741	0.425000	0.26087	0.561000	0.74099	CAC	.		0.577	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002823.2	NM_015557	
KIAA1324	57535	hgsc.bcm.edu	37	1	109714602	109714602	+	Silent	SNP	C	C	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr1:109714602C>T	ENST00000369939.3	+	4	765	c.582C>T	c.(580-582)taC>taT	p.Y194Y	KIAA1324_ENST00000529753.1_Silent_p.Y194Y	NM_020775.4	NP_065826	Q6UXG2	K1324_HUMAN	KIAA1324	194					cellular response to starvation (GO:0009267)|macroautophagy (GO:0016236)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|positive regulation of autophagic vacuole assembly (GO:2000786)|positive regulation of vacuole organization (GO:0044090)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34		all_epithelial(167;0.000102)|all_lung(203;0.000323)|Lung NSC(277;0.00063)		Colorectal(144;0.0188)|Lung(183;0.0527)|COAD - Colon adenocarcinoma(174;0.14)|Epithelial(280;0.21)|all cancers(265;0.249)		TCGAATACTACTATCCAGACT	0.537																																					p.Y194Y		.											.	.	.	0			c.C582T						.						155.0	133.0	140.0					1																	109714602		2203	4300	6503	SO:0001819	synonymous_variant	57535	exon4			ATACTACTATCCA	AK057647	CCDS794.1, CCDS58015.1	1p13.3	2008-09-18			ENSG00000116299	ENSG00000116299			29618	protein-coding gene	gene with protein product	"""estrogen induced gene 121"""	611298				10718198, 16322283	Standard	NM_020775		Approved	maba1, EIG121	uc021orb.1	Q6UXG2	OTTHUMG00000011725	ENST00000369939.3:c.582C>T	1.37:g.109714602C>T		Somatic	63	0		WXS	Illumina HiSeq	.	58	4	NM_020775	Q08AE6|Q5T5C9|Q5T5D0|Q5T5D1|Q9P2M2	Silent	SNP	ENST00000369939.3	37	CCDS794.1																																																																																			.		0.537	KIAA1324-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032389.2	NM_020775	
FAM184A	79632	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	119345170	119345170	+	Missense_Mutation	SNP	C	C	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr6:119345170C>T	ENST00000338891.7	-	2	1411	c.968G>A	c.(967-969)tGc>tAc	p.C323Y	FAM184A_ENST00000521531.1_Missense_Mutation_p.C323Y|FAM184A_ENST00000352896.5_Missense_Mutation_p.C203Y|RP11-351A11.1_ENST00000518570.1_RNA|FAM184A_ENST00000368475.4_Missense_Mutation_p.C203Y|FAM184A_ENST00000522284.1_Missense_Mutation_p.C203Y	NM_024581.4	NP_078857.5	Q8NB25	F184A_HUMAN	family with sequence similarity 184, member A	323						extracellular space (GO:0005615)				breast(2)|central_nervous_system(2)|endometrium(2)|kidney(5)|large_intestine(19)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(5)	52						AAGCTTTTGGCATTTGTCAAG	0.333																																					p.C323Y		.											.	.	.	0			c.G968A						.						125.0	121.0	123.0					6																	119345170		1827	4079	5906	SO:0001583	missense	79632	exon2			TTTTGGCATTTGT	BC009055	CCDS43499.1, CCDS43500.1, CCDS75508.1	6q22.31	2008-08-14	2008-08-14	2008-08-14	ENSG00000111879	ENSG00000111879			20991	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 60"""	C6orf60		11230166	Standard	NM_024581		Approved	FLJ13942	uc003pyj.3	Q8NB25	OTTHUMG00000015471	ENST00000338891.7:c.968G>A	6.37:g.119345170C>T	ENSP00000342604:p.Cys323Tyr	Somatic	88	0		WXS	Illumina HiSeq	.	62	5	NM_024581	B9DI75|F8W8D6|Q5TBS9|Q7Z323|Q96GY8|Q9H0J8|Q9H851	Missense_Mutation	SNP	ENST00000338891.7	37	CCDS43499.1	.	.	.	.	.	.	.	.	.	.	C	13.81	2.347628	0.41599	.	.	ENSG00000111879	ENST00000338891;ENST00000352896;ENST00000368475;ENST00000521531;ENST00000522284	T;T;T;T;T	0.00348	8.0;8.0;8.0;8.0;8.0	5.33	5.33	0.75918	.	0.096943	0.64402	D	0.000001	T	0.00356	0.0011	L	0.51422	1.61	0.49051	D	0.99974	D;D;D	0.67145	0.995;0.986;0.996	P;P;P	0.61800	0.858;0.742;0.894	D	0.90894	0.4763	10	0.51188	T	0.08	-1.6065	19.376	0.94508	0.0:1.0:0.0:0.0	.	323;203;323	Q8NB25-2;F8W8D6;Q8NB25	.;.;F184A_HUMAN	Y	323;203;203;323;203	ENSP00000342604:C323Y;ENSP00000326608:C203Y;ENSP00000357460:C203Y;ENSP00000430442:C323Y;ENSP00000429826:C203Y	ENSP00000342604:C323Y	C	-	2	0	FAM184A	119386869	1.000000	0.71417	1.000000	0.80357	0.142000	0.21351	5.811000	0.69187	2.656000	0.90262	0.591000	0.81541	TGC	.		0.333	FAM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042009.3	NM_024581	
MTG2	26164	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	60768516	60768516	+	Missense_Mutation	SNP	G	G	A			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr20:60768516G>A	ENST00000370823.3	+	2	58	c.40G>A	c.(40-42)Gtg>Atg	p.V14M	MTG2_ENST00000536470.1_Intron|MTG2_ENST00000436421.2_Missense_Mutation_p.V14M	NM_015666.3	NP_056481.1	Q9H4K7	MTG2_HUMAN	mitochondrial ribosome-associated GTPase 2	14					GTP catabolic process (GO:0006184)|regulation of mitochondrial translation (GO:0070129)|regulation of respiratory system process (GO:0044065)|ribosome biogenesis (GO:0042254)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial ribosome (GO:0005761)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)										ATTGAGGACCGTGTTTCAGGG	0.562																																					p.V14M		.											.	.	.	0			c.G40A						.						105.0	107.0	106.0					20																	60768516		2203	4300	6503	SO:0001583	missense	26164	exon2			AGGACCGTGTTTC	AK001603	CCDS13492.1	20q13.33	2013-05-24	2013-05-24	2013-05-24	ENSG00000101181	ENSG00000101181			16239	protein-coding gene	gene with protein product		610919	"""GTP-binding protein 5 (putative)"", ""GTP binding protein 5 (putative)"""	GTPBP5		17054726, 23396448	Standard	NM_015666		Approved	FLJ10741, dJ1005F21.2, ObgH1		Q9H4K7	OTTHUMG00000032897	ENST00000370823.3:c.40G>A	20.37:g.60768516G>A	ENSP00000359859:p.Val14Met	Somatic	46	0		WXS	Illumina HiSeq	.	50	10	NM_015666	A6NDR3|B4DR85|Q96I17|Q9NVG9|Q9UFR4	Missense_Mutation	SNP	ENST00000370823.3	37	CCDS13492.1	.	.	.	.	.	.	.	.	.	.	G	3.432	-0.115873	0.06881	.	.	ENSG00000101181	ENST00000436421;ENST00000370823;ENST00000448254	T;T;T	0.24538	1.85;2.68;2.19	5.0	-10.0	0.00425	.	2.671480	0.00937	N	0.002787	T	0.08980	0.0222	N	0.08118	0	0.09310	N	1	B;B;B	0.10296	0.003;0.003;0.003	B;B;B	0.06405	0.002;0.001;0.002	T	0.20940	-1.0260	10	0.13470	T	0.59	-0.1974	1.9012	0.03268	0.454:0.1961:0.1545:0.1955	.	14;14;14	Q5JXJ0;E7EU10;Q9H4K7	.;.;GTPB5_HUMAN	M	14	ENSP00000392267:V14M;ENSP00000359859:V14M;ENSP00000414693:V14M	ENSP00000359859:V14M	V	+	1	0	GTPBP5	60201911	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.801000	0.00761	-4.501000	0.00045	-1.829000	0.00594	GTG	.		0.562	MTG2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079989.1	NM_015666	
GALNT11	63917	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	7	151800310	151800310	+	Missense_Mutation	SNP	C	C	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr7:151800310C>T	ENST00000434507.1	+	6	970	c.533C>T	c.(532-534)aCg>aTg	p.T178M	GALNT11_ENST00000422997.2_3'UTR|GALNT11_ENST00000482812.1_3'UTR|GALNT11_ENST00000430044.2_Missense_Mutation_p.T178M|GALNT11_ENST00000320311.2_Missense_Mutation_p.T178M|GALNT11_ENST00000415421.1_Missense_Mutation_p.T178M|GALNT11_ENST00000452146.2_Missense_Mutation_p.T97M			Q8NCW6	GLT11_HUMAN	polypeptide N-acetylgalactosaminyltransferase 11	178	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation via threonine (GO:0018243)|regulation of Notch signaling pathway (GO:0008593)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|Notch binding (GO:0005112)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|prostate(5)|skin(2)	27	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.214)	OV - Ovarian serous cystadenocarcinoma(82;0.00168)	UCEC - Uterine corpus endometrioid carcinoma (81;0.177)|BRCA - Breast invasive adenocarcinoma(188;0.0932)		ATAGACCGCACGCCAGCACAC	0.488																																					p.T178M		.											.	.	.	0			c.C533T						.						176.0	136.0	149.0					7																	151800310		2203	4300	6503	SO:0001583	missense	63917	exon4			ACCGCACGCCAGC	AC006017	CCDS5930.1	7q36.1	2014-05-09	2014-05-09		ENSG00000178234	ENSG00000178234	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19875	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 11"""	615130	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11)"""			11925450	Standard	NM_022087		Approved	GalNAc-T11	uc010lqg.1	Q8NCW6	OTTHUMG00000157251	ENST00000434507.1:c.533C>T	7.37:g.151800310C>T	ENSP00000416787:p.Thr178Met	Somatic	60	0		WXS	Illumina HiSeq	.	38	4	NM_022087	B3KWF4|Q6PCD1|Q9H6C2|Q9H6Z5|Q9UDR8	Missense_Mutation	SNP	ENST00000434507.1	37	CCDS5930.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.972739	0.74246	.	.	ENSG00000178234	ENST00000430044;ENST00000452146;ENST00000443352;ENST00000434507;ENST00000415421;ENST00000320311;ENST00000419245	T;T;T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08;-0.08;-0.08	5.0	5.0	0.66597	Glycosyl transferase, family 2 (1);	0.109437	0.64402	D	0.000008	D	0.85296	0.5664	H	0.94734	3.575	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.89884	0.4032	10	0.87932	D	0	.	18.3133	0.90208	0.0:1.0:0.0:0.0	.	97;178;178	B7Z5G5;Q8NCW6-2;Q8NCW6	.;.;GLT11_HUMAN	M	178;97;178;178;178;178;178	ENSP00000395122:T178M;ENSP00000393399:T97M;ENSP00000416787:T178M;ENSP00000410093:T178M;ENSP00000315835:T178M;ENSP00000397581:T178M	ENSP00000315835:T178M	T	+	2	0	GALNT11	151431243	1.000000	0.71417	0.929000	0.37066	0.390000	0.30446	5.982000	0.70532	2.313000	0.78055	0.655000	0.94253	ACG	.		0.488	GALNT11-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348184.1	NM_022087	
IGF1R	3480	hgsc.bcm.edu	37	15	99482568	99482568	+	Missense_Mutation	SNP	G	G	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr15:99482568G>T	ENST00000268035.6	+	18	4047	c.3436G>T	c.(3436-3438)Gat>Tat	p.D1146Y	IGF1R_ENST00000558762.1_Missense_Mutation_p.D1145Y	NM_000875.3	NP_000866.1	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor	1146	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|epidermis development (GO:0008544)|establishment of cell polarity (GO:0030010)|exocrine pancreas development (GO:0031017)|immune response (GO:0006955)|inactivation of MAPKK activity (GO:0051389)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|male sex determination (GO:0030238)|mammary gland development (GO:0030879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|peptidyl-tyrosine autophosphorylation (GO:0038083)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of DNA replication (GO:0045740)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|prostate gland epithelium morphogenesis (GO:0060740)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein tetramerization (GO:0051262)|regulation of JNK cascade (GO:0046328)|response to vitamin E (GO:0033197)|signal transduction (GO:0007165)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor-activated receptor activity (GO:0005010)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(13)|lung(20)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		"""""""Insulin(DB00071)|Insulin Glargine(DB00047)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	GGTAGCCGAAGATTTCACAGT	0.502																																					p.D1146Y		.											IGF1R,NS,lymphoid_neoplasm,0,1	IGF1R	0	0			c.G3436T						.						156.0	146.0	149.0					15																	99482568		2197	4297	6494	SO:0001583	missense	3480	exon18			GCCGAAGATTTCA	M69229	CCDS10378.1, CCDS73785.1	15q26.3	2013-02-11			ENSG00000140443	ENSG00000140443		"""CD molecules"", ""Fibronectin type III domain containing"""	5465	protein-coding gene	gene with protein product		147370				1316909	Standard	XM_006720486		Approved	JTK13, CD221, IGFIR, MGC18216, IGFR	uc002bul.3	P08069	OTTHUMG00000149851	ENST00000268035.6:c.3436G>T	15.37:g.99482568G>T	ENSP00000268035:p.Asp1146Tyr	Somatic	57	0		WXS	Illumina HiSeq	.	43	2	NM_000875	B1B5Y2|Q14CV2|Q9UCC0	Missense_Mutation	SNP	ENST00000268035.6	37	CCDS10378.1	.	.	.	.	.	.	.	.	.	.	G	31	5.063381	0.93898	.	.	ENSG00000140443	ENST00000268035	D	0.90676	-2.71	5.9	5.9	0.94986	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000013	D	0.95127	0.8421	M	0.65498	2.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.996;0.997	D	0.94882	0.8040	10	0.87932	D	0	.	20.2822	0.98520	0.0:0.0:1.0:0.0	.	1145;1146	C9J5X1;P08069	.;IGF1R_HUMAN	Y	1146	ENSP00000268035:D1146Y	ENSP00000268035:D1146Y	D	+	1	0	IGF1R	97300091	1.000000	0.71417	0.997000	0.53966	0.891000	0.51852	9.832000	0.99423	2.806000	0.96561	0.655000	0.94253	GAT	.		0.502	IGF1R-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313537.2	NM_000875	
RALGAPA1	253959	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	36192384	36192384	+	Silent	SNP	C	C	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr14:36192384C>T	ENST00000389698.3	-	15	2343	c.1953G>A	c.(1951-1953)tcG>tcA	p.S651S	RALGAPA1_ENST00000307138.6_Silent_p.S651S|RALGAPA1_ENST00000554704.1_5'UTR|RALGAPA1_ENST00000258840.6_Silent_p.S651S|RALGAPA1_ENST00000382366.3_Silent_p.S651S	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)	651					activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						AATAGGTCAGCGATGACAATA	0.393																																					p.S651S		.											.	.	.	0			c.G1953A						.						80.0	72.0	75.0					14																	36192384		2203	4300	6503	SO:0001819	synonymous_variant	253959	exon15			GGTCAGCGATGAC	AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.1953G>A	14.37:g.36192384C>T		Somatic	169	0		WXS	Illumina HiSeq	.	123	7	NM_194301	A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Silent	SNP	ENST00000389698.3	37	CCDS32065.1																																																																																			.		0.393	RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409829.1	XM_210022	
CA3	761	hgsc.bcm.edu	37	8	86351153	86351153	+	Missense_Mutation	SNP	G	G	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr8:86351153G>T	ENST00000285381.2	+	1	98	c.15G>T	c.(13-15)tgG>tgT	p.W5C	RP11-317J10.2_ENST00000517697.1_RNA	NM_005181.3	NP_005172.1	P07451	CAH3_HUMAN	carbonic anhydrase III, muscle specific	5					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|response to ethanol (GO:0045471)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	carbonate dehydratase activity (GO:0004089)|nickel cation binding (GO:0016151)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23					Acetazolamide(DB00819)|Zonisamide(DB00909)	CCAAGGAGTGGGGCTACGCCA	0.637																																					p.W5C		.											.	.	.	0			c.G15T						.						66.0	45.0	53.0					8																	86351153		1800	3367	5167	SO:0001583	missense	761	exon1			GGAGTGGGGCTAC	AJ006473	CCDS6238.1	8q21.2	2012-10-02					4.2.1.1	"""Carbonic anhydrases"""	1374	protein-coding gene	gene with protein product		114750				6221502	Standard	NM_005181		Approved	Car3, CAIII	uc003ydj.3	P07451		ENST00000285381.2:c.15G>T	8.37:g.86351153G>T	ENSP00000285381:p.Trp5Cys	Somatic	136	0		WXS	Illumina HiSeq	.	104	5	NM_005181	B2R867|B3KUC8|O60842	Missense_Mutation	SNP	ENST00000285381.2	37	CCDS6238.1	.	.	.	.	.	.	.	.	.	.	G	18.09	3.546340	0.65198	.	.	ENSG00000164879	ENST00000285381;ENST00000426378	D	0.82711	-1.64	4.93	4.05	0.47172	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.165048	0.64402	D	0.000015	D	0.94371	0.8190	H	0.98559	4.265	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	D	0.96203	0.9147	10	0.87932	D	0	-10.797	14.1035	0.65072	0.0:0.0:0.8485:0.1515	.	5	P07451	CAH3_HUMAN	C	5	ENSP00000285381:W5C	ENSP00000285381:W5C	W	+	3	0	CA3	86538405	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	5.464000	0.66719	1.406000	0.46857	0.655000	0.94253	TGG	.		0.637	CA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381090.1	NM_005181	
SIT1	27240	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	35650620	35650620	+	Missense_Mutation	SNP	T	T	C			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr9:35650620T>C	ENST00000259608.3	-	2	201	c.115A>G	c.(115-117)Acc>Gcc	p.T39A	SIT1_ENST00000474403.1_Intron	NM_014450.2	NP_055265.1	Q9Y3P8	SIT1_HUMAN	signaling threshold regulating transmembrane adaptor 1	39					immune system process (GO:0002376)|regulation of T cell activation (GO:0050863)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	kinase binding (GO:0019900)|SH2 domain binding (GO:0042169)			endometrium(2)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	9			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CAGGCCTGGGTTATGGAGGGG	0.647																																					p.T39A		.											.	.	.	0			c.A115G						.						44.0	50.0	48.0					9																	35650620		2203	4300	6503	SO:0001583	missense	27240	exon2			CCTGGGTTATGGA		CCDS6582.1	9p13-p12	2008-02-05	2005-04-26		ENSG00000137078	ENSG00000137078			17710	protein-coding gene	gene with protein product	"""SHP2 interacting transmembrane adaptor"""	604964	"""suppression inducing transmembrane adaptor 1"""			11491537, 10209036	Standard	NM_014450		Approved	SIT	uc003zxe.1	Q9Y3P8	OTTHUMG00000019867	ENST00000259608.3:c.115A>G	9.37:g.35650620T>C	ENSP00000259608:p.Thr39Ala	Somatic	26	0		WXS	Illumina HiSeq	.	22	8	NM_014450	B2RBP9	Missense_Mutation	SNP	ENST00000259608.3	37	CCDS6582.1	.	.	.	.	.	.	.	.	.	.	T	1.505	-0.550968	0.03996	.	.	ENSG00000137078	ENST00000259608	.	.	.	4.48	0.00244	0.14050	.	1.740780	0.03617	N	0.235781	T	0.21468	0.0517	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.18429	-1.0337	9	0.42905	T	0.14	-0.0339	3.6407	0.08166	0.0:0.2983:0.1996:0.5022	.	39	Q9Y3P8	SIT1_HUMAN	A	39	.	ENSP00000259608:T39A	T	-	1	0	SIT1	35640620	0.000000	0.05858	0.000000	0.03702	0.432000	0.31715	-1.806000	0.01735	0.017000	0.15025	0.482000	0.46254	ACC	.		0.647	SIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052322.1	NM_014450	
CP	1356	hgsc.bcm.edu;bcgsc.ca	37	3	148896305	148896305	+	Missense_Mutation	SNP	C	C	A			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr3:148896305C>A	ENST00000264613.6	-	16	3037	c.2775G>T	c.(2773-2775)gaG>gaT	p.E925D		NM_000096.3	NP_000087	P00450	CERU_HUMAN	ceruloplasmin (ferroxidase)	925	F5/8 type A 3.|Plastocyanin-like 6.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|transmembrane transport (GO:0055085)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)	chaperone binding (GO:0051087)|copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			breast(6)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	AAGATTCATTCTCATCAAAAA	0.368																																					p.E925D		.											.	.	.	0			c.G2775T						.						110.0	102.0	104.0					3																	148896305		2203	4300	6503	SO:0001583	missense	1356	exon16			TTCATTCTCATCA	M13536	CCDS3141.1	3q23-q25	2010-07-01			ENSG00000047457	ENSG00000047457	1.16.3.1		2295	protein-coding gene	gene with protein product		117700					Standard	NM_000096		Approved		uc003ewy.4	P00450	OTTHUMG00000159563	ENST00000264613.6:c.2775G>T	3.37:g.148896305C>A	ENSP00000264613:p.Glu925Asp	Somatic	77	0		WXS	Illumina HiSeq	.	82	4	NM_000096	Q14063|Q2PP18|Q9UKS4	Missense_Mutation	SNP	ENST00000264613.6	37	CCDS3141.1	.	.	.	.	.	.	.	.	.	.	C	19.52	3.842170	0.71488	.	.	ENSG00000047457	ENST00000479771;ENST00000264613;ENST00000494544	D;D;D	0.99869	-7.34;-7.34;-7.34	5.68	2.39	0.29439	Cupredoxin (2);	0.000000	0.85682	D	0.000000	D	0.99869	0.9938	H	0.95043	3.615	0.53005	D	0.999968	D;D;D;D	0.76494	0.999;0.999;0.998;0.999	D;D;D;D	0.91635	0.998;0.998;0.992;0.999	D	0.97698	1.0183	10	0.62326	D	0.03	-31.5658	8.8835	0.35389	0.0:0.6234:0.0:0.3766	.	925;925;925;638	A8K5A4;P00450;Q1L857;B3KTA8	.;CERU_HUMAN;.;.	D	60;925;708	ENSP00000420367:E60D;ENSP00000264613:E925D;ENSP00000420545:E708D	ENSP00000264613:E925D	E	-	3	2	CP	150378995	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.602000	0.36783	0.715000	0.32103	0.650000	0.86243	GAG	.		0.368	CP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317498.1	NM_000096	
CMTR1	23070	hgsc.bcm.edu;bcgsc.ca	37	6	37421057	37421057	+	Missense_Mutation	SNP	G	G	A	rs542833926		TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr6:37421057G>A	ENST00000373451.4	+	8	910	c.746G>A	c.(745-747)cGc>cAc	p.R249H		NM_015050.2	NP_055865.1	Q8N1G2	CMTR1_HUMAN	cap methyltransferase 1	249	RrmJ-type SAM-dependent 2'-O-MTase. {ECO:0000255|PROSITE-ProRule:PRU00945}.				7-methylguanosine mRNA capping (GO:0006370)|cap1 mRNA methylation (GO:0097309)|mRNA methylation (GO:0080009)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA (nucleoside-2'-O-)-methyltransferase activity (GO:0004483)|nucleic acid binding (GO:0003676)										GTATTTGATCGCATGTTCACA	0.428													G|||	1	0.000199681	0.0	0.0	5008	,	,		610	0.0		0.0	False		,,,				2504	0.001				p.R249H		.											.	.	.	0			c.G746A						.						196.0	178.0	184.0					6																	37421057		2203	4300	6503	SO:0001583	missense	23070	exon8			TTGATCGCATGTT	BC031890	CCDS4835.1	6p21.2	2013-07-23	2013-07-23	2013-07-23	ENSG00000137200	ENSG00000137200	2.1.1.57	"""G patch domain containing"""	21077	protein-coding gene	gene with protein product			"""KIAA0082"", ""FtsJ methyltransferase domain containing 2"""	KIAA0082, FTSJD2		20713356	Standard	NM_015050		Approved	MTr1, ISG95	uc003ons.3	Q8N1G2	OTTHUMG00000014624	ENST00000373451.4:c.746G>A	6.37:g.37421057G>A	ENSP00000362550:p.Arg249His	Somatic	63	0		WXS	Illumina HiSeq	.	52	4	NM_015050	A8K949|Q14670|Q96FJ9	Missense_Mutation	SNP	ENST00000373451.4	37	CCDS4835.1	.	.	.	.	.	.	.	.	.	.	G	11.01	1.513151	0.27123	.	.	ENSG00000137200	ENST00000373451	T	0.29142	1.58	5.92	1.08	0.20341	Ribosomal RNA methyltransferase RrmJ/FtsJ (1);	0.650782	0.17782	N	0.162203	T	0.04452	0.0122	N	0.08118	0	0.28605	N	0.908947	B	0.11235	0.004	B	0.12156	0.007	T	0.38972	-0.9636	10	0.38643	T	0.18	-1.4057	5.6788	0.17763	0.4448:0.1336:0.4216:0.0	.	249	Q8N1G2	MTR1_HUMAN	H	249	ENSP00000362550:R249H	ENSP00000362550:R249H	R	+	2	0	FTSJD2	37529035	0.957000	0.32711	0.994000	0.49952	0.994000	0.84299	0.416000	0.21198	-0.080000	0.12685	0.650000	0.86243	CGC	.		0.428	CMTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040408.1	NM_015050	
FANCC	2176	hgsc.bcm.edu	37	9	98011555	98011555	+	Missense_Mutation	SNP	C	C	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr9:98011555C>T	ENST00000289081.3	-	2	273	c.19G>A	c.(19-21)Gat>Aat	p.D7N	FANCC_ENST00000375305.1_Missense_Mutation_p.D7N	NM_000136.2	NP_000127.2	Q00597	FANCC_HUMAN	Fanconi anemia, complementation group C	7					DNA repair (GO:0006281)|germ cell development (GO:0007281)|myeloid cell homeostasis (GO:0002262)|nucleotide-excision repair (GO:0006289)|protein complex assembly (GO:0006461)|removal of superoxide radicals (GO:0019430)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.D7Y(2)		kidney(1)|skin(1)|upper_aerodigestive_tract(1)	3		Acute lymphoblastic leukemia(62;0.138)				CAAGAAAGATCTACTGAATCT	0.458			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.D7N		.	yes	Rec		Fanconi anaemia C	9	9q22.3	2176	"""Fanconi anemia, complementation group C"""		L	FANCC_ENST00000289081,NS,carcinoma,0,1	FANCC_ENST00000289081	0	2	Substitution - Missense(2)	breast(2)	c.G19A						.						82.0	74.0	77.0					9																	98011555		2203	4300	6503	SO:0001583	missense	2176	exon2	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AAAGATCTACTGA	BC006303	CCDS35071.1, CCDS75861.1	9q22.3	2014-09-17			ENSG00000158169	ENSG00000158169		"""Fanconi anemia, complementation groups"""	3584	protein-coding gene	gene with protein product		613899		FACC		1303234	Standard	NM_001243743		Approved	FAC, FA3	uc004avh.3	Q00597	OTTHUMG00000020279	ENST00000289081.3:c.19G>A	9.37:g.98011555C>T	ENSP00000289081:p.Asp7Asn	Somatic	33	0		WXS	Illumina HiSeq	.	34	2	NM_001243743	B1ALR8	Missense_Mutation	SNP	ENST00000289081.3	37	CCDS35071.1	.	.	.	.	.	.	.	.	.	.	C	14.62	2.591108	0.46214	.	.	ENSG00000158169	ENST00000289081;ENST00000375305;ENST00000433829	T;T;T	0.51071	0.72;0.72;0.72	5.13	0.972	0.19704	.	0.686516	0.14218	N	0.333605	T	0.32255	0.0823	L	0.34521	1.04	0.09310	N	1	B;B	0.15141	0.006;0.012	B;B	0.17433	0.018;0.012	T	0.21314	-1.0249	10	0.23891	T	0.37	-0.0894	7.7745	0.29029	0.0:0.4834:0.372:0.1446	.	7;7	B1ALR7;Q00597	.;FANCC_HUMAN	N	7	ENSP00000289081:D7N;ENSP00000364454:D7N;ENSP00000406908:D7N	ENSP00000289081:D7N	D	-	1	0	FANCC	97051376	0.001000	0.12720	0.013000	0.15412	0.971000	0.66376	0.956000	0.29202	0.080000	0.16959	-0.181000	0.13052	GAT	.		0.458	FANCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053219.1	NM_000136	
GTPBP4	23560	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	1052974	1052974	+	Missense_Mutation	SNP	T	T	G			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr10:1052974T>G	ENST00000360803.4	+	10	1101	c.1019T>G	c.(1018-1020)tTg>tGg	p.L340W	GTPBP4_ENST00000491635.1_3'UTR|GTPBP4_ENST00000538293.1_Missense_Mutation_p.L224W|GTPBP4_ENST00000545048.1_Missense_Mutation_p.L293W	NM_012341.2	NP_036473.2	Q9BZE4	NOG1_HUMAN	GTP binding protein 4	340	OBG-type G. {ECO:0000255|PROSITE- ProRule:PRU01047}.				GTP catabolic process (GO:0006184)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of collagen binding (GO:0033342)|negative regulation of DNA replication (GO:0008156)|negative regulation of protein ubiquitination (GO:0031397)|osteoblast differentiation (GO:0001649)|protein stabilization (GO:0050821)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|ribosome biogenesis (GO:0042254)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(1)	21		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.0814)	Epithelial(11;0.0513)|all cancers(11;0.135)|OV - Ovarian serous cystadenocarcinoma(14;0.173)		GATAGGCTTTTGGCTCATCGA	0.483																																					p.L340W		.											.	.	.	0			c.T1019G						.						142.0	115.0	124.0					10																	1052974		2203	4300	6503	SO:0001583	missense	23560	exon10			GGCTTTTGGCTCA	AK001548	CCDS31132.1	10p15-p14	2007-07-27			ENSG00000107937	ENSG00000107937			21535	protein-coding gene	gene with protein product	"""G protein-binding protein CRFG"", "" GTP-binding protein"""					11316846	Standard	NM_012341		Approved	CRFG, NGB, FLJ10690, FLJ10686, NOG1	uc001ift.3	Q9BZE4	OTTHUMG00000017538	ENST00000360803.4:c.1019T>G	10.37:g.1052974T>G	ENSP00000354040:p.Leu340Trp	Somatic	106	0		WXS	Illumina HiSeq	.	77	13	NM_012341	B3KMC5|B4DY13|B7Z7A3|O95446|Q5T3R8|Q9NVJ8	Missense_Mutation	SNP	ENST00000360803.4	37	CCDS31132.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.000515	0.74818	.	.	ENSG00000107937	ENST00000360803;ENST00000538293;ENST00000545048	T;T;T	0.39787	1.06;1.06;1.06	5.47	5.47	0.80525	.	0.065007	0.64402	D	0.000007	T	0.55146	0.1902	M	0.89534	3.04	0.80722	D	1	P	0.52842	0.956	B	0.42995	0.404	T	0.69537	-0.5119	10	0.87932	D	0	-8.4795	15.8823	0.79213	0.0:0.0:0.0:1.0	.	340	Q9BZE4	NOG1_HUMAN	W	340;224;293	ENSP00000354040:L340W;ENSP00000444277:L224W;ENSP00000445473:L293W	ENSP00000354040:L340W	L	+	2	0	GTPBP4	1042974	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.641000	0.83368	2.206000	0.71126	0.529000	0.55759	TTG	.		0.483	GTPBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046412.1	NM_012341	
DAZL	1618	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	16633636	16633636	+	Missense_Mutation	SNP	A	A	G			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr3:16633636A>G	ENST00000399444.2	-	10	1048	c.755T>C	c.(754-756)aTa>aCa	p.I252T	DAZL_ENST00000250863.8_Missense_Mutation_p.I272T	NM_001351.3	NP_001342.2	Q92904	DAZL_HUMAN	deleted in azoospermia-like	252					female meiosis II (GO:0007147)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|oocyte maturation (GO:0001556)|positive regulation of meiosis (GO:0045836)|positive regulation of translational initiation (GO:0045948)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|polysome (GO:0005844)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|translation activator activity (GO:0008494)		RAF1/DAZL(2)	endometrium(1)|large_intestine(3)|lung(4)|prostate(3)	11						CACCGTTTGTATGCTTCGGTC	0.363																																					p.I272T		.											.	.	.	0			c.T815C						.						240.0	243.0	242.0					3																	16633636		2203	4300	6503	SO:0001583	missense	1618	exon10			GTTTGTATGCTTC	BC027595	CCDS43059.1, CCDS54556.1	3p24	2013-02-12			ENSG00000092345	ENSG00000092345		"""RNA binding motif (RRM) containing"""	2685	protein-coding gene	gene with protein product		601486		DAZLA		8896558	Standard	NM_001351		Approved	DAZH, SPGYLA, MGC26406, DAZL1	uc003cbb.3	Q92904	OTTHUMG00000157050	ENST00000399444.2:c.755T>C	3.37:g.16633636A>G	ENSP00000382373:p.Ile252Thr	Somatic	601	0		WXS	Illumina HiSeq	.	360	16	NM_001190811	O15396|Q5HYB4|Q92909	Missense_Mutation	SNP	ENST00000399444.2	37	CCDS43059.1	.	.	.	.	.	.	.	.	.	.	A	12.00	1.807733	0.31961	.	.	ENSG00000092345	ENST00000250863;ENST00000399444	T;T	0.26957	1.7;1.71	5.19	5.19	0.71726	.	0.519794	0.21498	N	0.073571	T	0.25005	0.0607	L	0.54323	1.7	0.34595	D	0.715913	B;B	0.24258	0.1;0.1	B;B	0.18263	0.012;0.021	T	0.25363	-1.0134	10	0.24483	T	0.36	-3.8534	13.2774	0.60194	1.0:0.0:0.0:0.0	.	252;272	Q92904;Q5HYB4	DAZL_HUMAN;.	T	272;252	ENSP00000250863:I272T;ENSP00000382373:I252T	ENSP00000250863:I272T	I	-	2	0	DAZL	16608640	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	5.615000	0.67702	1.956000	0.56807	0.459000	0.35465	ATA	.		0.363	DAZL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347261.2	NM_001351	
ZDHHC4	55146	hgsc.bcm.edu	37	7	6621822	6621822	+	Missense_Mutation	SNP	C	C	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr7:6621822C>T	ENST00000396706.2	+	5	753	c.310C>T	c.(310-312)Ccc>Tcc	p.P104S	ZDHHC4_ENST00000335965.6_Missense_Mutation_p.P104S|ZDHHC4_ENST00000396709.1_Missense_Mutation_p.P104S|ZDHHC4_ENST00000405731.3_Missense_Mutation_p.P104S|ZDHHC4_ENST00000396713.2_Missense_Mutation_p.P104S|AC079742.4_ENST00000434951.1_RNA|ZDHHC4_ENST00000396707.2_Missense_Mutation_p.P104S			Q9NPG8	ZDHC4_HUMAN	zinc finger, DHHC-type containing 4	104			P -> S (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.			Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.P104S(2)		breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.1)		CCTTCTTCTGCCCTATCTGCT	0.483																																					p.P104S		.											ZDHHC4,caecum,carcinoma,-1,2	ZDHHC4	-1	2	Substitution - Missense(2)	breast(2)	c.C310T						.						315.0	276.0	289.0					7																	6621822		2203	4300	6503	SO:0001583	missense	55146	exon5			CTTCTGCCCTATC	AF201931	CCDS5352.1	7p22.1	2011-01-11			ENSG00000136247	ENSG00000136247		"""Zinc fingers, DHHC-type"""	18471	protein-coding gene	gene with protein product							Standard	NM_018106		Approved	FLJ10479, ZNF374	uc003sqj.3	Q9NPG8	OTTHUMG00000023579	ENST00000396706.2:c.310C>T	7.37:g.6621822C>T	ENSP00000379934:p.Pro104Ser	Somatic	97	0		WXS	Illumina HiSeq	.	48	2	NM_018106	A4D2N9|Q53EV7|Q6FIB5|Q9H0R9	Missense_Mutation	SNP	ENST00000396706.2	37	CCDS5352.1	.	.	.	.	.	.	.	.	.	.	c	22.2	4.257481	0.80246	.	.	ENSG00000136247	ENST00000405731;ENST00000396713;ENST00000396707;ENST00000335965;ENST00000396709;ENST00000483589;ENST00000396706	T;T;T;T;T;T;T	0.35605	1.3;1.3;1.3;1.3;1.3;1.38;1.3	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.61123	0.2322	M	0.80746	2.51	0.80722	D	1	D;D	0.89917	0.959;1.0	P;D	0.97110	0.631;1.0	T	0.57087	-0.7871	10	0.23302	T	0.38	-23.1876	16.7439	0.85467	0.0:1.0:0.0:0.0	.	104;104	Q9NPG8;C9J5I9	ZDHC4_HUMAN;.	S	104	ENSP00000385027:P104S;ENSP00000379941:P104S;ENSP00000379935:P104S;ENSP00000337475:P104S;ENSP00000379937:P104S;ENSP00000418496:P104S;ENSP00000379934:P104S	ENSP00000337475:P104S	P	+	1	0	ZDHHC4	6588347	1.000000	0.71417	1.000000	0.80357	0.769000	0.43574	7.168000	0.77570	2.728000	0.93425	0.655000	0.94253	CCC	.		0.483	ZDHHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207477.3	NM_018106	
FBXL13	222235	hgsc.bcm.edu	37	7	102518847	102518847	+	Missense_Mutation	SNP	C	C	A			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr7:102518847C>A	ENST00000313221.4	-	15	1865	c.1439G>T	c.(1438-1440)aGg>aTg	p.R480M	FBXL13_ENST00000436908.1_Missense_Mutation_p.R480M|FBXL13_ENST00000379306.3_Intron|FBXL13_ENST00000379308.3_Missense_Mutation_p.R480M|FBXL13_ENST00000393772.2_Missense_Mutation_p.R480M|FBXL13_ENST00000379305.3_Missense_Mutation_p.R480M|FBXL13_ENST00000456695.1_Intron|FBXL13_ENST00000455112.2_Missense_Mutation_p.R480M	NM_145032.3	NP_659469.3	Q8NEE6	FXL13_HUMAN	F-box and leucine-rich repeat protein 13	480										NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|skin(3)|stomach(1)	27						CTCTCTTATCCTCATGCTTGC	0.348																																					p.R480M		.											.	.	.	0			c.G1439T						.						125.0	112.0	117.0					7																	102518847		2203	4300	6503	SO:0001583	missense	222235	exon15			CTTATCCTCATGC	BC031285	CCDS5726.1, CCDS47678.1, CCDS75649.1	7q22.1	2014-07-18			ENSG00000161040	ENSG00000161040		"""F-boxes / Leucine-rich repeats"""	21658	protein-coding gene	gene with protein product		609080					Standard	NM_145032		Approved	MGC21636, Fbl13	uc003vaq.2	Q8NEE6	OTTHUMG00000157224	ENST00000313221.4:c.1439G>T	7.37:g.102518847C>A	ENSP00000321927:p.Arg480Met	Somatic	73	0		WXS	Illumina HiSeq	.	71	4	NM_001111038	C9J565|C9J566|Q6UVW7|Q6UVW8|Q75MN5|Q86UJ5|Q8N7Y4|Q8TCL2|Q8WUF9|Q8WUG0	Missense_Mutation	SNP	ENST00000313221.4	37	CCDS5726.1	.	.	.	.	.	.	.	.	.	.	c	15.01	2.707293	0.48412	.	.	ENSG00000161040	ENST00000393772;ENST00000379308;ENST00000349747;ENST00000379305;ENST00000436908;ENST00000313221;ENST00000455112	T;T;T;T;T;T	0.12255	2.7;4.01;2.7;4.01;4.01;4.01	5.38	-7.86	0.01187	.	0.533626	0.18434	N	0.141351	T	0.29223	0.0727	M	0.85197	2.74	0.22500	N	0.999049	D;P;B	0.54047	0.964;0.917;0.335	P;P;B	0.55161	0.77;0.668;0.264	T	0.43782	-0.9370	10	0.87932	D	0	.	17.1899	0.86876	0.0:0.1916:0.0:0.8084	.	480;480;480	Q8NEE6-3;Q8NEE6-2;Q8NEE6	.;.;FXL13_HUMAN	M	480;480;201;480;480;480;480	ENSP00000377367:R480M;ENSP00000368610:R480M;ENSP00000368607:R480M;ENSP00000388608:R480M;ENSP00000321927:R480M;ENSP00000391550:R480M	ENSP00000321927:R480M	R	-	2	0	FBXL13	102306083	0.011000	0.17503	0.000000	0.03702	0.738000	0.42128	-0.677000	0.05215	-1.935000	0.01049	-1.650000	0.00758	AGG	.		0.348	FBXL13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348001.1	NM_145032	
TMPRSS6	164656	hgsc.bcm.edu	37	22	37494529	37494529	+	Missense_Mutation	SNP	C	C	T	rs371788844		TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr22:37494529C>T	ENST00000346753.3	-	3	406	c.290G>A	c.(289-291)cGc>cAc	p.R97H	TMPRSS6_ENST00000406725.1_Missense_Mutation_p.R88H|TMPRSS6_ENST00000406856.1_Missense_Mutation_p.R88H|TMPRSS6_ENST00000381792.2_Missense_Mutation_p.R88H|TMPRSS6_ENST00000442782.2_Missense_Mutation_p.R97H	NM_153609.2	NP_705837.1	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	97	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				angiogenesis (GO:0001525)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|intracellular signal transduction (GO:0035556)|iron ion homeostasis (GO:0055072)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			breast(5)|central_nervous_system(4)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)	40						GGAGAAGTGGCGATTGAGTAC	0.577																																					p.R97H		.											TMPRSS6,NS,carcinoma,0,1	TMPRSS6	0	0			c.G290A						.	C	HIS/ARG	0,4406	2.1+/-5.4	0,0,2203	307.0	292.0	297.0		290	4.0	1.0	22		297	1,8599	1.2+/-3.3	0,1,4299	no	missense	TMPRSS6	NM_153609.2	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	97/812	37494529	1,13005	2203	4300	6503	SO:0001583	missense	164656	exon3			AAGTGGCGATTGA	AY055383	CCDS13941.1, CCDS74856.1, CCDS74857.1	22q13.1	2010-04-13			ENSG00000187045	ENSG00000187045		"""Serine peptidases / Transmembrane"""	16517	protein-coding gene	gene with protein product		609862					Standard	NM_001289000		Approved	FLJ30744	uc003aqs.1	Q8IU80	OTTHUMG00000150541	ENST00000346753.3:c.290G>A	22.37:g.37494529C>T	ENSP00000334962:p.Arg97His	Somatic	85	0		WXS	Illumina HiSeq	.	53	3	NM_153609	B0QYB4|B0QYB7|B0QYB8|Q5TI06|Q6ICC2|Q6UXD8|Q8IUE2|Q8IXV8	Missense_Mutation	SNP	ENST00000346753.3	37	CCDS13941.1	.	.	.	.	.	.	.	.	.	.	C	18.77	3.693834	0.68386	0.0	1.16E-4	ENSG00000187045	ENST00000381792;ENST00000346753;ENST00000406725;ENST00000406856;ENST00000442782;ENST00000423761	T;T;T;T;T;T	0.38887	1.11;1.11;1.11;1.11;1.11;1.11	4.97	3.95	0.45737	SEA (1);	0.127879	0.49916	N	0.000121	T	0.33789	0.0875	N	0.17082	0.46	0.41091	D	0.985598	D;D;D	0.67145	0.996;0.987;0.99	P;P;P	0.50537	0.643;0.495;0.628	T	0.07539	-1.0767	10	0.34782	T	0.22	.	11.0532	0.47903	0.0:0.912:0.0:0.088	.	97;88;97	Q8IU80-2;Q8IU80-5;Q8IU80	.;.;TMPS6_HUMAN	H	88;97;88;88;97;88	ENSP00000371211:R88H;ENSP00000334962:R97H;ENSP00000385453:R88H;ENSP00000384964:R88H;ENSP00000397691:R97H;ENSP00000400317:R88H	ENSP00000334962:R97H	R	-	2	0	TMPRSS6	35824475	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	2.474000	0.45154	1.079000	0.41038	0.561000	0.74099	CGC	.		0.577	TMPRSS6-003	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000318822.1	NM_153609	
MAP4K4	9448	hgsc.bcm.edu;bcgsc.ca	37	2	102480371	102480371	+	Intron	SNP	C	C	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr2:102480371C>T	ENST00000347699.4	+	17	1866				MAP4K4_ENST00000350198.4_Intron|MAP4K4_ENST00000324219.4_Missense_Mutation_p.A652V|MAP4K4_ENST00000302217.5_Intron|MAP4K4_ENST00000413150.2_Intron|MAP4K4_ENST00000425019.1_Intron|MAP4K4_ENST00000456652.1_Intron|MAP4K4_ENST00000350878.4_Missense_Mutation_p.A547V	NM_001242559.1|NM_145687.3	NP_001229488.1|NP_663720.1	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase kinase 4						intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of JNK cascade (GO:0046328)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						CCCAAATTTGCACACCACCAT	0.527																																					p.A567V		.											.	.	.	0			c.C1700T						.						304.0	296.0	298.0					2																	102480371		2027	4177	6204	SO:0001627	intron_variant	9448	exon16			AATTTGCACACCA	AF096300	CCDS56130.1, CCDS74546.1	2q11.2-q12	2011-06-09			ENSG00000071054	ENSG00000071054		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6866	protein-coding gene	gene with protein product	"""HPK/GCK-like kinase"", ""hepatocyte progenitor kinase-like/germinal center kinase-like kinase"""	604666				9890973, 9734811, 9135144	Standard	NM_004834		Approved	HGK, NIK, FLH21957	uc002tbf.3	O95819	OTTHUMG00000155394	ENST00000347699.4:c.1867-1021C>T	2.37:g.102480371C>T		Somatic	64	0		WXS	Illumina HiSeq	.	57	4	NM_001242560	O75172|Q9NST7	Missense_Mutation	SNP	ENST00000347699.4	37	CCDS56130.1	.	.	.	.	.	.	.	.	.	.	C	17.49	3.403053	0.62288	.	.	ENSG00000071054	ENST00000324219;ENST00000350878;ENST00000418101	T;T;T	0.50548	0.74;0.74;0.74	5.98	5.98	0.97165	.	0.133325	0.51477	D	0.000093	T	0.57548	0.2061	L	0.27053	0.805	0.58432	D	0.999992	D;D;P	0.69078	0.997;0.993;0.702	D;D;B	0.70716	0.97;0.956;0.234	T	0.49303	-0.8954	10	0.27082	T	0.32	.	20.4581	0.99154	0.0:1.0:0.0:0.0	.	547;567;652	B7Z388;B7Z3V5;G5E948	.;.;.	V	652;547;187	ENSP00000313644:A652V;ENSP00000343658:A547V;ENSP00000414766:A187V	ENSP00000313644:A652V	A	+	2	0	MAP4K4	101846803	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.040000	0.76551	2.835000	0.97688	0.650000	0.86243	GCA	.		0.527	MAP4K4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339839.1	NM_004834	
PROS1	5627	hgsc.bcm.edu	37	3	93605209	93605209	+	Silent	SNP	G	G	T	rs370129669		TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr3:93605209G>T	ENST00000394236.3	-	11	1610	c.1294C>A	c.(1294-1296)Cgg>Agg	p.R432R	PROS1_ENST00000407433.1_Silent_p.R301R	NM_000313.3	NP_000304.2	P07225	PROS_HUMAN	protein S (alpha)	432	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|negative regulation of endopeptidase activity (GO:0010951)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|endopeptidase inhibitor activity (GO:0004866)	p.R432W(1)|p.R432L(1)		endometrium(3)|kidney(5)|large_intestine(8)|lung(26)|ovary(1)|skin(2)|urinary_tract(1)	46					Drotrecogin alfa(DB00055)|Menadione(DB00170)|Sodium Tetradecyl Sulfate(DB00464)	TCCACTTTCCGAGGGAATCCT	0.378																																					p.R432R		.											PROS1,bladder,carcinoma,0,1	PROS1	0	2	Substitution - Missense(2)	urinary_tract(1)|lung(1)	c.C1294A						.						118.0	126.0	123.0					3																	93605209		2203	4300	6503	SO:0001819	synonymous_variant	5627	exon11			CTTTCCGAGGGAA		CCDS2923.1	3q11.1	2013-06-03			ENSG00000184500	ENSG00000184500			9456	protein-coding gene	gene with protein product		176880		PROS		214811, 1833851	Standard	NM_000313		Approved		uc003drb.4	P07225	OTTHUMG00000150354	ENST00000394236.3:c.1294C>A	3.37:g.93605209G>T		Somatic	119	0		WXS	Illumina HiSeq	.	73	3	NM_000313	A8KAC9|D3DN28|Q15518|Q7Z715|Q9UCZ8	Silent	SNP	ENST00000394236.3	37	CCDS2923.1																																																																																			.		0.378	PROS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317762.1	NM_000313	
C16orf71	146562	hgsc.bcm.edu;broad.mit.edu	37	16	4796983	4796983	+	Silent	SNP	C	C	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr16:4796983C>T	ENST00000299320.5	+	8	1715	c.1237C>T	c.(1237-1239)Ctg>Ttg	p.L413L	C16orf71_ENST00000590191.1_Silent_p.L430L|RP11-127I20.7_ENST00000588099.1_RNA	NM_139170.2	NP_631909.2	Q8IYS4	CP071_HUMAN	chromosome 16 open reading frame 71	413										breast(1)|central_nervous_system(1)|large_intestine(4)|lung(4)|ovary(1)	11						GATGGCAGCTCTGGGAGACGC	0.622																																					p.L413L		.											.	.	.	0			c.C1237T						.						29.0	28.0	28.0					16																	4796983		2194	4299	6493	SO:0001819	synonymous_variant	146562	exon8			GCAGCTCTGGGAG	AF447587	CCDS10521.1	16p13.3	2008-02-05			ENSG00000166246	ENSG00000166246			25081	protein-coding gene	gene with protein product						12477932	Standard	XM_005255144		Approved	FLJ43261, DKFZp686H2240	uc002cxn.3	Q8IYS4	OTTHUMG00000129480	ENST00000299320.5:c.1237C>T	16.37:g.4796983C>T		Somatic	74	0		WXS	Illumina HiSeq	.	47	4	NM_139170	Q8NCV0	Silent	SNP	ENST00000299320.5	37	CCDS10521.1																																																																																			.		0.622	C16orf71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251644.1	NM_139170	
PRSS12	8492	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	119259352	119259352	+	Missense_Mutation	SNP	A	A	G			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr4:119259352A>G	ENST00000296498.3	-	2	902	c.620T>C	c.(619-621)aTt>aCt	p.I207T		NM_003619.3	NP_003610.2	P56730	NETR_HUMAN	protease, serine, 12 (neurotrypsin, motopsin)	207	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.				exocytosis (GO:0006887)|zymogen activation (GO:0031638)	axon (GO:0030424)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)|terminal bouton (GO:0043195)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(3)|kidney(1)|large_intestine(9)|lung(11)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	29						CTGGTGACAAATGACTGATGC	0.488																																					p.I207T		.											.	.	.	0			c.T620C						.						112.0	100.0	104.0					4																	119259352		2203	4300	6503	SO:0001583	missense	8492	exon2			TGACAAATGACTG	AJ001531	CCDS3709.1	4q25-q26	2010-05-07			ENSG00000164099	ENSG00000164099		"""Serine peptidases / Serine peptidases"""	9477	protein-coding gene	gene with protein product		606709				9540828, 9245503	Standard	NM_003619		Approved	BSSP-3, MRT1	uc003ica.2	P56730	OTTHUMG00000161166	ENST00000296498.3:c.620T>C	4.37:g.119259352A>G	ENSP00000296498:p.Ile207Thr	Somatic	33	0		WXS	Illumina HiSeq	.	21	8	NM_003619	Q9UP16	Missense_Mutation	SNP	ENST00000296498.3	37	CCDS3709.1	.	.	.	.	.	.	.	.	.	.	A	17.73	3.462400	0.63513	.	.	ENSG00000164099	ENST00000296498	T	0.31247	1.5	5.57	0.0311	0.14169	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.759418	0.13196	N	0.406345	T	0.24044	0.0582	L	0.59436	1.845	0.09310	N	1	P	0.36354	0.549	B	0.31946	0.138	T	0.11299	-1.0593	10	0.54805	T	0.06	.	5.6362	0.17538	0.5928:0.2723:0.1349:0.0	.	207	P56730	NETR_HUMAN	T	207	ENSP00000296498:I207T	ENSP00000296498:I207T	I	-	2	0	PRSS12	119478800	0.401000	0.25303	0.011000	0.14972	0.941000	0.58515	2.441000	0.44864	-0.188000	0.10499	-0.462000	0.05337	ATT	.		0.488	PRSS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256516.2		
ITGA8	8516	hgsc.bcm.edu	37	10	15649776	15649776	+	Missense_Mutation	SNP	C	C	T	rs140395954		TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr10:15649776C>T	ENST00000378076.3	-	17	2017	c.1664G>A	c.(1663-1665)cGg>cAg	p.R555Q		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	555					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)	p.R555Q(1)		NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						GAAGAGCGTCCGTTTAATAGC	0.433																																					p.R555Q		.											ITGA8,rectum,carcinoma,0,1	ITGA8	0	1	Substitution - Missense(1)	large_intestine(1)	c.G1664A						.	C	GLN/ARG	0,4406		0,0,2203	141.0	135.0	137.0		1664	5.8	0.3	10	dbSNP_134	137	1,8599		0,1,4299	no	missense	ITGA8	NM_003638.1	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	555/1064	15649776	1,13005	2203	4300	6503	SO:0001583	missense	8516	exon17			AGCGTCCGTTTAA	L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.1664G>A	10.37:g.15649776C>T	ENSP00000367316:p.Arg555Gln	Somatic	43	0		WXS	Illumina HiSeq	.	39	2	NM_003638	B0YJ31|Q5VX94	Missense_Mutation	SNP	ENST00000378076.3	37	CCDS31155.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.978062	0.74360	0.0	1.16E-4	ENSG00000077943	ENST00000378076;ENST00000538044	T	0.79940	-1.32	5.84	5.84	0.93424	Integrin alpha-2 (1);	0.000000	0.85682	D	0.000000	D	0.91905	0.7437	M	0.88704	2.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.92533	0.6035	10	0.87932	D	0	.	20.1336	0.98010	0.0:1.0:0.0:0.0	.	540;555	F5H818;P53708	.;ITA8_HUMAN	Q	555;540	ENSP00000367316:R555Q	ENSP00000367316:R555Q	R	-	2	0	ITGA8	15689782	1.000000	0.71417	0.257000	0.24404	0.121000	0.20230	6.043000	0.71004	2.767000	0.95098	0.591000	0.81541	CGG	0.000		0.433	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046987.1	NM_003638	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu	37	19	9090831	9090831	+	Silent	SNP	A	A	G			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr19:9090831A>G	ENST00000397910.4	-	1	1187	c.984T>C	c.(982-984)ccT>ccC	p.P328P		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	328	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TCATGGAAAAAGGGATAGCTG	0.522																																					p.P328P		.											MUC16_ENST00000397910,bladder,carcinoma,0,2	MUC16_ENST00000397910	0	0			c.T984C						.						96.0	95.0	96.0					19																	9090831		2041	4195	6236	SO:0001819	synonymous_variant	94025	exon1			GGAAAAAGGGATA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.984T>C	19.37:g.9090831A>G		Somatic	30	0		WXS	Illumina HiSeq	.	27	3	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																			.		0.522	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
PSIP1	11168	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	15468838	15468838	+	Silent	SNP	G	G	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr9:15468838G>T	ENST00000380733.4	-	14	1553	c.1210C>A	c.(1210-1212)Cgg>Agg	p.R404R	PSIP1_ENST00000380738.4_Silent_p.R404R			O75475	PSIP1_HUMAN	PC4 and SFRS1 interacting protein 1	404					establishment of integrated proviral latency (GO:0075713)|mRNA 5'-splice site recognition (GO:0000395)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to heat (GO:0009408)|response to oxidative stress (GO:0006979)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear heterochromatin (GO:0005720)|nuclear periphery (GO:0034399)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription coactivator activity (GO:0001105)|supercoiled DNA binding (GO:0097100)			breast(2)|endometrium(2)|kidney(1)|lung(3)|prostate(1)	9				GBM - Glioblastoma multiforme(50;2.38e-06)		TTGAATCGCCGTATCTGAGAA	0.303																																					p.R404R		.											PSIP1_ENST00000380733,NS,carcinoma,+1,2	PSIP1_ENST00000380733	+1	0			c.C1210A						.						71.0	69.0	70.0					9																	15468838		2203	4300	6503	SO:0001819	synonymous_variant	11168	exon14			ATCGCCGTATCTG	AF098482	CCDS6479.1, CCDS6480.1	9p22.2	2008-02-05	2004-02-24		ENSG00000164985	ENSG00000164985			9527	protein-coding gene	gene with protein product		603620	"""PC4 and SFRS1 interacting protein 2"""	PSIP2		9822615, 9885563	Standard	NM_033222		Approved	p52, LEDGF, p75	uc003zlw.4	O75475	OTTHUMG00000021021	ENST00000380733.4:c.1210C>A	9.37:g.15468838G>T		Somatic	36	0		WXS	Illumina HiSeq	.	21	7	NM_001128217	D3DRI9|O00256|O95368|Q6P391|Q86YB9|Q9NZI3|Q9UER6	Silent	SNP	ENST00000380733.4	37	CCDS6479.1																																																																																			.		0.303	PSIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055445.1	NM_033222	
QSER1	79832	hgsc.bcm.edu	37	11	32956871	32956871	+	Missense_Mutation	SNP	C	C	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr11:32956871C>T	ENST00000399302.2	+	4	4015	c.3680C>T	c.(3679-3681)tCt>tTt	p.S1227F	QSER1_ENST00000527788.1_Missense_Mutation_p.S988F	NM_001076786.1	NP_001070254.1	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	1227								p.S1227C(1)		breast(5)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	48	Breast(20;0.158)					GAACATTTATCTTCATTTTCT	0.363																																					p.S1227F		.											QSER1,bladder,carcinoma,0,1	QSER1	0	1	Substitution - Missense(1)	urinary_tract(1)	c.C3680T						.						143.0	144.0	144.0					11																	32956871		1827	4079	5906	SO:0001583	missense	79832	exon4			ATTTATCTTCATT	AL834141	CCDS41631.1	11p13	2014-02-12			ENSG00000060749	ENSG00000060749			26154	protein-coding gene	gene with protein product							Standard	XM_006718323		Approved	FLJ21924	uc001mty.3	Q2KHR3		ENST00000399302.2:c.3680C>T	11.37:g.32956871C>T	ENSP00000382241:p.Ser1227Phe	Somatic	93	0		WXS	Illumina HiSeq	.	46	2	NM_001076786	Q6ZU30|Q6ZUR5	Missense_Mutation	SNP	ENST00000399302.2	37	CCDS41631.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.87|14.87	2.663729|2.663729	0.47572|0.47572	.|.	.|.	ENSG00000060749|ENSG00000060749	ENST00000524678|ENST00000399302;ENST00000078652;ENST00000527788	.|T;T	.|0.24723	.|2.17;1.84	5.31|5.31	5.31|5.31	0.75309|0.75309	.|.	.|0.082750	.|0.51477	.|D	.|0.000095	T|T	0.44912|0.44912	0.1316|0.1316	L|L	0.47716|0.47716	1.5|1.5	0.44380|0.44380	D|D	0.997282|0.997282	.|D;D;D	.|0.69078	.|0.986;0.997;0.976	.|P;D;P	.|0.63597	.|0.742;0.916;0.556	T|T	0.38308|0.38308	-0.9667|-0.9667	5|10	.|0.87932	.|D	.|0	.|.	18.9689|18.9689	0.92707|0.92707	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|988;988;1227	.|C9JJ88;Q2KHR3-2;Q2KHR3	.|.;.;QSER1_HUMAN	F|F	248|1227;988;988	.|ENSP00000382241:S1227F;ENSP00000432766:S988F	.|ENSP00000078652:S988F	L|S	+|+	1|2	0|0	QSER1|QSER1	32913447|32913447	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.362000|0.362000	0.29581|0.29581	7.487000|7.487000	0.81328|0.81328	2.494000|2.494000	0.84150|0.84150	0.467000|0.467000	0.42956|0.42956	CTT|TCT	.		0.363	QSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388448.1	NM_024774	
SLC25A46	91137	hgsc.bcm.edu	37	5	110096916	110096916	+	Silent	SNP	C	C	A			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr5:110096916C>A	ENST00000355943.3	+	8	817	c.691C>A	c.(691-693)Cga>Aga	p.R231R	SLC25A46_ENST00000509432.1_Silent_p.R18R|SLC25A46_ENST00000509442.2_Silent_p.R140R|SLC25A46_ENST00000513706.1_3'UTR|SLC25A46_ENST00000447245.2_Intron|SLC25A46_ENST00000504098.1_Silent_p.R85R|SLC25A46_ENST00000513807.1_Silent_p.R69R	NM_138773.1	NP_620128.1	Q96AG3	S2546_HUMAN	solute carrier family 25, member 46	231					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	10		all_cancers(142;0.00203)|all_epithelial(76;4.52e-05)|Prostate(80;0.0115)|Colorectal(57;0.0676)|Ovarian(225;0.156)		OV - Ovarian serous cystadenocarcinoma(64;2.58e-09)|Epithelial(69;7.29e-08)|all cancers(49;9.35e-06)|COAD - Colon adenocarcinoma(37;0.211)		TGAGATAATTCGAGATAATAC	0.353																																					p.R231R		.											SLC25A46,colon,carcinoma,0,3	SLC25A46	0	0			c.C691A						.						106.0	109.0	108.0					5																	110096916		2202	4299	6501	SO:0001819	synonymous_variant	91137	exon8			ATAATTCGAGATA	BC017169	CCDS4100.1	5q22.1	2013-05-22			ENSG00000164209	ENSG00000164209		"""Solute carriers"""	25198	protein-coding gene	gene with protein product		610826				1651562, 1651563, 16949250	Standard	NM_138773		Approved		uc003koz.3	Q96AG3	OTTHUMG00000128794	ENST00000355943.3:c.691C>A	5.37:g.110096916C>A		Somatic	63	0		WXS	Illumina HiSeq	.	42	2	NM_138773	A8K2F2|B3KRE6|B4DTA3|D3DSZ6|D6R9W7|Q04197	Silent	SNP	ENST00000355943.3	37	CCDS4100.1																																																																																			.		0.353	SLC25A46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250721.5	NM_138773	
ATP6V0D2	245972	hgsc.bcm.edu	37	8	87162459	87162459	+	Missense_Mutation	SNP	G	G	T	rs549611957		TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr8:87162459G>T	ENST00000285393.3	+	6	900	c.758G>T	c.(757-759)cGg>cTg	p.R253L	CTD-3118D11.2_ENST00000522679.1_RNA	NM_152565.1	NP_689778.1	Q8N8Y2	VA0D2_HUMAN	ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d2	253					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	hydrogen ion transmembrane transporter activity (GO:0015078)			breast(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(9)|prostate(1)	27						GAGGGGTTGCGGCTGTTGGCT	0.468																																					p.R253L		.											ATP6V0D2,NS,carcinoma,0,1	ATP6V0D2	0	0			c.G758T						.						112.0	101.0	104.0					8																	87162459		2203	4300	6503	SO:0001583	missense	245972	exon6			GGTTGCGGCTGTT	AY079172	CCDS6241.1	8q21.3	2014-01-28	2006-01-20	2002-05-24	ENSG00000147614	ENSG00000147614		"""ATPases / V-type"""	18266	protein-coding gene	gene with protein product			"""ATPase, H+ transporting, lysosomal 38kD, V0 subunit d isoform 2"", ""ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 2"", ""ATPase, H+ transporting, lysosomal 38kDa, V0 subunit D2"""			12384298	Standard	NM_152565		Approved	FLJ38708, VMA6, ATP6D2	uc003ydp.1	Q8N8Y2	OTTHUMG00000163637	ENST00000285393.3:c.758G>T	8.37:g.87162459G>T	ENSP00000285393:p.Arg253Leu	Somatic	86	0		WXS	Illumina HiSeq	.	50	2	NM_152565		Missense_Mutation	SNP	ENST00000285393.3	37	CCDS6241.1	.	.	.	.	.	.	.	.	.	.	G	7.484	0.649310	0.14516	.	.	ENSG00000147614	ENST00000285393	T	0.30714	1.52	6.17	3.47	0.39725	.	0.168298	0.52532	D	0.000061	T	0.14960	0.0361	N	0.11313	0.125	0.40792	D	0.983261	B	0.28760	0.221	B	0.29785	0.107	T	0.09684	-1.0663	10	0.13853	T	0.58	-21.6581	9.4632	0.38798	0.2932:0.0:0.7068:0.0	.	253	Q8N8Y2	VA0D2_HUMAN	L	253	ENSP00000285393:R253L	ENSP00000285393:R253L	R	+	2	0	ATP6V0D2	87231575	0.040000	0.19996	0.839000	0.33178	0.375000	0.29983	1.078000	0.30754	0.508000	0.28173	-0.119000	0.15052	CGG	.		0.468	ATP6V0D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374651.1	NM_152565	
LOC105372257	105372257	hgsc.bcm.edu	37	19	6957050	6957050	+	RNA	SNP	C	C	A			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr19:6957050C>A	ENST00000593558.1	+	0	1030				EMR4P_ENST00000600751.1_RNA																							AATAATTAGCCTTACCTGGCG	0.408																																					.		.											.	.	.	0			.						.																																					326342	.			ATTAGCCTTACCT																													19.37:g.6957050C>A		Somatic	116	0		WXS	Illumina HiSeq	.	91	4	.		RNA	SNP	ENST00000593558.1	37																																																																																				.		0.408	RP11-1137G4.3-001	KNOWN	basic	antisense	antisense	OTTHUMT00000458493.1		
AMY2A	279	hgsc.bcm.edu;broad.mit.edu	37	1	104160125	104160125	+	Silent	SNP	A	A	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr1:104160125A>T	ENST00000414303.2	+	1	127	c.63A>T	c.(61-63)acA>acT	p.T21T		NM_000699.2	NP_000690.1	P04746	AMYP_HUMAN	amylase, alpha 2A (pancreatic)	21					carbohydrate catabolic process (GO:0016052)|carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|calcium ion binding (GO:0005509)|chloride ion binding (GO:0031404)			endometrium(3)|kidney(1)|large_intestine(5)|liver(3)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0654)|all cancers(265;0.0808)|Epithelial(280;0.0921)|Lung(183;0.111)	Acarbose(DB00284)|Icodextrin(DB00702)|Miglitol(DB00491)	CCCCAAATACACAACAAGGAC	0.428																																					p.T21T		.											.	.	.	0			c.A63T						.						113.0	94.0	100.0					1																	104160125		2200	4258	6458	SO:0001819	synonymous_variant	279	exon1			AAATACACAACAA	BC007060	CCDS783.1	1p21.1	2012-10-02	2007-05-03		ENSG00000243480	ENSG00000243480	3.2.1.1		477	protein-coding gene	gene with protein product		104650	"""amylase, alpha 2A; pancreatic"""	AMY2		3260028	Standard	NM_000699		Approved		uc001dut.3	P04746	OTTHUMG00000011023	ENST00000414303.2:c.63A>T	1.37:g.104160125A>T		Somatic	325	0		WXS	Illumina HiSeq	.	252	12	NM_000699	B9EJG1|Q9UBH3	Silent	SNP	ENST00000414303.2	37	CCDS783.1	.	.	.	.	.	.	.	.	.	.	a	0.134	-1.109688	0.01813	.	.	ENSG00000243480	ENST00000423678	.	.	.	3.22	-2.49	0.06403	.	0.203291	0.49916	D	0.000121	T	0.07593	0.0191	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.35624	-0.9781	6	0.22109	T	0.4	.	4.8441	0.13505	0.1602:0.5151:0.0:0.3247	.	.	.	.	S	20	.	ENSP00000390832:T20S	T	+	1	0	AMY2A	103961648	0.000000	0.05858	0.000000	0.03702	0.136000	0.21042	-1.357000	0.02607	-0.369000	0.08028	-0.714000	0.03626	ACA	.		0.428	AMY2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030315.1	NM_000699	
SEMA6D	80031	hgsc.bcm.edu	37	15	48055275	48055275	+	Missense_Mutation	SNP	G	G	A			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr15:48055275G>A	ENST00000316364.5	+	9	1160	c.721G>A	c.(721-723)Gct>Act	p.A241T	SEMA6D_ENST00000558816.1_Missense_Mutation_p.A241T|SEMA6D_ENST00000389425.3_Missense_Mutation_p.A241T|SEMA6D_ENST00000558014.1_Missense_Mutation_p.A241T|SEMA6D_ENST00000389433.2_Missense_Mutation_p.A241T|SEMA6D_ENST00000354744.4_Missense_Mutation_p.A241T|SEMA6D_ENST00000389432.2_Missense_Mutation_p.A241T|SEMA6D_ENST00000536845.2_Missense_Mutation_p.A241T|SEMA6D_ENST00000355997.3_Missense_Mutation_p.A241T|SEMA6D_ENST00000389428.3_Missense_Mutation_p.A241T|SEMA6D_ENST00000358066.4_Missense_Mutation_p.A241T|SEMA6D_ENST00000537942.1_Missense_Mutation_p.A241T	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	241	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.A241T(1)		biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		TCGAGAAATCGCTGTCGAACA	0.358																																					p.A241T		.											SEMA6D,rectum,carcinoma,0,1	SEMA6D	0	1	Substitution - Missense(1)	large_intestine(1)	c.G721A						.						86.0	82.0	83.0					15																	48055275		2198	4296	6494	SO:0001583	missense	80031	exon9			GAAATCGCTGTCG	AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.721G>A	15.37:g.48055275G>A	ENSP00000324857:p.Ala241Thr	Somatic	52	0		WXS	Illumina HiSeq	.	41	2	NM_153617	A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Missense_Mutation	SNP	ENST00000316364.5	37	CCDS32225.1	.	.	.	.	.	.	.	.	.	.	G	35	5.466457	0.96257	.	.	ENSG00000137872	ENST00000537942;ENST00000536845;ENST00000316364;ENST00000389433;ENST00000389432;ENST00000354744;ENST00000358066;ENST00000389428;ENST00000355997;ENST00000389425	T;T;T;T;T;T;T;T;T;T	0.13420	2.59;2.59;2.59;2.59;2.59;2.59;2.59;2.59;2.59;2.59	5.8	5.8	0.92144	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.46870	0.1415	M	0.87456	2.885	0.80722	D	1	D;D;D;D;D	0.89917	0.999;0.996;0.999;1.0;1.0	D;P;D;D;D	0.91635	0.961;0.885;0.961;0.999;0.961	T	0.50906	-0.8772	10	0.87932	D	0	.	20.0706	0.97721	0.0:0.0:1.0:0.0	.	241;241;241;241;241	Q8NFY4-3;A6NM95;Q8NFY4-4;Q8NFY4;Q8NFY4-2	.;.;.;SEM6D_HUMAN;.	T	241	ENSP00000442040:A241T;ENSP00000446152:A241T;ENSP00000324857:A241T;ENSP00000374084:A241T;ENSP00000374083:A241T;ENSP00000346786:A241T;ENSP00000350770:A241T;ENSP00000374079:A241T;ENSP00000348276:A241T;ENSP00000374076:A241T	ENSP00000324857:A241T	A	+	1	0	SEMA6D	45842567	1.000000	0.71417	1.000000	0.80357	0.759000	0.43091	9.476000	0.97823	2.744000	0.94065	0.655000	0.94253	GCT	.		0.358	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416868.1	NM_024966	
ZKSCAN4	387032	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	28213220	28213220	+	Missense_Mutation	SNP	C	C	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr6:28213220C>T	ENST00000377294.2	-	5	1555	c.1312G>A	c.(1312-1314)Ggc>Agc	p.G438S	ZKSCAN4_ENST00000423974.2_Missense_Mutation_p.G283S	NM_019110.3	NP_061983.2	Q969J2	ZKSC4_HUMAN	zinc finger with KRAB and SCAN domains 4	438					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(2)|lung(10)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	18						AAGGCTTTGCCACACATATTG	0.478																																					p.G438S		.											.	.	.	0			c.G1312A						.						93.0	94.0	94.0					6																	28213220		2203	4300	6503	SO:0001583	missense	387032	exon5			CTTTGCCACACAT	AK056698	CCDS4647.1	6p21	2013-01-09	2007-02-20	2007-02-20	ENSG00000187626	ENSG00000187626		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13854	protein-coding gene	gene with protein product		611643	"""zinc finger protein 307"", ""zinc finger protein 427"""	ZNF307, ZNF427		12477932	Standard	NM_019110		Approved	p373c6.1, P1P373C6, FLJ32136, ZSCAN36	uc003nks.1	Q969J2	OTTHUMG00000014511	ENST00000377294.2:c.1312G>A	6.37:g.28213220C>T	ENSP00000366509:p.Gly438Ser	Somatic	68	0		WXS	Illumina HiSeq	.	64	14	NM_019110	B2RE32|Q5U7L4	Missense_Mutation	SNP	ENST00000377294.2	37	CCDS4647.1	.	.	.	.	.	.	.	.	.	.	C	18.97	3.735435	0.69189	.	.	ENSG00000187626	ENST00000377294;ENST00000423974;ENST00000449813;ENST00000356796	T;T	0.35236	1.32;1.32	5.52	4.66	0.58398	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.43322	0.1242	M	0.68728	2.09	0.32441	N	0.546761	D	0.58970	0.984	P	0.61722	0.893	T	0.49808	-0.8900	9	0.66056	D	0.02	.	13.4569	0.61204	0.0:0.923:0.0:0.077	.	438	Q969J2	ZKSC4_HUMAN	S	438;283;144;314	ENSP00000366509:G438S;ENSP00000401978:G283S	ENSP00000349249:G314S	G	-	1	0	ZKSCAN4	28321199	0.020000	0.18652	0.997000	0.53966	0.650000	0.38633	0.854000	0.27791	1.460000	0.47911	0.655000	0.94253	GGC	.		0.478	ZKSCAN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040179.1	NM_019110	
ATP10B	23120	hgsc.bcm.edu	37	5	160047807	160047807	+	Missense_Mutation	SNP	C	C	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr5:160047807C>T	ENST00000327245.5	-	15	2809	c.1963G>A	c.(1963-1965)Gtg>Atg	p.V655M	CTC-348L5.1_ENST00000523598.1_RNA	NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	655					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GTGGTGGCCACGTTGGCCCCT	0.567																																					p.V655M		.											ATP10B,NS,carcinoma,0,1	ATP10B	0	0			c.G1963A						.						79.0	84.0	82.0					5																	160047807		2149	4246	6395	SO:0001583	missense	23120	exon15			TGGCCACGTTGGC	AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.1963G>A	5.37:g.160047807C>T	ENSP00000313600:p.Val655Met	Somatic	36	0		WXS	Illumina HiSeq	.	26	2	NM_025153	Q9H725	Missense_Mutation	SNP	ENST00000327245.5	37	CCDS43394.1	.	.	.	.	.	.	.	.	.	.	C	0.706	-0.788793	0.02884	.	.	ENSG00000118322	ENST00000327245;ENST00000520108	T;T	0.42900	0.96;2.01	5.36	-10.7	0.00240	HAD-like domain (1);	3.007070	0.00604	N	0.000384	T	0.16896	0.0406	N	0.11255	0.115	0.09310	N	1	B;B	0.21147	0.036;0.052	B;B	0.17098	0.01;0.017	T	0.08597	-1.0714	9	.	.	.	.	3.4713	0.07569	0.1456:0.3869:0.0863:0.3813	.	263;655	Q2YDW8;O94823	.;AT10B_HUMAN	M	655;263	ENSP00000313600:V655M;ENSP00000431081:V263M	.	V	-	1	0	ATP10B	159980385	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.853000	0.01666	-2.085000	0.00864	-0.742000	0.03525	GTG	.		0.567	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374127.1	NM_025153	
TBP	6908	hgsc.bcm.edu	37	6	170871016	170871016	+	Silent	SNP	G	G	A	rs542031948		TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr6:170871016G>A	ENST00000392092.2	+	3	471	c.192G>A	c.(190-192)caG>caA	p.Q64Q	TBP_ENST00000230354.6_Silent_p.Q64Q|TBP_ENST00000540980.1_Silent_p.Q44Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	64	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		aacaacaacagcagcagcagc	0.557													G|||	1	0.000199681	0.0008	0.0	5008	,	,		14897	0.0		0.0	False		,,,				2504	0.0				p.Q64Q		.											TBP,NS,carcinoma,0,2	TBP	0	0			c.G192A						.						31.0	35.0	33.0					6																	170871016		2202	4292	6494	SO:0001819	synonymous_variant	6908	exon3			ACAACAGCAGCAG	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.192G>A	6.37:g.170871016G>A		Somatic	34	0		WXS	Illumina HiSeq	.	36	3	NM_003194	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	37	CCDS5315.1																																																																																			.		0.557	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
ATP13A2	23400	broad.mit.edu	37	1	17316709	17316709	+	Silent	SNP	G	G	A	rs148374514		TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr1:17316709G>A	ENST00000326735.8	-	21	2358	c.2325C>T	c.(2323-2325)atC>atT	p.I775I	ATP13A2_ENST00000341676.5_Silent_p.I770I|ATP13A2_ENST00000452699.1_Silent_p.I770I|RP1-37C10.3_ENST00000446261.1_RNA			Q9NQ11	AT132_HUMAN	ATPase type 13A2	775					cell death (GO:0008219)|cellular response to manganese ion (GO:0071287)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(11)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)		TGGCGTGGACGATGATCAGAT	0.652																																					p.I775I													.	ATP13A2	85	0			c.C2325T						.	G	,,	1,4405	2.1+/-5.4	0,1,2202	45.0	49.0	48.0		2310,2310,2325	-1.0	0.0	1	dbSNP_134	48	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	ATP13A2	NM_001141973.1,NM_001141974.1,NM_022089.2	,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,	770/1176,770/1159,775/1181	17316709	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	23400	exon21			GTGGACGATGATC	AL354615	CCDS175.1, CCDS44072.1, CCDS44073.1	1p36	2014-09-17			ENSG00000159363	ENSG00000159363		"""ATPases / P-type"", ""Parkinson disease"""	30213	protein-coding gene	gene with protein product		610513	"""Parkinson disease (autosomal recessive) 9 (Kufor-Rakeb syndrome)"""	PARK9		15381061, 16964263	Standard	XM_005245809		Approved	HSA9947, CLN12	uc001baa.2	Q9NQ11	OTTHUMG00000002293	ENST00000326735.8:c.2325C>T	1.37:g.17316709G>A		Somatic	60	0		WXS	Illumina GAIIx	Phase_I	34	3	NM_022089	O75700|Q5JXY1|Q5JXY2|Q6S9Z9	Silent	SNP	ENST00000326735.8	37	CCDS175.1																																																																																			G|1.000;A|0.000		0.652	ATP13A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000006617.1	NM_022089	
STK40	83931	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	36819995	36819995	+	Missense_Mutation	SNP	A	A	C			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr1:36819995A>C	ENST00000373129.3	-	7	999	c.593T>G	c.(592-594)cTg>cGg	p.L198R	STK40_ENST00000373130.3_Missense_Mutation_p.L203R|STK40_ENST00000359297.2_Missense_Mutation_p.L198R|STK40_ENST00000482458.1_5'Flank|STK40_ENST00000373132.3_Missense_Mutation_p.L198R	NM_032017.1	NP_114406.1	Q8N2I9	STK40_HUMAN	serine/threonine kinase 40	198	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				glycogen metabolic process (GO:0005977)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|regulation of gene expression (GO:0010468)|regulation of MAPK cascade (GO:0043408)|respiratory system process (GO:0003016)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)|stomach(1)	13		Myeloproliferative disorder(586;0.0393)				CCCCAGCTTCAGGTCTCTGTG	0.517																																					p.L198R													.	STK40	53	0			c.T593G						.						214.0	196.0	202.0					1																	36819995		2203	4300	6503	SO:0001583	missense	83931	exon7			AGCTTCAGGTCTC	BC008344	CCDS407.1, CCDS60089.1	1p34.3	2008-02-05			ENSG00000196182	ENSG00000196182			21373	protein-coding gene	gene with protein product		609437					Standard	NM_032017		Approved	MGC4796, SgK495	uc001cak.1	Q8N2I9	OTTHUMG00000008238	ENST00000373129.3:c.593T>G	1.37:g.36819995A>C	ENSP00000362221:p.Leu198Arg	Somatic	75	1		WXS	Illumina GAIIx	Phase_I	63	16	NM_032017	D3DPS8|Q5VTK8|Q5VTK9|Q6ZMN1|Q8N2J8|Q8N3I6|Q96HN6|Q96I44|Q9BSA3|Q9H7H6	Missense_Mutation	SNP	ENST00000373129.3	37	CCDS407.1	.	.	.	.	.	.	.	.	.	.	A	26.7	4.759040	0.89843	.	.	ENSG00000196182	ENST00000373129;ENST00000359297;ENST00000373130;ENST00000373132	D;T;T;D	0.82619	-1.63;1.1;1.1;-1.63	5.36	5.36	0.76844	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.94647	0.8274	H	0.98646	4.29	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.96566	0.9419	10	0.87932	D	0	-20.0022	14.5606	0.68133	1.0:0.0:0.0:0.0	.	198;203;198	Q8N2I9-3;Q8N2I9-4;Q8N2I9	.;.;STK40_HUMAN	R	198;198;203;198	ENSP00000362221:L198R;ENSP00000352245:L198R;ENSP00000362222:L203R;ENSP00000362224:L198R	ENSP00000352245:L198R	L	-	2	0	STK40	36592582	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.915000	0.92740	2.037000	0.60232	0.533000	0.62120	CTG	.		0.517	STK40-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022592.1	NM_032017	
RNPC3	55599	broad.mit.edu	37	1	104084013	104084013	+	Missense_Mutation	SNP	G	G	C			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr1:104084013G>C	ENST00000533099.1	+	9	1045	c.809G>C	c.(808-810)aGa>aCa	p.R270T	RNPC3_ENST00000423855.2_Missense_Mutation_p.R270T|RNPC3_ENST00000524631.1_Missense_Mutation_p.R270T			Q96LT9	RBM40_HUMAN	RNA-binding region (RNP1, RRM) containing 3	270	Necessary for binding to m(7)G-capped U12 snRNA.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Lung(183;0.111)|Epithelial(280;0.122)|all cancers(265;0.125)|Colorectal(144;0.163)		CAGCCCAAAAGACCTAAAACA	0.338																																					p.R270T													.	RNPC3	20	0			c.G809C						.						120.0	93.0	101.0					1																	104084013		692	1589	2281	SO:0001583	missense	55599	exon8			CCAAAAGACCTAA	AB058742, AY099329	CCDS781.1	1p21.1	2013-07-16			ENSG00000185946	ENSG00000185946		"""RNA binding motif (RRM) containing"""	18666	protein-coding gene	gene with protein product	"""U11/U12 snRNP 65K"""					14974681, 15146077	Standard	NM_017619		Approved	KIAA1839, FLJ20008, RBM40, SNRNP65	uc010oun.2	Q96LT9	OTTHUMG00000166613	ENST00000533099.1:c.809G>C	1.37:g.104084013G>C	ENSP00000432886:p.Arg270Thr	Somatic	133	0		WXS	Illumina GAIIx	Phase_I	103	3	NM_017619	A8K1C9|D3DT74|Q5TZ87|Q96FK7|Q96JI8|Q9NSU7|Q9NXX2	Missense_Mutation	SNP	ENST00000533099.1	37	CCDS781.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.39|18.39	3.612504|3.612504	0.66672|0.66672	.|.	.|.	ENSG00000185946|ENSG00000185946	ENST00000524641|ENST00000524631;ENST00000533099;ENST00000527062;ENST00000423855	.|T;T;T	.|0.23348	.|1.95;1.91;1.91	4.76|4.76	3.84|3.84	0.44239|0.44239	.|.	.|.	.|.	.|.	.|.	T|T	0.35248|0.35248	0.0925|0.0925	L|L	0.56769|0.56769	1.78|1.78	0.47276|0.47276	D|D	0.999375|0.999375	.|D;D	.|0.89917	.|0.993;1.0	.|D;D	.|0.87578	.|0.977;0.998	T|T	0.24870|0.24870	-1.0148|-1.0148	5|9	.|0.72032	.|D	.|0.01	.|.	13.0702|13.0702	0.59057|0.59057	0.079:0.0:0.921:0.0|0.079:0.0:0.921:0.0	.|.	.|270;270	.|A8K1C9;Q96LT9	.|.;RBM40_HUMAN	H|T	11|270;270;111;270	.|ENSP00000437278:R270T;ENSP00000432886:R270T;ENSP00000391432:R270T	.|ENSP00000391432:R270T	D|R	+|+	1|2	0|0	RNPC3|RNPC3	.|.	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.936000|0.936000	0.57629|0.57629	5.782000|5.782000	0.68973|0.68973	1.107000|1.107000	0.41642|0.41642	0.557000|0.557000	0.71058|0.71058	GAC|AGA	.		0.338	RNPC3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390812.1	NM_017619	
LOC101927209	101927209	broad.mit.edu	37	1	142713765	142713765	+	lincRNA	SNP	T	T	C			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr1:142713765T>C	ENST00000610091.1	-	0	1893																											ATTTATTTTCTTTTTCCACAT	0.284																																					.													.	.	.	0			.						.																																					0	.			ATTTTCTTTTTCC																													1.37:g.142713765T>C		Somatic	257	0		WXS	Illumina GAIIx	Phase_I	281	7	.		RNA	SNP	ENST00000610091.1	37																																																																																				.		0.284	RP11-417J8.6-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000037265.2		
BRINP3	339479	broad.mit.edu	37	1	190203603	190203603	+	Missense_Mutation	SNP	G	G	C			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr1:190203603G>C	ENST00000367462.3	-	5	854	c.623C>G	c.(622-624)aCa>aGa	p.T208R	BRINP3_ENST00000534846.1_Missense_Mutation_p.T106R	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	208	MACPF.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											CCGTGTTTCTGTTACCTGGCA	0.383																																					p.T208R													.	FAM5C	343	0			c.C623G						.						112.0	96.0	101.0					1																	190203603		2203	4300	6503	SO:0001583	missense	0	exon5			GTTTCTGTTACCT	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.623C>G	1.37:g.190203603G>C	ENSP00000356432:p.Thr208Arg	Somatic	94	0		WXS	Illumina GAIIx	Phase_I	94	3	NM_199051	B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	ENST00000367462.3	37	CCDS1373.1	.	.	.	.	.	.	.	.	.	.	G	17.71	3.457740	0.63401	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	T;T	0.20332	2.3;2.08	5.87	5.87	0.94306	Membrane attack complex component/perforin (MACPF) domain (1);	0.000000	0.85682	D	0.000000	T	0.47967	0.1474	M	0.70595	2.14	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.80764	0.994;0.987	T	0.40608	-0.9554	10	0.72032	D	0.01	.	17.6929	0.88273	0.0:0.0:1.0:0.0	.	106;208	B7Z260;Q76B58	.;FAM5C_HUMAN	R	208;106	ENSP00000356432:T208R;ENSP00000438022:T106R	ENSP00000356432:T208R	T	-	2	0	FAM5C	188470226	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.724000	0.98775	2.775000	0.95449	0.650000	0.86243	ACA	.		0.383	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051	
CFAP58	159686	broad.mit.edu	37	10	106118238	106118238	+	Missense_Mutation	SNP	T	T	C			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr10:106118238T>C	ENST00000369704.3	+	2	283	c.149T>C	c.(148-150)aTg>aCg	p.M50T	CCDC147_ENST00000312902.5_5'UTR	NM_001008723.1	NP_001008723.1	Q5T655	CC147_HUMAN		50						extracellular space (GO:0005615)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	52		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)		CATGCTGTCATGAAAAAGTCT	0.408																																					p.M50T													.	CCDC147	137	0			c.T149C						.						69.0	66.0	67.0					10																	106118238		2203	4300	6503	SO:0001583	missense	159686	exon2			CTGTCATGAAAAA																												ENST00000369704.3:c.149T>C	10.37:g.106118238T>C	ENSP00000358718:p.Met50Thr	Somatic	41	0		WXS	Illumina GAIIx	Phase_I	42	3	NM_001008723	D3DRA6|Q8NA27	Missense_Mutation	SNP	ENST00000369704.3	37	CCDS31282.1	.	.	.	.	.	.	.	.	.	.	T	17.02	3.282639	0.59867	.	.	ENSG00000120051	ENST00000369704	T	0.30182	1.54	5.57	5.57	0.84162	.	0.100673	0.64402	D	0.000001	T	0.32436	0.0829	L	0.40543	1.245	0.80722	D	1	B	0.23249	0.082	B	0.31869	0.137	T	0.11567	-1.0582	10	0.66056	D	0.02	-21.9443	16.0347	0.80617	0.0:0.0:0.0:1.0	.	50	Q5T655	CC147_HUMAN	T	50	ENSP00000358718:M50T	ENSP00000358718:M50T	M	+	2	0	CCDC147	106108228	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	7.997000	0.88414	2.248000	0.74166	0.533000	0.62120	ATG	.		0.408	CCDC147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050216.1		
ATM	472	broad.mit.edu	37	11	108151894	108151894	+	Splice_Site	SNP	A	A	G			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr11:108151894A>G	ENST00000452508.2	+	25	3764	c.3575A>G	c.(3574-3576)aAg>aGg	p.K1192R	ATM_ENST00000278616.4_Splice_Site_p.K1192R			Q13315	ATM_HUMAN	ATM serine/threonine kinase	1192					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	CTTGTGAAAAAGGTATATATG	0.358			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											p.K1192R			yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	.	ATM	1657	0			c.A3575G						.						87.0	88.0	88.0					11																	108151894		2201	4298	6499	SO:0001630	splice_region_variant	472	exon24	Familial Cancer Database	AT, Louis-Bar syndrome	TGAAAAAGGTATA	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.3576+1A>G	11.37:g.108151894A>G		Somatic	134	0		WXS	Illumina GAIIx	Phase_I	98	4	NM_000051	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Splice_Site	SNP	ENST00000452508.2	37	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.527743	0.85706	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508	T;T;T	0.73152	-0.72;-0.72;-0.72	6.13	6.13	0.99165	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.79034	0.4378	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.80484	-0.1362	10	0.66056	D	0.02	.	16.8061	0.85666	1.0:0.0:0.0:0.0	.	1192	Q13315	ATM_HUMAN	R	1192	ENSP00000435747:K1192R;ENSP00000278616:K1192R;ENSP00000388058:K1192R	ENSP00000278616:K1192R	K	+	2	0	ATM	107657104	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	8.365000	0.90108	2.367000	0.80283	0.529000	0.55759	AAG	.		0.358	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	Missense_Mutation
LRP6	4040	broad.mit.edu	37	12	12300324	12300324	+	Silent	SNP	G	G	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr12:12300324G>T	ENST00000261349.4	-	15	3449	c.3373C>A	c.(3373-3375)Cga>Aga	p.R1125R	LRP6_ENST00000543091.1_Silent_p.R1125R	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	1125	Beta-propeller 4.				anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				CTTTCAATTCGCCGGAGATCT	0.403																																					p.R1125R													.	LRP6	170	0			c.C3373A						.						91.0	92.0	91.0					12																	12300324		2203	4300	6503	SO:0001819	synonymous_variant	4040	exon15			CAATTCGCCGGAG	AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.3373C>A	12.37:g.12300324G>T		Somatic	111	0		WXS	Illumina GAIIx	Phase_I	91	3	NM_002336	Q17RZ2	Silent	SNP	ENST00000261349.4	37	CCDS8647.1																																																																																			.		0.403	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400137.1		
HDC	3067	broad.mit.edu	37	15	50550626	50550626	+	Missense_Mutation	SNP	G	G	A			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr15:50550626G>A	ENST00000267845.3	-	3	695	c.293C>T	c.(292-294)gCc>gTc	p.A98V	HDC_ENST00000543581.1_Missense_Mutation_p.A98V	NM_002112.3	NP_002103.2	Q9UBI9	HDC_HUMAN	histidine decarboxylase	0					respiratory tube development (GO:0030323)	membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)		GCAGTTGATGGCATCAGCCAG	0.562																																					p.A98V	GBM(95;1627 1936 6910 9570)												.	HDC	86	0			c.C293T						.						90.0	76.0	81.0					15																	50550626		2196	4295	6491	SO:0001583	missense	3067	exon3			TTGATGGCATCAG		CCDS10134.1	15q21.2	2013-09-20			ENSG00000140287	ENSG00000140287	4.1.1.22		4855	protein-coding gene	gene with protein product		142704				1487235	Standard	NM_002112		Approved		uc001zxz.3	P19113	OTTHUMG00000131644	ENST00000267845.3:c.293C>T	15.37:g.50550626G>A	ENSP00000267845:p.Ala98Val	Somatic	56	0		WXS	Illumina GAIIx	Phase_I	49	3	NM_002112		Missense_Mutation	SNP	ENST00000267845.3	37	CCDS10134.1	.	.	.	.	.	.	.	.	.	.	G	32	5.115974	0.94339	.	.	ENSG00000140287	ENST00000267845;ENST00000543581	T;T	0.41758	0.99;0.99	5.48	5.48	0.80851	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.056439	0.64402	D	0.000001	T	0.70448	0.3225	M	0.85859	2.78	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.995;0.996	T	0.75274	-0.3375	10	0.87932	D	0	-22.3877	19.3432	0.94352	0.0:0.0:1.0:0.0	.	98;98	B7ZM01;P19113	.;DCHS_HUMAN	V	98	ENSP00000267845:A98V;ENSP00000440252:A98V	ENSP00000267845:A98V	A	-	2	0	HDC	48337918	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.911000	0.87458	2.577000	0.86979	0.462000	0.41574	GCC	.		0.562	HDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254540.1		
THAP11	57215	broad.mit.edu	37	16	67876820	67876820	+	Silent	SNP	G	G	A			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr16:67876820G>A	ENST00000303596.1	+	1	608	c.363G>A	c.(361-363)caG>caA	p.Q121Q	CENPT_ENST00000562787.1_Intron	NM_020457.2	NP_065190.2	Q96EK4	THA11_HUMAN	THAP domain containing 11	121	Gln-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|urinary_tract(1)	8		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00412)|Epithelial(162;0.018)|all cancers(182;0.118)		agcagcagcagcaacagcagc	0.677																																					p.Q121Q													.	THAP11	27	0			c.G363A						.						28.0	33.0	31.0					16																	67876820		1970	3892	5862	SO:0001819	synonymous_variant	57215	exon1			GCAGCAGCAACAG	AB015338	CCDS10847.1	16q22.1	2013-01-25			ENSG00000168286	ENSG00000168286		"""THAP (C2CH-type zinc finger) domain containing"""	23194	protein-coding gene	gene with protein product		609119				12575992, 8325628	Standard	NM_020457		Approved	HRIHFB2206, CTG-B45d, CTG-B43a	uc002euo.3	Q96EK4	OTTHUMG00000137546	ENST00000303596.1:c.363G>A	16.37:g.67876820G>A		Somatic	25	0		WXS	Illumina GAIIx	Phase_I	30	3	NM_020457	A4UCT5|A8K002|O94795	Silent	SNP	ENST00000303596.1	37	CCDS10847.1																																																																																			.		0.677	THAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268879.1	NM_020457	
PMFBP1	83449	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	72174346	72174346	+	Missense_Mutation	SNP	C	C	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr16:72174346C>T	ENST00000237353.10	-	6	1033	c.772G>A	c.(772-774)Gaa>Aaa	p.E258K	PMFBP1_ENST00000355636.6_Missense_Mutation_p.E113K|PMFBP1_ENST00000537465.1_Missense_Mutation_p.E258K	NM_031293.2	NP_112583.2	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	258						cytoplasm (GO:0005737)				NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	45		Ovarian(137;0.179)				TTTCGAAGTTCTTGAATGAGA	0.453																																					p.E258K													.	PMFBP1	101	0			c.G772A						.						317.0	305.0	309.0					16																	72174346		2198	4300	6498	SO:0001583	missense	83449	exon6			GAAGTTCTTGAAT	AF239683	CCDS32483.1	16q23.1	2008-08-04			ENSG00000118557	ENSG00000118557			17728	protein-coding gene	gene with protein product						11468771	Standard	NM_031293		Approved		uc002fcd.3	Q8TBY8	OTTHUMG00000167827	ENST00000237353.10:c.772G>A	16.37:g.72174346C>T	ENSP00000237353:p.Glu258Lys	Somatic	93	0		WXS	Illumina GAIIx	Phase_I	83	17	NM_031293	B3KVI9|H7BY07|Q8NA09|Q9BY16|Q9H0H4	Missense_Mutation	SNP	ENST00000237353.10	37	CCDS32483.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.018152	0.93404	.	.	ENSG00000118557	ENST00000537465;ENST00000237353;ENST00000355636	T;T;T	0.15372	2.43;2.44;2.49	5.65	5.65	0.86999	.	0.240618	0.29799	N	0.011161	T	0.25269	0.0614	N	0.24115	0.695	0.36708	D	0.880505	D;D;D	0.76494	0.999;0.997;0.999	D;D;D	0.74674	0.984;0.957;0.984	T	0.04635	-1.0937	10	0.13470	T	0.59	-17.4904	15.093	0.72211	0.0:1.0:0.0:0.0	.	258;258;258	Q8TBY8;Q8TBY8-2;G3V1Q7	PMFBP_HUMAN;.;.	K	258;258;113	ENSP00000443817:E258K;ENSP00000237353:E258K;ENSP00000347854:E113K	ENSP00000237353:E258K	E	-	1	0	PMFBP1	70731847	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.347000	0.52200	2.941000	0.99782	0.655000	0.94253	GAA	.		0.453	PMFBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396473.2	NM_031293	
C19orf26	255057	broad.mit.edu	37	19	1234721	1234721	+	Missense_Mutation	SNP	T	T	C			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr19:1234721T>C	ENST00000382477.2	-	6	810	c.536A>G	c.(535-537)gAc>gGc	p.D179G	C19orf26_ENST00000215376.6_Missense_Mutation_p.D153G|C19orf26_ENST00000590083.1_Missense_Mutation_p.D159G			Q8N350	DOS_HUMAN	chromosome 19 open reading frame 26	179						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)	9		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTGGTGGAAGTCCCCCTCCGT	0.652										HNSCC(14;0.022)																											p.D159G													.	C19orf26	31	0			c.A476G						.						116.0	94.0	101.0					19																	1234721		2200	4299	6499	SO:0001583	missense	255057	exon6			TGGAAGTCCCCCT	BC028156	CCDS12057.1, CCDS12057.2	19p13.3	2012-10-24			ENSG00000099625	ENSG00000099625			28617	protein-coding gene	gene with protein product	"""downstream of STK11"""					12477932	Standard	NM_152769		Approved	MGC40084, DOS	uc002lrm.3	Q8N350	OTTHUMG00000180141	ENST00000382477.2:c.536A>G	19.37:g.1234721T>C	ENSP00000371917:p.Asp179Gly	Somatic	80	1		WXS	Illumina GAIIx	Phase_I	74	4	NM_152769	O43385	Missense_Mutation	SNP	ENST00000382477.2	37		.	.	.	.	.	.	.	.	.	.	T	23.3	4.396055	0.83011	.	.	ENSG00000099625	ENST00000382477;ENST00000215376	.	.	.	3.06	3.06	0.35304	.	0.000000	0.85682	D	0.000000	T	0.64170	0.2574	L	0.36672	1.1	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.66630	-0.5875	9	0.87932	D	0	.	10.5162	0.44892	0.0:0.0:0.0:1.0	.	153	Q8N350-2	.	G	179;153	.	ENSP00000215376:D153G	D	-	2	0	C19orf26	1185721	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.064000	0.76721	1.407000	0.46875	0.459000	0.35465	GAC	.		0.652	C19orf26-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_152769	
ZNF730	100129543	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	23328817	23328817	+	Missense_Mutation	SNP	C	C	A			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr19:23328817C>A	ENST00000597761.2	+	4	1170	c.971C>A	c.(970-972)tCc>tAc	p.S324Y		NM_001277403.1	NP_001264332.1	Q6ZMV8	ZN730_HUMAN	zinc finger protein 730	324					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(7)|pancreas(1)|stomach(2)|urinary_tract(1)	16						TTTAAGTGGTCCTCAACCCTT	0.353																																					.													.	.	.	0			.						.																																			SO:0001583	missense	100129543	.			AGTGGTCCTCAAC	AK131472	CCDS59371.1	19p12	2013-01-08			ENSG00000183850	ENSG00000183850		"""Zinc fingers, C2H2-type"", ""-"""	32470	protein-coding gene	gene with protein product							Standard	NM_001277403		Approved		uc031rkc.1	Q6ZMV8		ENST00000597761.2:c.971C>A	19.37:g.23328817C>A	ENSP00000472959:p.Ser324Tyr	Somatic	98	0		WXS	Illumina GAIIx	Phase_I	87	21	.		Missense_Mutation	SNP	ENST00000597761.2	37	CCDS59371.1	.	.	.	.	.	.	.	.	.	.	C	0.459	-0.890096	0.02511	.	.	ENSG00000183850	ENST00000327867	.	.	.	0.916	-1.39	0.08997	.	.	.	.	.	T	0.43678	0.1258	M	0.80847	2.515	0.09310	N	1	.	.	.	.	.	.	T	0.41698	-0.9494	6	0.23302	T	0.38	.	3.2354	0.06762	0.2409:0.2983:0.4608:0.0	.	.	.	.	Y	324	.	ENSP00000329365:S324Y	S	+	2	0	ZNF730	23120657	0.000000	0.05858	0.004000	0.12327	0.004000	0.04260	-3.376000	0.00492	0.300000	0.22699	0.305000	0.20034	TCC	.		0.353	ZNF730-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465737.2	XM_001719792	
WFDC11	259239	broad.mit.edu	37	20	44279175	44279175	+	Missense_Mutation	SNP	G	G	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr20:44279175G>T	ENST00000356562.2	-	3	286	c.65C>A	c.(64-66)tCt>tAt	p.S22Y	WFDC11_ENST00000324384.3_Missense_Mutation_p.S22Y			Q8NEX6	WFD11_HUMAN	WAP four-disulfide core domain 11	22						extracellular region (GO:0005576)				endometrium(1)|lung(4)	5		Myeloproliferative disorder(115;0.0122)				TCCCAGCACAGACAGTAGCAC	0.473																																					p.S22Y													.	WFDC11	11	0			c.C65A						.						236.0	199.0	212.0					20																	44279175		2203	4300	6503	SO:0001583	missense	259239	exon3			AGCACAGACAGTA	AY047609	CCDS13364.1	20q13.12	2013-01-21			ENSG00000180083	ENSG00000180083		"""WAP four-disulfide core domain containing"""	20478	protein-coding gene	gene with protein product						12206714	Standard	NM_147197		Approved	WAP11	uc002xpa.3	Q8NEX6	OTTHUMG00000046330	ENST00000356562.2:c.65C>A	20.37:g.44279175G>T	ENSP00000348968:p.Ser22Tyr	Somatic	69	0		WXS	Illumina GAIIx	Phase_I	37	3	NM_147197	E1P624|Q5TGZ6	Missense_Mutation	SNP	ENST00000356562.2	37	CCDS13364.1	.	.	.	.	.	.	.	.	.	.	G	13.88	2.369458	0.42003	.	.	ENSG00000180083	ENST00000356562;ENST00000324384	T;T	0.32753	1.44;1.44	3.53	2.56	0.30785	.	0.896444	0.09075	N	0.852267	T	0.49218	0.1544	.	.	.	0.22412	N	0.999124	D	0.89917	1.0	D	0.68353	0.957	T	0.24119	-1.0169	9	0.46703	T	0.11	-5.904	8.899	0.35484	0.0:0.2288:0.7712:0.0	.	22	Q8NEX6	WFD11_HUMAN	Y	22	ENSP00000348968:S22Y;ENSP00000318753:S22Y	ENSP00000318753:S22Y	S	-	2	0	WFDC11	43712589	0.004000	0.15560	0.570000	0.28473	0.012000	0.07955	0.451000	0.21779	1.045000	0.40225	0.563000	0.77884	TCT	.		0.473	WFDC11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106943.1		
LIF	3976	broad.mit.edu	37	22	30642384	30642386	+	Intron	DEL	GAG	GAG	-			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr22:30642384_30642386delGAG	ENST00000249075.3	-	1	175				RP1-102K2.8_ENST00000593843.1_RNA|LIF_ENST00000403987.3_Intron|RP1-102K2.8_ENST00000608354.1_RNA	NM_002309.4	NP_002300.1	P15018	LIF_HUMAN	leukemia inhibitory factor						blood vessel remodeling (GO:0001974)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|immune response (GO:0006955)|leukemia inhibitory factor signaling pathway (GO:0048861)|lung alveolus development (GO:0048286)|lung lobe morphogenesis (GO:0060463)|lung vasculature development (GO:0060426)|multicellular organismal development (GO:0007275)|muscle organ morphogenesis (GO:0048644)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of hormone secretion (GO:0046888)|negative regulation of meiosis (GO:0045835)|neuron development (GO:0048666)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of cell proliferation (GO:0008284)|positive regulation of histone H3-K27 acetylation (GO:1901676)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0072108)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein localization to nucleus (GO:1900182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|spongiotrophoblast differentiation (GO:0060708)|stem cell maintenance (GO:0019827)|transcription from RNA polymerase II promoter (GO:0006366)|trophoblast giant cell differentiation (GO:0060707)|tyrosine phosphorylation of Stat3 protein (GO:0042503)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|leukemia inhibitory factor receptor binding (GO:0005146)|receptor binding (GO:0005102)|RNA polymerase II transcription factor recruiting transcription factor activity (GO:0001135)			breast(1)|lung(3)|skin(3)	7			Epithelial(10;0.171)			TGTCCggagcgaggaggaggagg	0.606																																					.													.	LIF	18	0			.						.																																			SO:0001627	intron_variant	0	.			CGGAGCGAGGAGG		CCDS13872.1, CCDS58799.1	22q12.2	2012-02-09	2012-02-09		ENSG00000128342	ENSG00000128342			6596	protein-coding gene	gene with protein product	"""differentiation inhibitory activity"", ""differentiation-inducing factor"", ""hepatocyte-stimulating factor III"", ""cholinergic differentiation factor"", ""human interleukin in DA cells"""	159540				1714745, 8058719	Standard	NM_002309		Approved	CDF, DIA, HILDA	uc003agz.3	P15018	OTTHUMG00000150910	ENST00000249075.3:c.19+279CTC>-	22.37:g.30642393_30642395delGAG		Somatic	6	0		WXS	Illumina GAIIx	Phase_I	6	1	.	B2RCW7|B5MC23|Q52LZ2	In_Frame_Del	DEL	ENST00000249075.3	37	CCDS13872.1																																																																																			.		0.606	LIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320508.1	NM_002309	
LINC00969	440993	broad.mit.edu	37	3	195392705	195392705	+	lincRNA	DEL	C	C	-	rs59802848		TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr3:195392705delC	ENST00000445430.1	+	0	647									long intergenic non-protein coding RNA 969																		AAATGTGTCACCAACATAGGA	0.567																																					.													.	.	.	0			.						.																																					0	.			GTGTCACCAACAT	AK128346		3q29	2013-06-07			ENSG00000242086	ENSG00000242086		"""Long non-coding RNAs"""	48729	non-coding RNA	RNA, long non-coding							Standard	XR_427455		Approved				OTTHUMG00000155834		3.37:g.195392705delC		Somatic	20	2		WXS	Illumina GAIIx	Phase_I	13	2	.		RNA	DEL	ENST00000445430.1	37																																																																																				.		0.567	LINC00969-038	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000341951.1		
PDCD6IP	10015	broad.mit.edu	37	3	33840300	33840300	+	Missense_Mutation	SNP	A	A	G			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr3:33840300A>G	ENST00000307296.3	+	1	457	c.80A>G	c.(79-81)cAg>cGg	p.Q27R	RP11-10C24.1_ENST00000605513.1_lincRNA|PDCD6IP_ENST00000457054.2_Missense_Mutation_p.Q27R|RP11-10C24.3_ENST00000604982.1_lincRNA			Q8WUM4	PDC6I_HUMAN	programmed cell death 6 interacting protein	27	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell division (GO:0051301)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium-dependent protein binding (GO:0048306)|protein homodimerization activity (GO:0042803)			central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|skin(1)|stomach(1)	23						TTCATCCAGCAGACTTACCCA	0.652																																					p.Q27R													.	PDCD6IP	62	0			c.A80G						.						17.0	15.0	16.0					3																	33840300		2200	4282	6482	SO:0001583	missense	10015	exon1			TCCAGCAGACTTA	BC020066	CCDS2660.1, CCDS54561.1	3p22.3	2012-08-30	2001-11-29		ENSG00000170248	ENSG00000170248			8766	protein-coding gene	gene with protein product	"""ALG-2 interacting protein X"""	608074	"""programmed cell death 6-interacting protein"""			9880530	Standard	NM_001162429		Approved	Alix, AIP1, Hp95	uc003cfy.4	Q8WUM4	OTTHUMG00000130751	ENST00000307296.3:c.80A>G	3.37:g.33840300A>G	ENSP00000307387:p.Gln27Arg	Somatic	60	0		WXS	Illumina GAIIx	Phase_I	73	4	NM_013374	C5MQH7|E9PFU1|Q6NUS1|Q9BX86|Q9NUN0|Q9P2H2|Q9UKL5	Missense_Mutation	SNP	ENST00000307296.3	37	CCDS2660.1	.	.	.	.	.	.	.	.	.	.	A	17.02	3.282820	0.59867	.	.	ENSG00000170248	ENST00000307296;ENST00000457054;ENST00000413073	T;T;T	0.16457	2.34;2.34;2.34	5.55	5.55	0.83447	BRO1 domain (3);	0.371820	0.30940	N	0.008575	T	0.16342	0.0393	L	0.41824	1.3	0.37899	D	0.93097	B;B;B	0.09022	0.002;0.002;0.001	B;B;B	0.16289	0.009;0.015;0.015	T	0.08186	-1.0734	10	0.22706	T	0.39	-9.9457	15.683	0.77388	1.0:0.0:0.0:0.0	.	27;27;27	C5MQH7;E9PFU1;Q8WUM4	.;.;PDC6I_HUMAN	R	27	ENSP00000307387:Q27R;ENSP00000411825:Q27R;ENSP00000406693:Q27R	ENSP00000307387:Q27R	Q	+	2	0	PDCD6IP	33815304	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.663000	0.46774	2.104000	0.64026	0.477000	0.44152	CAG	.		0.652	PDCD6IP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253251.2		
TIGIT	201633	broad.mit.edu;bcgsc.ca	37	3	114014670	114014670	+	Missense_Mutation	SNP	C	C	T	rs559114697		TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr3:114014670C>T	ENST00000486257.1	+	3	597	c.340C>T	c.(340-342)Cct>Tct	p.P114S	TIGIT_ENST00000383671.3_Missense_Mutation_p.P114S|TIGIT_ENST00000481065.1_Missense_Mutation_p.P181S			Q495A1	TIGIT_HUMAN	T cell immunoreceptor with Ig and ITIM domains	114	Ig-like V-type.				negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|positive regulation of interleukin-10 production (GO:0032733)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(7)|prostate(1)	17						TCACACCTACCCTGATGGGAC	0.557																																					p.P114S													.	TIGIT	42	0			c.C340T						.						87.0	82.0	84.0					3																	114014670		2203	4300	6503	SO:0001583	missense	201633	exon2			ACCTACCCTGATG	AK097192	CCDS2980.1	3q13.31	2013-01-11	2008-10-13	2008-10-13	ENSG00000181847	ENSG00000181847		"""Immunoglobulin superfamily / V-set domain containing"""	26838	protein-coding gene	gene with protein product		612859	"""V-set and immunoglobulin domain containing 9"", ""V-set and transmembrane domain containing 3"""	VSIG9, VSTM3		19011627	Standard	NM_173799		Approved	FLJ39873, DKFZp667A205	uc003ebg.2	Q495A1	OTTHUMG00000159331	ENST00000486257.1:c.340C>T	3.37:g.114014670C>T	ENSP00000419085:p.Pro114Ser	Somatic	25	0		WXS	Illumina GAIIx	Phase_I	11	3	NM_173799	Q495A3|Q5JPD8|Q6MZS2|Q8N877	Missense_Mutation	SNP	ENST00000486257.1	37	CCDS2980.1	.	.	.	.	.	.	.	.	.	.	C	18.70	3.679378	0.68042	.	.	ENSG00000181847	ENST00000461158;ENST00000481065;ENST00000486257;ENST00000383671;ENST00000484319	T;T;T;T;T	0.39997	1.05;1.05;1.05;1.05;1.05	4.71	4.71	0.59529	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.000000	0.53938	D	0.000055	T	0.66761	0.2822	M	0.84683	2.71	0.38017	D	0.934722	D	0.89917	1.0	D	0.91635	0.999	T	0.74153	-0.3757	10	0.62326	D	0.03	-17.2055	13.3416	0.60549	0.0:1.0:0.0:0.0	.	114	Q495A1	TIGIT_HUMAN	S	93;181;114;114;93	ENSP00000418917:P93S;ENSP00000420552:P181S;ENSP00000419085:P114S;ENSP00000373167:P114S;ENSP00000419706:P93S	ENSP00000373167:P114S	P	+	1	0	TIGIT	115497360	1.000000	0.71417	1.000000	0.80357	0.705000	0.40729	3.576000	0.53878	2.628000	0.89032	0.561000	0.74099	CCT	.		0.557	TIGIT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354690.1	NM_173799	
TCERG1	10915	broad.mit.edu	37	5	145859643	145859643	+	Silent	SNP	A	A	G			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr5:145859643A>G	ENST00000296702.5	+	12	1910	c.1872A>G	c.(1870-1872)aaA>aaG	p.K624K	TCERG1_ENST00000394421.2_Silent_p.K603K	NM_006706.3	NP_006697.2	O14776	TCRG1_HUMAN	transcription elongation regulator 1	624					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(18)|lung(9)|ovary(2)|prostate(3)|skin(1)	46		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGCCTGTTAAAGCAAAAAAAC	0.284																																					p.K624K													.	TCERG1	148	0			c.A1872G						.						41.0	47.0	45.0					5																	145859643		2195	4288	6483	SO:0001819	synonymous_variant	10915	exon12			TGTTAAAGCAAAA	AF017789	CCDS4282.1, CCDS43379.1	5q31	2010-01-25	2002-01-24	2002-01-25	ENSG00000113649	ENSG00000113649			15630	protein-coding gene	gene with protein product	"""transcription factor CA150"", ""co-activator of 150 kDa"", ""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"", ""TATA box-binding protein-associated factor 2S"""	605409	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"""	TAF2S		9315662, 11003711	Standard	XM_005268365		Approved	CA150, Urn1	uc003lob.3	O14776	OTTHUMG00000129683	ENST00000296702.5:c.1872A>G	5.37:g.145859643A>G		Somatic	128	0		WXS	Illumina GAIIx	Phase_I	108	4	NM_006706	Q2NKN2|Q59EA1	Silent	SNP	ENST00000296702.5	37	CCDS4282.1																																																																																			.		0.284	TCERG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251886.1	NM_001040006	
C2	717	broad.mit.edu	37	6	31903768	31903768	+	Missense_Mutation	SNP	G	G	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr6:31903768G>T	ENST00000299367.5	+	7	1194	c.918G>T	c.(916-918)atG>atT	p.M306I	CFB_ENST00000556679.1_Intron|C2_ENST00000442278.2_Missense_Mutation_p.M174I|CFB_ENST00000456570.1_Intron|CFB_ENST00000477310.1_Intron|C2_ENST00000452323.2_Intron|C2_ENST00000469372.1_Missense_Mutation_p.M60I	NM_000063.4	NP_000054.2	P06681	CO2_HUMAN	complement component 2	306	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|positive regulation of apoptotic cell clearance (GO:2000427)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(1)|skin(2)|urinary_tract(2)	27		Ovarian(999;0.00965)		LUAD - Lung adenocarcinoma(999;0.247)		AAGTCCTCATGTCTGTCCTGA	0.507																																					p.M306I													.	C2	50	0			c.G918T						.						110.0	99.0	103.0					6																	31903768		1511	2709	4220	SO:0001583	missense	717	exon7			CCTCATGTCTGTC		CCDS4728.1, CCDS54991.1, CCDS56416.1, CCDS75427.1, CCDS75428.1	6p21.3	2014-09-17			ENSG00000166278	ENSG00000166278		"""Complement system"""	1248	protein-coding gene	gene with protein product		613927					Standard	NM_001145903		Approved		uc011hbs.1	P06681	OTTHUMG00000031190	ENST00000299367.5:c.918G>T	6.37:g.31903768G>T	ENSP00000299367:p.Met306Ile	Somatic	106	0		WXS	Illumina GAIIx	Phase_I	63	3	NM_000063	B4DPF3|B4DV20|E9PFN7|O19694|Q13904	Missense_Mutation	SNP	ENST00000299367.5	37	CCDS4728.1	.	.	.	.	.	.	.	.	.	.	G	10.91	1.484413	0.26598	.	.	ENSG00000166278	ENST00000469372;ENST00000497706;ENST00000432397;ENST00000299367;ENST00000442278	D;D;D;D	0.81908	-1.55;-1.55;-1.55;-1.55	5.73	3.9	0.45041	von Willebrand factor, type A (3);	0.142631	0.32608	N	0.005868	T	0.55481	0.1923	.	.	.	0.80722	D	1	B;B;B;B;B	0.18968	0.006;0.001;0.003;0.001;0.032	B;B;B;B;B	0.18871	0.015;0.006;0.005;0.004;0.023	T	0.56902	-0.7902	9	0.33141	T	0.24	-16.0475	4.0007	0.09579	0.0857:0.1632:0.5818:0.1693	.	277;60;174;306;93	B4DV48;B4DQI1;E9PFN7;P06681;E9PDZ0	.;.;.;CO2_HUMAN;.	I	60;93;93;306;174	ENSP00000418923:M60I;ENSP00000417482:M93I;ENSP00000299367:M306I;ENSP00000395683:M174I	ENSP00000299367:M306I	M	+	3	0	C2	32011747	0.903000	0.30736	0.999000	0.59377	0.520000	0.34377	0.467000	0.22035	1.389000	0.46526	0.467000	0.42956	ATG	.		0.507	C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076379.9		
POR	5447	broad.mit.edu	37	7	75618420	75618435	+	IGR	DEL	AGGGGGGTAGGGGGCT	AGGGGGGTAGGGGGCT	-	rs375671571|rs186407955|rs528741489|rs372247602	byFrequency	TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr7:75618420_75618435delAGGGGGGTAGGGGGCT	ENST00000461988.1	+	0	2522				TMEM120A_ENST00000338761.4_RNA|TMEM120A_ENST00000493111.2_RNA	NM_000941.2	NP_000932.3	P16435	NCPR_HUMAN	P450 (cytochrome) oxidoreductase						carnitine metabolic process (GO:0009437)|cellular organofluorine metabolic process (GO:0090346)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to peptide hormone stimulus (GO:0071375)|demethylation (GO:0070988)|fatty acid oxidation (GO:0019395)|flavonoid metabolic process (GO:0009812)|internal peptidyl-lysine acetylation (GO:0018393)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of lipase activity (GO:0060192)|nitrate catabolic process (GO:0043602)|nitric oxide catabolic process (GO:0046210)|oxidation-reduction process (GO:0055114)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of monooxygenase activity (GO:0032770)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|regulation of growth plate cartilage chondrocyte proliferation (GO:0003420)|response to drug (GO:0042493)|response to nutrient (GO:0007584)	endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|hydrolase activity (GO:0016787)|iron ion binding (GO:0005506)|iron-cytochrome-c reductase activity (GO:0047726)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric oxide dioxygenase activity (GO:0008941)			central_nervous_system(1)|endometrium(2)|kidney(2)|lung(3)|ovary(1)	9					Benzphetamine(DB00865)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Ethylmorphine(DB01466)|Flavin adenine dinucleotide(DB03147)|Lipoic Acid(DB00166)|Mitomycin(DB00305)|Nilutamide(DB00665)|Nitrofurantoin(DB00698)	tgagggggggaggggggtagggggctaggggtggag	0.699														5006	0.999601	1.0	1.0	5008	,	,		1108	1.0		0.998	False		,,,				2504	1.0				.													.	.	.	0			.						.			74,18		37,0,9						-0.9	0.0			1	162,16		78,6,5	no	intron	TMEM120A	NM_031925.2		115,6,14	A1A1,A1R,RR		8.9888,19.5652,12.5926				236,34				SO:0001628	intergenic_variant	83862	.			GGGGGGAGGGGGG	AF258341	CCDS5579.1	7q11.2	2006-12-05			ENSG00000127948	ENSG00000127948			9208	protein-coding gene	gene with protein product		124015				2516426	Standard	NM_000941		Approved	CYPOR, FLJ26468	uc003udy.3	P16435	OTTHUMG00000130413		7.37:g.75618420_75618435delAGGGGGGTAGGGGGCT		Somatic	5	0		WXS	Illumina GAIIx	Phase_I	6	2	.	Q16455|Q197M5|Q8N181|Q9H3M8|Q9UDT3	RNA	DEL	ENST00000461988.1	37	CCDS5579.1																																																																																			.		0.699	POR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252796.7	NM_000941	
LINC01410	103352539	broad.mit.edu	37	9	66459820	66459820	+	lincRNA	SNP	G	G	C	rs371375365		TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr9:66459820G>C	ENST00000424345.1	+	0	80				RNA5SP283_ENST00000365604.1_RNA																							tttgtccccagtgccttattt	0.353																																					.													.	.	.	0			.						.																																					0	.			TCCCCAGTGCCTT																													9.37:g.66459820G>C		Somatic	10	0		WXS	Illumina GAIIx	Phase_I	4	3	.		RNA	SNP	ENST00000424345.1	37																																																																																				.		0.353	RP11-262H14.1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000128851.1		
MT-ND2	4536	broad.mit.edu	37	M	2606	2606	+	5'Flank	SNP	T	T	C			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chrM:2606T>C	ENST00000361453.3	+	0	0				MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TI_ENST00000387365.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TQ_ENST00000387372.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						tagcataatcacttgttcctt	0.498																																					.													.	.	.	0			.						.																																			SO:0001631	upstream_gene_variant	0	.			AATCACTTGTTCC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.2606T>C	Exception_encountered	Somatic	2640	1		WXS	Illumina GAIIx	Phase_I	3163	18	.	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	ENST00000361453.3	37																																																																																				.		0.498	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024027	
SLC25A6	293	broad.mit.edu	37	X	1506182	1506182	+	Silent	SNP	C	C	A			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chrX:1506182C>A	ENST00000381401.5	-	3	1443	c.729G>T	c.(727-729)ggG>ggT	p.G243G	SLC25A6_ENST00000475167.1_5'Flank	NM_001636.3	NP_001627.2	P12236	ADT3_HUMAN	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6	243					active induction of host immune response by virus (GO:0046732)|ADP transport (GO:0015866)|apoptotic process (GO:0006915)|ATP transport (GO:0015867)|cellular protein metabolic process (GO:0044267)|energy reserve metabolic process (GO:0006112)|modulation by virus of host morphology or physiology (GO:0019048)|protein targeting to mitochondrion (GO:0006626)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|viral life cycle (GO:0019058)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial inner membrane presequence translocase complex (GO:0005744)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP:ADP antiporter activity (GO:0005471)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(8)|upper_aerodigestive_tract(1)	11		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Clodronate(DB00720)	CTCCTTTGCGCCCGGACTGCA	0.672																																					p.G243G													.	SLC25A6	27	0			c.G729T						.						74.0	79.0	77.0					X																	1506182		2203	4296	6499	SO:0001819	synonymous_variant	293	exon3			TTTGCGCCCGGAC	AY007135	CCDS14114.1	Xp22.32 and Yp11.3	2013-05-22			ENSG00000169100	ENSG00000169100		"""Pseudoautosomal regions / PAR1"", ""Solute carriers"""	10992	protein-coding gene	gene with protein product		300151, 403000		ANT3			Standard	NM_001636		Approved	ANT3Y, MGC17525	uc004cpt.3	P12236	OTTHUMG00000021058	ENST00000381401.5:c.729G>T	X.37:g.1506182C>A		Somatic	101	0		WXS	Illumina GAIIx	Phase_I	105	4	NM_001636	Q96C49	Silent	SNP	ENST00000381401.5	37	CCDS14114.1																																																																																			.		0.672	SLC25A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055596.1	NM_001636	
PLXNB3	5365	broad.mit.edu	37	X	153040491	153040491	+	Missense_Mutation	SNP	G	G	A			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chrX:153040491G>A	ENST00000361971.5	+	24	4202	c.4088G>A	c.(4087-4089)tGt>tAt	p.C1363Y	PLXNB3_ENST00000538282.1_3'UTR|SRPK3_ENST00000489426.1_5'Flank|PLXNB3_ENST00000538966.1_Missense_Mutation_p.C1386Y|PLXNB3_ENST00000538776.1_Missense_Mutation_p.C1016Y	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3	1363					axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					GACGGCCACTGTGCCACTGTG	0.687																																					p.C1386Y													.	PLXNB3	208	0			c.G4157A						.						24.0	24.0	24.0					X																	153040491		2197	4275	6472	SO:0001583	missense	5365	exon25			GCCACTGTGCCAC	AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.4088G>A	X.37:g.153040491G>A	ENSP00000355378:p.Cys1363Tyr	Somatic	17	0		WXS	Illumina GAIIx	Phase_I	17	3	NM_001163257	B7Z3E6|F5H773|Q9HDA4	Missense_Mutation	SNP	ENST00000361971.5	37	CCDS14729.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.019|0.019	-1.454491|-1.454491	0.01071|0.01071	.|.	.|.	ENSG00000198753|ENSG00000198753	ENST00000538966;ENST00000361971;ENST00000538776|ENST00000411613	T;T;T|.	0.10960|.	2.82;2.82;2.82|.	4.95|4.95	2.16|2.16	0.27623|0.27623	Plexin, cytoplasmic RasGAP domain (1);|.	0.338459|.	0.32753|.	N|.	0.005681|.	T|T	0.13372|0.13372	0.0324|0.0324	N|N	0.02539|0.02539	-0.55|-0.55	0.23425|0.23425	N|N	0.997707|0.997707	B;B;B|.	0.19706|.	0.025;0.038;0.025|.	B;B;B|.	0.29440|.	0.102;0.01;0.102|.	T|T	0.29088|0.29088	-1.0023|-1.0023	10|5	0.87932|.	D|.	0|.	.|.	8.149|8.149	0.31130|0.31130	0.2815:0.0:0.7185:0.0|0.2815:0.0:0.7185:0.0	.|.	1016;1386;1363|.	B7Z3H9;F5H773;Q9ULL4|.	.;.;PLXB3_HUMAN|.	Y|M	1386;1363;1016|69	ENSP00000442736:C1386Y;ENSP00000355378:C1363Y;ENSP00000445569:C1016Y|.	ENSP00000355378:C1363Y|.	C|V	+|+	2|1	0|0	PLXNB3|PLXNB3	152693685|152693685	0.457000|0.457000	0.25752|0.25752	0.000000|0.000000	0.03702|0.03702	0.006000|0.006000	0.05464|0.05464	3.727000|3.727000	0.54984|0.54984	0.338000|0.338000	0.23692|0.23692	0.292000|0.292000	0.19580|0.19580	TGT|GTG	.		0.687	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061063.1		
CYB5R2	51700	ucsc.edu	37	11	7686607	7686607	+	Nonstop_Mutation	SNP	A	A	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr11:7686607A>T	ENST00000533558.1	-	9	1385	c.829T>A	c.(829-831)Taa>Aaa	p.*277K	CYB5R2_ENST00000528585.1_5'UTR|CYB5R2_ENST00000299498.6_Nonstop_Mutation_p.*277K|CYB5R2_ENST00000524790.1_3'UTR			Q6BCY4	NB5R2_HUMAN	cytochrome b5 reductase 2	0					oxidation-reduction process (GO:0055114)|sterol biosynthetic process (GO:0016126)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)	11				Epithelial(150;5.48e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TGGAGGTGTTAGTAGGTGAAA	0.493											OREG0020724	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.X277K													.	CYB5R2	23	0			c.T829A						.						69.0	59.0	62.0					11																	7686607		2201	4296	6497	SO:0001578	stop_lost	51700	exon9			GGTGTTAGTAGGT	AF169802	CCDS7780.1	11p15.4	2014-08-12			ENSG00000166394	ENSG00000166394	1.6.2.2		24376	protein-coding gene	gene with protein product		608342				10611283	Standard	XM_005252973		Approved		uc001mfm.3	Q6BCY4	OTTHUMG00000165665	ENST00000533558.1:c.829T>A	11.37:g.7686607A>T		Somatic	72	3	643	WXS	Illumina HiSeq		39	6	NM_016229	Q9BVA3|Q9UF68|Q9UHJ0	Nonstop_Mutation	SNP	ENST00000533558.1	37	CCDS7780.1	.	.	.	.	.	.	.	.	.	.	A	22.9	4.345382	0.82022	.	.	ENSG00000166394	ENST00000299498;ENST00000533558	.	.	.	5.9	5.9	0.94986	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2838	0.66232	1.0:0.0:0.0:0.0	.	.	.	.	K	277	.	.	X	-	1	0	CYB5R2	7643183	1.000000	0.71417	0.995000	0.50966	0.928000	0.56348	8.916000	0.92745	2.264000	0.75181	0.533000	0.62120	TAA	.		0.493	CYB5R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385679.1	NM_016229	
DNMT1	1786	ucsc.edu;bcgsc.ca	37	19	10250386	10250386	+	Missense_Mutation	SNP	C	C	T	rs564106859		TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr19:10250386C>T	ENST00000340748.4	-	33	4101	c.3866G>A	c.(3865-3867)cGc>cAc	p.R1289H	DNMT1_ENST00000589538.1_5'Flank|DNMT1_ENST00000359526.4_Missense_Mutation_p.R1305H|DNMT1_ENST00000540357.1_Missense_Mutation_p.R1289H			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1	1289	Catalytic.|Interaction with the PRC2/EED-EZH2 complex. {ECO:0000250}.|SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.R1289H(1)		breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	ATAGCCCATGCGGACCAGGCA	0.647													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18696	0.0		0.0	False		,,,				2504	0.0				p.R1305H													DNMT1,colon,NS,0,1	DNMT1	148	1	Substitution - Missense(1)	large_intestine(1)	c.G3914A						.						59.0	52.0	54.0					19																	10250386		2203	4300	6503	SO:0001583	missense	1786	exon34			CCCATGCGGACCA	X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.3866G>A	19.37:g.10250386C>T	ENSP00000345739:p.Arg1289His	Somatic	73	0		WXS	Illumina HiSeq		40	4	NM_001130823	A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	Missense_Mutation	SNP	ENST00000340748.4	37	CCDS12228.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.717524	0.89205	.	.	ENSG00000130816	ENST00000359526;ENST00000540357;ENST00000340748;ENST00000541266	T;T;T	0.44083	0.93;0.93;0.93	5.2	4.17	0.49024	.	0.121674	0.64402	D	0.000011	T	0.60573	0.2279	M	0.67397	2.05	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.72338	0.961;0.961;0.977	T	0.64097	-0.6487	10	0.72032	D	0.01	.	12.6228	0.56614	0.0:0.9173:0.0:0.0827	.	1289;1305;1289	F5GX68;P26358-2;P26358	.;.;DNMT1_HUMAN	H	1305;1289;1289;1157	ENSP00000352516:R1305H;ENSP00000440457:R1289H;ENSP00000345739:R1289H	ENSP00000345739:R1289H	R	-	2	0	DNMT1	10111386	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.349000	0.79376	1.196000	0.43129	0.558000	0.71614	CGC	.		0.647	DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451166.1	NM_001379	
NSFL1C	55968	ucsc.edu;bcgsc.ca	37	20	1445015	1445015	+	Silent	SNP	C	C	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr20:1445015C>T	ENST00000216879.4	-	2	1029	c.162G>A	c.(160-162)tcG>tcA	p.S54S	NSFL1C_ENST00000350991.4_Silent_p.S54S|NSFL1C_ENST00000476071.1_Silent_p.S54S|NSFL1C_ENST00000381658.4_Intron|NSFL1C_ENST00000353088.2_Silent_p.S54S	NM_016143.4	NP_057227.2	Q9UNZ2	NSF1C_HUMAN	NSFL1 (p97) cofactor (p47)	54						chromosome (GO:0005694)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			breast(1)|large_intestine(5)|lung(6)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	16						GGGTTGCCTGCGAAATGGTCA	0.522																																					p.S54S													NSFL1C,NS,carcinoma,-1,2	NSFL1C	38	0			c.G162A						.						185.0	171.0	176.0					20																	1445015		2203	4300	6503	SO:0001819	synonymous_variant	55968	exon2			TGCCTGCGAAATG	AF112211	CCDS13015.1, CCDS13016.1, CCDS56175.1	20p13	2011-06-28			ENSG00000088833	ENSG00000088833		"""UBX domain containing"""	15912	protein-coding gene	gene with protein product	"""SHP1 homolog (S. cerevisiae)"", ""UBX domain protein 2C"""	606610				11042152	Standard	NM_016143		Approved	dJ776F14.1, p47, UBXD10, UBX1, UBXN2C	uc002wfc.3	Q9UNZ2	OTTHUMG00000031665	ENST00000216879.4:c.162G>A	20.37:g.1445015C>T		Somatic	57	0		WXS	Illumina HiSeq		39	4	NM_016143	A2A2L1|B2RD74|Q5JXA4|Q5JXA5|Q7Z533|Q9H102|Q9NVL9|Q9UI06	Silent	SNP	ENST00000216879.4	37	CCDS13015.1																																																																																			.		0.522	NSFL1C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077525.2	NM_016143	
TTI1	9675	ucsc.edu;bcgsc.ca	37	20	36612006	36612006	+	Missense_Mutation	SNP	G	G	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr20:36612006G>T	ENST00000373448.2	-	9	3360	c.3122C>A	c.(3121-3123)tCc>tAc	p.S1041Y	TTI1_ENST00000373447.3_Missense_Mutation_p.S1041Y|TTI1_ENST00000449821.1_Missense_Mutation_p.S1041Y	NM_014657.1	NP_055472.1	O43156	TTI1_HUMAN	TELO2 interacting protein 1	1041					regulation of TOR signaling (GO:0032006)	cytoplasm (GO:0005737)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)				breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	47						GAACCAGGTGGAGTCTGGGTC	0.617																																					p.S1041Y													.	TTI1	104	0			c.C3122A						.						66.0	52.0	57.0					20																	36612006		2203	4300	6503	SO:0001583	missense	9675	exon9			CAGGTGGAGTCTG	BC013121	CCDS13300.1	20q11.23	2011-11-10	2011-11-10	2010-06-22	ENSG00000101407	ENSG00000101407			29029	protein-coding gene	gene with protein product	"""smg-10 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	614425	"""KIAA0406"", ""Tel2 interacting protein 1 homolog (S. pombe)"""	KIAA0406		9455477, 20427287, 20371770	Standard	NM_014657		Approved	smg-10	uc002xhl.3	O43156	OTTHUMG00000032433	ENST00000373448.2:c.3122C>A	20.37:g.36612006G>T	ENSP00000362547:p.Ser1041Tyr	Somatic	51	0		WXS	Illumina HiSeq		38	4	NM_014657	D6W4K3|Q5JX67|Q96A38|Q9BR47|Q9H4K0	Missense_Mutation	SNP	ENST00000373448.2	37	CCDS13300.1	.	.	.	.	.	.	.	.	.	.	G	15.75	2.924533	0.52653	.	.	ENSG00000101407	ENST00000373448;ENST00000373447;ENST00000449821	T;T;T	0.67171	-0.25;-0.25;-0.25	5.38	1.0	0.19881	Armadillo-type fold (1);	0.561481	0.20269	N	0.095704	T	0.57975	0.2090	M	0.63428	1.95	0.34134	D	0.665614	P	0.44006	0.824	B	0.40410	0.328	T	0.65026	-0.6268	10	0.59425	D	0.04	-19.2968	5.6443	0.17580	0.0769:0.4097:0.386:0.1274	.	1041	O43156	TTI1_HUMAN	Y	1041	ENSP00000362547:S1041Y;ENSP00000362546:S1041Y;ENSP00000407270:S1041Y	ENSP00000362546:S1041Y	S	-	2	0	TTI1	36045420	0.996000	0.38824	1.000000	0.80357	0.993000	0.82548	1.263000	0.33004	0.392000	0.25172	0.655000	0.94253	TCC	.		0.617	TTI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079138.2	NM_014657	
FGD4	121512	bcgsc.ca	37	12	32786595	32786599	+	Frame_Shift_Del	DEL	AAGAA	AAGAA	-	rs139663812		TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	AAGAA	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr12:32786595_32786599delAAGAA	ENST00000427716.2	+	15	2298_2302	c.1874_1878delAAGAA	c.(1873-1878)gaagaafs	p.EE625fs	FGD4_ENST00000534526.2_Frame_Shift_Del_p.EE762fs|FGD4_ENST00000266482.3_Frame_Shift_Del_p.EE377fs|FGD4_ENST00000525053.1_Frame_Shift_Del_p.EE737fs|FGD4_ENST00000546442.1_Frame_Shift_Del_p.EE532fs|FGD4_ENST00000531134.1_Frame_Shift_Del_p.EE710fs	NM_139241.2	NP_640334.2	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4	625					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|microspike assembly (GO:0030035)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	27	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					ACAGACAGTGAAGAAAAGAAAAGAA	0.341																																					p.625_626del													.	FGD4	86	0			c.1874_1878del						.																																			SO:0001589	frameshift_variant	121512	exon15			ACAGTGAAGAAAA	AK057294	CCDS8727.1	12p11.1	2014-09-17	2004-08-24		ENSG00000139132	ENSG00000139132		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19125	protein-coding gene	gene with protein product		611104	"""FGD1 family, member 4"""			11527409	Standard	NM_139241		Approved	FRABP, frabin, ZFYVE6, CMT4H	uc001rkz.3	Q96M96	OTTHUMG00000137374	ENST00000427716.2:c.1874_1878delAAGAA	12.37:g.32786605_32786609delAAGAA	ENSP00000394487:p.Glu625fs	Somatic	199	0		WXS	Illumina HiSeq	Phase_1	185	4	NM_139241	Q6ULS2|Q8TCP6	Frame_Shift_Del	DEL	ENST00000427716.2	37	CCDS8727.1																																																																																			.		0.341	FGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268017.1	NM_139241	
TRIM17	51127	bcgsc.ca	37	1	228602548	228602548	+	Missense_Mutation	SNP	G	G	A			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr1:228602548G>A	ENST00000366697.2	-	1	1182	c.226C>T	c.(226-228)Ccc>Tcc	p.P76S	TRIM17_ENST00000366698.2_Missense_Mutation_p.P76S|TRIM17_ENST00000456946.2_Missense_Mutation_p.P76S|TRIM17_ENST00000295033.3_Missense_Mutation_p.P76S			Q9Y577	TRI17_HUMAN	tripartite motif containing 17	76					protein autoubiquitination (GO:0051865)	intracellular (GO:0005622)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)	10		Prostate(94;0.0724)				AGCCGGTTGGGCAGCAGGTTC	0.642																																					p.P76S													.	TRIM17	66	0			c.C226T						.						50.0	49.0	49.0					1																	228602548		2203	4300	6503	SO:0001583	missense	51127	exon2			GGTTGGGCAGCAG	AF156271	CCDS1571.1, CCDS44327.1	1q42	2013-01-09	2011-01-25	2001-11-30	ENSG00000162931	ENSG00000162931		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	13430	protein-coding gene	gene with protein product	"""ring finger protein 16"", ""RING finger protein terf"", ""testis RING finger protein"""	606123	"""tripartite motif-containing 17"""	RNF16		9792805, 10894938	Standard	NM_016102		Approved	terf, RBCC	uc001hsv.3	Q9Y577	OTTHUMG00000039974	ENST00000366697.2:c.226C>T	1.37:g.228602548G>A	ENSP00000355658:p.Pro76Ser	Somatic	93	0		WXS	Illumina HiSeq	Phase_1	89	5	NM_001024940	B4DVJ2|Q5VST8	Missense_Mutation	SNP	ENST00000366697.2	37	CCDS1571.1	.	.	.	.	.	.	.	.	.	.	G	16.29	3.082146	0.55861	.	.	ENSG00000162931	ENST00000366697;ENST00000366698;ENST00000295033;ENST00000456946;ENST00000479800;ENST00000355586	T;T;T;T;T;T	0.21361	2.01;2.01;2.01;2.01;2.01;2.01	4.82	3.82	0.43975	Zinc finger, RING/FYVE/PHD-type (1);	0.000000	0.41823	D	0.000817	T	0.34279	0.0892	L	0.41632	1.29	0.32483	N	0.541278	D;D	0.89917	1.0;0.979	D;P	0.97110	1.0;0.65	T	0.24119	-1.0169	10	0.45353	T	0.12	.	11.9667	0.53040	0.0:0.0:0.826:0.174	.	76;76	Q9Y577-2;Q9Y577	.;TRI17_HUMAN	S	76;76;76;76;49;76	ENSP00000355658:P76S;ENSP00000355659:P76S;ENSP00000295033:P76S;ENSP00000403312:P76S;ENSP00000430468:P49S;ENSP00000347794:P76S	ENSP00000295033:P76S	P	-	1	0	TRIM17	226669171	1.000000	0.71417	1.000000	0.80357	0.478000	0.33099	3.141000	0.50593	2.607000	0.88179	0.655000	0.94253	CCC	.		0.642	TRIM17-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096439.2	NM_016102	
FMN2	56776	bcgsc.ca	37	1	240371688	240371688	+	Silent	SNP	A	A	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr1:240371688A>T	ENST00000319653.9	+	5	3806	c.3576A>T	c.(3574-3576)ggA>ggT	p.G1192G		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1192	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CTCTACCTGGAGTGGGAATAC	0.672																																					p.G1192G													FMN2,NS,carcinoma,+1,1	FMN2	451	0			c.A3576T						.						17.0	18.0	18.0					1																	240371688		2199	4297	6496	SO:0001819	synonymous_variant	56776	exon5			ACCTGGAGTGGGA	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.3576A>T	1.37:g.240371688A>T		Somatic	151	6		WXS	Illumina HiSeq	Phase_1	148	10	NM_020066	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Silent	SNP	ENST00000319653.9	37	CCDS31069.2																																																																																			.		0.672	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
LINC01317	104355287	bcgsc.ca	37	2	34064966	34064966	+	lincRNA	SNP	C	C	A			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr2:34064966C>A	ENST00000366209.2	+	0	68																											CACGAGCAATCTTCCTCCAGC	0.478																																					.													.	.	.	0			.						.																																					344371	.			AGCAATCTTCCTC																													2.37:g.34064966C>A		Somatic	26	0		WXS	Illumina HiSeq	Phase_1	13	4	.		RNA	SNP	ENST00000366209.2	37																																																																																				.		0.478	AC009499.1-002	KNOWN	non_canonical_polymorphism|basic	lincRNA	lincRNA	OTTHUMT00000325406.1		
Unknown	0	bcgsc.ca	37	2	73597340	73597340	+	IGR	SNP	T	T	C			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr2:73597340T>C								RNU6-111P (71425 upstream) : ALMS1 (15545 downstream)																							GCTCATGCCATTGAAAACCCT	0.498																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			ATGCCATTGAAAA																													2.37:g.73597340T>C		Somatic	25	0		WXS	Illumina HiSeq	Phase_1	26	9	.		RNA	SNP		37																																																																																				.	0	0.498								
RAD54L2	23132	bcgsc.ca	37	3	51697126	51697126	+	Missense_Mutation	SNP	G	G	A			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr3:51697126G>A	ENST00000409535.2	+	22	4219	c.4094G>A	c.(4093-4095)aGc>aAc	p.S1365N	RAD54L2_ENST00000296477.3_Missense_Mutation_p.S1059N	NM_015106.2	NP_055921.2	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2 (S. cerevisiae)	1365						nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|transcription cofactor activity (GO:0003712)			NS(2)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|liver(2)|lung(9)|ovary(4)|skin(2)	31				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		GTCACTGCCAGCAACCCCTCC	0.587																																					p.S1365N													.	RAD54L2	94	0			c.G4094A						.						125.0	116.0	119.0					3																	51697126		2203	4300	6503	SO:0001583	missense	23132	exon22			CTGCCAGCAACCC	AB018352	CCDS33765.2	3p21.2	2006-01-17			ENSG00000164080	ENSG00000164080			29123	protein-coding gene	gene with protein product						9872452	Standard	NM_015106		Approved	KIAA0809, SRISNF2L	uc011bdt.2	Q9Y4B4	OTTHUMG00000152936	ENST00000409535.2:c.4094G>A	3.37:g.51697126G>A	ENSP00000386520:p.Ser1365Asn	Somatic	34	0		WXS	Illumina HiSeq	Phase_1	15	3	NM_015106	Q8TB57|Q9BV54	Missense_Mutation	SNP	ENST00000409535.2	37	CCDS33765.2	.	.	.	.	.	.	.	.	.	.	G	14.96	2.690057	0.48097	.	.	ENSG00000164080	ENST00000409535;ENST00000296477	D;D	0.94650	-3.41;-3.48	5.41	5.41	0.78517	.	0.181563	0.49916	D	0.000127	D	0.89291	0.6673	N	0.24115	0.695	0.80722	D	1	P;P	0.43477	0.808;0.808	B;B	0.35607	0.206;0.206	D	0.90983	0.4829	10	0.66056	D	0.02	-16.3112	16.3572	0.83239	0.0:0.0:1.0:0.0	.	1365;954	Q9Y4B4;B3KV54	ARIP4_HUMAN;.	N	1365;1059	ENSP00000386520:S1365N;ENSP00000296477:S1059N	ENSP00000296477:S1059N	S	+	2	0	RAD54L2	51672166	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.225000	0.51246	2.532000	0.85374	0.655000	0.94253	AGC	.		0.587	RAD54L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328700.2	NM_015106	
DSPP	1834	bcgsc.ca	37	4	88536880	88536880	+	Silent	SNP	C	C	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr4:88536880C>T	ENST00000282478.7	+	4	3099	c.3066C>T	c.(3064-3066)agC>agT	p.S1022S	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.S1022S			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1022	Asp/Ser-rich.			S -> G (in Ref. 3; AAD16120). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gtgacagcagcaatagcagtg	0.517																																					p.S1022S													.	DSPP	174	0			c.C3066T						.						43.0	36.0	39.0					4																	88536880		1598	2799	4397	SO:0001819	synonymous_variant	1834	exon5			CAGCAGCAATAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3066C>T	4.37:g.88536880C>T		Somatic	58	1		WXS	Illumina HiSeq	Phase_1	60	7	NM_014208	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.517	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
DSPP	1834	bcgsc.ca	37	4	88537225	88537225	+	Missense_Mutation	SNP	C	C	A	rs201608130|rs200679221		TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr4:88537225C>A	ENST00000282478.7	+	4	3444	c.3411C>A	c.(3409-3411)gaC>gaA	p.D1137E	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Missense_Mutation_p.D1137E			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1137	Asp/Ser-rich.			Missing (in Ref. 1; AAF42472 and 3; AAD16120). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		atagcagtgacagcagcaaca	0.562																																					p.D1137E													.	DSPP	174	0			c.C3411A						.						23.0	34.0	31.0					4																	88537225		1394	2644	4038	SO:0001583	missense	1834	exon5			CAGTGACAGCAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3411C>A	4.37:g.88537225C>A	ENSP00000282478:p.Asp1137Glu	Somatic	33	0		WXS	Illumina HiSeq	Phase_1	48	7	NM_014208	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	37	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	c	0.286	-0.983242	0.02180	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.88124	-2.34;-2.34	1.8	-0.124	0.13523	.	1.128020	0.07042	N	0.830287	T	0.77638	0.4160	L	0.34521	1.04	0.09310	N	0.999993	B	0.24768	0.111	B	0.21708	0.036	T	0.62595	-0.6821	10	0.46703	T	0.11	-1.6689	2.3607	0.04307	0.2942:0.5173:0.0:0.1885	.	1137	Q9NZW4	DSPP_HUMAN	E	1137	ENSP00000382213:D1137E;ENSP00000282478:D1137E	ENSP00000282478:D1137E	D	+	3	2	DSPP	88756249	0.765000	0.28485	0.234000	0.24042	0.018000	0.09664	-0.576000	0.05854	-0.053000	0.13289	0.291000	0.19559	GAC	.		0.562	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
B4GALT7	11285	bcgsc.ca	37	5	177035587	177035587	+	Silent	SNP	C	C	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr5:177035587C>T	ENST00000029410.5	+	4	798	c.687C>T	c.(685-687)gaC>gaT	p.D229D	RP11-1277A3.1_ENST00000499900.2_RNA	NM_007255.2	NP_009186.1	Q9UBV7	B4GT7_HUMAN	xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7	229	N-acetyl-D-glucosamine binding. {ECO:0000250}.				carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|chondroitin sulfate metabolic process (GO:0030204)|extracellular fibril organization (GO:0043206)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|negative regulation of fibroblast proliferation (GO:0048147)|protein N-linked glycosylation (GO:0006487)|proteoglycan metabolic process (GO:0006029)|small molecule metabolic process (GO:0044281)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|galactosyltransferase activity (GO:0008378)|manganese ion binding (GO:0030145)|xylosylprotein 4-beta-galactosyltransferase activity (GO:0046525)			endometrium(2)|large_intestine(1)|lung(1)|pancreas(1)|skin(1)|urinary_tract(1)	7	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCGAGGACGACGAGTTCTACC	0.657																																					p.D229D													.	B4GALT7	21	0			c.C687T						.						47.0	52.0	50.0					5																	177035587		2203	4300	6503	SO:0001819	synonymous_variant	11285	exon4			GGACGACGAGTTC	AB028600	CCDS4429.1	5q35.1-q35.3	2013-02-19	2012-07-18		ENSG00000027847	ENSG00000027847		"""Beta 4-glycosyltransferases"""	930	protein-coding gene	gene with protein product	"""galactosyltransferase I"""	604327				10438455, 10473568	Standard	NM_007255		Approved	XGALT-1, beta4Gal-T7	uc003mhy.3	Q9UBV7	OTTHUMG00000130851	ENST00000029410.5:c.687C>T	5.37:g.177035587C>T		Somatic	117	0		WXS	Illumina HiSeq	Phase_1	140	6	NM_007255	B3KN39|Q9UHN2	Silent	SNP	ENST00000029410.5	37	CCDS4429.1																																																																																			.		0.657	B4GALT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253421.1	NM_007255	
NUFIP1P	89761	bcgsc.ca	37	6	66803759	66803759	+	IGR	SNP	A	A	G			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr6:66803759A>G								EYS (386641 upstream) : AC002485.1 (265558 downstream)																							TGGGTATCACAGAATGTTGTG	0.468																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	89761	.			TATCACAGAATGT																													6.37:g.66803759A>G		Somatic	54	0		WXS	Illumina HiSeq	Phase_1	34	14	.		RNA	SNP		37																																																																																				.	0	0.468								
AC008163.4	0	bcgsc.ca	37	7	81190144	81190144	+	lincRNA	SNP	G	G	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr7:81190144G>T	ENST00000412900.2	-	0	193																											ATCGGTAAATGTAACTTTTCC	0.378																																					.													.	.	.	0			.						.																																					0	.			GTAAATGTAACTT																													7.37:g.81190144G>T		Somatic	70	0		WXS	Illumina HiSeq	Phase_1	56	4	.		RNA	SNP	ENST00000412900.2	37																																																																																				.		0.378	AC008163.4-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000340013.3		
PTPRN2	5799	bcgsc.ca	37	7	157406760	157406760	+	Intron	SNP	C	C	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr7:157406760C>T	ENST00000389418.4	-	15	2354				PTPRN2_ENST00000404321.2_Intron|PTPRN2_ENST00000389413.3_Intron|AC005481.5_ENST00000409610.1_Missense_Mutation_p.P14S|PTPRN2_ENST00000389416.4_Intron|PTPRN2_ENST00000409483.1_Intron	NM_002847.3	NP_002838.2	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N polypeptide 2						negative regulation of GTPase activity (GO:0034260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum lumen (GO:0005788)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(1)|lung(42)|ovary(4)|pleura(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	86	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		GACTGCTCAACCGGCCAATCA	0.582																																					.													.	PTPRN2	243	0			.						.																																			SO:0001627	intron_variant	0	.			GCTCAACCGGCCA	AB002385	CCDS5947.1, CCDS5948.1, CCDS5949.1	7q36	2011-06-09			ENSG00000155093	ENSG00000155093		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9677	protein-coding gene	gene with protein product	"""IAR PTPRP"""	601698				8954911, 9220540	Standard	NM_130842		Approved	KIAA0387, phogrin, ICAAR, IA-2beta	uc003wno.3	Q92932	OTTHUMG00000152646	ENST00000389418.4:c.2344+7293G>A	7.37:g.157406760C>T		Somatic	38	0		WXS	Illumina HiSeq	Phase_1	33	4	.	E9PC57|Q8N4I5|Q92662|Q9Y4F8|Q9Y4I6	Missense_Mutation	SNP	ENST00000389418.4	37	CCDS5947.1	.	.	.	.	.	.	.	.	.	.	C	6.348	0.432305	0.12045	.	.	ENSG00000222012	ENST00000409610	.	.	.	1.12	-1.13	0.09775	.	.	.	.	.	T	0.33933	0.0880	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.37934	-0.9684	5	0.87932	D	0	.	2.5033	0.04638	0.0:0.4372:0.3204:0.2425	.	.	.	.	S	14	.	ENSP00000387291:P14S	P	+	1	0	AC005481.5	157099521	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.698000	0.25571	-0.437000	0.07243	-0.414000	0.06135	CCG	.		0.582	PTPRN2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353214.1		
MYO5BP3	441442	bcgsc.ca	37	9	68358153	68358153	+	IGR	SNP	G	G	A			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr9:68358153G>A								RP11-149F8.5 (17509 upstream) : RP11-764K9.1 (39724 downstream)																							TGAAGAAGGTGGCAGGTGTTG	0.483																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	441442	.			GAAGGTGGCAGGT																													9.37:g.68358153G>A		Somatic	150	8		WXS	Illumina HiSeq	Phase_1	98	19	.		RNA	SNP		37																																																																																				.	0	0.483								
OR5AN1	390195	bcgsc.ca	37	11	59132169	59132169	+	Missense_Mutation	SNP	C	C	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr11:59132169C>T	ENST00000313940.2	+	1	285	c.238C>T	c.(238-240)Ccc>Tcc	p.P80S		NM_001004729.1	NP_001004729.1	Q8NGI8	O5AN1_HUMAN	olfactory receptor, family 5, subfamily AN, member 1	80						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	21						CTCCACAGTCCCCAAGATGCT	0.413																																					p.P80S													.	OR5AN1	49	0			c.C238T						.						183.0	175.0	178.0					11																	59132169		2201	4295	6496	SO:0001583	missense	390195	exon1			ACAGTCCCCAAGA	AB065806	CCDS31559.1	11q12.1	2012-08-09			ENSG00000176495	ENSG00000176495		"""GPCR / Class A : Olfactory receptors"""	15255	protein-coding gene	gene with protein product		615702					Standard	NM_001004729		Approved		uc010rks.2	Q8NGI8	OTTHUMG00000167337	ENST00000313940.2:c.238C>T	11.37:g.59132169C>T	ENSP00000320302:p.Pro80Ser	Somatic	59	0		WXS	Illumina HiSeq	Phase_1	34	3	NM_001004729	B9EIS2|Q6IEV4	Missense_Mutation	SNP	ENST00000313940.2	37	CCDS31559.1	.	.	.	.	.	.	.	.	.	.	C	17.73	3.461199	0.63513	.	.	ENSG00000176495	ENST00000313940	T	0.01854	4.6	4.42	4.42	0.53409	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000080	T	0.21962	0.0529	H	0.96691	3.865	0.47407	D	0.999411	D	0.89917	1.0	D	0.87578	0.998	T	0.40040	-0.9584	10	0.87932	D	0	-28.4479	15.9406	0.79750	0.0:1.0:0.0:0.0	.	80	Q8NGI8	O5AN1_HUMAN	S	80	ENSP00000320302:P80S	ENSP00000320302:P80S	P	+	1	0	OR5AN1	58888745	1.000000	0.71417	0.665000	0.29768	0.359000	0.29487	7.313000	0.78978	2.150000	0.67090	0.655000	0.94253	CCC	.		0.413	OR5AN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394231.1	NM_001004729	
KDM5A	5927	bcgsc.ca	37	12	498247	498247	+	Missense_Mutation	SNP	A	A	C			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr12:498247A>C	ENST00000399788.2	-	1	373	c.11T>G	c.(10-12)gTg>gGg	p.V4G	KDM5A_ENST00000382815.4_Missense_Mutation_p.V4G|CCDC77_ENST00000540180.1_5'Flank|CCDC77_ENST00000422000.1_5'Flank	NM_001042603.1	NP_001036068.1	P29375	KDM5A_HUMAN	lysine (K)-specific demethylase 5A	4					chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|multicellular organismal development (GO:0007275)|negative regulation of histone deacetylase activity (GO:1901726)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(29)|ovary(1)|prostate(5)|skin(6)|stomach(1)|urinary_tract(2)	77						CCCCGGCCCCACGCCCGCCAT	0.682			T	NUP98	AML																																p.V4G				Dom	yes		12	12p11	5927	"""lysine (K)-specific demethylase 5A, JARID1A"""		L	.	KDM5A	307	0			c.T11G						.						8.0	9.0	9.0					12																	498247		1757	3971	5728	SO:0001583	missense	5927	exon1			GGCCCCACGCCCG		CCDS41736.1	12p13.33	2013-01-28	2009-04-06	2009-04-06	ENSG00000073614	ENSG00000073614		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	9886	protein-coding gene	gene with protein product		180202	"""retinoblastoma-binding protein 2"", ""Jumonji, AT rich interactive domain 1A (RBBP2-like)"", ""jumonji, AT rich interactive domain 1A"""	RBBP2, JARID1A		1857421	Standard	NM_001042603		Approved		uc001qif.1	P29375	OTTHUMG00000168055	ENST00000399788.2:c.11T>G	12.37:g.498247A>C	ENSP00000382688:p.Val4Gly	Somatic	136	9		WXS	Illumina HiSeq	Phase_1	103	33	NM_001042603	A8MV76|Q4LE72|Q86XZ1	Missense_Mutation	SNP	ENST00000399788.2	37	CCDS41736.1	.	.	.	.	.	.	.	.	.	.	A	10.98	1.504977	0.26949	.	.	ENSG00000073614	ENST00000261253;ENST00000399787;ENST00000399788;ENST00000382815;ENST00000544760;ENST00000535014;ENST00000543507	D;D;D;T;D	0.85556	-2.0;-1.82;-1.58;-1.1;-1.68	4.8	-0.204	0.13200	.	0.799243	0.10869	N	0.625114	T	0.69151	0.3079	N	0.08118	0	0.44316	D	0.997191	B;B;B;B	0.20459	0.015;0.026;0.027;0.045	B;B;B;B	0.22601	0.018;0.025;0.018;0.04	T	0.57820	-0.7745	10	0.87932	D	0	-3.6326	7.0779	0.25215	0.5397:0.0:0.4603:0.0	.	4;4;4;4	B4DVX3;F5H1F7;P29375;P29375-2	.;.;KDM5A_HUMAN;.	G	4	ENSP00000382688:V4G;ENSP00000372265:V4G;ENSP00000440622:V4G;ENSP00000443854:V4G;ENSP00000444251:V4G	ENSP00000261253:V4G	V	-	2	0	KDM5A	368508	0.032000	0.19561	0.985000	0.45067	0.968000	0.65278	-0.025000	0.12413	0.046000	0.15833	0.402000	0.26972	GTG	.		0.682	KDM5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397812.1	NM_005056	
KDM5A	5927	bcgsc.ca	37	12	498253	498253	+	Missense_Mutation	SNP	G	G	C			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr12:498253G>C	ENST00000399788.2	-	1	367	c.5C>G	c.(4-6)gCg>gGg	p.A2G	KDM5A_ENST00000382815.4_Missense_Mutation_p.A2G|CCDC77_ENST00000540180.1_5'Flank|CCDC77_ENST00000422000.1_5'Flank	NM_001042603.1	NP_001036068.1	P29375	KDM5A_HUMAN	lysine (K)-specific demethylase 5A	2					chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|multicellular organismal development (GO:0007275)|negative regulation of histone deacetylase activity (GO:1901726)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(29)|ovary(1)|prostate(5)|skin(6)|stomach(1)|urinary_tract(2)	77						CCCCACGCCCGCCATTGCAAC	0.682			T	NUP98	AML																																p.A2G				Dom	yes		12	12p11	5927	"""lysine (K)-specific demethylase 5A, JARID1A"""		L	.	KDM5A	307	0			c.C5G						.						7.0	8.0	8.0					12																	498253		1427	3426	4853	SO:0001583	missense	5927	exon1			ACGCCCGCCATTG		CCDS41736.1	12p13.33	2013-01-28	2009-04-06	2009-04-06	ENSG00000073614	ENSG00000073614		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	9886	protein-coding gene	gene with protein product		180202	"""retinoblastoma-binding protein 2"", ""Jumonji, AT rich interactive domain 1A (RBBP2-like)"", ""jumonji, AT rich interactive domain 1A"""	RBBP2, JARID1A		1857421	Standard	NM_001042603		Approved		uc001qif.1	P29375	OTTHUMG00000168055	ENST00000399788.2:c.5C>G	12.37:g.498253G>C	ENSP00000382688:p.Ala2Gly	Somatic	118	7		WXS	Illumina HiSeq	Phase_1	87	27	NM_001042603	A8MV76|Q4LE72|Q86XZ1	Missense_Mutation	SNP	ENST00000399788.2	37	CCDS41736.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.727637	0.89390	.	.	ENSG00000073614	ENST00000261253;ENST00000399787;ENST00000399788;ENST00000382815;ENST00000544760;ENST00000535014;ENST00000543507	D;D;D;T;D	0.85258	-1.96;-1.78;-1.67;-1.17;-1.73	4.8	3.91	0.45181	.	0.080637	0.49305	D	0.000155	T	0.74045	0.3665	N	0.14661	0.345	0.35888	D	0.829473	B;B;B;B	0.22683	0.069;0.073;0.043;0.073	B;B;B;B	0.24974	0.057;0.045;0.02;0.045	T	0.76005	-0.3117	10	0.87932	D	0	-12.3229	11.3486	0.49575	0.0844:0.0:0.9156:0.0	.	2;2;2;2	B4DVX3;F5H1F7;P29375;P29375-2	.;.;KDM5A_HUMAN;.	G	2	ENSP00000382688:A2G;ENSP00000372265:A2G;ENSP00000440622:A2G;ENSP00000443854:A2G;ENSP00000444251:A2G	ENSP00000261253:A2G	A	-	2	0	KDM5A	368514	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	4.981000	0.63819	1.240000	0.43803	0.491000	0.48974	GCG	.		0.682	KDM5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397812.1	NM_005056	
AICDA	57379	bcgsc.ca	37	12	8757981	8757981	+	Missense_Mutation	SNP	G	G	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr12:8757981G>T	ENST00000229335.6	-	3	360	c.257C>A	c.(256-258)cCc>cAc	p.P86H	AICDA_ENST00000537228.1_Missense_Mutation_p.P86H	NM_020661.2	NP_065712.1	Q9GZX7	AICDA_HUMAN	activation-induced cytidine deaminase	86					B cell differentiation (GO:0030183)|cellular response to lipopolysaccharide (GO:0071222)|DNA demethylation (GO:0080111)|isotype switching (GO:0045190)|mRNA processing (GO:0006397)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|somatic diversification of immunoglobulins (GO:0016445)|somatic hypermutation of immunoglobulin genes (GO:0016446)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cytidine deaminase activity (GO:0004126)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)|ovary(2)|pancreas(1)	16	Lung SC(5;0.184)					GTCGTAGCAGGGGCTCCAGGA	0.622																																					p.P86H	GBM(62;896 1067 5527 26594 30137)												.	AICDA	37	0			c.C257A						.						45.0	50.0	48.0					12																	8757981		2119	4239	6358	SO:0001583	missense	57379	exon3			TAGCAGGGGCTCC	AB040430	CCDS41747.1	12p13	2014-09-17			ENSG00000111732	ENSG00000111732		"""Apolipoprotein B mRNA editing enzymes"""	13203	protein-coding gene	gene with protein product		605257					Standard	NM_020661		Approved	HIGM2, CDA2, ARP2, AID	uc001qur.2	Q9GZX7	OTTHUMG00000168676	ENST00000229335.6:c.257C>A	12.37:g.8757981G>T	ENSP00000229335:p.Pro86His	Somatic	53	0		WXS	Illumina HiSeq	Phase_1	57	4	NM_020661	Q6QJ81|Q8NFC1	Missense_Mutation	SNP	ENST00000229335.6	37	CCDS41747.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.4|26.4	4.732742|4.732742	0.89482|0.89482	.|.	.|.	ENSG00000111732|ENSG00000111732	ENST00000229335;ENST00000537228|ENST00000543081;ENST00000545512	D;D|D;D	0.97888|0.97888	-4.59;-4.59|-4.59;-4.59	5.32|5.32	5.32|5.32	0.75619|0.75619	APOBEC-like, N-terminal (1);APOBEC/CMP deaminase, zinc-binding (1);Cytidine deaminase-like (1);|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	D|D	0.99001|0.99001	0.9659|0.9659	M|M	0.93062|0.93062	3.375|3.375	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;1.0;1.0|.	D|D	0.99651|0.99651	1.0991|1.0991	10|8	0.87932|0.87932	D|D	0|0	-32.238|-32.238	17.5616|17.5616	0.87909|0.87909	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	86;86;86|.	Q9GZX7;Q6QJ80;Q6QJ81|.	AICDA_HUMAN;.;.|.	H|T	86|85	ENSP00000229335:P86H;ENSP00000445691:P86H|ENSP00000439103:P85T;ENSP00000443060:P85T	ENSP00000229335:P86H|ENSP00000439103:P85T	P|P	-|-	2|1	0|0	AICDA|AICDA	8649248|8649248	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	9.178000|9.178000	0.94855|0.94855	2.485000|2.485000	0.83878|0.83878	0.462000|0.462000	0.41574|0.41574	CCC|CCT	.		0.622	AICDA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400575.1	NM_020661	
NEK3	4752	bcgsc.ca	37	13	52726745	52726745	+	Splice_Site	SNP	T	T	A	rs373174576		TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr13:52726745T>A	ENST00000400357.2	-	4	1685	c.392A>T	c.(391-393)aAg>aTg	p.K131M	NEK3_ENST00000452082.2_Splice_Site_p.K152M|NEK3_ENST00000339406.3_Splice_Site_p.K131M|NEK3_ENST00000378101.2_Splice_Site_p.K131M			P51956	NEK3_HUMAN	NIMA-related kinase 3	131	Interaction with VAV2.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|stomach(2)	18		Breast(56;0.000207)|Lung NSC(96;0.00145)|Prostate(109;0.034)|Hepatocellular(98;0.065)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.81e-08)		TCCACTCACCTTGGACTTGAT	0.343																																					p.K131M													.	NEK3	41	0			c.A392T						.						142.0	127.0	132.0					13																	52726745		1828	4094	5922	SO:0001630	splice_region_variant	4752	exon5			CTCACCTTGGACT	AK290259, BC019916	CCDS73576.1	13q14.2-q21.1	2014-07-17	2012-11-15		ENSG00000136098	ENSG00000136098	2.7.11.1		7746	protein-coding gene	gene with protein product	"""serine/threonine-protein kinase NEK3"", ""phosphorylase B kinase kinase"", ""glycogen synthase A kinase"", ""hydroxyalkyl-protein kinase"""	604044	"""NIMA (never in mitosis gene a)-related kinase 3"""			8274451, 7522034	Standard	NM_002498		Approved	HSPK36, MGC29949	uc010tgy.2	P51956	OTTHUMG00000016958	ENST00000400357.2:c.393+1A>T	13.37:g.52726745T>A		Somatic	48	0		WXS	Illumina HiSeq	Phase_1	31	4	NM_002498	A8K2J4|Q5TAP2|Q8J023|Q8WUN5	Missense_Mutation	SNP	ENST00000400357.2	37	CCDS53871.1	.	.	.	.	.	.	.	.	.	.	T	27.0	4.788520	0.90367	.	.	ENSG00000136098	ENST00000339406;ENST00000378101;ENST00000400357;ENST00000452082;ENST00000547422	T;T;T;T;T	0.50813	1.81;1.81;1.81;1.81;0.73	5.93	5.93	0.95920	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.046274	0.85682	D	0.000000	T	0.70185	0.3195	.	.	.	0.58432	D	0.999992	P;D;D	0.89917	0.888;1.0;1.0	P;D;D	0.97110	0.823;1.0;1.0	T	0.72421	-0.4299	9	0.52906	T	0.07	.	16.3766	0.83401	0.0:0.0:0.0:1.0	.	131;152;125	P51956;Q6ZN64;F8VS47	NEK3_HUMAN;.;.	M	131;131;131;152;125	ENSP00000339429:K131M;ENSP00000367341:K131M;ENSP00000383210:K131M;ENSP00000404197:K152M;ENSP00000448716:K125M	ENSP00000448782:K131M	K	-	2	0	NEK3	51624746	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.381000	0.79718	2.263000	0.75096	0.533000	0.62120	AAG	.		0.343	NEK3-002	KNOWN	upstream_ATG|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045047.3		Missense_Mutation
NPM1P22	390411	bcgsc.ca	37	13	68406867	68406867	+	IGR	SNP	C	C	G			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr13:68406867C>G								LINC00364 (452759 upstream) : RN7SL761P (861070 downstream)																							CCATGTCCATCGAATCTTCCA	0.483																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	390411	.			GTCCATCGAATCT																													13.37:g.68406867C>G		Somatic	36	0		WXS	Illumina HiSeq	Phase_1	19	6	.		RNA	SNP		37																																																																																				.	0	0.483								
TRAV8-1	28685	bcgsc.ca	37	14	22266022	22266022	+	RNA	SNP	G	G	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr14:22266022G>T	ENST00000390430.2	+	0	437									T cell receptor alpha variable 8-1																		TCTGTGCAGTGGAGTGACACA	0.458																																					.													.	.	.	0			.						.						68.0	66.0	66.0					14																	22266022		1909	4116	6025			28685	.			TGCAGTGGAGTGA	AE000659		14q11.2	2012-02-07			ENSG00000211782	ENSG00000211782		"""T cell receptors / TRA locus"""	12146	other	T cell receptor gene						8188290	Standard	NG_001332		Approved				OTTHUMG00000168986		14.37:g.22266022G>T		Somatic	76	0		WXS	Illumina HiSeq	Phase_1	60	4	.		RNA	SNP	ENST00000390430.2	37																																																																																				.		0.458	TRAV8-1-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TR_V_gene	OTTHUMT00000401884.1	NG_001332	
FOXN3	1112	bcgsc.ca	37	14	89629228	89629228	+	Missense_Mutation	SNP	G	G	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr14:89629228G>T	ENST00000345097.4	-	7	1119	c.1003C>A	c.(1003-1005)Cac>Aac	p.H335N	FOXN3_ENST00000261302.5_Missense_Mutation_p.H335N|FOXN3_ENST00000557258.1_Missense_Mutation_p.H313N|FOXN3_ENST00000555353.1_Missense_Mutation_p.H313N	NM_001085471.1	NP_001078940.1	O00409	FOXN3_HUMAN	forkhead box N3	335					mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|large_intestine(4)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CTGTAGTTGTGATCCTCCTTG	0.617																																					p.H335N													.	FOXN3	78	0			c.C1003A						.						35.0	25.0	29.0					14																	89629228		2169	4262	6431	SO:0001583	missense	1112	exon7			AGTTGTGATCCTC		CCDS32138.1, CCDS41977.1	14q32.11	2012-04-17	2007-05-02	2007-05-02	ENSG00000053254	ENSG00000053254		"""Forkhead boxes"""	1928	protein-coding gene	gene with protein product		602628	"""chromosome 14 open reading frame 116"", ""checkpoint suppressor 1"""	C14orf116, CHES1		9154802	Standard	NM_005197		Approved		uc001xxo.4	O00409	OTTHUMG00000170898	ENST00000345097.4:c.1003C>A	14.37:g.89629228G>T	ENSP00000343288:p.His335Asn	Somatic	42	0		WXS	Illumina HiSeq	Phase_1	34	5	NM_001085471	Q96II7|Q9UIE7	Missense_Mutation	SNP	ENST00000345097.4	37	CCDS41977.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.192436	0.78902	.	.	ENSG00000053254	ENST00000345097;ENST00000261302;ENST00000557258;ENST00000555353	T;T;T;T	0.62105	0.05;0.05;0.05;0.05	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.79269	0.4417	M	0.66939	2.045	0.80722	D	1	D;D	0.71674	0.997;0.998	D;D	0.78314	0.909;0.991	T	0.78831	-0.2049	10	0.62326	D	0.03	.	19.9882	0.97356	0.0:0.0:1.0:0.0	.	335;313	O00409;O00409-2	FOXN3_HUMAN;.	N	335;335;313;313	ENSP00000343288:H335N;ENSP00000261302:H335N;ENSP00000452005:H313N;ENSP00000452227:H313N	ENSP00000261302:H335N	H	-	1	0	FOXN3	88698981	1.000000	0.71417	0.983000	0.44433	0.997000	0.91878	9.828000	0.99408	2.824000	0.97209	0.655000	0.94253	CAC	.		0.617	FOXN3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410902.2	NM_005197	
LIPC	3990	bcgsc.ca	37	15	58834114	58834114	+	Missense_Mutation	SNP	G	G	A	rs372054789		TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr15:58834114G>A	ENST00000356113.6	+	5	1019	c.404G>A	c.(403-405)cGc>cAc	p.R135H	LIPC_ENST00000299022.5_Missense_Mutation_p.R135H|LIPC_ENST00000414170.3_Missense_Mutation_p.R135H|LIPC_ENST00000433326.2_Intron			P11150	LIPC_HUMAN	lipase, hepatic	135					cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|chylomicron remnant clearance (GO:0034382)|fatty acid biosynthetic process (GO:0006633)|high-density lipoprotein particle remodeling (GO:0034375)|intermediate-density lipoprotein particle remodeling (GO:0034373)|low-density lipoprotein particle remodeling (GO:0034374)|phosphatidylcholine catabolic process (GO:0034638)|reverse cholesterol transport (GO:0043691)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|very-low-density lipoprotein particle remodeling (GO:0034372)	extracellular space (GO:0005615)|high-density lipoprotein particle (GO:0034364)	apolipoprotein binding (GO:0034185)|heparin binding (GO:0008201)|low-density lipoprotein particle binding (GO:0030169)|phospholipase activity (GO:0004620)|triglyceride lipase activity (GO:0004806)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Colorectal(260;0.215)		GBM - Glioblastoma multiforme(80;0.00213)|all cancers(107;0.00548)		ATCGCCGTCCGCAACACCCGC	0.657																																					p.R135H													.	LIPC	56	0			c.G404A						.	G	HIS/ARG	1,4383	2.1+/-5.4	0,1,2191	52.0	41.0	45.0		404	2.6	0.9	15		45	0,8584		0,0,4292	no	missense	LIPC	NM_000236.2	29	0,1,6483	AA,AG,GG		0.0,0.0228,0.0077	benign	135/500	58834114	1,12967	2192	4292	6484	SO:0001583	missense	3990	exon3			CCGTCCGCAACAC		CCDS10166.1	15q21-q23	2012-10-02			ENSG00000166035	ENSG00000166035	3.1.1.3		6619	protein-coding gene	gene with protein product		151670					Standard	NM_000236		Approved	HL, HTGL	uc002afa.2	P11150	OTTHUMG00000132632	ENST00000356113.6:c.404G>A	15.37:g.58834114G>A	ENSP00000348425:p.Arg135His	Somatic	68	0		WXS	Illumina HiSeq	Phase_1	54	4	NM_000236	A2RUB4|A8K9B6|O43571|P78529|Q99465	Missense_Mutation	SNP	ENST00000356113.6	37	CCDS10166.1	.	.	.	.	.	.	.	.	.	.	G	11.63	1.695860	0.30052	2.28E-4	0.0	ENSG00000166035	ENST00000356113;ENST00000414170;ENST00000299022	D;D;D	0.91011	-2.77;-2.77;-2.77	4.53	2.61	0.31194	Lipase, N-terminal (1);	0.282367	0.35970	N	0.002871	T	0.81987	0.4939	L	0.33668	1.02	0.80722	D	1	B	0.31581	0.329	B	0.28916	0.096	T	0.73672	-0.3909	10	0.35671	T	0.21	.	6.1446	0.20278	0.4404:0.0:0.5596:0.0	.	135	P11150	LIPC_HUMAN	H	135	ENSP00000348425:R135H;ENSP00000395569:R135H;ENSP00000299022:R135H	ENSP00000299022:R135H	R	+	2	0	LIPC	56621406	0.933000	0.31639	0.917000	0.36280	0.293000	0.27360	1.583000	0.36579	0.503000	0.28060	0.407000	0.27541	CGC	.		0.657	LIPC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416209.1		
PCMTD1P2	100287647	bcgsc.ca	37	16	33941726	33941726	+	IGR	SNP	G	G	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr16:33941726G>T								RP11-812E19.3 (163982 upstream) : AC136932.2 (4222 downstream)																							ATGATGAGATGCAGGCCAAGG	0.398																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	100287647	.			TGAGATGCAGGCC																													16.37:g.33941726G>T		Somatic	154	6		WXS	Illumina HiSeq	Phase_1	156	10	.		RNA	SNP		37																																																																																				.	0	0.398								
Unknown	0	bcgsc.ca	37	16	34327734	34327734	+	IGR	SNP	T	T	A			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr16:34327734T>A								CTD-2144E22.6 (69113 upstream) : RP11-244B22.11 (50358 downstream)																							GTGTGCAGCATCCCTTGAGGG	0.413																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			GCAGCATCCCTTG																													16.37:g.34327734T>A		Somatic	68	0		WXS	Illumina HiSeq	Phase_1	42	12	.		RNA	SNP		37																																																																																				.	0	0.413								
LPHN1	22859	bcgsc.ca	37	19	14266967	14266967	+	Missense_Mutation	SNP	C	C	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr19:14266967C>T	ENST00000340736.6	-	18	3392	c.3095G>A	c.(3094-3096)aGc>aAc	p.S1032N	CTB-55O6.12_ENST00000588658.1_RNA|CTB-55O6.12_ENST00000592086.1_RNA|LPHN1_ENST00000361434.3_Missense_Mutation_p.S1027N|CTB-55O6.12_ENST00000588387.1_RNA	NM_001008701.2	NP_001008701.1	O94910	LPHN1_HUMAN	latrophilin 1	1032					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|heterophilic cell-cell adhesion (GO:0007157)|neuropeptide signaling pathway (GO:0007218)|positive regulation of synapse maturation (GO:0090129)	axon (GO:0030424)|cell junction (GO:0030054)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CACAGATGAGCTTCGGATCAT	0.657																																					p.S1032N													.	LPHN1	107	0			c.G3095A						.						71.0	59.0	63.0					19																	14266967		2203	4299	6502	SO:0001583	missense	22859	exon18			GATGAGCTTCGGA	AB020628	CCDS12307.1, CCDS32928.1	19p13.2	2014-08-08				ENSG00000072071		"""-"", ""GPCR / Class B : Orphans"""	20973	protein-coding gene	gene with protein product						10994649	Standard	NM_014921		Approved	KIAA0821, CIRL1, LEC2	uc010xnn.2	O94910		ENST00000340736.6:c.3095G>A	19.37:g.14266967C>T	ENSP00000340688:p.Ser1032Asn	Somatic	46	0		WXS	Illumina HiSeq	Phase_1	40	5	NM_001008701	Q96IE7|Q9BU07|Q9HAR3	Missense_Mutation	SNP	ENST00000340736.6	37	CCDS32928.1	.	.	.	.	.	.	.	.	.	.	C	14.81	2.645360	0.47258	.	.	ENSG00000072071	ENST00000340736;ENST00000361434	T;T	0.43294	0.95;0.95	4.72	4.72	0.59763	GPCR, family 2-like (1);	0.233772	0.43416	D	0.000568	T	0.30166	0.0756	L	0.28054	0.825	0.30659	N	0.754635	B;B	0.02656	0.0;0.0	B;B	0.09377	0.002;0.004	T	0.25745	-1.0123	10	0.52906	T	0.07	.	11.1959	0.48713	0.0:0.8138:0.1862:0.0	.	1027;1032	O94910-2;O94910	.;LPHN1_HUMAN	N	1032;1027	ENSP00000340688:S1032N;ENSP00000355328:S1027N	ENSP00000340688:S1032N	S	-	2	0	LPHN1	14127967	0.995000	0.38212	0.952000	0.39060	0.985000	0.73830	2.406000	0.44557	2.178000	0.69098	0.555000	0.69702	AGC	.		0.657	LPHN1-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459696.1	NM_014921	
WASF4P	644739	bcgsc.ca	37	X	47663663	47663663	+	IGR	SNP	A	A	C			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chrX:47663663A>C								CXXC1P1 (67636 upstream) : ZNF81 (32637 downstream)																							CTGCCCCTCCACCACCCCCGC	0.607																																					.													.	.	.	0			.						.						41.0	41.0	41.0					X																	47663663		2203	4300	6503	SO:0001628	intergenic_variant	644739	.			CCCTCCACCACCC																													X.37:g.47663663A>C		Somatic	182	10		WXS	Illumina HiSeq	Phase_1	137	28	.		RNA	SNP		37																																																																																				.	0	0.607								
TERF1P4	648283	bcgsc.ca	37	X	83004574	83004574	+	IGR	SNP	T	T	C			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chrX:83004574T>C								RP3-326L13.3 (237439 upstream) : CYLC1 (111579 downstream)																							CTTCTGCTTCTTTAAAGTTGC	0.303																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	648283	.			TGCTTCTTTAAAG																													X.37:g.83004574T>C		Somatic	185	0		WXS	Illumina HiSeq	Phase_1	162	5	.		RNA	SNP		37																																																																																				.	0	0.303								
Unknown	0	bcgsc.ca	37	X	101034086	101034086	+	IGR	SNP	G	G	A			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chrX:101034086G>A								RNU6-587P (87428 upstream) : NXF5 (52998 downstream)																							ACAAATCCTCGGGTTCGAGAC	0.502																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			ATCCTCGGGTTCG																													X.37:g.101034086G>A		Somatic	103	1		WXS	Illumina HiSeq	Phase_1	83	20	.		RNA	SNP		37																																																																																				.	0	0.502								
FAT1	2195	hgsc.bcm.edu	37	4	187549428	187549428	+	Missense_Mutation	SNP	C	C	A	rs2304867	byFrequency	TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr4:187549428C>A	ENST00000441802.2	-	9	4899	c.4690G>T	c.(4690-4692)Gct>Tct	p.A1564S		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	1564	Cadherin 14. {ECO:0000255|PROSITE- ProRule:PRU00043}.		A -> T (in dbSNP:rs2304867).		actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						TAGGAGGAAGCGGTGAACCAC	0.502										HNSCC(5;0.00058)																											p.A1564S	Colon(197;1040 2055 4143 4984 49344)	.											FAT1,colon,carcinoma,0,2	FAT1	0	0			c.G4690T						.						51.0	54.0	53.0					4																	187549428		2097	4236	6333	SO:0001583	missense	2195	exon9			AGGAAGCGGTGAA	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.4690G>T	4.37:g.187549428C>A	ENSP00000406229:p.Ala1564Ser	Somatic	29	0		WXS	Illumina HiSeq	.	16	2	NM_005245		Missense_Mutation	SNP	ENST00000441802.2	37	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	C	2.695	-0.272375	0.05716	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.01192	5.2	5.49	3.09	0.35607	Cadherin (2);Cadherin-like (1);	0.170756	0.64402	N	0.000004	T	0.00440	0.0014	N	0.00966	-1.09	0.34605	P	0.28308500000000003	B	0.02656	0.0	B	0.04013	0.001	T	0.36089	-0.9762	9	0.02654	T	1	.	7.3645	0.26766	0.1287:0.0695:0.0:0.8018	.	1564	Q14517	FAT1_HUMAN	S	1564;1563	ENSP00000406229:A1564S	ENSP00000260147:A1563S	A	-	1	0	FAT1	187786422	0.993000	0.37304	0.998000	0.56505	0.760000	0.43138	2.569000	0.45973	0.530000	0.28619	-1.093000	0.02169	GCT	.		0.502	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
SSPO	23145	hgsc.bcm.edu	37	7	149503923	149503924	+	RNA	DNP	TA	TA	GT			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	TA	TA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr7:149503923_149503924TA>GT	ENST00000378016.2	+	0	8747_8748							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CCGGGATAGATAGAGTGTACGG	0.658																																					.		.											.	.	.	0			c.A8748T						.																																					23145	exon60			ATAGATAGAGTGT	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884	Exception_encountered	7.37:g.149503923_149503924delinsGT		Somatic	71	0		WXS	Illumina HiSeq	.	62	4	NM_198455	Q76B61	Silent	DNP	ENST00000378016.2	37																																																																																				.		0.658	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript			
THSD7B	80731	hgsc.bcm.edu;bcgsc.ca	37	2	137988805	137988805	+	Splice_Site	SNP	G	G	T			TCGA-WD-A7RX-01A-12D-A417-09	TCGA-WD-A7RX-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3f045142-24cb-478a-8b21-9adb37e13d6c	f5ded799-618b-42f4-a824-a8194a599dbd	g.chr2:137988805G>T	ENST00000409968.1	+	8	2093	c.1915G>T	c.(1915-1917)Ggt>Tgt	p.G639C	THSD7B_ENST00000272643.3_Splice_Site_p.G639C|THSD7B_ENST00000543459.1_Intron|THSD7B_ENST00000413152.2_Splice_Site_p.G608C			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	639	TSP type-1 7. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		GGCTGGGGAAGGTGAGTAACA	0.423																																					.		.											.	.	.	0			.						.						31.0	31.0	31.0					2																	137988805		1879	4130	6009	SO:0001630	splice_region_variant	80731	p.G639C			GGGGAAGGTGAGT			2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.1915+1G>T	2.37:g.137988805G>T		Somatic	114	0		WXS	Illumina HiSeq	Phase_I	88	4	.		Missense_Mutation	SNP	ENST00000409968.1	37		.	.	.	.	.	.	.	.	.	.	G	31	5.096605	0.94197	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.64085	-0.08;-0.08;-0.08	5.89	5.89	0.94794	.	0.147994	0.64402	D	0.000010	D	0.85999	0.5828	H	0.94542	3.55	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	D	0.88591	0.3143	10	0.66056	D	0.02	.	20.2561	0.98419	0.0:0.0:1.0:0.0	.	639;608	Q9C0I4;C9JKN6	THS7B_HUMAN;.	C	639;639;608	ENSP00000387145:G639C;ENSP00000272643:G639C;ENSP00000413841:G608C	ENSP00000272643:G639C	G	+	1	0	THSD7B	137705275	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.827000	0.99397	2.797000	0.96272	0.563000	0.77884	GGT	.		0.423	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2	XM_046570.9	Missense_Mutation
