#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVarCov_SOL	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
NXPE3	91775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	101540335	101540335	+	Missense_Mutation	SNP	G	G	T	rs149452985		TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr3:101540335G>T	ENST00000491511.2	+	8	2173	c.1217G>T	c.(1216-1218)cGc>cTc	p.R406L	RP11-49I4.3_ENST00000490324.2_RNA|NXPE3_ENST00000477909.1_Missense_Mutation_p.R406L|NXPE3_ENST00000273347.5_Missense_Mutation_p.R406L|NXPE3_ENST00000422132.1_Missense_Mutation_p.R406L	NM_001134456.1	NP_001127928.1	Q969Y0	NXPE3_HUMAN	neurexophilin and PC-esterase domain family, member 3	406						extracellular region (GO:0005576)											CTCAAATACCGCTGCCATGGT	0.493																																					p.R406L		.											.	.	.	0			c.G1217T						.	G	LEU/ARG,LEU/ARG	1,4405	2.1+/-5.4	0,1,2202	127.0	99.0	108.0		1217,1217	5.8	1.0	3	dbSNP_134	108	0,8600		0,0,4300	no	missense,missense	FAM55C	NM_001134456.1,NM_145037.2	102,102	0,1,6502	TT,TG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	406/560,406/560	101540335	1,13005	2203	4300	6503	SO:0001583	missense	91775	exon8			AATACCGCTGCCA	AK054664	CCDS2945.1	3q12.3	2012-06-14	2012-06-11	2012-06-11	ENSG00000144815	ENSG00000144815			28238	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member C"""	FAM55C		12975309	Standard	NM_001134456		Approved	MGC15606	uc003dvn.3	Q969Y0	OTTHUMG00000159179	ENST00000491511.2:c.1217G>T	3.37:g.101540335G>T	ENSP00000417485:p.Arg406Leu	Somatic	27	0		WXS	Illumina HiSeq	.	26	11	NM_145037	A8K0X4|D3DN53|Q7Z2S8	Missense_Mutation	SNP	ENST00000491511.2	37	CCDS2945.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.022432	0.93462	2.27E-4	0.0	ENSG00000144815	ENST00000273347;ENST00000491511;ENST00000477909;ENST00000422132	T;T;T;T	0.18810	2.19;2.19;2.19;2.19	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.53626	0.1808	M	0.84326	2.69	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.56214	-0.8016	10	0.72032	D	0.01	-13.6396	20.1162	0.97934	0.0:0.0:1.0:0.0	.	406	Q969Y0	FA55C_HUMAN	L	406	ENSP00000273347:R406L;ENSP00000417485:R406L;ENSP00000418369:R406L;ENSP00000396421:R406L	ENSP00000273347:R406L	R	+	2	0	FAM55C	103023025	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.953000	0.87836	2.756000	0.94617	0.655000	0.94253	CGC	0.000		0.493	NXPE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353711.2	NM_145037	
TSC1	7248	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	135786449	135786449	+	Missense_Mutation	SNP	A	A	C			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr9:135786449A>C	ENST00000298552.3	-	11	1302	c.1081T>G	c.(1081-1083)Tct>Gct	p.S361A	TSC1_ENST00000440111.2_Missense_Mutation_p.S361A|TSC1_ENST00000545250.1_Missense_Mutation_p.S310A	NM_000368.4|NM_001162426.1|NM_001162427.1	NP_000359.1|NP_001155898.1|NP_001155899.1	Q92574	TSC1_HUMAN	tuberous sclerosis 1	361					activation of Rho GTPase activity (GO:0032862)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|insulin receptor signaling pathway (GO:0008286)|kidney development (GO:0001822)|myelination (GO:0042552)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of translation (GO:0017148)|neural tube closure (GO:0001843)|positive regulation of focal adhesion assembly (GO:0051894)|potassium ion transport (GO:0006813)|protein heterooligomerization (GO:0051291)|protein stabilization (GO:0050821)|regulation of cell cycle (GO:0051726)|regulation of cell-matrix adhesion (GO:0001952)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of protein kinase activity (GO:0045859)|regulation of stress fiber assembly (GO:0051492)|regulation of translation (GO:0006417)|response to insulin (GO:0032868)|rRNA export from nucleus (GO:0006407)|synapse organization (GO:0050808)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|lamellipodium (GO:0030027)|membrane (GO:0016020)|protein complex (GO:0043234)|TSC1-TSC2 complex (GO:0033596)	chaperone binding (GO:0051087)|GTPase regulator activity (GO:0030695)|protein N-terminus binding (GO:0047485)	p.?(1)		NS(1)|bone(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(9)|lung(20)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	65				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		TTTCCAGGAGAAGTTGGAGGA	0.433			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.S361A		.	yes	Rec		Tuberous sclerosis 1	9	9q34	7248	tuberous sclerosis 1 gene		"""E, O"""	.	.	.	1	Unknown(1)	bone(1)	c.T1081G						.						678.0	642.0	654.0					9																	135786449		2203	4300	6503	SO:0001583	missense	7248	exon11	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	CAGGAGAAGTTGG	AF013168	CCDS6956.1, CCDS55350.1	9q34	2014-09-17			ENSG00000165699	ENSG00000165699			12362	protein-coding gene	gene with protein product		605284		TSC		9242607, 10806479	Standard	NM_000368		Approved	KIAA0243, LAM, hamartin	uc004cca.2	Q92574	OTTHUMG00000020844	ENST00000298552.3:c.1081T>G	9.37:g.135786449A>C	ENSP00000298552:p.Ser361Ala	Somatic	48	0		WXS	Illumina HiSeq	.	38	15	NM_000368	B7Z897|Q5VVN5	Missense_Mutation	SNP	ENST00000298552.3	37	CCDS6956.1	.	.	.	.	.	.	.	.	.	.	A	29.9	5.045645	0.93685	.	.	ENSG00000165699	ENST00000298552;ENST00000440111;ENST00000545250;ENST00000424271	D;D;D	0.88896	-2.44;-2.44;-2.44	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	D	0.93494	0.7924	M	0.76002	2.32	0.80722	D	1	P;D;D;B	0.59357	0.852;0.979;0.985;0.178	P;P;D;P	0.64144	0.763;0.87;0.922;0.612	D	0.93947	0.7228	10	0.62326	D	0.03	-16.487	15.1557	0.72739	1.0:0.0:0.0:0.0	.	310;361;361;361	B7Z897;Q59IT9;Q32NF0;Q92574	.;.;.;TSC1_HUMAN	A	361;361;310;240	ENSP00000298552:S361A;ENSP00000394524:S361A;ENSP00000444017:S310A	ENSP00000298552:S361A	S	-	1	0	TSC1	134776270	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.573000	0.74009	2.168000	0.68352	0.533000	0.62120	TCT	.		0.433	TSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054799.1		
VPS26B	112936	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	134113055	134113055	+	Silent	SNP	G	G	C			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr11:134113055G>C	ENST00000281187.5	+	4	1066	c.588G>C	c.(586-588)ctG>ctC	p.L196L	VPS26B_ENST00000530402.1_3'UTR|VPS26B_ENST00000525095.2_Silent_p.L196L	NM_052875.3	NP_443107.1	Q4G0F5	VP26B_HUMAN	vacuolar protein sorting 26 homolog B (S. pombe)	196					protein transport (GO:0015031)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)				breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)	14	all_hematologic(175;0.127)	all_cancers(12;1.1e-21)|all_epithelial(12;3.77e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;2.43e-10)|all cancers(11;2.94e-09)|BRCA - Breast invasive adenocarcinoma(10;9.57e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00164)|Lung(977;0.216)		TATACTTCCTGCTGGTGAGAA	0.448																																					p.L196L	Colon(171;1263 1952 15904 45703 47982)	.											.	.	.	0			c.G588C						.						138.0	119.0	126.0					11																	134113055		2201	4297	6498	SO:0001819	synonymous_variant	112936	exon4			CTTCCTGCTGGTG		CCDS8495.1	11q25	2008-02-05	2007-01-12		ENSG00000151502	ENSG00000151502			28119	protein-coding gene	gene with protein product		610027	"""vacuolar protein sorting 26 homolog B (yeast)"""			16190980	Standard	NM_052875		Approved	MGC10485, Pep8b	uc001qhe.3	Q4G0F5	OTTHUMG00000167175	ENST00000281187.5:c.588G>C	11.37:g.134113055G>C		Somatic	52	0		WXS	Illumina HiSeq	.	34	9	NM_052875	Q96A55	Silent	SNP	ENST00000281187.5	37	CCDS8495.1																																																																																			.		0.448	VPS26B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393591.1	NM_052875	
SETD2	29072	hgsc.bcm.edu	37	3	47129614	47129614	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr3:47129614C>T	ENST00000409792.3	-	10	5308	c.5266G>A	c.(5266-5268)Gaa>Aaa	p.E1756K	snoU13_ENST00000516129.1_RNA	NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1756					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)	p.E1253*(1)|p.E1756*(1)		breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TGTATGAGTTCCAGACAGGTA	0.378			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.E1756K		.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	SETD2_ENST00000409792,NS,carcinoma,0,2	SETD2_ENST00000409792	0	2	Substitution - Nonsense(2)	lung(2)	c.G5266A						.						120.0	125.0	124.0					3																	47129614		2203	4300	6503	SO:0001583	missense	29072	exon10			TGAGTTCCAGACA	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.5266G>A	3.37:g.47129614C>T	ENSP00000386759:p.Glu1756Lys	Somatic	44	0		WXS	Illumina HiSeq	.	47	2	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	37	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	C	2.797	-0.249982	0.05867	.	.	ENSG00000181555	ENST00000451092;ENST00000409792	D	0.86297	-2.1	4.46	-4.26	0.03755	.	0.481780	0.18774	N	0.131531	T	0.53077	0.1774	N	0.00707	-1.245	0.20975	N	0.999818	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.60068	-0.7335	10	0.02654	T	1	.	8.4158	0.32670	0.0:0.4985:0.1305:0.3711	.	1756;1756	F2Z317;Q9BYW2	.;SETD2_HUMAN	K	1756	ENSP00000386759:E1756K	ENSP00000386759:E1756K	E	-	1	0	SETD2	47104618	0.947000	0.32204	0.005000	0.12908	0.920000	0.55202	0.827000	0.27421	-0.940000	0.03705	-0.355000	0.07637	GAA	.		0.378	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
KCNN3	3782	hgsc.bcm.edu	37	1	154842333	154842333	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr1:154842333C>T	ENST00000271915.4	-	1	423	c.108G>A	c.(106-108)caG>caA	p.Q36Q	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	36	Gln-rich.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	gctgctgttgctgctgctgct	0.672																																					p.Q36Q		.											.	.	.	0			c.G108A						.						8.0	8.0	8.0					1																	154842333		1967	3874	5841	SO:0001819	synonymous_variant	3782	exon1			CTGTTGCTGCTGC	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.108G>A	1.37:g.154842333C>T		Somatic	32	0		WXS	Illumina HiSeq	.	90	4	NM_001204087	B1ANX0|O43517|Q86VF9|Q8WXG7	Silent	SNP	ENST00000271915.4	37	CCDS30880.1																																																																																			.		0.672	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
TXNDC16	57544	hgsc.bcm.edu;bcgsc.ca	37	14	52922163	52922163	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr14:52922163G>T	ENST00000281741.4	-	18	2092	c.1721C>A	c.(1720-1722)gCa>gAa	p.A574E	TXNDC16_ENST00000554399.1_Intron	NM_001160047.1|NM_020784.2	NP_001153519.1|NP_065835.2	Q9P2K2	TXD16_HUMAN	thioredoxin domain containing 16	574					cell redox homeostasis (GO:0045454)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|prostate(3)|skin(1)	21	Breast(41;0.0716)					TGGAAGACTTGCAGCATATTT	0.418																																					p.A574E		.											.	.	.	0			c.C1721A						.						184.0	153.0	164.0					14																	52922163		2203	4300	6503	SO:0001583	missense	57544	exon18			AGACTTGCAGCAT	AB037765	CCDS32083.1	14q22.1	2007-08-16	2007-08-16	2007-08-16		ENSG00000087301			19965	protein-coding gene	gene with protein product			"""KIAA1344"""	KIAA1344			Standard	NM_020784		Approved		uc001wzs.3	Q9P2K2		ENST00000281741.4:c.1721C>A	14.37:g.52922163G>T	ENSP00000281741:p.Ala574Glu	Somatic	38	0		WXS	Illumina HiSeq	.	49	4	NM_020784	A5PKW9|A7E260|A7MD07|B9EH67|Q9H9W7	Missense_Mutation	SNP	ENST00000281741.4	37	CCDS32083.1	.	.	.	.	.	.	.	.	.	.	G	16.85	3.236278	0.58886	.	.	ENSG00000087301	ENST00000281741	T	0.32272	1.46	4.98	0.24	0.15489	.	0.628717	0.16800	N	0.199017	T	0.19446	0.0467	N	0.22421	0.69	0.21386	N	0.99971	P;B	0.43542	0.81;0.11	B;B	0.44224	0.444;0.125	T	0.13629	-1.0502	10	0.27785	T	0.31	-38.6582	6.6654	0.23037	0.5947:0.0:0.4053:0.0	.	569;574	B7ZME4;Q9P2K2	.;TXD16_HUMAN	E	574	ENSP00000281741:A574E	ENSP00000281741:A574E	A	-	2	0	TXNDC16	51991913	0.000000	0.05858	0.411000	0.26484	0.924000	0.55760	0.113000	0.15499	0.194000	0.20326	0.563000	0.77884	GCA	.		0.418	TXNDC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411681.1	XM_051699	
USP6NL	9712	hgsc.bcm.edu	37	10	11505503	11505503	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr10:11505503G>T	ENST00000609104.1	-	15	1818	c.1424C>A	c.(1423-1425)gCc>gAc	p.A475D	USP6NL_ENST00000379237.2_Missense_Mutation_p.A498D|USP6NL_ENST00000277575.5_Missense_Mutation_p.A492D	NM_014688.2	NP_055503.1	Q92738	US6NL_HUMAN	USP6 N-terminal like	475					Golgi organization (GO:0007030)|plasma membrane to endosome transport (GO:0048227)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of Golgi organization (GO:1903358)|retrograde transport, plasma membrane to Golgi (GO:0035526)|virion assembly (GO:0019068)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			endometrium(3)|kidney(2)|large_intestine(6)|lung(18)|prostate(1)|skin(1)|urinary_tract(1)	32						ATTTGAAGTGGCGTTGCTATT	0.453																																					p.A492D		.											.	.	.	0			c.C1475A						.						179.0	177.0	178.0					10																	11505503		1979	4156	6135	SO:0001583	missense	9712	exon14			GAAGTGGCGTTGC	BC010351	CCDS44357.1, CCDS53492.1	10p13	2013-07-09			ENSG00000148429	ENSG00000148429			16858	protein-coding gene	gene with protein product	"""related to the N terminus of tre"""	605405	"""USP6NL intronic transcript 1 (non-protein coding)"""	USP6NL-IT1		8700515, 8700527, 12399475	Standard	XR_247492		Approved	RNTRE, KIAA0019, TRE2NL, RN-tre	uc001iks.1	Q92738	OTTHUMG00000017672	ENST00000609104.1:c.1424C>A	10.37:g.11505503G>T	ENSP00000476462:p.Ala475Asp	Somatic	44	0		WXS	Illumina HiSeq	.	50	4	NM_001080491	A8KA79|Q15400|Q5VV10|Q7L0K9	Missense_Mutation	SNP	ENST00000609104.1	37	CCDS53492.1	.	.	.	.	.	.	.	.	.	.	G	33	5.219662	0.95139	.	.	ENSG00000148429	ENST00000535316;ENST00000277575;ENST00000379237	T;T	0.12255	2.7;2.73	5.74	5.74	0.90152	.	0.062585	0.64402	D	0.000006	T	0.40862	0.1134	M	0.70275	2.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.07829	-1.0752	10	0.72032	D	0.01	.	20.2825	0.98528	0.0:0.0:1.0:0.0	.	475;492	Q92738;Q92738-2	US6NL_HUMAN;.	D	475;492;475	ENSP00000277575:A492D;ENSP00000368539:A475D	ENSP00000277575:A492D	A	-	2	0	USP6NL	11545509	1.000000	0.71417	0.954000	0.39281	0.817000	0.46193	6.831000	0.75324	2.873000	0.98535	0.561000	0.74099	GCC	.		0.453	USP6NL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000046764.3	NM_014688	
KBTBD12	166348	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	3	127703108	127703108	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr3:127703108G>T	ENST00000405109.1	+	6	2326	c.1859G>T	c.(1858-1860)gGc>gTc	p.G620V	KBTBD12_ENST00000343941.4_Missense_Mutation_p.G195V|KBTBD12_ENST00000407609.3_Missense_Mutation_p.G227V|KBTBD12_ENST00000405256.1_Missense_Mutation_p.G620V|KBTBD12_ENST00000492025.1_3'UTR			Q3ZCT8	KBTBC_HUMAN	kelch repeat and BTB (POZ) domain containing 12	620										endometrium(1)|large_intestine(6)|lung(5)|ovary(1)	13						GTGGAAGAAGGCAATGAGCAC	0.547																																					p.G620V		.											.	.	.	0			c.G1859T						.						87.0	80.0	82.0					3																	127703108		2203	4300	6503	SO:0001583	missense	166348	exon5			AAGAAGGCAATGA		CCDS33848.2	3q21.3	2013-01-08	2009-10-01	2009-10-01	ENSG00000187715	ENSG00000187715		"""BTB/POZ domain containing"""	25731	protein-coding gene	gene with protein product			"""kelch domain containing 6"""	KLHDC6			Standard	NM_207335		Approved	FLJ46299	uc010hsr.3	Q3ZCT8	OTTHUMG00000150508	ENST00000405109.1:c.1859G>T	3.37:g.127703108G>T	ENSP00000385957:p.Gly620Val	Somatic	30	0		WXS	Illumina HiSeq	.	36	4	NM_207335	B5MCC6|Q6ZRK1	Missense_Mutation	SNP	ENST00000405109.1	37	CCDS33848.2	.	.	.	.	.	.	.	.	.	.	G	17.61	3.433486	0.62955	.	.	ENSG00000187715	ENST00000405109;ENST00000407609;ENST00000405256;ENST00000343941	T;T;T;D	0.83075	-0.84;-0.66;-0.84;-1.68	5.7	0.794	0.18638	.	0.702531	0.13033	N	0.419187	T	0.64103	0.2568	N	0.08118	0	0.09310	N	0.999997	B;B	0.31859	0.232;0.343	B;B	0.32533	0.07;0.147	T	0.51340	-0.8718	10	0.21540	T	0.41	.	8.8114	0.34969	0.3794:0.0:0.6206:0.0	.	620;195	Q3ZCT8;Q3ZCT8-2	KBTBC_HUMAN;.	V	620;227;620;195	ENSP00000385957:G620V;ENSP00000385830:G227V;ENSP00000385879:G620V;ENSP00000345478:G195V	ENSP00000345478:G195V	G	+	2	0	KBTBD12	129185798	0.023000	0.18921	0.000000	0.03702	0.950000	0.60333	0.042000	0.13949	-0.147000	0.11254	-0.216000	0.12614	GGC	.		0.547	KBTBD12-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318682.1	NM_207335	
LTN1	26046	hgsc.bcm.edu	37	21	30339206	30339206	+	Missense_Mutation	SNP	T	T	A	rs560176639	byFrequency	TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr21:30339206T>A	ENST00000361371.5	-	10	1686	c.1607A>T	c.(1606-1608)aAt>aTt	p.N536I	LTN1_ENST00000389194.2_Missense_Mutation_p.N582I|LTN1_ENST00000389195.2_Missense_Mutation_p.N582I			O94822	LTN1_HUMAN	listerin E3 ubiquitin protein ligase 1	536					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.N536fs*33(1)		NS(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(19)|ovary(5)|pancreas(1)|prostate(2)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)	60						AACCTTACCATTTTTTTTTTT	0.378																																					p.N582I		.											LTN1,colon,carcinoma,+1,6	LTN1	+1	1	Deletion - Frameshift(1)	ovary(1)	c.A1745T						.						50.0	47.0	48.0					21																	30339206		2203	4300	6503	SO:0001583	missense	26046	exon10			TTACCATTTTTTT	AK001915	CCDS33527.1, CCDS33527.2	21q21.3	2013-01-09	2010-09-17	2010-09-17	ENSG00000198862	ENSG00000198862		"""RING-type (C3HC4) zinc fingers"""	13082	protein-coding gene	gene with protein product	"""listerin"""	613083	"""chromosome 21 open reading frame 98"", ""zinc finger protein 294"", ""ring finger protein 160"""	C21orf98, C21orf10, ZNF294, RNF160		20835226, 19196968	Standard	NM_015565		Approved	KIAA0714, FLJ11053, LISTERIN	uc002ymr.2	O94822	OTTHUMG00000078803	ENST00000361371.5:c.1607A>T	21.37:g.30339206T>A	ENSP00000354977:p.Asn536Ile	Somatic	47	1		WXS	Illumina HiSeq	.	45	2	NM_015565	A6NL41|A7E2D0|B2RTS0|C9J7U3|J3KPL4|Q05C47|Q9H8M4|Q9NUY5|Q9P0E9	Missense_Mutation	SNP	ENST00000361371.5	37		.	.	.	.	.	.	.	.	.	.	T	11.32	1.603025	0.28534	.	.	ENSG00000198862	ENST00000389194;ENST00000361371;ENST00000389195	T;T;T	0.23348	2.24;2.25;1.91	5.02	-4.43	0.03568	Armadillo-type fold (1);	0.777959	0.12592	N	0.455504	T	0.08714	0.0216	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.16778	-1.0391	10	0.40728	T	0.16	.	1.5733	0.02619	0.2505:0.0857:0.2706:0.3933	.	536	O94822	LTN1_HUMAN	I	582;536;582	ENSP00000373846:N582I;ENSP00000354977:N536I;ENSP00000373847:N582I	ENSP00000354977:N536I	N	-	2	0	LTN1	29261077	0.000000	0.05858	0.001000	0.08648	0.814000	0.46013	-0.245000	0.08890	-0.844000	0.04184	0.528000	0.53228	AAT	.		0.378	LTN1-008	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000472108.1	NM_015565	
LIM2	3982	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	51890594	51890594	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr19:51890594C>T	ENST00000596399.1	-	2	151	c.104G>A	c.(103-105)gGg>gAg	p.G35E	LIM2_ENST00000221973.3_Missense_Mutation_p.G35E	NM_001161748.1	NP_001155220.1	P55344	LMIP_HUMAN	lens intrinsic membrane protein 2, 19kDa	35					cell-cell junction assembly (GO:0007043)|lens development in camera-type eye (GO:0002088)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	structural constituent of eye lens (GO:0005212)			endometrium(1)|large_intestine(3)|lung(2)|skin(1)	7		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000214)|OV - Ovarian serous cystadenocarcinoma(262;0.00985)		GGCGAAGGACCCTGACAGCCG	0.652																																					p.G35E		.											.	.	.	0			c.G104A						.						67.0	64.0	65.0					19																	51890594		2203	4300	6503	SO:0001583	missense	3982	exon2			AAGGACCCTGACA		CCDS12831.1, CCDS59415.1	19q13.4	2008-07-17	2002-08-29			ENSG00000105370			6610	protein-coding gene	gene with protein product		154045	"""lens intrinsic membrane protein 2 (19kD)"""			1606837	Standard	NM_030657		Approved	MP19, MP17	uc002pwl.2	P55344		ENST00000596399.1:c.104G>A	19.37:g.51890594C>T	ENSP00000472090:p.Gly35Glu	Somatic	20	0		WXS	Illumina HiSeq	.	23	8	NM_001161748	Q6B083|Q9BXD0|Q9HAR5	Missense_Mutation	SNP	ENST00000596399.1	37	CCDS59415.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.623935	0.87460	.	.	ENSG00000105370	ENST00000221973	D	0.90069	-2.61	4.97	4.97	0.65823	.	0.106283	0.64402	D	0.000005	D	0.93556	0.7943	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.91635	0.941;0.999	D	0.93183	0.6576	10	0.42905	T	0.14	-12.4022	15.7209	0.77710	0.0:1.0:0.0:0.0	.	35;35	P55344;P55344-2	LMIP_HUMAN;.	E	35	ENSP00000221973:G35E	ENSP00000221973:G35E	G	-	2	0	LIM2	56582406	0.987000	0.35691	0.974000	0.42286	0.961000	0.63080	5.098000	0.64548	2.299000	0.77371	0.561000	0.74099	GGG	.		0.652	LIM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464247.1	NM_030657	
C3orf17	25871	hgsc.bcm.edu	37	3	112727076	112727076	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr3:112727076G>T	ENST00000314400.5	-	8	1368	c.1177C>A	c.(1177-1179)Ctg>Atg	p.L393M	C3orf17_ENST00000383675.2_Missense_Mutation_p.L323M|C3orf17_ENST00000393857.2_Missense_Mutation_p.L257M|C3orf17_ENST00000472762.1_5'UTR	NM_015412.3	NP_056227.2	Q6NW34	CC017_HUMAN	chromosome 3 open reading frame 17	393					negative regulation of neuron differentiation (GO:0045665)|positive regulation of Notch signaling pathway (GO:0045747)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|kidney(2)|lung(6)|prostate(2)|skin(1)	13						TTGTTACCCAGAAAAATGGCC	0.398																																					p.L393M		.											.	.	.	0			c.C1177A						.						107.0	107.0	107.0					3																	112727076		2203	4300	6503	SO:0001583	missense	25871	exon8			TACCCAGAAAAAT	AL117573	CCDS33824.1	3q13.2	2009-11-06			ENSG00000163608	ENSG00000163608			24496	protein-coding gene	gene with protein product						12477932	Standard	NR_027794		Approved	DKFZP434F2021, NET17	uc003dzr.3	Q6NW34	OTTHUMG00000159286	ENST00000314400.5:c.1177C>A	3.37:g.112727076G>T	ENSP00000320251:p.Leu393Met	Somatic	99	0		WXS	Illumina HiSeq	.	63	3	NM_015412	D3DN69|Q68DM6|Q9H7U0|Q9UFM4	Missense_Mutation	SNP	ENST00000314400.5	37	CCDS33824.1	.	.	.	.	.	.	.	.	.	.	G	15.03	2.712204	0.48517	.	.	ENSG00000163608	ENST00000314400;ENST00000383675;ENST00000412848;ENST00000393857	T;T;T	0.45276	0.9;0.9;0.9	6.07	3.36	0.38483	.	0.067551	0.64402	D	0.000010	T	0.58892	0.2154	M	0.71581	2.175	0.38563	D	0.949753	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;0.999	T	0.60826	-0.7186	10	0.72032	D	0.01	-9.6666	7.8377	0.29380	0.3153:0.0:0.6847:0.0	.	282;190;323;393	E7EN80;E7EQH6;Q6NW34-2;Q6NW34	.;.;.;CC017_HUMAN	M	393;323;40;257	ENSP00000320251:L393M;ENSP00000373173:L323M;ENSP00000377438:L257M	ENSP00000320251:L393M	L	-	1	2	C3orf17	114209766	1.000000	0.71417	0.997000	0.53966	0.549000	0.35272	2.826000	0.48104	0.472000	0.27344	-0.225000	0.12378	CTG	.		0.398	C3orf17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354405.3	NM_015412	
MUC4	4585	hgsc.bcm.edu	37	3	195508450	195508450	+	Missense_Mutation	SNP	G	G	A	rs568124972	byFrequency	TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr3:195508450G>A	ENST00000463781.3	-	2	10460	c.10001C>T	c.(10000-10002)cCt>cTt	p.P3334L	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P3334L	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.V3305_S3336delVSTGHATPLLVTDASSASTGHATPLHVTSPSS(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGCTGAGGAAGGGCTGGTGAC	0.592													.|||	18	0.00359425	0.0106	0.0	5008	,	,		12254	0.001		0.002	False		,,,				2504	0.001				p.P3334L		.											.,7	.	1505	1	Deletion - In frame(1)	stomach(1)	c.C10001T						.						29.0	22.0	24.0					3																	195508450		689	1574	2263	SO:0001583	missense	4585	exon2			GAGGAAGGGCTGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10001C>T	3.37:g.195508450G>A	ENSP00000417498:p.Pro3334Leu	Somatic	18	2		WXS	Illumina HiSeq	.	20	2	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	8.879	0.951156	0.18431	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.29917	1.57;1.55	0.423	0.423	0.16463	.	.	.	.	.	T	0.09730	0.0239	N	0.03608	-0.345	0.09310	N	1	P	0.38110	0.618	B	0.28638	0.092	T	0.19811	-1.0294	7	.	.	.	.	.	.	.	.	3206	E7ESK3	.	L	3334	ENSP00000417498:P3334L;ENSP00000420243:P3334L	.	P	-	2	0	MUC4	196993229	0.001000	0.12720	0.006000	0.13384	0.012000	0.07955	0.776000	0.26704	0.494000	0.27859	0.089000	0.15464	CCT	.		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
PRMT3	10196	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	20448337	20448337	+	Missense_Mutation	SNP	A	A	G			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr11:20448337A>G	ENST00000331079.6	+	10	1136	c.919A>G	c.(919-921)Aca>Gca	p.T307A	PRMT3_ENST00000437750.2_Missense_Mutation_p.T245A	NM_001145167.1|NM_005788.3	NP_001138639.1|NP_005779	O60678	ANM3_HUMAN	protein arginine methyltransferase 3	307	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				histone arginine methylation (GO:0034969)|negative regulation of protein ubiquitination (GO:0031397)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|ribosome (GO:0005840)	histone-arginine N-methyltransferase activity (GO:0008469)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|modified amino acid binding (GO:0072341)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)			endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|prostate(1)	17						AGATACTATTACACTAATTAA	0.269																																					p.T307A		.											.	.	.	0			c.A919G						.						44.0	46.0	46.0					11																	20448337		2181	4266	6447	SO:0001583	missense	10196	exon10			ACTATTACACTAA	AF059531	CCDS7853.1, CCDS44554.1	11p15.1	2008-02-05	2006-02-16	2006-02-16	ENSG00000185238	ENSG00000185238		"""Protein arginine methyltransferases"""	30163	protein-coding gene	gene with protein product		603190	"""HMT1 hnRNP methyltransferase-like 3 (S. cerevisiae)"""	HRMT1L3		9642256	Standard	NM_005788		Approved		uc001mqb.3	O60678	OTTHUMG00000166022	ENST00000331079.6:c.919A>G	11.37:g.20448337A>G	ENSP00000331879:p.Thr307Ala	Somatic	105	0		WXS	Illumina HiSeq	.	85	32	NM_005788	B4DUC7	Missense_Mutation	SNP	ENST00000331079.6	37	CCDS7853.1	.	.	.	.	.	.	.	.	.	.	A	9.849	1.193255	0.22037	.	.	ENSG00000185238	ENST00000331079;ENST00000541255;ENST00000437750	T;T	0.25579	1.79;1.79	5.32	2.6	0.31112	.	0.562858	0.20805	N	0.085356	T	0.15219	0.0367	L	0.31664	0.95	0.35670	D	0.813225	B;B	0.10296	0.003;0.002	B;B	0.15052	0.007;0.012	T	0.11494	-1.0585	10	0.44086	T	0.13	0.1632	2.9788	0.05947	0.5189:0.0:0.1331:0.348	.	245;307	O60678-2;O60678	.;ANM3_HUMAN	A	307;307;245	ENSP00000331879:T307A;ENSP00000397766:T245A	ENSP00000331879:T307A	T	+	1	0	PRMT3	20404913	0.854000	0.29725	0.483000	0.27378	0.994000	0.84299	1.686000	0.37669	0.210000	0.20664	0.454000	0.30748	ACA	.		0.269	PRMT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387489.1	NM_005788	
ATP13A3	79572	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	194168696	194168696	+	Missense_Mutation	SNP	T	T	C			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr3:194168696T>C	ENST00000439040.1	-	13	1984	c.1193A>G	c.(1192-1194)tAt>tGt	p.Y398C	ATP13A3_ENST00000256031.4_Missense_Mutation_p.Y398C			Q9H7F0	AT133_HUMAN	ATPase type 13A3	398						integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	24	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)		TGGTTTGGGATACAATATGGA	0.328																																					p.Y398C		.											.	.	.	0			c.A1193G						.						166.0	163.0	164.0					3																	194168696		1844	4083	5927	SO:0001583	missense	79572	exon12			TTGGGATACAATA	AJ306929	CCDS43187.1	3q29	2010-04-20			ENSG00000133657	ENSG00000133657		"""ATPases / P-type"""	24113	protein-coding gene	gene with protein product	"""ATPase family homolog up regulated in senescence cells"""	610232				11867234	Standard	NM_024524		Approved	AFURS1	uc003fty.4	Q9H7F0	OTTHUMG00000156034	ENST00000439040.1:c.1193A>G	3.37:g.194168696T>C	ENSP00000416508:p.Tyr398Cys	Somatic	141	0		WXS	Illumina HiSeq	.	73	30	NM_024524	Q8NC11|Q96KS1	Missense_Mutation	SNP	ENST00000439040.1	37	CCDS43187.1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.464510	0.84425	.	.	ENSG00000133657	ENST00000439040;ENST00000256031;ENST00000310773	D;D	0.90620	-2.7;-2.7	5.69	5.69	0.88448	ATPase, P-type, ATPase-associated domain (1);	0.057979	0.64402	D	0.000001	D	0.95541	0.8551	M	0.82716	2.605	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96100	0.9068	10	0.87932	D	0	-18.3797	15.9429	0.79771	0.0:0.0:0.0:1.0	.	398	Q9H7F0	AT133_HUMAN	C	398;398;136	ENSP00000416508:Y398C;ENSP00000256031:Y398C	ENSP00000256031:Y398C	Y	-	2	0	ATP13A3	195649985	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.444000	0.80532	2.147000	0.66899	0.533000	0.62120	TAT	.		0.328	ATP13A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342799.2	NM_024524	
CENPC	1060	hgsc.bcm.edu	37	4	68396538	68396538	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr4:68396538C>T	ENST00000273853.6	-	5	576	c.326G>A	c.(325-327)aGa>aAa	p.R109K		NM_001812.2	NP_001803.2	Q03188	CENPC_HUMAN	centromere protein C	109					chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	centromeric DNA binding (GO:0019237)|DNA binding (GO:0003677)										CCAACCTGATCTGTTTGTGGC	0.413																																					p.R109K		.											.	.	.	0			c.G326A						.						76.0	72.0	74.0					4																	68396538		1835	4084	5919	SO:0001583	missense	1060	exon5			CCTGATCTGTTTG	M95724	CCDS47063.1	4q13.2	2013-11-05	2013-07-03	2013-07-03	ENSG00000145241	ENSG00000145241			1854	protein-coding gene	gene with protein product		117141	"""centromere protein C 1"""	CENPC1		7959789	Standard	XR_245245		Approved	CENP-C, hcp-4, MIF2	uc003hdd.1	Q03188	OTTHUMG00000160735	ENST00000273853.6:c.326G>A	4.37:g.68396538C>T	ENSP00000273853:p.Arg109Lys	Somatic	77	0		WXS	Illumina HiSeq	.	76	4	NM_001812	Q8IW27|Q9P0M5	Missense_Mutation	SNP	ENST00000273853.6	37	CCDS47063.1	.	.	.	.	.	.	.	.	.	.	C	1.334	-0.595969	0.03771	.	.	ENSG00000145241	ENST00000273853	.	.	.	4.37	-7.67	0.01272	.	1.093840	0.06906	N	0.806780	T	0.18383	0.0441	N	0.22421	0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.33111	-0.9881	9	0.05436	T	0.98	-0.3943	5.3104	0.15828	0.2267:0.1923:0.0:0.581	.	109;109	Q8IW27;Q03188	.;CENPC_HUMAN	K	109	.	ENSP00000273853:R109K	R	-	2	0	CENPC1	68079133	0.000000	0.05858	0.003000	0.11579	0.661000	0.39034	-1.735000	0.01847	-1.787000	0.01268	-0.150000	0.13652	AGA	.		0.413	CENPC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362001.2		
ANKRD12	23253	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	9254584	9254584	+	Missense_Mutation	SNP	C	C	G			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr18:9254584C>G	ENST00000262126.4	+	9	1559	c.1319C>G	c.(1318-1320)tCt>tGt	p.S440C	ANKRD12_ENST00000400020.3_Missense_Mutation_p.S417C|ANKRD12_ENST00000383440.2_Missense_Mutation_p.S417C	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	440						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						AAAAAGATTTCTACTTCATGT	0.318																																					p.S440C		.											.	.	.	0			c.C1319G						.						64.0	75.0	71.0					18																	9254584		2202	4294	6496	SO:0001583	missense	23253	exon9			AGATTTCTACTTC	AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.1319C>G	18.37:g.9254584C>G	ENSP00000262126:p.Ser440Cys	Somatic	141	0		WXS	Illumina HiSeq	.	34	26	NM_015208	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	ENST00000262126.4	37	CCDS11843.1	.	.	.	.	.	.	.	.	.	.	C	11.10	1.538159	0.27475	.	.	ENSG00000101745	ENST00000383440;ENST00000262126;ENST00000359158	T;T	0.06142	3.35;3.34	5.86	5.86	0.93980	.	0.357498	0.33199	N	0.005178	T	0.11367	0.0277	L	0.50333	1.59	0.23254	N	0.998038	D;D;P	0.60575	0.988;0.969;0.948	P;P;B	0.53360	0.724;0.614;0.41	T	0.27502	-1.0072	10	0.37606	T	0.19	-15.9131	7.682	0.28520	0.0:0.8085:0.0:0.1915	.	67;417;440	Q9NXU3;Q6UB98-2;Q6UB98	.;.;ANR12_HUMAN	C	417;440;147	ENSP00000372932:S417C;ENSP00000262126:S440C	ENSP00000262126:S440C	S	+	2	0	ANKRD12	9244584	1.000000	0.71417	0.566000	0.28421	0.975000	0.68041	5.189000	0.65098	2.771000	0.95319	0.650000	0.86243	TCT	.		0.318	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2	NM_015208	
ADRA2A	150	hgsc.bcm.edu	37	10	112838330	112838330	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr10:112838330C>T	ENST00000280155.2	+	1	1541	c.576C>T	c.(574-576)ggC>ggT	p.G192G		NM_000681.3	NP_000672.3	P08913	ADA2A_HUMAN	adrenoceptor alpha 2A	177					actin cytoskeleton organization (GO:0030036)|activation of MAPK activity by adrenergic receptor signaling pathway (GO:0071883)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|acute inflammatory response (GO:0002526)|adenylate cyclase-inhibiting adrenergic receptor signaling pathway (GO:0071881)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|DNA replication (GO:0006260)|energy reserve metabolic process (GO:0006112)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|fear response (GO:0042596)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|intestinal absorption (GO:0050892)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of adrenergic receptor signaling pathway (GO:0071878)|negative regulation of calcium ion transmembrane transporter activity (GO:1901020)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of insulin secretion (GO:0046676)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of norepinephrine secretion (GO:0010700)|negative regulation of uterine smooth muscle contraction (GO:0070473)|phospholipase C-activating adrenergic receptor signaling pathway (GO:0071882)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine production (GO:0001819)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of potassium ion transport (GO:0043268)|positive regulation of vasodilation (GO:0045909)|positive regulation of wound healing (GO:0090303)|Ras protein signal transduction (GO:0007265)|regulation of insulin secretion (GO:0050796)|regulation of vasoconstriction (GO:0019229)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|thermoception (GO:0050955)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	alpha-1B adrenergic receptor binding (GO:0031692)|alpha-2C adrenergic receptor binding (GO:0031696)|alpha2-adrenergic receptor activity (GO:0004938)|epinephrine binding (GO:0051379)|heterotrimeric G-protein binding (GO:0032795)|norepinephrine binding (GO:0051380)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|thioesterase binding (GO:0031996)			breast(1)|cervix(3)|endometrium(6)|large_intestine(3)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Breast(234;0.0735)|Lung NSC(174;0.238)		Epithelial(162;0.000316)|all cancers(201;0.00501)|BRCA - Breast invasive adenocarcinoma(275;0.118)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Apraclonidine(DB00964)|Aripiprazole(DB01238)|Asenapine(DB06216)|Benzphetamine(DB00865)|Bethanidine(DB00217)|Brimonidine(DB00484)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Clozapine(DB00363)|Desipramine(DB01151)|Dexmedetomidine(DB00633)|Dihydroergotamine(DB00320)|Dipivefrin(DB00449)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinastine(DB00751)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Flupirtine(DB06623)|Guanabenz(DB00629)|Guanfacine(DB01018)|Lisuride(DB00589)|Lofexidine(DB04948)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methamphetamine(DB01577)|Methotrimeprazine(DB01403)|Methyldopa(DB00968)|Mianserin(DB06148)|Mirtazapine(DB00370)|Naphazoline(DB06711)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxymetazoline(DB00935)|Paliperidone(DB01267)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phentolamine(DB00692)|Phenylpropanolamine(DB00397)|Pramipexole(DB00413)|Prazosin(DB00457)|Propericiazine(DB01608)|Pseudoephedrine(DB00852)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Tizanidine(DB00697)|Tolazoline(DB00797)|Trazodone(DB00656)|Trimipramine(DB00726)|Xylometazoline(DB06694)|Yohimbine(DB01392)|Ziprasidone(DB00246)	AGAAgggcggcggcggcggcc	0.662																																					p.G192G	Esophageal Squamous(173;605 2658 7278 49362)	.											ADRA2A,colon,carcinoma,0,1	ADRA2A	0	0			c.C576T						.						13.0	17.0	16.0					10																	112838330		2196	4289	6485	SO:0001819	synonymous_variant	150	exon1			GGGCGGCGGCGGC	AF284095	CCDS7569.2	10q25.2	2012-08-08	2012-05-09		ENSG00000150594	ENSG00000150594		"""GPCR / Class A : Adrenoceptors : alpha"""	281	protein-coding gene	gene with protein product	"""alpha-2AAR subtype C10"", "" alpha-2A-adrenergic receptor"""	104210	"""adrenergic, alpha-2A-, receptor"""	ADRA2, ADRA2R			Standard	NM_000681		Approved	ADRAR	uc001kzo.3	P08913	OTTHUMG00000019050	ENST00000280155.2:c.576C>T	10.37:g.112838330C>T		Somatic	34	0		WXS	Illumina HiSeq	.	33	2	NM_000681	B0LPF6|Q2I8G2|Q2XN99|Q86TH8|Q9BZK1	Silent	SNP	ENST00000280155.2	37	CCDS7569.2																																																																																			.		0.662	ADRA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050372.2	NM_000681	
PLEKHA3	65977	hgsc.bcm.edu	37	2	179363925	179363925	+	Intron	SNP	C	C	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr2:179363925C>T	ENST00000234453.5	+	6	1017					NM_019091.3	NP_061964.3	Q9HB20	PKHA3_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3							Golgi apparatus (GO:0005794)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	11			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.0266)|all cancers(119;0.0865)			TTTTTTTTTTCCAAAATTTCT	0.308																																					.		.											.	.	.	0			.						.						54.0	57.0	56.0					2																	179363925		2203	4300	6503	SO:0001627	intron_variant	100302152	.			TTTTTTCCAAAAT	AF286162	CCDS33336.1	2q31.2	2013-01-10	2002-01-14		ENSG00000116095	ENSG00000116095		"""Pleckstrin homology (PH) domain containing"""	14338	protein-coding gene	gene with protein product	"""four-phosphate-adaptor protein 1"""	607774	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 3"""			11001876, 15107860	Standard	NM_019091		Approved	FAPP1	uc002umn.3	Q9HB20	OTTHUMG00000154446	ENST00000234453.5:c.616-13C>T	2.37:g.179363925C>T		Somatic	79	0		WXS	Illumina HiSeq	.	59	4	.	Q4ZG69|Q86TQ1|Q9NXT3	RNA	SNP	ENST00000234453.5	37	CCDS33336.1																																																																																			.		0.308	PLEKHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335241.2	NM_019091	
C12orf5	57103	hgsc.bcm.edu	37	12	4458991	4458991	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr12:4458991C>T	ENST00000179259.4	+	4	266	c.199C>T	c.(199-201)Cat>Tat	p.H67Y	C12orf5_ENST00000537251.1_3'UTR	NM_020375.2	NP_065108.1	Q9NQ88	TIGAR_HUMAN	chromosome 12 open reading frame 5	67					intestinal epithelial cell development (GO:0060576)|negative regulation of macromitophagy (GO:1901525)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|response to gamma radiation (GO:0010332)|response to xenobiotic stimulus (GO:0009410)	intracellular (GO:0005622)	fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)			endometrium(1)|large_intestine(1)|lung(5)|skin(3)	10			all cancers(3;1.15e-07)|Colorectal(7;0.00165)|OV - Ovarian serous cystadenocarcinoma(31;0.00596)|COAD - Colon adenocarcinoma(12;0.0229)|GBM - Glioblastoma multiforme(3;0.0266)|STAD - Stomach adenocarcinoma(119;0.206)			TCAGACCATGCATGGAATTTT	0.328																																					p.H67Y	Colon(1;100 192 35375 49454 52532)	.											.	.	.	0			c.C199T						.						84.0	87.0	86.0					12																	4458991		2203	4300	6503	SO:0001583	missense	57103	exon4			ACCATGCATGGAA	AJ272206	CCDS8525.1	12p13.32	2014-05-29	2009-11-24	2009-11-24	ENSG00000078237	ENSG00000078237	3.1.3.46		1185	protein-coding gene	gene with protein product	"""TP53-induced glycolysis and apoptosis regulator"""	610775				16140933, 16839880, 18945750, 19713938	Standard	NM_020375		Approved	TIGAR	uc001qmp.3	Q9NQ88		ENST00000179259.4:c.199C>T	12.37:g.4458991C>T	ENSP00000179259:p.His67Tyr	Somatic	58	0		WXS	Illumina HiSeq	.	79	4	NM_020375	B2R840	Missense_Mutation	SNP	ENST00000179259.4	37	CCDS8525.1	.	.	.	.	.	.	.	.	.	.	C	0.995	-0.692821	0.03303	.	.	ENSG00000078237	ENST00000179259	T	0.72167	-0.63	4.58	1.56	0.23342	Histidine phosphatase superfamily, clade-1 (2);	0.769595	0.12494	N	0.463970	T	0.53642	0.1809	N	0.25332	0.735	0.09310	N	1	P	0.40476	0.718	P	0.44811	0.461	T	0.45396	-0.9264	10	0.06494	T	0.89	-9.489	5.0472	0.14490	0.0:0.4727:0.2403:0.287	.	67	Q9NQ88	TIGAR_HUMAN	Y	67	ENSP00000179259:H67Y	ENSP00000179259:H67Y	H	+	1	0	C12orf5	4329252	0.027000	0.19231	0.857000	0.33713	0.875000	0.50365	0.424000	0.21330	0.671000	0.31185	-0.140000	0.14226	CAT	.		0.328	C12orf5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398290.1	NM_020375	
PINX1	54984	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	10677706	10677706	+	Silent	SNP	G	G	A	rs368778352		TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr8:10677706G>A	ENST00000314787.3	-	6	587	c.468C>T	c.(466-468)ccC>ccT	p.P156P	SOX7_ENST00000554914.1_Intron|PINX1_ENST00000426190.2_Intron|SOX7_ENST00000553390.1_Intron|PINX1_ENST00000519088.1_Intron	NM_017884.4	NP_060354.4	Q96BK5	PINX1_HUMAN	PIN2/TERF1 interacting, telomerase inhibitor 1	156					mitotic metaphase plate congression (GO:0007080)|negative regulation of cell proliferation (GO:0008285)|negative regulation of telomerase activity (GO:0051974)|regulation of telomerase activity (GO:0051972)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)|nucleolus (GO:0005730)|spindle (GO:0005819)	telomerase inhibitor activity (GO:0010521)|telomeric RNA binding (GO:0070034)			kidney(2)|large_intestine(4)|lung(8)|ovary(1)|skin(2)	17				Kidney(29;0.0595)|COAD - Colon adenocarcinoma(149;0.105)|KIRC - Kidney renal clear cell carcinoma(542;0.201)		TTTATACCTCGGGAGTCTTCT	0.403													G|||	1	0.000199681	0.0	0.0	5008	,	,		16931	0.0		0.0	False		,,,				2504	0.001				p.P156P		.											.	.	.	0			c.C468T						.						96.0	90.0	92.0					8																	10677706		1850	4096	5946	SO:0001819	synonymous_variant	54984	exon6			TACCTCGGGAGTC	AF418553	CCDS47801.1, CCDS64825.1	8p23	2013-01-28				ENSG00000254093		"""G patch domain containing"""	30046	protein-coding gene	gene with protein product	"""PIN2 interacting protein 1"", ""liver-related putative tumor suppressor"""	606505				11003615, 11701125	Standard	NM_001284356		Approved	PinX1, LPTL, LPTS, FLJ20565, MGC8850		Q96BK5		ENST00000314787.3:c.468C>T	8.37:g.10677706G>A		Somatic	90	0		WXS	Illumina HiSeq	.	65	58	NM_017884	B2R9B1|Q548A5|Q6QWG9|Q7Z7J8|Q96QD7|Q9HBU7|Q9NWW2	Silent	SNP	ENST00000314787.3	37	CCDS47801.1																																																																																			.		0.403	PINX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375683.1	NM_017884	
UGT2B17	7367	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	69403575	69403575	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr4:69403575G>A	ENST00000317746.2	-	6	1403	c.1361C>T	c.(1360-1362)cCg>cTg	p.P454L		NM_001077.3	NP_001068.1	O75795	UDB17_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B17	454					cellular glucuronidation (GO:0052695)|steroid metabolic process (GO:0008202)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyltransferase activity (GO:0015020)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(14)|ovary(2)|prostate(1)	30					Losartan(DB00678)	GGGCTTCACCGGTTGATCATG	0.408																																					p.P454L	Melanoma(18;649 833 28984 37818 38500)	.											.	.	.	0			c.C1361T						.						96.0	95.0	96.0					4																	69403575		2092	3934	6026	SO:0001583	missense	7367	exon6			TTCACCGGTTGAT	U59209	CCDS3523.1	4q13	2008-02-05	2005-07-20		ENSG00000197888	ENSG00000197888		"""UDP glucuronosyltransferases"""	12547	protein-coding gene	gene with protein product		601903	"""UDP glycosyltransferase 2 family, polypeptide B17"""			8798464	Standard	NM_001077		Approved		uc021xov.1	O75795	OTTHUMG00000129305	ENST00000317746.2:c.1361C>T	4.37:g.69403575G>A	ENSP00000320401:p.Pro454Leu	Somatic	59	0		WXS	Illumina HiSeq	.	58	48	NM_001077		Missense_Mutation	SNP	ENST00000317746.2	37	CCDS3523.1	.	.	.	.	.	.	.	.	.	.	G	13.43	2.236122	0.39498	.	.	ENSG00000197888	ENST00000317746	T	0.76060	-0.99	2.85	2.85	0.33270	.	0.000000	0.64402	U	0.000002	D	0.85509	0.5713	M	0.90019	3.08	0.46499	D	0.999071	.	.	.	.	.	.	D	0.88078	0.2805	8	0.87932	D	0	.	11.4257	0.50009	0.0:0.0:1.0:0.0	.	.	.	.	L	454	ENSP00000320401:P454L	ENSP00000320401:P454L	P	-	2	0	UGT2B17	69086170	1.000000	0.71417	0.391000	0.26233	0.028000	0.11728	4.709000	0.61867	1.580000	0.49851	0.195000	0.17529	CCG	.		0.408	UGT2B17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251436.1	NM_001077	
EP400	57634	hgsc.bcm.edu	37	12	132547144	132547144	+	Silent	SNP	G	G	A			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr12:132547144G>A	ENST00000333577.4	+	48	8449	c.8340G>A	c.(8338-8340)caG>caA	p.Q2780Q	EP400_ENST00000389561.2_Silent_p.Q2744Q|EP400_ENST00000332482.4_Silent_p.Q2707Q|EP400_ENST00000389562.2_Silent_p.Q2743Q|EP400_ENST00000330386.6_Silent_p.Q2663Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2780	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcaacagcagcagcagcaac	0.607																																					p.Q2744Q		.											EP400,NS,carcinoma,0,1	EP400	0	0			c.G8232A						.						56.0	45.0	49.0					12																	132547144		2203	4300	6503	SO:0001819	synonymous_variant	57634	exon47			ACAGCAGCAGCAG	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8340G>A	12.37:g.132547144G>A		Somatic	34	1		WXS	Illumina HiSeq	.	12	3	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37																																																																																				.		0.607	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
MT-ND2	4536	hgsc.bcm.edu;broad.mit.edu	37	M	2681	2681	+	5'Flank	SNP	G	G	A			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chrM:2681G>A	ENST00000361453.3	+	0	0				MT-ND1_ENST00000361390.2_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TF_ENST00000387314.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TV_ENST00000387342.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						accagtgaaattgacctgccc	0.453																																					.		.											.	.	.	0			.						.																																			SO:0001631	upstream_gene_variant	6053	.			GAAATTGACCTGC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.2681G>A	Exception_encountered	Somatic	1862	0		WXS	Illumina HiSeq	.	1316	83	.	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	ENST00000361453.3	37																																																																																				.		0.453	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024027	
DOCK10	55619	hgsc.bcm.edu	37	2	225637968	225637968	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr2:225637968G>T	ENST00000258390.7	-	53	6177	c.6110C>A	c.(6109-6111)tCc>tAc	p.S2037Y	DOCK10_ENST00000409592.3_Missense_Mutation_p.S2031Y	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	2037	DHR-2.				regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		AACCTTCTTGGACATCTCGTC	0.453																																					p.S2037Y		.											DOCK10_ENST00000373702,NS,carcinoma,0,2	DOCK10_ENST00000373702	0	0			c.C6110A						.						145.0	139.0	141.0					2																	225637968		2106	4247	6353	SO:0001583	missense	55619	exon53			TTCTTGGACATCT	AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.6110C>A	2.37:g.225637968G>T	ENSP00000258390:p.Ser2037Tyr	Somatic	37	0		WXS	Illumina HiSeq	.	33	2	NM_014689	B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	ENST00000258390.7	37	CCDS46528.1	.	.	.	.	.	.	.	.	.	.	G	17.84	3.489008	0.64074	.	.	ENSG00000135905	ENST00000409592;ENST00000258390;ENST00000373702	T;T	0.18960	2.18;2.18	5.63	5.63	0.86233	.	0.113540	0.64402	D	0.000007	T	0.43188	0.1236	M	0.69823	2.125	0.46298	D	0.998979	P;P;P	0.42993	0.797;0.797;0.703	P;P;P	0.53266	0.516;0.633;0.722	T	0.21999	-1.0229	10	0.66056	D	0.02	.	19.7096	0.96089	0.0:0.0:1.0:0.0	.	2037;2031;699	Q96BY6;B3FL70;B4DEY4	DOC10_HUMAN;.;.	Y	2031;2037;544	ENSP00000386694:S2031Y;ENSP00000258390:S2037Y	ENSP00000258390:S2037Y	S	-	2	0	DOCK10	225346212	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.310000	0.78947	2.652000	0.90054	0.655000	0.94253	TCC	.		0.453	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331246.1		
CUBN	8029	hgsc.bcm.edu	37	10	17026203	17026203	+	Nonsense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr10:17026203G>A	ENST00000377833.4	-	30	4491	c.4426C>T	c.(4426-4428)Cag>Tag	p.Q1476*		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	1476	CUB 9. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CTGGAGACCTGCATGGGGTTC	0.498																																					p.Q1476X		.											.	.	.	0			c.C4426T						.						135.0	122.0	126.0					10																	17026203		2203	4300	6503	SO:0001587	stop_gained	8029	exon30			AGACCTGCATGGG	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.4426C>T	10.37:g.17026203G>A	ENSP00000367064:p.Gln1476*	Somatic	39	0		WXS	Illumina HiSeq	.	72	4	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Nonsense_Mutation	SNP	ENST00000377833.4	37	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	G	47	12.992122	0.99711	.	.	ENSG00000107611	ENST00000377833	.	.	.	5.96	5.96	0.96718	.	0.318937	0.22927	N	0.053948	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.4008	0.98991	0.0:0.0:1.0:0.0	.	.	.	.	X	1476	.	ENSP00000367064:Q1476X	Q	-	1	0	CUBN	17066209	1.000000	0.71417	0.988000	0.46212	0.622000	0.37654	6.039000	0.70972	2.826000	0.97356	0.655000	0.94253	CAG	.		0.498	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
PIP4K2B	8396	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	17	36925956	36925956	+	Missense_Mutation	SNP	G	G	T	rs549240348		TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr17:36925956G>T	ENST00000269554.3	-	10	1719	c.1239C>A	c.(1237-1239)aaC>aaA	p.N413K		NM_003559.4	NP_003550.1	P78356	PI42B_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type II, beta	413	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				cell surface receptor signaling pathway (GO:0007166)|intracellular signal transduction (GO:0035556)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|1-phosphatidylinositol-5-phosphate 4-kinase activity (GO:0016309)|ATP binding (GO:0005524)|receptor signaling protein activity (GO:0005057)			endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(8)|ovary(1)	19						ACGTCAGGATGTTGGACATAA	0.522																																					p.N413K		.											.	.	.	0			c.C1239A						.						205.0	193.0	197.0					17																	36925956		2203	4300	6503	SO:0001583	missense	8396	exon10			CAGGATGTTGGAC	U85245	CCDS11329.1	17q21.2	2007-08-14	2007-08-14	2007-08-14		ENSG00000276293	2.7.1.149		8998	protein-coding gene	gene with protein product		603261	"""phosphatidylinositol-4-phosphate 5-kinase, type II, beta"""	PIP5K2B		9038203, 14691457, 9367159	Standard	NM_003559		Approved	PIP5KIIB, PIP5KIIbeta	uc002hqs.3	P78356		ENST00000269554.3:c.1239C>A	17.37:g.36925956G>T	ENSP00000269554:p.Asn413Lys	Somatic	67	0		WXS	Illumina HiSeq	.	42	4	NM_003559	Q5U0E8|Q8TBP2	Missense_Mutation	SNP	ENST00000269554.3	37	CCDS11329.1	.	.	.	.	.	.	.	.	.	.	G	14.99	2.699311	0.48307	.	.	ENSG00000141720	ENST00000269554	T	0.32515	1.45	5.89	5.89	0.94794	Phosphatidylinositol-4-phosphate 5-kinase, core (2);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.18045	0.0433	N	0.17764	0.52	0.80722	D	1	B	0.10296	0.003	B	0.16289	0.015	T	0.05937	-1.0855	10	0.05620	T	0.96	-32.4576	13.1242	0.59344	0.0769:0.0:0.9231:0.0	.	413	P78356	PI42B_HUMAN	K	413	ENSP00000269554:N413K	ENSP00000269554:N413K	N	-	3	2	PIP4K2B	34179482	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	4.406000	0.59748	2.793000	0.96121	0.655000	0.94253	AAC	.		0.522	PIP4K2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256791.1	NM_003559	
NDUFA9	4704	hgsc.bcm.edu;bcgsc.ca	37	12	4763523	4763523	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr12:4763523G>T	ENST00000266544.5	+	2	135	c.115G>T	c.(115-117)Gcc>Tcc	p.A39S	RP11-500M8.7_ENST00000536588.1_3'UTR|NDUFA9_ENST00000542369.1_3'UTR	NM_005002.4	NP_004993.1	Q16795	NDUA9_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa	39					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|sodium ion transport (GO:0006814)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)|nucleus (GO:0005634)	coenzyme binding (GO:0050662)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|NADH dehydrogenase activity (GO:0003954)|protein complex binding (GO:0032403)			NS(1)|breast(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	21						GCTTCATCATGCCCTCATGCC	0.512																																					p.A39S	Colon(75;996 1244 23946 25294 29232)	.											.	.	.	0			c.G115T						.						163.0	143.0	150.0					12																	4763523		2203	4300	6503	SO:0001583	missense	4704	exon2			CATCATGCCCTCA	AF050641	CCDS8532.1	12p13.3	2011-09-14	2002-08-29		ENSG00000139180	ENSG00000139180		"""Mitochondrial respiratory chain complex / Complex I"", ""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	7693	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 22E, member 1"", ""complex I 39kDa subunit"""	603834	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9 (39kD)"""	NDUFS2L		8486360, 19027726	Standard	NM_005002		Approved	SDR22E1, CI-39k	uc001qnc.3	Q16795		ENST00000266544.5:c.115G>T	12.37:g.4763523G>T	ENSP00000266544:p.Ala39Ser	Somatic	48	0		WXS	Illumina HiSeq	.	72	4	NM_005002	Q14076|Q2NKX0	Missense_Mutation	SNP	ENST00000266544.5	37	CCDS8532.1	.	.	.	.	.	.	.	.	.	.	G	16.48	3.136266	0.56936	.	.	ENSG00000139180	ENST00000266544;ENST00000535050	T	0.78924	-1.22	5.76	4.86	0.63082	.	0.047558	0.85682	N	0.000000	T	0.73992	0.3658	M	0.64997	1.995	0.80722	D	1	B;B	0.22909	0.077;0.077	B;B	0.24394	0.053;0.053	T	0.68819	-0.5308	10	0.23302	T	0.38	-6.6194	13.4854	0.61361	0.0:0.0:0.7164:0.2836	.	39;39	A8K4V2;Q16795	.;NDUA9_HUMAN	S	39;61	ENSP00000266544:A39S	ENSP00000266544:A39S	A	+	1	0	NDUFA9	4633784	1.000000	0.71417	0.971000	0.41717	0.742000	0.42306	4.867000	0.63013	1.399000	0.46721	0.563000	0.77884	GCC	.		0.512	NDUFA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398900.2	NM_005002	
LAMA5	3911	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	20	60887332	60887332	+	Missense_Mutation	SNP	C	C	A	rs535545260		TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr20:60887332C>A	ENST00000252999.3	-	69	9467	c.9401G>T	c.(9400-9402)cGc>cTc	p.R3134L		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	3134	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GAGCGCCAGGCGAAGGAAGCC	0.682																																					p.R3134L		.											.	.	.	0			c.G9401T						.						33.0	35.0	34.0					20																	60887332		2190	4291	6481	SO:0001583	missense	3911	exon69			GCCAGGCGAAGGA	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.9401G>T	20.37:g.60887332C>A	ENSP00000252999:p.Arg3134Leu	Somatic	15	0		WXS	Illumina HiSeq	.	22	7	NM_005560	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	ENST00000252999.3	37	CCDS33502.1	.	.	.	.	.	.	.	.	.	.	c	3.824	-0.037189	0.07497	.	.	ENSG00000130702	ENST00000252999	T	0.41400	1.0	4.06	-1.67	0.08238	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.792234	0.11846	N	0.523827	T	0.22244	0.0536	L	0.27053	0.805	0.09310	N	0.999993	B	0.02656	0.0	B	0.01281	0.0	T	0.15435	-1.0437	10	0.36615	T	0.2	.	1.6352	0.02740	0.1515:0.2622:0.3368:0.2496	.	3134	O15230	LAMA5_HUMAN	L	3134	ENSP00000252999:R3134L	ENSP00000252999:R3134L	R	-	2	0	LAMA5	60320727	0.002000	0.14202	0.344000	0.25628	0.002000	0.02628	0.708000	0.25719	-0.352000	0.08237	-2.393000	0.00227	CGC	.		0.682	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080014.2	NM_005560	
MAGEL2	54551	hgsc.bcm.edu	37	15	23892486	23892486	+	5'Flank	SNP	G	G	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr15:23892486G>T	ENST00000532292.1	-	0	0					NM_019066.4	NP_061939.3	Q9UJ55	MAGL2_HUMAN	MAGE-like 2						Arp2/3 complex-mediated actin nucleation (GO:0034314)|protein K63-linked ubiquitination (GO:0070534)|retrograde transport, endosome to Golgi (GO:0042147)	endosome (GO:0005768)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		GGGAGCTCCGGGAGCTGAAGG	0.711																																					p.P135H		.											.	.	.	0			c.C404A						.						15.0	20.0	18.0					15																	23892486		691	1590	2281	SO:0001631	upstream_gene_variant	54551	exon1			GCTCCGGGAGCTG	AJ243531	CCDS73700.1	15q11-q12	2008-07-18				ENSG00000254585			6814	protein-coding gene	gene with protein product		605283		NDNL1		10556298	Standard	NM_019066		Approved	nM15	uc001ywj.4	Q9UJ55			15.37:g.23892486G>T	Exception_encountered	Somatic	94	0		WXS	Illumina HiSeq	.	70	34	NM_019066		Missense_Mutation	SNP	ENST00000532292.1	37																																																																																				.		0.711	MAGEL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395182.2	NM_019066	
MAPKAPK2	9261	hgsc.bcm.edu	37	1	206858675	206858675	+	Missense_Mutation	SNP	A	A	C			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr1:206858675A>C	ENST00000367103.3	+	1	294	c.101A>C	c.(100-102)cAg>cCg	p.Q34P	MAPKAPK2_ENST00000294981.4_Missense_Mutation_p.Q34P	NM_004759.4|NM_032960.3	NP_004750.1|NP_116584.2	P49137	MAPK2_HUMAN	mitogen-activated protein kinase-activated protein kinase 2	34	Pro-rich.				3'-UTR-mediated mRNA stabilization (GO:0070935)|activation of MAPK activity (GO:0000187)|arachidonic acid metabolic process (GO:0019369)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|G2 DNA damage checkpoint (GO:0031572)|gene expression (GO:0010467)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|leukotriene metabolic process (GO:0006691)|macropinocytosis (GO:0044351)|MAPK cascade (GO:0000165)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of interleukin-6 production (GO:0032675)|regulation of tumor necrosis factor production (GO:0032680)|response to cytokine (GO:0034097)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	19	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.211)			cccccggcgcagccgccgccg	0.726																																					p.Q34P		.											.,2	.	45	0			c.A101C						.						6.0	7.0	6.0					1																	206858675		2149	4215	6364	SO:0001583	missense	9261	exon1			CGGCGCAGCCGCC	U12779	CCDS1466.1, CCDS31001.1	1q32	2008-02-05			ENSG00000162889	ENSG00000162889			6887	protein-coding gene	gene with protein product		602006				8179591, 8280084	Standard	NM_004759		Approved		uc001hem.2	P49137	OTTHUMG00000036342	ENST00000367103.3:c.101A>C	1.37:g.206858675A>C	ENSP00000356070:p.Gln34Pro	Somatic	12	0		WXS	Illumina HiSeq	.	21	2	NM_004759	Q5SY30|Q5SY41|Q8IYD6	Missense_Mutation	SNP	ENST00000367103.3	37	CCDS31001.1	.	.	.	.	.	.	.	.	.	.	A	9.674	1.147563	0.21288	.	.	ENSG00000162889	ENST00000294981;ENST00000367103	T;T	0.69040	-0.35;-0.37	2.61	-5.21	0.02815	.	.	.	.	.	T	0.36386	0.0965	N	0.08118	0	0.25438	N	0.98813	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.14035	-1.0487	9	0.27785	T	0.31	-0.0185	4.2261	0.10580	0.4405:0.334:0.2255:0.0	.	34;34	P49137;P49137-2	MAPK2_HUMAN;.	P	34	ENSP00000294981:Q34P;ENSP00000356070:Q34P	ENSP00000294981:Q34P	Q	+	2	0	MAPKAPK2	204925298	0.198000	0.23374	0.009000	0.14445	0.658000	0.38924	-0.918000	0.04021	-0.751000	0.04734	0.155000	0.16302	CAG	.		0.726	MAPKAPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088465.1	NM_004759	
CLIP4	79745	hgsc.bcm.edu	37	2	29404628	29404628	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr2:29404628G>T	ENST00000320081.5	+	16	2242	c.1987G>T	c.(1987-1989)Gga>Tga	p.G663*	CLIP4_ENST00000404424.1_Nonsense_Mutation_p.G663*|CLIP4_ENST00000401617.2_Intron	NM_024692.4	NP_078968.3	Q8N3C7	CLIP4_HUMAN	CAP-GLY domain containing linker protein family, member 4	663	CAP-Gly 3. {ECO:0000255|PROSITE- ProRule:PRU00045}.									endometrium(4)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|prostate(1)|skin(1)	26	Acute lymphoblastic leukemia(172;0.155)					AAGCGCCAAGGGAAAAAATGA	0.517																																					p.G663X		.											.	.	.	0			c.G1987T						.						118.0	115.0	116.0					2																	29404628		2203	4300	6503	SO:0001587	stop_gained	79745	exon16			GCCAAGGGAAAAA	AK024722	CCDS1770.1, CCDS74502.1	2p23	2013-01-10	2007-01-04	2007-01-04	ENSG00000115295	ENSG00000115295		"""Ankyrin repeat domain containing"""	26108	protein-coding gene	gene with protein product			"""restin-like 2"""	RSNL2			Standard	XM_005264562		Approved	FLJ21069	uc002rmv.3	Q8N3C7	OTTHUMG00000097837	ENST00000320081.5:c.1987G>T	2.37:g.29404628G>T	ENSP00000327009:p.Gly663*	Somatic	38	0		WXS	Illumina HiSeq	.	20	3	NM_024692	A0AV10|B2RMQ3|B7Z7N8|Q7Z4U3|Q96BR7|Q96MA5|Q9H7C0	Nonsense_Mutation	SNP	ENST00000320081.5	37	CCDS1770.1	.	.	.	.	.	.	.	.	.	.	G	41	8.678303	0.98912	.	.	ENSG00000115295	ENST00000404424;ENST00000402240;ENST00000320081;ENST00000379543;ENST00000530644	.	.	.	5.69	5.69	0.88448	.	0.054730	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8182	0.96579	0.0:0.0:1.0:0.0	.	.	.	.	X	663;665;663;681;623	.	.	G	+	1	0	CLIP4	29258132	1.000000	0.71417	0.998000	0.56505	0.959000	0.62525	9.582000	0.98214	2.700000	0.92200	0.561000	0.74099	GGA	.		0.517	CLIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215123.2	NM_024692	
MAPKBP1	23005	hgsc.bcm.edu	37	15	42113096	42113096	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr15:42113096C>T	ENST00000456763.2	+	24	2762	c.2566C>T	c.(2566-2568)Cgc>Tgc	p.R856C	MAPKBP1_ENST00000457542.2_Missense_Mutation_p.R850C|MAPKBP1_ENST00000221214.6_Missense_Mutation_p.R733C|MAPKBP1_ENST00000260357.7_Missense_Mutation_p.R689C|MAPKBP1_ENST00000514566.1_Missense_Mutation_p.R850C	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	856										breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		AAGAAGAGGGCGCTGGGTTCA	0.632																																					p.R856C		.											MAPKBP1,colon,carcinoma,0,1	MAPKBP1	0	0			c.C2566T						.						37.0	38.0	37.0					15																	42113096		2203	4300	6503	SO:0001583	missense	23005	exon24			AGAGGGCGCTGGG	AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.2566C>T	15.37:g.42113096C>T	ENSP00000393099:p.Arg856Cys	Somatic	22	0		WXS	Illumina HiSeq	.	24	2	NM_001128608	A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Missense_Mutation	SNP	ENST00000456763.2	37	CCDS45239.1	.	.	.	.	.	.	.	.	.	.	c	29.5	5.014460	0.93404	.	.	ENSG00000137802	ENST00000457542;ENST00000221214;ENST00000260357;ENST00000456763;ENST00000514566	T;T;T;T;T	0.60548	0.47;0.55;0.18;0.51;0.81	5.11	5.11	0.69529	.	0.102146	0.64402	D	0.000001	T	0.68586	0.3017	L	0.34521	1.04	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.999;0.999;0.999;0.997;0.998;0.999	T	0.71790	-0.4486	10	0.87932	D	0	-17.85	18.7328	0.91742	0.0:1.0:0.0:0.0	.	689;733;689;850;856;850	F8WC21;O60336-3;B4DYK7;O60336-2;O60336;O60336-6	.;.;.;.;MABP1_HUMAN;.	C	850;733;689;856;850	ENSP00000397570:R850C;ENSP00000221214:R733C;ENSP00000260357:R689C;ENSP00000393099:R856C;ENSP00000426154:R850C	ENSP00000221214:R733C	R	+	1	0	MAPKBP1	39900388	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	5.028000	0.64115	2.652000	0.90054	0.655000	0.94253	CGC	.		0.632	MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000359745.1	NM_014994	
GNPDA1	10007	hgsc.bcm.edu	37	5	141384672	141384672	+	Missense_Mutation	SNP	G	G	C	rs11557798		TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr5:141384672G>C	ENST00000508177.1	-	4	1177	c.419C>G	c.(418-420)cCt>cGt	p.P140R	GNPDA1_ENST00000458112.2_Missense_Mutation_p.P106R|GNPDA1_ENST00000513454.1_Missense_Mutation_p.P140R|GNPDA1_ENST00000311337.6_Missense_Mutation_p.P140R|GNPDA1_ENST00000500692.2_Missense_Mutation_p.P140R|GNPDA1_ENST00000503794.1_Missense_Mutation_p.P140R|GNPDA1_ENST00000542860.1_Intron			P46926	GNPI1_HUMAN	glucosamine-6-phosphate deaminase 1	140					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucosamine catabolic process (GO:0006043)|N-acetylglucosamine metabolic process (GO:0006044)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	glucosamine-6-phosphate deaminase activity (GO:0004342)|hydrolase activity (GO:0016787)			central_nervous_system(1)|lung(1)|skin(3)|stomach(1)	6		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGTCCATCAGGGCCGATGCC	0.557																																					p.P140R		.											.	.	.	0			c.C419G						.						49.0	44.0	45.0					5																	141384672		2203	4300	6503	SO:0001583	missense	10007	exon5			CCATCAGGGCCGA	AF048826	CCDS4272.1	5q21	2008-02-05	2003-10-17	2003-10-22	ENSG00000113552	ENSG00000113552	3.5.99.6		4417	protein-coding gene	gene with protein product	"""glucosamine-6-phosphate deaminase"", ""oscillin"""	601798	"""glucosamine-6-phosphate isomerase"""	GNPI		9714720, 9438414	Standard	NM_005471		Approved	GNPDA, HLN, GPI, KIAA0060	uc010jgh.3	P46926	OTTHUMG00000129657	ENST00000508177.1:c.419C>G	5.37:g.141384672G>C	ENSP00000423674:p.Pro140Arg	Somatic	8	0		WXS	Illumina HiSeq	.	19	9	NM_005471	B7Z3X4|D3DQE7	Missense_Mutation	SNP	ENST00000508177.1	37	CCDS4272.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.910946	0.92178	.	.	ENSG00000113552	ENST00000513454;ENST00000311337;ENST00000458112;ENST00000500692;ENST00000508177;ENST00000503794;ENST00000504139;ENST00000505689;ENST00000510194	T;T;T;T;T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83	5.84	5.84	0.93424	Glucosamine-6-phosphate isomerase, conserved site (1);Glucosamine/galactosamine-6-phosphate isomerase (1);	0.100922	0.64402	D	0.000001	T	0.56307	0.1976	L	0.31804	0.96	0.80722	D	1	P;P	0.40638	0.725;0.721	P;P	0.53988	0.739;0.659	T	0.55854	-0.8075	10	0.66056	D	0.02	-18.0721	20.1187	0.97949	0.0:0.0:1.0:0.0	.	106;140	E7EVU7;P46926	.;GNPI1_HUMAN	R	140;140;106;140;140;140;140;161;140	ENSP00000423494:P140R;ENSP00000311876:P140R;ENSP00000387718:P106R;ENSP00000424275:P140R;ENSP00000423674:P140R;ENSP00000423485:P140R;ENSP00000424625:P140R;ENSP00000421524:P161R;ENSP00000424537:P140R	ENSP00000311876:P140R	P	-	2	0	GNPDA1	141364856	1.000000	0.71417	0.997000	0.53966	0.928000	0.56348	9.476000	0.97823	2.767000	0.95098	0.591000	0.81541	CCT	.		0.557	GNPDA1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370631.1	NM_005471	
PRDM10	56980	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	11	129784863	129784863	+	Silent	SNP	G	G	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr11:129784863G>T	ENST00000360871.3	-	17	2808	c.2577C>A	c.(2575-2577)ctC>ctA	p.L859L	PRDM10_ENST00000528746.1_Silent_p.L833L|PRDM10_ENST00000304538.6_Silent_p.L773L|PRDM10_ENST00000358825.5_Silent_p.L863L|PRDM10_ENST00000423662.2_Silent_p.L777L|PRDM10_ENST00000526082.1_Silent_p.L777L	NM_199437.1	NP_955469.1	Q9NQV6	PRD10_HUMAN	PR domain containing 10	863					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(2)|endometrium(6)|kidney(3)|large_intestine(14)|lung(15)|pancreas(2)|skin(1)|stomach(3)|urinary_tract(2)	48	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		TGGTGTTGGAGAGCTGGGCGA	0.478																																					p.L863L		.											.	.	.	0			c.C2589A						.						142.0	136.0	138.0					11																	129784863		2201	4297	6498	SO:0001819	synonymous_variant	56980	exon18			GTTGGAGAGCTGG	AF275817	CCDS8484.1, CCDS8485.1, CCDS44771.1, CCDS44772.1	11q24.3	2013-01-08			ENSG00000170325	ENSG00000170325		"""Zinc fingers, C2H2-type"""	13995	protein-coding gene	gene with protein product	"""PRDM zinc finger transcription factor"", ""PR-domain family member 7"", ""tristanin"""					12175877	Standard	NM_020228		Approved	KIAA1231, PFM7, MGC131802	uc001qfm.3	Q9NQV6	OTTHUMG00000165762	ENST00000360871.3:c.2577C>A	11.37:g.129784863G>T		Somatic	22	0		WXS	Illumina HiSeq	.	19	4	NM_020228	B7ZL71|G3XAE5|J3KP23|Q17R90|Q2KHR4|Q863Z2|Q9NXI4|Q9ULI9	Silent	SNP	ENST00000360871.3	37	CCDS8484.1																																																																																			.		0.478	PRDM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386076.1	NM_199437	
USH2A	7399	hgsc.bcm.edu	37	1	216591858	216591858	+	Nonsense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr1:216591858G>A	ENST00000307340.3	-	3	1035	c.649C>T	c.(649-651)Cag>Tag	p.Q217*	USH2A_ENST00000366943.2_Nonsense_Mutation_p.Q217*|USH2A_ENST00000366942.3_Nonsense_Mutation_p.Q217*	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	217					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TTACTCACCTGCACACTAAGA	0.343										HNSCC(13;0.011)																											p.Q217X		.											.	.	.	0			c.C649T						.						84.0	85.0	85.0					1																	216591858		2203	4300	6503	SO:0001587	stop_gained	7399	exon3			TCACCTGCACACT	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.649C>T	1.37:g.216591858G>A	ENSP00000305941:p.Gln217*	Somatic	51	0		WXS	Illumina HiSeq	.	92	4	NM_007123	Q5VVM9|Q6S362|Q9NS27	Nonsense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	42	9.559731	0.99205	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	.	.	.	5.62	5.62	0.85841	.	0.000000	0.40554	U	0.001073	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	19.6478	0.95789	0.0:0.0:1.0:0.0	.	.	.	.	X	217	.	ENSP00000305941:Q217X	Q	-	1	0	USH2A	214658481	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.778000	0.75043	2.638000	0.89438	0.655000	0.94253	CAG	.		0.343	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
ZNF30	90075	hgsc.bcm.edu	37	19	35434870	35434870	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr19:35434870C>T	ENST00000601142.1	+	5	1237	c.1000C>T	c.(1000-1002)Cat>Tat	p.H334Y	ZNF30_ENST00000439785.1_Missense_Mutation_p.H335Y|ZNF30_ENST00000303586.7_Missense_Mutation_p.H335Y|ZNF30_ENST00000601957.1_3'UTR|ZNF30_ENST00000426813.2_Missense_Mutation_p.H253Y			P17039	ZNF30_HUMAN	zinc finger protein 30	334					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)	16	all_lung(56;8.38e-08)|Lung NSC(56;1.31e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)	GBM - Glioblastoma multiforme(1328;0.0265)		GCTTACTCGACATCAGAGTAT	0.438																																					p.H335Y		.											ZNF30,colon,carcinoma,0,1	ZNF30	0	0			c.C1003T						.						93.0	100.0	98.0					19																	35434870		2203	4300	6503	SO:0001583	missense	90075	exon5			ACTCGACATCAGA	X52359	CCDS46044.1, CCDS46045.1	19q13.13	2013-01-08	2006-05-10			ENSG00000168661		"""Zinc fingers, C2H2-type"", ""-"""	13090	protein-coding gene	gene with protein product			"""zinc finger protein 30 (KOX 28)"""				Standard	NM_001099437		Approved	KOX28, DKFZp686N19164, FLJ20562	uc010edq.1	P17039		ENST00000601142.1:c.1000C>T	19.37:g.35434870C>T	ENSP00000469954:p.His334Tyr	Somatic	41	0		WXS	Illumina HiSeq	.	35	2	NM_001099438	A5PLP1|A8K320|B4DIC0|Q6N068	Missense_Mutation	SNP	ENST00000601142.1	37	CCDS46045.1	.	.	.	.	.	.	.	.	.	.	c	16.21	3.057464	0.55325	.	.	ENSG00000168661	ENST00000439785;ENST00000303586;ENST00000426813;ENST00000342559	D;D	0.86769	-2.17;-2.17	2.23	2.23	0.28157	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94905	0.8353	H	0.96015	3.755	0.27950	N	0.937183	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87212	0.2248	9	0.87932	D	0	.	10.1036	0.42519	0.0:1.0:0.0:0.0	.	335;334	P17039-2;P17039	.;ZNF30_HUMAN	Y	335;334;253;71	ENSP00000403441:H335Y;ENSP00000416457:H253Y	ENSP00000303889:H334Y	H	+	1	0	ZNF30	40126710	0.977000	0.34250	0.007000	0.13788	0.015000	0.08874	2.735000	0.47377	1.243000	0.43853	0.404000	0.27445	CAT	.		0.438	ZNF30-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464432.1	NM_194325	
FGFR1OP	11116	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	167447400	167447400	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr6:167447400G>A	ENST00000366847.4	+	12	1297	c.1066G>A	c.(1066-1068)Ggt>Agt	p.G356S	RP11-517H2.6_ENST00000609590.1_RNA|FGFR1OP_ENST00000349556.4_Missense_Mutation_p.G336S	NM_007045.2	NP_008976.1	O95684	FR1OP_HUMAN	FGFR1 oncogene partner	356					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|mitotic cell cycle (GO:0000278)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein tyrosine kinase activity (GO:0061099)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|protein tyrosine kinase inhibitor activity (GO:0030292)			large_intestine(2)|ovary(1)|stomach(1)	4		Breast(66;1.48e-05)|Ovarian(120;0.0607)		OV - Ovarian serous cystadenocarcinoma(33;1.73e-19)|BRCA - Breast invasive adenocarcinoma(81;5.1e-06)|GBM - Glioblastoma multiforme(31;0.00231)		GATAAGTATTGGTGAAGAGAT	0.333			T	FGFR1	"""MPD, NHL"""																																p.G356S		.		Dom	yes		6	6q27	11116	FGFR1 oncogene partner (FOP)		L	.	.	.	0			c.G1066A						.						100.0	99.0	99.0					6																	167447400		2203	4300	6503	SO:0001583	missense	11116	exon12			AGTATTGGTGAAG	Y18046	CCDS5296.1, CCDS5297.1, CCDS75550.1	6q27	2008-02-05			ENSG00000213066	ENSG00000213066			17012	protein-coding gene	gene with protein product		605392				9949182, 10373756	Standard	NM_007045		Approved	FOP	uc003qvj.3	O95684	OTTHUMG00000016011	ENST00000366847.4:c.1066G>A	6.37:g.167447400G>A	ENSP00000355812:p.Gly356Ser	Somatic	67	0		WXS	Illumina HiSeq	.	33	26	NM_007045	A8K1D1|B2R705|Q49AI0|Q5R3F6|Q96EW1	Missense_Mutation	SNP	ENST00000366847.4	37	CCDS5296.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.464830	0.84425	.	.	ENSG00000213066	ENST00000366847;ENST00000420493;ENST00000349556	T;T	0.34859	1.34;1.35	4.94	4.94	0.65067	.	0.128250	0.52532	U	0.000076	T	0.32376	0.0827	L	0.27053	0.805	0.52099	D	0.999944	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	T	0.06180	-1.0841	10	0.10636	T	0.68	-20.0815	17.1495	0.86774	0.0:0.0:1.0:0.0	.	309;336;356	E7ET71;O95684-2;O95684	.;.;FR1OP_HUMAN	S	356;309;336	ENSP00000355812:G356S;ENSP00000230248:G336S	ENSP00000230248:G336S	G	+	1	0	FGFR1OP	167367390	1.000000	0.71417	0.657000	0.29651	0.986000	0.74619	5.944000	0.70219	2.263000	0.75096	0.650000	0.86243	GGT	.		0.333	FGFR1OP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043099.2	NM_007045	
ZNF195	7748	hgsc.bcm.edu;bcgsc.ca	37	11	3381489	3381489	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr11:3381489C>T	ENST00000399602.4	-	6	875	c.749G>A	c.(748-750)gGc>gAc	p.G250D	ZNF195_ENST00000354599.6_Missense_Mutation_p.G178D|ZNF195_ENST00000526601.1_Missense_Mutation_p.G231D|ZNF195_ENST00000528796.1_Intron|ZNF195_ENST00000429541.2_Missense_Mutation_p.G182D|ZNF195_ENST00000438262.2_3'UTR|ZNF195_ENST00000005082.9_Missense_Mutation_p.G227D|ZNF195_ENST00000343338.7_Missense_Mutation_p.G182D	NM_001130520.2	NP_001123992.1	O14628	ZN195_HUMAN	zinc finger protein 195	250					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)	17		Medulloblastoma(188;0.00106)|Breast(177;0.00328)|all_neural(188;0.00681)|Ovarian(85;0.00965)		BRCA - Breast invasive adenocarcinoma(625;0.0361)|LUSC - Lung squamous cell carcinoma(625;0.2)		AAAGGATTTGCCACATTCTTG	0.299																																					p.G250D		.											.	.	.	0			c.G749A						.						55.0	54.0	55.0					11																	3381489		1934	4156	6090	SO:0001583	missense	7748	exon6			GATTTGCCACATT		CCDS41604.1, CCDS44521.1, CCDS44522.1, CCDS55736.1, CCDS55737.1, CCDS58111.1	11p15.5	2013-01-08			ENSG00000005801	ENSG00000005801		"""Zinc fingers, C2H2-type"", ""-"""	12986	protein-coding gene	gene with protein product		602187				9344677	Standard	NM_001130520		Approved		uc001lxt.3	O14628	OTTHUMG00000011694	ENST00000399602.4:c.749G>A	11.37:g.3381489C>T	ENSP00000382511:p.Gly250Asp	Somatic	60	0		WXS	Illumina HiSeq	.	51	4	NM_001130520	A8K234|B3KTK2|B4DEL0|C9JLY9|L7MNK2|Q0VAJ6|Q658N8|Q6ZNA9	Missense_Mutation	SNP	ENST00000399602.4	37	CCDS44522.1	.	.	.	.	.	.	.	.	.	.	c	11.46	1.646014	0.29246	.	.	ENSG00000005801	ENST00000354599;ENST00000399602;ENST00000343338;ENST00000429541;ENST00000005082;ENST00000526601;ENST00000528410	T;T;T;T;T;T;T	0.34472	2.04;2.04;2.04;2.04;2.04;2.04;1.36	0.693	-0.389	0.12455	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.49064	0.1535	M	0.64630	1.985	0.26048	N	0.981527	D;P;D;B;D;B	0.89917	0.997;0.745;1.0;0.445;1.0;0.445	D;B;D;B;D;B	0.87578	0.994;0.095;0.996;0.058;0.998;0.058	T	0.35001	-0.9806	9	0.62326	D	0.03	.	3.7929	0.08728	0.0:0.4377:0.0:0.5623	.	231;109;227;182;250;178	O14628-6;Q59EZ7;O14628-5;O14628-7;O14628;O14628-4	.;.;.;.;ZN195_HUMAN;.	D	178;250;182;182;227;231;205	ENSP00000346613:G178D;ENSP00000382511:G250D;ENSP00000344483:G182D;ENSP00000387998:G182D;ENSP00000005082:G227D;ENSP00000435828:G231D;ENSP00000431937:G205D	ENSP00000005082:G227D	G	-	2	0	ZNF195	3338065	0.810000	0.29049	0.015000	0.15790	0.768000	0.43524	0.518000	0.22847	-0.180000	0.10637	0.313000	0.20887	GGC	.		0.299	ZNF195-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000032321.2		
ABCA13	154664	hgsc.bcm.edu	37	7	48318114	48318114	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr7:48318114G>T	ENST00000435803.1	+	18	7347	c.7323G>T	c.(7321-7323)ttG>ttT	p.L2441F		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	2441					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.L2386L(1)|p.L2441L(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TCTATGCTTTGTATCCTACCC	0.353																																					p.L2441F		.											ABCA13_ENST00000435803,NS,carcinoma,0,2	ABCA13_ENST00000435803	0	2	Substitution - coding silent(2)	endometrium(2)	c.G7323T						.						95.0	94.0	94.0					7																	48318114		1842	4082	5924	SO:0001583	missense	154664	exon18			TGCTTTGTATCCT	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.7323G>T	7.37:g.48318114G>T	ENSP00000411096:p.Leu2441Phe	Somatic	56	0		WXS	Illumina HiSeq	.	32	2	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	G	6.501	0.460634	0.12342	.	.	ENSG00000179869	ENST00000435803	T	0.55052	0.54	5.12	-6.02	0.02192	.	1.592420	0.04111	N	0.314547	T	0.24774	0.0601	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.06445	-1.0826	10	0.38643	T	0.18	.	0.8276	0.01124	0.3048:0.101:0.2784:0.3157	.	2441	Q86UQ4	ABCAD_HUMAN	F	2441	ENSP00000411096:L2441F	ENSP00000411096:L2441F	L	+	3	2	ABCA13	48288660	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.471000	0.06631	-1.000000	0.03438	-0.825000	0.03093	TTG	.		0.353	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
VENTX	27287	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	135053262	135053262	+	Silent	SNP	C	C	T	rs560345091		TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr10:135053262C>T	ENST00000325980.9	+	2	835	c.324C>T	c.(322-324)ggC>ggT	p.G108G		NM_014468.3	NP_055283.1	O95231	VENTX_HUMAN	VENT homeobox	108					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			NS(1)|endometrium(1)|large_intestine(1)|lung(9)|soft_tissue(1)|upper_aerodigestive_tract(1)	14		all_cancers(35;4.15e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;7.8e-06)|Epithelial(32;9.31e-06)|all cancers(32;1.19e-05)		CCTTGGAGGGCGTCTTCCAGC	0.637													C|||	1	0.000199681	0.0	0.0014	5008	,	,		13272	0.0		0.0	False		,,,				2504	0.0				p.G108G		.											.	.	.	0			c.C324T						.						36.0	34.0	35.0					10																	135053262		2203	4298	6501	SO:0001819	synonymous_variant	27287	exon2			GGAGGGCGTCTTC	AF068006	CCDS7675.1	10q26.3	2011-06-20	2011-06-01	2005-09-27	ENSG00000151650	ENSG00000151650		"""Homeoboxes / ANTP class : NKL subclass"""	13639	protein-coding gene	gene with protein product		607158	"""VENT-like homeobox 2"", ""VENT homeobox homolog (Xenopus laevis)"""	VENTX2		10790436	Standard	NM_014468		Approved	HPX42B	uc010quy.1	O95231	OTTHUMG00000019307	ENST00000325980.9:c.324C>T	10.37:g.135053262C>T		Somatic	26	0		WXS	Illumina HiSeq	.	33	11	NM_014468	Q32MZ3	Silent	SNP	ENST00000325980.9	37	CCDS7675.1																																																																																			.		0.637	VENTX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051116.4	NM_014468	
MAB21L1	4081	hgsc.bcm.edu;ucsc.edu	37	13	36048562	36048562	+	3'UTR	SNP	T	T	G			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr13:36048562T>G	ENST00000379919.4	-	0	2270				NBEA_ENST00000540320.1_Intron|NBEA_ENST00000400445.3_Intron|NBEA_ENST00000379939.2_Intron|NBEA_ENST00000537702.1_5'Flank|NBEA_ENST00000310336.4_Intron	NM_005584.4	NP_005575.1	Q13394	MB211_HUMAN	mab-21-like 1 (C. elegans)						anatomical structure morphogenesis (GO:0009653)|camera-type eye development (GO:0043010)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	20		Breast(139;0.014)|Lung SC(185;0.051)|Prostate(109;0.202)		all cancers(112;9.63e-08)|Epithelial(112;1.37e-06)|BRCA - Breast invasive adenocarcinoma(63;0.000659)|OV - Ovarian serous cystadenocarcinoma(117;0.00372)|GBM - Glioblastoma multiforme(144;0.115)		ACAAGCAATATTTGAAACAAA	0.244																																					.		.											.	.	.	0			.						.																																			SO:0001624	3_prime_UTR_variant	4081	.			GCAATATTTGAAA	BC028170	CCDS9353.1	13q13.3	2008-02-05	2001-11-28		ENSG00000180660	ENSG00000180660			6757	protein-coding gene	gene with protein product		601280	"""mab-21 (C. elegans)-like 1"""			8733127	Standard	NM_005584		Approved	CAGR1		Q13394	OTTHUMG00000016723	ENST00000379919.4:c.*634A>C	13.37:g.36048562T>G		Somatic	149	0		WXS	Illumina HiSeq	.	123	56	.	Q6I9T5	RNA	SNP	ENST00000379919.4	37	CCDS9353.1																																																																																			.		0.244	MAB21L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044459.3	NM_005584	
CENPF	1063	hgsc.bcm.edu;bcgsc.ca	37	1	214818019	214818019	+	Silent	SNP	C	C	A			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr1:214818019C>A	ENST00000366955.3	+	13	5274	c.5106C>A	c.(5104-5106)ctC>ctA	p.L1702L		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	1798					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		AGCAGGACCTCAATCTAGACA	0.438																																					p.L1702L	Colon(80;575 1284 11000 14801 43496)	.											CENPF,right_lower_lobe,carcinoma,0,1	CENPF	0	0			c.C5106A						.						73.0	71.0	71.0					1																	214818019		2203	4300	6503	SO:0001819	synonymous_variant	1063	exon13			GGACCTCAATCTA	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.5106C>A	1.37:g.214818019C>A		Somatic	41	0		WXS	Illumina HiSeq	.	88	4	NM_016343	Q13171|Q13246|Q5VVM7	Silent	SNP	ENST00000366955.3	37	CCDS31023.1																																																																																			.		0.438	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343	
IFT122	55764	hgsc.bcm.edu	37	3	129218838	129218838	+	Missense_Mutation	SNP	G	G	T	rs561825107		TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr3:129218838G>T	ENST00000348417.2	+	19	2379	c.2302G>T	c.(2302-2304)Gtg>Ttg	p.V768L	IFT122_ENST00000507564.1_Missense_Mutation_p.V760L|IFT122_ENST00000513932.1_3'UTR|IFT122_ENST00000349441.2_Missense_Mutation_p.V657L|IFT122_ENST00000440957.2_Missense_Mutation_p.V559L|IFT122_ENST00000296266.3_Missense_Mutation_p.V819L|IFT122_ENST00000504021.1_Missense_Mutation_p.V644L|IFT122_ENST00000347300.2_Missense_Mutation_p.V709L|IFT122_ENST00000431818.2_Missense_Mutation_p.V618L	NM_052989.1	NP_443715.1	Q9HBG6	IF122_HUMAN	intraflagellar transport 122	768					camera-type eye morphogenesis (GO:0048593)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|establishment of protein localization to organelle (GO:0072594)|intraciliary anterograde transport (GO:0035720)|intraciliary retrograde transport (GO:0035721)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|protein localization to cilium (GO:0061512)|signal transduction downstream of smoothened (GO:0007227)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|intraciliary transport particle A (GO:0030991)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|primary cilium (GO:0072372)		p.V819L(1)		breast(3)|cervix(1)|endometrium(9)|large_intestine(10)|lung(21)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	52						CAAAGCCGCCGTGGAGATGTA	0.527																																					p.V819L		.											IFT122,colon,carcinoma,0,3	IFT122	0	1	Substitution - Missense(1)	ovary(1)	c.G2455T						.						157.0	142.0	147.0					3																	129218838		2203	4300	6503	SO:0001583	missense	55764	exon20			GCCGCCGTGGAGA	AF244930	CCDS3059.1, CCDS3060.1, CCDS3061.1, CCDS3062.1, CCDS63770.1, CCDS63772.1, CCDS63773.1	3q21	2014-07-03	2014-07-03	2005-11-02	ENSG00000163913	ENSG00000163913		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	13556	protein-coding gene	gene with protein product		606045	"""WD repeat domain 10"", ""intraflagellar transport 122 homolog (Chlamydomonas)"""	WDR10		11242542	Standard	NM_052985		Approved	WDR140, WDR10p, SPG	uc003emm.3	Q9HBG6	OTTHUMG00000159516	ENST00000348417.2:c.2302G>T	3.37:g.129218838G>T	ENSP00000324005:p.Val768Leu	Somatic	51	0		WXS	Illumina HiSeq	.	45	3	NM_052985	B3KW53|B4DEY9|B4DPW7|E7EQF4|E9PDG2|E9PDX2|G3XAB1|H7C3C0|Q53G36|Q8TC06|Q9BTB9|Q9BTY4|Q9HAT9|Q9HBG5|Q9NV68|Q9UF80	Missense_Mutation	SNP	ENST00000348417.2	37	CCDS3061.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.939921	0.73557	.	.	ENSG00000163913	ENST00000347300;ENST00000296266;ENST00000507564;ENST00000454840;ENST00000431818;ENST00000504021;ENST00000349441;ENST00000348417;ENST00000446384;ENST00000440957;ENST00000509522;ENST00000507221	T;T;T;T;T;T;T;T;T	0.60672	0.81;0.17;0.29;0.34;0.95;0.94;0.81;0.34;0.93	5.06	5.06	0.68205	.	0.063147	0.64402	D	0.000005	T	0.59266	0.2181	L	0.55481	1.735	0.53005	D	0.999965	P;P;B;P;B;B;B;B;P;P	0.46457	0.628;0.591;0.353;0.546;0.273;0.273;0.273;0.393;0.662;0.878	B;B;B;B;B;B;B;B;B;B	0.43478	0.209;0.421;0.089;0.325;0.124;0.124;0.124;0.246;0.145;0.35	T	0.66156	-0.5994	10	0.72032	D	0.01	-22.0937	18.4268	0.90612	0.0:0.0:1.0:0.0	.	559;94;760;155;644;608;657;709;768;819	E9PDG2;B3KUD1;E7EQF4;B3KT43;B4DEY9;B4DPW7;Q9BTY4;Q9HBG6-3;Q9HBG6;G3XAB1	.;.;.;.;.;.;.;.;IF122_HUMAN;.	L	709;819;760;709;618;644;657;768;608;559;265;130	ENSP00000323973:V709L;ENSP00000296266:V819L;ENSP00000425536:V760L;ENSP00000410946:V618L;ENSP00000422179:V644L;ENSP00000324165:V657L;ENSP00000324005:V768L;ENSP00000401569:V559L;ENSP00000424727:V265L	ENSP00000296266:V819L	V	+	1	0	IFT122	130701528	1.000000	0.71417	0.962000	0.40283	0.979000	0.70002	9.525000	0.98039	2.338000	0.79540	0.655000	0.94253	GTG	.		0.527	IFT122-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355852.1	NM_018262	
TP53	7157	hgsc.bcm.edu	37	17	7579316	7579316	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr17:7579316C>T	ENST00000269305.4	-	4	560	c.371G>A	c.(370-372)tGc>tAc	p.C124Y	TP53_ENST00000455263.2_Missense_Mutation_p.C124Y|TP53_ENST00000420246.2_Missense_Mutation_p.C124Y|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.C124Y|TP53_ENST00000413465.2_Missense_Mutation_p.C124Y|TP53_ENST00000359597.4_Missense_Mutation_p.C124Y	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	124	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> G (in a sporadic cancer; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in a sporadic cancer; somatic mutation).|C -> Y (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.G59fs*23(3)|p.V73fs*9(1)|p.T123fs*24(1)|p.G105_T125del21(1)|p.Y107fs*44(1)|p.C124S(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.C124Y(1)|p.C124fs*25(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACTGACCGTGCAAGTCACAGA	0.542		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.C124Y	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000413465,NS,carcinoma,+1,4	TP53_ENST00000413465	+1	20	Whole gene deletion(8)|Deletion - Frameshift(8)|Substitution - Missense(2)|Deletion - In frame(1)|Insertion - Frameshift(1)	upper_aerodigestive_tract(4)|bone(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|lung(2)|ovary(2)|breast(2)|stomach(1)|liver(1)	c.G371A						.						66.0	62.0	63.0					17																	7579316		2203	4300	6503	SO:0001583	missense	7157	exon4	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	ACCGTGCAAGTCA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.371G>A	17.37:g.7579316C>T	ENSP00000269305:p.Cys124Tyr	Somatic	94	0		WXS	Illumina HiSeq	.	47	2	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	15.09	2.730942	0.48939	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	D;D;D;D;D;D;D;D	0.99741	-6.6;-6.6;-6.6;-6.6;-6.6;-6.6;-6.6;-6.6	4.75	4.75	0.60458	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.099990	0.64402	D	0.000002	D	0.99351	0.9772	L	0.43152	1.355	0.58432	D	0.999998	D;B;B;B;B;B;D	0.60575	0.988;0.224;0.33;0.006;0.072;0.413;0.972	P;B;B;B;B;P;P	0.61397	0.779;0.151;0.286;0.023;0.212;0.545;0.888	D	0.98218	1.0476	10	0.66056	D	0.02	-11.7577	15.6419	0.77012	0.0:1.0:0.0:0.0	.	85;124;124;124;124;124;124	B4E095;E7EMR6;P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	Y	124;124;124;124;124;124;113;124;124	ENSP00000410739:C124Y;ENSP00000352610:C124Y;ENSP00000269305:C124Y;ENSP00000398846:C124Y;ENSP00000391127:C124Y;ENSP00000391478:C124Y;ENSP00000424104:C124Y;ENSP00000426252:C124Y	ENSP00000269305:C124Y	C	-	2	0	TP53	7520041	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.379000	0.52440	2.630000	0.89119	0.655000	0.94253	TGC	.		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
ARHGAP19	84986	hgsc.bcm.edu	37	10	99024582	99024582	+	Splice_Site	SNP	C	C	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr10:99024582C>T	ENST00000358531.4	-	3	432		c.e3+1		ARHGAP19_ENST00000355366.5_Splice_Site|ARHGAP19-SLIT1_ENST00000316676.8_Splice_Site|ARHGAP19-SLIT1_ENST00000358308.3_Splice_Site|ARHGAP19_ENST00000371027.1_Splice_Site|ARHGAP19-SLIT1_ENST00000453547.2_Splice_Site	NM_001204300.1|NM_032900.5	NP_001191229.1|NP_116289.4	Q14CB8	RHG19_HUMAN	Rho GTPase activating protein 19						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|stomach(2)|urinary_tract(1)	13		Colorectal(252;0.0854)		Epithelial(162;7.65e-09)|all cancers(201;4.49e-07)		AGTAGTCTTACTTTTGTGTAG	0.363																																					.		.											ARHGAP19_ENST00000358531,NS,carcinoma,0,1	ARHGAP19_ENST00000358531	0	0			c.403+1G>A						.						82.0	83.0	82.0					10																	99024582		2203	4300	6503	SO:0001630	splice_region_variant	84986	exon4			GTCTTACTTTTGT	AK074122	CCDS7454.2, CCDS58092.1, CCDS73175.1	10q24.2	2011-06-29			ENSG00000213390	ENSG00000213390		"""Rho GTPase activating proteins"""	23724	protein-coding gene	gene with protein product		611587					Standard	NM_032900		Approved	FLJ00194, MGC14258	uc001knb.3	Q14CB8	OTTHUMG00000018845	ENST00000358531.4:c.403+1G>A	10.37:g.99024582C>T		Somatic	35	0		WXS	Illumina HiSeq	.	50	2	NM_032900	A1XCP1|B4DZR1|Q14CF2|Q5J8M2|Q5T460|Q5T462|Q68DG6|Q8N9X1|Q8NF34|Q8TEK1	Splice_Site	SNP	ENST00000358531.4	37	CCDS7454.2	.	.	.	.	.	.	.	.	.	.	C	23.0	4.358525	0.82243	.	.	ENSG00000213390	ENST00000453547;ENST00000316676;ENST00000355366;ENST00000358531;ENST00000371027;ENST00000358308	.	.	.	5.49	5.49	0.81192	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3571	0.94420	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ARHGAP19	99014572	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	7.539000	0.82063	2.592000	0.87571	0.655000	0.94253	.	.		0.363	ARHGAP19-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049647.2	NM_032900	Intron
DMRTA1	63951	hgsc.bcm.edu	37	9	22451584	22451584	+	Nonsense_Mutation	SNP	G	G	T	rs150162716		TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr9:22451584G>T	ENST00000325870.2	+	2	1414	c.1189G>T	c.(1189-1191)Gga>Tga	p.G397*		NM_022160.2	NP_071443.2	Q5VZB9	DMRTA_HUMAN	DMRT-like family A1	397					male mating behavior (GO:0060179)|ovarian follicle development (GO:0001541)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G397R(1)		breast(1)|kidney(1)|large_intestine(3)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15		all_cancers(5;4.09e-243)|Acute lymphoblastic leukemia(3;8.25e-150)|all_hematologic(3;4.25e-147)|Esophageal squamous(3;2.32e-09)|Renal(3;1.71e-07)|Breast(3;2.07e-06)|Hepatocellular(5;0.00563)		GBM - Glioblastoma multiforme(1;5.12e-278)|Lung(24;8.2e-52)|LUSC - Lung squamous cell carcinoma(38;1.46e-37)|OV - Ovarian serous cystadenocarcinoma(39;0.0517)		TAGTCTTGCTGGAATTGGTTT	0.408																																					p.G397X		.											DMRTA1,arm,malignant_melanoma,0,1	DMRTA1	0	1	Substitution - Missense(1)	skin(1)	c.G1189T						.						89.0	96.0	94.0					9																	22451584		2203	4300	6503	SO:0001587	stop_gained	63951	exon2			CTTGCTGGAATTG	AJ290954	CCDS6514.1	9p21.3	2008-05-15			ENSG00000176399	ENSG00000176399			13826	protein-coding gene	gene with protein product		614803					Standard	NM_022160		Approved		uc003zpp.1	Q5VZB9	OTTHUMG00000019693	ENST00000325870.2:c.1189G>T	9.37:g.22451584G>T	ENSP00000319651:p.Gly397*	Somatic	57	0		WXS	Illumina HiSeq	.	49	3	NM_022160	A1L481|Q8N8Y9|Q9H4B9	Nonsense_Mutation	SNP	ENST00000325870.2	37	CCDS6514.1	.	.	.	.	.	.	.	.	.	.	G	39	7.376310	0.98245	.	.	ENSG00000176399	ENST00000325870	.	.	.	5.92	5.92	0.95590	.	0.588879	0.17749	N	0.163318	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	-18.8041	19.0887	0.93217	0.0:0.0:1.0:0.0	.	.	.	.	X	397	.	ENSP00000319651:G397X	G	+	1	0	DMRTA1	22441584	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	1.887000	0.39698	2.801000	0.96364	0.650000	0.86243	GGA	.		0.408	DMRTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051935.2		
WRAP53	55135	hgsc.bcm.edu;broad.mit.edu	37	17	7606344	7606344	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr17:7606344C>T	ENST00000316024.5	+	9	3650	c.1302C>T	c.(1300-1302)agC>agT	p.S434S	EFNB3_ENST00000226091.2_5'Flank|WRAP53_ENST00000396463.2_Silent_p.S434S|WRAP53_ENST00000431639.2_Silent_p.S434S|WRAP53_ENST00000457584.2_Silent_p.S434S|WRAP53_ENST00000534050.1_Silent_p.S401S			Q9BUR4	WAP53_HUMAN	WD repeat containing, antisense to TP53	434					positive regulation of telomerase activity (GO:0051973)|telomere formation via telomerase (GO:0032203)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	RNA binding (GO:0003723)			endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|prostate(2)|stomach(2)	18						GCAGCACGAGCGGGGCTGTCT	0.632																																					p.S434S		.											WRAP53,NS,carcinoma,0,1	WRAP53	0	0			c.C1302T						.						45.0	50.0	48.0					17																	7606344		2203	4300	6503	SO:0001819	synonymous_variant	55135	exon10			CACGAGCGGGGCT	AK001247, DQ431240	CCDS11119.1	17p13.1	2014-09-17	2009-02-16	2009-02-16	ENSG00000141499	ENSG00000141499		"""WD repeat domain containing"""	25522	protein-coding gene	gene with protein product	"""telomerase cajal body protein 1"", ""WD-encoding RNA antisense to p53"""	612661	"""WD repeat domain 79"""	WDR79		19179534, 19250907, 19571673, 19342896, 20494116, 21441950	Standard	NM_018081		Approved	FLJ10385, TCAB1	uc010vuh.2	Q9BUR4	OTTHUMG00000134323	ENST00000316024.5:c.1302C>T	17.37:g.7606344C>T		Somatic	16	0		WXS	Illumina HiSeq	.	23	3	NM_001143991	B3KPR9|D3DTQ4|Q08ET9|Q9NW09	Silent	SNP	ENST00000316024.5	37	CCDS11119.1																																																																																			.		0.632	WRAP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259385.2	NM_018081	
ARID2	196528	hgsc.bcm.edu	37	12	46245336	46245336	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr12:46245336C>T	ENST00000334344.6	+	15	3602	c.3430C>T	c.(3430-3432)Ccc>Tcc	p.P1144S	ARID2_ENST00000444670.1_Missense_Mutation_p.P754S|ARID2_ENST00000457135.1_5'Flank|ARID2_ENST00000422737.1_Missense_Mutation_p.P995S|ARID2_ENST00000479608.1_3'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1144					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P1144S(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		ACAAACTGTGCCCATTTCGAA	0.493			"""N, S, F"""		hepatocellular carcinoma																																p.P1144S		.		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	ARID2,NS,carcinoma,0,1	ARID2	0	1	Substitution - Missense(1)	ovary(1)	c.C3430T						.						95.0	91.0	92.0					12																	46245336		2203	4300	6503	SO:0001583	missense	196528	exon15			ACTGTGCCCATTT		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.3430C>T	12.37:g.46245336C>T	ENSP00000335044:p.Pro1144Ser	Somatic	43	0		WXS	Illumina HiSeq	.	33	2	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Missense_Mutation	SNP	ENST00000334344.6	37	CCDS31783.1	.	.	.	.	.	.	.	.	.	.	C	13.52	2.261392	0.39995	.	.	ENSG00000189079	ENST00000334344;ENST00000549153;ENST00000338636;ENST00000422737;ENST00000444670	T	0.33865	1.39	5.86	5.86	0.93980	.	0.154543	0.64402	D	0.000016	T	0.28134	0.0694	L	0.27053	0.805	0.80722	D	1	B;B;B	0.33637	0.42;0.42;0.296	B;B;B	0.29176	0.099;0.099;0.027	T	0.03630	-1.1018	10	0.20046	T	0.44	-4.825	20.1931	0.98233	0.0:1.0:0.0:0.0	.	1144;754;1144	Q68CP9-3;F8W108;Q68CP9	.;.;ARID2_HUMAN	S	1144;261;261;995;754	ENSP00000335044:P1144S	ENSP00000335044:P1144S	P	+	1	0	ARID2	44531603	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.263000	0.78421	2.771000	0.95319	0.563000	0.77884	CCC	.		0.493	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
SLC5A12	159963	hgsc.bcm.edu;bcgsc.ca	37	11	26725205	26725205	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr11:26725205G>T	ENST00000396005.3	-	6	1003	c.694C>A	c.(694-696)Cct>Act	p.P232T	SLC5A12_ENST00000280467.6_Missense_Mutation_p.P232T	NM_178498.3	NP_848593.2	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12	232					sodium ion transport (GO:0006814)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)	35						CGCCTGAGAGGATCTACATCA	0.403																																					p.P232T		.											.	.	.	0			c.C694A						.						124.0	120.0	121.0					11																	26725205		2203	4299	6502	SO:0001583	missense	159963	exon6			TGAGAGGATCTAC	BC049207	CCDS7860.2	11p14.2	2013-07-19	2013-07-19		ENSG00000148942	ENSG00000148942		"""Solute carriers"""	28750	protein-coding gene	gene with protein product		612455	"""solute carrier family 5 (sodium/glucose cotransporter), member 12"""			12477932	Standard	NM_178498		Approved	MGC52019, SMCT2	uc001mra.2	Q1EHB4	OTTHUMG00000150706	ENST00000396005.3:c.694C>A	11.37:g.26725205G>T	ENSP00000379326:p.Pro232Thr	Somatic	60	0		WXS	Illumina HiSeq	.	56	4	NM_178498	Q86UC7	Missense_Mutation	SNP	ENST00000396005.3	37	CCDS7860.2	.	.	.	.	.	.	.	.	.	.	G	25.9	4.680908	0.88542	.	.	ENSG00000148942	ENST00000396005;ENST00000280467;ENST00000533617	D;D;D	0.89196	-2.48;-2.48;-2.48	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.96981	0.9014	H	0.97874	4.095	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.98270	1.0503	10	0.87932	D	0	.	19.3946	0.94601	0.0:0.0:1.0:0.0	.	232;232	Q1EHB4-2;Q1EHB4	.;SC5AC_HUMAN	T	232;232;44	ENSP00000379326:P232T;ENSP00000280467:P232T;ENSP00000435053:P44T	ENSP00000280467:P232T	P	-	1	0	SLC5A12	26681781	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.813000	0.99286	2.592000	0.87571	0.585000	0.79938	CCT	.		0.403	SLC5A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319681.1	NM_178498	
MT-ND4	4538	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	M	11988	11988	+	Missense_Mutation	SNP	T	T	C			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chrM:11988T>C	ENST00000361381.2	+	1	1229	c.1229T>C	c.(1228-1230)aTa>aCa	p.I410T	MT-TG_ENST00000387429.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-ND5_ENST00000361567.2_5'Flank			P03905	NU4M_HUMAN	mitochondrially encoded NADH dehydrogenase 4	410					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|prostate(1)	13						CTCCCTCTACATATTTACCAC	0.448																																					p.M410T		.											.	.	.	0			c.T1229C						.																																			SO:0001583	missense	0	exon1			TCTACATATTTAC			mitochondria	2014-02-03	2005-02-15	2005-02-16	ENSG00000198886	ENSG00000198886	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7459	protein-coding gene	gene with protein product	"""complex I ND4 subunit"", ""NADH-ubiquinone oxidoreductase chain 4"""	516003	"""NADH dehydrogenase 4"", ""Leber optic neuropathy"""	MTND4, LHON		8103501	Standard			Approved	ND4, NAD4		P03905		ENST00000361381.2:c.1229T>C	M.37:g.11988T>C	ENSP00000354961:p.Ile410Thr	Somatic	25	0		WXS	Illumina HiSeq	.	78	73	ENST00000361381	Q6RL39|Q6RQN9|Q8HNR8	Missense_Mutation	SNP	ENST00000361381.2	37																																																																																				.		0.448	MT-ND4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024035	
U2AF1L4	199746	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	36233568	36233568	+	3'UTR	SNP	C	C	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr19:36233568C>T	ENST00000412391.2	-	0	728				IGFLR1_ENST00000246532.1_5'Flank|U2AF1L4_ENST00000292879.5_Silent_p.Q180Q|IGFLR1_ENST00000588992.1_5'Flank|IGFLR1_ENST00000587101.1_5'Flank|U2AF1L4_ENST00000588100.1_5'Flank|U2AF1L4_ENST00000378975.3_3'UTR|PSENEN_ENST00000591949.1_5'Flank|IGFLR1_ENST00000344990.3_5'Flank|PSENEN_ENST00000222266.2_5'Flank|IGFLR1_ENST00000592537.1_5'Flank|PSENEN_ENST00000587708.2_5'Flank|AD000671.6_ENST00000589807.1_Intron|IGFLR1_ENST00000592889.1_5'Flank			Q8WU68	U2AF4_HUMAN	U2 small nuclear RNA auxiliary factor 1-like 4						mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	spliceosomal complex (GO:0005681)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)	8	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			AGGAGAGGTCCTGCCAGGAAC	0.592																																					p.Q180Q		.											.	.	.	0			c.G540A						.						83.0	95.0	91.0					19																	36233568		2203	4300	6503	SO:0001624	3_prime_UTR_variant	199746	exon6			GAGGTCCTGCCAG	BC021186, AY569437	CCDS12473.1, CCDS42551.1	19q13.13	2013-02-12	2006-04-12	2006-04-12		ENSG00000161265		"""RNA binding motif (RRM) containing"""	23020	protein-coding gene	gene with protein product		601080	"""U2(RNU2) small nuclear RNA auxiliary factor 1-like 3"", ""U2 small nuclear RNA auxiliary factor 1-like 3"""	U2AF1L3		8586425, 11739736	Standard	NM_001040425		Approved	MGC33901, U2af26	uc002obf.3	Q8WU68		ENST00000412391.2:c.*52G>A	19.37:g.36233568C>T		Somatic	31	0		WXS	Illumina HiSeq	.	41	16	NM_144987	A6NKI8|Q56UU3	Silent	SNP	ENST00000412391.2	37																																																																																				.		0.592	U2AF1L4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_144987	
ITGAV	3685	hgsc.bcm.edu	37	2	187511445	187511445	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr2:187511445G>T	ENST00000261023.3	+	13	1466	c.1192G>T	c.(1192-1194)Gat>Tat	p.D398Y	ITGAV_ENST00000433736.2_Missense_Mutation_p.D352Y|ITGAV_ENST00000374907.3_Missense_Mutation_p.D362Y|AC017101.10_ENST00000453665.1_RNA	NM_002210.3	NP_002201	P06756	ITAV_HUMAN	integrin, alpha V	398					angiogenesis (GO:0001525)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|apoptotic cell clearance (GO:0043277)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|endodermal cell differentiation (GO:0035987)|entry of symbiont into host cell by promotion of host phagocytosis (GO:0052066)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|negative chemotaxis (GO:0050919)|negative regulation of entry of bacterium into host cell (GO:2000536)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast proliferation (GO:0033690)|regulation of apoptotic cell clearance (GO:2000425)|regulation of phagocytosis (GO:0050764)|substrate adhesion-dependent cell spreading (GO:0034446)|viral entry into host cell (GO:0046718)	alphav-beta3 integrin-IGF-1-IGF1R complex (GO:0035867)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin alphav-beta5 complex (GO:0034684)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	extracellular matrix binding (GO:0050840)|extracellular matrix protein binding (GO:1990430)|fibronectin binding (GO:0001968)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|transforming growth factor beta binding (GO:0050431)|virus receptor activity (GO:0001618)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)	Antithymocyte globulin(DB00098)	TGGGGGTGAAGATAAAAAAGG	0.453																																					p.D398Y	Melanoma(58;108 1995 6081)	.											ITGAV,caecum,carcinoma,0,1	ITGAV	0	0			c.G1192T						.						92.0	89.0	90.0					2																	187511445		2203	4300	6503	SO:0001583	missense	3685	exon13			GGTGAAGATAAAA		CCDS2292.1, CCDS46470.1, CCDS46471.1	2q31-q32	2012-04-20	2012-04-20		ENSG00000138448	ENSG00000138448		"""CD molecules"", ""Integrins"""	6150	protein-coding gene	gene with protein product		193210	"""antigen identified by monoclonal antibody L230"", ""vitronectin receptor"", ""integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51)"""	VNRA, MSK8, VTNR		2454952	Standard	NM_001144999		Approved	CD51	uc002upq.4	P06756	OTTHUMG00000132635	ENST00000261023.3:c.1192G>T	2.37:g.187511445G>T	ENSP00000261023:p.Asp398Tyr	Somatic	25	0		WXS	Illumina HiSeq	.	26	2	NM_002210	A0AV67|B0LPF4|B7Z883|B7ZLX0|D3DPG8|E7EWZ6|Q53SK4|Q59EB7|Q6LD15	Missense_Mutation	SNP	ENST00000261023.3	37	CCDS2292.1	.	.	.	.	.	.	.	.	.	.	G	16.61	3.172524	0.57584	.	.	ENSG00000138448	ENST00000544640;ENST00000261023;ENST00000374907;ENST00000433736	T;T;T	0.23552	1.9;1.9;1.9	5.38	5.38	0.77491	.	0.374286	0.32372	N	0.006183	T	0.36991	0.0987	M	0.63843	1.955	0.51482	D	0.999925	B;P;P	0.36354	0.322;0.549;0.548	B;B;B	0.41571	0.24;0.36;0.24	T	0.23511	-1.0186	10	0.72032	D	0.01	.	19.1392	0.93441	0.0:0.0:1.0:0.0	.	352;362;398	E7EWZ6;P06756-2;P06756	.;.;ITAV_HUMAN	Y	398;398;362;352	ENSP00000261023:D398Y;ENSP00000364042:D362Y;ENSP00000404291:D352Y	ENSP00000261023:D398Y	D	+	1	0	ITGAV	187219690	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	4.393000	0.59665	2.512000	0.84698	0.561000	0.74099	GAT	.		0.453	ITGAV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255882.2	NM_002210	
ACTN2	88	hgsc.bcm.edu	37	1	236882229	236882229	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr1:236882229C>T	ENST00000366578.4	+	3	443	c.277C>T	c.(277-279)Cgg>Tgg	p.R93W	ACTN2_ENST00000542672.1_Missense_Mutation_p.R93W|ACTN2_ENST00000492634.1_3'UTR	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	93	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)			endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			GGGAAAAATGCGGTTCCACAA	0.483																																					p.R93W		.											.	.	.	0			c.C277T						.						128.0	123.0	124.0					1																	236882229		2203	4300	6503	SO:0001583	missense	88	exon3			AAAATGCGGTTCC	BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.277C>T	1.37:g.236882229C>T	ENSP00000355537:p.Arg93Trp	Somatic	51	0		WXS	Illumina HiSeq	.	87	4	NM_001103	B1ANE4|B2RCS5|Q86TF4|Q86TI8	Missense_Mutation	SNP	ENST00000366578.4	37	CCDS1613.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.705444	0.89018	.	.	ENSG00000077522	ENST00000542672;ENST00000366578	T;T	0.64260	-0.09;-0.09	5.56	5.56	0.83823	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	D	0.87609	0.6220	H	0.98027	4.13	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.996	D	0.91745	0.5407	10	0.87932	D	0	.	18.6602	0.91469	0.0:1.0:0.0:0.0	.	93;93	B2RCS5;P35609	.;ACTN2_HUMAN	W	93	ENSP00000443495:R93W;ENSP00000355537:R93W	ENSP00000355537:R93W	R	+	1	2	ACTN2	234948852	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.709000	0.54853	2.775000	0.95449	0.655000	0.94253	CGG	.		0.483	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096628.1	NM_001103	
FOXF1	2294	hgsc.bcm.edu	37	16	86544554	86544554	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr16:86544554G>A	ENST00000262426.4	+	1	422	c.379G>A	c.(379-381)Gcc>Acc	p.A127T	FENDRR_ENST00000595886.1_lincRNA	NM_001451.2	NP_001442.2	Q12946	FOXF1_HUMAN	forkhead box F1	127					blood vessel development (GO:0001568)|branching involved in open tracheal system development (GO:0060446)|cardiac left ventricle morphogenesis (GO:0003214)|cellular response to cytokine stimulus (GO:0071345)|cellular response to organic cyclic compound (GO:0071407)|detection of wounding (GO:0014822)|determination of left/right symmetry (GO:0007368)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic ectodermal digestive tract morphogenesis (GO:0048613)|embryonic foregut morphogenesis (GO:0048617)|endocardial cushion development (GO:0003197)|epithelial cell differentiation involved in mammary gland alveolus development (GO:0061030)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lateral mesodermal cell differentiation (GO:0048371)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung lobe morphogenesis (GO:0060463)|lung vasculature development (GO:0060426)|mesenchyme migration (GO:0090131)|midgut development (GO:0007494)|morphogenesis of a branching structure (GO:0001763)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mast cell degranulation (GO:0043305)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas development (GO:0031016)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smooth muscle cell differentiation (GO:0051150)|renal system development (GO:0072001)|respiratory tube development (GO:0030323)|right lung morphogenesis (GO:0060461)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|smoothened signaling pathway (GO:0007224)|somitogenesis (GO:0001756)|trachea development (GO:0060438)|ureter development (GO:0072189)|vasculogenesis (GO:0001570)|venous blood vessel development (GO:0060841)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)			autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|urinary_tract(1)	12						CATCGACCCGGCCAGCGAGTT	0.637																																					p.A127T		.											FOXF1_ENST00000262426,NS,carcinoma,0,2	FOXF1_ENST00000262426	0	0			c.G379A						.						70.0	86.0	80.0					16																	86544554		2197	4300	6497	SO:0001583	missense	2294	exon1			GACCCGGCCAGCG	U13219	CCDS10957.2	16q24	2008-02-05			ENSG00000103241	ENSG00000103241		"""Forkhead boxes"""	3809	protein-coding gene	gene with protein product		601089		FKHL5		8825632, 7957066	Standard	NM_001451		Approved	FREAC1	uc002fjl.3	Q12946	OTTHUMG00000137651	ENST00000262426.4:c.379G>A	16.37:g.86544554G>A	ENSP00000262426:p.Ala127Thr	Somatic	40	0		WXS	Illumina HiSeq	.	49	3	NM_001451	B2RAF4|Q5FWE5	Missense_Mutation	SNP	ENST00000262426.4	37	CCDS10957.2	.	.	.	.	.	.	.	.	.	.	G	25.4	4.638389	0.87760	.	.	ENSG00000103241	ENST00000262426	D	0.95482	-3.72	4.51	4.51	0.55191	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.191142	0.47093	D	0.000242	D	0.93890	0.8045	L	0.28740	0.885	0.80722	D	1	P	0.46395	0.877	P	0.49953	0.627	D	0.93894	0.7182	10	0.42905	T	0.14	.	16.1868	0.81960	0.0:0.0:1.0:0.0	.	127	Q12946	FOXF1_HUMAN	T	127	ENSP00000262426:A127T	ENSP00000262426:A127T	A	+	1	0	FOXF1	85102055	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.379000	0.97198	2.052000	0.61016	0.650000	0.86243	GCC	.		0.637	FOXF1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000269103.2	NM_001451	
FREM2	341640	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	13	39454561	39454561	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr13:39454561C>T	ENST00000280481.7	+	24	9363	c.9147C>T	c.(9145-9147)agC>agT	p.S3049S		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	3049					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		CCACCAAGAGCCGGAAGAAGA	0.512																																					p.S3049S		.											.	.	.	0			c.C9147T						.						103.0	98.0	99.0					13																	39454561		2203	4300	6503	SO:0001819	synonymous_variant	341640	exon24			CAAGAGCCGGAAG	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.9147C>T	13.37:g.39454561C>T		Somatic	41	0		WXS	Illumina HiSeq	.	29	4	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Silent	SNP	ENST00000280481.7	37	CCDS31960.1																																																																																			.		0.512	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
SESTD1	91404	hgsc.bcm.edu;bcgsc.ca	37	2	180016103	180016103	+	Missense_Mutation	SNP	C	C	T	rs377062896		TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr2:180016103C>T	ENST00000428443.3	-	6	701	c.385G>A	c.(385-387)Gcc>Acc	p.A129T		NM_178123.4	NP_835224.3	Q86VW0	SESD1_HUMAN	SEC14 and spectrin domains 1	129	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.						phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(3)	30			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)			AATTTGTTGGCGGACACTAAA	0.348																																					p.A129T		.											.	.	.	0			c.G385A						.	C	THR/ALA	0,4406		0,0,2203	64.0	63.0	64.0		385	5.7	1.0	2		64	1,8599	1.2+/-3.3	0,1,4299	no	missense	SESTD1	NM_178123.4	58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	129/697	180016103	1,13005	2203	4300	6503	SO:0001583	missense	91404	exon6			TGTTGGCGGACAC	AK096232	CCDS33338.1	2q31.3	2014-01-28			ENSG00000187231	ENSG00000187231			18379	protein-coding gene	gene with protein product						12837271	Standard	NM_178123		Approved	DKFZp434O0515, Solo	uc002uni.4	Q86VW0	OTTHUMG00000154554	ENST00000428443.3:c.385G>A	2.37:g.180016103C>T	ENSP00000415332:p.Ala129Thr	Somatic	108	0		WXS	Illumina HiSeq	.	59	5	NM_178123	Q53R38|Q53SP3|Q5GM69|Q8N6M1|Q96LQ2	Missense_Mutation	SNP	ENST00000428443.3	37	CCDS33338.1	.	.	.	.	.	.	.	.	.	.	C	18.09	3.546838	0.65198	0.0	1.16E-4	ENSG00000187231	ENST00000428443;ENST00000440010;ENST00000435047	T;T;T	0.62788	-0.0;-0.0;-0.0	5.68	5.68	0.88126	Cellular retinaldehyde-binding/triple function, C-terminal (1);	0.046327	0.85682	D	0.000000	T	0.51669	0.1688	N	0.19112	0.55	0.80722	D	1	P	0.43857	0.819	B	0.41332	0.354	T	0.47368	-0.9123	9	.	.	.	-9.0444	20.1554	0.98111	0.0:1.0:0.0:0.0	.	129	Q86VW0	SESD1_HUMAN	T	129	ENSP00000415332:A129T;ENSP00000416164:A129T;ENSP00000410286:A129T	.	A	-	1	0	SESTD1	179724348	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.742000	0.85008	2.838000	0.97847	0.591000	0.81541	GCC	.		0.348	SESTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335916.2	NM_178123	
PRDM1	639	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	106553700	106553700	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr6:106553700C>A	ENST00000369096.4	+	5	1899	c.1665C>A	c.(1663-1665)aaC>aaA	p.N555K	PRDM1_ENST00000369091.2_Missense_Mutation_p.N519K|PRDM1_ENST00000369089.3_Missense_Mutation_p.N421K	NM_001198.3	NP_001189.2	O75626	PRDM1_HUMAN	PR domain containing 1, with ZNF domain	555	Interaction with PIAS1.				cell fate commitment (GO:0045165)|eye photoreceptor cell development (GO:0042462)|germ cell development (GO:0007281)|intestinal epithelial cell development (GO:0060576)|maternal placenta development (GO:0001893)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gene expression (GO:0010628)|post-embryonic development (GO:0009791)|transcription, DNA-templated (GO:0006351)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(59)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(5)|urinary_tract(2)	94	Breast(9;0.022)	all_cancers(87;2.2e-31)|all_epithelial(87;2.03e-21)|Acute lymphoblastic leukemia(125;4.99e-11)|all_lung(197;7.55e-09)|all_hematologic(75;5.82e-08)|Lung NSC(302;1.28e-06)|Colorectal(196;0.0112)|Ovarian(999;0.0365)		all cancers(137;1.83e-46)|Epithelial(106;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(136;1.99e-20)|GBM - Glioblastoma multiforme(226;3.72e-11)|BRCA - Breast invasive adenocarcinoma(108;1.38e-05)		ACAAAAGAAACATGACCGGCT	0.542			"""D, N, Mis, F, S"""		DLBCL																																p.N555K		.		Rec	yes		6	6q21	639	"""PR domain containing 1, with ZNF domain"""		L	.	.	.	0			c.C1665A						.						57.0	58.0	57.0					6																	106553700		2203	4300	6503	SO:0001583	missense	639	exon5			AAGAAACATGACC		CCDS5054.2, CCDS34505.1	6q21	2013-01-08			ENSG00000057657	ENSG00000057657		"""Zinc fingers, C2H2-type"""	9346	protein-coding gene	gene with protein product		603423		BLIMP1		1851123	Standard	NM_001198		Approved	PRDI-BF1	uc003prd.2	O75626	OTTHUMG00000015299	ENST00000369096.4:c.1665C>A	6.37:g.106553700C>A	ENSP00000358092:p.Asn555Lys	Somatic	25	0		WXS	Illumina HiSeq	.	22	17	NM_001198	B2REA6|E1P5E0|Q86WM7	Missense_Mutation	SNP	ENST00000369096.4	37	CCDS5054.2	.	.	.	.	.	.	.	.	.	.	C	16.95	3.262706	0.59431	.	.	ENSG00000057657	ENST00000369091;ENST00000369096;ENST00000456278;ENST00000369089	T;T;T	0.06768	3.27;3.26;3.27	5.74	4.88	0.63580	.	0.125824	0.85682	D	0.000000	T	0.05273	0.0140	L	0.60455	1.87	0.51012	D	0.999905	P;P	0.52170	0.865;0.951	B;P	0.45913	0.379;0.497	T	0.41980	-0.9478	10	0.25751	T	0.34	-47.0413	9.1176	0.36766	0.0:0.7687:0.0:0.2313	.	421;555	Q86WM7;O75626	.;PRDM1_HUMAN	K	519;555;518;421	ENSP00000358087:N519K;ENSP00000358092:N555K;ENSP00000358085:N421K	ENSP00000358085:N421K	N	+	3	2	PRDM1	106660393	0.989000	0.36119	1.000000	0.80357	0.923000	0.55619	0.756000	0.26419	1.432000	0.47375	0.655000	0.94253	AAC	.		0.542	PRDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041661.3		
CLRN1	7401	hgsc.bcm.edu	37	3	150690293	150690293	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr3:150690293C>T	ENST00000327047.1	-	1	493	c.203G>A	c.(202-204)gGa>gAa	p.G68E	CLRN1-AS1_ENST00000465576.1_RNA|CLRN1-AS1_ENST00000476886.1_RNA|CLRN1_ENST00000328863.4_Missense_Mutation_p.G68E|RP11-166N6.2_ENST00000469268.1_RNA	NM_174878.2	NP_777367.1	P58418	CLRN1_HUMAN	clarin 1	68					actin filament organization (GO:0007015)|auditory receptor cell stereocilium organization (GO:0060088)|cell motility (GO:0048870)|equilibrioception (GO:0050957)|photoreceptor cell maintenance (GO:0045494)|positive regulation of lamellipodium assembly (GO:0010592)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|microvillus (GO:0005902)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|skin(2)	14			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			CACACCCTCTCCGTGGAAAAG	0.507																																					p.G68E		.											CLRN1,NS,carcinoma,0,1	CLRN1	0	0			c.G203A						.						92.0	80.0	84.0					3																	150690293		2203	4300	6503	SO:0001583	missense	7401	exon1			CCCTCTCCGTGGA	AF388366	CCDS3153.1, CCDS35492.1, CCDS56285.1	3q25.1	2014-09-17	2006-11-23	2006-11-23	ENSG00000163646	ENSG00000163646			12605	protein-coding gene	gene with protein product		606397	"""Usher syndrome 3A"""	USH3, USH3A, RP61		7711740, 8975700	Standard	NM_052995		Approved		uc021xfr.1	P58418	OTTHUMG00000140368	ENST00000327047.1:c.203G>A	3.37:g.150690293C>T	ENSP00000322280:p.Gly68Glu	Somatic	24	0		WXS	Illumina HiSeq	.	28	2	NM_001256819	D3DNJ3|E1ACU9|Q8N6A9	Missense_Mutation	SNP	ENST00000327047.1	37	CCDS3153.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.914583	0.92178	.	.	ENSG00000163646	ENST00000327047;ENST00000328863	T;T	0.72282	-0.25;-0.64	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	D	0.84311	0.5444	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85563	0.1229	10	0.87932	D	0	0.1963	19.4011	0.94630	0.0:1.0:0.0:0.0	.	68	P58418	CLRN1_HUMAN	E	68	ENSP00000322280:G68E;ENSP00000329158:G68E	ENSP00000322280:G68E	G	-	2	0	CLRN1	152172983	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.323000	0.79105	2.588000	0.87417	0.561000	0.74099	GGA	.		0.507	CLRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277060.1		
DKKL1	27120	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	49878126	49878126	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr19:49878126C>T	ENST00000221498.2	+	5	975	c.570C>T	c.(568-570)ctC>ctT	p.L190L	DKKL1_ENST00000594268.1_Silent_p.L48L|AC010524.2_ENST00000599433.1_RNA	NM_014419.3	NP_055234.1	Q9UK85	DKKL1_HUMAN	dickkopf-like 1	190					anatomical structure morphogenesis (GO:0009653)|positive regulation of fat cell differentiation (GO:0045600)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	signal transducer activity (GO:0004871)			large_intestine(2)|upper_aerodigestive_tract(1)	3		all_lung(116;1.66e-06)|Lung NSC(112;5.89e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0456)		GCCACTGGCTCAGCGAGAAGC	0.647																																					p.L190L		.											.	.	.	0			c.C570T						.						27.0	30.0	29.0					19																	49878126		2203	4300	6503	SO:0001819	synonymous_variant	27120	exon5			CTGGCTCAGCGAG	AB047816	CCDS12762.1	19q13.3	2010-10-12	2010-10-12		ENSG00000104901	ENSG00000104901			16528	protein-coding gene	gene with protein product	"""cancer/testis antigen 34"", ""soggy"""	605418	"""dickkopf-like 1 (soggy)"""			10570958	Standard	NM_001197301		Approved	SGY-1, CT34	uc002pnk.3	Q9UK85		ENST00000221498.2:c.570C>T	19.37:g.49878126C>T		Somatic	49	0		WXS	Illumina HiSeq	.	29	11	NM_014419		Silent	SNP	ENST00000221498.2	37	CCDS12762.1																																																																																			.		0.647	DKKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465454.2	NM_014419	
SALL1	6299	hgsc.bcm.edu	37	16	51173912	51173912	+	Silent	SNP	G	G	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr16:51173912G>T	ENST00000251020.4	-	2	2254	c.2221C>A	c.(2221-2223)Cgg>Agg	p.R741R	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Silent_p.R644R|SALL1_ENST00000541611.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	741					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R741W(1)		NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			GTGAAAGCCCGGCCACAGATC	0.547																																					p.R741R	GBM(103;1352 1446 1855 4775 8890)	.											SALL1,NS,carcinoma,0,2	SALL1	0	1	Substitution - Missense(1)	prostate(1)	c.C2221A						.						57.0	58.0	58.0					16																	51173912		2198	4300	6498	SO:0001819	synonymous_variant	6299	exon2			AAGCCCGGCCACA	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.2221C>A	16.37:g.51173912G>T		Somatic	40	0		WXS	Illumina HiSeq	.	41	2	NM_002968	Q99881|Q9NSC3|Q9P1R0	Silent	SNP	ENST00000251020.4	37	CCDS10747.1																																																																																			.		0.547	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968	
PASK	23178	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	242051786	242051786	+	Silent	SNP	G	G	A	rs200314136		TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr2:242051786G>A	ENST00000405260.1	-	15	4100	c.3402C>T	c.(3400-3402)atC>atT	p.I1134I	PASK_ENST00000234040.4_Silent_p.I1134I|PASK_ENST00000544142.1_Silent_p.I948I|PASK_ENST00000475666.1_5'UTR|PASK_ENST00000539818.1_Silent_p.I918I|PASK_ENST00000358649.4_Silent_p.I1141I	NM_001252120.1	NP_001239049.1	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	1134	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of glycogen biosynthetic process (GO:0045719)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of energy homeostasis (GO:2000505)|regulation of glucagon secretion (GO:0070092)|regulation of respiratory gaseous exchange (GO:0043576)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(20)|ovary(4)|prostate(4)|skin(1)|stomach(1)|urinary_tract(2)	53		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		CGGCGATCACGATGTTCTCAT	0.488																																					p.I1141I		.											.	.	.	0			c.C3423T						.	G		0,4406		0,0,2203	79.0	72.0	74.0		3402	-3.0	0.1	2		74	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	PASK	NM_015148.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		1134/1324	242051786	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	23178	exon15			GATCACGATGTTC	U79240	CCDS2545.1, CCDS58758.1, CCDS58759.1	2q37.3	2008-05-23			ENSG00000115687	ENSG00000115687			17270	protein-coding gene	gene with protein product		607505				11688972, 11459942, 15148392	Standard	NM_001252119		Approved	PASKIN, KIAA0135, STK37	uc010fzl.2	Q96RG2	OTTHUMG00000133392	ENST00000405260.1:c.3402C>T	2.37:g.242051786G>A		Somatic	22	0		WXS	Illumina HiSeq	.	22	8	NM_001252119	G5E9F1|Q05BE4|Q68DY3|Q6GSJ5|Q86XH6|Q99763|Q9UFR7	Silent	SNP	ENST00000405260.1	37	CCDS2545.1																																																																																			0.001		0.488	PASK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000323753.1	NM_015148	
PKD1	5310	hgsc.bcm.edu	37	16	2160404	2160404	+	Silent	SNP	G	G	A	rs376144237		TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr16:2160404G>A	ENST00000262304.4	-	15	4972	c.4764C>T	c.(4762-4764)tgC>tgT	p.C1588C	RP11-304L19.4_ENST00000568795.1_RNA|PKD1_ENST00000423118.1_Silent_p.C1588C	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	1588	PKD 11. {ECO:0000255|PROSITE- ProRule:PRU00151}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						GGATGGGCGTGCAGCGGTCAC	0.637																																					p.C1588C		.											.	.	.	0			c.C4764T						.	G	,	0,4382		0,0,2191	54.0	52.0	53.0		4764,4764	4.2	1.0	16		53	1,8585	1.2+/-3.3	0,1,4292	no	coding-synonymous,coding-synonymous	PKD1	NM_000296.3,NM_001009944.2	,	0,1,6483	AA,AG,GG		0.0116,0.0,0.0077	,	1588/4303,1588/4304	2160404	1,12967	2191	4293	6484	SO:0001819	synonymous_variant	5310	exon15			GGGCGTGCAGCGG	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.4764C>T	16.37:g.2160404G>A		Somatic	61	0		WXS	Illumina HiSeq	.	52	4	NM_000296	Q15140|Q15141	Silent	SNP	ENST00000262304.4	37	CCDS32369.1																																																																																			.		0.637	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
MT-ND2	4536	hgsc.bcm.edu;broad.mit.edu	37	M	1964	1964	+	5'Flank	SNP	T	T	C			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chrM:1964T>C	ENST00000361453.3	+	0	0				MT-ND1_ENST00000361390.2_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TV_ENST00000387342.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						TATGTAGCAAAATAGTGGGAA	0.433																																					.		.											.	.	.	0			.						.																																			SO:0001631	upstream_gene_variant	6053	.			GCAAAATAGTGGG			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.1964T>C	Exception_encountered	Somatic	14	0		WXS	Illumina HiSeq	.	89	25	.	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	ENST00000361453.3	37																																																																																				.		0.433	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024027	
GIGYF2	26058	hgsc.bcm.edu	37	2	233708929	233708929	+	Silent	SNP	G	G	A			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr2:233708929G>A	ENST00000409547.1	+	26	3374	c.3063G>A	c.(3061-3063)caG>caA	p.Q1021Q	GIGYF2_ENST00000452341.2_Missense_Mutation_p.A864T|GIGYF2_ENST00000409480.1_Silent_p.Q1043Q|GIGYF2_ENST00000409451.3_Silent_p.Q1042Q|GIGYF2_ENST00000409196.3_Silent_p.Q1015Q|GIGYF2_ENST00000373566.3_Silent_p.Q1043Q|GIGYF2_ENST00000373563.4_Silent_p.Q1021Q	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	1021	Gln-rich.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.Q1042Q(1)|p.Q1021Q(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		agcagcagcagcaacaccagc	0.473																																					p.Q1042Q		.											GIGYF2_ENST00000409451,NS,carcinoma,0,2	GIGYF2_ENST00000409451	0	2	Substitution - coding silent(2)	endometrium(2)	c.G3126A						.						38.0	27.0	31.0					2																	233708929		2195	4290	6485	SO:0001819	synonymous_variant	26058	exon26			GCAGCAGCAACAC	U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.3063G>A	2.37:g.233708929G>A		Somatic	26	0		WXS	Illumina HiSeq	.	26	2	NM_001103147	A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Silent	SNP	ENST00000409547.1	37	CCDS33401.1	.	.	.	.	.	.	.	.	.	.	G	13.26	2.185557	0.38609	.	.	ENSG00000204120	ENST00000452341	T	0.72051	-0.62	4.57	1.77	0.24775	.	.	.	.	.	T	0.58452	0.2123	.	.	.	0.20196	N	0.999926	B	0.02656	0.0	B	0.08055	0.003	T	0.52845	-0.8521	8	0.87932	D	0	-12.091	7.606	0.28103	0.2887:0.0:0.7113:0.0	.	864	E9PC50	.	T	864	ENSP00000411505:A864T	ENSP00000411505:A864T	A	+	1	0	GIGYF2	233417173	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	2.850000	0.48294	0.372000	0.24591	-0.291000	0.09656	GCA	.		0.473	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000330316.2	NM_001103146	
KMT2A	4297	hgsc.bcm.edu	37	11	118344932	118344932	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr11:118344932G>T	ENST00000389506.5	+	3	3058	c.3058G>T	c.(3058-3060)Gac>Tac	p.D1020Y	KMT2A_ENST00000354520.4_Missense_Mutation_p.D1020Y|KMT2A_ENST00000534358.1_Missense_Mutation_p.D1020Y			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	1020					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										TCCAATGACTGACAAGAGGGT	0.483																																					p.D1020Y		.											.	.	.	0			c.G3058T						.						89.0	88.0	88.0					11																	118344932		2200	4296	6496	SO:0001583	missense	4297	exon3			ATGACTGACAAGA	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.3058G>T	11.37:g.118344932G>T	ENSP00000374157:p.Asp1020Tyr	Somatic	29	0		WXS	Illumina HiSeq	.	35	3	NM_001197104	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	ENST00000389506.5	37	CCDS31686.1	.	.	.	.	.	.	.	.	.	.	G	15.39	2.820500	0.50633	.	.	ENSG00000118058	ENST00000534358;ENST00000531904;ENST00000389506;ENST00000354520;ENST00000527869;ENST00000533790;ENST00000389507	D;T;D;D	0.86497	-2.09;1.74;-2.09;-2.13	5.52	5.52	0.82312	.	0.114120	0.56097	D	0.000021	D	0.91205	0.7229	L	0.40543	1.245	0.58432	D	0.999998	D;D;D	0.89917	0.998;1.0;0.998	D;D;D	0.77557	0.982;0.956;0.99	D	0.91938	0.5560	10	0.87932	D	0	.	19.4359	0.94794	0.0:0.0:1.0:0.0	.	1020;1020;1053	E9PQG7;Q03164;E9PR05	.;MLL1_HUMAN;.	Y	1020;1053;1020;1020;131;98;40	ENSP00000436786:D1020Y;ENSP00000432391:D1053Y;ENSP00000374157:D1020Y;ENSP00000346516:D1020Y	ENSP00000346516:D1020Y	D	+	1	0	MLL	117850142	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.484000	0.81180	2.588000	0.87417	0.591000	0.81541	GAC	.		0.483	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933	
CACNA1B	774	hgsc.bcm.edu	37	9	140773613	140773613	+	Splice_Site	SNP	T	T	A	rs201604190		TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr9:140773613T>A	ENST00000371372.1	+	2	535		c.e2+2		CACNA1B_ENST00000277549.5_Splice_Site|CACNA1B_ENST00000371363.1_Splice_Site|CACNA1B_ENST00000277551.2_Splice_Site|CACNA1B_ENST00000371355.4_Splice_Site|CACNA1B_ENST00000371357.1_Splice_Site|RP11-188C12.3_ENST00000371390.1_RNA	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit						calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)	p.?(2)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	GAGCGGCTGGTGAGTGCCCGG	0.632																																					.		.											CACNA1B,colon,carcinoma,0,8	CACNA1B	0	2	Unknown(2)	lung(1)|breast(1)	c.390+2T>A						.						25.0	29.0	28.0					9																	140773613		2104	4235	6339	SO:0001630	splice_region_variant	774	exon2			GGCTGGTGAGTGC	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.390+2T>A	9.37:g.140773613T>A		Somatic	39	2		WXS	Illumina HiSeq	.	27	4	NM_001243812	B1AQK5	Splice_Site	SNP	ENST00000371372.1	37	CCDS59522.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.975539	0.74360	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000371363;ENST00000371357;ENST00000371355	.	.	.	4.73	3.57	0.40892	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.6445	0.51253	0.0:0.0:0.1485:0.8515	.	.	.	.	.	-1	.	.	.	+	.	.	CACNA1B	139893434	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.830000	0.86741	0.644000	0.30656	0.459000	0.35465	.	.		0.632	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718	Intron
OR6P1	128366	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	158533186	158533186	+	Missense_Mutation	SNP	T	T	C			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr1:158533186T>C	ENST00000334632.1	-	1	208	c.209A>G	c.(208-210)gAg>gGg	p.E70G		NM_001160325.1	NP_001153797.1	Q8NGX9	OR6P1_HUMAN	olfactory receptor, family 6, subfamily P, member 1	70						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(4)|lung(1)	6						GTACCATAGCTCCAGGAAAGA	0.473																																					p.E70G		.											.	.	.	0			c.A209G						.						39.0	40.0	40.0					1																	158533186		692	1591	2283	SO:0001583	missense	128366	exon1			CATAGCTCCAGGA	BK004193	CCDS53391.1	1q23.1	2012-08-09			ENSG00000186440	ENSG00000186440		"""GPCR / Class A : Olfactory receptors"""	15036	protein-coding gene	gene with protein product							Standard	NM_001160325		Approved		uc010pim.2	Q8NGX9	OTTHUMG00000019633	ENST00000334632.1:c.209A>G	1.37:g.158533186T>C	ENSP00000334721:p.Glu70Gly	Somatic	54	0		WXS	Illumina HiSeq	.	138	77	NM_001160325	Q6IFR9	Missense_Mutation	SNP	ENST00000334632.1	37	CCDS53391.1	.	.	.	.	.	.	.	.	.	.	T	14.03	2.413216	0.42817	.	.	ENSG00000186440	ENST00000334632	T	0.00444	7.4	5.0	5.0	0.66597	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47093	D	0.000256	T	0.00784	0.0026	M	0.87971	2.92	0.42088	D	0.991283	D	0.89917	1.0	D	0.85130	0.997	T	0.61148	-0.7121	10	0.87932	D	0	.	13.8199	0.63313	0.0:0.0:0.0:1.0	.	70	Q8NGX9	OR6P1_HUMAN	G	70	ENSP00000334721:E70G	ENSP00000334721:E70G	E	-	2	0	OR6P1	156799810	1.000000	0.71417	0.938000	0.37757	0.005000	0.04900	5.943000	0.70211	2.100000	0.63781	0.482000	0.46254	GAG	.		0.473	OR6P1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051848.1		
MANBA	4126	hgsc.bcm.edu	37	4	103560932	103560932	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr4:103560932G>A	ENST00000226578.4	-	14	2051	c.1952C>T	c.(1951-1953)aCg>aTg	p.T651M	MANBA_ENST00000505239.1_Missense_Mutation_p.T594M	NM_005908.3	NP_005899.3	O00462	MANBA_HUMAN	mannosidase, beta A, lysosomal	651					cellular protein modification process (GO:0006464)|glycoprotein catabolic process (GO:0006516)|mannan catabolic process (GO:0046355)	intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)	beta-mannosidase activity (GO:0004567)|mannose binding (GO:0005537)	p.T651M(1)		cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;4.44e-08)		TGCCCCCATCGTGTGCCCTTG	0.493																																					p.T651M		.											MANBA,colon,carcinoma,0,1	MANBA	0	1	Substitution - Missense(1)	large_intestine(1)	c.C1952T						.						144.0	118.0	127.0					4																	103560932		2203	4300	6503	SO:0001583	missense	4126	exon14			CCCATCGTGTGCC		CCDS3658.1	4q24	2013-09-20			ENSG00000109323	ENSG00000109323	3.2.1.25		6831	protein-coding gene	gene with protein product		609489				7876128	Standard	NM_005908		Approved		uc003hwg.3	O00462	OTTHUMG00000131123	ENST00000226578.4:c.1952C>T	4.37:g.103560932G>A	ENSP00000226578:p.Thr651Met	Somatic	29	0		WXS	Illumina HiSeq	.	33	2	NM_005908	Q96BC3|Q9NYX9	Missense_Mutation	SNP	ENST00000226578.4	37	CCDS3658.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.458820	0.84317	.	.	ENSG00000109323	ENST00000226578;ENST00000505239	T;T	0.79749	-1.3;-1.3	5.7	4.86	0.63082	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.097443	0.64402	D	0.000001	D	0.91425	0.7294	M	0.91972	3.26	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	D	0.93048	0.6463	10	0.66056	D	0.02	-6.3094	14.6915	0.69091	0.0696:0.0:0.9304:0.0	.	594;651	E9PFW2;O00462	.;MANBA_HUMAN	M	651;594	ENSP00000226578:T651M;ENSP00000427322:T594M	ENSP00000226578:T651M	T	-	2	0	MANBA	103779980	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	9.353000	0.97080	1.432000	0.47375	0.650000	0.86243	ACG	.		0.493	MANBA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253803.2		
TMEM44	93109	hgsc.bcm.edu	37	3	194337847	194337847	+	Missense_Mutation	SNP	C	C	T	rs369611318		TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr3:194337847C>T	ENST00000392432.2	-	7	1110	c.905G>A	c.(904-906)cGt>cAt	p.R302H	TMEM44_ENST00000347147.4_Missense_Mutation_p.R255H|TMEM44_ENST00000273580.7_Missense_Mutation_p.R255H|TMEM44_ENST00000381975.3_Missense_Mutation_p.R255H|TMEM44_ENST00000473092.1_Missense_Mutation_p.R255H	NM_001166305.1	NP_001159777.1	Q2T9K0	TMM44_HUMAN	transmembrane protein 44	302						integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|urinary_tract(1)	8	all_cancers(143;1.41e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;9.06e-06)		CAGTGCCGCACGGCCGAGGGA	0.687																																					p.R302H		.											.	.	.	0			c.G905A						.	C	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	0,4322		0,0,2161	24.0	20.0	21.0		764,905,764,764	1.8	0.2	3		21	1,8535		0,1,4267	no	missense,missense,missense,missense	TMEM44	NM_001011655.2,NM_001166305.1,NM_001166306.1,NM_138399.4	29,29,29,29	0,1,6428	TT,TC,CC		0.0117,0.0,0.0078	probably-damaging,probably-damaging,probably-damaging,probably-damaging	255/429,302/476,255/397,255/439	194337847	1,12857	2161	4268	6429	SO:0001583	missense	93109	exon7			GCCGCACGGCCGA	AL833026	CCDS3308.1, CCDS33921.1, CCDS3308.2, CCDS54698.1, CCDS54699.1	3q29	2005-08-16			ENSG00000145014	ENSG00000145014			25120	protein-coding gene	gene with protein product							Standard	NM_138399		Approved	DKFZp686O18124	uc010hzn.3	Q2T9K0	OTTHUMG00000156023	ENST00000392432.2:c.905G>A	3.37:g.194337847C>T	ENSP00000376227:p.Arg302His	Somatic	89	0		WXS	Illumina HiSeq	.	75	4	NM_001166305	A1L3V7|B7ZLZ5|B7ZLZ6|C9JJ62|E9PGA9|Q0P6F7|Q6ZT47|Q8IXR1|Q8N4G3	Missense_Mutation	SNP	ENST00000392432.2	37	CCDS54699.1	.	.	.	.	.	.	.	.	.	.	C	10.84	1.465243	0.26335	0.0	1.17E-4	ENSG00000145014	ENST00000392432;ENST00000273580;ENST00000432352;ENST00000347147;ENST00000381975;ENST00000473092	T;T;T;T;T;T	0.37411	1.2;1.2;1.2;1.2;1.2;1.2	5.34	1.81	0.25067	.	0.468479	0.18876	N	0.128718	T	0.25606	0.0623	L	0.57536	1.79	0.09310	N	1	B;P;B;B;B	0.37141	0.196;0.584;0.027;0.027;0.196	B;B;B;B;B	0.28232	0.041;0.087;0.009;0.009;0.041	T	0.21965	-1.0230	10	0.54805	T	0.06	-2.4635	4.6261	0.12479	0.0:0.5344:0.2653:0.2003	.	255;302;255;255;255	E9PGA9;Q2T9K0;Q2T9K0-4;Q2T9K0-2;Q2T9K0-6	.;TMM44_HUMAN;.;.;.	H	302;255;13;255;255;255	ENSP00000376227:R302H;ENSP00000273580:R255H;ENSP00000409963:R13H;ENSP00000333355:R255H;ENSP00000371402:R255H;ENSP00000418674:R255H	ENSP00000273580:R255H	R	-	2	0	TMEM44	195819136	0.011000	0.17503	0.199000	0.23439	0.454000	0.32378	0.859000	0.27858	1.250000	0.43966	0.655000	0.94253	CGT	.		0.687	TMEM44-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000342750.1	NM_138399	
C18orf25	147339	hgsc.bcm.edu	37	18	43833705	43833705	+	Missense_Mutation	SNP	G	G	C	rs370787556		TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr18:43833705G>C	ENST00000282059.6	+	4	1315	c.941G>C	c.(940-942)gGc>gCc	p.G314A	C18orf25_ENST00000321319.6_Missense_Mutation_p.G253A	NM_145055.3	NP_659492	Q96B23	CR025_HUMAN	chromosome 18 open reading frame 25	314										central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)	11						AAAACATCTGGCAATGCGCCA	0.403																																					p.G314A		.											.,1	.	27	0			c.G941C						.						127.0	117.0	120.0					18																	43833705		1867	4091	5958	SO:0001583	missense	147339	exon4			CATCTGGCAATGC	AL713661	CCDS42430.1, CCDS42431.1	18q21.1	2014-01-03			ENSG00000152242	ENSG00000152242			28172	protein-coding gene	gene with protein product	"""ARKadia-like 1"""					15722956	Standard	NM_001008239		Approved	MGC12909, ARKL1, RNF111L1	uc002lbw.3	Q96B23		ENST00000282059.6:c.941G>C	18.37:g.43833705G>C	ENSP00000282059:p.Gly314Ala	Somatic	90	1		WXS	Illumina HiSeq	.	101	5	NM_145055	A8K123|A8KAB6|Q5XG78|Q6N058|Q86TB5|Q8TCQ5	Missense_Mutation	SNP	ENST00000282059.6	37	CCDS42430.1	.	.	.	.	.	.	.	.	.	.	G	7.249	0.602752	0.13939	.	.	ENSG00000152242	ENST00000282059;ENST00000321319	.	.	.	4.88	4.88	0.63580	.	0.277861	0.34110	N	0.004252	T	0.42359	0.1199	L	0.29908	0.895	0.40975	D	0.984731	B;B	0.30914	0.002;0.3	B;B	0.29785	0.006;0.107	T	0.38351	-0.9665	9	0.02654	T	1	-6.069	16.5472	0.84450	0.0:0.0:1.0:0.0	.	253;314	Q96B23-2;Q96B23	.;CR025_HUMAN	A	314;253	.	ENSP00000282059:G314A	G	+	2	0	C18orf25	42087703	1.000000	0.71417	0.250000	0.24296	0.003000	0.03518	5.274000	0.65569	2.407000	0.81776	0.585000	0.79938	GGC	.		0.403	C18orf25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445242.1	NM_145055	
MT-CO1	4512	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	M	6510	6510	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chrM:6510G>A	ENST00000361624.2	+	1	607	c.607G>A	c.(607-609)Gct>Act	p.A203T	MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TM_ENST00000387377.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-CO2_ENST00000361739.1_5'Flank			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	203					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						TCCCAGTCCTAGCTGCTGGCA	0.507																																					p.A203T		.											.	.	.	0			c.G607A						.																																			SO:0001583	missense	5742	exon1			GTCCTAGCTGCTG			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.607G>A	M.37:g.6510G>A	ENSP00000354499:p.Ala203Thr	Somatic	22	0		WXS	Illumina HiSeq	.	82	77	ENST00000361624	Q34770	Missense_Mutation	SNP	ENST00000361624.2	37																																																																																				.		0.507	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024028	
PABPC3	5042	hgsc.bcm.edu	37	13	25671456	25671456	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr13:25671456C>T	ENST00000281589.3	+	1	1157	c.1120C>T	c.(1120-1122)Cgc>Tgc	p.R374C		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	374					mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		CAAAGAAGAGCGCCAGGCTTA	0.493																																					p.R374C		.											PABPC3,colon,carcinoma,-1,1	PABPC3	-1	0			c.C1120T						.						152.0	137.0	142.0					13																	25671456		2203	4300	6503	SO:0001583	missense	5042	exon1			GAAGAGCGCCAGG	AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.1120C>T	13.37:g.25671456C>T	ENSP00000281589:p.Arg374Cys	Somatic	74	0		WXS	Illumina HiSeq	.	39	2	NM_030979	Q8NHV0|Q9H086	Missense_Mutation	SNP	ENST00000281589.3	37	CCDS9311.1	.	.	.	.	.	.	.	.	.	.	C	14.86	2.662075	0.47572	.	.	ENSG00000151846	ENST00000281589	T	0.06933	3.24	1.41	1.41	0.22369	.	0.134911	0.32287	U	0.006318	T	0.19967	0.0480	M	0.75615	2.305	0.80722	D	1	D	0.76494	0.999	P	0.59546	0.859	T	0.01360	-1.1375	10	0.87932	D	0	.	8.3066	0.32047	0.0:1.0:0.0:0.0	.	374	Q9H361	PABP3_HUMAN	C	374	ENSP00000281589:R374C	ENSP00000281589:R374C	R	+	1	0	PABPC3	24569456	1.000000	0.71417	0.898000	0.35279	0.499000	0.33736	5.304000	0.65744	0.759000	0.33084	0.313000	0.20887	CGC	.		0.493	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2	NM_030979	
NUP210P1	255330	hgsc.bcm.edu	37	3	126385744	126385744	+	RNA	SNP	C	C	A			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr3:126385744C>A	ENST00000357061.3	+	0	400					NR_034158.1				nucleoporin 210kDa pseudogene 1																		GAGGAACCAGCACTGTGGGGC	0.622																																					.		.											.	.	.	0			.						.																																					255330	.			AACCAGCACTGTG	BC042038		3q21.2	2011-08-16	2011-08-16	2011-08-16	ENSG00000198284	ENSG00000198284			27399	pseudogene	pseudogene			"""chromosome 3 open reading frame 46"""	C3orf46			Standard	NR_034158		Approved		uc003eje.1		OTTHUMG00000159577		3.37:g.126385744C>A		Somatic	24	0		WXS	Illumina HiSeq	.	30	10	.		RNA	SNP	ENST00000357061.3	37																																																																																				.		0.622	NUP210P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000356320.1	NR_034158	
PTPRS	5802	hgsc.bcm.edu	37	19	5218452	5218452	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr19:5218452G>T	ENST00000587303.1	-	24	4126	c.4027C>A	c.(4027-4029)Cgc>Agc	p.R1343S	PTPRS_ENST00000588552.1_5'UTR|PTPRS_ENST00000353284.2_Missense_Mutation_p.R912S|PTPRS_ENST00000588012.1_Missense_Mutation_p.R1321S|PTPRS_ENST00000592099.1_Missense_Mutation_p.R912S|PTPRS_ENST00000348075.2_Missense_Mutation_p.R1321S|PTPRS_ENST00000357368.4_Missense_Mutation_p.R1343S|PTPRS_ENST00000372412.4_Missense_Mutation_p.R1344S|PTPRS_ENST00000262963.6_Missense_Mutation_p.R1339S			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	1343					cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	AAGTTAATGCGTCTCATTTCC	0.562																																					p.R1343S		.											PTPRS,colon,carcinoma,+1,1	PTPRS	+1	0			c.C4027A						.						218.0	200.0	206.0					19																	5218452		2203	4300	6503	SO:0001583	missense	5802	exon25			TAATGCGTCTCAT	U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.4027C>A	19.37:g.5218452G>T	ENSP00000467537:p.Arg1343Ser	Somatic	39	1		WXS	Illumina HiSeq	.	32	2	NM_002850	O75255|O75870|Q15718|Q16341|Q2M3R7	Missense_Mutation	SNP	ENST00000587303.1	37	CCDS45930.1	.	.	.	.	.	.	.	.	.	.	G	19.33	3.807387	0.70797	.	.	ENSG00000105426	ENST00000536396;ENST00000372412;ENST00000357368;ENST00000355005;ENST00000356037;ENST00000262963;ENST00000348075;ENST00000355322;ENST00000544524;ENST00000353284	T;T;T;T;T	0.56941	0.61;0.61;0.55;0.43;0.52	4.3	4.3	0.51218	.	0.000000	0.64402	U	0.000006	T	0.75481	0.3855	M	0.88181	2.935	0.80722	D	1	D;D;D;P;D;D	0.89917	0.999;0.983;1.0;0.85;1.0;1.0	D;P;D;P;D;D	0.91635	0.989;0.904;0.999;0.532;0.999;0.998	T	0.81002	-0.1130	10	0.87932	D	0	.	13.5638	0.61806	0.0:0.0:0.8441:0.1559	.	925;912;916;1321;1343;938	F8W800;Q13332-7;F5H2T4;Q13332-6;Q13332;Q59FX6	.;.;.;.;PTPRS_HUMAN;.	S	938;1344;1343;1343;1334;1339;1321;925;916;912	ENSP00000361489:R1344S;ENSP00000349932:R1343S;ENSP00000262963:R1339S;ENSP00000269907:R1321S;ENSP00000327313:R912S	ENSP00000262963:R1339S	R	-	1	0	PTPRS	5169452	1.000000	0.71417	0.987000	0.45799	0.930000	0.56654	4.882000	0.63121	2.232000	0.73038	0.561000	0.74099	CGC	.		0.562	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450762.2		
ZNF85	7639	hgsc.bcm.edu	37	19	21132556	21132556	+	Silent	SNP	C	C	A			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr19:21132556C>A	ENST00000328178.8	+	4	1349	c.1236C>A	c.(1234-1236)acC>acA	p.T412T	ZNF85_ENST00000601023.1_Silent_p.T353T|ZNF85_ENST00000345030.6_Silent_p.T379T	NM_001256173.1|NM_003429.4	NP_001243102.1|NP_003420.2	Q03923	ZNF85_HUMAN	zinc finger protein 85	412					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.T412T(1)		breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)	20						ACTCTTCAACCCTTACTAAAC	0.308																																					p.T442T		.											ZNF85,NS,carcinoma,0,1	ZNF85	0	1	Substitution - coding silent(1)	lung(1)	c.C1326A						.						29.0	31.0	30.0					19																	21132556		2200	4293	6493	SO:0001819	synonymous_variant	7639	exon5			TTCAACCCTTACT	U35376	CCDS32977.1, CCDS58657.1	19p12	2013-01-08	2006-05-12			ENSG00000105750		"""Zinc fingers, C2H2-type"", ""-"""	13160	protein-coding gene	gene with protein product		603899	"""zinc finger protein 85 (HPF4, HTF1)"""			2505992	Standard	NM_003429		Approved	HPF4, HTF1	uc031rjx.1	Q03923		ENST00000328178.8:c.1236C>A	19.37:g.21132556C>A		Somatic	61	0		WXS	Illumina HiSeq	.	39	3	NM_001256171	B9ZVP4|Q6NVI0	Silent	SNP	ENST00000328178.8	37	CCDS32977.1																																																																																			.		0.308	ZNF85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463430.1	NM_003429	
CACNA1G	8913	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	48684279	48684279	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr17:48684279G>A	ENST00000359106.5	+	24	4441	c.4441G>A	c.(4441-4443)Gtt>Att	p.V1481I	CACNA1G_ENST00000352832.5_Missense_Mutation_p.V1458I|CACNA1G_ENST00000515165.1_Missense_Mutation_p.V1481I|CACNA1G_ENST00000513964.1_Missense_Mutation_p.V1481I|CACNA1G_ENST00000358244.5_Missense_Mutation_p.V1458I|CACNA1G_ENST00000354983.4_Missense_Mutation_p.V1458I|CACNA1G_ENST00000502264.1_Missense_Mutation_p.V1458I|CACNA1G_ENST00000360761.4_Missense_Mutation_p.V1458I|CACNA1G_ENST00000514181.1_Missense_Mutation_p.V1481I|CACNA1G_ENST00000510366.1_Missense_Mutation_p.V1481I|CACNA1G_ENST00000512389.1_Missense_Mutation_p.V1481I|CACNA1G_ENST00000515765.1_Missense_Mutation_p.V1481I|CACNA1G_ENST00000514079.1_Missense_Mutation_p.V1481I|CACNA1G_ENST00000507510.2_Missense_Mutation_p.V1481I|CACNA1G_ENST00000507609.1_Missense_Mutation_p.V1481I|CACNA1G_ENST00000513689.2_Missense_Mutation_p.V1481I|CACNA1G_ENST00000442258.2_Missense_Mutation_p.V1458I|CACNA1G_ENST00000507336.1_Missense_Mutation_p.V1481I|CACNA1G_ENST00000510115.1_Missense_Mutation_p.V1458I|CACNA1G_ENST00000507896.1_Missense_Mutation_p.V1481I|CACNA1G_ENST00000503485.1_Missense_Mutation_p.V1481I|CACNA1G_ENST00000515411.1_Missense_Mutation_p.V1481I|CACNA1G_ENST00000505165.1_Missense_Mutation_p.V1481I|CACNA1G_ENST00000514717.1_Missense_Mutation_p.V1458I|CACNA1G_ENST00000429973.2_Missense_Mutation_p.V1481I	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	1481					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	GTCCCTGTTCGTTTTGGCCTC	0.572																																					p.V1481I		.											.	.	.	0			c.G4441A						.						133.0	128.0	130.0					17																	48684279		2119	4222	6341	SO:0001583	missense	8913	exon24			CTGTTCGTTTTGG	AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.4441G>A	17.37:g.48684279G>A	ENSP00000352011:p.Val1481Ile	Somatic	28	0		WXS	Illumina HiSeq	.	33	9	NM_001256360	D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Missense_Mutation	SNP	ENST00000359106.5	37	CCDS45730.1	.	.	.	.	.	.	.	.	.	.	g	34	5.350270	0.95830	.	.	ENSG00000006283	ENST00000360761;ENST00000352832;ENST00000354983;ENST00000442258;ENST00000502264;ENST00000512389;ENST00000513964;ENST00000514717;ENST00000510366;ENST00000503485;ENST00000507510;ENST00000507336;ENST00000513689;ENST00000507609;ENST00000510115;ENST00000515165;ENST00000514181;ENST00000515765;ENST00000514079;ENST00000358244;ENST00000359106;ENST00000429973;ENST00000515411;ENST00000505165;ENST00000507896;ENST00000506520	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97620	-4.46;-4.46;-4.46;-4.46;-4.46;-4.46;-4.46;-4.46;-4.46;-4.46;-4.46;-4.46;-4.46;-4.46;-4.46;-4.46;-4.46;-4.46;-4.46;-4.46;-4.46;-4.46;-4.46;-4.46;-4.46;-4.46	5.64	5.64	0.86602	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98137	0.9385	M	0.64260	1.97	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	0.999;0.996;1.0;0.999;0.996;1.0;1.0;0.993;0.999;0.996;1.0;0.999;0.998;0.997;0.999;0.998;1.0;0.999;0.967;1.0;1.0;0.998;0.998;0.999;1.0;0.999	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;P;D;D;D;D;D;D;D	0.91635	0.981;0.979;0.999;0.997;0.99;0.998;0.997;0.989;0.998;0.987;0.999;0.998;0.97;0.952;0.998;0.988;0.995;0.964;0.705;0.998;0.999;0.987;0.974;0.998;0.988;0.995	D	0.98498	1.0613	10	0.54805	T	0.06	.	19.7167	0.96124	0.0:0.0:1.0:0.0	.	511;1458;1481;1481;1481;1481;1481;1481;1481;1481;1481;1481;1458;1481;1481;1481;1481;1481;1458;1481;1458;1458;1458;1458;1481;1458	B4DKD3;Q19QZ5;Q19QZ1;Q19QZ4;Q19R07;Q19QY8;Q19R10;Q19QZ6;Q19QZ3;Q19R06;Q19R00;Q19R04;O43497-10;Q19QZ9;Q19QZ7;Q19R08;Q19QZ8;Q19R03;O43497-4;Q19R02;Q19R12;Q19R17;Q19R11;Q2TAC4;O43497;Q19R13	.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;CAC1G_HUMAN;.	I	1458;1458;1458;1458;1458;1481;1481;1458;1481;1481;1481;1481;1481;1481;1458;1481;1481;1481;1481;1458;1481;1481;1481;1481;1481;296	ENSP00000353990:V1458I;ENSP00000339302:V1458I;ENSP00000347078:V1458I;ENSP00000409759:V1458I;ENSP00000425522:V1458I;ENSP00000426261:V1481I;ENSP00000425451:V1481I;ENSP00000422407:V1458I;ENSP00000426814:V1481I;ENSP00000427238:V1481I;ENSP00000423112:V1481I;ENSP00000420918:V1481I;ENSP00000426172:V1481I;ENSP00000423045:V1481I;ENSP00000427173:V1458I;ENSP00000426098:V1481I;ENSP00000425698:V1481I;ENSP00000426232:V1481I;ENSP00000423317:V1481I;ENSP00000350979:V1458I;ENSP00000352011:V1481I;ENSP00000414388:V1481I;ENSP00000423155:V1481I;ENSP00000422268:V1481I;ENSP00000421518:V1481I;ENSP00000427697:V296I	ENSP00000339302:V1458I	V	+	1	0	CACNA1G	46039278	1.000000	0.71417	0.998000	0.56505	0.948000	0.59901	9.869000	0.99810	2.667000	0.90743	0.655000	0.94253	GTT	.		0.572	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367895.1	NM_018896	
PDE9A	5152	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	44189140	44189140	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr21:44189140G>A	ENST00000291539.6	+	17	1525	c.1465G>A	c.(1465-1467)Gac>Aac	p.D489N	PDE9A_ENST00000470987.1_3'UTR|PDE9A_ENST00000398236.3_Missense_Mutation_p.D403N|PDE9A_ENST00000398225.3_Missense_Mutation_p.D448N|PDE9A_ENST00000398227.3_Missense_Mutation_p.D329N|PDE9A_ENST00000328862.6_Missense_Mutation_p.D463N|PDE9A_ENST00000398224.3_Missense_Mutation_p.D362N|PDE9A_ENST00000335440.6_Missense_Mutation_p.D387N|PDE9A_ENST00000335512.4_Missense_Mutation_p.D429N|PDE9A_ENST00000398229.3_Missense_Mutation_p.D355N|PDE9A_ENST00000398232.3_Missense_Mutation_p.D422N|PDE9A_ENST00000380328.2_Missense_Mutation_p.D436N|PDE9A_ENST00000539837.1_Missense_Mutation_p.D361N|PDE9A_ENST00000349112.3_Missense_Mutation_p.D361N|PDE9A_ENST00000398234.3_Missense_Mutation_p.D388N	NM_002606.2	NP_002597.1	O76083	PDE9A_HUMAN	phosphodiesterase 9A	489	Catalytic. {ECO:0000250}.				blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|metabolic process (GO:0008152)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|large_intestine(6)|lung(8)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	27					Caffeine(DB00201)	CCTGCAGAGCGACCGTGAGAA	0.517																																					p.D489N		.											.	.	.	0			c.G1465A						.						151.0	134.0	140.0					21																	44189140		2203	4300	6503	SO:0001583	missense	5152	exon17			CAGAGCGACCGTG	AF048837	CCDS13690.1, CCDS33567.1, CCDS33568.1, CCDS33569.1, CCDS33570.1, CCDS33571.1, CCDS42941.1, CCDS42942.1, CCDS42943.1, CCDS42944.1, CCDS42945.1, CCDS42946.1, CCDS42947.1	21q22.3	2005-11-29			ENSG00000160191	ENSG00000160191	3.1.4.17	"""Phosphodiesterases"""	8795	protein-coding gene	gene with protein product		602973				9624146	Standard	NM_001001584		Approved		uc002zbm.3	O76083	OTTHUMG00000086825	ENST00000291539.6:c.1465G>A	21.37:g.44189140G>A	ENSP00000291539:p.Asp489Asn	Somatic	40	0		WXS	Illumina HiSeq	.	28	15	NM_002606	B2RBI5|B4DFI5|D3DSJ8|D3DSJ9|O75490|O75491|O95225|Q53Y40|Q5QD39|Q86SF7|Q86SI6|Q86SJ3|Q86WN3|Q86WN4|Q86WN5|Q86WN6|Q86WN7|Q86WN8|Q86WN9|Q86WP0	Missense_Mutation	SNP	ENST00000291539.6	37	CCDS13690.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.364687	0.82463	.	.	ENSG00000160191	ENST00000335512;ENST00000539837;ENST00000291539;ENST00000380328;ENST00000398232;ENST00000398234;ENST00000398236;ENST00000328862;ENST00000335440;ENST00000398225;ENST00000398229;ENST00000398227;ENST00000349112;ENST00000398224	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.85339	-1.97;-1.97;-1.97;-1.97;-1.97;-1.97;-1.97;-1.97;-1.97;-1.97;-1.97;-1.97;-1.97;-1.97	4.75	4.75	0.60458	5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.047408	0.85682	N	0.000000	D	0.94381	0.8193	M	0.93720	3.45	0.58432	D	0.999994	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.996;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;P;D;D;D;D;D;D;D;D;D;D;D	0.91635	0.991;0.996;0.996;0.873;0.999;0.999;0.994;0.991;0.991;0.996;0.991;0.999;0.997;0.996;0.996	D	0.95631	0.8689	10	0.59425	D	0.04	.	17.7454	0.88419	0.0:0.0:1.0:0.0	.	422;403;388;463;448;381;429;272;329;355;361;387;436;362;489	O76083-13;O76083-8;O76083-6;O76083-15;O76083-14;O76083-16;O76083-2;O76083-10;O76083-9;O76083-11;O76083-4;O76083-12;O76083-5;O76083-3;O76083	.;.;.;.;.;.;.;.;.;.;.;.;.;.;PDE9A_HUMAN	N	429;361;489;436;422;388;403;463;387;448;355;329;361;362	ENSP00000335242:D429N;ENSP00000441899:D361N;ENSP00000291539:D489N;ENSP00000369685:D436N;ENSP00000381287:D422N;ENSP00000381289:D388N;ENSP00000381291:D403N;ENSP00000328699:D463N;ENSP00000335365:D387N;ENSP00000381281:D448N;ENSP00000381285:D355N;ENSP00000381283:D329N;ENSP00000344730:D361N;ENSP00000381280:D362N	ENSP00000291539:D489N	D	+	1	0	PDE9A	43062209	1.000000	0.71417	1.000000	0.80357	0.516000	0.34256	9.304000	0.96190	2.190000	0.69967	0.313000	0.20887	GAC	.		0.517	PDE9A-016	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000195466.1		
DPY19L3	147991	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	32930122	32930122	+	Missense_Mutation	SNP	A	A	G			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr19:32930122A>G	ENST00000342179.5	+	7	916	c.701A>G	c.(700-702)aAc>aGc	p.N234S	DPY19L3_ENST00000392250.2_Missense_Mutation_p.N234S|DPY19L3_ENST00000586987.1_Missense_Mutation_p.N234S	NM_207325.2	NP_997208.2	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3 (C. elegans)	234						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(4)|pancreas(1)	32	Esophageal squamous(110;0.162)					CTGAGACCAAACTTACAGCCT	0.363																																					p.N234S		.											.	.	.	0			c.A701G						.						123.0	122.0	122.0					19																	32930122		2203	4300	6503	SO:0001583	missense	147991	exon7			GACCAAACTTACA		CCDS12422.1	19q13.11	2008-02-05				ENSG00000178904			27120	protein-coding gene	gene with protein product		613894					Standard	NM_207325		Approved		uc002ntg.3	Q6ZPD9		ENST00000342179.5:c.701A>G	19.37:g.32930122A>G	ENSP00000344937:p.Asn234Ser	Somatic	118	0		WXS	Illumina HiSeq	.	80	11	NM_001172774	Q68DC7|Q6ZTB7|Q6ZTS2	Missense_Mutation	SNP	ENST00000342179.5	37	CCDS12422.1	.	.	.	.	.	.	.	.	.	.	A	14.38	2.516860	0.44763	.	.	ENSG00000178904	ENST00000392250;ENST00000319326;ENST00000342179	T;T	0.54866	0.55;0.55	5.66	4.64	0.57946	.	0.310059	0.36200	N	0.002734	T	0.41789	0.1174	L	0.38838	1.175	0.33619	D	0.604546	B	0.28783	0.222	B	0.33960	0.173	T	0.50101	-0.8867	10	0.15066	T	0.55	-7.8164	11.0498	0.47880	0.9279:0.0:0.0721:0.0	.	234	Q6ZPD9	D19L3_HUMAN	S	234	ENSP00000376081:N234S;ENSP00000344937:N234S	ENSP00000315672:N234S	N	+	2	0	DPY19L3	37621962	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.702000	0.68332	2.163000	0.67991	0.460000	0.39030	AAC	.		0.363	DPY19L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450311.1	NM_207325	
PGGT1B	5229	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	5	114566719	114566719	+	Splice_Site	SNP	C	C	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr5:114566719C>T	ENST00000419445.1	-	6	633		c.e6-1		PGGT1B_ENST00000514178.1_Splice_Site|PGGT1B_ENST00000379615.3_Intron	NM_005023.3	NP_005014.2	P53609	PGTB1_HUMAN	protein geranylgeranyltransferase type I, beta subunit						negative regulation of nitric-oxide synthase biosynthetic process (GO:0051771)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|protein geranylgeranylation (GO:0018344)|response to cytokine (GO:0034097)	CAAX-protein geranylgeranyltransferase complex (GO:0005953)	CAAX-protein geranylgeranyltransferase activity (GO:0004662)|protein geranylgeranyltransferase activity (GO:0004661)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(2)|lung(1)	6		all_cancers(142;0.000523)|all_epithelial(76;6.45e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		Epithelial(69;2.95e-08)|OV - Ovarian serous cystadenocarcinoma(64;4.98e-08)|all cancers(49;3.1e-06)		TGTCATAGGACTGAAAAAGAA	0.308																																					.		.											.	.	.	0			c.613-1G>A						.						66.0	63.0	64.0					5																	114566719		2202	4299	6501	SO:0001630	splice_region_variant	5229	exon7			ATAGGACTGAAAA		CCDS4116.1	5q23.1	2008-02-05			ENSG00000164219	ENSG00000164219			8895	protein-coding gene	gene with protein product		602031				8106351	Standard	NM_005023		Approved	GGTI, BGGI	uc003kqw.4	P53609	OTTHUMG00000128893	ENST00000419445.1:c.613-1G>A	5.37:g.114566719C>T		Somatic	36	0		WXS	Illumina HiSeq	.	26	4	NM_005023	Q5MJP9	Splice_Site	SNP	ENST00000419445.1	37	CCDS4116.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.028200	0.75390	.	.	ENSG00000164219	ENST00000419445	.	.	.	5.84	4.95	0.65309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8173	0.78612	0.1371:0.8629:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PGGT1B	114594618	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.385000	0.79763	1.422000	0.47177	0.557000	0.71058	.	.		0.308	PGGT1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250855.2	NM_005023	Intron
ROCK1P1	727758	hgsc.bcm.edu	37	18	109926	109926	+	RNA	SNP	C	C	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr18:109926C>T	ENST00000608049.1	+	0	389					NR_033770.1				Rho-associated, coiled-coil containing protein kinase 1 pseudogene 1																		ctgcactgatcacccaggtga	0.478																																					.		.											.	.	.	0			.						.																																					727758	.			ACTGATCACCCAG			18p11.32	2012-10-04			ENSG00000263006	ENSG00000263006			37832	pseudogene	pseudogene							Standard	NR_033770		Approved		uc002kke.3		OTTHUMG00000177913		18.37:g.109926C>T		Somatic	17	0		WXS	Illumina HiSeq	.	83	7	.		RNA	SNP	ENST00000608049.1	37																																																																																				.		0.478	ROCK1P1-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000472417.1		
PLA2G4F	255189	hgsc.bcm.edu	37	15	42446614	42446614	+	Missense_Mutation	SNP	G	G	T	rs142310375		TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr15:42446614G>T	ENST00000382396.4	-	3	313	c.227C>A	c.(226-228)gCg>gAg	p.A76E	PLA2G4F_ENST00000397272.3_Missense_Mutation_p.A76E			Q68DD2	PA24F_HUMAN	phospholipase A2, group IVF	76	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				arachidonic acid secretion (GO:0050482)|cellular response to antibiotic (GO:0071236)|cellular response to organic cyclic compound (GO:0071407)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	calcium-dependent phospholipase A2 activity (GO:0047498)|lysophospholipase activity (GO:0004622)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(109;4.82e-12)|all_epithelial(112;5.64e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.97e-07)		GCTTGGGGACGCCGTGGGCAG	0.592																																					p.A76E		.											PLA2G4F,right_lower_lobe,carcinoma,0,1	PLA2G4F	0	0			c.C227A						.						51.0	45.0	47.0					15																	42446614		2203	4299	6502	SO:0001583	missense	255189	exon3			GGGGACGCCGTGG		CCDS32204.1	15q15.1	2008-09-19				ENSG00000168907	3.1.1.4		27396	protein-coding gene	gene with protein product						14702039, 15866882	Standard	NM_213600		Approved	PLA2G4F/Z	uc001zoz.3	Q68DD2		ENST00000382396.4:c.227C>A	15.37:g.42446614G>T	ENSP00000371833:p.Ala76Glu	Somatic	31	0		WXS	Illumina HiSeq	.	26	2	NM_213600	Q6ZMC8	Missense_Mutation	SNP	ENST00000382396.4	37	CCDS32204.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.868248	0.91587	.	.	ENSG00000168907	ENST00000290497;ENST00000397272;ENST00000382396;ENST00000357924;ENST00000443825	T;T	0.69926	-0.44;-0.44	5.4	5.4	0.78164	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.64402	D	0.000005	T	0.80232	0.4585	M	0.62209	1.925	0.44018	D	0.996738	D	0.76494	0.999	D	0.70935	0.971	T	0.81527	-0.0892	10	0.87932	D	0	-18.2086	18.321	0.90238	0.0:0.0:1.0:0.0	.	76	Q68DD2	PA24F_HUMAN	E	72;76;76;76;76	ENSP00000380442:A76E;ENSP00000371833:A76E	ENSP00000290497:A72E	A	-	2	0	PLA2G4F	40233906	1.000000	0.71417	0.265000	0.24526	0.928000	0.56348	7.066000	0.76734	2.717000	0.92951	0.650000	0.86243	GCG	.		0.592	PLA2G4F-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000420463.1	NM_213600	
ELOVL7	79993	hgsc.bcm.edu	37	5	60060157	60060157	+	Silent	SNP	G	G	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr5:60060157G>T	ENST00000508821.1	-	7	710	c.396C>A	c.(394-396)atC>atA	p.I132I	ELOVL7_ENST00000425382.1_Silent_p.I132I|ELOVL7_ENST00000438340.1_Silent_p.I132I|ELOVL7_ENST00000505959.1_Silent_p.I119I	NM_024930.2	NP_079206.2	A1L3X0	ELOV7_HUMAN	ELOVL fatty acid elongase 7	132					cellular lipid metabolic process (GO:0044255)|fatty acid elongation, polyunsaturated fatty acid (GO:0034626)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity (GO:0016740)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(1)	9		Lung NSC(810;2.56e-06)|Prostate(74;0.0115)|Breast(144;0.0244)|Ovarian(174;0.0481)				GAACAAAAAAGATCTGAAATA	0.328																																					p.I132I		.											ELOVL7,NS,carcinoma,0,1	ELOVL7	0	0			c.C396A						.						51.0	51.0	51.0					5																	60060157		2203	4300	6503	SO:0001819	synonymous_variant	79993	exon6			AAAAAAGATCTGA	AK027216	CCDS34164.1	5q12	2011-05-25	2011-05-25			ENSG00000164181			26292	protein-coding gene	gene with protein product		614451	"""ELOVL family member 7, elongation of long chain fatty acids (yeast)"""			19826053	Standard	NM_024930		Approved	FLJ23563	uc010iwk.3	A1L3X0		ENST00000508821.1:c.396C>A	5.37:g.60060157G>T		Somatic	73	0		WXS	Illumina HiSeq	.	44	2	NM_001104558	Q589T3|Q9H5D0|Q9NT66	Silent	SNP	ENST00000508821.1	37	CCDS34164.1																																																																																			.		0.328	ELOVL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368195.1		
ANO7	50636	hgsc.bcm.edu;ucsc.edu	37	2	242135132	242135132	+	Missense_Mutation	SNP	G	G	A	rs149691575		TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr2:242135132G>A	ENST00000274979.8	+	4	446	c.343G>A	c.(343-345)Gtt>Att	p.V115I	ANO7_ENST00000402530.3_Missense_Mutation_p.V114I|ANO7_ENST00000402430.3_Missense_Mutation_p.V114I	NM_001001891.3	NP_001001891.2	Q6IWH7	ANO7_HUMAN	anoctamin 7	115					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(14)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	32						CTTCGTCCTCGTTTGGGAGGA	0.622																																					p.V115I		.											.	.	.	0			c.G343A						.	G	ILE/VAL,ILE/VAL	2,4404	4.2+/-10.8	0,2,2201	61.0	54.0	56.0		340,343	1.0	0.0	2	dbSNP_134	56	0,8600		0,0,4300	yes	missense,missense	ANO7	NM_001001666.3,NM_001001891.3	29,29	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	probably-damaging,probably-damaging	114/180,115/934	242135132	2,13004	2203	4300	6503	SO:0001583	missense	50636	exon4			GTCCTCGTTTGGG	AY617079	CCDS33423.1, CCDS46563.1	2q37.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000146205	ENSG00000146205		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	31677	protein-coding gene	gene with protein product		605096	"""transmembrane protein 16G"""	PCANAP5, TMEM16G		14981236, 15375614, 24692353	Standard	NM_001001891		Approved	NGEP, PCANAP5L, IPCA-5	uc002wax.2	Q6IWH7	OTTHUMG00000151702	ENST00000274979.8:c.343G>A	2.37:g.242135132G>A	ENSP00000274979:p.Val115Ile	Somatic	11	0		WXS	Illumina HiSeq	.	20	11	NM_001001891	Q6IWH6	Missense_Mutation	SNP	ENST00000274979.8	37	CCDS33423.1	.	.	.	.	.	.	.	.	.	.	G	11.36	1.615198	0.28712	4.54E-4	0.0	ENSG00000146205	ENST00000274979;ENST00000402530;ENST00000402430	T;T;T	0.73897	-0.69;0.24;-0.79	2.92	0.957	0.19613	.	.	.	.	.	T	0.82019	0.4946	M	0.76170	2.325	0.27368	N	0.955778	D;D	0.89917	1.0;0.975	D;B	0.80764	0.994;0.249	T	0.69390	-0.5158	9	0.59425	D	0.04	.	5.4983	0.16815	0.1253:0.2043:0.6705:0.0	.	115;114	Q6IWH7;Q6IWH7-2	ANO7_HUMAN;.	I	115;114;114	ENSP00000274979:V115I;ENSP00000383985:V114I;ENSP00000385418:V114I	ENSP00000274979:V115I	V	+	1	0	ANO7	241783805	0.899000	0.30636	0.016000	0.15963	0.063000	0.16089	1.109000	0.31135	0.067000	0.16545	0.467000	0.42956	GTT	0.000		0.622	ANO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323509.1	NM_001001891	
ZBTB7A	51341	hgsc.bcm.edu	37	19	4053996	4053996	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr19:4053996C>T	ENST00000322357.4	-	2	1513	c.1235G>A	c.(1234-1236)tGc>tAc	p.C412Y	ZBTB7A_ENST00000601588.1_Missense_Mutation_p.C412Y	NM_015898.2	NP_056982.1	O95365	ZBT7A_HUMAN	zinc finger and BTB domain containing 7A	412					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone acetyltransferase binding (GO:0035035)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	14		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.014)|STAD - Stomach adenocarcinoma(1328;0.18)		GCAGATGTTGCACTCGTAGGG	0.687																																					p.C412Y		.											ZBTB7A,colon,carcinoma,0,1	ZBTB7A	0	0			c.G1235A						.						54.0	48.0	50.0					19																	4053996		2203	4299	6502	SO:0001583	missense	51341	exon2			ATGTTGCACTCGT	AF000561	CCDS12119.1	19p13.3	2013-01-08		2005-04-07		ENSG00000178951		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	18078	protein-coding gene	gene with protein product	"""zinc finger and BTB domain containing 7A, HIV-1 inducer of short transcripts binding protein"", ""lymphoma related factor"""	605878	"""zinc finger and BTB domain containing 7"""	ZBTB7		9973611, 9927193	Standard	NM_015898		Approved	FBI-1, LRF, DKFZp547O146, pokemon, ZNF857A	uc002lzi.3	O95365		ENST00000322357.4:c.1235G>A	19.37:g.4053996C>T	ENSP00000323670:p.Cys412Tyr	Somatic	36	0		WXS	Illumina HiSeq	.	34	2	NM_015898	D6W619|O00456|Q14D41|Q5XG86	Missense_Mutation	SNP	ENST00000322357.4	37	CCDS12119.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.039668	0.75732	.	.	ENSG00000178951	ENST00000322357	D	0.85088	-1.94	4.95	4.95	0.65309	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.94324	0.8176	M	0.93150	3.385	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	D	0.95786	0.8821	10	0.87932	D	0	.	16.7416	0.85461	0.0:1.0:0.0:0.0	.	412	O95365	ZBT7A_HUMAN	Y	412	ENSP00000323670:C412Y	ENSP00000323670:C412Y	C	-	2	0	ZBTB7A	4004996	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	7.673000	0.83973	2.293000	0.77203	0.462000	0.41574	TGC	.		0.687	ZBTB7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457621.2	NM_015898	
SMAP1	60682	hgsc.bcm.edu	37	6	71567931	71567931	+	Splice_Site	SNP	A	A	G			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr6:71567931A>G	ENST00000370455.3	+	10	1516	c.1268A>G	c.(1267-1269)cAg>cGg	p.Q423R	SMAP1_ENST00000370452.3_Splice_Site_p.Q396R|B3GAT2_ENST00000230053.6_3'UTR|SMAP1_ENST00000316999.5_Splice_Site_p.Q396R	NM_001044305.1|NM_001281440.1	NP_001037770.1|NP_001268369.1	Q8IYB5	SMAP1_HUMAN	small ArfGAP 1	423					positive regulation of erythrocyte differentiation (GO:0045648)|regulation of ARF GTPase activity (GO:0032312)|regulation of clathrin-mediated endocytosis (GO:2000369)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(1)|urinary_tract(1)	15						AGCCTCTCACAGGTAGGGGTC	0.428																																					p.Q423R		.											SMAP1_ENST00000370455,NS,carcinoma,0,2	SMAP1_ENST00000370455	0	0			c.A1268G						.						26.0	27.0	26.0					6																	71567931		2203	4300	6503	SO:0001630	splice_region_variant	60682	exon10			TCTCACAGGTAGG	AK023221	CCDS4973.1, CCDS43478.1, CCDS64459.1, CCDS75478.1	6q12-q13	2009-11-30	2008-09-05		ENSG00000112305	ENSG00000112305		"""ADP-ribosylation factor GTPase activating proteins"""	19651	protein-coding gene	gene with protein product		611372	"""stromal membrane-associated protein 1"", ""stromal membrane-associated GTPase-activating protein 1"""			9644265, 12119110	Standard	NM_001044305		Approved	FLJ13159, SMAP-1	uc003pfr.3	Q8IYB5	OTTHUMG00000014996	ENST00000370455.3:c.1269+1A>G	6.37:g.71567931A>G		Somatic	63	0		WXS	Illumina HiSeq	.	50	2	NM_001044305	Q53H70|Q5SYQ2|Q6PK24|Q8NDH4|Q96L38|Q96L39|Q9H8X4	Missense_Mutation	SNP	ENST00000370455.3	37	CCDS43478.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.586849	0.86851	.	.	ENSG00000112305	ENST00000370452;ENST00000316999;ENST00000370455	T;T;T	0.29142	1.82;1.87;1.58	5.39	5.39	0.77823	.	0.257238	0.39341	N	0.001397	T	0.47002	0.1422	M	0.71036	2.16	0.80722	D	1	D;D;D;D	0.71674	0.998;0.996;0.996;0.998	D;D;D;D	0.77557	0.99;0.986;0.986;0.99	T	0.52457	-0.8573	10	0.72032	D	0.01	-5.6338	15.4359	0.75146	1.0:0.0:0.0:0.0	.	423;396;396;423	A8K333;Q8IYB5-3;Q8IYB5-2;Q8IYB5	.;.;.;SMAP1_HUMAN	R	396;396;423	ENSP00000359481:Q396R;ENSP00000313382:Q396R;ENSP00000359484:Q423R	ENSP00000313382:Q396R	Q	+	2	0	SMAP1	71624652	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.730000	0.91510	2.049000	0.60858	0.454000	0.30748	CAG	.		0.428	SMAP1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041149.1	NM_001044305	Missense_Mutation
AHNAK2	113146	hgsc.bcm.edu	37	14	105415064	105415064	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr14:105415064G>A	ENST00000333244.5	-	7	6843	c.6724C>T	c.(6724-6726)Ccc>Tcc	p.P2242S	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2242						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TTGAAACTGGGCATCTGCAGC	0.612																																					p.P2242S		.											.	.	.	0			c.C6724T						.						113.0	122.0	119.0					14																	105415064		1859	4112	5971	SO:0001583	missense	113146	exon7			AACTGGGCATCTG	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.6724C>T	14.37:g.105415064G>A	ENSP00000353114:p.Pro2242Ser	Somatic	79	0		WXS	Illumina HiSeq	.	51	4	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	N	12.09	1.834368	0.32421	.	.	ENSG00000185567	ENST00000333244	T	0.03152	4.03	4.26	4.26	0.50523	.	.	.	.	.	T	0.16811	0.0404	M	0.77486	2.375	0.09310	N	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.02617	-1.1133	9	0.52906	T	0.07	.	10.6973	0.45907	0.0:0.0:0.8088:0.1912	.	2242	Q8IVF2	AHNK2_HUMAN	S	2242	ENSP00000353114:P2242S	ENSP00000353114:P2242S	P	-	1	0	AHNAK2	104486109	1.000000	0.71417	0.725000	0.30721	0.010000	0.07245	3.802000	0.55553	1.933000	0.56026	0.485000	0.47835	CCC	.		0.612	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
ARFGEF2	10564	hgsc.bcm.edu	37	20	47569405	47569405	+	Missense_Mutation	SNP	G	G	A	rs572333257		TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr20:47569405G>A	ENST00000371917.4	+	5	587	c.587G>A	c.(586-588)cGc>cAc	p.R196H		NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)	196	DCB; DCB:DCB domain and DCB:HUS domain interaction.				endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)	p.R196H(1)		breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			ATTTTCACCCGCATGGAAAAC	0.453																																					p.R196H	Esophageal Squamous(176;1738 1974 26285 33069 35354)	.											ARFGEF2,NS,carcinoma,-1,1	ARFGEF2	-1	1	Substitution - Missense(1)	breast(1)	c.G587A						.						97.0	88.0	91.0					20																	47569405		2203	4300	6503	SO:0001583	missense	10564	exon5			TCACCCGCATGGA	AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.587G>A	20.37:g.47569405G>A	ENSP00000360985:p.Arg196His	Somatic	25	0		WXS	Illumina HiSeq	.	62	3	NM_006420	Q5TFT9|Q9NTS1	Missense_Mutation	SNP	ENST00000371917.4	37	CCDS13411.1	.	.	.	.	.	.	.	.	.	.	G	35	5.555635	0.96514	.	.	ENSG00000124198	ENST00000538445;ENST00000371917	T	0.52295	0.67	6.06	6.06	0.98353	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.78387	0.4275	M	0.93763	3.455	0.80722	D	1	D	0.89917	1.0	D	0.70716	0.97	T	0.82680	-0.0337	10	0.87932	D	0	.	20.6208	0.99490	0.0:0.0:1.0:0.0	.	196	Q9Y6D5	BIG2_HUMAN	H	196	ENSP00000360985:R196H	ENSP00000360985:R196H	R	+	2	0	ARFGEF2	47002812	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.857000	0.99534	2.882000	0.98803	0.655000	0.94253	CGC	.		0.453	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079627.1	NM_006420	
RHBDL3	162494	hgsc.bcm.edu	37	17	30621346	30621346	+	Missense_Mutation	SNP	G	G	T	rs138890553		TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr17:30621346G>T	ENST00000269051.4	+	5	567	c.553G>T	c.(553-555)Ggt>Tgt	p.G185C	RHBDL3_ENST00000538145.1_Missense_Mutation_p.G177C|RHBDL3_ENST00000536287.1_Missense_Mutation_p.G87C	NM_138328.2	NP_612201.1	P58872	RHBL3_HUMAN	rhomboid, veinlet-like 3 (Drosophila)	185						integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)|skin(1)	16		Breast(31;0.116)|Ovarian(249;0.182)				GGTGTCACTAGGTCAATTTGT	0.493																																					p.G185C		.											RHBDL3,NS,carcinoma,0,1	RHBDL3	0	0			c.G553T						.	G	CYS/GLY	0,4406		0,0,2203	240.0	195.0	210.0		553	1.7	0.4	17	dbSNP_134	210	2,8598	2.2+/-6.3	0,2,4298	no	missense	RHBDL3	NM_138328.2	159	0,2,6501	TT,TG,GG		0.0233,0.0,0.0154	possibly-damaging	185/405	30621346	2,13004	2203	4300	6503	SO:0001583	missense	162494	exon5			TCACTAGGTCAAT	AJ313480	CCDS32613.1	17q11.2	2013-01-10				ENSG00000141314		"""EF-hand domain containing"""	16502	protein-coding gene	gene with protein product			"""rhomboid, veinlet-like 4 (Drosophila)"""	RHBDL4		11900977	Standard	XM_006721733		Approved	VRHO	uc002hhe.1	P58872		ENST00000269051.4:c.553G>T	17.37:g.30621346G>T	ENSP00000269051:p.Gly185Cys	Somatic	55	0		WXS	Illumina HiSeq	.	50	2	NM_138328	A6NMH1|Q495Y4|Q495Y5|Q495Y6	Missense_Mutation	SNP	ENST00000269051.4	37	CCDS32613.1	.	.	.	.	.	.	.	.	.	.	G	15.93	2.978520	0.53720	0.0	2.33E-4	ENSG00000141314	ENST00000431505;ENST00000269051;ENST00000538145;ENST00000536287	T;T;T;T	0.67345	-0.26;0.31;0.73;1.33	6.17	1.69	0.24217	.	0.483471	0.25363	N	0.031202	T	0.59985	0.2234	L	0.39245	1.2	0.37787	D	0.927226	D;P;P	0.57257	0.979;0.806;0.806	P;B;B	0.46975	0.533;0.332;0.332	T	0.63395	-0.6647	10	0.66056	D	0.02	-17.0001	10.8363	0.46690	0.2629:0.0:0.7371:0.0	.	185;177;185	E9PD28;Q495Y5;P58872	.;.;RHBL3_HUMAN	C	185;185;177;87	ENSP00000394849:G185C;ENSP00000269051:G185C;ENSP00000442092:G177C;ENSP00000466508:G87C	ENSP00000269051:G185C	G	+	1	0	RHBDL3	27645459	1.000000	0.71417	0.425000	0.26659	0.924000	0.55760	2.747000	0.47475	0.109000	0.17891	0.655000	0.94253	GGT	0.000		0.493	RHBDL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447120.1	NM_138328	
LRRC71	149499	broad.mit.edu	37	1	156893876	156893876	+	Frame_Shift_Del	DEL	A	A	-			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr1:156893876delA	ENST00000337428.7	+	2	450	c.296delA	c.(295-297)gaafs	p.E99fs	LRRC71_ENST00000490146.1_3'UTR	NM_144702.2	NP_653303.2	Q8N4P6	LRC71_HUMAN	leucine rich repeat containing 71	99										endometrium(2)|large_intestine(3)|lung(5)|ovary(1)|stomach(1)	12						TCTTTGTCGGAAAAGGCCACC	0.672																																					p.E99fs													.	LRRC71	33	0			c.296delA						.						6.0	7.0	6.0					1																	156893876		674	1573	2247	SO:0001589	frameshift_variant	149499	exon2			TGTCGGAAAAGGC	BC033790	CCDS44249.1	1q23.1	2011-02-14	2011-02-14	2011-02-14	ENSG00000160838	ENSG00000160838			26556	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 92"""	C1orf92		14702039	Standard	NM_144702		Approved	FLJ32884	uc001fqm.2	Q8N4P6	OTTHUMG00000041298	ENST00000337428.7:c.296delA	1.37:g.156893876delA	ENSP00000336661:p.Glu99fs	Somatic	47	0		WXS	Illumina GAIIx	Phase_I	187	6	NM_144702	Q96M24	Frame_Shift_Del	DEL	ENST00000337428.7	37	CCDS44249.1																																																																																			.		0.672	LRRC71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098961.1	NM_144702	
CR1	1378	broad.mit.edu	37	1	207787753	207787753	+	Nonsense_Mutation	SNP	C	C	T	rs55749440		TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr1:207787753C>T	ENST00000367049.4	+	40	6580	c.6580C>T	c.(6580-6582)Cga>Tga	p.R2194*	CR1_ENST00000367053.1_Nonsense_Mutation_p.R1744*|CR1_ENST00000367051.1_Nonsense_Mutation_p.R1744*|CR1_ENST00000400960.2_Nonsense_Mutation_p.R1744*|CR1_ENST00000367052.1_Nonsense_Mutation_p.R1744*	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1744					complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)	p.R1749*(9)|p.R2194*(9)|p.R1744*(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						CTTTAGGTTCCGATTAAAAGG	0.423																																					p.R2194X													CR1_ENST00000367049,NS,carcinoma,0,15	CR1	354	19	Substitution - Nonsense(19)	lung(6)|endometrium(6)|prostate(3)|kidney(2)|central_nervous_system(2)	c.C6580T						.						103.0	94.0	97.0					1																	207787753		1868	4107	5975	SO:0001587	stop_gained	1378	exon40			AGGTTCCGATTAA	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.6580C>T	1.37:g.207787753C>T	ENSP00000356016:p.Arg2194*	Somatic	153	1		WXS	Illumina GAIIx	Phase_I	223	8	NM_000651	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Nonsense_Mutation	SNP	ENST00000367049.4	37	CCDS44308.1	.	.	.	.	.	.	.	.	.	.	C	44	11.182593	0.99528	.	.	ENSG00000203710	ENST00000367052;ENST00000367051;ENST00000367053;ENST00000400960;ENST00000367049	.	.	.	4.29	2.39	0.29439	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.5152	0.27596	0.0:0.7891:0.0:0.2109	rs55749440	.	.	.	X	1744;1744;1744;1744;2194	.	ENSP00000356016:R2194X	R	+	1	2	CR1	205854376	0.129000	0.22400	0.370000	0.25965	0.352000	0.29268	0.213000	0.17521	0.518000	0.28383	0.436000	0.28706	CGA	.		0.423	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1	NM_000573	
ART5	116969	broad.mit.edu;ucsc.edu	37	11	3661209	3661209	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr11:3661209G>T	ENST00000397068.3	-	2	842	c.450C>A	c.(448-450)tgC>tgA	p.C150*	ART5_ENST00000397067.3_Nonsense_Mutation_p.C150*|TRPC2_ENST00000526541.1_RNA|ART5_ENST00000359918.4_Nonsense_Mutation_p.C150*	NM_053017.3	NP_443750.2	Q96L15	NAR5_HUMAN	ADP-ribosyltransferase 5	150					protein ADP-ribosylation (GO:0006471)	extracellular region (GO:0005576)|membrane (GO:0016020)	NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|NAD+ nucleosidase activity (GO:0003953)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(6)|ovary(1)	11		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0336)|LUSC - Lung squamous cell carcinoma(625;0.19)		GTCCCCTGCTGCAGCCCCCAC	0.642																																					p.C150X													.	ART5	38	0			c.C450A						.						46.0	48.0	47.0					11																	3661209		2201	4298	6499	SO:0001587	stop_gained	116969	exon3			CCTGCTGCAGCCC	Y16835	CCDS7743.1, CCDS73242.1	11p15.4	2008-02-05			ENSG00000167311	ENSG00000167311			24049	protein-coding gene	gene with protein product		610625				11587854, 10448534	Standard	NM_001079536		Approved		uc001lyb.1	Q96L15	OTTHUMG00000011842	ENST00000397068.3:c.450C>A	11.37:g.3661209G>T	ENSP00000380258:p.Cys150*	Somatic	82	1		WXS	Illumina GAIIx	Phase_I	52	9	NM_001079536	C9IYG7|Q6UX84|Q86W02	Nonsense_Mutation	SNP	ENST00000397068.3	37	CCDS7743.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	31|31	5.073642|5.073642	0.94000|0.94000	.|.	.|.	ENSG00000167311|ENSG00000167311	ENST00000397068;ENST00000397067;ENST00000359918|ENST00000453353	.|.	.|.	.|.	6.07|6.07	4.2|4.2	0.49525|0.49525	.|.	0.306475|.	0.39083|.	N|.	0.001480|.	.|T	.|0.50769	.|0.1635	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.60826	.|-0.7186	.|3	0.02654|.	T|.	1|.	-29.3234|-29.3234	8.5145|8.5145	0.33237|0.33237	0.2358:0.0:0.7642:0.0|0.2358:0.0:0.7642:0.0	.|.	.|.	.|.	.|.	X|K	150|107	.|.	ENSP00000352992:C150X|.	C|Q	-|-	3|1	2|0	ART5|ART5	3617785|3617785	0.829000|0.829000	0.29322|0.29322	0.946000|0.946000	0.38457|0.38457	0.026000|0.026000	0.11368|0.11368	1.220000|1.220000	0.32491|0.32491	1.582000|1.582000	0.49881|0.49881	0.655000|0.655000	0.94253|0.94253	TGC|CAG	.		0.642	ART5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032760.2	NM_053017	
ADAM21P1	145241	broad.mit.edu	37	14	70714144	70714144	+	RNA	SNP	A	A	G	rs111296958		TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr14:70714144A>G	ENST00000530196.1	-	0	374					NR_003951.1				ADAM metallopeptidase domain 21 pseudogene 1																		AGAGCTTCTTAACCCTCATAT	0.502																																					.													.	.	.	0			.						.																																					0	.			CTTCTTAACCCTC			14q24.2	2014-03-25	2010-01-12	2010-01-12	ENSG00000235812	ENSG00000235812			19822	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 21 pseudogene"", ""ADAM metallopeptidase domain 21 pseudogene"""	ADAM21P			Standard	NR_003951		Approved		uc010ttg.2		OTTHUMG00000166565		14.37:g.70714144A>G		Somatic	47	1		WXS	Illumina GAIIx	Phase_I	21	5	.		RNA	SNP	ENST00000530196.1	37																																																																																				.		0.502	ADAM21P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000390451.1	NG_002467	
WDR25	79446	broad.mit.edu;bcgsc.ca	37	14	100847912	100847916	+	Frame_Shift_Del	DEL	GTCTG	GTCTG	-			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr14:100847912_100847916delGTCTG	ENST00000335290.6	+	2	877_881	c.651_655delGTCTG	c.(649-657)gtgtctgagfs	p.SE218fs	WDR25_ENST00000554175.1_Frame_Shift_Del_p.SE218fs|WDR25_ENST00000554998.1_Frame_Shift_Del_p.SE218fs|WDR25_ENST00000542471.2_5'Flank|WDR25_ENST00000402312.3_Frame_Shift_Del_p.SE218fs	NM_024515.4	NP_078791.3	Q64LD2	WDR25_HUMAN	WD repeat domain 25	218								p.E219Q(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(8)|skin(1)	20		Melanoma(154;0.212)				GCCCGGGAGTGTCTGAGTTTATTCA	0.571																																					p.217_219del													.	WDR25	37	1	Substitution - Missense(1)	large_intestine(1)	c.651_655del						.																																			SO:0001589	frameshift_variant	79446	exon2			GGGAGTGTCTGAG	BC007953	CCDS32157.1	14q32.32	2013-01-09				ENSG00000176473		"""WD repeat domain containing"""	21064	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 67"""	C14orf67		15587985	Standard	NM_001161476		Approved	MGC4645	uc001yhn.3	Q64LD2		ENST00000335290.6:c.651_655delGTCTG	14.37:g.100847912_100847916delGTCTG	ENSP00000334148:p.Ser218fs	Somatic	66	0		WXS	Illumina GAIIx	Phase_I	18	8	NM_001161476	A8K7E5|Q6NVV6|Q86TQ4|Q9BTK5	Frame_Shift_Del	DEL	ENST00000335290.6	37	CCDS32157.1																																																																																			.		0.571	WDR25-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414312.1	NM_024515	
WDR25	79446	broad.mit.edu;bcgsc.ca	37	14	100847918	100847924	+	Frame_Shift_Del	DEL	GTTTATT	GTTTATT	-			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr14:100847918_100847924delGTTTATT	ENST00000335290.6	+	2	883_889	c.657_663delGTTTATT	c.(655-663)gagtttattfs	p.EFI219fs	WDR25_ENST00000554175.1_Frame_Shift_Del_p.EFI219fs|WDR25_ENST00000554998.1_Frame_Shift_Del_p.EFI219fs|WDR25_ENST00000542471.2_5'Flank|WDR25_ENST00000402312.3_Frame_Shift_Del_p.EFI219fs	NM_024515.4	NP_078791.3	Q64LD2	WDR25_HUMAN	WD repeat domain 25	219								p.E219D(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(8)|skin(1)	20		Melanoma(154;0.212)				GAGTGTCTGAGTTTATTCAGCCATATT	0.56																																					p.219_221del													WDR25,colon,carcinoma,+2,2	WDR25	37	1	Substitution - Missense(1)	lung(1)	c.657_663del						.																																			SO:0001589	frameshift_variant	79446	exon2			GTCTGAGTTTATT	BC007953	CCDS32157.1	14q32.32	2013-01-09				ENSG00000176473		"""WD repeat domain containing"""	21064	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 67"""	C14orf67		15587985	Standard	NM_001161476		Approved	MGC4645	uc001yhn.3	Q64LD2		ENST00000335290.6:c.657_663delGTTTATT	14.37:g.100847918_100847924delGTTTATT	ENSP00000334148:p.Glu219fs	Somatic	65	0		WXS	Illumina GAIIx	Phase_I	15	9	NM_001161476	A8K7E5|Q6NVV6|Q86TQ4|Q9BTK5	Frame_Shift_Del	DEL	ENST00000335290.6	37	CCDS32157.1																																																																																			.		0.560	WDR25-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414312.1	NM_024515	
KIAA1024	23251	broad.mit.edu	37	15	79749365	79749365	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr15:79749365G>T	ENST00000305428.3	+	2	951	c.876G>T	c.(874-876)aaG>aaT	p.K292N		NM_015206.2	NP_056021.1	Q9UPX6	K1024_HUMAN	KIAA1024	292						integral component of membrane (GO:0016021)				central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(2)|pancreas(2)|prostate(1)	49						AGAGTCGAAAGGAACCCCACA	0.502																																					p.K292N													.	KIAA1024	146	0			c.G876T						.						132.0	146.0	141.0					15																	79749365		2196	4293	6489	SO:0001583	missense	23251	exon2			TCGAAAGGAACCC	AB028947	CCDS32306.1	15q25.1	2007-12-12				ENSG00000169330			29172	protein-coding gene	gene with protein product						10470851	Standard	NM_015206		Approved		uc002bew.1	Q9UPX6		ENST00000305428.3:c.876G>T	15.37:g.79749365G>T	ENSP00000307461:p.Lys292Asn	Somatic	32	0		WXS	Illumina GAIIx	Phase_I	32	3	NM_015206	A7MD43	Missense_Mutation	SNP	ENST00000305428.3	37	CCDS32306.1	.	.	.	.	.	.	.	.	.	.	G	10.57	1.386325	0.25031	.	.	ENSG00000169330	ENST00000305428	T	0.37915	1.17	5.01	2.76	0.32466	.	0.066942	0.64402	D	0.000019	T	0.29783	0.0744	M	0.63428	1.95	0.37182	D	0.903532	B	0.12013	0.005	B	0.06405	0.002	T	0.16867	-1.0388	9	.	.	.	.	5.8352	0.18602	0.2353:0.0:0.6085:0.1562	.	292	Q9UPX6	K1024_HUMAN	N	292	ENSP00000307461:K292N	.	K	+	3	2	KIAA1024	77536420	1.000000	0.71417	0.883000	0.34634	0.113000	0.19764	1.205000	0.32308	1.102000	0.41551	0.591000	0.81541	AAG	.		0.502	KIAA1024-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416718.1	NM_015206	
C16orf90	646174	broad.mit.edu	37	16	3546141	3546141	+	5'Flank	DEL	A	A	-	rs74546027		TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr16:3546141delA	ENST00000437192.3	-	0	0				LA16c-306E5.3_ENST00000574423.2_RNA	NM_001080524.1	NP_001073993.1	A8MZG2	CP090_HUMAN	chromosome 16 open reading frame 90											large_intestine(1)	1						actccgtctcaaaaaaaaaaa	0.557																																					.													.	C16orf90	16	0			.						.																																			SO:0001631	upstream_gene_variant	0	.			CGTCTCAAAAAAA		CCDS45397.1	16p13.3	2009-01-29			ENSG00000215131	ENSG00000215131			34455	protein-coding gene	gene with protein product							Standard	NM_001080524		Approved	LOC646174	uc002cvi.3	A8MZG2	OTTHUMG00000154627		16.37:g.3546141delA	Exception_encountered	Somatic	7	0		WXS	Illumina GAIIx	Phase_I	7	1	.		RNA	DEL	ENST00000437192.3	37	CCDS45397.1																																																																																			.		0.557	C16orf90-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346319.2	NM_001080524	
HERC2P4	100289574	broad.mit.edu	37	16	32118199	32118200	+	IGR	DEL	AT	AT	-	rs144117991		TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr16:32118199_32118200delAT								RP11-1166P10.6 (22093 upstream) : HERC2P4 (63104 downstream)																							acaaaataacataaaccgggtg	0.386																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			AATAACATAAACC																													16.37:g.32118199_32118200delAT		Somatic	4	0		WXS	Illumina GAIIx	Phase_I	10	3	.		RNA	DEL		37																																																																																				.	0	0.386								
TTC25	83538	broad.mit.edu	37	17	40101598	40101598	+	RNA	DEL	A	A	-	rs35481109		TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr17:40101598delA	ENST00000591658.1	+	0	1213							Q96NG3	TTC25_HUMAN	tetratricopeptide repeat domain 25							cytoplasm (GO:0005737)				endometrium(2)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(1)	12		all_cancers(22;8.16e-06)|Breast(137;0.000143)|all_epithelial(22;0.000236)				ccctctctacaaaaaaaaaaa	0.458																																					.													.	TTC25	37	0			.						.																																					83538	.			CTCTACAAAAAAA	AK055498	CCDS74063.1	17q21.2	2014-08-12			ENSG00000204815	ENSG00000204815		"""Tetratricopeptide (TTC) repeat domain containing"""	25280	protein-coding gene	gene with protein product							Standard	XM_006722129		Approved	DKFZP434H0115	uc002hyj.4	Q96NG3	OTTHUMG00000175837		17.37:g.40101598delA		Somatic	7	0		WXS	Illumina GAIIx	Phase_I	6	1	.	Q6NX40|Q6PJ04|Q9H0K5	RNA	DEL	ENST00000591658.1	37																																																																																				-|1.000;|0.000		0.458	TTC25-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000449237.1	NM_031421	
LPIN2	9663	broad.mit.edu	37	18	2937759	2937759	+	Missense_Mutation	SNP	C	C	A	rs540544894		TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr18:2937759C>A	ENST00000261596.4	-	7	1337	c.1099G>T	c.(1099-1101)Gca>Tca	p.A367S		NM_014646.2	NP_055461.1	Q92539	LPIN2_HUMAN	lipin 2	367					cellular lipid metabolic process (GO:0044255)|dephosphorylation (GO:0016311)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)|transcription coactivator activity (GO:0003713)			autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	29				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		GCTAAGGCTGCGTTGGGAAGG	0.493																																					p.A367S													.	LPIN2	75	0			c.G1099T						.						82.0	80.0	81.0					18																	2937759		2203	4300	6503	SO:0001583	missense	9663	exon7			AGGCTGCGTTGGG	D87436	CCDS11829.1	18p	2014-09-17			ENSG00000101577	ENSG00000101577			14450	protein-coding gene	gene with protein product		605519				11138012, 9039502	Standard	NM_014646		Approved	KIAA0249	uc002klo.3	Q92539	OTTHUMG00000131508	ENST00000261596.4:c.1099G>T	18.37:g.2937759C>A	ENSP00000261596:p.Ala367Ser	Somatic	49	0		WXS	Illumina GAIIx	Phase_I	22	3	NM_014646	A7MD25|D3DUH3	Missense_Mutation	SNP	ENST00000261596.4	37	CCDS11829.1	.	.	.	.	.	.	.	.	.	.	G	0.001	-3.074466	0.00036	.	.	ENSG00000101577	ENST00000261596	T	0.80214	-1.35	5.74	3.93	0.45458	.	0.864816	0.10481	N	0.669546	T	0.49847	0.1581	N	0.01576	-0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48019	-0.9071	10	0.07030	T	0.85	.	4.832	0.13445	0.117:0.1247:0.63:0.1283	.	367	Q92539	LPIN2_HUMAN	S	367	ENSP00000261596:A367S	ENSP00000261596:A367S	A	-	1	0	LPIN2	2927759	0.001000	0.12720	0.241000	0.24154	0.030000	0.12068	0.268000	0.18571	1.450000	0.47717	-0.120000	0.15030	GCA	.		0.493	LPIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254363.2	NM_014646	
FFAR3	2865	broad.mit.edu;bcgsc.ca	37	19	35850647	35850647	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr19:35850647C>T	ENST00000327809.4	+	2	1056	c.855C>T	c.(853-855)gcC>gcT	p.A285A	FFAR3_ENST00000594310.1_Silent_p.A285A	NM_005304.3	NP_005295.1	O14843	FFAR3_HUMAN	free fatty acid receptor 3	285					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to fatty acid (GO:0071398)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|mucosal immune response (GO:0002385)|negative regulation of blood pressure (GO:0045776)|positive regulation of acute inflammatory response to non-antigenic stimulus (GO:0002879)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine production involved in immune response (GO:0002720)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|regulation of hormone biosynthetic process (GO:0046885)|regulation of norepinephrine secretion (GO:0014061)|regulation of peptide hormone secretion (GO:0090276)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)			endometrium(3)|large_intestine(2)|lung(9)|ovary(1)|skin(1)|stomach(1)	17	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;1.29e-19)|OV - Ovarian serous cystadenocarcinoma(14;4.63e-18)|all cancers(14;5.19e-17)|LUSC - Lung squamous cell carcinoma(66;0.0221)			GGTTCCAAGCCGACTTTCATG	0.597																																					p.A285A	Esophageal Squamous(185;1742 2042 21963 24215 27871)												.	FFAR3	40	0			c.C855T						.						54.0	40.0	45.0					19																	35850647		2200	4274	6474	SO:0001819	synonymous_variant	2865	exon2			CCAAGCCGACTTT	AF024688	CCDS12459.1	19q13.1	2012-08-08	2006-02-15	2006-02-15	ENSG00000185897	ENSG00000185897		"""GPCR / Class A : Fatty acid receptors"""	4499	protein-coding gene	gene with protein product		603821	"""G protein-coupled receptor 41"""	GPR41		9344866, 22493486	Standard	NM_005304		Approved	FFA3R	uc002nzd.3	O14843	OTTHUMG00000172514	ENST00000327809.4:c.855C>T	19.37:g.35850647C>T		Somatic	113	1		WXS	Illumina GAIIx	Phase_I	91	28	NM_005304	B2RWM8|Q14CM7	Silent	SNP	ENST00000327809.4	37	CCDS12459.1																																																																																			.		0.597	FFAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418873.2	NM_005304	
ZNF649	65251	broad.mit.edu	37	19	52395140	52395140	+	Missense_Mutation	SNP	T	T	G			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr19:52395140T>G	ENST00000354957.3	-	5	533	c.249A>C	c.(247-249)aaA>aaC	p.K83N	CTC-429C10.2_ENST00000600329.1_RNA|ZNF649_ENST00000600738.1_Missense_Mutation_p.K83N	NM_023074.3	NP_075562.2	Q9BS31	ZN649_HUMAN	zinc finger protein 649	83					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	29		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00152)|OV - Ovarian serous cystadenocarcinoma(262;0.0185)		GATCATCAGCTTTCTCAATTT	0.408																																					p.K83N													.	ZNF649	72	0			c.A249C						.						82.0	79.0	80.0					19																	52395140		2203	4300	6503	SO:0001583	missense	65251	exon5			ATCAGCTTTCTCA	BC005368	CCDS12843.1	19q13.41	2013-01-08				ENSG00000198093		"""Zinc fingers, C2H2-type"", ""-"""	25741	protein-coding gene	gene with protein product		611903				15950191	Standard	NM_023074		Approved	FLJ12644	uc002pxy.3	Q9BS31		ENST00000354957.3:c.249A>C	19.37:g.52395140T>G	ENSP00000347043:p.Lys83Asn	Somatic	35	0		WXS	Illumina GAIIx	Phase_I	34	3	NM_023074	A8MYJ5|B2RDC4|Q9H9N2	Missense_Mutation	SNP	ENST00000354957.3	37	CCDS12843.1	.	.	.	.	.	.	.	.	.	.	T	10.95	1.496921	0.26861	.	.	ENSG00000198093	ENST00000354957	T	0.06608	3.28	2.49	2.49	0.30216	.	.	.	.	.	T	0.08133	0.0203	L	0.37697	1.125	0.09310	N	1	D	0.64830	0.994	P	0.51516	0.672	T	0.31024	-0.9958	9	0.31617	T	0.26	.	5.5982	0.17339	0.0:0.0:0.2851:0.7148	.	83	Q9BS31	ZN649_HUMAN	N	83	ENSP00000347043:K83N	ENSP00000347043:K83N	K	-	3	2	ZNF649	57086952	0.000000	0.05858	0.002000	0.10522	0.336000	0.28762	-0.088000	0.11198	1.150000	0.42419	0.332000	0.21555	AAA	.		0.408	ZNF649-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461097.1	NM_023074	
NLRP8	126205	broad.mit.edu	37	19	56467321	56467321	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr19:56467321G>T	ENST00000291971.3	+	3	1968	c.1897G>T	c.(1897-1899)Gtc>Ttc	p.V633F	NLRP8_ENST00000590542.1_Missense_Mutation_p.V633F	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	633					neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		TCATAAAGTTGTCTTGAGAAT	0.463																																					p.V633F													.	NLRP8	225	0			c.G1897T						.						124.0	116.0	119.0					19																	56467321		2203	4300	6503	SO:0001583	missense	126205	exon3			AAAGTTGTCTTGA	AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.1897G>T	19.37:g.56467321G>T	ENSP00000291971:p.Val633Phe	Somatic	57	1		WXS	Illumina GAIIx	Phase_I	57	3	NM_176811	Q7RTR4	Missense_Mutation	SNP	ENST00000291971.3	37	CCDS12937.1	.	.	.	.	.	.	.	.	.	.	G	10.66	1.413205	0.25465	.	.	ENSG00000179709	ENST00000291971	D	0.87571	-2.27	2.03	-3.94	0.04130	.	.	.	.	.	T	0.81631	0.4863	L	0.46157	1.445	0.09310	N	1	P;B	0.42785	0.79;0.08	P;B	0.44990	0.466;0.029	T	0.72481	-0.4280	9	0.54805	T	0.06	.	4.7461	0.13038	0.2735:0.2128:0.5137:0.0	.	633;633	Q86W28-2;Q86W28	.;NALP8_HUMAN	F	633	ENSP00000291971:V633F	ENSP00000291971:V633F	V	+	1	0	NLRP8	61159133	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.168000	0.00574	-1.137000	0.02888	-0.507000	0.04495	GTC	.		0.463	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457462.1	NM_176811	
BAGE2	85319	broad.mit.edu	37	21	11048049	11048049	+	RNA	DEL	A	A	-	rs147865622		TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr21:11048049delA	ENST00000470054.1	-	0	659							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ctgtgtcactaaacaacttag	0.348																																					.													.	.	.	0			.						.																																					85319	.			GTCACTAAACAAC	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11048049delA		Somatic	4	0		WXS	Illumina GAIIx	Phase_I	7	3	.	A8K925|Q08ER0	RNA	DEL	ENST00000470054.1	37																																																																																				.		0.348	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000157417.3	NM_182482	
FLJ22763	401081	broad.mit.edu	37	3	108868962	108868962	+	lincRNA	DEL	A	A	-	rs552524027|rs57306274|rs79353012	byFrequency	TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr3:108868962delA	ENST00000467240.1	+	0	1944					NR_033977.1																						AAAAAGAACTAAAAAAAAAAA	0.299													|||unknown(HR)	2623	0.523762	0.2307	0.6383	5008	,	,		19177	0.8353		0.4543	False		,,,				2504	0.589				.													.	.	.	0			.						.																																					0	.			AGAACTAAAAAAA																													3.37:g.108868962delA		Somatic	5	0		WXS	Illumina GAIIx	Phase_I	15	5	.		RNA	DEL	ENST00000467240.1	37																																																																																				.		0.299	RP11-59E19.1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000353832.1		
VPRBP	9730	broad.mit.edu;bcgsc.ca	37	3	51449832	51449832	+	Splice_Site	SNP	C	C	G			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr3:51449832C>G	ENST00000335891.5	-	15	2875		c.e15+1					Q9Y4B6	VPRBP_HUMAN	Vpr (HIV-1) binding protein						B cell differentiation (GO:0030183)|cell competition in a multicellular organism (GO:0035212)|histone H2A-T120 phosphorylation (GO:1990245)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone kinase activity (H2A-T120 specific) (GO:1990244)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		AGACCACTGACCTGGTCCTCC	0.483																																					.													.	VPRBP	107	0			c.4050+1G>C						.						130.0	131.0	130.0					3																	51449832		2147	4256	6403	SO:0001630	splice_region_variant	9730	exon22			CACTGACCTGGTC	AB018343	CCDS74943.1, CCDS74944.1	3p21.2	2011-06-17			ENSG00000145041	ENSG00000145041		"""DDB1 and CUL4 associated factors"""	30911	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 1"""					8195203, 11223251	Standard	NM_014703		Approved	KIAA0800, MGC102804, DCAF1	uc003dbe.2	Q9Y4B6	OTTHUMG00000156895	ENST00000335891.5:c.2865+1G>C	3.37:g.51449832C>G		Somatic	24	0		WXS	Illumina GAIIx	Phase_I	14	10	NM_001171904	Q2YD74|Q8TBD9|Q9HCA1|Q9UG37	Splice_Site	SNP	ENST00000335891.5	37		.	.	.	.	.	.	.	.	.	.	C	28.6	4.934628	0.92458	.	.	ENSG00000145041	ENST00000423656;ENST00000335891	.	.	.	5.93	5.93	0.95920	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3539	0.98825	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	VPRBP	51424872	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	6.861000	0.75478	2.826000	0.97356	0.655000	0.94253	.	.		0.483	VPRBP-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_014703	Intron
AF146191.4	0	broad.mit.edu	37	4	190805401	190805401	+	lincRNA	DEL	T	T	-	rs143862550|rs60889582		TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr4:190805401delT	ENST00000511785.1	-	0	231				RP11-463J17.1_ENST00000503609.1_lincRNA																							caaataataattttaGAGAGC	0.353																																					.													.	.	.	0			.						.																																					0	.			TAATAATTTTAGA																													4.37:g.190805401delT		Somatic	4	0		WXS	Illumina GAIIx	Phase_I	8	2	.		RNA	DEL	ENST00000511785.1	37																																																																																				T|0.500;-|0.500		0.353	AF146191.4-001	KNOWN	basic|exp_conf	lincRNA	lincRNA	OTTHUMT00000361301.1		
CENPE	1062	broad.mit.edu	37	4	104032141	104032141	+	Missense_Mutation	SNP	G	G	T	rs373836132		TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr4:104032141G>T	ENST00000265148.3	-	47	7657	c.7568C>A	c.(7567-7569)cCt>cAt	p.P2523H	CENPE_ENST00000380026.3_Missense_Mutation_p.P2402H	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	2523	Globular autoinhibitory domain. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		TTTATTTGAAGGCTGAGGATC	0.338																																					p.P2523H													.	CENPE	253	0			c.C7568A						.						107.0	115.0	112.0					4																	104032141		2203	4300	6503	SO:0001583	missense	1062	exon47			TTTGAAGGCTGAG	Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.7568C>A	4.37:g.104032141G>T	ENSP00000265148:p.Pro2523His	Somatic	43	0		WXS	Illumina GAIIx	Phase_I	45	3	NM_001813	A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	ENST00000265148.3	37	CCDS34042.1	.	.	.	.	.	.	.	.	.	.	G	14.99	2.700937	0.48307	.	.	ENSG00000138778	ENST00000265148;ENST00000380026	T;T	0.67523	-0.27;-0.26	4.22	2.41	0.29592	.	.	.	.	.	T	0.69006	0.3063	L	0.44542	1.39	0.09310	N	1	D;D	0.71674	0.998;0.997	P;P	0.59889	0.865;0.85	T	0.56673	-0.7940	9	0.87932	D	0	.	7.0662	0.25154	0.2183:0.0:0.7817:0.0	.	2402;2523	Q02224-3;Q02224	.;CENPE_HUMAN	H	2523;2402	ENSP00000265148:P2523H;ENSP00000369365:P2402H	ENSP00000265148:P2523H	P	-	2	0	CENPE	104251590	0.063000	0.20901	0.854000	0.33618	0.997000	0.91878	0.268000	0.18571	0.958000	0.37956	0.650000	0.86243	CCT	.		0.338	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
MARCH6	10299	broad.mit.edu	37	5	10415711	10415711	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr5:10415711C>T	ENST00000274140.5	+	21	2210	c.2078C>T	c.(2077-2079)aCg>aTg	p.T693M	MARCH6_ENST00000510792.1_Missense_Mutation_p.T391M|MARCH6_ENST00000449913.2_Missense_Mutation_p.T645M|MARCH6_ENST00000503788.1_Missense_Mutation_p.T588M	NM_005885.3	NP_005876.2	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase	693					protein K48-linked ubiquitination (GO:0070936)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	enzyme binding (GO:0019899)|ligase activity (GO:0016874)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(35)|ovary(1)|urinary_tract(3)	54						AGGGCTGTGACGGTGATGGTG	0.488																																					p.T693M													.	MARCH6	89	0			c.C2078T						.						247.0	215.0	226.0					5																	10415711		2203	4300	6503	SO:0001583	missense	10299	exon21			CTGTGACGGTGAT	AB011169	CCDS34135.1, CCDS59487.1, CCDS59488.1	5p15.2	2013-01-09	2012-02-23		ENSG00000145495	ENSG00000145495		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	30550	protein-coding gene	gene with protein product		613297	"""membrane-associated ring finger (C3HC4) 6"""			14722266	Standard	NM_001270660		Approved	TEB4, MARCH-VI, RNF176	uc003jet.2	O60337	OTTHUMG00000162027	ENST00000274140.5:c.2078C>T	5.37:g.10415711C>T	ENSP00000274140:p.Thr693Met	Somatic	55	0		WXS	Illumina GAIIx	Phase_I	37	3	NM_005885	A5PKZ4|B4DKJ2|B4DT33|D3DTC8|O14670|Q86X77	Missense_Mutation	SNP	ENST00000274140.5	37	CCDS34135.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.684963	0.88639	.	.	ENSG00000145495	ENST00000449913;ENST00000503788;ENST00000274140;ENST00000510792	T;T;T;T	0.47177	1.86;0.85;1.86;0.85	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.68522	0.3010	M	0.65498	2.005	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.995	D;P;D;P	0.83275	0.957;0.869;0.996;0.764	T	0.63954	-0.6520	10	0.34782	T	0.22	-18.5768	19.8804	0.96895	0.0:1.0:0.0:0.0	.	588;645;273;693	B4DKJ2;B4DT33;B2RBJ1;O60337	.;.;.;MARH6_HUMAN	M	645;588;693;391	ENSP00000414643:T645M;ENSP00000425930:T588M;ENSP00000274140:T693M;ENSP00000424512:T391M	ENSP00000274140:T693M	T	+	2	0	MARCH6	10468711	1.000000	0.71417	0.967000	0.41034	0.983000	0.72400	7.508000	0.81686	2.684000	0.91462	0.563000	0.77884	ACG	.		0.488	MARCH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366919.2	NM_005885	
RN7SKP240	106479202	broad.mit.edu	37	6	22086023	22086023	+	RNA	DEL	A	A	-			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr6:22086023delA	ENST00000410583.1	+	0	251									RNA, 7SK small nuclear pseudogene 240																		aaatgcatGcaaaacctctac	0.398																																					.													.	.	.	0			.						.																																					0	.			GCATGCAAAACCT			6p22.3	2013-03-19			ENSG00000222515	ENSG00000222515			45964	pseudogene	RNA, pseudogene							Standard			Approved						6.37:g.22086023delA		Somatic	5	0		WXS	Illumina GAIIx	Phase_I	5	1	.		RNA	DEL	ENST00000410583.1	37																																																																																				.		0.398	RN7SKP240-201	KNOWN	basic	misc_RNA	misc_RNA			
ADCK5	203054	broad.mit.edu	37	8	145617535	145617549	+	Splice_Site	DEL	GGGGGTGCAAGGTGA	GGGGGTGCAAGGTGA	-	rs563415390|rs148509143|rs374281647	byFrequency	TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr8:145617535_145617549delGGGGGTGCAAGGTGA	ENST00000308860.6	+	12	1301_1311	c.1257_1267delGGGGGTGCAAGGTGA	c.(1255-1269)ctgggggtgcaaggt>ctgt	p.GVQG420del	CPSF1_ENST00000531727.1_5'Flank|MIR939_ENST00000401314.1_RNA	NM_174922.3	NP_777582.4	Q3MIX3	ADCK5_HUMAN	aarF domain containing kinase 5	420						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	protein serine/threonine kinase activity (GO:0004674)	p.?(2)		endometrium(1)|lung(2)|prostate(2)|skin(1)|stomach(2)	8	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;8.96e-41)|Epithelial(56;4.08e-40)|all cancers(56;4.51e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			CAGCCGCACTGGGGGTGCAAGGTGAGGGGGTGCAA	0.73														3140	0.626997	0.8109	0.562	5008	,	,		8769	0.6577		0.4205	False		,,,				2504	0.6053				p.419_423del													.	ADCK5	36	2	Unknown(2)	prostate(2)	c.1257_1267del						.			1836,894		805,226,334						4.5	0.7		dbSNP_120	4	2015,4403		639,737,1833	no	coding-near-splice	ADCK5	NM_174922.3		1444,963,2167	A1A1,A1R,RR		31.3961,32.7473,42.0966				3851,5297				SO:0001630	splice_region_variant	203054	exon12			CGCACTGGGGGTG	BC032402	CCDS34965.1, CCDS34965.2	8q24.3	2004-07-06			ENSG00000173137	ENSG00000173137			21738	protein-coding gene	gene with protein product							Standard	NM_174922		Approved	FLJ35454	uc003zch.3	Q3MIX3	OTTHUMG00000165190	ENST00000308860.6:c.1267+1GGGGGTGCAAGGTGA>-	8.37:g.145617535_145617549delGGGGGTGCAAGGTGA		Somatic	4	0		WXS	Illumina GAIIx	Phase_I	7	2	NM_174922	B3KS46|Q5U4P1|Q6P2S4|Q8N5V3	Splice_Site	DEL	ENST00000308860.6	37	CCDS34965.1																																																																																			.		0.730	ADCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382556.2	NM_174922	In_Frame_Del
LRRC2	79442	ucsc.edu;bcgsc.ca	37	3	46563075	46563075	+	Silent	SNP	G	G	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr3:46563075G>T	ENST00000395905.3	-	8	1395	c.1003C>A	c.(1003-1005)Cgg>Agg	p.R335R	LRRC2_ENST00000296144.3_Silent_p.R335R	NM_024512.4	NP_078788.2	Q9BYS8	LRRC2_HUMAN	leucine rich repeat containing 2	335										breast(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	17		Ovarian(412;0.0563)		OV - Ovarian serous cystadenocarcinoma(275;6.37e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00133)|KIRC - Kidney renal clear cell carcinoma(197;0.0214)|Kidney(197;0.0254)		TGGCGATCCCGTTCACTTTCC	0.333																																					p.R335R													LRRC2,NS,carcinoma,+1,3	LRRC2	37	0			c.C1003A						.						111.0	109.0	110.0					3																	46563075		2203	4300	6503	SO:0001819	synonymous_variant	79442	exon8			GATCCCGTTCACT	AJ308569	CCDS2741.1	3p21.3	2014-07-30	2003-11-19		ENSG00000163827	ENSG00000163827			14676	protein-coding gene	gene with protein product		607180	"""leucine-rich repeat-containing 2"""			11896456	Standard	NM_024512		Approved		uc010hji.3	Q9BYS8	OTTHUMG00000133479	ENST00000395905.3:c.1003C>A	3.37:g.46563075G>T		Somatic	40	0		WXS	Illumina HiSeq		38	4	NM_024512	B2RDQ7|Q96LT5	Silent	SNP	ENST00000395905.3	37	CCDS2741.1																																																																																			.		0.333	LRRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257375.2		
SLC3A2	6520	ucsc.edu;bcgsc.ca	37	11	62648550	62648550	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr11:62648550C>T	ENST00000377890.2	+	4	526	c.358C>T	c.(358-360)Ccc>Tcc	p.P120S	SLC3A2_ENST00000536981.1_5'Flank|SLC3A2_ENST00000338663.7_Missense_Mutation_p.P19S|SLC3A2_ENST00000377891.2_Missense_Mutation_p.P121S|SLC3A2_ENST00000377892.1_Missense_Mutation_p.P151S|SLC3A2_ENST00000535296.1_Missense_Mutation_p.P89S|SLC3A2_ENST00000377889.2_Missense_Mutation_p.P58S	NM_002394.5	NP_002385.3	P08195	4F2_HUMAN	solute carrier family 3 (amino acid transporter heavy chain), member 2	120					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|carbohydrate metabolic process (GO:0005975)|cell growth (GO:0016049)|ion transport (GO:0006811)|leucine import (GO:0060356)|leukocyte migration (GO:0050900)|response to exogenous dsRNA (GO:0043330)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|tryptophan transport (GO:0015827)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)|catalytic activity (GO:0003824)|cation binding (GO:0043169)|double-stranded RNA binding (GO:0003725)|neutral amino acid transmembrane transporter activity (GO:0015175)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(3)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(2)	22						TGAGTTAGAGCCCGAGAAGCA	0.617											OREG0021031	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P121S													.	SLC3A2	55	0			c.C361T						.						32.0	37.0	35.0					11																	62648550		2201	4299	6500	SO:0001583	missense	6520	exon4			TTAGAGCCCGAGA		CCDS8039.2, CCDS31588.1, CCDS31589.1, CCDS31590.1	11q12-q22	2013-07-19	2013-07-19		ENSG00000168003	ENSG00000168003		"""Solute carriers"""	11026	protein-coding gene	gene with protein product	"""antigen identified by monoclonal antibodies 4F2, TRA1.10, TROP4, and T43"", ""antigen defined by monoclonal antibody 4F2"", ""heavy chain"", ""4F2 heavy chain"", ""CD98 heavy chain"", ""monoclonal antibody 44D7"", ""4F2 cell-surface antigen heavy chain"", ""lymphocyte activation antigen 4F2 large subunit"""	158070	"""solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2"""	MDU1		3036867	Standard	NM_001012662		Approved	4T2HC, 4F2, NACAE, CD98, CD98HC, 4F2HC	uc001nwd.3	P08195	OTTHUMG00000074091	ENST00000377890.2:c.358C>T	11.37:g.62648550C>T	ENSP00000367122:p.Pro120Ser	Somatic	47	0	1062	WXS	Illumina HiSeq		40	4	NM_001012662	Q13543	Missense_Mutation	SNP	ENST00000377890.2	37	CCDS8039.2	.	.	.	.	.	.	.	.	.	.	C	24.6	4.546864	0.86022	.	.	ENSG00000168003	ENST00000377892;ENST00000377891;ENST00000377890;ENST00000542007;ENST00000377889;ENST00000535296;ENST00000544377;ENST00000338663;ENST00000539458;ENST00000422606	T;T;T;T;T;T;T	0.78816	-1.21;-1.21;-1.21;-1.21;-1.21;-1.21;-1.21	5.15	3.18	0.36537	.	0.253032	0.40144	N	0.001169	T	0.72827	0.3509	L	0.31926	0.97	0.34912	D	0.747545	P;P;P;P;D	0.54207	0.86;0.905;0.847;0.702;0.965	B;P;B;B;P	0.49887	0.439;0.487;0.293;0.294;0.625	T	0.79162	-0.1917	10	0.40728	T	0.16	-20.7966	12.3852	0.55328	0.3017:0.6983:0.0:0.0	.	58;89;120;19;151	P08195-3;F5GZS6;P08195;P08195-2;P08195-4	.;.;4F2_HUMAN;.;.	S	151;121;120;121;58;89;19;19;19;19	ENSP00000367124:P151S;ENSP00000367123:P121S;ENSP00000367122:P120S;ENSP00000367121:P58S;ENSP00000444236:P89S;ENSP00000442135:P19S;ENSP00000340815:P19S	ENSP00000340815:P19S	P	+	1	0	SLC3A2	62405126	0.214000	0.23563	0.977000	0.42913	0.975000	0.68041	1.800000	0.38833	1.392000	0.46585	0.561000	0.74099	CCC	.		0.617	SLC3A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000157306.1	NM_001012661	
ANO1	55107	ucsc.edu;bcgsc.ca	37	11	69950201	69950201	+	Missense_Mutation	SNP	A	A	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr11:69950201A>T	ENST00000355303.5	+	4	942	c.637A>T	c.(637-639)Agg>Tgg	p.R213W	ANO1_ENST00000398543.2_Missense_Mutation_p.R97W|ANO1_ENST00000316296.5_Missense_Mutation_p.R185W|ANO1_ENST00000530676.1_Missense_Mutation_p.R97W|ANO1_ENST00000538023.1_Missense_Mutation_p.R213W	NM_018043.5	NP_060513.5	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel	213					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of membrane potential (GO:0042391)|trachea development (GO:0060438)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(12)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)	29					Crofelemer(DB04941)	GGCTGAGCACAGGCCCCAGAC	0.547																																					p.R213W													.	ANO1	156	0			c.A637T						.						48.0	50.0	49.0					11																	69950201		1901	4107	6008	SO:0001583	missense	55107	exon4			GAGCACAGGCCCC	BC033036	CCDS44663.1	11q13.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000131620	ENSG00000131620		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	21625	protein-coding gene	gene with protein product		610108	"""oral cancer overexpressed 2"", ""transmembrane protein 16A"""	ORAOV2, TMEM16A		15067359, 18724360, 24692353	Standard	NM_018043		Approved	TAOS2, FLJ10261, DOG1	uc001opj.3	Q5XXA6	OTTHUMG00000167204	ENST00000355303.5:c.637A>T	11.37:g.69950201A>T	ENSP00000347454:p.Arg213Trp	Somatic	27	0		WXS	Illumina HiSeq		15	4	NM_018043	A8KAM3|Q8IYY8|Q8N7V3	Missense_Mutation	SNP	ENST00000355303.5	37	CCDS44663.1	.	.	.	.	.	.	.	.	.	.	A	16.57	3.158883	0.57368	.	.	ENSG00000131620	ENST00000355303;ENST00000538023;ENST00000398543;ENST00000531604;ENST00000316296;ENST00000530676	T;T;T;T;T;T	0.20069	2.1;2.1;2.1;2.1;2.1;2.1	5.25	1.4	0.22301	.	0.211816	0.41712	D	0.000837	T	0.27278	0.0669	L	0.36672	1.1	0.37817	D	0.928267	D;P	0.67145	0.996;0.946	D;P	0.64410	0.925;0.741	T	0.05484	-1.0882	9	.	.	.	.	7.4689	0.27336	0.506:0.4185:0.0755:0.0	.	185;213	Q5XXA6-3;Q5XXA6	.;ANO1_HUMAN	W	213;213;97;180;185;97	ENSP00000347454:R213W;ENSP00000444689:R213W;ENSP00000381551:R97W;ENSP00000436392:R180W;ENSP00000319477:R185W;ENSP00000435797:R97W	.	R	+	1	2	ANO1	69627849	0.993000	0.37304	0.995000	0.50966	0.287000	0.27160	0.689000	0.25437	0.277000	0.22141	0.528000	0.53228	AGG	.		0.547	ANO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393685.1	NM_018043	
SLC7A10	56301	ucsc.edu	37	19	33701909	33701909	+	Intron	SNP	C	C	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr19:33701909C>T	ENST00000253188.4	-	8	1163					NM_019849.2	NP_062823.1	Q9NS82	AAA1_HUMAN	solute carrier family 7 (neutral amino acid transporter light chain, asc system), member 10						amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|D-alanine transport (GO:0042941)|D-serine transport (GO:0042942)|ion transport (GO:0006811)|L-serine transport (GO:0015825)|leukocyte migration (GO:0050900)|neutral amino acid transport (GO:0015804)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-serine transmembrane transporter activity (GO:0015194)|neutral amino acid transmembrane transporter activity (GO:0015175)			central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|stomach(1)	18	Esophageal squamous(110;0.137)					CCGGGCCCAGCAGCCCCACTG	0.582																																					.													.	SLC7A10	43	0			.						.																																			SO:0001627	intron_variant	56301	.			GCCCAGCAGCCCC	AB037670	CCDS12431.1	19q13.11	2013-05-28	2011-07-12		ENSG00000130876	ENSG00000130876		"""Solute carriers"""	11058	protein-coding gene	gene with protein product		607959				10734121, 10863037	Standard	NM_019849		Approved	asc-1	uc002num.2	Q9NS82	OTTHUMG00000180344	ENST00000253188.4:c.1017-105G>A	19.37:g.33701909C>T		Somatic	23	0		WXS	Illumina HiSeq		35	4	.	B2RE84	Silent	SNP	ENST00000253188.4	37	CCDS12431.1																																																																																			.		0.582	SLC7A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450846.2	NM_019849	
RPAP2	79871	bcgsc.ca	37	1	92789386	92789386	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr1:92789386C>A	ENST00000610020.1	+	8	1018	c.909C>A	c.(907-909)agC>agA	p.S303R	RPAP2_ENST00000484158.1_3'UTR	NM_024813.2	NP_079089.2	Q8IXW5	RPAP2_HUMAN	RNA polymerase II associated protein 2	303					dephosphorylation of RNA polymerase II C-terminal domain (GO:0070940)|snRNA transcription (GO:0009301)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nucleolus (GO:0005730)|nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	22		all_lung(203;0.0565)|Lung NSC(277;0.152)|Glioma(108;0.222)		all cancers(265;0.00647)|GBM - Glioblastoma multiforme(16;0.0234)|Epithelial(280;0.115)		CTTCAAATAGCACTTTGCCTG	0.363																																					p.S303R													.	RPAP2	48	0			c.C909A						.						71.0	78.0	76.0					1																	92789386		2203	4299	6502	SO:0001583	missense	79871	exon8			AAATAGCACTTTG	AK023212	CCDS740.1	1p22.1	2014-01-28	2007-07-26	2007-07-26	ENSG00000122484	ENSG00000122484			25791	protein-coding gene	gene with protein product		611476	"""chromosome 1 open reading frame 82"""	C1orf82		17643375	Standard	NM_024813		Approved	FLJ13150	uc001dot.2	Q8IXW5	OTTHUMG00000010288	ENST00000610020.1:c.909C>A	1.37:g.92789386C>A	ENSP00000476948:p.Ser303Arg	Somatic	53	0		WXS	Illumina HiSeq	Phase_1	20	3	NM_024813	C9JKB5|Q49AS7|Q9H8Y2	Missense_Mutation	SNP	ENST00000610020.1	37	CCDS740.1	.	.	.	.	.	.	.	.	.	.	C	2.944	-0.218339	0.06101	.	.	ENSG00000122484	ENST00000370343;ENST00000394482	.	.	.	6.07	0.915	0.19366	.	1.003210	0.08019	N	0.991606	T	0.15869	0.0382	L	0.51422	1.61	0.23421	N	0.997719	B	0.06786	0.001	B	0.04013	0.001	T	0.19192	-1.0313	8	0.13470	T	0.59	-0.3716	5.6038	0.17369	0.0:0.2114:0.1323:0.6563	.	303	Q8IXW5	RPAP2_HUMAN	R	303	.	ENSP00000359368:S303R	S	+	3	2	RPAP2	92561974	0.000000	0.05858	0.001000	0.08648	0.025000	0.11179	0.189000	0.17037	-0.048000	0.13401	-0.290000	0.09829	AGC	.		0.363	RPAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028368.2	NM_024813	
IGKV1D-43	28891	bcgsc.ca	37	2	90248911	90248911	+	RNA	SNP	G	G	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr2:90248911G>T	ENST00000468879.1	+	0	173									immunoglobulin kappa variable 1D-43																		GACCCAGTCAGGACACAGCAT	0.562																																					.													.	.	.	0			.						.						90.0	94.0	93.0					2																	90248911		1990	4170	6160			28891	.			CAGTCAGGACACA	X72817		2p11.2	2012-10-03			ENSG00000242580	ENSG00000242580		"""Immunoglobulins / IGK locus"""	5758	other	immunoglobulin gene							Standard	NG_000833		Approved				OTTHUMG00000151572		2.37:g.90248911G>T		Somatic	84	0		WXS	Illumina HiSeq	Phase_1	64	27	.		Missense_Mutation	SNP	ENST00000468879.1	37																																																																																				.		0.562	IGKV1D-43-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene	OTTHUMT00000323147.2	NG_000833	
MUC12	10071	bcgsc.ca	37	7	100643832	100643832	+	Missense_Mutation	SNP	C	C	G	rs57050353		TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr7:100643832C>G	ENST00000379442.3	+	5	10417	c.10417C>G	c.(10417-10419)Cac>Gac	p.H3473D	MUC12_ENST00000536621.1_Missense_Mutation_p.H3330D			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	3473	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						TACGACCTACCACAGCAGCCC	0.547																																					p.H3330D													.	MUC12	140	0			c.C9988G						.						4.0	5.0	4.0					7																	100643832		610	1476	2086	SO:0001583	missense	10071	exon2			ACCTACCACAGCA	AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.10417C>G	7.37:g.100643832C>G	ENSP00000368755:p.His3473Asp	Somatic	550	33		WXS	Illumina HiSeq	Phase_1	537	28	NM_001164462	A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	ENST00000379442.3	37		.	.	.	.	.	.	.	.	.	.	c	0.278	-0.988338	0.02162	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.11930	2.73;2.73	0.109	0.109	0.14578	.	.	.	.	.	T	0.06371	0.0164	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.40997	-0.9533	6	0.32370	T	0.25	.	.	.	.	.	.	.	.	D	3473;3330	ENSP00000368755:H3473D;ENSP00000441929:H3330D	ENSP00000368755:H3473D	H	+	1	0	MUC12	100430552	0.000000	0.05858	0.015000	0.15790	0.015000	0.08874	0.085000	0.14912	0.181000	0.19994	0.184000	0.17185	CAC	.		0.547	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000347234.1	XM_379904	
MUC12	10071	bcgsc.ca	37	7	100643876	100643876	+	Silent	SNP	C	C	T	rs55930823		TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr7:100643876C>T	ENST00000379442.3	+	5	10461	c.10461C>T	c.(10459-10461)agC>agT	p.S3487S	MUC12_ENST00000536621.1_Silent_p.S3344S			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	3487	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						TCCCTGAAAGCGACACAACTT	0.537																																					p.S3344S													.	MUC12	140	0			c.C10032T						.						3.0	4.0	4.0					7																	100643876		594	1436	2030	SO:0001819	synonymous_variant	10071	exon2			TGAAAGCGACACA	AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.10461C>T	7.37:g.100643876C>T		Somatic	485	27		WXS	Illumina HiSeq	Phase_1	502	26	NM_001164462	A6ND38|F5GWV9|Q9UKN0	Silent	SNP	ENST00000379442.3	37																																																																																				.		0.537	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000347234.1	XM_379904	
Unknown	0	bcgsc.ca	37	8	55667427	55667427	+	IGR	SNP	G	G	A			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr8:55667427G>A								RP1 (124033 upstream) : XKR4 (347521 downstream)																							TGGCTGTCTCGGATTCAGGCA	0.398																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			TGTCTCGGATTCA																													8.37:g.55667427G>A		Somatic	72	2		WXS	Illumina HiSeq	Phase_1	75	42	.		RNA	SNP		37		.	.	.	.	.	.	.	.	.	.	G	0.889	-0.725980	0.03158	.	.	ENSG00000104237	ENST00000427058	.	.	.	5.41	0.605	0.17553	.	.	.	.	.	T	0.31199	0.0789	N	0.19112	0.55	.	.	.	B	0.06786	0.001	B	0.10450	0.005	T	0.24657	-1.0154	7	0.44086	T	0.13	.	10.2481	0.43354	0.408:0.0:0.592:0.0	.	768	E7EVW9	.	Q	768	.	ENSP00000399618:R768Q	R	+	2	0	RP1	55829981	0.511000	0.26179	0.012000	0.15200	0.013000	0.08279	0.442000	0.21628	-0.179000	0.10654	-0.244000	0.11960	CGG	.	0	0.398								
OR10G5P	79515	bcgsc.ca	37	11	123880424	123880424	+	IGR	SNP	G	G	T	rs548161709	byFrequency	TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr11:123880424G>T								OR10G6 (14556 upstream) : OR10G4 (5857 downstream)																							AGCTCTGGACGCCCCACTCTT	0.532																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	79515	.			CTGGACGCCCCAC																													11.37:g.123880424G>T		Somatic	40	0		WXS	Illumina HiSeq	Phase_1	27	11	.		RNA	SNP		37																																																																																				.	0	0.532								
Unknown	0	bcgsc.ca	37	12	6588416	6588416	+	IGR	SNP	T	T	C			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr12:6588416T>C								VAMP1 (8263 upstream) : MRPL51 (12733 downstream)																							CCACTGGATGTCTAAGAAACA	0.453																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			TGGATGTCTAAGA																													12.37:g.6588416T>C		Somatic	21	0		WXS	Illumina HiSeq	Phase_1	32	9	.		RNA	SNP		37																																																																																				.	0	0.453								
SOAT2	8435	bcgsc.ca	37	12	53509269	53509269	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr12:53509269C>T	ENST00000301466.3	+	6	599	c.539C>T	c.(538-540)gCg>gTg	p.A180V		NM_003578.3	NP_003569.1	O75908	SOAT2_HUMAN	sterol O-acyltransferase 2	180					cholesterol efflux (GO:0033344)|cholesterol esterification (GO:0034435)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|intestinal cholesterol absorption (GO:0030299)|macrophage derived foam cell differentiation (GO:0010742)|very-low-density lipoprotein particle assembly (GO:0034379)	brush border (GO:0005903)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	cholesterol binding (GO:0015485)|cholesterol O-acyltransferase activity (GO:0034736)|fatty-acyl-CoA binding (GO:0000062)|transferase activity, transferring acyl groups (GO:0016746)			endometrium(5)|kidney(3)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|skin(1)	18					Hesperetin(DB01094)	ACCCTGTTGGCGCCGTACCAG	0.672																																					p.A180V													.	SOAT2	44	0			c.C539T						.						46.0	46.0	46.0					12																	53509269		2203	4300	6503	SO:0001583	missense	8435	exon6			TGTTGGCGCCGTA	AF059203	CCDS8847.1	12q13.13	2012-09-20			ENSG00000167780	ENSG00000167780	2.3.1.26		11178	protein-coding gene	gene with protein product		601311				9756920	Standard	NM_003578		Approved	ACAT2	uc001sbv.3	O75908	OTTHUMG00000169774	ENST00000301466.3:c.539C>T	12.37:g.53509269C>T	ENSP00000301466:p.Ala180Val	Somatic	18	0		WXS	Illumina HiSeq	Phase_1	15	3	NM_003578	F5H7W4|I6L9H9|Q4VB99|Q4VBA1|Q96TD4|Q9UNR2	Missense_Mutation	SNP	ENST00000301466.3	37	CCDS8847.1	.	.	.	.	.	.	.	.	.	.	C	5.298	0.240320	0.10023	.	.	ENSG00000167780	ENST00000551896;ENST00000301466	T;T	0.73363	2.59;-0.74	5.61	-10.0	0.00425	.	0.842743	0.10580	N	0.658004	T	0.36936	0.0985	N	0.00742	-1.23	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.52208	-0.8606	10	0.02654	T	1	0.0423	21.523	0.99955	0.0:0.1227:0.0:0.8773	.	180	O75908	SOAT2_HUMAN	V	160;180	ENSP00000450120:A160V;ENSP00000301466:A180V	ENSP00000301466:A180V	A	+	2	0	SOAT2	51795536	0.011000	0.17503	0.026000	0.17262	0.695000	0.40330	-0.023000	0.12456	-2.135000	0.00811	-1.105000	0.02106	GCG	.		0.672	SOAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405817.1		
PARP1P1	144	bcgsc.ca	37	13	111591134	111591134	+	IGR	SNP	G	G	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr13:111591134G>T								ANKRD10 (23718 upstream) : LINC00431 (44519 downstream)																							CTTTGATGTGGAAAGTATGAG	0.532																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	144	.			GATGTGGAAAGTA																													13.37:g.111591134G>T		Somatic	18	0		WXS	Illumina HiSeq	Phase_1	28	13	.		RNA	SNP		37																																																																																				.	0	0.532								
IGHV2OR16-5	100129631	bcgsc.ca	37	16	32859392	32859392	+	RNA	SNP	C	C	T			TCGA-ZH-A8Y5-01A-11D-A417-09	TCGA-ZH-A8Y5-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85df6bba-88a3-4a2a-9233-157b59947c23	14be0260-55ec-4801-b29f-15ddeb9b79bb	g.chr16:32859392C>T	ENST00000560724.1	+	0	216									immunoglobulin heavy variable 2/OR16-5 (non-functional)																		TCATCATCTCCAAGGACACCT	0.522																																					.													.	.	.	0			.						.																																					100129631	.			CATCTCCAAGGAC	L25544		16p11.2	2012-10-03	2008-08-22		ENSG00000259303	ENSG00000259303		"""Immunoglobulins / IGH orphons"""	5579	other	immunoglobulin gene			"""immunoglobulin heavy variable 2/OR16-5"""				Standard			Approved	IGHV2/OR16-5			OTTHUMG00000152881		16.37:g.32859392C>T		Somatic	137	0		WXS	Illumina HiSeq	Phase_1	122	22	.		RNA	SNP	ENST00000560724.1	37																																																																																				.		0.522	IGHV2OR16-5-201	KNOWN	basic|appris_principal	IG_V_gene	IG_V_gene			
