#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVarCov_SOL	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TP53BP1	7158	hgsc.bcm.edu	37	15	43766909	43766910	+	Frame_Shift_Ins	INS	-	-	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr15:43766909_43766910insT	ENST00000263801.3	-	10	1378_1379	c.1126_1127insA	c.(1126-1128)atcfs	p.I376fs	TP53BP1_ENST00000450115.2_Frame_Shift_Ins_p.I381fs|TP53BP1_ENST00000382039.3_Frame_Shift_Ins_p.I381fs|TP53BP1_ENST00000382044.4_Frame_Shift_Ins_p.I381fs	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	376					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)			breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		GCTAGGAACGATAAAAGGAGTA	0.426								Other conserved DNA damage response genes																													p.I381fs		.											.	.	.	0			c.1142_1143insA						.																																			SO:0001589	frameshift_variant	7158	exon10			GGAACGATAAAAG	U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.1127dupA	15.37:g.43766910_43766910dupT	ENSP00000263801:p.Ile376fs	Somatic	30	0		WXS	Illumina HiSeq	.	41	10	NM_001141979	F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Frame_Shift_Ins	INS	ENST00000263801.3	37	CCDS10096.1																																																																																			.		0.426	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132897.3		
PXMP4	11264	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	32298495	32298502	+	Frame_Shift_Del	DEL	ACCGTGCC	ACCGTGCC	-	rs374588175		TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	ACCGTGCC	ACCGTGCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr20:32298495_32298502delACCGTGCC	ENST00000409299.3	-	3	326_333	c.234_241delGGCACGGT	c.(232-243)ctggcacggtttfs	p.ARF79fs	PXMP4_ENST00000344022.3_Intron|PXMP4_ENST00000217398.3_Frame_Shift_Del_p.WHG85fs	NM_007238.4	NP_009169.3	Q9Y6I8	PXMP4_HUMAN	peroxisomal membrane protein 4, 24kDa	79						integral component of membrane (GO:0016021)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)				NS(1)|endometrium(2)|large_intestine(2)|lung(8)	13						GTGAACACAAACCGTGCCAGGTTCCAGG	0.587																																					p.79_81del		.											.	.	.	0			c.235_242del						.																																			SO:0001589	frameshift_variant	11264	exon3			ACACAAACCGTGC	AF072864	CCDS13225.1, CCDS13226.1	20q11.22	2008-07-02	2002-08-29		ENSG00000101417	ENSG00000101417			15920	protein-coding gene	gene with protein product	"""24 kDa peroxisomal intrinsic membrane protein"""		"""peroxisomal membrane protein 4 (24kD)"""			10366717	Standard	NM_183397		Approved	PMP24	uc002wzv.3	Q9Y6I8	OTTHUMG00000032273	ENST00000409299.3:c.234_241delGGCACGGT	20.37:g.32298495_32298502delACCGTGCC	ENSP00000386385:p.Ala79fs	Somatic	45	0		WXS	Illumina HiSeq	.	55	12	NM_007238	A2A2I7|Q9H0T4	Frame_Shift_Del	DEL	ENST00000409299.3	37	CCDS13225.1																																																																																			.		0.587	PXMP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078739.2	NM_007238	
ARID1B	57492	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	157517340	157517340	+	Frame_Shift_Del	DEL	C	C	-			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr6:157517340delC	ENST00000350026.5	+	15	3866	c.3865delC	c.(3865-3867)cccfs	p.P1289fs	ARID1B_ENST00000367148.1_Frame_Shift_Del_p.P1342fs|ARID1B_ENST00000346085.5_Frame_Shift_Del_p.P1302fs|ARID1B_ENST00000275248.4_Frame_Shift_Del_p.P1284fs	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1289					chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		AGGACAGATGCCCAACAGCAG	0.493																																					p.M1301fs		.											.	.	.	0			c.3903delG						.						158.0	153.0	155.0					6																	157517340		2203	4296	6499	SO:0001589	frameshift_variant	57492	exon16			CAGATGCCCAACA	AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.3865delC	6.37:g.157517340delC	ENSP00000055163:p.Pro1289fs	Somatic	41	0		WXS	Illumina HiSeq	.	32	11	NM_020732	Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Frame_Shift_Del	DEL	ENST00000350026.5	37	CCDS5251.2																																																																																			.		0.493	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372723.1	NM_020732	
RBM27	54439	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	145610369	145610369	+	Missense_Mutation	SNP	C	C	G			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr5:145610369C>G	ENST00000265271.5	+	6	905	c.739C>G	c.(739-741)Cac>Gac	p.H247D	RBM27_ENST00000506502.1_Missense_Mutation_p.H247D	NM_018989.1	NP_061862.1	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27	247					mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(4)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CGCACCTGCTCACCACTCTGA	0.468																																					p.H247D		.											.	.	.	0			c.C739G						.						137.0	118.0	124.0					5																	145610369		1568	3582	5150	SO:0001583	missense	54439	exon6			CCTGCTCACCACT	AL833706	CCDS43378.1	5q32	2013-01-09				ENSG00000091009		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	29243	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 1"""					10718198, 15741184	Standard	NM_018989		Approved	KIAA1311, ARRS1, Psc1, ZC3H18	uc003lnz.4	Q9P2N5		ENST00000265271.5:c.739C>G	5.37:g.145610369C>G	ENSP00000265271:p.His247Asp	Somatic	40	0		WXS	Illumina HiSeq	.	29	9	NM_018989	Q8IYW9	Missense_Mutation	SNP	ENST00000265271.5	37	CCDS43378.1	.	.	.	.	.	.	.	.	.	.	C	17.77	3.470352	0.63625	.	.	ENSG00000091009	ENST00000265271	T	0.46819	0.86	5.45	5.45	0.79879	.	0.068094	0.64402	D	0.000010	T	0.44435	0.1293	L	0.52573	1.65	0.80722	D	1	B;P	0.36048	0.442;0.534	B;B	0.31869	0.137;0.107	T	0.35943	-0.9768	10	0.33940	T	0.23	-9.2018	19.2991	0.94136	0.0:1.0:0.0:0.0	.	247;247	Q9P2N5;B3KY61	RBM27_HUMAN;.	D	247	ENSP00000265271:H247D	ENSP00000265271:H247D	H	+	1	0	RBM27	145590562	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.778000	0.75043	2.561000	0.86390	0.563000	0.77884	CAC	.		0.468	RBM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373420.1	XM_291128	
EP400	57634	hgsc.bcm.edu;bcgsc.ca	37	12	132475225	132475225	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr12:132475225G>T	ENST00000333577.4	+	10	2812	c.2703G>T	c.(2701-2703)aaG>aaT	p.K901N	EP400_ENST00000389562.2_Missense_Mutation_p.K864N|EP400_ENST00000389561.2_Missense_Mutation_p.K865N|EP400_ENST00000332482.4_Missense_Mutation_p.K828N|EP400_ENST00000330386.6_Missense_Mutation_p.K865N			Q96L91	EP400_HUMAN	E1A binding protein p400	901					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		AAAAAAGGAAGAAGGCCTTAA	0.373																																					p.K865N		.											.	.	.	0			c.G2595T						.						72.0	79.0	77.0					12																	132475225		2203	4300	6503	SO:0001583	missense	57634	exon9			AAGGAAGAAGGCC	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.2703G>T	12.37:g.132475225G>T	ENSP00000333602:p.Lys901Asn	Somatic	122	0		WXS	Illumina HiSeq	.	82	4	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Missense_Mutation	SNP	ENST00000333577.4	37		.	.	.	.	.	.	.	.	.	.	G	10.85	1.465567	0.26335	.	.	ENSG00000183495	ENST00000333577;ENST00000389561;ENST00000389562;ENST00000332482;ENST00000330386;ENST00000423130;ENST00000541296;ENST00000542457	D;D;D;D;D	0.93763	-3.21;-3.22;-3.23;-3.28;-3.2	5.08	-1.47	0.08772	.	0.148491	0.53938	D	0.000047	D	0.94644	0.8273	M	0.78456	2.415	0.34448	D	0.700374	D;D;D;D;P	0.63046	0.977;0.977;0.977;0.992;0.928	P;P;P;P;P	0.61397	0.787;0.787;0.787;0.888;0.626	D	0.93996	0.7271	9	.	.	.	.	10.4105	0.44289	0.6068:0.0:0.3932:0.0	.	865;865;864;901;828	Q96L91-2;Q96L91-4;Q96L91-5;F8WCN8;Q96L91-3	.;.;.;.;.	N	901;865;864;828;865;901;865;865	ENSP00000333602:K901N;ENSP00000374212:K865N;ENSP00000374213:K864N;ENSP00000331737:K828N;ENSP00000330620:K865N	.	K	+	3	2	EP400	131041178	0.895000	0.30542	0.954000	0.39281	0.816000	0.46133	-0.019000	0.12546	-0.176000	0.10707	-0.378000	0.06908	AAG	.		0.373	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
STX3	6809	hgsc.bcm.edu	37	11	59560628	59560628	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr11:59560628G>A	ENST00000337979.4	+	7	1070	c.523G>A	c.(523-525)Gcc>Acc	p.A175T	STX3_ENST00000437946.2_Missense_Mutation_p.A78T|STX3_ENST00000300150.7_Missense_Mutation_p.A144T|STX3_ENST00000529177.1_Missense_Mutation_p.A175T|STX3_ENST00000535361.1_Missense_Mutation_p.A175T	NM_001178040.1|NM_004177.4	NP_001171511.1|NP_004168.1	Q13277	STX3_HUMAN	syntaxin 3	175					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|long-term synaptic potentiation (GO:0060291)|membrane fusion (GO:0061025)|neuron projection development (GO:0031175)|neurotransmitter transport (GO:0006836)	apical plasma membrane (GO:0016324)|azurophil granule (GO:0042582)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|SNARE complex (GO:0031201)|specific granule (GO:0042581)|vacuole (GO:0005773)	arachidonic acid binding (GO:0050544)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|skin(1)	13						TGGCAACCCGGCCATCTTCAC	0.542																																					p.A175T		.											.	.	.	0			c.G523A						.						102.0	92.0	95.0					11																	59560628		2201	4295	6496	SO:0001583	missense	6809	exon7			AACCCGGCCATCT	AJ002076	CCDS7975.1, CCDS53637.1	11q12.1	2008-02-05	2006-04-25	2006-04-25	ENSG00000166900	ENSG00000166900			11438	protein-coding gene	gene with protein product		600876	"""syntaxin 3A"""	STX3A		16598260, 16339081	Standard	NM_004177		Approved		uc001nog.3	Q13277	OTTHUMG00000167353	ENST00000337979.4:c.523G>A	11.37:g.59560628G>A	ENSP00000338562:p.Ala175Thr	Somatic	37	0		WXS	Illumina HiSeq	.	45	4	NM_004177	B4DME0|O43750|O43751|Q15360	Missense_Mutation	SNP	ENST00000337979.4	37	CCDS7975.1	.	.	.	.	.	.	.	.	.	.	G	15.89	2.967598	0.53507	.	.	ENSG00000166900	ENST00000300150;ENST00000337979;ENST00000535361;ENST00000437946;ENST00000529177;ENST00000528805	T;T;T;T;T;T	0.21734	1.99;1.99;1.99;1.99;1.99;1.99	5.11	5.11	0.69529	t-SNARE (1);	0.101437	0.64402	D	0.000002	T	0.23611	0.0571	M	0.75264	2.295	0.47276	D	0.999376	B;B;B;B	0.26635	0.023;0.026;0.155;0.096	B;B;B;B	0.25614	0.037;0.012;0.062;0.028	T	0.11717	-1.0576	10	0.56958	D	0.05	-8.4395	6.7489	0.23475	0.0897:0.0:0.733:0.1773	.	78;175;175;175	E7ET77;B4DME0;Q13277-2;Q13277	.;.;.;STX3_HUMAN	T	144;175;175;78;175;127	ENSP00000300150:A144T;ENSP00000338562:A175T;ENSP00000441649:A175T;ENSP00000393536:A78T;ENSP00000433248:A175T;ENSP00000431386:A127T	ENSP00000300150:A144T	A	+	1	0	STX3	59317204	0.957000	0.32711	0.961000	0.40146	0.738000	0.42128	1.542000	0.36137	2.379000	0.81126	0.555000	0.69702	GCC	.		0.542	STX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394264.1	NM_004177	
CLDN7	1366	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	7164180	7164180	+	Silent	SNP	G	G	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr17:7164180G>A	ENST00000360325.7	-	2	782	c.348C>T	c.(346-348)gcC>gcT	p.A116A	CLDN7_ENST00000397317.4_Silent_p.A116A|CLDN7_ENST00000571881.2_Missense_Mutation_p.P108S|CLDN7_ENST00000573745.1_5'Flank|RP1-4G17.5_ENST00000577138.1_Intron|CLDN7_ENST00000538261.3_Silent_p.A116A	NM_001307.5	NP_001298.3	O95471	CLD7_HUMAN	claudin 7	116					calcium-independent cell-cell adhesion (GO:0016338)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)	6						TGGCTATACGGGCCTTCTTCA	0.602																																					p.A116A		.											.	.	.	0			c.C348T						.						136.0	112.0	120.0					17																	7164180		2203	4300	6503	SO:0001819	synonymous_variant	1366	exon2			TATACGGGCCTTC	AJ011497	CCDS11096.1, CCDS54081.1	17p13.1	2013-09-20			ENSG00000181885	ENSG00000181885		"""Claudins"""	2049	protein-coding gene	gene with protein product		609131		CEPTRL2, CPETRL2		9892664	Standard	NM_001307		Approved	Hs.84359	uc002gfm.4	O95471	OTTHUMG00000178005	ENST00000360325.7:c.348C>T	17.37:g.7164180G>A		Somatic	62	0		WXS	Illumina HiSeq	.	44	14	NM_001185023	B2R9X7|D3DTP0|Q6IPN3|Q7Z4Y7|Q9BVN0	Silent	SNP	ENST00000360325.7	37	CCDS11096.1																																																																																			.		0.602	CLDN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440204.2	NM_001307	
OR2D3	120775	hgsc.bcm.edu	37	11	6942250	6942250	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr11:6942250G>T	ENST00000317834.3	+	1	46	c.18G>T	c.(16-18)ttG>ttT	p.L6F		NM_001004684.1	NP_001004684.1	Q8NGH3	OR2D3_HUMAN	olfactory receptor, family 2, subfamily D, member 3	6						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|large_intestine(7)|lung(12)|prostate(3)|skin(1)|stomach(1)	27		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		CTTTTTTCTTGTGCCAAACAG	0.398																																					p.L6F		.											OR2D3,right_upper_lobe,carcinoma,0,1	OR2D3	0	0			c.G18T						.						68.0	70.0	69.0					11																	6942250		2201	4296	6497	SO:0001583	missense	120775	exon1			TTTCTTGTGCCAA	BK004294	CCDS31417.1	11p15.4	2012-08-09			ENSG00000178358	ENSG00000178358		"""GPCR / Class A : Olfactory receptors"""	15146	protein-coding gene	gene with protein product							Standard	NM_001004684		Approved		uc010rav.2	Q8NGH3	OTTHUMG00000165742	ENST00000317834.3:c.18G>T	11.37:g.6942250G>T	ENSP00000320560:p.Leu6Phe	Somatic	67	0		WXS	Illumina HiSeq	.	44	2	NM_001004684	B2RP06|Q6IFG8|Q96R51	Missense_Mutation	SNP	ENST00000317834.3	37	CCDS31417.1	.	.	.	.	.	.	.	.	.	.	G	1.413	-0.574904	0.03882	.	.	ENSG00000178358	ENST00000317834	T	0.01495	4.83	4.24	-2.5	0.06384	.	.	.	.	.	T	0.01189	0.0039	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.45556	-0.9253	9	0.48119	T	0.1	.	5.2207	0.15368	0.4818:0.1583:0.3599:0.0	.	6	Q8NGH3	OR2D3_HUMAN	F	6	ENSP00000320560:L6F	ENSP00000320560:L6F	L	+	3	2	OR2D3	6898826	0.000000	0.05858	0.000000	0.03702	0.084000	0.17831	-0.301000	0.08232	-0.463000	0.06973	0.650000	0.86243	TTG	.		0.398	OR2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385987.1	NM_001004684	
CEP68	23177	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	65305018	65305018	+	Missense_Mutation	SNP	T	T	C			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr2:65305018T>C	ENST00000377990.2	+	5	2227	c.2024T>C	c.(2023-2025)aTa>aCa	p.I675T	RAB1A_ENST00000494188.1_Intron|CEP68_ENST00000260569.4_Missense_Mutation_p.I538T|CEP68_ENST00000546106.1_Intron	NM_015147.2	NP_055962.2	Q76N32	CEP68_HUMAN	centrosomal protein 68kDa	675					centriole-centriole cohesion (GO:0010457)|centrosome organization (GO:0051297)|protein localization to organelle (GO:0033365)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|endometrium(6)|kidney(8)|large_intestine(5)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32						AAGAAAGATATAGATGAACAT	0.408																																					p.I675T		.											.	.	.	0			c.T2024C						.						76.0	78.0	78.0					2																	65305018		2203	4300	6503	SO:0001583	missense	23177	exon5			AAGATATAGATGA	BC004873	CCDS1880.2	2p14	2014-02-20	2005-12-01	2005-12-01	ENSG00000011523	ENSG00000011523			29076	protein-coding gene	gene with protein product			"""KIAA0582"""	KIAA0582		9628581, 9847074, 14654843	Standard	NM_015147		Approved		uc002sdl.4	Q76N32	OTTHUMG00000129538	ENST00000377990.2:c.2024T>C	2.37:g.65305018T>C	ENSP00000367229:p.Ile675Thr	Somatic	83	0		WXS	Illumina HiSeq	.	83	22	NM_015147	B4DRQ1|D6W5F1|D6W5F2|O60326|Q9BQ18|Q9UDM9	Missense_Mutation	SNP	ENST00000377990.2	37	CCDS1880.2	.	.	.	.	.	.	.	.	.	.	T	17.13	3.310465	0.60414	.	.	ENSG00000011523	ENST00000377990;ENST00000260569	T;T	0.56444	0.46;0.46	5.86	5.86	0.93980	.	0.228496	0.37348	N	0.002137	T	0.62344	0.2420	L	0.59436	1.845	0.80722	D	1	D;D	0.56746	0.977;0.96	P;P	0.53593	0.73;0.643	T	0.66011	-0.6029	10	0.72032	D	0.01	-1.3675	14.8316	0.70153	0.0:0.0:0.0:1.0	.	675;538	Q76N32;Q76N32-2	CEP68_HUMAN;.	T	675;538	ENSP00000367229:I675T;ENSP00000260569:I538T	ENSP00000260569:I538T	I	+	2	0	CEP68	65158522	0.984000	0.35163	0.269000	0.24586	0.850000	0.48378	5.457000	0.66672	2.237000	0.73441	0.460000	0.39030	ATA	.		0.408	CEP68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251727.2	NM_015147	
INF2	64423	hgsc.bcm.edu	37	14	105180791	105180791	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr14:105180791G>T	ENST00000392634.4	+	21	3404	c.3292G>T	c.(3292-3294)Gag>Tag	p.E1098*	INF2_ENST00000330634.7_Nonsense_Mutation_p.E1098*	NM_022489.3	NP_071934.3	Q27J81	INF2_HUMAN	inverted formin, FH2 and WH2 domain containing	1098					actin cytoskeleton organization (GO:0030036)|cell death (GO:0008219)|regulation of cellular component size (GO:0032535)|regulation of mitochondrial fission (GO:0090140)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00188)|OV - Ovarian serous cystadenocarcinoma(23;0.0191)|Epithelial(46;0.047)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.176)		CCAGCCCTTGGAGGGGGCCTG	0.642																																					p.E1098X		.											.	.	.	0			c.G3292T						.						25.0	33.0	30.0					14																	105180791		1926	4116	6042	SO:0001587	stop_gained	64423	exon21			CCCTTGGAGGGGG	AK025709	CCDS9989.2, CCDS45173.1	14q32.33	2009-09-07	2007-11-29	2007-11-29	ENSG00000203485	ENSG00000203485			23791	protein-coding gene	gene with protein product	"""inverted formin 2"""	610982	"""chromosome 14 open reading frame 151"", ""chromosome 14 open reading frame 173"""	C14orf151, C14orf173		16818491	Standard	NM_001031714		Approved	MGC13251	uc001ypb.2	Q27J81	OTTHUMG00000029811	ENST00000392634.4:c.3292G>T	14.37:g.105180791G>T	ENSP00000376410:p.Glu1098*	Somatic	77	0		WXS	Illumina HiSeq	.	54	4	NM_022489	Q27J83|Q69YL8|Q6P1X7|Q6PK22|Q86TR7|Q9BRM1|Q9H6N1	Nonsense_Mutation	SNP	ENST00000392634.4	37	CCDS9989.2	.	.	.	.	.	.	.	.	.	.	G	40	7.938860	0.98571	.	.	ENSG00000203485	ENST00000330634;ENST00000392634	.	.	.	3.7	-0.548	0.11833	.	1.274440	0.06129	U	0.670342	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	.	4.1092	0.10052	0.2339:0.3851:0.381:0.0	.	.	.	.	X	1098	.	ENSP00000252527:E566X	E	+	1	0	INF2	104251836	0.000000	0.05858	0.000000	0.03702	0.267000	0.26476	0.637000	0.24659	0.009000	0.14813	0.491000	0.48974	GAG	.		0.642	INF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000074371.4	NM_022489	
EMC2	9694	hgsc.bcm.edu	37	8	109482343	109482343	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr8:109482343G>T	ENST00000220853.3	+	7	537	c.502G>T	c.(502-504)Gaa>Taa	p.E168*	EMC2_ENST00000520294.1_3'UTR	NM_014673.3	NP_055488.1	Q15006	EMC2_HUMAN	ER membrane protein complex subunit 2	168						cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|ER membrane protein complex (GO:0072546)|mitochondrion (GO:0005739)|nucleus (GO:0005634)											TTACATCAATGAACATGAGTA	0.373																																					p.E168X		.											TTC35,NS,carcinoma,0,1	TTC35	0	0			c.G502T						.						56.0	53.0	54.0					8																	109482343		2203	4300	6503	SO:0001587	stop_gained	9694	exon7			ATCAATGAACATG	BC021667	CCDS6309.1	8q23.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000104412	ENSG00000104412			28963	protein-coding gene	gene with protein product		607722	"""tetratricopeptide repeat domain 35"""	KIAA0103, TTC35		7788527, 22119785	Standard	NM_014673		Approved		uc003ymw.1	Q15006	OTTHUMG00000164873	ENST00000220853.3:c.502G>T	8.37:g.109482343G>T	ENSP00000220853:p.Glu168*	Somatic	31	0		WXS	Illumina HiSeq	.	33	2	NM_014673	Q8WUE1	Nonsense_Mutation	SNP	ENST00000220853.3	37	CCDS6309.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.0|26.0	4.697664|4.697664	0.88830|0.88830	.|.	.|.	ENSG00000104412|ENSG00000104412	ENST00000220853|ENST00000519642	.|.	.|.	.|.	5.65|5.65	5.65|5.65	0.86999|0.86999	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.80019	.|0.4547	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.77582	.|-0.2534	.|3	0.07990|.	T|.	0.79|.	-16.07|-16.07	20.0919|20.0919	0.97823|0.97823	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|I	168|115	.|.	ENSP00000220853:E168X|.	E|M	+|+	1|3	0|0	TTC35|TTC35	109551519|109551519	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.971000|0.971000	0.66376|0.66376	9.251000|9.251000	0.95483|0.95483	2.810000|2.810000	0.96702|0.96702	0.650000|0.650000	0.86243|0.86243	GAA|ATG	.		0.373	EMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380717.1	NM_014673	
KIAA1731	85459	hgsc.bcm.edu;bcgsc.ca	37	11	93417166	93417166	+	Missense_Mutation	SNP	A	A	G			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr11:93417166A>G	ENST00000325212.6	+	9	1148	c.986A>G	c.(985-987)gAg>gGg	p.E329G	KIAA1731_ENST00000411936.1_Missense_Mutation_p.E329G|KIAA1731_ENST00000344196.4_5'UTR			Q9C0D2	K1731_HUMAN	KIAA1731	329						centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)	11		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				CTTGAACCAGAGCCCTTGCCC	0.403																																					p.E329G		.											.	.	.	0			c.A986G						.						80.0	73.0	75.0					11																	93417166		692	1591	2283	SO:0001583	missense	85459	exon9			AACCAGAGCCCTT	AB051518	CCDS44708.1	11q21	2014-03-11			ENSG00000166004	ENSG00000166004			29366	protein-coding gene	gene with protein product						20844083	Standard	NM_033395		Approved		uc009ywb.1	Q9C0D2	OTTHUMG00000167449	ENST00000325212.6:c.986A>G	11.37:g.93417166A>G	ENSP00000316681:p.Glu329Gly	Somatic	50	0		WXS	Illumina HiSeq	.	56	4	NM_033395	C9J5H9|C9JQY8|Q8N7L4|Q8N919|Q8N9B0|Q96LT8	Missense_Mutation	SNP	ENST00000325212.6	37	CCDS44708.1	.	.	.	.	.	.	.	.	.	.	A	19.96	3.924139	0.73213	.	.	ENSG00000166004	ENST00000325212;ENST00000411936	T;T	0.12361	2.69;2.69	5.13	3.99	0.46301	.	0.000000	0.44483	D	0.000457	T	0.23572	0.0570	L	0.59436	1.845	0.80722	D	1	D	0.53312	0.959	P	0.51615	0.675	T	0.01015	-1.1480	10	0.72032	D	0.01	-3.0292	12.3055	0.54900	0.8581:0.1419:0.0:0.0	.	329	Q9C0D2	K1731_HUMAN	G	329	ENSP00000316681:E329G;ENSP00000406505:E329G	ENSP00000316681:E329G	E	+	2	0	KIAA1731	93056814	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	7.593000	0.82686	0.878000	0.35920	-0.321000	0.08615	GAG	.		0.403	KIAA1731-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000394640.1	NM_033395	
RAD54L2	23132	hgsc.bcm.edu	37	3	51624525	51624525	+	Missense_Mutation	SNP	A	A	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr3:51624525A>T	ENST00000409535.2	+	2	214	c.89A>T	c.(88-90)gAg>gTg	p.E30V		NM_015106.2	NP_055921.2	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2 (S. cerevisiae)	30						nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|transcription cofactor activity (GO:0003712)	p.E30V(1)		NS(2)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|liver(2)|lung(9)|ovary(4)|skin(2)	31				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		gaggaggaggaggtggcagtg	0.562																																					p.E30V		.											RAD54L2,NS,carcinoma,0,1	RAD54L2	0	1	Substitution - Missense(1)	endometrium(1)	c.A89T						.						321.0	323.0	322.0					3																	51624525		692	1591	2283	SO:0001583	missense	23132	exon2			AGGAGGAGGTGGC	AB018352	CCDS33765.2	3p21.2	2006-01-17			ENSG00000164080	ENSG00000164080			29123	protein-coding gene	gene with protein product						9872452	Standard	NM_015106		Approved	KIAA0809, SRISNF2L	uc011bdt.2	Q9Y4B4	OTTHUMG00000152936	ENST00000409535.2:c.89A>T	3.37:g.51624525A>T	ENSP00000386520:p.Glu30Val	Somatic	59	0		WXS	Illumina HiSeq	.	43	3	NM_015106	Q8TB57|Q9BV54	Missense_Mutation	SNP	ENST00000409535.2	37	CCDS33765.2	.	.	.	.	.	.	.	.	.	.	A	16.85	3.235622	0.58886	.	.	ENSG00000164080	ENST00000409535	D	0.94417	-3.42	5.1	3.92	0.45320	.	.	.	.	.	D	0.92420	0.7594	N	0.08118	0	0.80722	D	1	D	0.71674	0.998	D	0.73708	0.981	D	0.92157	0.5733	9	0.59425	D	0.04	-0.4356	10.2076	0.43122	0.8512:0.0:0.0:0.1488	.	30	Q9Y4B4	ARIP4_HUMAN	V	30	ENSP00000386520:E30V	ENSP00000386520:E30V	E	+	2	0	RAD54L2	51599565	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.749000	0.62155	0.930000	0.37217	0.533000	0.62120	GAG	.		0.562	RAD54L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328700.2	NM_015106	
KIAA1841	84542	hgsc.bcm.edu	37	2	61319611	61319611	+	Nonsense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr2:61319611G>A	ENST00000402291.1	+	11	1342	c.1101G>A	c.(1099-1101)tgG>tgA	p.W367*	KIAA1841_ENST00000295031.5_Nonsense_Mutation_p.W367*|KIAA1841_ENST00000356719.2_Nonsense_Mutation_p.W367*|KIAA1841_ENST00000453873.1_Nonsense_Mutation_p.W367*	NM_001129993.1	NP_001123465.1	Q6NSI8	K1841_HUMAN	KIAA1841	367								p.W367C(2)		breast(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	25			Epithelial(17;0.193)			ATAAGACATGGGATGTTCATG	0.318																																					p.W367X		.											KIAA1841_ENST00000402291,NS,carcinoma,0,4	KIAA1841_ENST00000402291	0	2	Substitution - Missense(2)	lung(2)	c.G1101A						.						88.0	94.0	92.0					2																	61319611		2203	4300	6503	SO:0001587	stop_gained	84542	exon11			GACATGGGATGTT	BC070104	CCDS1867.1, CCDS46296.1	2p15	2010-06-22			ENSG00000162929	ENSG00000162929			29387	protein-coding gene	gene with protein product						11347906	Standard	NM_032506		Approved		uc002saw.4	Q6NSI8	OTTHUMG00000129421	ENST00000402291.1:c.1101G>A	2.37:g.61319611G>A	ENSP00000385579:p.Trp367*	Somatic	63	0		WXS	Illumina HiSeq	.	40	2	NM_032506	Q49AF0|Q6ZND0|Q96JI6	Nonsense_Mutation	SNP	ENST00000402291.1	37	CCDS46296.1	.	.	.	.	.	.	.	.	.	.	G	37	6.004216	0.97195	.	.	ENSG00000162929	ENST00000402291;ENST00000295031;ENST00000356719;ENST00000453873	.	.	.	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.1003	19.5405	0.95272	0.0:0.0:1.0:0.0	.	.	.	.	X	367	.	ENSP00000295031:W367X	W	+	3	0	KIAA1841	61173115	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.698000	0.98700	2.608000	0.88229	0.555000	0.69702	TGG	.		0.318	KIAA1841-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325477.1	NM_032506	
IFI16	3428	hgsc.bcm.edu	37	1	158985757	158985757	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr1:158985757G>T	ENST00000295809.7	+	3	616	c.361G>T	c.(361-363)Gag>Tag	p.E121*	IFI16_ENST00000359709.3_Nonsense_Mutation_p.E121*|IFI16_ENST00000340979.6_Nonsense_Mutation_p.E121*|IFI16_ENST00000368131.4_Nonsense_Mutation_p.E121*|IFI16_ENST00000430894.2_Nonsense_Mutation_p.E125*|IFI16_ENST00000368132.3_Nonsense_Mutation_p.E121*|IFI16_ENST00000448393.2_Nonsense_Mutation_p.E121*			Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	121	Lys-rich.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of innate immune response (GO:0002218)|autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular response to glucose starvation (GO:0042149)|cellular response to ionizing radiation (GO:0071479)|defense response to virus (GO:0051607)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|monocyte differentiation (GO:0030224)|myeloid cell differentiation (GO:0030099)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|negative regulation of DNA binding (GO:0043392)|negative regulation of innate immune response (GO:0045824)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|positive regulation of cytokine production (GO:0001819)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of autophagy (GO:0010506)|regulation of gene expression, epigenetic (GO:0040029)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0429)					TGAAGGAGCAGAGGCAACTCC	0.522																																					p.E121X		.											IFI16,bladder,carcinoma,0,1	IFI16	0	0			c.G361T						.						71.0	64.0	67.0					1																	158985757		2203	4300	6503	SO:0001587	stop_gained	3428	exon3			GGAGCAGAGGCAA	M63838	CCDS1180.3, CCDS58039.1	1q22	2008-02-05			ENSG00000163565	ENSG00000163565			5395	protein-coding gene	gene with protein product		147586				1526658, 7959953	Standard	NM_005531		Approved	IFNGIP1, PYHIN2	uc010pis.2	Q16666	OTTHUMG00000037108	ENST00000295809.7:c.361G>T	1.37:g.158985757G>T	ENSP00000295809:p.Glu121*	Somatic	23	0		WXS	Illumina HiSeq	.	36	2	NM_001206567	B4DJT8|H3BLV7|Q59GX0|Q5T3W7|Q5T3W8|Q5T3X0|Q5T3X1|Q5T3X2|Q8N9E5|Q8NEQ7|Q96AJ5|Q9UH78	Nonsense_Mutation	SNP	ENST00000295809.7	37		.	.	.	.	.	.	.	.	.	.	.	20.2	3.942070	0.73557	.	.	ENSG00000163565	ENST00000359709;ENST00000426592;ENST00000447473;ENST00000295809;ENST00000340979;ENST00000368131;ENST00000368132;ENST00000430894	.	.	.	2.09	-1.44	0.08856	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	.	2.7474	0.05271	0.3668:0.2513:0.3819:0.0	.	.	.	.	X	121;121;121;121;121;121;121;125	.	ENSP00000295809:E121X	E	+	1	0	IFI16	157252381	0.000000	0.05858	0.000000	0.03702	0.116000	0.19942	-2.051000	0.01402	-0.367000	0.08052	0.462000	0.41574	GAG	.		0.522	IFI16-013	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000421720.1	NM_005531	
TACR2	6865	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	10	71174776	71174776	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr10:71174776G>T	ENST00000373306.4	-	2	1055	c.512C>A	c.(511-513)aCc>aAc	p.T171N		NM_001057.2	NP_001048.2	P21452	NK2R_HUMAN	tachykinin receptor 2	171					excretion (GO:0007588)|intestine smooth muscle contraction (GO:0014827)|muscle contraction (GO:0006936)|negative regulation of luteinizing hormone secretion (GO:0033685)|operant conditioning (GO:0035106)|positive regulation of acetylcholine secretion, neurotransmission (GO:0014057)|positive regulation of uterine smooth muscle contraction (GO:0070474)|positive regulation of vascular permeability (GO:0043117)|prolactin secretion (GO:0070459)|tachykinin receptor signaling pathway (GO:0007217)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	substance K receptor activity (GO:0016497)|tachykinin receptor activity (GO:0004995)			endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	11						CATGGTGACGGTGGAGTAGAA	0.647																																					p.T171N		.											.	.	.	0			c.C512A						.						96.0	86.0	89.0					10																	71174776		2203	4300	6503	SO:0001583	missense	6865	exon2			GTGACGGTGGAGT		CCDS7293.1	10q22.1	2012-09-20			ENSG00000075073	ENSG00000075073		"""GPCR / Class A : Tachykinin receptors"""	11527	protein-coding gene	gene with protein product		162321		TAC2R, NKNAR			Standard	NM_001057		Approved	SKR, NK2R	uc001jpn.2	P21452	OTTHUMG00000018377	ENST00000373306.4:c.512C>A	10.37:g.71174776G>T	ENSP00000362403:p.Thr171Asn	Somatic	33	0		WXS	Illumina HiSeq	.	32	4	NM_001057	A8K7I1|Q4QRI5|Q8NGQ8|Q9UDE6|Q9UDE7	Missense_Mutation	SNP	ENST00000373306.4	37	CCDS7293.1	.	.	.	.	.	.	.	.	.	.	G	11.03	1.518266	0.27211	.	.	ENSG00000075073	ENST00000373306	T	0.71934	-0.61	5.51	3.51	0.40186	GPCR, rhodopsin-like superfamily (1);	0.329884	0.31290	N	0.007918	T	0.58666	0.2138	L	0.38953	1.18	0.34123	D	0.66439	B	0.06786	0.001	B	0.15052	0.012	T	0.62469	-0.6848	10	0.23891	T	0.37	.	12.559	0.56271	0.0:0.0:0.4878:0.5122	.	171	P21452	NK2R_HUMAN	N	171	ENSP00000362403:T171N	ENSP00000362403:T171N	T	-	2	0	TACR2	70844782	1.000000	0.71417	0.998000	0.56505	0.253000	0.25986	2.551000	0.45820	1.454000	0.47793	-0.181000	0.13052	ACC	.		0.647	TACR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048411.1		
ZNF638	27332	hgsc.bcm.edu	37	2	71650945	71650945	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr2:71650945C>A	ENST00000409544.1	+	22	4931	c.4301C>A	c.(4300-4302)gCc>gAc	p.A1434D	ZNF638_ENST00000409407.1_Missense_Mutation_p.A374D|ZNF638_ENST00000355812.3_Intron|ZNF638_ENST00000264447.4_Missense_Mutation_p.A1434D	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	1434					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.A1434G(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						AAACTTTCAGCCAAGGAATTT	0.418																																					p.A1434D		.											ZNF638,NS,carcinoma,0,1	ZNF638	0	1	Substitution - Missense(1)	lung(1)	c.C4301A						.						50.0	53.0	52.0					2																	71650945		2203	4300	6503	SO:0001583	missense	27332	exon22			TTTCAGCCAAGGA	D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.4301C>A	2.37:g.71650945C>A	ENSP00000386433:p.Ala1434Asp	Somatic	23	0		WXS	Illumina HiSeq	.	32	2	NM_014497	B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Missense_Mutation	SNP	ENST00000409544.1	37	CCDS1917.1	.	.	.	.	.	.	.	.	.	.	C	16.77	3.216325	0.58452	.	.	ENSG00000075292	ENST00000264447;ENST00000409544;ENST00000409407;ENST00000462695	T;T;T	0.36340	1.26;1.26;1.65	5.66	4.78	0.61160	.	0.644139	0.14537	N	0.313530	T	0.29524	0.0736	L	0.29908	0.895	0.80722	D	1	P;B;P	0.46706	0.718;0.033;0.883	B;B;P	0.46629	0.221;0.025;0.522	T	0.01940	-1.1243	10	0.17369	T	0.5	2.0252	8.1088	0.30903	0.0:0.7559:0.1592:0.0848	.	1434;1434;1434	A8K583;Q14966-3;Q14966	.;.;ZN638_HUMAN	D	1434;1434;374;374	ENSP00000264447:A1434D;ENSP00000386433:A1434D;ENSP00000386813:A374D	ENSP00000264447:A1434D	A	+	2	0	ZNF638	71504453	0.849000	0.29639	1.000000	0.80357	0.955000	0.61496	2.122000	0.41987	1.383000	0.46405	0.563000	0.77884	GCC	.		0.418	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327431.1	NM_014497	
TENM2	57451	hgsc.bcm.edu	37	5	167675132	167675132	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr5:167675132G>T	ENST00000518659.1	+	27	7227	c.7188G>T	c.(7186-7188)gaG>gaT	p.E2396D	TENM2_ENST00000403607.2_Missense_Mutation_p.E2220D|TENM2_ENST00000545108.1_Missense_Mutation_p.E2395D|TENM2_ENST00000520394.1_Missense_Mutation_p.E2157D|TENM2_ENST00000519204.1_Missense_Mutation_p.E2275D	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	2396					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										CCTATGGGGAGATTTATTATG	0.517																																					p.E2387D		.											ODZ2_ENST00000519204,NS,carcinoma,0,3	ODZ2_ENST00000519204	0	0			c.G7161T						.						154.0	154.0	154.0					5																	167675132		1985	4161	6146	SO:0001583	missense	57451	exon27			TGGGGAGATTTAT	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.7188G>T	5.37:g.167675132G>T	ENSP00000429430:p.Glu2396Asp	Somatic	49	0		WXS	Illumina HiSeq	.	42	2	NM_001122679	Q9ULU2	Missense_Mutation	SNP	ENST00000518659.1	37		.	.	.	.	.	.	.	.	.	.	G	14.40	2.524365	0.44969	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	D;D;D;D;D	0.89681	-2.08;-2.07;-2.18;-2.53;-2.55	4.62	4.62	0.57501	Rhs repeat-associated core (1);	0.000000	0.85682	D	0.000000	D	0.89339	0.6687	L	0.38733	1.17	0.47341	D	0.999399	D;D;P	0.69078	0.997;0.995;0.713	D;P;B	0.65773	0.938;0.868;0.36	D	0.85787	0.1365	10	0.22109	T	0.4	.	11.4928	0.50391	0.0828:0.0:0.9172:0.0	.	2395;2396;2157	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	D	2396;2395;2275;2157;2220	ENSP00000429430:E2396D;ENSP00000438635:E2395D;ENSP00000428964:E2275D;ENSP00000427874:E2157D;ENSP00000384905:E2220D	ENSP00000384905:E2220D	E	+	3	2	ODZ2	167607710	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	3.338000	0.52128	2.556000	0.86216	0.561000	0.74099	GAG	.		0.517	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679	
FAM73A	374986	hgsc.bcm.edu	37	1	78272787	78272787	+	Splice_Site	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr1:78272787G>T	ENST00000370791.3	+	5	669		c.e5+1		FAM73A_ENST00000443751.2_Splice_Site	NM_001270384.1|NM_198549.3	NP_001257313.1|NP_940951.1	Q8NAN2	FA73A_HUMAN	family with sequence similarity 73, member A							integral component of membrane (GO:0016021)				breast(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	19				Colorectal(170;0.226)		TACTTAATGGGTAGGAATGAG	0.348																																					.		.											FAM73A,NS,carcinoma,0,1	FAM73A	0	0			c.637+1G>T						.						95.0	102.0	99.0					1																	78272787		2203	4300	6503	SO:0001630	splice_region_variant	374986	exon5			TAATGGGTAGGAA		CCDS681.1, CCDS72809.1	1p31.1	2008-02-05			ENSG00000180488	ENSG00000180488			24741	protein-coding gene	gene with protein product							Standard	NM_001270384		Approved	FLJ35093	uc010ork.3	Q8NAN2	OTTHUMG00000009766	ENST00000370791.3:c.637+1G>T	1.37:g.78272787G>T		Somatic	46	1		WXS	Illumina HiSeq	.	50	2	NM_198549	Q6MZG0	Splice_Site	SNP	ENST00000370791.3	37	CCDS681.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.301148	0.81136	.	.	ENSG00000180488	ENST00000370791;ENST00000443751	.	.	.	5.63	5.63	0.86233	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2924	0.94105	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FAM73A	78045375	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	8.390000	0.90175	2.650000	0.89964	0.655000	0.94253	.	.		0.348	FAM73A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000026931.1	NM_198549	Intron
PROS1	5627	hgsc.bcm.edu	37	3	93605180	93605180	+	Splice_Site	SNP	C	C	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr3:93605180C>T	ENST00000394236.3	-	11	1639	c.1323G>A	c.(1321-1323)ccG>ccA	p.P441P	PROS1_ENST00000407433.1_Splice_Site_p.P310P	NM_000313.3	NP_000304.2	P07225	PROS_HUMAN	protein S (alpha)	441	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|negative regulation of endopeptidase activity (GO:0010951)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|endopeptidase inhibitor activity (GO:0004866)	p.P441P(1)		endometrium(3)|kidney(5)|large_intestine(8)|lung(26)|ovary(1)|skin(2)|urinary_tract(1)	46					Drotrecogin alfa(DB00055)|Menadione(DB00170)|Sodium Tetradecyl Sulfate(DB00464)	GGATCATTACCGGTTTAATGA	0.373																																					p.P441P		.											PROS1,NS,carcinoma,0,1	PROS1	0	1	Substitution - coding silent(1)	lung(1)	c.G1323A						.						93.0	98.0	96.0					3																	93605180		2203	4300	6503	SO:0001630	splice_region_variant	5627	exon11			CATTACCGGTTTA		CCDS2923.1	3q11.1	2013-06-03			ENSG00000184500	ENSG00000184500			9456	protein-coding gene	gene with protein product		176880		PROS		214811, 1833851	Standard	NM_000313		Approved		uc003drb.4	P07225	OTTHUMG00000150354	ENST00000394236.3:c.1323+1G>A	3.37:g.93605180C>T		Somatic	71	0		WXS	Illumina HiSeq	.	35	2	NM_000313	A8KAC9|D3DN28|Q15518|Q7Z715|Q9UCZ8	Silent	SNP	ENST00000394236.3	37	CCDS2923.1																																																																																			.		0.373	PROS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317762.1	NM_000313	Silent
NAMPT	10135	hgsc.bcm.edu;bcgsc.ca	37	7	105894878	105894878	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr7:105894878G>T	ENST00000222553.3	-	9	1469	c.1162C>A	c.(1162-1164)Cag>Aag	p.Q388K		NM_005746.2	NP_005737.1	P43490	NAMPT_HUMAN	nicotinamide phosphoribosyltransferase	388					cell-cell signaling (GO:0007267)|circadian regulation of gene expression (GO:0032922)|NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|nicotinamide metabolic process (GO:0006769)|positive regulation of cell proliferation (GO:0008284)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|nicotinamide phosphoribosyltransferase activity (GO:0047280)|nicotinate-nucleotide diphosphorylase (carboxylating) activity (GO:0004514)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	14						GTCAACTTCTGTAGCAAACCT	0.358																																					p.Q388K		.											.	.	.	0			c.C1162A						.						136.0	118.0	124.0					7																	105894878		2203	4300	6503	SO:0001583	missense	10135	exon9			ACTTCTGTAGCAA	U02020	CCDS5737.1	7q22.3	2012-10-02	2008-03-27	2008-03-27	ENSG00000105835	ENSG00000105835			30092	protein-coding gene	gene with protein product	"""visfatin"""	608764	"""pre-B-cell colony enhancing factor 1"""	PBEF1		8289818	Standard	NM_005746		Approved	PBEF	uc003vdq.3	P43490	OTTHUMG00000140388	ENST00000222553.3:c.1162C>A	7.37:g.105894878G>T	ENSP00000222553:p.Gln388Lys	Somatic	60	0		WXS	Illumina HiSeq	.	66	4	NM_005746	A4D0Q9|A4D0R0|Q3KQV0|Q8WW95	Missense_Mutation	SNP	ENST00000222553.3	37	CCDS5737.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.969420	0.92855	.	.	ENSG00000105835	ENST00000222553	.	.	.	5.21	5.21	0.72293	Quinolinate phosphoribosyl transferase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.86928	0.6051	M	0.93808	3.46	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.89639	0.3861	9	0.59425	D	0.04	-1.4489	19.1305	0.93404	0.0:0.0:1.0:0.0	.	388	P43490	NAMPT_HUMAN	K	388	.	ENSP00000222553:Q388K	Q	-	1	0	NAMPT	105682114	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.420000	0.97426	2.590000	0.87494	0.467000	0.42956	CAG	.		0.358	NAMPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277146.1	NM_182790	
MUC5B	727897	hgsc.bcm.edu	37	11	1258387	1258387	+	Missense_Mutation	SNP	G	G	A	rs202160055		TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr11:1258387G>A	ENST00000529681.1	+	25	3348	c.3290G>A	c.(3289-3291)cGc>cAc	p.R1097H	MUC5B_ENST00000447027.1_Missense_Mutation_p.R1100H	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	1097	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GCCGCCTGCCGCTCCCAGGTG	0.682																																					p.R1097H		.											MUC5B,NS,carcinoma,+1,2	MUC5B	+1	0			c.G3290A						.						10.0	16.0	14.0					11																	1258387		1900	4086	5986	SO:0001583	missense	727897	exon25			CCTGCCGCTCCCA	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.3290G>A	11.37:g.1258387G>A	ENSP00000436812:p.Arg1097His	Somatic	39	1		WXS	Illumina HiSeq	.	42	6	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	G	6.941	0.543406	0.13250	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.72505	-0.66;-0.66	4.38	-0.728	0.11162	von Willebrand factor, type D domain (1);Uncharacterised domain, cysteine-rich (2);	.	.	.	.	T	0.30198	0.0757	N	0.00135	-2.02	0.26154	N	0.980103	B;B;B	0.24132	0.004;0.098;0.098	B;B;B	0.12837	0.001;0.008;0.008	T	0.37934	-0.9684	9	0.87932	D	0	.	8.5449	0.33415	0.6733:0.0:0.3267:0.0	rs35573593	1097;1790;1100	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	H	1097;1100;1098;1167	ENSP00000436812:R1097H;ENSP00000415793:R1100H	ENSP00000343037:R1098H	R	+	2	0	MUC5B	1214963	0.002000	0.14202	0.101000	0.21167	0.007000	0.05969	0.139000	0.16036	-0.476000	0.06842	-0.379000	0.06801	CGC	.		0.682	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
PLCH2	9651	hgsc.bcm.edu	37	1	2430086	2430086	+	Splice_Site	SNP	G	G	C	rs142848828		TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr1:2430086G>C	ENST00000419816.2	+	17	2623	c.2349G>C	c.(2347-2349)gaG>gaC	p.E783D	PLCH2_ENST00000288766.5_Intron|PLCH2_ENST00000378486.3_Splice_Site_p.E783D|PLCH2_ENST00000449969.1_Splice_Site_p.E756D|PLCH2_ENST00000378488.3_Splice_Site_p.E747D			O75038	PLCH2_HUMAN	phospholipase C, eta 2	783	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)	p.E783_I784insVGA(1)|p.E630_I631insVGA(1)		central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(3)|skin(1)	20	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)		ACCGTGGGGAGGTGGGGGCCA	0.706																																					p.E783D		.											.,6	.	131	2	Insertion - In frame(2)	central_nervous_system(2)	c.G2349C						.						6.0	6.0	6.0					1																	2430086		1812	3983	5795	SO:0001630	splice_region_variant	9651	exon17			TGGGGAGGTGGGG	AB007919	CCDS59959.1	1p36.32	2013-01-10	2006-03-16	2006-03-16	ENSG00000149527	ENSG00000149527	3.1.4.11	"""EF-hand domain containing"""	29037	protein-coding gene	gene with protein product		612836	"""phospholipase C-like 4"""	PLCL4		15899900	Standard	XM_006711054		Approved	KIAA0450, PLCeta2, RP3-395M20.1, PLC-eta2	uc001aji.1	O75038	OTTHUMG00000000719	ENST00000419816.2:c.2349+1G>C	1.37:g.2430086G>C		Somatic	7	1		WXS	Illumina HiSeq	.	5	2	NM_014638	A2VCM3|B9DI80|Q3LUA8|Q86XJ2|Q86XU1|Q86YU7|Q8TEH5|Q8WUS6	Missense_Mutation	SNP	ENST00000419816.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.44|17.44	3.390174|3.390174	0.62066|0.62066	.|.	.|.	ENSG00000149527|ENSG00000149527	ENST00000449969;ENST00000378486;ENST00000378488;ENST00000343889;ENST00000278878|ENST00000419816	T;T;T|.	0.13196|.	2.61;2.61;2.61|.	4.84|4.84	4.84|4.84	0.62591|0.62591	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);|.	0.286925|.	0.30538|.	N|.	0.009416|.	T|T	0.49133|0.49133	0.1539|0.1539	N|N	0.13371|0.13371	0.34|0.34	0.80722|0.80722	D|D	1|1	P;D;P;D|.	0.60160|.	0.929;0.987;0.852;0.964|.	P;D;P;D|.	0.66351|.	0.882;0.943;0.555;0.912|.	T|T	0.45775|0.45775	-0.9238|-0.9238	10|5	0.49607|.	T|.	0.09|.	.|.	16.9045|16.9045	0.86123|0.86123	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	630;535;756;783|.	B9DI81;B9DI82;O75038-2;O75038|.	.;.;.;PLCH2_HUMAN|.	D|T	756;783;747;630;535|78	ENSP00000397289:E756D;ENSP00000367747:E783D;ENSP00000367749:E747D|.	ENSP00000278878:E535D|.	E|R	+|+	3|2	2|0	PLCH2|PLCH2	2419946|2419946	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.147000|0.147000	0.21601|0.21601	5.417000|5.417000	0.66423|0.66423	2.224000|2.224000	0.72417|0.72417	0.561000|0.561000	0.74099|0.74099	GAG|AGA	.		0.706	PLCH2-009	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467514.1	NM_014638	Missense_Mutation
ZNF521	25925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	18	22669523	22669523	+	Nonsense_Mutation	SNP	A	A	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr18:22669523A>T	ENST00000361524.3	-	7	3960	c.3812T>A	c.(3811-3813)tTg>tAg	p.L1271*	ZNF521_ENST00000584787.1_Nonsense_Mutation_p.L1051*|ZNF521_ENST00000538137.2_Nonsense_Mutation_p.L1271*	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	1271					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					ATGCTGCTGCAACTTGTTTGC	0.398			T	PAX5	ALL																																p.L1271X		.		Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	.	.	.	0			c.T3812A						.						162.0	149.0	154.0					18																	22669523		2203	4300	6503	SO:0001587	stop_gained	25925	exon7			TGCTGCAACTTGT	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.3812T>A	18.37:g.22669523A>T	ENSP00000354794:p.Leu1271*	Somatic	58	0		WXS	Illumina HiSeq	.	49	9	NM_015461	A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Nonsense_Mutation	SNP	ENST00000361524.3	37	CCDS32806.1	.	.	.	.	.	.	.	.	.	.	A	43	10.266585	0.99371	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	.	.	.	5.79	5.79	0.91817	.	0.000000	0.52532	D	0.000061	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.3933	16.1088	0.81244	1.0:0.0:0.0:0.0	.	.	.	.	X	1271;1305;1271	.	ENSP00000354794:L1271X	L	-	2	0	ZNF521	20923521	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.957000	0.93082	2.186000	0.69663	0.528000	0.53228	TTG	.		0.398	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461	
ZNF709	163051	hgsc.bcm.edu;bcgsc.ca	37	19	12575678	12575678	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr19:12575678C>T	ENST00000397732.3	-	4	1229	c.1058G>A	c.(1057-1059)aGa>aAa	p.R353K	ZNF709_ENST00000428311.1_Missense_Mutation_p.R353K|CTD-3105H18.18_ENST00000598753.1_Intron	NM_152601.3	NP_689814.1	Q8N972	ZN709_HUMAN	zinc finger protein 709	353					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(3)|upper_aerodigestive_tract(3)	6						TATCATATGTCTTCGATAGCT	0.378																																					p.R353K	GBM(33;565 669 12371 29134 51667)	.											.	.	.	0			c.G1058A						.						101.0	109.0	106.0					19																	12575678		2202	4300	6502	SO:0001583	missense	163051	exon4			ATATGTCTTCGAT	AK095600	CCDS42504.1	19p13.2	2013-01-08			ENSG00000242852	ENSG00000242852		"""Zinc fingers, C2H2-type"", ""-"""	20629	protein-coding gene	gene with protein product							Standard	NM_152601		Approved	FLJ38281	uc002mtv.4	Q8N972	OTTHUMG00000156406	ENST00000397732.3:c.1058G>A	19.37:g.12575678C>T	ENSP00000380840:p.Arg353Lys	Somatic	70	0		WXS	Illumina HiSeq	.	63	4	NM_152601	A8K4E6	Missense_Mutation	SNP	ENST00000397732.3	37	CCDS42504.1	.	.	.	.	.	.	.	.	.	.	C	0.040	-1.287971	0.01387	.	.	ENSG00000242852;ENSG00000196826	ENST00000397732;ENST00000428311	T;T	0.22539	1.95;1.95	2.43	-4.86	0.03132	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.216320	0.23360	N	0.049032	T	0.09949	0.0244	N	0.25144	0.715	0.09310	N	1	B	0.34399	0.452	B	0.40864	0.342	T	0.35748	-0.9776	10	0.05620	T	0.96	.	6.2093	0.20619	0.1102:0.2013:0.5956:0.093	.	353	Q8N972	ZN709_HUMAN	K	353	ENSP00000380840:R353K;ENSP00000404127:R353K	ENSP00000404127:R353K	R	-	2	0	ZNF709;CTD-2192J16.17	12436678	0.000000	0.05858	0.000000	0.03702	0.991000	0.79684	-6.756000	0.00054	-1.307000	0.02321	0.467000	0.42956	AGA	.		0.378	ZNF709-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344088.1	NM_152601	
HMCN1	83872	hgsc.bcm.edu;bcgsc.ca	37	1	186158652	186158652	+	Missense_Mutation	SNP	T	T	C			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr1:186158652T>C	ENST00000271588.4	+	107	16779	c.16550T>C	c.(16549-16551)cTc>cCc	p.L5517P	HMCN1_ENST00000367492.2_Missense_Mutation_p.L5400P	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	5517					response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						AGGTTCTGCCTCAAGAACTGT	0.428																																					p.L5517P		.											.	.	.	0			c.T16550C						.						96.0	88.0	91.0					1																	186158652		2178	4266	6444	SO:0001583	missense	83872	exon107			TCTGCCTCAAGAA	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.16550T>C	1.37:g.186158652T>C	ENSP00000271588:p.Leu5517Pro	Somatic	70	0		WXS	Illumina HiSeq	.	83	4	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.426394	0.83667	.	.	ENSG00000143341	ENST00000271588;ENST00000367492;ENST00000414277	D;D;D	0.88124	-2.34;-2.34;-2.34	5.75	5.75	0.90469	Growth factor, receptor (1);Epidermal growth factor-like (1);	0.120124	0.56097	D	0.000023	D	0.90314	0.6970	L	0.54323	1.7	0.58432	D	0.999999	D	0.57899	0.981	P	0.57244	0.816	D	0.90797	0.4691	10	0.56958	D	0.05	.	16.0707	0.80928	0.0:0.0:0.0:1.0	.	5517	Q96RW7	HMCN1_HUMAN	P	5517;5400;192	ENSP00000271588:L5517P;ENSP00000356462:L5400P;ENSP00000406205:L192P	ENSP00000271588:L5517P	L	+	2	0	HMCN1	184425275	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.959000	0.87885	2.194000	0.70268	0.533000	0.62120	CTC	.		0.428	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
ANKRD30B	374860	hgsc.bcm.edu	37	18	14757844	14757844	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr18:14757844C>T	ENST00000358984.4	+	5	828	c.648C>T	c.(646-648)ggC>ggT	p.G216G	ANKRD30B_ENST00000579292.1_Intron|RNU6-1210P_ENST00000363775.1_RNA|ANKRD30B_ENST00000447268.2_Silent_p.G216G	NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	216										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						TATGTGAAGGCTCATCAGAGA	0.393																																					p.G216G		.											ANKRD30B_ENST00000358984,NS,carcinoma,0,2	ANKRD30B_ENST00000358984	0	0			c.C648T						.						104.0	82.0	89.0					18																	14757844		692	1591	2283	SO:0001819	synonymous_variant	374860	exon5			TGAAGGCTCATCA	BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.648C>T	18.37:g.14757844C>T		Somatic	75	0		WXS	Illumina HiSeq	.	57	2	NM_001145029	B4DGP1|F8WAG3|Q4G175	Silent	SNP	ENST00000358984.4	37	CCDS54182.1																																																																																			.		0.393	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443557.1	NM_001145029	
ESRP1	54845	hgsc.bcm.edu	37	8	95653675	95653675	+	Missense_Mutation	SNP	G	G	T	rs371931710		TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr8:95653675G>T	ENST00000433389.2	+	1	319	c.129G>T	c.(127-129)aaG>aaT	p.K43N	ESRP1_ENST00000454170.2_Missense_Mutation_p.K43N|ESRP1_ENST00000358397.5_Missense_Mutation_p.K43N|RP11-22C11.2_ENST00000562760.1_RNA|ESRP1_ENST00000423620.2_Missense_Mutation_p.K43N	NM_001034915.2|NM_017697.3	NP_001030087.2|NP_060167.2	Q6NXG1	ESRP1_HUMAN	epithelial splicing regulatory protein 1	43					mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)		ESRP1/RAF1(4)	NS(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)|urinary_tract(2)	20						TGGCCAACAAGAAGGTATTTC	0.517																																					p.K43N		.											ESRP1_ENST00000433389,NS,carcinoma,0,2	ESRP1_ENST00000433389	0	0			c.G129T						.						91.0	92.0	92.0					8																	95653675		1928	4125	6053	SO:0001583	missense	54845	exon1			CAACAAGAAGGTA	AK000178	CCDS47895.1, CCDS47896.1, CCDS47897.1, CCDS47898.1	8q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000104413	ENSG00000104413		"""RNA binding motif (RRM) containing"""	25966	protein-coding gene	gene with protein product		612959	"""RNA binding motif protein 35A"""	RBM35A		12477932	Standard	NM_017697		Approved	FLJ20171	uc003ygq.4	Q6NXG1	OTTHUMG00000164587	ENST00000433389.2:c.129G>T	8.37:g.95653675G>T	ENSP00000405738:p.Lys43Asn	Somatic	38	0		WXS	Illumina HiSeq	.	44	2	NM_001122827	A6NHA8|A8MPX1|E9PB47|Q2M2B0|Q499G3|Q6PJ86|Q9NXL8	Missense_Mutation	SNP	ENST00000433389.2	37	CCDS47897.1	.	.	.	.	.	.	.	.	.	.	G	13.24	2.178089	0.38511	.	.	ENSG00000104413	ENST00000423620;ENST00000433389;ENST00000358397;ENST00000454170	T;T;T;T	0.39592	1.07;1.07;1.07;1.07	5.05	5.05	0.67936	Ribonuclease H-like (1);	0.228496	0.42682	D	0.000669	T	0.19485	0.0468	N	0.05230	-0.09	0.44862	D	0.997879	B;B;B;B;B	0.09022	0.002;0.0;0.0;0.001;0.001	B;B;B;B;B	0.13407	0.009;0.003;0.002;0.003;0.001	T	0.13202	-1.0518	10	0.12430	T	0.62	-5.5277	9.0004	0.36079	0.1654:0.0:0.8346:0.0	.	43;43;43;43;43	Q6NXG1-4;Q6NXG1-2;E9PB47;Q6NXG1-3;Q6NXG1	.;.;.;.;ESRP1_HUMAN	N	43	ENSP00000407349:K43N;ENSP00000405738:K43N;ENSP00000351168:K43N;ENSP00000402766:K43N	ENSP00000351168:K43N	K	+	3	2	ESRP1	95722851	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.429000	0.59901	2.323000	0.78572	0.655000	0.94253	AAG	.		0.517	ESRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379326.1	NM_017697	
CWF19L2	143884	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	107325251	107325251	+	Silent	SNP	T	T	C			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr11:107325251T>C	ENST00000282251.5	-	3	291	c.264A>G	c.(262-264)aaA>aaG	p.K88K	CWF19L2_ENST00000433523.1_Silent_p.K88K	NM_152434.2	NP_689647.2	Q2TBE0	C19L2_HUMAN	CWF19-like 2, cell cycle control (S. pombe)	88	Lys-rich.						catalytic activity (GO:0003824)			endometrium(4)|kidney(2)|large_intestine(13)|lung(21)	40		Melanoma(852;1.75e-05)|all_epithelial(67;6.27e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0258)		Epithelial(105;7.18e-06)|BRCA - Breast invasive adenocarcinoma(274;1.65e-05)|all cancers(92;1.76e-05)		ctttctttgctttttttgaat	0.259																																					p.K88K		.											.	.	.	0			c.A264G						.						190.0	160.0	169.0					11																	107325251		692	1581	2273	SO:0001819	synonymous_variant	143884	exon3			CTTTGCTTTTTTT	AK056905	CCDS8336.2	11q23.1	2005-09-22			ENSG00000152404	ENSG00000152404			26508	protein-coding gene	gene with protein product						14702039	Standard	NM_152434		Approved	FLJ32343	uc010rvp.2	Q2TBE0	OTTHUMG00000152975	ENST00000282251.5:c.264A>G	11.37:g.107325251T>C		Somatic	56	0		WXS	Illumina HiSeq	.	43	11	NM_152434	A4FU66|A4FU67|A4FU68|Q6PHW1|Q96MI1	Silent	SNP	ENST00000282251.5	37	CCDS8336.2																																																																																			.		0.259	CWF19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328825.2	NM_152434	
AL441988.1	0	hgsc.bcm.edu	37	20	29638070	29638070	+	RNA	SNP	T	T	G	rs77854365		TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr20:29638070T>G	ENST00000408392.1	+	0	139																											ATTGTAACATTTTGATTCAAA	0.294																																					.		.											.	.	.	0			.						.																																					140678	.			TAACATTTTGATT																													20.37:g.29638070T>G		Somatic	48	0		WXS	Illumina HiSeq	.	55	8	.		RNA	SNP	ENST00000408392.1	37																																																																																				.		0.294	AL441988.1-201	NOVEL	basic	miRNA	miRNA			
ZNF682	91120	hgsc.bcm.edu	37	19	20117004	20117004	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr19:20117004C>A	ENST00000397165.2	-	4	1467	c.1307G>T	c.(1306-1308)cGg>cTg	p.R436L	ZNF682_ENST00000596019.1_Intron|ZNF682_ENST00000595736.1_Missense_Mutation_p.R360L|ZNF682_ENST00000597972.1_Missense_Mutation_p.R442L|ZNF682_ENST00000358523.5_Missense_Mutation_p.R404L|ZNF682_ENST00000397162.1_Missense_Mutation_p.R404L	NM_033196.2	NP_149973.1	O95780	ZN682_HUMAN	zinc finger protein 682	436					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	14						GTGTGAGCACCGATTAAAGGC	0.388																																					p.R436L		.											ZNF682,NS,carcinoma,0,1	ZNF682	0	0			c.G1307T						.						91.0	99.0	96.0					19																	20117004		2181	4293	6474	SO:0001583	missense	91120	exon4			GAGCACCGATTAA	AC006539	CCDS42533.1, CCDS42534.1	19p12	2014-02-13			ENSG00000197124	ENSG00000197124		"""Zinc fingers, C2H2-type"", ""-"""	28857	protein-coding gene	gene with protein product							Standard	NM_033196		Approved	BC39498_3	uc002noq.3	O95780	OTTHUMG00000182650	ENST00000397165.2:c.1307G>T	19.37:g.20117004C>A	ENSP00000380351:p.Arg436Leu	Somatic	60	0		WXS	Illumina HiSeq	.	54	3	NM_033196	B3KU64|E9PFJ5|Q96JV9	Missense_Mutation	SNP	ENST00000397165.2	37	CCDS42533.1	.	.	.	.	.	.	.	.	.	.	C	0.080	-1.184720	0.01620	.	.	ENSG00000197124	ENST00000397165;ENST00000397162;ENST00000341262;ENST00000358523	T;T;T	0.35236	1.32;1.32;1.32	1.09	-1.17	0.09648	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.28300	0.0699	L	0.53249	1.67	0.09310	N	1	B	0.11235	0.004	B	0.13407	0.009	T	0.27226	-1.0080	9	0.37606	T	0.19	.	4.8142	0.13358	0.0:0.5524:0.0:0.4476	.	436	O95780	ZN682_HUMAN	L	436;404;105;404	ENSP00000380351:R436L;ENSP00000380348:R404L;ENSP00000351324:R404L	ENSP00000340236:R105L	R	-	2	0	ZNF682	19978004	0.000000	0.05858	0.020000	0.16555	0.018000	0.09664	-2.036000	0.01421	-0.344000	0.08338	-0.339000	0.08088	CGG	.		0.388	ZNF682-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462888.1	NM_033196	
ZFR	51663	hgsc.bcm.edu	37	5	32407029	32407029	+	Silent	SNP	A	A	T	rs139769264		TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr5:32407029A>T	ENST00000265069.8	-	6	984	c.882T>A	c.(880-882)gcT>gcA	p.A294A		NM_016107.3	NP_057191.2	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein	294	Ala-rich.				multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.A294A(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|upper_aerodigestive_tract(2)	32				STAD - Stomach adenocarcinoma(35;0.19)		cagcagcagcagctgctgctg	0.483																																					p.A294A		.											ZFR,NS,carcinoma,0,2	ZFR	0	1	Substitution - coding silent(1)	endometrium(1)	c.T882A						.	A		0,4406		0,0,2203	35.0	36.0	36.0		882	-7.9	1.0	5	dbSNP_134	36	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ZFR	NM_016107.3		0,1,6502	TT,TA,AA		0.0116,0.0,0.0077		294/1075	32407029	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	51663	exon6			AGCAGCAGCTGCT	AF100742	CCDS34139.1	5p15.2	2014-03-03			ENSG00000056097	ENSG00000056097			17277	protein-coding gene	gene with protein product		615635				11574164, 24482476	Standard	NM_016107		Approved	ZFR1, SPG71	uc003jhr.1	Q96KR1	OTTHUMG00000161979	ENST00000265069.8:c.882T>A	5.37:g.32407029A>T		Somatic	22	0		WXS	Illumina HiSeq	.	28	2	NM_016107	B2RNR5|Q05C08|Q3B7X5|Q6P5A3|Q86UA0|Q9H6V4|Q9NTI1|Q9Y687	Silent	SNP	ENST00000265069.8	37	CCDS34139.1	.	.	.	.	.	.	.	.	.	.	A	11.68	1.711849	0.30322	0.0	1.16E-4	ENSG00000056097	ENST00000416900	.	.	.	5.89	-7.9	0.01169	.	.	.	.	.	T	0.27731	0.0682	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33292	-0.9874	5	0.08179	T	0.78	.	8.2119	0.31488	0.2876:0.1859:0.0:0.5266	.	.	.	.	S	175	.	ENSP00000393243:C175S	C	-	1	0	ZFR	32442786	0.089000	0.21612	0.989000	0.46669	0.998000	0.95712	-1.076000	0.03420	-0.596000	0.05821	0.454000	0.30748	TGC	0.000		0.483	ZFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366586.1		
ZNF254	9534	hgsc.bcm.edu	37	19	24289441	24289441	+	Silent	SNP	C	C	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr19:24289441C>A	ENST00000357002.4	+	3	364	c.249C>A	c.(247-249)ccC>ccA	p.P83P	ZNF254_ENST00000342944.6_Intron|ZNF254_ENST00000339642.6_Silent_p.P83P	NM_001278661.1|NM_001278662.1|NM_001278664.1|NM_001278677.1|NM_001278678.1|NM_203282.2	NP_001265590.1|NP_001265591.1|NP_001265593.1|NP_001265606.1|NP_001265607.1|NP_975011.3	O75437	ZN254_HUMAN	zinc finger protein 254	83	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)						all_cancers(12;0.086)|all_lung(12;0.00528)|Lung NSC(12;0.00731)|all_epithelial(12;0.0186)				TGGATGAACCCCCAGGTAGGT	0.443																																					p.P83P		.											.	.	.	0			c.C249A						.						113.0	119.0	117.0					19																	24289441		1511	2708	4219	SO:0001819	synonymous_variant	9534	exon3			TGAACCCCCAGGT	AF054180	CCDS32983.1, CCDS62622.1, CCDS62623.1, CCDS74323.1, CCDS74324.1	19p13	2013-01-08				ENSG00000213096		"""Zinc fingers, C2H2-type"", ""-"""	13047	protein-coding gene	gene with protein product		604768	"""zinc finger protein 539"""	ZNF91L, ZNF539		9653160	Standard	NM_001278661		Approved	HD-ZNF1, BMZF-5	uc002nru.3	O75437		ENST00000357002.4:c.249C>A	19.37:g.24289441C>A		Somatic	88	0		WXS	Illumina HiSeq	.	90	3	NM_203282	A4QPC0|Q86XL7	Silent	SNP	ENST00000357002.4	37	CCDS32983.1																																																																																			.		0.443	ZNF254-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466453.1	NM_004876	
ZNF792	126375	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	35450228	35450228	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr19:35450228C>T	ENST00000404801.1	-	4	917	c.531G>A	c.(529-531)cgG>cgA	p.R177R	ZNF792_ENST00000605484.1_Silent_p.R110R	NM_175872.4	NP_787068.3	Q3KQV3	ZN792_HUMAN	zinc finger protein 792	177			R -> Q (in dbSNP:rs2651079). {ECO:0000269|PubMed:15489334}.		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(5)	12	all_lung(56;4.18e-08)|Lung NSC(56;6.62e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			GCACCTGTTTCCGGGGAAGGT	0.507																																					p.R177R	GBM(1;7 183 21053 22581 22847)	.											.	.	.	0			c.G531A						.						252.0	246.0	248.0					19																	35450228		2203	4300	6503	SO:0001819	synonymous_variant	126375	exon4			CTGTTTCCGGGGA	AK095770	CCDS12440.2	19q13.11	2013-01-08			ENSG00000180884	ENSG00000180884		"""Zinc fingers, C2H2-type"", ""-"""	24751	protein-coding gene	gene with protein product						8889548	Standard	NM_175872		Approved	FLJ38451	uc002nxh.1	Q3KQV3	OTTHUMG00000150339	ENST00000404801.1:c.531G>A	19.37:g.35450228C>T		Somatic	53	0		WXS	Illumina HiSeq	.	59	11	NM_175872	B4E333|Q495L1|Q495L3|Q8N932	Silent	SNP	ENST00000404801.1	37	CCDS12440.2																																																																																			.		0.507	ZNF792-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317673.1	NM_175872	
RPF1	80135	hgsc.bcm.edu	37	1	84948633	84948633	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr1:84948633C>T	ENST00000370654.5	+	3	336	c.321C>T	c.(319-321)aaC>aaT	p.N107N	RPF1_ENST00000370656.1_Silent_p.N107N	NM_025065.6	NP_079341.2	Q9H9Y2	RPF1_HUMAN	ribosome production factor 1 homolog (S. cerevisiae)	107					rRNA processing (GO:0006364)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)			breast(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(2)|prostate(1)	14						CCATTGACAACCAGCGAGTGT	0.333																																					p.N107N		.											.	.	.	0			c.C321T						.						109.0	101.0	104.0					1																	84948633		2203	4300	6503	SO:0001819	synonymous_variant	80135	exon3			TGACAACCAGCGA	AF322053	CCDS695.1	1p22.3	2009-09-25	2009-09-25	2009-09-25	ENSG00000117133	ENSG00000117133			30350	protein-coding gene	gene with protein product	"""RNA processing factor 1"", ""ribosome production factor 1"""		"""brix domain containing 5"""	BXDC5		11864606	Standard	NM_025065		Approved		uc001djv.4	Q9H9Y2	OTTHUMG00000009857	ENST00000370654.5:c.321C>T	1.37:g.84948633C>T		Somatic	102	0		WXS	Illumina HiSeq	.	95	4	NM_025065	Q5VSK7|Q6AHX1|Q8WXZ8	Silent	SNP	ENST00000370654.5	37	CCDS695.1																																																																																			.		0.333	RPF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027238.1	NM_025065	
PRKG1	5592	hgsc.bcm.edu	37	10	53893621	53893621	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr10:53893621C>T	ENST00000401604.2	+	8	1106	c.912C>T	c.(910-912)aaC>aaT	p.N304N	PRKG1_ENST00000373980.4_Silent_p.N319N|PRKG1_ENST00000373975.2_Silent_p.N22N|PRKG1_ENST00000373985.1_Silent_p.N292N			Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I	304	cGMP-binding, low affinity.				actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|dendrite development (GO:0016358)|forebrain development (GO:0030900)|negative regulation of platelet aggregation (GO:0090331)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|regulation of GTPase activity (GO:0043087)|relaxation of vascular smooth muscle (GO:0060087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)	p.N319N(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	53		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		GAACAGCAAACGTAATTGCTG	0.348																																					p.N319N		.											PRKG1,rectum,carcinoma,0,1	PRKG1	0	1	Substitution - coding silent(1)	large_intestine(1)	c.C957T						.						169.0	168.0	168.0					10																	53893621		2203	4300	6503	SO:0001819	synonymous_variant	5592	exon8			AGCAAACGTAATT		CCDS7244.1	10q11.2	2009-07-10			ENSG00000185532	ENSG00000185532	2.7.11.1		9414	protein-coding gene	gene with protein product		176894		PRKGR1B, PRKG1B		2792381, 1544322	Standard	NM_001098512		Approved	PGK, PKG	uc001jjo.3	Q13976	OTTHUMG00000018248	ENST00000401604.2:c.912C>T	10.37:g.53893621C>T		Somatic	43	0		WXS	Illumina HiSeq	.	34	2	NM_006258	A5YM56|B3KSF3|E2PU10|P14619|Q5JP05|Q5JSJ6|Q6P5T7	Silent	SNP	ENST00000401604.2	37	CCDS44399.1																																																																																			.		0.348	PRKG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
PHLPP1	23239	hgsc.bcm.edu	37	18	60612431	60612431	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr18:60612431G>A	ENST00000262719.5	+	12	3485	c.3251G>A	c.(3250-3252)cGc>cAc	p.R1084H	PHLPP1_ENST00000400316.4_Missense_Mutation_p.R572H			O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein phosphatase 1	1084					apoptotic process (GO:0006915)|entrainment of circadian clock (GO:0009649)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)	p.R571P(1)		endometrium(2)|kidney(2)|lung(13)	17						AATTGCAGGCGCATGCACACC	0.433																																					p.R1084H		.											PHLPP,NS,carcinoma,0,1	PHLPP	0	1	Substitution - Missense(1)	lung(1)	c.G3251A						.						90.0	86.0	87.0					18																	60612431		1956	4156	6112	SO:0001583	missense	23239	exon12			GCAGGCGCATGCA	AB011178	CCDS45881.1, CCDS45881.2	18q21.32	2013-01-11	2009-05-26	2009-05-26	ENSG00000081913	ENSG00000081913		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	20610	protein-coding gene	gene with protein product		609396	"""pleckstrin homology domain containing, family E (with leucine rich repeats) member 1"", ""PH domain and leucine rich repeat protein phosphatase"""	PLEKHE1, PHLPP		10570941, 15808505	Standard	NM_194449		Approved	KIAA0606, SCOP	uc021ule.1	O60346	OTTHUMG00000150629	ENST00000262719.5:c.3251G>A	18.37:g.60612431G>A	ENSP00000262719:p.Arg1084His	Somatic	34	0		WXS	Illumina HiSeq	.	47	2	NM_194449	A1A4F5|Q641Q7|Q6P4C4|Q6PJI6|Q86TN6|Q96FK2|Q9NUY1	Missense_Mutation	SNP	ENST00000262719.5	37	CCDS45881.2	.	.	.	.	.	.	.	.	.	.	G	26.2	4.713180	0.89112	.	.	ENSG00000081913	ENST00000400316;ENST00000262719	T;T	0.18810	2.19;2.19	4.8	4.8	0.61643	.	.	.	.	.	T	0.41673	0.1169	L	0.53249	1.67	0.52501	D	0.999952	D	0.89917	1.0	D	0.73708	0.981	T	0.04693	-1.0933	9	0.29301	T	0.29	-10.5664	18.4074	0.90541	0.0:0.0:1.0:0.0	.	1084	O60346	PHLP1_HUMAN	H	572;1084	ENSP00000383170:R572H;ENSP00000262719:R1084H	ENSP00000262719:R1084H	R	+	2	0	PHLPP1	58763411	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	9.290000	0.96065	2.655000	0.90218	0.655000	0.94253	CGC	.		0.433	PHLPP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319249.2	NM_194449	
PIK3C2G	5288	hgsc.bcm.edu	37	12	18524178	18524178	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr12:18524178G>T	ENST00000266497.5	+	11	1728	c.1690G>T	c.(1690-1692)Ggg>Tgg	p.G564W	PIK3C2G_ENST00000538779.1_Missense_Mutation_p.G605W|PIK3C2G_ENST00000433979.1_Missense_Mutation_p.G564W			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	564	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.				chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)			breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				AAAACTGTTTGGGATTGCCTG	0.393																																					p.G564W		.											.,2	.	315	0			c.G1690T						.						96.0	97.0	97.0					12																	18524178		1854	4095	5949	SO:0001583	missense	5288	exon12			CTGTTTGGGATTG	AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.1690G>T	12.37:g.18524178G>T	ENSP00000266497:p.Gly564Trp	Somatic	55	0		WXS	Illumina HiSeq	.	40	2	NM_004570	A1L3U0	Missense_Mutation	SNP	ENST00000266497.5	37	CCDS44839.1	.	.	.	.	.	.	.	.	.	.	G	17.11	3.305440	0.60305	.	.	ENSG00000139144	ENST00000433979;ENST00000266497;ENST00000538779	T;T;T	0.77877	-1.13;-1.13;-1.13	4.01	4.01	0.46588	C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (2);	0.240653	0.29246	N	0.012713	D	0.87063	0.6084	M	0.80422	2.495	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.88165	0.2860	10	0.87932	D	0	-12.712	11.9244	0.52810	0.0:0.0:1.0:0.0	.	604;605;564	B7ZLY6;F5H369;O75747	.;.;P3C2G_HUMAN	W	564;564;605	ENSP00000404845:G564W;ENSP00000266497:G564W;ENSP00000445381:G605W	ENSP00000266497:G564W	G	+	1	0	PIK3C2G	18415445	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	4.770000	0.62309	2.520000	0.84964	0.563000	0.77884	GGG	.		0.393	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401316.1	NM_004570	
CAMK2B	816	hgsc.bcm.edu;bcgsc.ca	37	7	44302636	44302636	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr7:44302636C>A	ENST00000395749.2	-	3	264	c.188G>T	c.(187-189)cGg>cTg	p.R63L	CAMK2B_ENST00000358707.3_Missense_Mutation_p.R63L|CAMK2B_ENST00000347193.4_Missense_Mutation_p.R63L|CAMK2B_ENST00000457475.1_Missense_Mutation_p.R63L|CAMK2B_ENST00000395747.2_Missense_Mutation_p.R63L|CAMK2B_ENST00000440254.2_Missense_Mutation_p.R63L|CAMK2B_ENST00000353625.4_Missense_Mutation_p.R63L|CAMK2B_ENST00000346990.4_Missense_Mutation_p.R63L|CAMK2B_ENST00000258682.6_Missense_Mutation_p.R63L|CAMK2B_ENST00000350811.3_Missense_Mutation_p.R63L|CAMK2B_ENST00000502837.2_5'UTR	NM_001220.4	NP_001211.3	Q13554	KCC2B_HUMAN	calcium/calmodulin-dependent protein kinase II beta	63	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of meiosis involved in egg activation (GO:0060466)|calcium ion transport (GO:0006816)|cytokine-mediated signaling pathway (GO:0019221)|G1/S transition of mitotic cell cycle (GO:0000082)|inhibitory G-protein coupled receptor phosphorylation (GO:0002030)|interferon-gamma-mediated signaling pathway (GO:0060333)|neuromuscular process controlling balance (GO:0050885)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of neuron projection development (GO:0010976)|positive regulation of synapse maturation (GO:0090129)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of calcium ion transport (GO:0051924)|regulation of dendritic spine development (GO:0060998)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of skeletal muscle adaptation (GO:0014733)|regulation of synapse structural plasticity (GO:0051823)|regulation of synaptic transmission, cholinergic (GO:0032222)|response to cadmium ion (GO:0046686)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)	18						GCGGCAGATCCGAGCCTCTCT	0.617																																					p.R63L		.											.	.	.	0			c.G188T						.						60.0	59.0	60.0					7																	44302636		2203	4300	6503	SO:0001583	missense	816	exon3			CAGATCCGAGCCT	U50358	CCDS5483.1, CCDS5484.1, CCDS5485.1, CCDS5486.1, CCDS5487.1, CCDS5488.1, CCDS5489.1, CCDS43573.1	7p14.3-p14.1	2008-10-30	2008-10-30		ENSG00000058404	ENSG00000058404			1461	protein-coding gene	gene with protein product	"""CaM-kinase II beta chain"", ""calcium/calmodulin-dependent protein kinase type II beta chain"", ""CaM kinase II beta subunit"", ""proline rich calmodulin-dependent protein kinase"""	607707	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II beta"""	CAMKB			Standard	NM_172079		Approved	CAM2, CAMK2	uc003tkq.2	Q13554	OTTHUMG00000023491	ENST00000395749.2:c.188G>T	7.37:g.44302636C>A	ENSP00000379098:p.Arg63Leu	Somatic	80	0		WXS	Illumina HiSeq	.	55	5	NM_172081	A4D2K0|A4D2K1|A4D2K2|A4D2K3|A4D2K4|A4D2K5|A4D2K6|O95437|O95438|O95599|Q9UGH7|Q9UGH8|Q9UGH9|Q9UNX0|Q9UNX7|Q9UP00|Q9Y5N4|Q9Y6F4	Missense_Mutation	SNP	ENST00000395749.2	37	CCDS5483.1	.	.	.	.	.	.	.	.	.	.	C	33	5.195106	0.94960	.	.	ENSG00000058404	ENST00000350811;ENST00000457475;ENST00000395749;ENST00000440254;ENST00000358707;ENST00000353625;ENST00000347193;ENST00000346990;ENST00000258682;ENST00000395747;ENST00000415369;ENST00000424197;ENST00000421607	T;T;T;T;T;T;T;T;T;T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22;-0.22;-0.22;-0.22;-0.22;-0.22;-0.22;-0.22;-0.22;-0.22	4.47	4.47	0.54385	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.64605	0.2613	N	0.12422	0.21	0.80722	D	1	P;D;P;B;P;P;P;D;P	0.63046	0.821;0.977;0.598;0.329;0.675;0.852;0.821;0.992;0.9	P;P;B;B;B;P;P;D;P	0.63033	0.523;0.753;0.399;0.413;0.308;0.654;0.698;0.91;0.657	T	0.69335	-0.5172	9	0.62326	D	0.03	.	12.8104	0.57637	0.0:1.0:0.0:0.0	.	63;63;63;63;63;63;63;63;63	Q13554-8;Q13554-7;Q13554-4;Q13554-3;Q13554-6;A4D2K5;Q13554-5;Q13554;Q13554-2	.;.;.;.;.;.;.;KCC2B_HUMAN;.	L	63;63;63;63;63;63;63;63;63;63;79;63;63	ENSP00000326375:R63L;ENSP00000390292:R63L;ENSP00000379098:R63L;ENSP00000397937:R63L;ENSP00000351542:R63L;ENSP00000326427:R63L;ENSP00000326544:R63L;ENSP00000326518:R63L;ENSP00000258682:R63L;ENSP00000379096:R63L;ENSP00000390419:R79L;ENSP00000400387:R63L;ENSP00000388445:R63L	ENSP00000258682:R63L	R	-	2	0	CAMK2B	44269161	0.997000	0.39634	1.000000	0.80357	0.999000	0.98932	5.747000	0.68689	2.459000	0.83118	0.655000	0.94253	CGG	.		0.617	CAMK2B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251138.2	NM_172084	
POPDC3	64208	hgsc.bcm.edu	37	6	105609709	105609709	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr6:105609709C>T	ENST00000254765.3	-	2	354	c.76G>A	c.(76-78)Gaa>Aaa	p.E26K	BVES-AS1_ENST00000369122.3_RNA|BVES-AS1_ENST00000580511.1_RNA|BVES-AS1_ENST00000580854.1_RNA|POPDC3_ENST00000474760.1_5'UTR|BVES-AS1_ENST00000369120.2_RNA	NM_022361.4	NP_071756.2	Q9HBV1	POPD3_HUMAN	popeye domain containing 3	26					regulation of membrane potential (GO:0042391)	integral component of membrane (GO:0016021)		p.E26K(1)		NS(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|skin(3)|urinary_tract(1)	26		all_cancers(87;4.87e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0157)|Colorectal(196;0.202)|Lung NSC(302;0.238)				ATGGCTCCTTCGGCCTCTTGC	0.438																																					p.E26K		.											POPDC3,NS,NS,0,2	POPDC3	0	1	Substitution - Missense(1)	NS(1)	c.G76A						.						86.0	90.0	89.0					6																	105609709		2203	4300	6503	SO:0001583	missense	64208	exon2			CTCCTTCGGCCTC	BC022323	CCDS5052.1	6q21	2003-06-12			ENSG00000132429	ENSG00000132429			17649	protein-coding gene	gene with protein product		605824				10882522	Standard	NM_022361		Approved	POP3, MGC22671, bA355M14.1	uc003prb.3	Q9HBV1	OTTHUMG00000015293	ENST00000254765.3:c.76G>A	6.37:g.105609709C>T	ENSP00000254765:p.Glu26Lys	Somatic	39	0		WXS	Illumina HiSeq	.	36	2	NM_022361	B2RA98|Q5T3Y8|Q8TBW6	Missense_Mutation	SNP	ENST00000254765.3	37	CCDS5052.1	.	.	.	.	.	.	.	.	.	.	C	29.5	5.013678	0.93404	.	.	ENSG00000132429	ENST00000254765	T	0.45668	0.89	5.93	5.93	0.95920	.	0.046631	0.85682	D	0.000000	T	0.48132	0.1483	M	0.78049	2.395	0.58432	D	0.999999	D	0.67145	0.996	P	0.47786	0.557	T	0.55679	-0.8103	10	0.66056	D	0.02	-19.7045	20.3261	0.98701	0.0:1.0:0.0:0.0	.	26	Q9HBV1	POPD3_HUMAN	K	26	ENSP00000254765:E26K	ENSP00000254765:E26K	E	-	1	0	POPDC3	105716402	1.000000	0.71417	0.962000	0.40283	0.979000	0.70002	6.040000	0.70980	2.814000	0.96858	0.655000	0.94253	GAA	.		0.438	POPDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041651.1	NM_022361	
NGEF	25791	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	233756101	233756101	+	Silent	SNP	G	G	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr2:233756101G>A	ENST00000264051.3	-	8	1517	c.1239C>T	c.(1237-1239)ttC>ttT	p.F413F	NGEF_ENST00000373552.4_Silent_p.F321F|NGEF_ENST00000539537.1_Silent_p.F136F	NM_019850.2	NP_062824.2	Q8N5V2	NGEF_HUMAN	neuronal guanine nucleotide exchange factor	413	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|ephrin receptor signaling pathway (GO:0048013)|negative regulation of dendritic spine morphogenesis (GO:0061002)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(4)|endometrium(8)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|pancreas(1)|skin(4)	35		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.00793)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;8.65e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(119;0.00984)|GBM - Glioblastoma multiforme(43;0.0604)		TGATCCTCTGGAAAGGCAGGA	0.632																																					p.F413F		.											.	.	.	0			c.C1239T						.						103.0	99.0	101.0					2																	233756101		2203	4300	6503	SO:0001819	synonymous_variant	25791	exon8			CCTCTGGAAAGGC	AJ238899	CCDS2500.1, CCDS46544.1	2q37	2012-07-24			ENSG00000066248	ENSG00000066248		"""Rho guanine nucleotide exchange factors"""	7807	protein-coding gene	gene with protein product	"""ephexin"""	605991				10777665	Standard	NM_019850		Approved	ARHGEF27	uc002vts.2	Q8N5V2	OTTHUMG00000133272	ENST00000264051.3:c.1239C>T	2.37:g.233756101G>A		Somatic	33	0		WXS	Illumina HiSeq	.	34	8	NM_019850	B4DMB8|B9A045|E9PC42|Q53QQ4|Q53ST7|Q6GMQ5|Q9NQD6	Silent	SNP	ENST00000264051.3	37	CCDS2500.1																																																																																			.		0.632	NGEF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257051.2	XM_044799	
ITIH5	80760	hgsc.bcm.edu	37	10	7608296	7608296	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr10:7608296G>A	ENST00000256861.6	-	13	2302	c.2224C>T	c.(2224-2226)Cgc>Tgc	p.R742C	ITIH5_ENST00000397146.2_Intron|ITIH5_ENST00000298441.6_Missense_Mutation_p.R528C|ITIH5_ENST00000446830.2_Missense_Mutation_p.R524C	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	742					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.R742C(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						GTGATAGTGCGCAAGTAAGTG	0.527																																					p.R742C		.											ITIH5,NS,adenocarcinoma,+1,1	ITIH5	+1	1	Substitution - Missense(1)	endometrium(1)	c.C2224T						.						111.0	95.0	101.0					10																	7608296		2203	4300	6503	SO:0001583	missense	80760	exon13			TAGTGCGCAAGTA			10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.2224C>T	10.37:g.7608296G>A	ENSP00000256861:p.Arg742Cys	Somatic	36	0		WXS	Illumina HiSeq	.	36	2	NM_030569	Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Missense_Mutation	SNP	ENST00000256861.6	37		.	.	.	.	.	.	.	.	.	.	G	18.09	3.547292	0.65311	.	.	ENSG00000123243	ENST00000256861;ENST00000298441;ENST00000446830	T;T;T	0.12255	2.7;2.7;2.7	5.84	0.122	0.14702	Inter-alpha-trypsin inhibitor heavy chain, C-terminal (1);	0.297109	0.45126	D	0.000385	T	0.29093	0.0723	.	.	.	0.80722	D	1	D;D	0.76494	0.999;0.998	D;P	0.63192	0.912;0.857	T	0.02917	-1.1094	9	0.72032	D	0.01	-6.0799	9.4182	0.38534	0.0:0.4035:0.2912:0.3054	.	742;528	Q86UX2;Q86UX2-3	ITIH5_HUMAN;.	C	742;528;524	ENSP00000256861:R742C;ENSP00000298441:R528C;ENSP00000387969:R524C	ENSP00000256861:R742C	R	-	1	0	ITIH5	7648302	1.000000	0.71417	0.991000	0.47740	0.642000	0.38348	3.485000	0.53208	0.035000	0.15519	-0.165000	0.13383	CGC	.		0.527	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569	
DUSP12	11266	hgsc.bcm.edu;bcgsc.ca	37	1	161726605	161726605	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr1:161726605G>T	ENST00000367943.4	+	6	923	c.891G>T	c.(889-891)ttG>ttT	p.L297F		NM_007240.1	NP_009171.1	Q9UNI6	DUS12_HUMAN	dual specificity phosphatase 12	297					cellular protein modification process (GO:0006464)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of glucokinase activity (GO:0033133)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|lung(1)	5	all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00634)			GTGCCAAGTTGGGTTCCTTCA	0.353																																					p.L297F		.											.	.	.	0			c.G891T						.						153.0	150.0	151.0					1																	161726605		2203	4300	6503	SO:0001583	missense	11266	exon6			CAAGTTGGGTTCC	AF119226	CCDS1234.1	1q21-q22	2011-06-09			ENSG00000081721	ENSG00000081721		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	3067	protein-coding gene	gene with protein product	"""serine/threonine specific protein phosphatase"", ""YVH1 protein-tyrosine phosphatase (S. cerevisiae) ortholog"""	604835				10446167	Standard	XM_005244862		Approved	YVH1, DUSP1	uc001gbo.3	Q9UNI6	OTTHUMG00000034540	ENST00000367943.4:c.891G>T	1.37:g.161726605G>T	ENSP00000356920:p.Leu297Phe	Somatic	49	0		WXS	Illumina HiSeq	.	62	4	NM_007240	Q5VXA8	Missense_Mutation	SNP	ENST00000367943.4	37	CCDS1234.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.701242	0.88924	.	.	ENSG00000081721	ENST00000367943	T	0.08807	3.05	5.72	5.72	0.89469	.	0.080670	0.51477	D	0.000091	T	0.31575	0.0801	M	0.91972	3.26	0.58432	D	0.999995	D	0.89917	1.0	D	0.85130	0.997	T	0.29971	-0.9994	9	0.87932	D	0	.	17.3878	0.87421	0.0:0.0:1.0:0.0	.	297	Q9UNI6	DUS12_HUMAN	F	297	ENSP00000356920:L297F	ENSP00000356920:L297F	L	+	3	2	DUSP12	159993229	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.444000	0.73452	2.695000	0.91970	0.655000	0.94253	TTG	.		0.353	DUSP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083588.1	NM_007240	
TLL1	7092	hgsc.bcm.edu;bcgsc.ca	37	4	166981259	166981259	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr4:166981259G>T	ENST00000061240.2	+	15	2573	c.1926G>T	c.(1924-1926)aaG>aaT	p.K642N	TLL1_ENST00000507499.1_Missense_Mutation_p.K665N	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	642	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		CTCCTAATAAGAACTGTGTGT	0.428																																					p.K642N		.											.	.	.	0			c.G1926T						.						91.0	89.0	90.0					4																	166981259		2203	4300	6503	SO:0001583	missense	7092	exon15			TAATAAGAACTGT	AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.1926G>T	4.37:g.166981259G>T	ENSP00000061240:p.Lys642Asn	Somatic	66	0		WXS	Illumina HiSeq	.	51	4	NM_012464	B2RMU2|Q96AN3|Q9NQS4	Missense_Mutation	SNP	ENST00000061240.2	37	CCDS3811.1	.	.	.	.	.	.	.	.	.	.	G	17.07	3.294295	0.60086	.	.	ENSG00000038295	ENST00000061240;ENST00000507499	T;T	0.28454	1.61;1.61	5.98	1.99	0.26369	CUB (5);	0.000000	0.85682	U	0.000000	T	0.54806	0.1881	M	0.86097	2.795	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.53542	-0.8424	10	0.51188	T	0.08	.	9.8594	0.41105	0.8045:0.0:0.1955:0.0	.	665;642	E9PD25;O43897	.;TLL1_HUMAN	N	642;665	ENSP00000061240:K642N;ENSP00000426082:K665N	ENSP00000061240:K642N	K	+	3	2	TLL1	167200709	1.000000	0.71417	1.000000	0.80357	0.674000	0.39518	1.620000	0.36976	0.152000	0.19188	-0.423000	0.05987	AAG	.		0.428	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363821.1		
CD22	933	hgsc.bcm.edu	37	19	35832642	35832642	+	Silent	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr19:35832642G>T	ENST00000085219.5	+	9	1875	c.1809G>T	c.(1807-1809)ggG>ggT	p.G603G	CD22_ENST00000419549.2_Silent_p.G431G|CD22_ENST00000270311.6_Silent_p.G483G|CD22_ENST00000544992.2_Silent_p.G603G|CD22_ENST00000341773.6_Silent_p.G426G|CD22_ENST00000594250.1_Silent_p.G426G|CD22_ENST00000536635.2_Silent_p.G515G	NM_001771.3	NP_001762.2	P20273	CD22_HUMAN	CD22 molecule	603	Ig-like C2-type 6.				cell adhesion (GO:0007155)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			breast(2)|endometrium(2)|kidney(3)|large_intestine(14)|lung(21)|ovary(5)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	54	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			TGAGCCCGGGGGACCAAGTGA	0.627																																					p.G603G	Ovarian(42;1009 1133 23674 26041)	.											CD22,NS,carcinoma,0,1	CD22	0	0			c.G1809T						.						103.0	84.0	90.0					19																	35832642		2203	4300	6503	SO:0001819	synonymous_variant	933	exon9			CCCGGGGGACCAA	X52785	CCDS12457.1, CCDS54247.1, CCDS54248.1, CCDS54249.1, CCDS62634.1	19q13.1	2013-01-29	2006-03-28		ENSG00000012124	ENSG00000012124		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1643	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 2"""	107266	"""CD22 antigen"""			8496602, 1691828	Standard	NM_001185099		Approved	SIGLEC-2, SIGLEC2	uc010edt.3	P20273		ENST00000085219.5:c.1809G>T	19.37:g.35832642G>T		Somatic	48	0		WXS	Illumina HiSeq	.	49	2	NM_001185100	F5GYU4|F5H7U3|O95699|O95701|O95702|O95703|Q01665|Q32M46|Q92872|Q92873|Q9UQA6|Q9UQA7|Q9UQA8|Q9UQA9|Q9UQB0|Q9Y2A6	Silent	SNP	ENST00000085219.5	37	CCDS12457.1																																																																																			.		0.627	CD22-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466099.1	NM_001771	
ANKRD17	26057	hgsc.bcm.edu	37	4	74019647	74019647	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr4:74019647G>T	ENST00000358602.4	-	6	1300	c.1184C>A	c.(1183-1185)aCg>aAg	p.T395K	ANKRD17_ENST00000330838.6_Missense_Mutation_p.T395K|ANKRD17_ENST00000509867.2_Missense_Mutation_p.T282K|ANKRD17_ENST00000514252.1_5'UTR	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	395					blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.T395M(1)		NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			ATTAGAATGCGTATTAATGCC	0.368																																					p.T395K		.											ANKRD17,brain,primitive_neuroectodermal_tumour-medulloblastoma,0,1	ANKRD17	0	1	Substitution - Missense(1)	central_nervous_system(1)	c.C1184A						.						115.0	110.0	112.0					4																	74019647		2203	4300	6503	SO:0001583	missense	26057	exon6			GAATGCGTATTAA	AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.1184C>A	4.37:g.74019647G>T	ENSP00000351416:p.Thr395Lys	Somatic	70	0		WXS	Illumina HiSeq	.	35	2	NM_198889	E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Missense_Mutation	SNP	ENST00000358602.4	37	CCDS34004.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.847144	0.91277	.	.	ENSG00000132466	ENST00000358602;ENST00000426990;ENST00000330838;ENST00000509867;ENST00000411811	T;T;T	0.62105	0.05;0.05;0.05	4.95	4.95	0.65309	Ankyrin repeat-containing domain (3);	0.000000	0.64402	D	0.000007	T	0.68641	0.3023	L	0.28608	0.87	0.47183	D	0.999343	D;D;D;D	0.76494	0.998;0.999;0.999;0.999	D;D;D;D	0.87578	0.993;0.992;0.998;0.995	T	0.63413	-0.6643	10	0.16896	T	0.51	.	18.1916	0.89808	0.0:0.0:1.0:0.0	.	395;395;395;282	O75179-2;G5E964;O75179;E7EUV3	.;.;ANR17_HUMAN;.	K	395;395;395;282;395	ENSP00000351416:T395K;ENSP00000332265:T395K;ENSP00000427151:T282K	ENSP00000332265:T395K	T	-	2	0	ANKRD17	74238511	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.295000	0.77249	0.557000	0.71058	ACG	.		0.368	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362475.1	NM_032217	
TRIM5	85363	hgsc.bcm.edu	37	11	5686556	5686556	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr11:5686556G>T	ENST00000380034.3	-	8	1221	c.965C>A	c.(964-966)tCt>tAt	p.S322Y	TRIM5_ENST00000396847.3_3'UTR|TRIM5_ENST00000396853.4_Intron|TRIM5_ENST00000483835.1_5'UTR|TRIM5_ENST00000380027.1_Intron|TRIM5_ENST00000396855.3_Intron|TRIM5_ENST00000305836.5_Missense_Mutation_p.S322Y	NM_033034.2|NM_033092.2	NP_149023.2|NP_149083.2	Q9C035	TRIM5_HUMAN	tripartite motif containing 5	322	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				activation of innate immune response (GO:0002218)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein K63-linked ubiquitination (GO:0070534)|protein trimerization (GO:0070206)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|signaling pattern recognition receptor activity (GO:0008329)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)|Lung NSC(207;0.138)|all_lung(207;0.221)		Epithelial(150;7.21e-09)|BRCA - Breast invasive adenocarcinoma(625;0.139)		TGGTTTCGGAGAGCTCACTTG	0.413																																					p.S322Y		.											TRIM5_ENST00000380034,NS,carcinoma,0,2	TRIM5_ENST00000380034	0	0			c.C965A						.						71.0	70.0	70.0					11																	5686556		2201	4297	6498	SO:0001583	missense	85363	exon8			TTCGGAGAGCTCA	AF220025	CCDS31392.1, CCDS31393.1, CCDS31394.1	11p15	2014-06-03	2011-01-25		ENSG00000132256	ENSG00000132256		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16276	protein-coding gene	gene with protein product	"""tripartite motif protein TRIM5"", ""tripartite motif protein TRIM"""	608487	"""tripartite motif-containing 5"""			11331580	Standard	NM_033034		Approved	RNF88, TRIM5alpha	uc001mbm.2	Q9C035	OTTHUMG00000066893	ENST00000380034.3:c.965C>A	11.37:g.5686556G>T	ENSP00000369373:p.Ser322Tyr	Somatic	47	0		WXS	Illumina HiSeq	.	35	2	NM_033034	A6NGQ1|A8WFA8|D3DQS8|D3DQS9|G3GJY1|Q2MLV4|Q2MLV8|Q2MLV9|Q2MLW1|Q2MLW3|Q2MLW4|Q2MLW6|Q2MLW7|Q2MLX1|Q2MLX2|Q2MLX3|Q2MLX5|Q2MLY3|Q2MLY4|Q2V6Q6|Q6GX26|Q8WU46|Q96SR5|Q9C031|Q9C032|Q9C033|Q9C034	Missense_Mutation	SNP	ENST00000380034.3	37	CCDS31393.1	.	.	.	.	.	.	.	.	.	.	G	0.001	-3.391254	0.00014	.	.	ENSG00000132256	ENST00000305836;ENST00000380034	T;T	0.59502	0.26;0.26	0.158	-0.317	0.12736	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	3.715760	0.00616	N	0.000431	T	0.23649	0.0572	N	0.01515	-0.825	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32587	-0.9901	9	0.02654	T	1	.	.	.	.	.	322	Q9C035	TRIM5_HUMAN	Y	322	ENSP00000307031:S322Y;ENSP00000369373:S322Y	ENSP00000307031:S322Y	S	-	2	0	TRIM5	5643132	0.001000	0.12720	0.002000	0.10522	0.012000	0.07955	-0.320000	0.08028	-1.053000	0.03218	-1.043000	0.02367	TCT	.		0.413	TRIM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000143360.3	NM_033034	
GABRA4	2557	hgsc.bcm.edu	37	4	46930465	46930465	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr4:46930465G>T	ENST00000264318.3	-	9	2424	c.1442C>A	c.(1441-1443)tCa>tAa	p.S481*		NM_000809.3|NM_001204266.1|NM_001204267.1	NP_000800.2|NP_001191195.1|NP_001191196.1	P48169	GBRA4_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 4	481					central nervous system development (GO:0007417)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|regulation of response to drug (GO:2001023)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45					Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	CTGCAGTCTTGATCCAAACAC	0.498																																					p.S481X	Ovarian(6;283 369 8234 12290 33402)	.											.	.	.	0			c.C1442A						.						137.0	127.0	130.0					4																	46930465		2203	4300	6503	SO:0001587	stop_gained	2557	exon9			AGTCTTGATCCAA		CCDS3473.1	4p12	2012-06-22			ENSG00000109158	ENSG00000109158		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4078	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 4"""	137141				7607683	Standard	NM_000809		Approved		uc021xnz.1	P48169	OTTHUMG00000099431	ENST00000264318.3:c.1442C>A	4.37:g.46930465G>T	ENSP00000264318:p.Ser481*	Somatic	83	0		WXS	Illumina HiSeq	.	53	4	NM_000809	Q8IYR7	Nonsense_Mutation	SNP	ENST00000264318.3	37	CCDS3473.1	.	.	.	.	.	.	.	.	.	.	G	43	10.057640	0.99327	.	.	ENSG00000109158	ENST00000264318	.	.	.	5.82	5.82	0.92795	.	16.939900	0.00166	N	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.2702	0.87099	0.0:0.0:1.0:0.0	.	.	.	.	X	481	.	ENSP00000264318:S481X	S	-	2	0	GABRA4	46625222	1.000000	0.71417	1.000000	0.80357	0.059000	0.15707	8.476000	0.90421	2.765000	0.95021	0.650000	0.86243	TCA	.		0.498	GABRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216893.1		
ALS2CR11	151254	hgsc.bcm.edu	37	2	202359173	202359173	+	Intron	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr2:202359173G>T	ENST00000286195.3	-	14	1626				ALS2CR11_ENST00000439802.1_Intron|ALS2CR11_ENST00000482942.1_Intron|ALS2CR11_ENST00000439140.1_Missense_Mutation_p.L631I	NM_152525.5	NP_689738.3	Q53TS8	AL2SA_HUMAN	amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11											NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(11)|ovary(1)|skin(5)|urinary_tract(3)	33						ACATTTGGTAGATTTTCTTTT	0.353																																					p.L631I		.											ALS2CR11_ENST00000439140,NS,carcinoma,0,1	ALS2CR11_ENST00000439140	0	0			c.C1891A						.						132.0	105.0	113.0					2																	202359173		692	1591	2283	SO:0001627	intron_variant	151254	exon15			TTGGTAGATTTTC	AB053313	CCDS2349.1, CCDS54430.1, CCDS54428.1, CCDS54429.1	2q33	2007-12-07			ENSG00000155754	ENSG00000155754			14438	protein-coding gene	gene with protein product						11586298	Standard	NM_152525		Approved	FLJ25351	uc002uyf.3	Q53TS8	OTTHUMG00000132830	ENST00000286195.3:c.1581+1444C>A	2.37:g.202359173G>T		Somatic	76	0		WXS	Illumina HiSeq	.	47	3	NM_001168221	C9IZH7|E9PGG4|Q8NCN6|Q96LN4	Missense_Mutation	SNP	ENST00000286195.3	37	CCDS2349.1	.	.	.	.	.	.	.	.	.	.	G	14.82	2.648195	0.47258	.	.	ENSG00000155754	ENST00000439140	T	0.58506	0.33	4.98	1.05	0.20165	.	.	.	.	.	T	0.34308	0.0893	N	0.22421	0.69	0.09310	N	1	B	0.32031	0.352	B	0.30105	0.111	T	0.15607	-1.0431	9	0.27082	T	0.32	.	1.735	0.02940	0.1835:0.1747:0.4808:0.161	.	631	E9PGG4	.	I	631	ENSP00000409937:L631I	ENSP00000409937:L631I	L	-	1	2	ALS2CR11	202067418	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	0.002000	0.13061	0.076000	0.16826	0.650000	0.86243	CTA	.		0.353	ALS2CR11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256296.2	NM_152525	
GJA5	2702	hgsc.bcm.edu	37	1	147231066	147231066	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr1:147231066C>A	ENST00000271348.2	-	2	442	c.281G>T	c.(280-282)gGc>gTc	p.G94V	RP11-433J22.2_ENST00000428911.1_RNA|GJA5_ENST00000369237.1_Missense_Mutation_p.G94V	NM_005266.5	NP_005257.2	P36382	CXA5_HUMAN	gap junction protein, alpha 5, 40kDa	94					angiogenesis (GO:0001525)|artery morphogenesis (GO:0048844)|atrial cardiac muscle cell action potential (GO:0086014)|atrial septum development (GO:0003283)|AV node cell to bundle of His cell communication by electrical coupling (GO:0086053)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|gap junction assembly (GO:0016264)|mitral valve development (GO:0003174)|outflow tract morphogenesis (GO:0003151)|pulmonary valve formation (GO:0003193)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|transmembrane transport (GO:0055085)|ventricular septum development (GO:0003281)	connexon complex (GO:0005922)|gap junction (GO:0005921)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)	gap junction channel activity involved in AV node cell-bundle of His cell electrical coupling (GO:0086077)|gap junction channel activity involved in cardiac conduction electrical coupling (GO:0086075)|gap junction hemi-channel activity (GO:0055077)	p.G94A(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	20	all_hematologic(923;0.0276)		LUSC - Lung squamous cell carcinoma(543;0.202)			CATGGCGTGGCCCATGTACAC	0.607																																					p.G94V		.											GJA5,NS,carcinoma,0,1	GJA5	0	1	Substitution - Missense(1)	breast(1)	c.G281T						.						131.0	113.0	119.0					1																	147231066		2203	4300	6503	SO:0001583	missense	2702	exon2			GCGTGGCCCATGT		CCDS929.1	1q21.1	2008-02-05	2007-01-16		ENSG00000143140	ENSG00000265107		"""Ion channels / Gap junction proteins (connexins)"""	4279	protein-coding gene	gene with protein product	"""connexin 40"""	121013	"""gap junction protein, alpha 5, 40kD (connexin 40)"", ""gap junction protein, alpha 5, 40kDa (connexin 40)"""				Standard	NM_005266		Approved	CX40	uc001eps.1	P36382	OTTHUMG00000014020	ENST00000271348.2:c.281G>T	1.37:g.147231066C>A	ENSP00000271348:p.Gly94Val	Somatic	29	0		WXS	Illumina HiSeq	.	29	2	NM_005266	Q5T3B6|Q5U0N6	Missense_Mutation	SNP	ENST00000271348.2	37	CCDS929.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.381615	0.82792	.	.	ENSG00000143140	ENST00000271348;ENST00000369237;ENST00000430508	D;D;D	0.99070	-5.39;-5.39;-5.39	5.53	4.61	0.57282	Connexin, N-terminal (1);	0.097311	0.64402	D	0.000001	D	0.98839	0.9608	L	0.57536	1.79	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	D	0.99861	1.1083	10	0.87932	D	0	.	15.7517	0.77992	0.1377:0.8623:0.0:0.0	.	94	P36382	CXA5_HUMAN	V	94	ENSP00000271348:G94V;ENSP00000358240:G94V;ENSP00000407645:G94V	ENSP00000271348:G94V	G	-	2	0	GJA5	145697690	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.907000	0.63300	1.306000	0.44926	0.563000	0.77884	GGC	.		0.607	GJA5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039422.2	NM_181703	
CAPN14	440854	hgsc.bcm.edu	37	2	31428272	31428272	+	Silent	SNP	C	C	T	rs374924641		TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr2:31428272C>T	ENST00000403897.3	-	2	183	c.42G>A	c.(40-42)gcG>gcA	p.A14A	CAPN14_ENST00000444918.2_Silent_p.A14A	NM_001145122.1	NP_001138594.1	A8MX76	CAN14_HUMAN	calpain 14	14					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)	p.A14A(1)		NS(1)|endometrium(2)|prostate(1)|skin(1)|stomach(2)	7						AGTACCTTGGCGCCAGCTTCC	0.572													C|||	1	0.000199681	0.0	0.0	5008	,	,		18353	0.0		0.001	False		,,,				2504	0.0				p.A14A		.											CAPN14,NS,carcinoma,0,1	CAPN14	0	1	Substitution - coding silent(1)	endometrium(1)	c.G42A						.	C		0,1384		0,0,692	54.0	58.0	57.0		42	-1.6	0.0	2		57	1,3181		0,1,1590	no	coding-synonymous	CAPN14	NM_001145122.1		0,1,2282	TT,TC,CC		0.0314,0.0,0.0219		14/685	31428272	1,4565	692	1591	2283	SO:0001819	synonymous_variant	440854	exon2			CCTTGGCGCCAGC	AC015980	CCDS46254.1	2p23.1-p21	2013-01-10			ENSG00000214711	ENSG00000214711		"""EF-hand domain containing"""	16664	protein-coding gene	gene with protein product		610229				11675017	Standard	NM_001145122		Approved		uc010yms.2	A8MX76	OTTHUMG00000152039	ENST00000403897.3:c.42G>A	2.37:g.31428272C>T		Somatic	58	0		WXS	Illumina HiSeq	.	38	2	NM_001145122	B3KRU9	Silent	SNP	ENST00000403897.3	37	CCDS46254.1																																																																																			.		0.572	CAPN14-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325010.1	NM_001145122	
BIRC6	57448	hgsc.bcm.edu	37	2	32774511	32774511	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr2:32774511C>T	ENST00000421745.2	+	65	13241	c.13107C>T	c.(13105-13107)ctC>ctT	p.L4369L		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	4369					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)	p.L4341L(1)|p.L4369L(1)		NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					AGTCCTGCCTCATCCCAGCCA	0.418																																					p.L4369L	Pancreas(94;175 1509 16028 18060 45422)	.											BIRC6_ENST00000421745,NS,carcinoma,0,2	BIRC6_ENST00000421745	0	2	Substitution - coding silent(2)	lung(2)	c.C13107T						.						130.0	121.0	124.0					2																	32774511		2203	4300	6503	SO:0001819	synonymous_variant	57448	exon65			CTGCCTCATCCCA	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.13107C>T	2.37:g.32774511C>T		Somatic	51	0		WXS	Illumina HiSeq	.	47	2	NM_016252	Q9ULD1	Silent	SNP	ENST00000421745.2	37	CCDS33175.2																																																																																			.		0.418	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
COL6A3	1293	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	238268788	238268788	+	Silent	SNP	C	C	T	rs368711215		TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr2:238268788C>T	ENST00000295550.4	-	17	6677	c.6225G>A	c.(6223-6225)ccG>ccA	p.P2075P	COL6A3_ENST00000409809.1_Silent_p.P1869P|COL6A3_ENST00000353578.4_Silent_p.P1869P|COL6A3_ENST00000472056.1_Silent_p.P1468P|COL6A3_ENST00000346358.4_Silent_p.P1875P|COL6A3_ENST00000347401.3_Silent_p.P1874P	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2075	Collagen-like 1.|Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.P2075P(1)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TCACACCAGGCGGACCACGCT	0.602													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19799	0.0		0.0	False		,,,				2504	0.0				p.P2075P		.											COL6A3,colon,carcinoma,0,1	COL6A3	0	1	Substitution - coding silent(1)	large_intestine(1)	c.G6225A						.	C	,,	1,4405	2.1+/-5.4	0,1,2202	166.0	126.0	139.0		6225,4404,5607	-10.7	0.0	2		139	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	COL6A3	NM_004369.3,NM_057166.4,NM_057167.3	,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,	2075/3178,1468/2571,1869/2972	238268788	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	1293	exon17			ACCAGGCGGACCA	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.6225G>A	2.37:g.238268788C>T		Somatic	35	0		WXS	Illumina HiSeq	.	33	6	NM_004369	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Silent	SNP	ENST00000295550.4	37	CCDS33412.1																																																																																			.		0.602	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
PRB2	653247	hgsc.bcm.edu	37	12	11546444	11546444	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr12:11546444G>T	ENST00000389362.4	-	3	603	c.568C>A	c.(568-570)Cag>Aag	p.Q190K	PRB1_ENST00000546254.1_Intron|PRB2_ENST00000545829.1_5'Flank	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	190	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-P-Q-G-[GD]-[NKS]-[KSQ]- [PRS]-[QRS] [GPS]-[PSAR]-[PSR].					extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			CCTTGGGGCTGGTTGCCTCCT	0.597																																					p.Q190K		.											.	.	.	0			c.C568A						.						142.0	142.0	142.0					12																	11546444		2163	4271	6434	SO:0001583	missense	653247	exon3			GGGGCTGGTTGCC	K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.568C>A	12.37:g.11546444G>T	ENSP00000374013:p.Gln190Lys	Somatic	105	1		WXS	Illumina HiSeq	.	122	6	NM_006248	O00599|P02811|P04281	Missense_Mutation	SNP	ENST00000389362.4	37	CCDS41757.2	.	.	.	.	.	.	.	.	.	.	.	0.331	-0.956317	0.02267	.	.	ENSG00000121335	ENST00000389362	T	0.04862	3.54	1.56	0.541	0.17168	.	0.679913	0.10184	U	0.705525	T	0.02848	0.0085	N	0.12182	0.205	0.09310	N	1	B	0.19331	0.035	B	0.06405	0.002	T	0.45411	-0.9263	10	0.02654	T	1	.	7.2338	0.26057	0.0:0.0:0.7355:0.2645	.	190	P02812	PRB2_HUMAN	K	190	ENSP00000374013:Q190K	ENSP00000374013:Q190K	Q	-	1	0	PRB2	11437711	0.000000	0.05858	0.000000	0.03702	0.611000	0.37282	-2.656000	0.00854	-0.031000	0.13781	-1.143000	0.01870	CAG	.		0.597	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346925.2	NM_006248	
ARHGAP44	9912	hgsc.bcm.edu	37	17	12852466	12852466	+	Nonsense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr17:12852466C>T	ENST00000379672.5	+	11	1171	c.871C>T	c.(871-873)Cga>Tga	p.R291*	ARHGAP44_ENST00000340825.3_Nonsense_Mutation_p.R291*|ARHGAP44_ENST00000262444.9_Nonsense_Mutation_p.R291*	NM_014859.4	NP_055674.4	Q17R89	RHG44_HUMAN	Rho GTPase activating protein 44	291	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				exocytosis (GO:0006887)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endosome (GO:0005768)|leading edge membrane (GO:0031256)|synapse (GO:0045202)	GTPase activator activity (GO:0005096)|phospholipid binding (GO:0005543)	p.R291*(1)		NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(7)|skin(1)|urinary_tract(1)	31						GGGACTCTTCCGAGTAGCCCC	0.577																																					p.R291X		.											ARHGAP44,extremity,malignant_melanoma,0,1	ARHGAP44	0	1	Substitution - Nonsense(1)	skin(1)	c.C871T						.						29.0	30.0	30.0					17																	12852466		2084	4198	6282	SO:0001587	stop_gained	9912	exon11			CTCTTCCGAGTAG		CCDS45616.1	17p12	2011-06-29			ENSG00000006740	ENSG00000006740		"""Rho GTPase activating proteins"""	29096	protein-coding gene	gene with protein product						19273615	Standard	NM_014859		Approved	KIAA0672, RICH-2, RICH2	uc002gnr.4	Q17R89	OTTHUMG00000058765	ENST00000379672.5:c.871C>T	17.37:g.12852466C>T	ENSP00000368994:p.Arg291*	Somatic	41	0		WXS	Illumina HiSeq	.	52	3	NM_014859	A6NCP5|A8MQB2|O75160|Q7Z5Z7|Q9Y4Q4	Nonsense_Mutation	SNP	ENST00000379672.5	37	CCDS45616.1	.	.	.	.	.	.	.	.	.	.	C	38	7.276385	0.98182	.	.	ENSG00000006740	ENST00000379672;ENST00000340825;ENST00000538915	.	.	.	5.74	4.7	0.59300	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.0798	0.72106	0.1514:0.8486:0.0:0.0	.	.	.	.	X	291;291;14	.	ENSP00000342566:R291X	R	+	1	2	ARHGAP44	12793191	0.988000	0.35896	1.000000	0.80357	0.960000	0.62799	0.388000	0.20735	2.718000	0.92993	0.637000	0.83480	CGA	.		0.577	ARHGAP44-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441566.1	NM_014859	
TDH	157739	hgsc.bcm.edu	37	8	11213601	11213601	+	RNA	SNP	C	C	T	rs75194683|rs33952720|rs3021508	byFrequency	TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr8:11213601C>T	ENST00000534302.1	+	0	171									L-threonine dehydrogenase (pseudogene)																		TAACTCTGCTCTTTTCTCACA	0.468																																					.		.											.	.	.	0			.						.																																					157739	.			TCTGCTCTTTTCT	AJ301562		8p23.1	2013-09-26	2013-09-26		ENSG00000154316	ENSG00000154316		"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	15547	pseudogene	pseudogene	"""short chain dehydrogenase/reductase family 14E, member 1 (pseudogene)"""	615174	"""L-threonine dehydrogenase"""			11896452, 12361482, 19027726	Standard	NR_001578		Approved	FLJ25033, SDR14E1P	uc003wtq.1	Q8IZJ6	OTTHUMG00000165365		8.37:g.11213601C>T		Somatic	97	0		WXS	Illumina HiSeq	.	76	0	.		RNA	SNP	ENST00000534302.1	37																																																																																				.		0.468	TDH-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000385807.1	NM_152566	
POLR2F	5435	hgsc.bcm.edu	37	22	38363154	38363154	+	Silent	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr22:38363154G>T	ENST00000442738.2	+	4	395	c.270G>T	c.(268-270)ctG>ctT	p.L90L	POLR2F_ENST00000460648.1_Silent_p.L66L|POLR2F_ENST00000470701.1_Silent_p.L85L|POLR2F_ENST00000488684.1_3'UTR|POLR2F_ENST00000407936.1_Silent_p.L90L|POLR2F_ENST00000606538.1_Silent_p.L90L|POLR2F_ENST00000405557.1_Silent_p.L90L	NM_021974.3	NP_068809.1	P61218	RPAB2_HUMAN	polymerase (RNA) II (DNA directed) polypeptide F	90					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of type I interferon production (GO:0032481)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase II, core complex (GO:0005665)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			breast(1)|urinary_tract(2)	3	Melanoma(58;0.045)					CAGATCCTCTGCTCATTGCCA	0.527																																					p.L90L		.											POLR2F,NS,carcinoma,0,1	POLR2F	0	0			c.G270T						.						190.0	146.0	161.0					22																	38363154		2203	4300	6503	SO:0001819	synonymous_variant	5435	exon4			TCCTCTGCTCATT		CCDS13963.1	22q13.1	2013-01-21			ENSG00000100142	ENSG00000100142		"""RNA polymerase subunits"""	9193	protein-coding gene	gene with protein product	"""DNA directed RNA polymerase II 14.4 kda polypeptide"""	604414				8786150	Standard	XR_112241		Approved	RPB6, HRBP14.4	uc010gxi.3	P61218	OTTHUMG00000151160	ENST00000442738.2:c.270G>T	22.37:g.38363154G>T		Somatic	49	0		WXS	Illumina HiSeq	.	40	2	NM_021974	P41584|Q6IAY3	Silent	SNP	ENST00000442738.2	37	CCDS13963.1																																																																																			.		0.527	POLR2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321570.1	NM_021974	
TYR	7299	hgsc.bcm.edu	37	11	89017970	89017970	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr11:89017970G>A	ENST00000263321.5	+	4	1716	c.1214G>A	c.(1213-1215)cGt>cAt	p.R405H		NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	405			R -> L (in OCA1A). {ECO:0000269|PubMed:15146472}.		cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	CGAAGGCACCGTCCTCTTCAA	0.383																																					p.R405H		.											.	.	.	0			c.G1214A	GRCh37	CM041480	TYR	M		.						65.0	66.0	65.0					11																	89017970		2201	4299	6500	SO:0001583	missense	7299	exon4			GGCACCGTCCTCT	M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.1214G>A	11.37:g.89017970G>A	ENSP00000263321:p.Arg405His	Somatic	93	0		WXS	Illumina HiSeq	.	96	5	NM_000372	Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Missense_Mutation	SNP	ENST00000263321.5	37	CCDS8284.1	.	.	.	.	.	.	.	.	.	.	G	9.367	1.069557	0.20147	.	.	ENSG00000077498	ENST00000263321	D	0.98862	-5.19	4.68	-0.449	0.12226	Uncharacterised domain, di-copper centre (2);	0.493212	0.19908	N	0.103354	D	0.95182	0.8438	N	0.22421	0.69	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	D	0.84679	0.0716	9	.	.	.	.	15.3426	0.74309	0.1635:0.0:0.8365:0.0	.	405	P14679	TYRO_HUMAN	H	405	ENSP00000263321:R405H	.	R	+	2	0	TYR	88657618	0.015000	0.18098	0.017000	0.16124	0.879000	0.50718	1.025000	0.30090	-0.284000	0.09102	-1.164000	0.01763	CGT	.		0.383	TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394045.2	NM_000372	
DSE	29940	hgsc.bcm.edu	37	6	116756770	116756770	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr6:116756770C>T	ENST00000331677.3	+	7	1583	c.1139C>T	c.(1138-1140)tCg>tTg	p.S380L	DSE_ENST00000359564.2_Missense_Mutation_p.S380L|DSE_ENST00000537543.1_Missense_Mutation_p.S399L|DSE_ENST00000452085.3_Missense_Mutation_p.S380L			Q9UL01	DSE_HUMAN	dermatan sulfate epimerase	380					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin-glucuronate 5-epimerase activity (GO:0047757)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		AGCTTGAAATCGGTTCCTCCT	0.398																																					p.S380L		.											DSE,NS,carcinoma,0,1	DSE	0	0			c.C1139T						.						83.0	83.0	83.0					6																	116756770		2203	4300	6503	SO:0001583	missense	29940	exon6			TGAAATCGGTTCC	AF098066	CCDS5107.1	6q22	2008-02-05	2007-01-29	2007-01-29	ENSG00000111817	ENSG00000111817	5.1.3.19		21144	protein-coding gene	gene with protein product		605942	"""squamous cell carcinoma antigen recognized by T cells 2"""	SART2		11920522, 16505484	Standard	NM_001080976		Approved	DSEPI	uc003pws.3	Q9UL01	OTTHUMG00000015434	ENST00000331677.3:c.1139C>T	6.37:g.116756770C>T	ENSP00000332151:p.Ser380Leu	Somatic	39	0		WXS	Illumina HiSeq	.	54	3	NM_001080976	Q5R3K6	Missense_Mutation	SNP	ENST00000331677.3	37	CCDS5107.1	.	.	.	.	.	.	.	.	.	.	C	13.35	2.210325	0.39003	.	.	ENSG00000111817	ENST00000452085;ENST00000537543;ENST00000331677;ENST00000359564	T;T;T;T	0.18502	2.21;2.21;2.21;2.21	5.99	5.99	0.97316	.	0.229512	0.46442	D	0.000286	T	0.05914	0.0154	N	0.19112	0.55	0.45648	D	0.998577	B;B	0.17268	0.021;0.021	B;B	0.15870	0.014;0.009	T	0.22138	-1.0225	10	0.32370	T	0.25	-10.5375	14.6024	0.68450	0.0:0.931:0.0:0.069	.	399;380	B7Z765;Q9UL01	.;DSE_HUMAN	L	380;399;380;380	ENSP00000404049:S380L;ENSP00000441152:S399L;ENSP00000332151:S380L;ENSP00000352567:S380L	ENSP00000332151:S380L	S	+	2	0	DSE	116863463	0.982000	0.34865	0.997000	0.53966	0.999000	0.98932	4.924000	0.63418	2.840000	0.97914	0.655000	0.94253	TCG	.		0.398	DSE-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041940.2	NM_013352	
OR51F2	119694	hgsc.bcm.edu	37	11	4842747	4842747	+	Silent	SNP	T	T	C			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr11:4842747T>C	ENST00000322110.5	+	1	197	c.132T>C	c.(130-132)ccT>ccC	p.P44P	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001004753.1	NP_001004753.1	Q8NH61	O51F2_HUMAN	olfactory receptor, family 51, subfamily F, member 2	44						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P44P(1)		breast(2)|endometrium(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		TCTCCATCCCTTTTTGTCTCC	0.483																																					p.P44P		.											OR51F2,NS,carcinoma,0,1	OR51F2	0	1	Substitution - coding silent(1)	lung(1)	c.T132C						.						274.0	271.0	272.0					11																	4842747		2201	4298	6499	SO:0001819	synonymous_variant	119694	exon1			CATCCCTTTTTGT	BK004281	CCDS31361.1	11p15.4	2012-08-09			ENSG00000176925	ENSG00000176925		"""GPCR / Class A : Olfactory receptors"""	15197	protein-coding gene	gene with protein product							Standard	NM_001004753		Approved		uc010qyn.2	Q8NH61	OTTHUMG00000066508	ENST00000322110.5:c.132T>C	11.37:g.4842747T>C		Somatic	55	0		WXS	Illumina HiSeq	.	48	2	NM_001004753	Q6IFI1	Silent	SNP	ENST00000322110.5	37	CCDS31361.1																																																																																			.		0.483	OR51F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142181.1	NM_001004753	
ADCY10	55811	hgsc.bcm.edu;bcgsc.ca	37	1	167779005	167779005	+	Missense_Mutation	SNP	C	C	A	rs267598153		TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr1:167779005C>A	ENST00000367851.4	-	33	4927	c.4743G>T	c.(4741-4743)tgG>tgT	p.W1581C	ADCY10_ENST00000367848.1_Missense_Mutation_p.W1489C|ADCY10_ENST00000545172.1_Missense_Mutation_p.W1428C	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	1581					cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						CAATTTTTTCCCATGATGGGA	0.388																																					p.W1581C		.											.	.	.	0			c.G4743T						.						134.0	126.0	129.0					1																	167779005		2203	4300	6503	SO:0001583	missense	55811	exon33			TTTTTCCCATGAT	AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.4743G>T	1.37:g.167779005C>A	ENSP00000356825:p.Trp1581Cys	Somatic	62	0		WXS	Illumina HiSeq	.	74	4	NM_018417	B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Missense_Mutation	SNP	ENST00000367851.4	37	CCDS1265.1	.	.	.	.	.	.	.	.	.	.	C	14.07	2.425151	0.43020	.	.	ENSG00000143199	ENST00000545172;ENST00000367851;ENST00000367848	T;T;T	0.61158	0.13;0.18;0.16	5.54	5.54	0.83059	.	0.000000	0.51477	D	0.000096	T	0.68860	0.3047	M	0.65975	2.015	0.36087	D	0.843187	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.72734	-0.4204	9	0.72032	D	0.01	-12.7663	14.9801	0.71306	0.0:1.0:0.0:0.0	.	1489;1581	Q96PN6-2;Q96PN6	.;ADCYA_HUMAN	C	1428;1581;1489	ENSP00000441992:W1428C;ENSP00000356825:W1581C;ENSP00000356822:W1489C	ENSP00000356822:W1489C	W	-	3	0	ADCY10	166045629	1.000000	0.71417	0.992000	0.48379	0.106000	0.19336	3.618000	0.54188	2.606000	0.88127	0.655000	0.94253	TGG	.		0.388	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083663.1	NM_018417	
TRPM5	29850	hgsc.bcm.edu	37	11	2443523	2443523	+	Missense_Mutation	SNP	G	G	T	rs200361945		TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr11:2443523G>T	ENST00000155858.6	-	2	154	c.146C>A	c.(145-147)cCg>cAg	p.P49Q	TRPM5_ENST00000528453.1_Missense_Mutation_p.P49Q|TRPM5_ENST00000533060.1_Missense_Mutation_p.P49Q|TRPM5_ENST00000452833.1_Missense_Mutation_p.P49Q	NM_014555.3	NP_055370.1			transient receptor potential cation channel, subfamily M, member 5											breast(1)|central_nervous_system(1)|endometrium(4)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	23		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		GAGCACAGACGGGGCCACTCC	0.662																																					p.P49Q	NSCLC(1;49 61 17205 18850 43201)	.											TRPM5,bladder,carcinoma,0,1	TRPM5	0	0			c.C146A						.						48.0	51.0	50.0					11																	2443523		2199	4299	6498	SO:0001583	missense	29850	exon2			ACAGACGGGGCCA	AF177473	CCDS31340.1	11p15.5	2011-12-14			ENSG00000070985	ENSG00000070985		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	14323	protein-coding gene	gene with protein product		604600				10607831, 16382100	Standard	NM_014555		Approved	LTRPC5, MTR1	uc001lwm.4	Q9NZQ8	OTTHUMG00000009896	ENST00000155858.6:c.146C>A	11.37:g.2443523G>T	ENSP00000155858:p.Pro49Gln	Somatic	53	0		WXS	Illumina HiSeq	.	49	3	NM_014555		Missense_Mutation	SNP	ENST00000155858.6	37	CCDS31340.1	.	.	.	.	.	.	.	.	.	.	g	14.84	2.654425	0.47467	.	.	ENSG00000070985	ENST00000533881;ENST00000155858;ENST00000452833;ENST00000533060;ENST00000528453;ENST00000437542	D;D;D;D;D	0.83250	-1.7;-1.7;-1.7;-1.7;-1.7	2.64	2.64	0.31445	.	0.000000	0.64402	U	0.000014	D	0.89339	0.6687	M	0.80616	2.505	0.40030	D	0.97552	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.89767	0.3951	10	0.87932	D	0	-15.2711	8.9439	0.35747	0.0:0.0:1.0:0.0	.	49;49;49	E9PRW0;Q9NZQ8-2;Q9NZQ8	.;.;TRPM5_HUMAN	Q	41;49;49;49;49;49	ENSP00000434383:P41Q;ENSP00000155858:P49Q;ENSP00000387965:P49Q;ENSP00000434121:P49Q;ENSP00000436809:P49Q	ENSP00000155858:P49Q	P	-	2	0	TRPM5	2400099	1.000000	0.71417	0.985000	0.45067	0.063000	0.16089	2.906000	0.48735	1.810000	0.52873	0.586000	0.80456	CCG	.		0.662	TRPM5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000027378.1	NM_014555	
PARD3	56288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	34671618	34671618	+	Missense_Mutation	SNP	A	A	C			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr10:34671618A>C	ENST00000374789.3	-	9	1574	c.1249T>G	c.(1249-1251)Tct>Gct	p.S417A	PARD3_ENST00000340077.5_Missense_Mutation_p.S417A|PARD3_ENST00000545693.1_Missense_Mutation_p.S417A|PARD3_ENST00000374790.3_Missense_Mutation_p.S373A|PARD3_ENST00000350537.4_Missense_Mutation_p.S417A|PARD3_ENST00000374773.1_Missense_Mutation_p.S417A|PARD3_ENST00000544292.1_Missense_Mutation_p.S147A|PARD3_ENST00000374788.3_Missense_Mutation_p.S417A|PARD3_ENST00000374776.1_Missense_Mutation_p.S417A|PARD3_ENST00000545260.1_Missense_Mutation_p.S373A|PARD3_ENST00000346874.4_Missense_Mutation_p.S417A|PARD3_ENST00000374794.3_Missense_Mutation_p.S373A	NM_019619.3	NP_062565.2	Q8TEW0	PARD3_HUMAN	par-3 family cell polarity regulator	417					apical constriction (GO:0003383)|asymmetric cell division (GO:0008356)|axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|centrosome localization (GO:0051642)|establishment of epithelial cell polarity (GO:0090162)|establishment or maintenance of cell polarity (GO:0007163)|microtubule cytoskeleton organization (GO:0000226)|myelination in peripheral nervous system (GO:0022011)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein targeting to membrane (GO:0006612)|regulation of actin filament-based process (GO:0032970)|regulation of cellular localization (GO:0060341)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing, spreading of cells (GO:0044319)	apical part of cell (GO:0045177)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|internode region of axon (GO:0033269)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|tight junction (GO:0005923)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	63		Breast(68;0.0707)				CTTGAGTGAGAGTCTATCTGC	0.552																																					p.S417A		.											.	.	.	0			c.T1249G						.						162.0	122.0	135.0					10																	34671618		2203	4300	6503	SO:0001583	missense	56288	exon9			AGTGAGAGTCTAT	AF252293	CCDS7178.1, CCDS53509.1, CCDS53510.1, CCDS53511.1, CCDS53512.1, CCDS53513.1, CCDS53514.1, CCDS53515.1, CCDS53516.1	10p11.22	2014-06-13	2013-08-28		ENSG00000148498	ENSG00000148498			16051	protein-coding gene	gene with protein product	"""atypical PKC isotype-specific interacting protein"", ""par-3 family cell polarity regulator alpha"", ""protein phosphatase 1, regulatory subunit 118"""	606745	"""par-3 (partitioning defective 3, C.elegans) homolog"", ""par-3 partitioning defective 3 homolog (C. elegans)"""			10934474	Standard	NM_001184790		Approved	PAR3, PARD3A, Bazooka, Baz, ASIP, PPP1R118	uc010qej.2	Q8TEW0	OTTHUMG00000017948	ENST00000374789.3:c.1249T>G	10.37:g.34671618A>C	ENSP00000363921:p.Ser417Ala	Somatic	58	0		WXS	Illumina HiSeq	.	41	6	NM_001184788	F5H5T0|Q5T2U1|Q5VUA2|Q5VUA3|Q5VWV0|Q5VWV1|Q5VWV3|Q5VWV4|Q5VWV5|Q6IQ47|Q8TCZ9|Q8TEW1|Q8TEW2|Q8TEW3|Q96K28|Q96RM6|Q96RM7|Q9BY57|Q9BY58|Q9HC48|Q9NWL4|Q9NYE6	Missense_Mutation	SNP	ENST00000374789.3	37	CCDS7178.1	.	.	.	.	.	.	.	.	.	.	A	11.73	1.724416	0.30593	.	.	ENSG00000148498	ENST00000545693;ENST00000545260;ENST00000374789;ENST00000374788;ENST00000346874;ENST00000374794;ENST00000350537;ENST00000374790;ENST00000374776;ENST00000340077;ENST00000374773;ENST00000544292	T;T;T;T;T;T;T;T;T;T;T;T	0.18016	2.62;2.65;2.67;2.66;2.68;2.66;2.63;2.65;2.29;2.24;2.34;2.32	5.69	-5.78	0.02362	.	0.794445	0.11942	N	0.514622	T	0.07503	0.0189	L	0.31294	0.92	0.27250	N	0.958907	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.06786	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.001;0.001;0.0;0.001;0.0	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.10450	0.002;0.002;0.003;0.002;0.003;0.002;0.002;0.001;0.001;0.001;0.001;0.002;0.003;0.002;0.005	T	0.41124	-0.9526	10	0.11485	T	0.65	.	3.0567	0.06187	0.4953:0.2142:0.2034:0.0871	.	373;373;417;417;417;417;417;417;373;417;417;417;417;417;147	Q8TEW0-5;Q8TEW0-3;Q8TEW0-7;Q8TEW0-6;F5H5T0;Q8TEW0-4;Q8TEW0-2;Q8TEW0;Q5VWV2;Q6IQ47;Q5VWU8;Q8TEW0-8;Q8TEW0-9;Q8TEW0-10;F5GZI3	.;.;.;.;.;.;.;PARD3_HUMAN;.;.;.;.;.;.;.	A	417;373;417;417;417;373;417;373;417;417;417;147	ENSP00000443147:S417A;ENSP00000440857:S373A;ENSP00000363921:S417A;ENSP00000363920:S417A;ENSP00000340591:S417A;ENSP00000363926:S373A;ENSP00000311986:S417A;ENSP00000363922:S373A;ENSP00000363908:S417A;ENSP00000341844:S417A;ENSP00000363905:S417A;ENSP00000444429:S147A	ENSP00000341844:S417A	S	-	1	0	PARD3	34711624	0.906000	0.30813	0.000000	0.03702	0.934000	0.57294	0.008000	0.13197	-1.419000	0.02012	0.533000	0.62120	TCT	.		0.552	PARD3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047527.1	NM_019619	
ENGASE	64772	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	77073889	77073889	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr17:77073889G>A	ENST00000579016.1	+	3	359	c.359G>A	c.(358-360)aGc>aAc	p.S120N	ENGASE_ENST00000539857.2_5'UTR	NM_001042573.2	NP_001036038.1	Q8NFI3	ENASE_HUMAN	endo-beta-N-acetylglucosaminidase	120						cytoplasm (GO:0005737)	mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase activity (GO:0033925)			breast(2)|endometrium(4)|large_intestine(1)|lung(15)|prostate(2)|skin(1)	25						CCTCTGAGCAGCCAGAGGCCC	0.587																																					p.S120N		.											.	.	.	0			c.G359A						.						38.0	40.0	40.0					17																	77073889		1922	4129	6051	SO:0001583	missense	64772	exon3			TGAGCAGCCAGAG	AF512564	CCDS42394.1	17q25.3	2009-03-03			ENSG00000167280	ENSG00000167280	3.2.1.96		24622	protein-coding gene	gene with protein product	"""Mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase"", ""Di-N-acetylchitobiosyl beta-N-acetylglucosaminidase"""	611898				12114544, 18586680	Standard	NM_001042573		Approved	FLJ21865	uc002jwv.4	Q8NFI3	OTTHUMG00000167714	ENST00000579016.1:c.359G>A	17.37:g.77073889G>A	ENSP00000462333:p.Ser120Asn	Somatic	20	0		WXS	Illumina HiSeq	.	26	8	NM_001042573	Q659F0|Q8TB86|Q9H6U4	Missense_Mutation	SNP	ENST00000579016.1	37	CCDS42394.1	.	.	.	.	.	.	.	.	.	.	G	13.43	2.233548	0.39498	.	.	ENSG00000167280	ENST00000311595;ENST00000545583	.	.	.	4.92	3.91	0.45181	.	0.126919	0.64402	D	0.000001	T	0.54806	0.1881	M	0.68593	2.085	0.80722	D	1	P;B	0.37781	0.608;0.232	B;B	0.35550	0.205;0.113	T	0.62201	-0.6904	9	0.46703	T	0.11	-16.7758	14.5977	0.68419	0.0:0.0:0.8537:0.1463	.	120;120	Q8NFI3;Q8NFI3-3	ENASE_HUMAN;.	N	120	.	ENSP00000308158:S120N	S	+	2	0	ENGASE	74585484	1.000000	0.71417	0.996000	0.52242	0.843000	0.47879	3.425000	0.52771	2.260000	0.74910	0.563000	0.77884	AGC	.		0.587	ENGASE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395807.1	NM_022759	
HNRNPK	3190	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	86592623	86592623	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr9:86592623C>T	ENST00000376264.2	-	4	395	c.137G>A	c.(136-138)cGc>cAc	p.R46H	HNRNPK_ENST00000360384.5_Missense_Mutation_p.R46H|RP11-575L7.8_ENST00000448389.1_RNA|HNRNPK_ENST00000376263.3_Missense_Mutation_p.R46H|HNRNPK_ENST00000351839.3_Missense_Mutation_p.R46H|HNRNPK_ENST00000376281.4_Missense_Mutation_p.R46H	NM_002140.3|NM_031262.2	NP_002131.2|NP_112552.1	P61978	HNRPK_HUMAN	heterogeneous nuclear ribonucleoprotein K	46	Interaction with ASFV p30.|KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.|Necessary for interaction with DDX1.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of lipid transport by positive regulation of transcription from RNA polymerase II promoter (GO:0072369)|regulation of low-density lipoprotein particle clearance (GO:0010988)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|single-stranded DNA binding (GO:0003697)			endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|skin(1)|stomach(1)	19						AAGCAGAATGCGTAATTCAAC	0.353																																					p.R46H		.											.	.	.	0			c.G137A						.						74.0	71.0	72.0					9																	86592623		2202	4299	6501	SO:0001583	missense	3190	exon4			AGAATGCGTAATT		CCDS6667.1, CCDS6668.1	9q21.32-q21.33	2011-10-24		2008-04-18	ENSG00000165119	ENSG00000165119			5044	protein-coding gene	gene with protein product	"""transformation upregulated nuclear protein"""	600712		HNRPK		8107114	Standard	NM_031263		Approved	CSBP, TUNP	uc004anf.4	P61978	OTTHUMG00000020107	ENST00000376264.2:c.137G>A	9.37:g.86592623C>T	ENSP00000365440:p.Arg46His	Somatic	37	0		WXS	Illumina HiSeq	.	30	5	NM_031262	Q07244|Q15671|Q59F98|Q5T6W4|Q60577|Q922Y7|Q96J62	Missense_Mutation	SNP	ENST00000376264.2	37	CCDS6667.1	.	.	.	.	.	.	.	.	.	.	C	18.87	3.714936	0.68844	.	.	ENSG00000165119	ENST00000376281;ENST00000376264;ENST00000376263;ENST00000376268;ENST00000351839;ENST00000435158;ENST00000360384;ENST00000376258;ENST00000457156	T;T;T;T;T;T	0.35973	1.28;1.28;1.28;1.28;1.28;1.28	5.03	5.03	0.67393	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.000000	0.85682	D	0.000000	T	0.46678	0.1405	M	0.83774	2.66	0.80722	D	1	B;B;B;B;B;B;B;B	0.24823	0.0;0.112;0.002;0.002;0.006;0.001;0.001;0.007	B;B;B;B;B;B;B;B	0.20955	0.001;0.032;0.001;0.002;0.005;0.0;0.006;0.008	T	0.52845	-0.8521	10	0.72032	D	0.01	0.5278	18.7769	0.91915	0.0:1.0:0.0:0.0	.	46;46;46;46;46;46;46;46	B4DUQ1;Q5T6W5;Q5EC54;B4DFF1;P61978-2;P61978-3;P61978;Q6IBN1	.;.;.;.;.;.;HNRPK_HUMAN;.	H	46	ENSP00000365458:R46H;ENSP00000365440:R46H;ENSP00000365439:R46H;ENSP00000317788:R46H;ENSP00000353552:R46H;ENSP00000409456:R46H	ENSP00000317788:R46H	R	-	2	0	HNRNPK	85782443	1.000000	0.71417	0.996000	0.52242	0.994000	0.84299	3.814000	0.55643	2.490000	0.84030	0.644000	0.83932	CGC	.		0.353	HNRNPK-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052846.2		
EYS	346007	hgsc.bcm.edu	37	6	66005908	66005908	+	Nonsense_Mutation	SNP	G	G	T	rs548565748		TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr6:66005908G>T	ENST00000370621.3	-	12	2397	c.1871C>A	c.(1870-1872)tCg>tAg	p.S624*	EYS_ENST00000370616.2_Nonsense_Mutation_p.S624*|EYS_ENST00000503581.1_Nonsense_Mutation_p.S624*			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	624					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						ACAATTGTGCGAAAGGGCCAG	0.433																																					p.S624X		.											EYS_ENST00000370621,caecum,carcinoma,0,2	EYS_ENST00000370621	0	0			c.C1871A						.						142.0	111.0	120.0					6																	66005908		692	1591	2283	SO:0001587	stop_gained	346007	exon12			TTGTGCGAAAGGG		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.1871C>A	6.37:g.66005908G>T	ENSP00000359655:p.Ser624*	Somatic	51	0		WXS	Illumina HiSeq	.	21	2	NM_001142800	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Nonsense_Mutation	SNP	ENST00000370621.3	37		.	.	.	.	.	.	.	.	.	.	.	16.61	3.171642	0.57584	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	.	.	.	5.48	1.33	0.21861	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	.	6.2659	0.20925	0.6132:0.3054:0.0815:0.0	.	.	.	.	X	624	.	ENSP00000359650:S624X	S	-	2	0	EYS	66062629	0.917000	0.31117	0.002000	0.10522	0.007000	0.05969	2.092000	0.41700	0.027000	0.15297	-0.423000	0.05987	TCG	.		0.433	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
CADM4	199731	hgsc.bcm.edu	37	19	44127517	44127517	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr19:44127517C>T	ENST00000222374.2	-	9	1180	c.1132G>A	c.(1132-1134)Gac>Aac	p.D378N	CADM4_ENST00000593506.1_5'Flank	NM_145296.1	NP_660339.1	Q8NFZ8	CADM4_HUMAN	cell adhesion molecule 4	378					cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(3)|lung(4)|prostate(1)|skin(2)	12		Prostate(69;0.0199)				TTGTGTCCGTCGCTGCCATTG	0.617																																					p.D378N		.											CADM4,colon,carcinoma,+2,1	CADM4	+2	0			c.G1132A						.						162.0	159.0	160.0					19																	44127517		2203	4300	6503	SO:0001583	missense	199731	exon9			GTCCGTCGCTGCC	AF363368	CCDS12627.1	19q13.32	2013-01-29	2007-02-07	2007-02-07		ENSG00000105767		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30825	protein-coding gene	gene with protein product	"""nectin-like 4"""	609744	"""immunoglobulin superfamily, member 4C"""	IGSF4C		11536053	Standard	NM_145296		Approved	TSLL2, Necl-4, SynCAM4	uc002oxc.1	Q8NFZ8		ENST00000222374.2:c.1132G>A	19.37:g.44127517C>T	ENSP00000222374:p.Asp378Asn	Somatic	50	0		WXS	Illumina HiSeq	.	45	2	NM_145296	B2R7L5|Q9Y4A4	Missense_Mutation	SNP	ENST00000222374.2	37	CCDS12627.1	.	.	.	.	.	.	.	.	.	.	C	14.27	2.484826	0.44147	.	.	ENSG00000105767	ENST00000222374	T	0.61742	0.08	4.56	3.43	0.39272	.	0.061173	0.64402	D	0.000010	T	0.39253	0.1071	N	0.20986	0.625	0.41621	D	0.988962	B	0.32731	0.382	B	0.23018	0.043	T	0.49624	-0.8920	10	0.66056	D	0.02	.	12.0836	0.53686	0.0:0.8248:0.1751:0.0	.	378	Q8NFZ8	CADM4_HUMAN	N	378	ENSP00000222374:D378N	ENSP00000222374:D378N	D	-	1	0	CADM4	48819357	1.000000	0.71417	0.986000	0.45419	0.976000	0.68499	4.650000	0.61440	2.270000	0.75569	0.460000	0.39030	GAC	.		0.617	CADM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463352.1	NM_145296	
PPFIA3	8541	hgsc.bcm.edu	37	19	49651449	49651449	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr19:49651449G>T	ENST00000334186.4	+	24	3294	c.2945G>T	c.(2944-2946)cGa>cTa	p.R982L	PPFIA3_ENST00000602351.1_Missense_Mutation_p.R973L	NM_003660.2	NP_003651.1	O75145	LIPA3_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3	982	SAM 2. {ECO:0000255|PROSITE- ProRule:PRU00184}.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|presynaptic active zone (GO:0048786)		p.R982Q(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(16)|pancreas(1)|prostate(1)|skin(4)|urinary_tract(1)	35		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)		GTGGACGCTCGAATGTTAGAT	0.592																																					p.R982L		.											PPFIA3,colon,carcinoma,0,1	PPFIA3	0	1	Substitution - Missense(1)	large_intestine(1)	c.G2945T						.						57.0	56.0	56.0					19																	49651449		2203	4300	6503	SO:0001583	missense	8541	exon24			ACGCTCGAATGTT	AF034800	CCDS12758.1	19q13.33	2013-09-23			ENSG00000177380	ENSG00000177380		"""Sterile alpha motif (SAM) domain containing"""	9247	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase, receptor type, f polypeptide, alpha 3"", ""liprin-alpha 3"", ""liprin"""	603144				9624153, 9734811	Standard	NM_003660		Approved	KIAA0654, LPNA3, MGC126567, MGC126569	uc002pmr.3	O75145	OTTHUMG00000183213	ENST00000334186.4:c.2945G>T	19.37:g.49651449G>T	ENSP00000335614:p.Arg982Leu	Somatic	68	0		WXS	Illumina HiSeq	.	48	2	NM_003660	A8K142|Q3MJA0|Q9H8B5|Q9UEW4	Missense_Mutation	SNP	ENST00000334186.4	37	CCDS12758.1	.	.	.	.	.	.	.	.	.	.	G	32	5.133847	0.94517	.	.	ENSG00000177380	ENST00000334186	T	0.52295	0.67	4.59	4.59	0.56863	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.000000	0.43747	D	0.000534	T	0.75199	0.3817	M	0.91038	3.17	0.80722	D	1	P;D	0.89917	0.954;1.0	P;D	0.85130	0.664;0.997	T	0.82390	-0.0481	10	0.87932	D	0	-7.6618	16.5581	0.84491	0.0:0.0:1.0:0.0	.	973;982	O75145-2;O75145	.;LIPA3_HUMAN	L	982	ENSP00000335614:R982L	ENSP00000335614:R982L	R	+	2	0	PPFIA3	54343261	1.000000	0.71417	0.995000	0.50966	0.965000	0.64279	9.800000	0.99124	2.272000	0.75746	0.563000	0.77884	CGA	.		0.592	PPFIA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465688.1	NM_003660	
WAPAL	23063	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	88230836	88230836	+	Missense_Mutation	SNP	A	A	C			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr10:88230836A>C	ENST00000298767.5	-	8	2527	c.2055T>G	c.(2053-2055)tgT>tgG	p.C685W	WAPAL_ENST00000263070.7_5'Flank	NM_015045.2	NP_055860.1	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog (Drosophila)	685	WAPL. {ECO:0000255|PROSITE- ProRule:PRU00603}.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of chromatin binding (GO:0035562)|negative regulation of DNA replication (GO:0008156)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of fibroblast proliferation (GO:0048146)|protein localization to chromatin (GO:0071168)|regulation of chromosome condensation (GO:0060623)|regulation of cohesin localization to chromatin (GO:0071922)|response to toxic substance (GO:0009636)|viral process (GO:0016032)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)				breast(2)|endometrium(2)|kidney(5)|large_intestine(6)|lung(13)|ovary(2)|stomach(1)	31						TGGGCATGGCACATTTAGTAG	0.413																																					p.C685W		.											.	.	.	0			c.T2055G						.						92.0	83.0	86.0					10																	88230836		2203	4300	6503	SO:0001583	missense	23063	exon8			CATGGCACATTTA	AB065003	CCDS7375.1	10q23.31	2006-12-08	2006-03-16	2006-03-16	ENSG00000062650	ENSG00000062650			23293	protein-coding gene	gene with protein product	"""friend of EBNA2"""	610754	"""KIAA0261"""	KIAA0261		9039502, 17112726	Standard	XM_006717726		Approved	FOE, WAPL	uc001kdo.3	Q7Z5K2	OTTHUMG00000018651	ENST00000298767.5:c.2055T>G	10.37:g.88230836A>C	ENSP00000298767:p.Cys685Trp	Somatic	44	0		WXS	Illumina HiSeq	.	32	6	NM_015045	A7E2B5|Q5VSK5|Q8IX10|Q92549	Missense_Mutation	SNP	ENST00000298767.5	37	CCDS7375.1	.	.	.	.	.	.	.	.	.	.	A	18.48	3.632106	0.67015	.	.	ENSG00000062650	ENST00000342368;ENST00000298767;ENST00000372076	T	0.51817	0.69	5.96	3.63	0.41609	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.68393	0.2996	M	0.87180	2.865	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.998	T	0.70831	-0.4765	10	0.87932	D	0	.	7.8611	0.29509	0.7275:0.0:0.2725:0.0	.	679;685;722	B2RTX8;Q7Z5K2;Q7Z5K2-2	.;WAPL_HUMAN;.	W	770;685;770	ENSP00000298767:C685W	ENSP00000298767:C685W	C	-	3	2	WAPAL	88220816	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.684000	0.37649	1.078000	0.41014	0.528000	0.53228	TGT	.		0.413	WAPAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049151.2	NM_015045	
SLC9B2	133308	hgsc.bcm.edu;bcgsc.ca	37	4	103988622	103988622	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr4:103988622G>T	ENST00000394785.3	-	2	717	c.86C>A	c.(85-87)gCa>gAa	p.A29E	SLC9B2_ENST00000339611.4_Missense_Mutation_p.A29E|SLC9B2_ENST00000362026.3_Missense_Mutation_p.A29E|SLC9B2_ENST00000505838.1_5'UTR|SLC9B2_ENST00000503103.1_Missense_Mutation_p.A29E|SLC9B2_ENST00000503230.1_Missense_Mutation_p.A29E	NM_178833.4	NP_849155.2	Q86UD5	SL9B2_HUMAN	solute carrier family 9, subfamily B (NHA2, cation proton antiporter 2), member 2	29					ion transmembrane transport (GO:0034220)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	solute:proton antiporter activity (GO:0015299)										ATTTACCTGTGCTTCTTGATG	0.368																																					p.A29E		.											.	.	.	0			c.C86A						.						259.0	221.0	234.0					4																	103988622		2203	4300	6503	SO:0001583	missense	133308	exon2			ACCTGTGCTTCTT	AK172823	CCDS3662.1, CCDS75173.1, CCDS75174.1	4q24	2013-05-22	2012-03-22	2011-08-03	ENSG00000164038	ENSG00000164038		"""Solute carriers"""	25143	protein-coding gene	gene with protein product		611789	"""Na+/H+ exchanger domain containing 2"", ""solute carrier family 9, subfamily B (cation proton antiporter 2), member 2"""	NHEDC2		18600791	Standard	XM_005262758		Approved	FLJ23984, NHA2	uc003hwy.3	Q86UD5	OTTHUMG00000131125	ENST00000394785.3:c.86C>A	4.37:g.103988622G>T	ENSP00000378265:p.Ala29Glu	Somatic	104	0		WXS	Illumina HiSeq	.	74	4	NM_178833	B5ME52|Q6ZMD8|Q96D95	Missense_Mutation	SNP	ENST00000394785.3	37	CCDS3662.1	.	.	.	.	.	.	.	.	.	.	G	13.36	2.213376	0.39102	.	.	ENSG00000164038	ENST00000362026;ENST00000339611;ENST00000394785;ENST00000503103;ENST00000503230;ENST00000503818	T;T;T;T;T	0.25579	1.91;1.88;1.91;1.79;1.82	3.84	0.0882	0.14454	.	1.031990	0.07719	N	0.943324	T	0.07728	0.0194	N	0.03608	-0.345	0.09310	N	1	B;B;B	0.12013	0.005;0.001;0.001	B;B;B	0.08055	0.003;0.003;0.003	T	0.33292	-0.9874	10	0.06236	T	0.91	-0.0033	0.9302	0.01333	0.2187:0.1799:0.4167:0.1846	.	29;29;29	B7Z676;E9PE63;Q86UD5	.;.;SL9B2_HUMAN	E	29	ENSP00000354574:A29E;ENSP00000345241:A29E;ENSP00000378265:A29E;ENSP00000425385:A29E;ENSP00000422477:A29E	ENSP00000345241:A29E	A	-	2	0	SLC9B2	104208071	0.001000	0.12720	0.001000	0.08648	0.696000	0.40369	0.009000	0.13219	-0.029000	0.13827	0.655000	0.94253	GCA	.		0.368	SLC9B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253805.1	NM_178833	
PCSK2	5126	hgsc.bcm.edu	37	20	17338992	17338992	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr20:17338992G>T	ENST00000262545.2	+	3	618	c.303G>T	c.(301-303)caG>caT	p.Q101H	PCSK2_ENST00000536609.1_Missense_Mutation_p.Q66H|PCSK2_ENST00000377899.1_Missense_Mutation_p.Q82H	NM_002594.3	NP_002585.2	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	101					cellular protein metabolic process (GO:0044267)|embryo development (GO:0009790)|enkephalin processing (GO:0034230)|insulin processing (GO:0030070)|islet amyloid polypeptide processing (GO:0034231)|nervous system development (GO:0007399)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	dendrite (GO:0030425)|extracellular space (GO:0005615)|membrane (GO:0016020)|perikaryon (GO:0043204)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|lung(17)|ovary(3)|pancreas(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	53					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CTTTGCAGCAGGAAGGATTTG	0.393																																					p.Q101H		.											.,1	.	112	0			c.G303T						.						165.0	135.0	146.0					20																	17338992		2203	4300	6503	SO:0001583	missense	5126	exon3			GCAGCAGGAAGGA	AK312341	CCDS13125.1, CCDS56179.1, CCDS56180.1	20p11.2	2008-08-01			ENSG00000125851	ENSG00000125851			8744	protein-coding gene	gene with protein product	"""neuroendocrine convertase 2"", ""KEX2-like endoprotease 2"""	162151		NEC2		1765368	Standard	NM_001201528		Approved	PC2, SPC2	uc002wpm.3	P16519	OTTHUMG00000031941	ENST00000262545.2:c.303G>T	20.37:g.17338992G>T	ENSP00000262545:p.Gln101His	Somatic	58	1		WXS	Illumina HiSeq	.	75	3	NM_002594	B1ANH9|B4DFQ3|Q14927|Q5JYQ1|Q8IWA8|Q9NQG3|Q9NUG1|Q9UJC6	Missense_Mutation	SNP	ENST00000262545.2	37	CCDS13125.1	.	.	.	.	.	.	.	.	.	.	.	14.68	2.609037	0.46527	.	.	ENSG00000125851	ENST00000377899;ENST00000262545;ENST00000536609	T;T;T	0.73152	0.81;0.81;-0.72	6.17	0.647	0.17796	Proteinase inhibitor, propeptide (1);	0.051408	0.85682	N	0.000000	D	0.82912	0.5140	M	0.91510	3.215	0.58432	D	0.999999	D;D	0.89917	0.994;1.0	P;D	0.76071	0.864;0.987	T	0.79060	-0.1958	10	0.87932	D	0	-27.8839	5.1542	0.15027	0.4231:0.1417:0.4352:0.0	.	66;101	B4DFQ3;P16519	.;NEC2_HUMAN	H	82;101;66	ENSP00000367131:Q82H;ENSP00000262545:Q101H;ENSP00000437458:Q66H	ENSP00000262545:Q101H	Q	+	3	2	PCSK2	17286992	1.000000	0.71417	0.990000	0.47175	0.392000	0.30506	2.064000	0.41432	-0.087000	0.12528	-0.136000	0.14681	CAG	.		0.393	PCSK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078120.2	NM_002594	
SDHAF2	54949	hgsc.bcm.edu	37	11	61205106	61205106	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr11:61205106C>A	ENST00000543265.1	+	2	49	c.46C>A	c.(46-48)Ctg>Atg	p.L16M	RP11-286N22.8_ENST00000544880.1_3'UTR|SDHAF2_ENST00000537782.1_Missense_Mutation_p.L16M|SDHAF2_ENST00000534878.1_Missense_Mutation_p.L16M|RP11-286N22.8_ENST00000543044.1_Missense_Mutation_p.L4M|SDHAF2_ENST00000301761.2_Missense_Mutation_p.L16M|SDHAF2_ENST00000542074.1_Intron					succinate dehydrogenase complex assembly factor 2											large_intestine(3)|lung(4)|ovary(2)	9						GATGCTTGCTCTGTCAAGGCA	0.418																																					p.L16M		.											SDHAF2,colon,carcinoma,-1,1	SDHAF2	-1	0			c.C46A						.						181.0	179.0	179.0					11																	61205106		2202	4299	6501	SO:0001583	missense	54949	exon2			CTTGCTCTGTCAA	AK000494	CCDS8007.1	11q12.2	2014-09-17	2009-08-10	2009-08-10	ENSG00000167985	ENSG00000167985		"""Mitochondrial respiratory chain complex assembly factors"""	26034	protein-coding gene	gene with protein product		613019	"""paraganglioma or familial glomus tumors 2"", ""chromosome 11 open reading frame 79"""	PGL2, C11orf79		19628817	Standard	NM_017841		Approved	FLJ20487, SDH5	uc001nrt.3	Q9NX18	OTTHUMG00000168279	ENST00000543265.1:c.46C>A	11.37:g.61205106C>A	ENSP00000443660:p.Leu16Met	Somatic	19	0		WXS	Illumina HiSeq	.	26	2	NM_017841		Missense_Mutation	SNP	ENST00000543265.1	37		.	.	.	.	.	.	.	.	.	.	C	13.14	2.149655	0.37923	.	.	ENSG00000256591;ENSG00000167985;ENSG00000167985	ENST00000541135;ENST00000301761;ENST00000543265	T;T;T	0.79653	-1.29;-1.24;-1.25	5.91	-0.0971	0.13634	.	0.763615	0.12824	N	0.436225	T	0.73961	0.3654	M	0.63428	1.95	0.09310	N	1	P	0.38250	0.624	B	0.37091	0.241	T	0.62320	-0.6879	10	0.42905	T	0.14	0.0051	7.4438	0.27198	0.0:0.4535:0.3841:0.1624	.	16	Q9NX18	SDHF2_HUMAN	M	16	ENSP00000443130:L16M;ENSP00000301761:L16M;ENSP00000443660:L16M	ENSP00000440939:L16M	L	+	1	2	SDHAF2;RP11-286N22.8	60961682	0.001000	0.12720	0.000000	0.03702	0.055000	0.15305	-0.184000	0.09698	0.073000	0.16731	0.655000	0.94253	CTG	.		0.418	SDHAF2-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000398484.1	NM_017841	
SEMA5A	9037	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	9063091	9063091	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr5:9063091C>T	ENST00000382496.5	-	18	3091	c.2426G>A	c.(2425-2427)cGt>cAt	p.R809H		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	809	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						GTTGCAAACACGCTTCCGGTT	0.587																																					p.R809H		.											.	.	.	0			c.G2426A						.						106.0	84.0	92.0					5																	9063091		2203	4300	6503	SO:0001583	missense	9037	exon18			CAAACACGCTTCC	U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.2426G>A	5.37:g.9063091C>T	ENSP00000371936:p.Arg809His	Somatic	47	0		WXS	Illumina HiSeq	.	49	10	NM_003966	D3DTC6|O60408|Q1RLL9	Missense_Mutation	SNP	ENST00000382496.5	37	CCDS3875.1	.	.	.	.	.	.	.	.	.	.	C	36	5.611877	0.96637	.	.	ENSG00000112902	ENST00000382496	T	0.65364	-0.15	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	D	0.88440	0.6437	H	0.99090	4.425	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93001	0.6423	10	0.87932	D	0	.	17.2182	0.86950	0.0:1.0:0.0:0.0	.	809	Q13591	SEM5A_HUMAN	H	809	ENSP00000371936:R809H	ENSP00000371936:R809H	R	-	2	0	SEMA5A	9116091	1.000000	0.71417	0.958000	0.39756	0.990000	0.78478	7.573000	0.82421	2.659000	0.90383	0.655000	0.94253	CGT	.		0.587	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206989.2		
ZNF408	79797	hgsc.bcm.edu	37	11	46724728	46724728	+	Missense_Mutation	SNP	A	A	C	rs376220307|rs148055528	byFrequency	TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr11:46724728A>C	ENST00000311764.2	+	4	817	c.587A>C	c.(586-588)gAa>gCa	p.E196A	ARHGAP1_ENST00000311956.4_5'Flank	NM_001184751.1|NM_024741.2	NP_001171680.1|NP_079017.1	Q9H9D4	ZN408_HUMAN	zinc finger protein 408	196					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GTGGTGACAGAAGTGGAGTCT	0.567																																					p.E196A	Pancreas(79;698 1390 6545 18745 34127)|Esophageal Squamous(120;1014 1625 12837 24601 49525)	.											ZNF408,caecum,carcinoma,0,1	ZNF408	0	0			c.A587C						.	A	ALA/GLU,ALA/GLU	4,4398		0,4,2197	46.0	39.0	42.0		563,587	0.5	0.6	11		42	36,8500		10,16,4242	no	missense,missense	ZNF408	NM_001184751.1,NM_024741.2	107,107	10,20,6439	CC,CA,AA		0.4217,0.0909,0.3092	benign,benign	188/713,196/721	46724728	40,12898	2201	4268	6469	SO:0001583	missense	79797	exon4			TGACAGAAGTGGA	AF346626	CCDS7923.1	11p11.2	2008-02-05			ENSG00000175213	ENSG00000175213		"""Zinc fingers, C2H2-type"""	20041	protein-coding gene	gene with protein product						15231747	Standard	NM_024741		Approved	FLJ12827	uc010rgw.2	Q9H9D4	OTTHUMG00000166568	ENST00000311764.2:c.587A>C	11.37:g.46724728A>C	ENSP00000309606:p.Glu196Ala	Somatic	15	0		WXS	Illumina HiSeq	.	18	2	NM_024741		Missense_Mutation	SNP	ENST00000311764.2	37	CCDS7923.1	.	.	.	.	.	.	.	.	.	.	A	16.30	3.083402	0.55861	9.09E-4	0.004217	ENSG00000175213	ENST00000311764	T	0.10477	2.87	5.66	0.47	0.16747	.	0.900334	0.09183	N	0.837160	T	0.07593	0.0191	L	0.32530	0.975	0.09310	N	1	B;B	0.31680	0.335;0.335	B;B	0.25140	0.058;0.058	T	0.40590	-0.9555	10	0.19590	T	0.45	-0.378	9.3275	0.38001	0.6254:0.0:0.3746:0.0	.	188;196	B4DXY4;Q9H9D4	.;ZN408_HUMAN	A	196	ENSP00000309606:E196A	ENSP00000309606:E196A	E	+	2	0	ZNF408	46681304	0.229000	0.23729	0.610000	0.28997	0.457000	0.32468	-0.129000	0.10515	0.078000	0.16900	0.533000	0.62120	GAA	.		0.567	ZNF408-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390485.2	NM_024741	
CCDC83	220047	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	85597249	85597249	+	Missense_Mutation	SNP	G	G	T	rs553174518		TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr11:85597249G>T	ENST00000342404.3	+	5	566	c.350G>T	c.(349-351)cGc>cTc	p.R117L	CCDC83_ENST00000529676.2_Intron|CCDC83_ENST00000376067.1_Intron|CCDC83_ENST00000280245.4_Missense_Mutation_p.R117L			Q8IWF9	CCD83_HUMAN	coiled-coil domain containing 83	117								p.R117H(2)|p.R117L(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(12)|skin(3)|upper_aerodigestive_tract(2)	29		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)				ACAGATATGCGCATGCAAATA	0.333																																					p.R117L		.											CCDC83,NS,carcinoma,0,4	CCDC83	0	3	Substitution - Missense(3)	large_intestine(1)|lung(1)|endometrium(1)	c.G350T						.						61.0	56.0	58.0					11																	85597249		2203	4299	6502	SO:0001583	missense	220047	exon5			ATATGCGCATGCA	AK124113	CCDS8271.1, CCDS66196.1	11q14.1-q14.2	2014-01-21			ENSG00000150676	ENSG00000150676			28535	protein-coding gene	gene with protein product						12477932	Standard	XM_005273842		Approved	MGC34732, FLJ42119, CT148	uc001pbg.1	Q8IWF9	OTTHUMG00000166978	ENST00000342404.3:c.350G>T	11.37:g.85597249G>T	ENSP00000344512:p.Arg117Leu	Somatic	67	0		WXS	Illumina HiSeq	.	53	4	NM_173556	B2RA49|Q6X7T2|Q6ZVT5|Q8N9Y1	Missense_Mutation	SNP	ENST00000342404.3	37		.	.	.	.	.	.	.	.	.	.	G	6.306	0.424561	0.11928	.	.	ENSG00000150676	ENST00000280245;ENST00000342404	T;T	0.45668	0.89;0.9	5.26	4.35	0.52113	.	0.261751	0.34110	N	0.004242	T	0.49253	0.1546	M	0.63428	1.95	0.80722	D	1	P;D	0.54964	0.94;0.969	P;P	0.51895	0.593;0.683	T	0.47898	-0.9081	9	.	.	.	-0.2256	11.0699	0.47997	0.088:0.0:0.912:0.0	.	117;117	Q8IWF9;Q8IWF9-2	CCD83_HUMAN;.	L	117	ENSP00000280245:R117L;ENSP00000344512:R117L	.	R	+	2	0	CCDC83	85274897	0.996000	0.38824	0.891000	0.34965	0.054000	0.15201	1.194000	0.32174	1.200000	0.43188	0.650000	0.86243	CGC	.		0.333	CCDC83-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000392215.1	NM_173556	
KLK4	9622	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	19	51412609	51412609	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr19:51412609C>T	ENST00000324041.1	-	2	122	c.123G>A	c.(121-123)tcG>tcA	p.S41S	KLK4_ENST00000597441.1_5'Flank|KLK4_ENST00000431178.2_5'Flank	NM_004917.3	NP_004908.3	Q9Y5K2	KLK4_HUMAN	kallikrein-related peptidase 4	41	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				amelogenesis (GO:0097186)|extracellular matrix disassembly (GO:0022617)|protein catabolic process (GO:0030163)|proteolysis (GO:0006508)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(8)	19		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00624)|GBM - Glioblastoma multiforme(134;0.00878)		GCCAGGGCTGCGAGTGCGGGC	0.622																																					p.S41S		.											.	.	.	0			c.G123A						.						139.0	153.0	149.0					19																	51412609		2203	4300	6503	SO:0001819	synonymous_variant	9622	exon2			GGGCTGCGAGTGC	AF113141	CCDS12809.1	19q13.41	2014-09-04	2006-10-27		ENSG00000167749	ENSG00000167749		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6365	protein-coding gene	gene with protein product		603767	"""kallikrein 4 (prostase, enamel matrix, prostate)"""	PRSS17		10077646, 10438493, 16800724, 10863090, 9465170	Standard	XM_005259441		Approved	EMSP, EMSP1, PSTS, KLK-L1	uc002pua.1	Q9Y5K2	OTTHUMG00000182964	ENST00000324041.1:c.123G>A	19.37:g.51412609C>T		Somatic	48	0		WXS	Illumina HiSeq	.	37	4	NM_004917	Q4VB16|Q96RU5|Q9GZL6|Q9UBJ6	Silent	SNP	ENST00000324041.1	37	CCDS12809.1																																																																																			.		0.622	KLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464449.1	NM_004917	
SPG21	51324	hgsc.bcm.edu	37	15	65267060	65267060	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr15:65267060C>A	ENST00000204566.2	-	5	627	c.332G>T	c.(331-333)gGa>gTa	p.G111V	SPG21_ENST00000560564.1_5'UTR|SPG21_ENST00000433215.2_Missense_Mutation_p.G111V|SPG21_ENST00000416889.2_Missense_Mutation_p.G84V|SPG21_ENST00000559199.1_5'UTR	NM_016630.3	NP_057714.1	Q9NZD8	SPG21_HUMAN	spastic paraplegia 21 (autosomal recessive, Mast syndrome)	111					antigen receptor-mediated signaling pathway (GO:0050851)|cell death (GO:0008219)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network transport vesicle (GO:0030140)	CD4 receptor binding (GO:0042609)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|urinary_tract(1)	10						CAAAAAGCCTCCCAAAGAAGC	0.378																																					p.G111V		.											.	.	.	0			c.G332T						.						84.0	89.0	87.0					15																	65267060		2202	4299	6501	SO:0001583	missense	51324	exon5			AAGCCTCCCAAAG	AF208861	CCDS10198.1, CCDS45279.1	15q21-q22	2008-02-05	2007-04-23		ENSG00000090487	ENSG00000090487			20373	protein-coding gene	gene with protein product	"""maspardin"""	608181				11113139, 14564668	Standard	XM_006720564		Approved	ACP33, GL010, BM-019, MAST	uc002aoe.3	Q9NZD8	OTTHUMG00000133098	ENST00000204566.2:c.332G>T	15.37:g.65267060C>A	ENSP00000204566:p.Gly111Val	Somatic	71	0		WXS	Illumina HiSeq	.	85	4	NM_001127889	B4DW44|Q6ZMB6	Missense_Mutation	SNP	ENST00000204566.2	37	CCDS10198.1	.	.	.	.	.	.	.	.	.	.	C	31	5.100273	0.94245	.	.	ENSG00000090487	ENST00000204566;ENST00000416889;ENST00000433215	D;D;D	0.87491	-2.25;-2.26;-2.25	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	D	0.95749	0.8617	H	0.94462	3.54	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.99;0.996	D	0.96039	0.9023	10	0.87932	D	0	-16.6071	19.4236	0.94732	0.0:1.0:0.0:0.0	.	84;111	Q9NZD8-2;Q9NZD8	.;SPG21_HUMAN	V	111;84;111	ENSP00000204566:G111V;ENSP00000394846:G84V;ENSP00000404111:G111V	ENSP00000204566:G111V	G	-	2	0	SPG21	63054113	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.680000	0.84062	2.937000	0.99478	0.650000	0.86243	GGA	.		0.378	SPG21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256758.3	NM_016630	
CD5L	922	hgsc.bcm.edu	37	1	157803043	157803043	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr1:157803043C>A	ENST00000368174.4	-	5	1074	c.978G>T	c.(976-978)caG>caT	p.Q326H	CD5L_ENST00000484609.1_5'Flank	NM_005894.2	NP_005885.1	O43866	CD5L_HUMAN	CD5 molecule-like	326	SRCR 3. {ECO:0000255|PROSITE- ProRule:PRU00196}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	scavenger receptor activity (GO:0005044)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	52	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			AAAATCTGTGCTGGCACTGCT	0.567																																					p.Q326H		.											CD5L,NS,carcinoma,-1,1	CD5L	-1	0			c.G978T						.						92.0	90.0	91.0					1																	157803043		2203	4300	6503	SO:0001583	missense	922	exon5			TCTGTGCTGGCAC	U82812	CCDS1171.1	1q21-q23	2008-02-05	2006-03-28		ENSG00000073754	ENSG00000073754			1690	protein-coding gene	gene with protein product		602592	"""apoptosis inhibitor 6"", ""CD5 antigen-like (scavenger receptor cysteine rich family)"""	API6		9045627	Standard	NM_005894		Approved	Spalpha	uc001frk.4	O43866	OTTHUMG00000022440	ENST00000368174.4:c.978G>T	1.37:g.157803043C>A	ENSP00000357156:p.Gln326His	Somatic	19	0		WXS	Illumina HiSeq	.	37	2	NM_005894	A8K7M5|Q6UX63	Missense_Mutation	SNP	ENST00000368174.4	37	CCDS1171.1	.	.	.	.	.	.	.	.	.	.	C	13.33	2.205419	0.39003	.	.	ENSG00000073754	ENST00000368174	T	0.35236	1.32	5.06	1.98	0.26296	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	1.415450	0.04339	N	0.353667	T	0.23532	0.0569	L	0.39692	1.235	0.22787	N	0.998736	D	0.55800	0.973	P	0.54270	0.747	T	0.16867	-1.0388	10	0.23302	T	0.38	.	8.2274	0.31577	0.0:0.7105:0.0:0.2895	.	326	O43866	CD5L_HUMAN	H	326	ENSP00000357156:Q326H	ENSP00000357156:Q326H	Q	-	3	2	CD5L	156069667	0.000000	0.05858	0.714000	0.30535	0.517000	0.34286	-3.904000	0.00338	0.721000	0.32231	0.655000	0.94253	CAG	.		0.567	CD5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058346.1	NM_005894	
SLAMF6	114836	hgsc.bcm.edu	37	1	160458958	160458958	+	Nonsense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr1:160458958C>A	ENST00000368057.3	-	6	859	c.799G>T	c.(799-801)Gag>Tag	p.E267*	SLAMF6_ENST00000368059.3_Splice_Site|SLAMF6_ENST00000368055.1_Nonsense_Mutation_p.E156*			Q96DU3	SLAF6_HUMAN	SLAM family member 6	267						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|skin(4)	22	all_cancers(52;1.05e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0923)			CTTGCGGACTCTGCTGTTAAC	0.493																																					p.E267X		.											.	.	.	0			c.G799T						.						208.0	167.0	181.0					1																	160458958		2203	4300	6503	SO:0001587	stop_gained	114836	exon6			CGGACTCTGCTGT	AL832854	CCDS1205.1, CCDS53393.1, CCDS53394.1	1q23.1	2013-01-29			ENSG00000162739	ENSG00000162739		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21392	protein-coding gene	gene with protein product		606446				11489943	Standard	NM_052931		Approved	KALI, NTBA, KALIb, Ly108, SF2000, NTB-A, CD352	uc001fwe.2	Q96DU3	OTTHUMG00000022729	ENST00000368057.3:c.799G>T	1.37:g.160458958C>A	ENSP00000357036:p.Glu267*	Somatic	40	0		WXS	Illumina HiSeq	.	70	4	NM_001184714	A6NMW2|B2R8X8|Q14CF0|Q5TAS4|Q5TAS6|Q5TAT3|Q96DV0	Nonsense_Mutation	SNP	ENST00000368057.3	37	CCDS53394.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	6.551|6.551	0.469938|0.469938	0.12461|0.12461	.|.	.|.	ENSG00000162739|ENSG00000162739	ENST00000368059|ENST00000368057;ENST00000368055	.|.	.|.	.|.	4.58|4.58	1.57|1.57	0.23409|0.23409	.|.	.|2.497930	.|0.01526	.|N	.|0.018567	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|-4.0E-4	6.1448|6.1448	0.20278|0.20278	0.0:0.523:0.3752:0.1017|0.0:0.523:0.3752:0.1017	.|.	.|.	.|.	.|.	.|X	-1|267;156	.|.	.|.	.|E	-|-	.|1	.|0	SLAMF6|SLAMF6	158725582|158725582	0.034000|0.034000	0.19679|0.19679	0.006000|0.006000	0.13384|0.13384	0.012000|0.012000	0.07955|0.07955	1.437000|1.437000	0.34991|0.34991	0.619000|0.619000	0.30197|0.30197	-0.176000|-0.176000	0.13171|0.13171	.|GAG	.		0.493	SLAMF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059010.1	NM_052931	
CCDC66	285331	hgsc.bcm.edu	37	3	56653888	56653888	+	Nonsense_Mutation	SNP	C	C	T	rs374852204		TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr3:56653888C>T	ENST00000394672.3	+	17	2789	c.2719C>T	c.(2719-2721)Cga>Tga	p.R907*	CCDC66_ENST00000326595.7_Nonsense_Mutation_p.R873*|CCDC66_ENST00000436465.2_Nonsense_Mutation_p.R907*	NM_001012506.4|NM_001141947.1	NP_001012524.4|NP_001135419.1	A2RUB6	CCD66_HUMAN	coiled-coil domain containing 66	907					post-embryonic retina morphogenesis in camera-type eye (GO:0060060)|retinal rod cell development (GO:0046548)					breast(1)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|skin(2)|urinary_tract(1)	12				KIRC - Kidney renal clear cell carcinoma(284;0.0478)|Kidney(284;0.0597)|OV - Ovarian serous cystadenocarcinoma(275;0.233)		AAATAGGGATCGACAGCAAGC	0.443																																					p.R907X		.											CCDC66_ENST00000394672,NS,carcinoma,0,2	CCDC66_ENST00000394672	0	0			c.C2719T						.	C	stop/ARG,stop/ARG	1,4405	2.1+/-5.4	0,1,2202	197.0	203.0	201.0		2617,2719	-0.1	1.0	3		201	0,8600		0,0,4300	no	stop-gained,stop-gained	CCDC66	NM_001012506.4,NM_001141947.1	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	873/915,907/949	56653888	1,13005	2203	4300	6503	SO:0001587	stop_gained	285331	exon17			AGGGATCGACAGC	AL832692	CCDS33770.2, CCDS46852.1	3p14.3	2006-03-27			ENSG00000180376	ENSG00000180376			27709	protein-coding gene	gene with protein product						14702039	Standard	NR_024460		Approved	DKFZp686C0433	uc003dhz.3	A2RUB6	OTTHUMG00000155748	ENST00000394672.3:c.2719C>T	3.37:g.56653888C>T	ENSP00000378167:p.Arg907*	Somatic	43	0		WXS	Illumina HiSeq	.	28	2	NM_001141947	B3KWL8|Q4VC34|Q8N949	Nonsense_Mutation	SNP	ENST00000394672.3	37	CCDS46852.1	.	.	.	.	.	.	.	.	.	.	C	38	7.029185	0.98013	2.27E-4	0.0	ENSG00000180376	ENST00000394672;ENST00000326595;ENST00000436465	.	.	.	5.62	-0.0669	0.13762	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.774	16.0463	0.80724	0.7086:0.2914:0.0:0.0	.	.	.	.	X	907;873;907	.	ENSP00000326050:R873X	R	+	1	2	CCDC66	56628928	0.992000	0.36948	1.000000	0.80357	0.992000	0.81027	0.267000	0.18552	0.273000	0.22049	-0.182000	0.12963	CGA	.		0.443	CCDC66-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341473.1	NM_001012506	
PRDM6	93166	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	122506475	122506475	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr5:122506475C>T	ENST00000407847.4	+	6	1583	c.1169C>T	c.(1168-1170)aCg>aTg	p.T390M	PRDM6_ENST00000464424.1_3'UTR	NM_001136239.1	NP_001129711.1	Q9NQX0	PRDM6_HUMAN	PR domain containing 6	390					negative regulation of smooth muscle cell differentiation (GO:0051151)|negative regulation of transcription, DNA-templated (GO:0045892)|neurogenesis (GO:0022008)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	7						GTCCCTTCAACGGTAATGGAA	0.428																																					p.T390M		.											.	.	.	0			c.C1169T						.						36.0	38.0	38.0					5																	122506475		692	1591	2283	SO:0001583	missense	93166	exon6			CTTCAACGGTAAT	AF272898	CCDS47259.1	5q21-q23	2013-01-08			ENSG00000061455	ENSG00000061455		"""Zinc fingers, C2H2-type"""	9350	protein-coding gene	gene with protein product							Standard	NM_001136239		Approved		uc003kti.3	Q9NQX0	OTTHUMG00000150469	ENST00000407847.4:c.1169C>T	5.37:g.122506475C>T	ENSP00000384725:p.Thr390Met	Somatic	59	0		WXS	Illumina HiSeq	.	47	10	NM_001136239	B5MCJ4|Q9NQW9	Missense_Mutation	SNP	ENST00000407847.4	37	CCDS47259.1	.	.	.	.	.	.	.	.	.	.	C	16.53	3.148502	0.57151	.	.	ENSG00000061455	ENST00000407847	T	0.08896	3.04	5.1	5.1	0.69264	.	0.128707	0.53938	D	0.000051	T	0.12817	0.0311	N	0.14661	0.345	0.53688	D	0.999979	D	0.76494	0.999	P	0.56088	0.791	T	0.09335	-1.0679	10	0.56958	D	0.05	-12.1299	19.0691	0.93125	0.0:1.0:0.0:0.0	.	390	Q9NQX0	PRDM6_HUMAN	M	390	ENSP00000384725:T390M	ENSP00000384725:T390M	T	+	2	0	PRDM6	122534374	0.995000	0.38212	0.874000	0.34290	0.990000	0.78478	5.800000	0.69108	2.822000	0.97130	0.650000	0.86243	ACG	.		0.428	PRDM6-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318226.2	XM_049619	
ABCB4	5244	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	87053267	87053267	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr7:87053267C>T	ENST00000265723.4	-	17	2277	c.2166G>A	c.(2164-2166)ggG>ggA	p.G722G	ABCB4_ENST00000545634.1_Silent_p.G722G|ABCB4_ENST00000453593.1_Silent_p.G722G|ABCB4_ENST00000358400.3_Silent_p.G722G|ABCB4_ENST00000359206.3_Silent_p.G722G	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	722	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	GCTGAAGCCCCCCATTGGCAA	0.453																																					p.G722G		.											.	.	.	0			c.G2166A						.						149.0	151.0	150.0					7																	87053267		2203	4300	6503	SO:0001819	synonymous_variant	5244	exon17			AAGCCCCCCATTG	M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.2166G>A	7.37:g.87053267C>T		Somatic	60	0		WXS	Illumina HiSeq	.	42	10	NM_018850	A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Silent	SNP	ENST00000265723.4	37	CCDS5606.1																																																																																			.		0.453	ABCB4-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000336083.1	NM_000443	
BRDT	676	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	92428423	92428423	+	Missense_Mutation	SNP	G	G	C			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr1:92428423G>C	ENST00000362005.3	+	3	530	c.112G>C	c.(112-114)Gtt>Ctt	p.V38L	BRDT_ENST00000399546.2_Missense_Mutation_p.V38L|BRDT_ENST00000394530.3_Missense_Mutation_p.V38L|BRDT_ENST00000370389.2_Intron|BRDT_ENST00000402388.1_Missense_Mutation_p.V38L	NM_001242805.1	NP_001229734	Q58F21	BRDT_HUMAN	bromodomain, testis-specific	38					cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|histone displacement (GO:0001207)|male meiosis (GO:0007140)|male meiosis I (GO:0007141)|mRNA processing (GO:0006397)|positive regulation of transcription during meiosis (GO:0051039)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(24)|ovary(1)|prostate(4)|skin(2)|stomach(2)|urinary_tract(2)	56		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)		TCTACAAAAAGTTGTCCTAAA	0.368																																					p.V38L		.											.	.	.	0			c.G112C						.						135.0	136.0	135.0					1																	92428423		2203	4300	6503	SO:0001583	missense	676	exon2			CAAAAAGTTGTCC	AF019085	CCDS735.1, CCDS55615.1, CCDS55616.1, CCDS72820.1	1p22.1	2010-12-23			ENSG00000137948	ENSG00000137948			1105	protein-coding gene	gene with protein product	"""cancer/testis antigen 9"""	602144				9367677	Standard	NM_001726		Approved	BRD6, CT9	uc010osz.2	Q58F21	OTTHUMG00000010113	ENST00000362005.3:c.112G>C	1.37:g.92428423G>C	ENSP00000354568:p.Val38Leu	Somatic	84	0		WXS	Illumina HiSeq	.	109	19	NM_001242806	A6NF68|B7Z811|B7Z890|B7ZAX7|D3DT32|O14789|Q05DQ4|Q6P5T1|Q7Z4A6|Q8IWI6	Missense_Mutation	SNP	ENST00000362005.3	37	CCDS735.1	.	.	.	.	.	.	.	.	.	.	G	14.77	2.633338	0.47049	.	.	ENSG00000137948	ENST00000362005;ENST00000399546;ENST00000539070;ENST00000423434;ENST00000394530;ENST00000440509;ENST00000449584;ENST00000427104;ENST00000448194;ENST00000426141;ENST00000450792;ENST00000548992;ENST00000402388	T;T;T;T;T;T;T;T;T;T;T;T	0.40756	2.24;2.24;2.24;2.24;2.24;2.24;2.24;2.24;2.24;1.02;2.24;2.24	6.13	5.22	0.72569	Bromodomain (3);	0.094664	0.44688	D	0.000440	T	0.27419	0.0673	L	0.52364	1.645	0.58432	D	0.999994	B;B;B;B	0.33857	0.429;0.429;0.017;0.101	B;B;B;B	0.33960	0.173;0.173;0.047;0.067	T	0.22138	-1.0225	10	0.87932	D	0	-12.2955	15.3595	0.74460	0.0671:0.0:0.9329:0.0	.	38;38;38;38	B7ZAX7;B7Z811;B7Z890;Q58F21	.;.;.;BRDT_HUMAN	L	38	ENSP00000354568:V38L;ENSP00000387822:V38L;ENSP00000396351:V38L;ENSP00000378038:V38L;ENSP00000416714:V38L;ENSP00000408625:V38L;ENSP00000400002:V38L;ENSP00000410587:V38L;ENSP00000404969:V38L;ENSP00000414349:V38L;ENSP00000447394:V38L;ENSP00000384051:V38L	ENSP00000354568:V38L	V	+	1	0	BRDT	92201011	1.000000	0.71417	1.000000	0.80357	0.377000	0.30045	6.311000	0.72835	1.619000	0.50296	0.644000	0.83932	GTT	.		0.368	BRDT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027980.2	NM_207189	
NPHP3	27031	hgsc.bcm.edu	37	3	132436902	132436902	+	Intron	SNP	T	T	A	rs35348816|rs200159916	byFrequency	TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr3:132436902T>A	ENST00000337331.5	-	3	757				NPHP3_ENST00000476742.1_5'Flank|NPHP3_ENST00000326682.8_Intron	NM_153240.4	NP_694972.3	Q7Z494	NPHP3_HUMAN	nephronophthisis 3 (adolescent)						atrial septum development (GO:0003283)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|determination of intestine left/right asymmetry (GO:0071908)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|determination of stomach left/right asymmetry (GO:0071909)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|establishment or maintenance of cell polarity (GO:0007163)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|kidney development (GO:0001822)|kidney morphogenesis (GO:0060993)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|maintenance of organ identity (GO:0048496)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|photoreceptor cell maintenance (GO:0045494)|regulation of cAMP metabolic process (GO:0030814)|regulation of planar cell polarity pathway involved in neural tube closure (GO:2000167)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|ureter development (GO:0072189)|Wnt signaling pathway (GO:0016055)	cilium (GO:0005929)|primary cilium (GO:0072372)				NS(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(15)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						ccggccTTCATTTTTTTTCCT	0.433																																					.		.											.	.	.	0			.						.																																			SO:0001627	intron_variant	0	.			CCTTCATTTTTTT	AB056657	CCDS3078.1	3q22	2014-07-18			ENSG00000113971	ENSG00000113971		"""Tetratricopeptide (TTC) repeat domain containing"""	7907	protein-coding gene	gene with protein product	"""nephrocystin-3"", ""Meckel syndrome, type 7"", ""cilia and flagella associated protein 31"""	608002				12872122, 15381417	Standard	NM_153240		Approved	NPH3, KIAA2000, FLJ30691, FLJ36696, MKS7, SLSN3, CFAP31	uc003epe.2	Q7Z494	OTTHUMG00000159713	ENST00000337331.5:c.670+935A>T	3.37:g.132436902T>A		Somatic	103	0		WXS	Illumina HiSeq	.	79	5	.	Q5JPE3|Q5JPE6|Q68D99|Q6NVH3|Q7Z492|Q7Z493|Q8N9R2|Q8NCM5|Q96N70|Q96NK2	RNA	SNP	ENST00000337331.5	37	CCDS3078.1																																																																																			.		0.433	NPHP3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357020.2	NM_153240	
FBXL4	26235	hgsc.bcm.edu	37	6	99323408	99323408	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr6:99323408C>T	ENST00000369244.2	-	9	2013	c.1585G>A	c.(1585-1587)Gca>Aca	p.A529T	FBXL4_ENST00000229971.1_Missense_Mutation_p.A529T	NM_001278716.1	NP_001265645.1	Q9UKA2	FBXL4_HUMAN	F-box and leucine-rich repeat protein 4	529					ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(4)|prostate(3)|skin(2)	18		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0413)		AGCTGGTGTGCCAGTCTGGTG	0.493																																					p.A529T		.											FBXL4,colon,carcinoma,0,1	FBXL4	0	0			c.G1585A						.						93.0	89.0	90.0					6																	99323408		2203	4300	6503	SO:0001583	missense	26235	exon8			GGTGTGCCAGTCT	AF176699	CCDS5041.1	6q16.1-q16.3	2011-06-09			ENSG00000112234	ENSG00000112234		"""F-boxes / Leucine-rich repeats"""	13601	protein-coding gene	gene with protein product		605654				10531035	Standard	NM_012160		Approved	FBL4, FBL5	uc003ppf.1	Q9UKA2	OTTHUMG00000015259	ENST00000369244.2:c.1585G>A	6.37:g.99323408C>T	ENSP00000358247:p.Ala529Thr	Somatic	53	0		WXS	Illumina HiSeq	.	40	2	NM_012160	B2R7Q5|E1P530|O95919|Q5BJH0|Q9UJU0	Missense_Mutation	SNP	ENST00000369244.2	37	CCDS5041.1	.	.	.	.	.	.	.	.	.	.	C	19.56	3.850162	0.71719	.	.	ENSG00000112234	ENST00000369244;ENST00000229971	T;T	0.03124	4.04;4.04	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.13157	0.0319	M	0.76328	2.33	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.02144	-1.1206	10	0.35671	T	0.21	.	20.2314	0.98350	0.0:1.0:0.0:0.0	.	529;529	B2R7Q5;Q9UKA2	.;FBXL4_HUMAN	T	529	ENSP00000358247:A529T;ENSP00000229971:A529T	ENSP00000229971:A529T	A	-	1	0	FBXL4	99430129	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	5.644000	0.67902	2.789000	0.95967	0.591000	0.81541	GCA	.		0.493	FBXL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041587.2		
TMEM69	51249	hgsc.bcm.edu	37	1	46159032	46159032	+	Missense_Mutation	SNP	T	T	C			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr1:46159032T>C	ENST00000372025.4	+	3	1356	c.199T>C	c.(199-201)Tcc>Ccc	p.S67P	RP11-767N6.7_ENST00000430643.1_RNA|TMEM69_ENST00000496366.1_3'UTR	NM_016486.3	NP_057570.2	Q5SWH9	TMM69_HUMAN	transmembrane protein 69	67						integral component of membrane (GO:0016021)				kidney(3)|lung(4)|ovary(1)	8	Acute lymphoblastic leukemia(166;0.155)					CTATCATACATCCCCCTGCAG	0.473																																					p.S67P		.											TMEM69,NS,carcinoma,0,1	TMEM69	0	0			c.T199C						.						236.0	235.0	236.0					1																	46159032		1966	4159	6125	SO:0001583	missense	51249	exon3			CATACATCCCCCT	BC040289, BC013608	CCDS41325.1	1p34.1	2008-02-05	2005-08-17	2005-08-17	ENSG00000159596	ENSG00000159596			28035	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 154"""	C1orf154			Standard	NM_016486		Approved	FLJ21029	uc001cor.1	Q5SWH9	OTTHUMG00000040993	ENST00000372025.4:c.199T>C	1.37:g.46159032T>C	ENSP00000361095:p.Ser67Pro	Somatic	44	0		WXS	Illumina HiSeq	.	40	2	NM_016486	Q3SWW5|Q7Z2G0|Q9P0P9	Missense_Mutation	SNP	ENST00000372025.4	37	CCDS41325.1	.	.	.	.	.	.	.	.	.	.	T	26.1	4.706014	0.89018	.	.	ENSG00000159596	ENST00000372025	.	.	.	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.68778	0.3038	L	0.36672	1.1	0.58432	D	0.999995	D	0.89917	1.0	D	0.85130	0.997	T	0.71444	-0.4591	9	0.72032	D	0.01	-13.6235	16.3634	0.83296	0.0:0.0:0.0:1.0	.	67	Q5SWH9	TMM69_HUMAN	P	67	.	ENSP00000361095:S67P	S	+	1	0	TMEM69	45931619	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	3.457000	0.53007	2.270000	0.75569	0.459000	0.35465	TCC	.		0.473	TMEM69-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098390.1	NM_016486	
FITM1	161247	hgsc.bcm.edu	37	14	24600887	24600887	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr14:24600887G>T	ENST00000267426.5	+	1	404	c.115G>T	c.(115-117)Gga>Tga	p.G39*	FITM1_ENST00000559294.1_5'Flank|RP11-468E2.6_ENST00000558325.1_Missense_Mutation_p.W226L	NM_203402.2	NP_981947.1	A5D6W6	FITM1_HUMAN	fat storage-inducing transmembrane protein 1	39					lipid particle organization (GO:0034389)|positive regulation of sequestering of triglyceride (GO:0010890)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)		p.G39R(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	11						GCTGTACTTTGGAAGCGAACA	0.667																																					p.G39X		.											FITM1,face,carcinoma,0,1	FITM1	0	1	Substitution - Missense(1)	skin(1)	c.G115T						.						39.0	43.0	42.0					14																	24600887		2203	4300	6503	SO:0001587	stop_gained	161247	exon1			TACTTTGGAAGCG		CCDS9611.1	14q12	2009-07-09			ENSG00000139914	ENSG00000139914			33714	protein-coding gene	gene with protein product	"""fat-inducing transcript 1"""	612028				18160536	Standard	NM_203402		Approved	FIT1	uc001wmf.2	A5D6W6	OTTHUMG00000133476	ENST00000267426.5:c.115G>T	14.37:g.24600887G>T	ENSP00000267426:p.Gly39*	Somatic	69	0		WXS	Illumina HiSeq	.	46	2	NM_203402	Q8IUQ7	Nonsense_Mutation	SNP	ENST00000267426.5	37	CCDS9611.1	.	.	.	.	.	.	.	.	.	.	g	35	5.506917	0.96386	.	.	ENSG00000139914	ENST00000267426	.	.	.	4.7	4.7	0.59300	.	0.273852	0.31450	N	0.007631	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	-6.0489	13.0257	0.58814	0.0:0.0:1.0:0.0	.	.	.	.	X	39	.	ENSP00000267426:G39X	G	+	1	0	FITM1	23670727	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	2.223000	0.42936	2.426000	0.82243	0.462000	0.41574	GGA	.		0.667	FITM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257366.1	NM_203402	
SMIM17	147670	hgsc.bcm.edu	37	19	57157057	57157057	+	Nonsense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr19:57157057C>T	ENST00000598409.1	+	2	188	c.22C>T	c.(22-24)Cag>Tag	p.Q8*	SMIM17_ENST00000600547.1_Nonsense_Mutation_p.Q8*	NM_001193628.1	NP_001180557.1	P0DL12	SIM17_HUMAN	small integral membrane protein 17	8						integral component of membrane (GO:0016021)											CAGGCCTGAGCAGACACGGGG	0.627																																					p.Q8X		.											.	.	.	0			c.C22T						.																																			SO:0001587	stop_gained	147670	exon2			CCTGAGCAGACAC	AK095199	CCDS58683.1	19q13.43	2013-06-21			ENSG00000268182	ENSG00000268182			27114	protein-coding gene	gene with protein product							Standard	NM_001193628		Approved		uc021vch.1	P0DL12	OTTHUMG00000177861	ENST00000598409.1:c.22C>T	19.37:g.57157057C>T	ENSP00000471126:p.Gln8*	Somatic	49	0		WXS	Illumina HiSeq	.	51	4	NM_001193628		Nonsense_Mutation	SNP	ENST00000598409.1	37	CCDS58683.1																																																																																			.		0.627	SMIM17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439277.1	NM_001193628	
MAML2	84441	hgsc.bcm.edu	37	11	95825254	95825254	+	Silent	SNP	C	C	T	rs61749250		TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr11:95825254C>T	ENST00000524717.1	-	2	3225	c.1941G>A	c.(1939-1941)caG>caA	p.Q647Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	647					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.Q647Q(1)	CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgctgctgctgttgttgct	0.512			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.Q647Q		.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	MAML2,caecum,carcinoma,0,2	MAML2	0	1	Substitution - coding silent(1)	endometrium(1)	c.G1941A						.	C		0,4198		0,0,2099	35.0	40.0	38.0		1941	1.7	0.1	11	dbSNP_129	38	5,8237		0,5,4116	no	coding-synonymous	MAML2	NM_032427.1		0,5,6215	TT,TC,CC		0.0607,0.0,0.0402		647/1157	95825254	5,12435	2099	4121	6220	SO:0001819	synonymous_variant	84441	exon2			CTGCTGCTGTTGT	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1941G>A	11.37:g.95825254C>T		Somatic	44	1		WXS	Illumina HiSeq	.	45	2	NM_032427	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																			.		0.512	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
ERBB4	2066	hgsc.bcm.edu	37	2	212566887	212566887	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr2:212566887G>T	ENST00000342788.4	-	12	1604	c.1294C>A	c.(1294-1296)Ctg>Atg	p.L432M	ERBB4_ENST00000436443.1_Missense_Mutation_p.L432M|ERBB4_ENST00000402597.1_Missense_Mutation_p.L432M	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	432					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.L432M(1)		NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	AGCAAGGACAGGCCACTAAGG	0.428										TSP Lung(8;0.080)																											p.L432M		.											ERBB4,caecum,carcinoma,0,1	ERBB4	0	1	Substitution - Missense(1)	large_intestine(1)	c.C1294A						.						97.0	91.0	93.0					2																	212566887		2203	4300	6503	SO:0001583	missense	2066	exon12			AGGACAGGCCACT	L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.1294C>A	2.37:g.212566887G>T	ENSP00000342235:p.Leu432Met	Somatic	52	0		WXS	Illumina HiSeq	.	41	2	NM_001042599	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	ENST00000342788.4	37	CCDS2394.1	.	.	.	.	.	.	.	.	.	.	G	16.20	3.055159	0.55325	.	.	ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597	T;T;T	0.44482	0.92;0.92;0.92	5.71	5.71	0.89125	EGF receptor, L domain (1);	0.052531	0.85682	D	0.000000	T	0.46268	0.1384	L	0.31578	0.945	0.43830	D	0.996408	P;P;P;P;P	0.51240	0.896;0.657;0.943;0.896;0.915	P;P;P;P;P	0.62649	0.846;0.599;0.792;0.846;0.905	T	0.30119	-0.9989	10	0.33141	T	0.24	.	9.0523	0.36383	0.0731:0.0:0.7792:0.1476	.	432;432;291;432;432	Q15303-4;Q15303-2;Q53QS8;Q15303-3;Q15303	.;.;.;.;ERBB4_HUMAN	M	432	ENSP00000342235:L432M;ENSP00000403204:L432M;ENSP00000385565:L432M	ENSP00000342235:L432M	L	-	1	2	ERBB4	212275132	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.881000	0.63114	2.712000	0.92718	0.650000	0.86243	CTG	.		0.428	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599	
MT-ND1	4535	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	M	3850	3850	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chrM:3850G>A	ENST00000361390.2	+	1	544	c.544G>A	c.(544-546)Gcc>Acc	p.A182T	MT-TI_ENST00000387365.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-CO1_ENST00000361624.2_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TL1_ENST00000386347.1_RNA|MT-ND2_ENST00000361453.3_5'Flank|MT-TW_ENST00000387382.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TY_ENST00000387409.1_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1	182					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	CATGACCCTTGGCCATAATAT	0.458																																					p.A182T		.											.	.	.	0			c.G544A						.																																			SO:0001583	missense	10625	exon1			CCCTTGGCCATAA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886		ENST00000361390.2:c.544G>A	M.37:g.3850G>A	ENSP00000354687:p.Ala182Thr	Somatic	17	0		WXS	Illumina HiSeq	.	66	11	ENST00000361390	C0JKH6|Q37523	Missense_Mutation	SNP	ENST00000361390.2	37																																																																																				.		0.458	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024026	
ZFP64	55734	hgsc.bcm.edu	37	20	50768700	50768700	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr20:50768700G>T	ENST00000216923.4	-	6	2380	c.2031C>A	c.(2029-2031)gaC>gaA	p.D677E	ZFP64_ENST00000371518.2_Intron|ZFP64_ENST00000371515.4_Missense_Mutation_p.D675E|ZFP64_ENST00000361387.2_Intron|ZFP64_ENST00000477786.1_Intron|ZFP64_ENST00000346617.4_Missense_Mutation_p.D623E	NM_018197.2|NM_199426.1	NP_060667.2|NP_955458.1	Q9NPA5	ZF64A_HUMAN	ZFP64 zinc finger protein	677					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(5)|large_intestine(8)|lung(11)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	33						CTGGAATGGAGTCGGCGGGAC	0.463																																					p.D677E		.											.	.	.	0			c.C2031A						.						55.0	53.0	54.0					20																	50768700		2202	4300	6502	SO:0001583	missense	55734	exon6			AATGGAGTCGGCG	AK001596	CCDS13439.1, CCDS13440.1, CCDS13441.1, CCDS13442.1	20q13.11-q13.13	2013-01-08	2012-11-27		ENSG00000020256	ENSG00000020256		"""Zinc fingers, C2H2-type"""	15940	protein-coding gene	gene with protein product			"""zinc finger protein 338"", ""zinc finger protein 64 homolog (mouse)"", ""zinc finger protein 64"""	ZNF338		9034307	Standard	NM_199427		Approved	FLJ10734, dJ831D17.1, FLJ12628, dJ548G19.1	uc002xwl.3	Q9NPA5	OTTHUMG00000032756	ENST00000216923.4:c.2031C>A	20.37:g.50768700G>T	ENSP00000216923:p.Asp677Glu	Somatic	42	0		WXS	Illumina HiSeq	.	53	4	NM_018197	Q9NTS7|Q9NVH4	Missense_Mutation	SNP	ENST00000216923.4	37	CCDS13440.1	.	.	.	.	.	.	.	.	.	.	G	12.52	1.962709	0.34659	.	.	ENSG00000020256	ENST00000216923;ENST00000346617;ENST00000371515;ENST00000546083	T;T;T	0.11495	2.79;2.82;2.77	5.44	-2.23	0.06930	.	0.000000	0.64402	D	0.000014	T	0.08537	0.0212	L	0.32530	0.975	0.34802	D	0.736853	P;P;P	0.41748	0.761;0.648;0.648	B;B;B	0.39465	0.3;0.158;0.158	T	0.13683	-1.0500	10	0.87932	D	0	-19.2467	13.3986	0.60870	0.3566:0.0:0.6434:0.0	.	623;675;677	Q9NPA5-2;Q5JWM1;Q9NPA5	.;.;ZF64A_HUMAN	E	677;623;675;519	ENSP00000216923:D677E;ENSP00000344615:D623E;ENSP00000360570:D675E	ENSP00000216923:D677E	D	-	3	2	ZFP64	50202107	0.605000	0.26941	0.672000	0.29872	0.249000	0.25844	-0.346000	0.07760	-0.337000	0.08426	0.650000	0.86243	GAC	.		0.463	ZFP64-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079744.1	NM_018197	
KRBA2	124751	hgsc.bcm.edu	37	17	8274670	8274670	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr17:8274670G>T	ENST00000331336.2	-	1	188	c.183C>A	c.(181-183)taC>taA	p.Y61*	KRBA2_ENST00000396267.1_Intron|RP11-849F2.5_ENST00000580537.1_RNA|RP11-849F2.5_ENST00000583963.1_RNA|RP11-849F2.7_ENST00000582471.1_3'UTR	NM_213597.2	NP_998762.1	Q6ZNG9	KRBA2_HUMAN	KRAB-A domain containing 2	61	KRAB.				DNA integration (GO:0015074)|regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	nucleic acid binding (GO:0003676)			endometrium(2)|kidney(2)|large_intestine(7)|lung(5)|stomach(1)|urinary_tract(1)	18						TTGTGTCTCTGTAGCAATCCT	0.438																																					p.Y61X		.											.	.	.	0			c.C183A						.						141.0	140.0	140.0					17																	8274670		2203	4300	6503	SO:0001587	stop_gained	124751	exon1			GTCTCTGTAGCAA	BC024723	CCDS11141.1	17p13.1	2013-01-08	2006-08-15		ENSG00000184619	ENSG00000184619		"""-"""	26989	protein-coding gene	gene with protein product			"""KRAB A domain containing 2"""			12477932	Standard	NM_213597		Approved		uc002glf.1	Q6ZNG9	OTTHUMG00000132864	ENST00000331336.2:c.183C>A	17.37:g.8274670G>T	ENSP00000328017:p.Tyr61*	Somatic	70	0		WXS	Illumina HiSeq	.	76	3	NM_213597	Q8IYY0	Nonsense_Mutation	SNP	ENST00000331336.2	37	CCDS11141.1	.	.	.	.	.	.	.	.	.	.	G	10.79	1.448682	0.26074	.	.	ENSG00000184619	ENST00000331336	.	.	.	2.21	0.068	0.14368	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.532	0.12010	0.0:0.2505:0.4929:0.2566	.	.	.	.	X	61	.	ENSP00000328017:Y61X	Y	-	3	2	KRBA2	8215395	0.170000	0.23016	0.006000	0.13384	0.026000	0.11368	3.013000	0.49582	0.051000	0.15978	-0.304000	0.09214	TAC	.		0.438	KRBA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256338.1	NM_213597	
TPM3	7170	hgsc.bcm.edu	37	1	154144580	154144580	+	Intron	SNP	G	G	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr1:154144580G>A	ENST00000368530.2	-	6	759				TPM3_ENST00000302206.5_Intron|TPM3_ENST00000341372.3_Splice_Site_p.S127S|TPM3_ENST00000328159.4_Splice_Site_p.S152S|TPM3_ENST00000368531.2_Splice_Site_p.S152S|TPM3_ENST00000368533.3_Splice_Site_p.S152S|TPM3_ENST00000469717.1_5'UTR|TPM3_ENST00000341485.5_Splice_Site_p.S136S|TPM3_ENST00000330188.9_Intron|TPM3_ENST00000323144.7_Intron|TPM3_ENST00000271850.7_Splice_Site_p.S189S	NM_152263.2	NP_689476.2	P06753	TPM3_HUMAN	tropomyosin 3						cellular component movement (GO:0006928)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle thin filament tropomyosin (GO:0005862)|stress fiber (GO:0001725)			TPM3/NTRK1_ENST00000392302(70)|TPM3/ALK(33)	breast(1)|endometrium(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)					CTCGGCAACGGCTGTTAGTGA	0.473			T	"""NTRK1, ALK, ROS1"""	"""papillary thyroid, ALCL, NSCLC"""																																p.S152S		.		Dom	yes		1	1q22-q23	7170	tropomyosin 3		"""E, L"""	.	.	.	0			c.C456T						.						165.0	157.0	160.0					1																	154144580		2203	4300	6503	SO:0001627	intron_variant	7170	exon5			GCAACGGCTGTTA	BC008425	CCDS1060.1, CCDS41400.1, CCDS41401.1, CCDS41402.1, CCDS41403.1, CCDS60274.1, CCDS60275.1, CCDS72922.1	1q21.2	2014-09-17			ENSG00000143549	ENSG00000143549		"""Tropomyosins"""	12012	protein-coding gene	gene with protein product		191030		NEM1		1829807	Standard	NM_153649		Approved	TRK	uc001fec.2	P06753	OTTHUMG00000035853	ENST00000368530.2:c.567-616C>T	1.37:g.154144580G>A		Somatic	61	0		WXS	Illumina HiSeq	.	58	3	NM_001043352	D3DV71|P12324|Q2QD06|Q5VU58|Q5VU63|Q5VU66|Q5VU71|Q5VU72|Q8TCG3|Q969Q2|Q9NQH8	Silent	SNP	ENST00000368530.2	37	CCDS41403.1																																																																																			.		0.473	TPM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087271.2	NM_152263	
PYURF	100996939	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	89443125	89443125	+	Missense_Mutation	SNP	T	T	C			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr4:89443125T>C	ENST00000273968.4	-	2	371	c.259A>G	c.(259-261)Atc>Gtc	p.I87V	HERC3_ENST00000601319.1_3'UTR|PIGY_ENST00000527353.1_5'Flank	NM_001042616.2|NM_032906.4	NP_001036081.1|NP_116295.1	Q96I23	PREY_HUMAN	PIGY upstream reading frame	87	TRM112.				GPI anchor biosynthetic process (GO:0006506)|positive regulation of metabolic process (GO:0009893)	endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|mitochondrion (GO:0005739)											CCATCAATGATTGGATAAGCT	0.363																																					p.I87V		.											.	.	.	0			c.A259G						.						195.0	149.0	163.0					4																	89443125		692	1591	2283	SO:0001583	missense	100996939	exon2			CAATGATTGGATA			4q22.1	2012-08-14			ENSG00000145337	ENSG00000145337			44317	protein-coding gene	gene with protein product						16162815	Standard	NM_032906		Approved	PreY	uc003hru.2	Q96I23	OTTHUMG00000130949	ENST00000273968.4:c.259A>G	4.37:g.89443125T>C	ENSP00000273968:p.Ile87Val	Somatic	50	0		WXS	Illumina HiSeq	.	32	12	NM_032906	B2R571	Missense_Mutation	SNP	ENST00000273968.4	37	CCDS3631.1	.	.	.	.	.	.	.	.	.	.	T	15.59	2.878101	0.51801	.	.	ENSG00000145337	ENST00000273968	.	.	.	4.86	-1.98	0.07480	.	0.157042	0.56097	N	0.000030	T	0.42988	0.1227	L	0.47716	1.5	0.35708	D	0.816176	B	0.25048	0.117	B	0.31812	0.136	T	0.48328	-0.9045	8	0.48119	T	0.1	-13.9776	10.2323	0.43262	0.0:0.3544:0.0:0.6456	.	87	Q96I23	PREY_HUMAN	V	87	.	ENSP00000273968:I87V	I	-	1	0	PIGY	89662148	0.278000	0.24230	0.995000	0.50966	0.956000	0.61745	0.313000	0.19415	-0.180000	0.10637	-0.250000	0.11733	ATC	.		0.363	PYURF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253550.1	NM_032906.4	
DEFA3	1668	hgsc.bcm.edu	37	8	6873578	6873578	+	Silent	SNP	G	G	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr8:6873578G>A	ENST00000327857.2	-	3	310	c.219C>T	c.(217-219)tgC>tgT	p.C73C	DEFA1B_ENST00000535841.1_Intron	NM_005217.3	NP_005208.1	P59666	DEF3_HUMAN	defensin, alpha 3, neutrophil-specific	73					antibacterial humoral response (GO:0019731)|defense response to fungus (GO:0050832)|defense response to Gram-positive bacterium (GO:0050830)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|innate immune response in mucosa (GO:0002227)|intracellular estrogen receptor signaling pathway (GO:0030520)|killing of cells of other organism (GO:0031640)	azurophil granule lumen (GO:0035578)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.C73C(1)		endometrium(1)|prostate(2)	3				COAD - Colon adenocarcinoma(149;0.0561)|READ - Rectum adenocarcinoma(644;0.118)		CTCCTGCAATGCACGCTGGTA	0.463																																					p.C73C		.											DEFA3,NS,carcinoma,0,1	DEFA3	0	1	Substitution - coding silent(1)	endometrium(1)	c.C219T						.						116.0	87.0	96.0					8																	6873578		1914	4089	6003	SO:0001819	synonymous_variant	1667	exon3			TGCAATGCACGCT	M23281	CCDS5962.1	8p23.1	2009-08-05			ENSG00000239839	ENSG00000239839		"""Defensins, alpha"""	2762	protein-coding gene	gene with protein product		604522		DEF3		8477861, 17214878, 15944200	Standard	NM_005217		Approved	HNP-3		P59666	OTTHUMG00000090381	ENST00000327857.2:c.219C>T	8.37:g.6873578G>A		Somatic	70	0		WXS	Illumina HiSeq	.	69	3	NM_004084	P11479|Q14125	Silent	SNP	ENST00000327857.2	37	CCDS5962.1																																																																																			.		0.463	DEFA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206753.2	NM_005217	
COL4A3	1285	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	228148934	228148934	+	Silent	SNP	T	T	C			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr2:228148934T>C	ENST00000396578.3	+	34	2916	c.2754T>C	c.(2752-2754)ccT>ccC	p.P918P	AC097662.2_ENST00000433324.1_RNA|AC097662.2_ENST00000439598.2_RNA|AC097662.2_ENST00000396588.2_RNA	NM_000091.4	NP_000082.2	Q01955	CO4A3_HUMAN	collagen, type IV, alpha 3 (Goodpasture antigen)	918	Triple-helical region.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|blood circulation (GO:0008015)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|collagen catabolic process (GO:0030574)|endothelial cell apoptotic process (GO:0072577)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|sensory perception of sound (GO:0007605)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metalloendopeptidase inhibitor activity (GO:0008191)|structural molecule activity (GO:0005198)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		TAGGGAGCCCTGGAATTCCAG	0.463																																					p.P918P		.											.	.	.	0			c.T2754C						.						51.0	57.0	55.0					2																	228148934		1834	4083	5917	SO:0001819	synonymous_variant	1285	exon34			GAGCCCTGGAATT		CCDS42829.1	2q36-q37	2014-09-17			ENSG00000169031	ENSG00000169031		"""Collagens"""	2204	protein-coding gene	gene with protein product	"""tumstatin"""	120070				1737849	Standard	NM_000091		Approved		uc002vom.2	Q01955	OTTHUMG00000149891	ENST00000396578.3:c.2754T>C	2.37:g.228148934T>C		Somatic	71	0		WXS	Illumina HiSeq	.	62	4	NM_000091	Q53QQ1|Q53R14|Q53RW8|Q9BQT2|Q9NYC4|Q9UDJ9|Q9UDK9|Q9UDL0|Q9UDL1	Silent	SNP	ENST00000396578.3	37	CCDS42829.1																																																																																			.		0.463	COL4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331409.2	NM_000091	
LRIT3	345193	hgsc.bcm.edu	37	4	110788871	110788871	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr4:110788871G>A	ENST00000594814.1	+	3	664	c.664G>A	c.(664-666)Gct>Act	p.A222T	LRIT3_ENST00000327908.3_Missense_Mutation_p.A39T|LRIT3_ENST00000379920.3_Missense_Mutation_p.A177T|LRIT3_ENST00000409621.2_Missense_Mutation_p.A39T	NM_198506.3	NP_940908.3	Q3SXY7	LRIT3_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 3	222	LRRCT.				regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.A39S(1)		cervix(1)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)|skin(1)	16				OV - Ovarian serous cystadenocarcinoma(123;0.0011)		CGTTGACCCTGCTATAGTGCT	0.453																																					p.A222T		.											LRIT3,ear,carcinoma,0,1	LRIT3	0	1	Substitution - Missense(1)	skin(1)	c.G664A						.						148.0	124.0	132.0					4																	110788871		2203	4300	6503	SO:0001583	missense	345193	exon3			GACCCTGCTATAG	AK126648	CCDS3688.2, CCDS3688.3	4q25	2014-01-28	2007-06-19		ENSG00000183423	ENSG00000183423		"""Immunoglobulin superfamily / I-set domain containing"""	24783	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 4"""	615004					Standard	NM_198506		Approved	FLJ44691, FIGLER4, CSNB1F	uc031sgv.1	Q3SXY7	OTTHUMG00000132043	ENST00000594814.1:c.664G>A	4.37:g.110788871G>A	ENSP00000469759:p.Ala222Thr	Somatic	46	1		WXS	Illumina HiSeq	.	34	3	NM_198506	C9J1C2|Q6ZTG1	Missense_Mutation	SNP	ENST00000594814.1	37	CCDS3688.3	.	.	.	.	.	.	.	.	.	.	G	1.845	-0.466434	0.04476	.	.	ENSG00000183423	ENST00000327908;ENST00000379920;ENST00000409621	T;T;T	0.57595	0.39;0.72;0.39	5.88	-1.37	0.09056	.	0.486130	0.24296	N	0.039780	T	0.21761	0.0524	N	0.11560	0.145	0.09310	N	1	B;B	0.21821	0.007;0.061	B;B	0.18263	0.004;0.021	T	0.06752	-1.0809	10	0.19590	T	0.45	.	1.3567	0.02184	0.4343:0.1005:0.1961:0.2691	.	177;39	Q3SXY7;Q3SXY7-2	LRIT3_HUMAN;.	T	39;177;39	ENSP00000328222:A39T;ENSP00000369252:A177T;ENSP00000386734:A39T	ENSP00000328222:A39T	A	+	1	0	LRIT3	111008320	0.000000	0.05858	0.000000	0.03702	0.089000	0.18198	-0.006000	0.12833	-0.158000	0.11040	0.655000	0.94253	GCT	.		0.453	LRIT3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335270.2	NM_198506	
IL9R	3581	hgsc.bcm.edu	37	X	155232673	155232673	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chrX:155232673G>T	ENST00000244174.5	+	2	310	c.131G>T	c.(130-132)gGg>gTg	p.G44V	IL9R_ENST00000424344.3_Missense_Mutation_p.G23V|IL9R_ENST00000369423.2_Missense_Mutation_p.G91V|IL9R_ENST00000540897.1_Missense_Mutation_p.G81V	NM_002186.2	NP_002177.2	Q01113	IL9R_HUMAN	interleukin 9 receptor	44					cell proliferation (GO:0008283)|positive regulation of cell growth (GO:0030307)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	interleukin-9 receptor activity (GO:0004919)	p.G44V(1)		NS(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(12)|upper_aerodigestive_tract(1)	23	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TCTGTCACAGGGGAAGGACAA	0.587																																					p.G91V		.											.	.	.	1	Substitution - Missense(1)	lung(1)	c.G272T						.						180.0	175.0	177.0					X																	155232673		2203	4296	6499	SO:0001583	missense	3581	exon3			TCACAGGGGAAGG	M84747	CCDS14771.4, CCDS59180.1	Xq28 and Yq12	2008-02-05			ENSG00000124334	ENSG00000124334		"""Pseudoautosomal regions / PAR2"", ""Interleukins and interleukin receptors"", ""CD molecules"""	6030	protein-coding gene	gene with protein product		300007				1376929, 8666384	Standard	NM_002186		Approved	CD129	uc004fnv.1	Q01113	OTTHUMG00000022720	ENST00000244174.5:c.131G>T	X.37:g.155232673G>T	ENSP00000244174:p.Gly44Val	Somatic	79	0		WXS	Illumina HiSeq	.	81	4	NM_176786	B9ZVT0|Q14634|Q8WWU1|Q96TF0	Missense_Mutation	SNP	ENST00000244174.5	37	CCDS14771.4	.	.	.	.	.	.	.	.	.	.	g	9.329	1.060052	0.19987	.	.	ENSG00000124334	ENST00000244174;ENST00000424344;ENST00000455739;ENST00000369423;ENST00000540897	T;T;T;T	0.34667	1.35;1.35;1.35;1.35	1.29	-2.3	0.06785	.	2.169470	0.02215	N	0.063550	T	0.45357	0.1338	.	.	.	0.09310	N	1	P;P;D	0.55172	0.928;0.741;0.97	P;B;P	0.56563	0.66;0.426;0.801	T	0.39078	-0.9631	9	0.46703	T	0.11	-5.0637	5.4356	0.16480	0.4992:0.0:0.5008:0.0	.	23;44;91	F5H3Z0;Q01113;B9ZVT0	.;IL9R_HUMAN;.	V	44;23;23;91;81	ENSP00000244174:G44V;ENSP00000388918:G23V;ENSP00000358431:G91V;ENSP00000438112:G81V	ENSP00000244174:G44V	G	+	2	0	IL9R	154885867	0.122000	0.22280	0.005000	0.12908	0.065000	0.16274	-0.093000	0.11111	-1.115000	0.02973	-1.346000	0.01242	GGG	.		0.587	IL9R-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058981.1	NM_002186	
ST5	6764	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	8752429	8752429	+	Missense_Mutation	SNP	C	C	G			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr11:8752429C>G	ENST00000534127.1	-	6	793	c.408G>C	c.(406-408)caG>caC	p.Q136H	ST5_ENST00000526757.1_Intron|ST5_ENST00000530438.1_Intron|ST5_ENST00000357665.1_Missense_Mutation_p.Q136H|ST5_ENST00000313726.6_Missense_Mutation_p.Q136H	NM_005418.3	NP_005409.3	P78524	ST5_HUMAN	suppression of tumorigenicity 5	136					positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(13)|liver(1)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	39				Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)		ATGGCGTGCTCTGGGCAAGGG	0.667																																					p.Q136H		.											.	.	.	0			c.G408C						.						37.0	45.0	43.0					11																	8752429		2201	4295	6496	SO:0001583	missense	6764	exon6			CGTGCTCTGGGCA	U15131	CCDS7791.1, CCDS7792.1	11p15	2012-10-04				ENSG00000166444		"""DENN/MADD domain containing"""	11350	protein-coding gene	gene with protein product	"""DENN/MADD domain containing 2B"""	140750				1390339	Standard	NM_005418		Approved	HTS1, DENND2B, p126	uc001mgt.3	P78524		ENST00000534127.1:c.408G>C	11.37:g.8752429C>G	ENSP00000433528:p.Gln136His	Somatic	34	0		WXS	Illumina HiSeq	.	31	9	NM_005418	B2R6X7|B3KXQ6|P78523|Q16492|Q7KYY2|Q7KZ12|Q8NE12|Q9BQQ6	Missense_Mutation	SNP	ENST00000534127.1	37	CCDS7791.1	.	.	.	.	.	.	.	.	.	.	C	6.978	0.550453	0.13374	.	.	ENSG00000166444	ENST00000534127;ENST00000313726;ENST00000357665;ENST00000528523;ENST00000527930;ENST00000533681;ENST00000526241;ENST00000530959;ENST00000533580	T;T;T	0.05139	3.49;3.49;3.49	5.87	2.76	0.32466	.	0.794745	0.12439	N	0.468831	T	0.08537	0.0212	L	0.47716	1.5	0.31839	N	0.623767	B	0.02656	0.0	B	0.01281	0.0	T	0.03875	-1.0996	10	0.56958	D	0.05	-3.3912	13.9428	0.64066	0.0:0.6225:0.3141:0.0634	.	136	P78524	ST5_HUMAN	H	136;136;136;136;166;136;136;136;153	ENSP00000433528:Q136H;ENSP00000319678:Q136H;ENSP00000350294:Q136H	ENSP00000319678:Q136H	Q	-	3	2	ST5	8709005	1.000000	0.71417	1.000000	0.80357	0.158000	0.22134	1.639000	0.37176	0.803000	0.34113	-0.140000	0.14226	CAG	.		0.667	ST5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386518.1	NM_005418	
CTSW	1521	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	65647690	65647690	+	Silent	SNP	G	G	A	rs559592357		TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr11:65647690G>A	ENST00000307886.3	+	2	151	c.105G>A	c.(103-105)ccG>ccA	p.P35P	CTSW_ENST00000528419.1_Silent_p.P35P	NM_001335.3	NP_001326	P56202	CATW_HUMAN	cathepsin W	35					immune response (GO:0006955)	membrane (GO:0016020)	cysteine-type peptidase activity (GO:0008234)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(5)	9				READ - Rectum adenocarcinoma(159;0.168)		GTCCCCAGCCGCTAGAGCTGA	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		17884	0.0		0.0	False		,,,				2504	0.001				p.P35P		.											.	.	.	0			c.G105A						.						71.0	68.0	69.0					11																	65647690		2201	4296	6497	SO:0001819	synonymous_variant	1521	exon2			CCAGCCGCTAGAG	AF055903	CCDS8117.1	11q13.1	2008-02-01	2006-12-05		ENSG00000172543	ENSG00000172543		"""Cathepsins"""	2546	protein-coding gene	gene with protein product		602364	"""cathepsin W (lymphopain)"""			9108299, 9675123	Standard	NM_001335		Approved		uc001ogc.1	P56202	OTTHUMG00000166663	ENST00000307886.3:c.105G>A	11.37:g.65647690G>A		Somatic	96	0		WXS	Illumina HiSeq	.	104	30	NM_001335	Q86VT4	Silent	SNP	ENST00000307886.3	37	CCDS8117.1																																																																																			.		0.577	CTSW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391042.1	NM_001335	
A2MP1	3	hgsc.bcm.edu	37	12	9384345	9384345	+	RNA	SNP	C	C	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr12:9384345C>A	ENST00000543404.1	-	0	730					NR_040112.1				alpha-2-macroglobulin pseudogene 1																		TCTTGGAATTCATTCAAGACA	0.328																																					.		.											.	.	.	0			.						.																																					3	.			GGAATTCATTCAA	M24415		12p13.31	2012-05-16	2010-02-24	2010-02-24	ENSG00000256069	ENSG00000256069			8	pseudogene	pseudogene			"""alpha-2-macroglobulin pseudogene"""	A2MP		2478422	Standard	NR_040112		Approved		uc021qum.1		OTTHUMG00000168334		12.37:g.9384345C>A		Somatic	97	0		WXS	Illumina HiSeq	.	92	4	.		RNA	SNP	ENST00000543404.1	37																																																																																				.		0.328	A2MP1-004	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000399345.2	NG_001067	
SHC4	399694	hgsc.bcm.edu	37	15	49255141	49255141	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr15:49255141C>T	ENST00000332408.4	-	1	500	c.72G>A	c.(70-72)atG>atA	p.M24I		NM_203349.3	NP_976224.3	Q6S5L8	SHC4_HUMAN	SHC (Src homology 2 domain containing) family, member 4	24	CH2.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of cell proliferation (GO:0008284)|regulation of gene expression (GO:0010468)|stem cell differentiation (GO:0048863)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)		p.M24I(1)		breast(1)|endometrium(2)|large_intestine(8)|lung(11)|ovary(3)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	29		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)		CCCTGTGCAGCATCCCGGGGT	0.622																																					p.M24I		.											SHC4,NS,carcinoma,0,1	SHC4	0	1	Substitution - Missense(1)	lung(1)	c.G72A						.						73.0	79.0	77.0					15																	49255141		2195	4294	6489	SO:0001583	missense	399694	exon1			GTGCAGCATCCCG	AY358250	CCDS10130.1	15q21.1-q21.2	2013-02-14			ENSG00000185634	ENSG00000185634		"""SH2 domain containing"""	16743	protein-coding gene	gene with protein product	"""rai-like protein"""						Standard	NM_203349		Approved	RaLP	uc001zxb.1	Q6S5L8	OTTHUMG00000131513	ENST00000332408.4:c.72G>A	15.37:g.49255141C>T	ENSP00000329668:p.Met24Ile	Somatic	50	0		WXS	Illumina HiSeq	.	59	3	NM_203349	Q6UXQ3|Q8IYW3	Missense_Mutation	SNP	ENST00000332408.4	37	CCDS10130.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.557075	0.86231	.	.	ENSG00000185634	ENST00000332408	T	0.07567	3.18	4.63	4.63	0.57726	.	0.000000	0.64402	D	0.000001	T	0.27241	0.0668	M	0.64404	1.975	0.80722	D	1	D	0.69078	0.997	D	0.75484	0.986	T	0.01290	-1.1394	10	0.72032	D	0.01	1.5243	17.3133	0.87215	0.0:1.0:0.0:0.0	.	24	Q6S5L8	SHC4_HUMAN	I	24	ENSP00000329668:M24I	ENSP00000329668:M24I	M	-	3	0	SHC4	47042433	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.466000	0.73543	2.401000	0.81631	0.655000	0.94253	ATG	.		0.622	SHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254371.1	NM_203349	
PRSS37	136242	hgsc.bcm.edu	37	7	141536247	141536247	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr7:141536247G>T	ENST00000350549.3	-	5	1027	c.656C>A	c.(655-657)aCc>aAc	p.T219N	PRSS37_ENST00000438520.1_Missense_Mutation_p.T219N	NM_001008270.2|NM_001171951.1	NP_001008271.2|NP_001165422.1	A4D1T9	PRS37_HUMAN	protease, serine, 37	219	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				binding of sperm to zona pellucida (GO:0007339)|cell migration (GO:0016477)|protein maturation (GO:0051604)	extracellular region (GO:0005576)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)	p.T219N(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|skin(3)	15						GTAAACATTGGTGTAGATGCC	0.517																																					p.T219N		.											PRSS37,NS,carcinoma,0,1	PRSS37	0	1	Substitution - Missense(1)	lung(1)	c.C656A						.						209.0	177.0	188.0					7																	141536247		2203	4300	6503	SO:0001583	missense	136242	exon5			ACATTGGTGTAGA		CCDS34764.1	7q34	2010-05-07			ENSG00000165076	ENSG00000165076		"""Serine peptidases / Serine peptidases"""	29211	protein-coding gene	gene with protein product							Standard	NM_001008270		Approved		uc003vws.2	A4D1T9	OTTHUMG00000157174	ENST00000350549.3:c.656C>A	7.37:g.141536247G>T	ENSP00000297767:p.Thr219Asn	Somatic	47	0		WXS	Illumina HiSeq	.	44	2	NM_001008270	B2RPB5	Missense_Mutation	SNP	ENST00000350549.3	37	CCDS34764.1	.	.	.	.	.	.	.	.	.	.	g	17.94	3.510572	0.64522	.	.	ENSG00000165076	ENST00000350549;ENST00000438520	T;T	0.54479	0.57;0.57	5.28	5.28	0.74379	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.64402	D	0.000017	T	0.73768	0.3629	M	0.83483	2.645	0.43230	D	0.995128	D;D	0.57571	0.98;0.98	D;D	0.65573	0.936;0.936	T	0.77216	-0.2669	10	0.72032	D	0.01	.	16.4526	0.83997	0.0:0.0:1.0:0.0	.	218;219	B7ZMK3;A4D1T9	.;PRS37_HUMAN	N	219	ENSP00000297767:T219N;ENSP00000414461:T219N	ENSP00000297767:T219N	T	-	2	0	PRSS37	141182716	1.000000	0.71417	0.997000	0.53966	0.317000	0.28152	5.664000	0.68045	2.761000	0.94854	0.585000	0.79938	ACC	.		0.517	PRSS37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347763.1	NM_001008270	
FUT6	2528	hgsc.bcm.edu	37	19	5831808	5831808	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr19:5831808C>A	ENST00000318336.4	-	3	1965	c.771G>T	c.(769-771)gaG>gaT	p.E257D	FUT6_ENST00000524754.1_Missense_Mutation_p.E257D|FUT6_ENST00000286955.5_Missense_Mutation_p.E257D|FUT6_ENST00000592563.1_Missense_Mutation_p.E257D|FUT6_ENST00000527106.1_Missense_Mutation_p.E257D	NM_000150.2	NP_000141.1	P51993	FUT6_HUMAN	fucosyltransferase 6 (alpha (1,3) fucosyltransferase)	257					fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity (GO:0017060)|alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			endometrium(2)|kidney(1)|large_intestine(1)|lung(2)	6						TCCACAGCTTCTCGGTGATGT	0.632																																					p.E257D		.											FUT6,NS,carcinoma,0,1	FUT6	0	0			c.G771T						.						53.0	56.0	55.0					19																	5831808		2202	4277	6479	SO:0001583	missense	2528	exon3			CAGCTTCTCGGTG		CCDS12152.1	19p13.3	2013-02-26			ENSG00000156413	ENSG00000156413	2.4.1.65	"""Fucosyltransferases"""	4017	protein-coding gene	gene with protein product	"""alpha-(1,3)-fucosyltransferase"", ""galactoside 3-L-fucosyltransferase"""	136836				1520296, 7782074	Standard	NM_001040701		Approved	FT1A, FCT3A, FucT-VI, FLJ40754	uc002mdh.1	P51993	OTTHUMG00000167335	ENST00000318336.4:c.771G>T	19.37:g.5831808C>A	ENSP00000313398:p.Glu257Asp	Somatic	44	0		WXS	Illumina HiSeq	.	58	4	NM_000150	A6NEX0|D6W637|Q9UND8	Missense_Mutation	SNP	ENST00000318336.4	37	CCDS12152.1	.	.	.	.	.	.	.	.	.	.	C	15.89	2.965602	0.53507	.	.	ENSG00000156413	ENST00000524754;ENST00000527106;ENST00000318336;ENST00000286955;ENST00000341530	T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14	3.07	3.07	0.35406	.	0.000000	0.64402	D	0.000018	T	0.82195	0.4984	H	0.96239	3.79	0.32324	N	0.561958	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.84504	0.0618	10	0.87932	D	0	.	6.7607	0.23538	0.0:0.8576:0.0:0.1424	.	257;257	C9J8A2;P51993	.;FUT6_HUMAN	D	257	ENSP00000431708:E257D;ENSP00000432954:E257D;ENSP00000313398:E257D;ENSP00000286955:E257D	ENSP00000286955:E257D	E	-	3	2	FUT6	5782808	1.000000	0.71417	0.998000	0.56505	0.424000	0.31475	1.652000	0.37313	1.677000	0.50941	0.430000	0.28490	GAG	.		0.632	FUT6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394218.2	NM_000150	
TRIM29	23650	hgsc.bcm.edu	37	11	120008077	120008077	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr11:120008077C>A	ENST00000341846.5	-	1	1084	c.663G>T	c.(661-663)gaG>gaT	p.E221D		NM_012101.3	NP_036233.2	Q14134	TRI29_HUMAN	tripartite motif containing 29	221					negative regulation of protein localization to nucleus (GO:1900181)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(17)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	30		Breast(109;0.00117)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.37e-06)		ACTTGCGGGCCTCAAAGTCCC	0.617																																					p.E221D		.											TRIM29,NS,carcinoma,0,1	TRIM29	0	0			c.G663T						.						55.0	57.0	56.0					11																	120008077		2203	4300	6503	SO:0001583	missense	23650	exon1			GCGGGCCTCAAAG	AF230388	CCDS8428.1	11q23.3	2011-04-20	2011-01-25		ENSG00000137699	ENSG00000137699		"""Tripartite motif containing / Tripartite motif containing"""	17274	protein-coding gene	gene with protein product	"""tripartite motif protein TRIM29"", ""ataxia-telangiectasia group D-associated protein"""	610658	"""tripartite motif-containing 29"""			11331580	Standard	NM_012101		Approved	ATDC, FLJ36085	uc001pwz.3	Q14134	OTTHUMG00000140377	ENST00000341846.5:c.663G>T	11.37:g.120008077C>A	ENSP00000343129:p.Glu221Asp	Somatic	38	0		WXS	Illumina HiSeq	.	28	2	NM_012101	Q96AA9|Q9BZY7	Missense_Mutation	SNP	ENST00000341846.5	37	CCDS8428.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.964729	0.74131	.	.	ENSG00000137699	ENST00000341846	T	0.46063	0.88	5.91	4.99	0.66335	Zinc finger, B-box (3);	0.000000	0.64402	D	0.000001	T	0.48409	0.1498	N	0.25485	0.75	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.29579	-1.0007	9	.	.	.	.	12.3193	0.54975	0.0:0.8403:0.0:0.1597	.	221	Q14134	TRI29_HUMAN	D	221	ENSP00000343129:E221D	.	E	-	3	2	TRIM29	119513287	0.976000	0.34144	1.000000	0.80357	0.998000	0.95712	0.191000	0.17076	2.793000	0.96121	0.655000	0.94253	GAG	.		0.617	TRIM29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277108.2	NM_012101	
TMEM127	55654	hgsc.bcm.edu	37	2	96933103	96933103	+	5'Flank	SNP	C	C	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr2:96933103C>A	ENST00000258439.3	-	0	0				TMEM127_ENST00000432959.1_5'Flank|CIAO1_ENST00000469320.1_3'UTR|CIAO1_ENST00000488633.1_Missense_Mutation_p.R62S	NM_001193304.2|NM_017849.3	NP_001180233.1|NP_060319.1	O75204	TM127_HUMAN	transmembrane protein 127						negative regulation of cell proliferation (GO:0008285)|negative regulation of TOR signaling (GO:0032007)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(1)|lung(1)|prostate(1)|stomach(1)	5						AGGCCACCAGCGCACCGTGCG	0.572																																					p.R62S		.											.	.	.	0			c.C184A						.						124.0	119.0	121.0					2																	96933103		2203	4300	6503	SO:0001631	upstream_gene_variant	9391	exon2			CACCAGCGCACCG	AK000514	CCDS2018.1	2q11.2	2014-09-17			ENSG00000135956	ENSG00000135956			26038	protein-coding gene	gene with protein product		613403				10493829	Standard	NM_017849		Approved	FLJ20507, FLJ22257	uc002svr.3	O75204	OTTHUMG00000130454		2.37:g.96933103C>A	Exception_encountered	Somatic	35	0		WXS	Illumina HiSeq	.	28	4	NM_004804	D3DXH0	Missense_Mutation	SNP	ENST00000258439.3	37	CCDS2018.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.794889	0.90453	.	.	ENSG00000144021	ENST00000488633	T	0.56941	0.43	4.56	4.56	0.56223	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.54951	0.1890	L	0.37630	1.12	0.80722	D	1	D	0.67145	0.996	P	0.59703	0.862	T	0.45308	-0.9270	10	0.10111	T	0.7	-20.7939	14.8698	0.70448	0.0:1.0:0.0:0.0	.	62	O76071	CIAO1_HUMAN	S	62	ENSP00000418287:R62S	ENSP00000418287:R62S	R	+	1	0	CIAO1	96296830	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	3.539000	0.53604	2.363000	0.80096	0.561000	0.74099	CGC	.		0.572	TMEM127-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252845.3	NM_017849	
KIF1B	23095	hgsc.bcm.edu;bcgsc.ca	37	1	10351202	10351202	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr1:10351202G>T	ENST00000377086.1	+	16	1699	c.1497G>T	c.(1495-1497)gaG>gaT	p.E499D	KIF1B_ENST00000377093.4_Missense_Mutation_p.E453D|KIF1B_ENST00000377081.1_Missense_Mutation_p.E499D|KIF1B_ENST00000263934.6_Missense_Mutation_p.E453D|KIF1B_ENST00000377083.1_Missense_Mutation_p.E453D			O60333	KIF1B_HUMAN	kinesin family member 1B	499					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		GTAAAACAGAGGCCATCAGAA	0.383																																					p.E453D		.											.	.	.	0			c.G1359T						.						78.0	81.0	80.0					1																	10351202		2203	4300	6503	SO:0001583	missense	23095	exon14			AACAGAGGCCATC	AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.1497G>T	1.37:g.10351202G>T	ENSP00000366290:p.Glu499Asp	Somatic	97	0		WXS	Illumina HiSeq	.	85	4	NM_183416	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	ENST00000377086.1	37		.	.	.	.	.	.	.	.	.	.	G	21.0	4.080934	0.76528	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377093;ENST00000377086;ENST00000377083;ENST00000377081	T;T;T;T;T	0.77489	-0.96;-1.03;-1.09;-1.03;-1.1	5.17	2.29	0.28610	.	0.000000	0.85682	D	0.000000	D	0.84826	0.5558	M	0.71920	2.185	0.58432	D	0.999997	P;P;D;D;D;D;D	0.76494	0.942;0.887;0.997;0.997;0.999;0.974;0.969	P;P;D;D;D;D;P	0.79784	0.656;0.562;0.937;0.952;0.993;0.969;0.868	T	0.83243	-0.0057	10	0.56958	D	0.05	.	10.3508	0.43934	0.2063:0.0:0.7937:0.0	.	485;459;499;473;499;453;453	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2;O60333-3	.;.;.;.;KIF1B_HUMAN;.;.	D	499;453;453;499;453;499	ENSP00000263934:E453D;ENSP00000366297:E453D;ENSP00000366290:E499D;ENSP00000366287:E453D;ENSP00000366284:E499D	ENSP00000263934:E453D	E	+	3	2	KIF1B	10273789	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.688000	0.25422	0.291000	0.22468	0.655000	0.94253	GAG	.		0.383	KIF1B-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000005102.1		
NUFIP1	26747	hgsc.bcm.edu	37	13	45563441	45563441	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr13:45563441G>A	ENST00000379161.4	-	1	177	c.131C>T	c.(130-132)cCg>cTg	p.P44L	GPALPP1_ENST00000379151.4_5'Flank|RP11-321C24.1_ENST00000437748.2_lincRNA|GPALPP1_ENST00000361121.2_5'Flank	NM_012345.2	NP_036477.2	Q9UHK0	NUFP1_HUMAN	nuclear fragile X mental retardation protein interacting protein 1	44	Pro-rich.				box C/D snoRNP assembly (GO:0000492)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|RNA processing (GO:0006396)	cytosolic ribosome (GO:0022626)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|pre-snoRNP complex (GO:0070761)|presynaptic active zone (GO:0048786)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)			breast(2)|cervix(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(4)|skin(3)	18		Lung NSC(96;8.23e-05)|Breast(139;0.00378)|Prostate(109;0.0107)|all_hematologic(4;0.014)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)|Acute lymphoblastic leukemia(4;0.143)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000306)|BRCA - Breast invasive adenocarcinoma(63;0.125)		TGGCGGTGGCGGCAGCATTGC	0.682																																					p.P44L		.											.	.	.	0			c.C131T						.						16.0	19.0	18.0					13																	45563441		2186	4278	6464	SO:0001583	missense	26747	exon1			GGTGGCGGCAGCA	AF159548	CCDS9393.1	13q14	2008-02-05			ENSG00000083635	ENSG00000083635			8057	protein-coding gene	gene with protein product		604354				10556305, 10894927	Standard	NM_012345		Approved	NUFIP	uc001uzp.2	Q9UHK0	OTTHUMG00000016842	ENST00000379161.4:c.131C>T	13.37:g.45563441G>A	ENSP00000368459:p.Pro44Leu	Somatic	66	0		WXS	Illumina HiSeq	.	53	4	NM_012345	Q8WVM5|Q96SG1	Missense_Mutation	SNP	ENST00000379161.4	37	CCDS9393.1	.	.	.	.	.	.	.	.	.	.	G	16.61	3.172441	0.57584	.	.	ENSG00000083635	ENST00000379161	T	0.59906	0.23	4.82	4.82	0.62117	.	0.343474	0.21467	N	0.074069	T	0.40498	0.1119	L	0.34521	1.04	0.21220	N	0.99976	D	0.54207	0.965	B	0.39068	0.289	T	0.36841	-0.9731	10	0.07813	T	0.8	-0.609	13.2754	0.60184	0.0:0.0:1.0:0.0	.	44	Q9UHK0	NUFP1_HUMAN	L	44	ENSP00000368459:P44L	ENSP00000368459:P44L	P	-	2	0	NUFIP1	44461441	0.835000	0.29415	0.267000	0.24556	0.047000	0.14425	1.847000	0.39299	2.497000	0.84241	0.563000	0.77884	CCG	.		0.682	NUFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044755.2	NM_012345	
MUC4	4585	hgsc.bcm.edu	37	3	195505863	195505863	+	Silent	SNP	G	G	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr3:195505863G>A	ENST00000463781.3	-	2	13047	c.12588C>T	c.(12586-12588)acC>acT	p.T4196T	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.T4196T|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T4196T(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGAAGTGTCGGTGACAGGAA	0.607																																					p.T4196T		.											MUC4_ENST00000463781,NS,carcinoma,0,1	MUC4_ENST00000463781	0	1	Substitution - coding silent(1)	prostate(1)	c.C12588T						.						19.0	14.0	16.0					3																	195505863		689	1578	2267	SO:0001819	synonymous_variant	4585	exon2			AGTGTCGGTGACA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12588C>T	3.37:g.195505863G>A		Somatic	73	1		WXS	Illumina HiSeq	.	81	4	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			.		0.607	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
CTSL3P	392360	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	90388066	90388066	+	RNA	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr9:90388066G>T	ENST00000354530.2	+	0	137					NR_027917.1		Q5NE16	CATL3_HUMAN	cathepsin L family member 3, pseudogene								cysteine-type peptidase activity (GO:0008234)										CAGAAGCACAGGAAGGGGAAA	0.438																																					.		.											.	.	.	0			.						.						98.0	94.0	95.0					9																	90388066		2203	4300	6503			392360	.			AGCACAGGAAGGG	AJ851862		9q21.33	2013-01-07	2013-01-07	2013-01-07	ENSG00000188029	ENSG00000188029		"""Cathepsins"""	33132	pseudogene	pseudogene			"""cathepsin L family member 3"""	CTSL3		19663681	Standard	NR_027917		Approved	HCTSL-s	uc004apm.1	Q5NE16	OTTHUMG00000020152		9.37:g.90388066G>T		Somatic	88	0		WXS	Illumina HiSeq	.	53	4	.		RNA	SNP	ENST00000354530.2	37																																																																																				.		0.438	CTSL3P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000356542.1	NR_027917	
WNT10B	7480	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	49360090	49360090	+	Nonsense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr12:49360090G>A	ENST00000301061.4	-	5	1306	c.958C>T	c.(958-960)Cga>Tga	p.R320*	WNT10B_ENST00000407467.1_3'UTR|WNT10B_ENST00000403957.1_3'UTR	NM_003394.3	NP_003385.2	O00744	WN10B_HUMAN	wingless-type MMTV integration site family, member 10B	320					bone trabecula formation (GO:0060346)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to cAMP (GO:0071320)|cellular response to hydrostatic pressure (GO:0071464)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|chondrocyte differentiation (GO:0002062)|fungiform papilla development (GO:0061196)|G2/M transition of mitotic cell cycle (GO:0000086)|hematopoietic stem cell proliferation (GO:0071425)|lipid metabolic process (GO:0006629)|myoblast differentiation involved in skeletal muscle regeneration (GO:0014835)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|positive regulation of anagen (GO:0051885)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein stabilization (GO:0050821)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|regulation of skeletal muscle tissue development (GO:0048641)|sensory perception of taste (GO:0050909)|skeletal muscle fiber development (GO:0048741)|smoothened signaling pathway (GO:0007224)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)	p.R320G(1)|p.R320*(1)		central_nervous_system(1)|large_intestine(5)|lung(12)|prostate(1)|skin(4)	23						GTGGGGTCTCGCTCACAGAAG	0.632																																					p.R320X		.											WNT10B,NS,carcinoma,0,2	WNT10B	0	2	Substitution - Nonsense(1)|Substitution - Missense(1)	large_intestine(1)|prostate(1)	c.C958T						.						37.0	43.0	41.0					12																	49360090		2203	4300	6503	SO:0001587	stop_gained	7480	exon5			GGTCTCGCTCACA	X97057	CCDS8775.1	12q13	2009-01-02			ENSG00000169884	ENSG00000169884		"""Wingless-type MMTV integration sites"""	12775	protein-coding gene	gene with protein product		601906				9121776, 9284937, 18515319	Standard	NM_003394		Approved	WNT-12, SHFM6	uc001rss.3	O00744	OTTHUMG00000150734	ENST00000301061.4:c.958C>T	12.37:g.49360090G>A	ENSP00000301061:p.Arg320*	Somatic	124	0		WXS	Illumina HiSeq	.	104	21	NM_003394	B2R7A5|O00747|Q4VAJ4|Q4VAJ5|Q8WZ97	Nonsense_Mutation	SNP	ENST00000301061.4	37	CCDS8775.1	.	.	.	.	.	.	.	.	.	.	G	38	6.733131	0.97796	.	.	ENSG00000169884	ENST00000301061	.	.	.	4.43	2.55	0.30701	.	0.167445	0.38837	N	0.001546	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.2219	0.15373	0.1683:0.0:0.651:0.1807	.	.	.	.	X	320	.	ENSP00000301061:R320X	R	-	1	2	WNT10B	47646357	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.152000	0.50677	1.212000	0.43366	0.561000	0.74099	CGA	.		0.632	WNT10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319864.1	NM_003394	
KEAP1	9817	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	10610426	10610426	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr19:10610426G>A	ENST00000171111.5	-	2	831	c.284C>T	c.(283-285)gCc>gTc	p.A95V	KEAP1_ENST00000588024.1_5'Flank|KEAP1_ENST00000393623.2_Missense_Mutation_p.A95V	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	95	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	CACCTTGTGGGCCATGAACTG	0.612																																					p.A95V		.											.	.	.	0			c.C284T						.						83.0	66.0	71.0					19																	10610426		2203	4300	6503	SO:0001583	missense	9817	exon2			TTGTGGGCCATGA	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.284C>T	19.37:g.10610426G>A	ENSP00000171111:p.Ala95Val	Somatic	22	0		WXS	Illumina HiSeq	.	20	5	NM_012289	B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	37	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	G	15.94	2.980141	0.53827	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	T;T	0.74002	-0.8;-0.8	4.68	4.68	0.58851	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.053923	0.64402	D	0.000001	T	0.69305	0.3096	L	0.46819	1.47	0.58432	D	0.999996	P	0.42296	0.775	B	0.39660	0.306	T	0.74598	-0.3612	10	0.62326	D	0.03	.	15.0979	0.72250	0.0:0.0:1.0:0.0	.	95	Q14145	KEAP1_HUMAN	V	95	ENSP00000171111:A95V;ENSP00000377245:A95V	ENSP00000171111:A95V	A	-	2	0	KEAP1	10471426	1.000000	0.71417	1.000000	0.80357	0.800000	0.45204	6.622000	0.74233	2.162000	0.67917	0.462000	0.41574	GCC	.		0.612	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289	
PADI2	11240	hgsc.bcm.edu	37	1	17422416	17422416	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr1:17422416G>T	ENST00000375486.4	-	4	462	c.399C>A	c.(397-399)aaC>aaA	p.N133K	PADI2_ENST00000444885.2_Missense_Mutation_p.N133K|PADI2_ENST00000375481.1_Missense_Mutation_p.N133K	NM_007365.2	NP_031391.2	Q9Y2J8	PADI2_HUMAN	peptidyl arginine deiminase, type II	133					chromatin-mediated maintenance of transcription (GO:0048096)|histone H3-R26 citrullination (GO:0036413)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of lymphocyte chemotaxis (GO:1901624)|protein citrullination (GO:0018101)|regulation of chromatin disassembly (GO:0010848)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptionally active chromatin (GO:0035327)	calcium ion binding (GO:0005509)|estrogen receptor binding (GO:0030331)|protein-arginine deiminase activity (GO:0004668)	p.N133K(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(12)|ovary(4)|pancreas(1)|skin(5)|urinary_tract(3)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000422)|Renal(390;0.000518)|all_lung(284;0.000546)|Ovarian(437;0.00671)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;1.49e-05)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)	L-Citrulline(DB00155)	TCTTTGGGTTGTTCTTCTCCA	0.602																																					p.N133K		.											PADI2,NS,carcinoma,0,1	PADI2	0	1	Substitution - Missense(1)	lung(1)	c.C399A						.						218.0	187.0	197.0					1																	17422416		2203	4300	6503	SO:0001583	missense	11240	exon4			TGGGTTGTTCTTC	AB030176	CCDS177.1	1p35.2-p35.1	2008-02-05			ENSG00000117115	ENSG00000117115	3.5.3.15	"""Peptidyl arginine deiminases"""	18341	protein-coding gene	gene with protein product		607935				2768262	Standard	NM_007365		Approved	KIAA0994, PDI2	uc001baf.3	Q9Y2J8	OTTHUMG00000002295	ENST00000375486.4:c.399C>A	1.37:g.17422416G>T	ENSP00000364635:p.Asn133Lys	Somatic	74	0		WXS	Illumina HiSeq	.	27	2	NM_007365	Q96DA7|Q9UPN2	Missense_Mutation	SNP	ENST00000375486.4	37	CCDS177.1	.	.	.	.	.	.	.	.	.	.	G	18.04	3.535763	0.64972	.	.	ENSG00000117115	ENST00000375486;ENST00000444885;ENST00000375481	T;T;T	0.14640	2.49;2.49;2.49	6.08	2.01	0.26516	Protein-arginine deiminase (PAD), central domain (2);	0.000000	0.85682	D	0.000000	T	0.24967	0.0606	M	0.64170	1.965	0.23657	N	0.997186	P;D	0.52996	0.615;0.957	B;P	0.61533	0.1;0.89	T	0.05115	-1.0905	10	0.28530	T	0.3	-57.7554	8.103	0.30868	0.1973:0.1136:0.6891:0.0	.	133;133	B4DIU3;Q9Y2J8	.;PADI2_HUMAN	K	133	ENSP00000364635:N133K;ENSP00000405894:N133K;ENSP00000364630:N133K	ENSP00000364630:N133K	N	-	3	2	PADI2	17295003	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.200000	0.42724	0.425000	0.26087	0.655000	0.94253	AAC	.		0.602	PADI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006624.1		
OLFM3	118427	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	102290693	102290693	+	Missense_Mutation	SNP	A	A	G			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr1:102290693A>G	ENST00000338858.5	-	4	540	c.541T>C	c.(541-543)Tct>Cct	p.S181P	OLFM3_ENST00000462354.1_5'UTR|OLFM3_ENST00000359814.3_Missense_Mutation_p.S181P|OLFM3_ENST00000536598.1_Missense_Mutation_p.S86P|OLFM3_ENST00000370103.4_Missense_Mutation_p.S161P			Q96PB7	NOE3_HUMAN	olfactomedin 3	181					eye photoreceptor cell development (GO:0042462)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)				breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(24)|ovary(3)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	43		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)		AGGACAGCAGACAGATTCCTT	0.463																																					p.S161P		.											.	.	.	0			c.T481C						.						154.0	139.0	144.0					1																	102290693		2203	4300	6503	SO:0001583	missense	118427	exon4			CAGCAGACAGATT	AF397392	CCDS30781.1, CCDS72832.1	1p22	2008-05-23			ENSG00000118733	ENSG00000118733			17990	protein-coding gene	gene with protein product	"""optimedin"""	607567				12019210, 16115881	Standard	NM_001288821		Approved	NOE3	uc001dug.2	Q96PB7	OTTHUMG00000010941	ENST00000338858.5:c.541T>C	1.37:g.102290693A>G	ENSP00000345192:p.Ser181Pro	Somatic	67	0		WXS	Illumina HiSeq	.	69	10	NM_058170	Q5T3V6|Q6IMI7|Q6IMI8|Q6IMI9|Q6IMJ1|Q8TBG1|Q96PB2|Q96PB3|Q96PB4|Q96PB5|Q96PB6	Missense_Mutation	SNP	ENST00000338858.5	37		.	.	.	.	.	.	.	.	.	.	A	16.19	3.052357	0.55218	.	.	ENSG00000118733	ENST00000424771;ENST00000370103;ENST00000338858;ENST00000536598;ENST00000359814	D;D;T;T	0.89196	-2.47;-2.48;-0.84;0.15	5.91	5.91	0.95273	.	0.051877	0.85682	D	0.000000	D	0.83252	0.5214	M	0.61703	1.905	0.46954	D	0.999266	B;B	0.31100	0.012;0.308	B;B	0.34346	0.041;0.18	D	0.84972	0.0883	10	0.66056	D	0.02	.	11.4291	0.50029	0.8654:0.0:0.0:0.1346	.	161;181	Q5T3V6;Q96PB7	.;NOE3_HUMAN	P	32;161;181;86;181	ENSP00000359121:S161P;ENSP00000345192:S181P;ENSP00000443471:S86P;ENSP00000352867:S181P	ENSP00000345192:S181P	S	-	1	0	OLFM3	102063281	1.000000	0.71417	1.000000	0.80357	0.735000	0.41995	5.043000	0.64208	2.269000	0.75478	0.533000	0.62120	TCT	.		0.463	OLFM3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000030142.1		
NCOA4	8031	hgsc.bcm.edu	37	10	51582263	51582263	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr10:51582263G>T	ENST00000443446.1	+	6	790	c.561G>T	c.(559-561)atG>atT	p.M187I	NCOA4_ENST00000374087.4_Missense_Mutation_p.M187I|NCOA4_ENST00000344348.6_Missense_Mutation_p.M187I|NCOA4_ENST00000438493.1_Missense_Mutation_p.M203I|NCOA4_ENST00000430396.2_Missense_Mutation_p.M87I|NCOA4_ENST00000414907.2_Missense_Mutation_p.M21I|NCOA4_ENST00000452682.1_Missense_Mutation_p.M203I|NCOA4_ENST00000374082.1_Missense_Mutation_p.M187I|NCOA4_ENST00000498586.1_3'UTR	NM_001145262.1	NP_001138734.1	Q13772	NCOA4_HUMAN	nuclear receptor coactivator 4	187					androgen receptor signaling pathway (GO:0030521)|male gonad development (GO:0008584)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|transcription coactivator activity (GO:0003713)	p.M203I(1)		NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|skin(1)	5						GTATCTCCATGCCAGAGCAGG	0.358			T	RET	papillary thyroid																																p.M203I		.		Dom	yes		10	10q11.2	8031	nuclear receptor coactivator 4 - PTC3 (ELE1)		E	NCOA4_ENST00000452682,NS,carcinoma,0,1	NCOA4_ENST00000452682	0	1	Substitution - Missense(1)	kidney(1)	c.G609T						.						106.0	104.0	104.0					10																	51582263		2203	4300	6503	SO:0001583	missense	8031	exon7			CTCCATGCCAGAG	L49399	CCDS73092.1, CCDS73093.1, CCDS73094.1	10q11.2	2014-04-10			ENSG00000138293	ENSG00000266412			7671	protein-coding gene	gene with protein product	"""RET-activating gene ELE1"""	601984				8290261, 8643607, 24695223	Standard	NM_001145260		Approved	ARA70, RFG, ELE1, PTC3, DKFZp762E1112	uc009xon.3	Q13772	OTTHUMG00000188314	ENST00000443446.1:c.561G>T	10.37:g.51582263G>T	ENSP00000390713:p.Met187Ile	Somatic	49	0		WXS	Illumina HiSeq	.	47	2	NM_001145261	A8K8W5|B4E260|E9PAV7|J3KQN8|Q14239	Missense_Mutation	SNP	ENST00000443446.1	37	CCDS7237.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.200|0.200	-1.045839|-1.045839	0.01997|0.01997	.|.	.|.	ENSG00000138293|ENSG00000138293	ENST00000431200|ENST00000438493;ENST00000452682;ENST00000430396;ENST00000374087;ENST00000330923;ENST00000414907;ENST00000344348;ENST00000374082;ENST00000443446	.|T;T;T;T;T;T;T;T	.|0.21191	.|2.62;2.61;2.35;2.62;2.02;2.62;2.34;2.62	5.35|5.35	1.47|1.47	0.22746|0.22746	.|.	.|1.240080	.|0.05111	.|N	.|0.488930	T|T	0.17066|0.17066	0.0410|0.0410	L|L	0.36672|0.36672	1.1|1.1	0.21416|0.21416	N|N	0.999695|0.999695	.|B;B;B;B	.|0.17667	.|0.023;0.002;0.01;0.0	.|B;B;B;B	.|0.11329	.|0.006;0.004;0.004;0.0	T|T	0.32561|0.32561	-0.9902|-0.9902	5|10	.|0.20046	.|T	.|0.44	-14.6911|-14.6911	7.1894|7.1894	0.25816|0.25816	0.3534:0.0:0.6466:0.0|0.3534:0.0:0.6466:0.0	.|.	.|87;203;203;187	.|B4DF87;B4E260;E9PAV7;Q13772	.|.;.;.;NCOA4_HUMAN	S|I	103|203;203;87;187;187;21;187;187;187	.|ENSP00000405146:M203I;ENSP00000395465:M203I;ENSP00000393053:M87I;ENSP00000363200:M187I;ENSP00000411018:M21I;ENSP00000344552:M187I;ENSP00000363195:M187I;ENSP00000390713:M187I	.|ENSP00000332421:M187I	A|M	+|+	1|3	0|0	NCOA4|NCOA4	51252269|51252269	0.885000|0.885000	0.30320|0.30320	0.609000|0.609000	0.28983|0.28983	0.032000|0.032000	0.12392|0.12392	0.866000|0.866000	0.27954|0.27954	0.187000|0.187000	0.20147|0.20147	-0.136000|-0.136000	0.14681|0.14681	GCC|ATG	.		0.358	NCOA4-204	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048052.1	NM_005437	
AL441988.1	0	hgsc.bcm.edu	37	20	29638065	29638065	+	RNA	SNP	A	A	G			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr20:29638065A>G	ENST00000408392.1	+	0	139																											GTATAATTGTAACATTTTGAT	0.303																																					.		.											.	.	.	0			.						.																																					140678	.			AATTGTAACATTT																													20.37:g.29638065A>G		Somatic	47	0		WXS	Illumina HiSeq	.	64	8	.		RNA	SNP	ENST00000408392.1	37																																																																																				.		0.303	AL441988.1-201	NOVEL	basic	miRNA	miRNA			
Unknown	0	hgsc.bcm.edu	37	10	45622894	45622894	+	IGR	SNP	A	A	G	rs373548572		TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr10:45622894A>G								RSU1P2 (19458 upstream) : RP11-445N18.7 (19947 downstream)																							GCAGGCTTCAATGCATCCTTT	0.438																																					.		.											.	.	.	0			.						.																																			SO:0001628	intergenic_variant	100133308	.			GCTTCAATGCATC																													10.37:g.45622894A>G		Somatic	35	0		WXS	Illumina HiSeq	.	38	5	.		RNA	SNP		37																																																																																				.	0	0.438								
CDH1	999	hgsc.bcm.edu	37	16	68835581	68835581	+	Missense_Mutation	SNP	G	G	C			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr16:68835581G>C	ENST00000261769.5	+	3	363	c.172G>C	c.(172-174)Gaa>Caa	p.E58Q	CDH1_ENST00000562836.1_3'UTR|CDH1_ENST00000422392.2_Missense_Mutation_p.E58Q	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	58					adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.?(2)|p.E58*(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		AGTGAATTTTGAAGATTGCAC	0.463			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																												p.E58Q		.	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	CDH1,caecum,carcinoma,-2,1	CDH1	-2	3	Unknown(2)|Substitution - Nonsense(1)	breast(3)	c.G172C						.						135.0	130.0	132.0					16																	68835581		2198	4300	6498	SO:0001583	missense	999	exon3	Familial Cancer Database	HDGC	AATTTTGAAGATT	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.172G>C	16.37:g.68835581G>C	ENSP00000261769:p.Glu58Gln	Somatic	43	0		WXS	Illumina HiSeq	.	48	2	NM_004360	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Missense_Mutation	SNP	ENST00000261769.5	37	CCDS10869.1	.	.	.	.	.	.	.	.	.	.	G	17.98	3.520722	0.64747	.	.	ENSG00000039068	ENST00000261769;ENST00000379120;ENST00000268794;ENST00000422392	T;T	0.48522	0.81;0.81	5.43	5.43	0.79202	Cadherin prodomain-like (1);Cadherin-like (1);	0.000000	0.49916	D	0.000125	T	0.59348	0.2187	M	0.61703	1.905	0.25390	N	0.988538	D;P	0.58970	0.984;0.942	P;P	0.61533	0.89;0.772	T	0.52719	-0.8538	10	0.21014	T	0.42	.	12.5116	0.56009	0.0811:0.0:0.9189:0.0	.	58;58	Q9UII8;P12830	.;CADH1_HUMAN	Q	58	ENSP00000261769:E58Q;ENSP00000414946:E58Q	ENSP00000261769:E58Q	E	+	1	0	CDH1	67393082	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	2.035000	0.41155	2.707000	0.92482	0.561000	0.74099	GAA	.		0.463	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268897.2	NM_004360	
ACIN1	22985	hgsc.bcm.edu;ucsc.edu	37	14	23549704	23549704	+	Silent	SNP	C	C	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr14:23549704C>A	ENST00000262710.1	-	6	1341	c.1014G>T	c.(1012-1014)ggG>ggT	p.G338G	ACIN1_ENST00000605057.1_Silent_p.G280G|ACIN1_ENST00000555352.1_5'Flank|ACIN1_ENST00000457657.1_Silent_p.G298G|ACIN1_ENST00000555053.1_Silent_p.G338G	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	338	Glu-rich.				apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		TTGTAAATCTCCCTCCTCTCT	0.468																																					p.G338G		.											ACIN1,caecum,carcinoma,0,1	ACIN1	0	0			c.G1014T						.						169.0	142.0	151.0					14																	23549704		2203	4300	6503	SO:0001819	synonymous_variant	22985	exon6			AAATCTCCCTCCT	AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.1014G>T	14.37:g.23549704C>A		Somatic	72	0		WXS	Illumina HiSeq	.	41	4	NM_001164814	B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Silent	SNP	ENST00000262710.1	37	CCDS9587.1																																																																																			.		0.468	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071707.3	NM_014977	
NEB	4703	hgsc.bcm.edu	37	2	152426643	152426643	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr2:152426643G>T	ENST00000172853.10	-	81	12426	c.12279C>A	c.(12277-12279)gaC>gaA	p.D4093E	NEB_ENST00000604864.1_Missense_Mutation_p.D5794E|NEB_ENST00000603639.1_Missense_Mutation_p.D5794E|NEB_ENST00000409198.1_Missense_Mutation_p.D4093E|NEB_ENST00000397345.3_Missense_Mutation_p.D5794E|NEB_ENST00000427231.2_Missense_Mutation_p.D5794E			P20929	NEBU_HUMAN	nebulin	4093					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.D4093D(1)|p.D5794D(1)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		CATCGTTCTGGTCGGGCATGC	0.512																																					p.D5794E		.											NEB_ENST00000427231,NS,carcinoma,0,3	NEB_ENST00000427231	0	2	Substitution - coding silent(2)	lung(2)	c.C17382A						.						46.0	46.0	46.0					2																	152426643		2056	4193	6249	SO:0001583	missense	4703	exon109			GTTCTGGTCGGGC	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.12279C>A	2.37:g.152426643G>T	ENSP00000172853:p.Asp4093Glu	Somatic	38	0		WXS	Illumina HiSeq	.	35	2	NM_001271208	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37		.	.	.	.	.	.	.	.	.	.	G	22.7	4.325844	0.81580	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000397342;ENST00000413693;ENST00000172853	T;T;T;T;T	0.24350	1.86;1.86;1.86;1.86;1.86	5.95	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.44685	0.1305	L	0.54323	1.7	0.80722	D	1	D;D	0.89917	1.0;0.99	D;D	0.91635	0.999;0.989	T	0.25537	-1.0129	10	0.36615	T	0.2	.	13.1282	0.59368	0.1327:0.0:0.8673:0.0	.	4093;524	P20929;Q14215	NEBU_HUMAN;.	E	4093;5794;5794;142;524;4093	ENSP00000386259:D4093E;ENSP00000380505:D5794E;ENSP00000416578:D5794E;ENSP00000410961:D524E;ENSP00000172853:D4093E	ENSP00000172853:D4093E	D	-	3	2	NEB	152134889	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.440000	0.35024	1.537000	0.49254	0.563000	0.77884	GAC	.		0.512	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
SVEP1	79987	hgsc.bcm.edu	37	9	113166721	113166721	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr9:113166721C>T	ENST00000401783.2	-	39	9888	c.9552G>A	c.(9550-9552)ccG>ccA	p.P3184P	SVEP1_ENST00000297826.5_Silent_p.P1110P|SVEP1_ENST00000374469.1_Silent_p.P3161P	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	3184	Sushi 30. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)	p.P3187P(2)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						TTATGTTTTCCGGGAGAGGAC	0.428																																					p.P3184P		.											SVEP1,NS,carcinoma,0,1	SVEP1	0	2	Substitution - coding silent(2)	prostate(1)|lung(1)	c.G9552A						.						258.0	255.0	256.0					9																	113166721		1881	4106	5987	SO:0001819	synonymous_variant	79987	exon39			GTTTTCCGGGAGA	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.9552G>A	9.37:g.113166721C>T		Somatic	66	1		WXS	Illumina HiSeq	.	46	2	NM_153366	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Silent	SNP	ENST00000401783.2	37	CCDS48004.1																																																																																			.		0.428	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
RYR3	6263	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	15	33923424	33923424	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr15:33923424C>A	ENST00000389232.4	+	23	2867	c.2797C>A	c.(2797-2799)Ctg>Atg	p.L933M	RYR3_ENST00000415757.3_Missense_Mutation_p.L933M	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	933	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CCTCTTGGCCCTGGGGTGCCA	0.448																																					p.L933M		.											.	.	.	0			c.C2797A						.						79.0	77.0	78.0					15																	33923424		1895	4116	6011	SO:0001583	missense	6263	exon23			TTGGCCCTGGGGT		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.2797C>A	15.37:g.33923424C>A	ENSP00000373884:p.Leu933Met	Somatic	34	0		WXS	Illumina HiSeq	.	44	4	NM_001243996	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	C	16.73	3.203675	0.58234	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.91996	-2.95;-2.95	5.09	2.01	0.26516	Ryanodine receptor Ryr (1);	0.000000	0.64402	D	0.000013	D	0.94108	0.8111	M	0.66297	2.02	0.44104	D	0.996875	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.977	D	0.92211	0.5776	10	0.59425	D	0.04	.	8.9467	0.35762	0.0:0.7432:0.0:0.2568	.	933;933	Q15413-2;Q15413	.;RYR3_HUMAN	M	933	ENSP00000373884:L933M;ENSP00000399610:L933M	ENSP00000354735:L933M	L	+	1	2	RYR3	31710716	0.992000	0.36948	0.980000	0.43619	0.941000	0.58515	2.022000	0.41030	0.248000	0.21435	0.563000	0.77884	CTG	.		0.448	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
OR2AG1	144125	hgsc.bcm.edu	37	11	6806283	6806283	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr11:6806283C>A	ENST00000307401.4	+	1	36	c.15C>A	c.(13-15)aaC>aaA	p.N5K		NM_001004489.2	NP_001004489.1	Q9H205	O2AG1_HUMAN	olfactory receptor, family 2, subfamily AG, member 1	5						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.N5K(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(13)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	26		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.19e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		AGCTCTGGAACTTCACCTTGG	0.428																																					p.N5K		.											OR2AG1,NS,carcinoma,0,1	OR2AG1	0	1	Substitution - Missense(1)	kidney(1)	c.C15A						.						107.0	103.0	104.0					11																	6806283		2201	4296	6497	SO:0001583	missense	144125	exon1			CTGGAACTTCACC	AB065823	CCDS31414.1	11p15.4	2012-08-09			ENSG00000170803	ENSG00000170803		"""GPCR / Class A : Olfactory receptors"""	15142	protein-coding gene	gene with protein product				OR2AG3			Standard	NM_001004489		Approved		uc001mer.2	Q9H205	OTTHUMG00000165735	ENST00000307401.4:c.15C>A	11.37:g.6806283C>A	ENSP00000307447:p.Asn5Lys	Somatic	44	0		WXS	Illumina HiSeq	.	26	2	NM_001004489	B9EKV7|Q6IFG7|Q96R26	Missense_Mutation	SNP	ENST00000307401.4	37	CCDS31414.1	.	.	.	.	.	.	.	.	.	.	C	8.803	0.933330	0.18131	.	.	ENSG00000170803	ENST00000307401	T	0.64085	-0.08	4.25	1.32	0.21799	.	0.475888	0.19469	N	0.113503	T	0.78559	0.4302	M	0.92268	3.29	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.66428	-0.5926	10	0.87932	D	0	.	3.3044	0.06994	0.1836:0.5233:0.0:0.2931	.	5	Q9H205	O2AG1_HUMAN	K	5	ENSP00000307447:N5K	ENSP00000307447:N5K	N	+	3	2	OR2AG1	6762859	0.000000	0.05858	0.557000	0.28306	0.056000	0.15407	-0.541000	0.06099	0.190000	0.20209	-0.237000	0.12165	AAC	.		0.428	OR2AG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385980.1	NM_001004489	
LINC00303	284573	broad.mit.edu	37	1	204005963	204005963	+	lincRNA	DEL	A	A	-			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr1:204005963delA	ENST00000367207.3	-	0	924							Q3SY05	CA157_HUMAN	long intergenic non-protein coding RNA 303																		actctgtctcaaaaaaaaaaa	0.463																																					.													.	.	.	0			.						.																																					0	.			TGTCTCAAAAAAA	AK097662		1q32.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000176754	ENSG00000176754		"""Long non-coding RNAs"""	26865	non-coding RNA	RNA, long non-coding			"""chromosome 1 open reading frame 157"", ""non-protein coding RNA 303"""	C1orf157, NCRNA00303			Standard	NR_027902		Approved	FLJ40343	uc010pqo.1	Q3SY05	OTTHUMG00000036054		1.37:g.204005963delA		Somatic	5	0		WXS	Illumina GAIIx	Phase_I	6	2	.	Q3SY06|Q8N7U1	RNA	DEL	ENST00000367207.3	37																																																																																				A|0.750;-|0.250		0.463	LINC00303-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000087885.3	NR_027902	
ADAM21P1	145241	broad.mit.edu;ucsc.edu	37	14	70713782	70713782	+	RNA	SNP	A	A	G	rs200469187		TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr14:70713782A>G	ENST00000530196.1	-	0	736					NR_003951.1				ADAM metallopeptidase domain 21 pseudogene 1																		GTCACCAGCAAATTTTGGTTC	0.443																																					.													.	.	.	0			.						.																																					0	.			CCAGCAAATTTTG			14q24.2	2014-03-25	2010-01-12	2010-01-12	ENSG00000235812	ENSG00000235812			19822	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 21 pseudogene"", ""ADAM metallopeptidase domain 21 pseudogene"""	ADAM21P			Standard	NR_003951		Approved		uc010ttg.2		OTTHUMG00000166565		14.37:g.70713782A>G		Somatic	53	1		WXS	Illumina GAIIx	Phase_I	38	8	.		RNA	SNP	ENST00000530196.1	37																																																																																				A|0.994;G|0.006		0.443	ADAM21P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000390451.1	NG_002467	
SRP54-AS1	100506157	broad.mit.edu	37	14	35390923	35390923	+	RNA	DEL	A	A	-			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr14:35390923delA	ENST00000556355.1	-	0	399				RP11-85K15.2_ENST00000555015.1_RNA																							AATTACTCTGAAAAAAAAAAA	0.274																																					.													.	.	.	0			.						.																																					0	.			ACTCTGAAAAAAA																													14.37:g.35390923delA		Somatic	5	0		WXS	Illumina GAIIx	Phase_I	8	2	.		RNA	DEL	ENST00000556355.1	37																																																																																				.		0.274	RP11-85K15.2-004	KNOWN	basic	antisense	processed_transcript	OTTHUMT00000410682.2		
CCDC88C	440193	broad.mit.edu	37	14	91744298	91744298	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr14:91744298G>T	ENST00000389857.6	-	29	5112	c.5026C>A	c.(5026-5028)Ctg>Atg	p.L1676M	CCDC88C_ENST00000331194.7_Missense_Mutation_p.L200M	NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	1676					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				CTCTCCTCCAGGAACTCCTCC	0.632																																					p.L1676M													.	CCDC88C	192	0			c.C5026A						.						11.0	14.0	13.0					14																	91744298		1996	4151	6147	SO:0001583	missense	440193	exon29			CCTCCAGGAACTC		CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.5026C>A	14.37:g.91744298G>T	ENSP00000374507:p.Leu1676Met	Somatic	72	0		WXS	Illumina GAIIx	Phase_I	38	3	NM_001080414	Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Missense_Mutation	SNP	ENST00000389857.6	37	CCDS45151.1	.	.	.	.	.	.	.	.	.	.	G	18.27	3.586697	0.66105	.	.	ENSG00000015133	ENST00000389857;ENST00000427583;ENST00000331194	T;T	0.74632	0.56;-0.86	5.55	1.08	0.20341	.	0.000000	0.37669	U	0.001988	D	0.82518	0.5054	M	0.70275	2.135	0.41248	D	0.986697	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.995;0.995	T	0.81495	-0.0907	10	0.54805	T	0.06	-17.2914	10.9064	0.47081	0.411:0.0:0.589:0.0	.	1676;200;126	Q9P219;Q9P219-2;Q9P219-3	DAPLE_HUMAN;.;.	M	1676;200;200	ENSP00000374507:L1676M;ENSP00000330332:L200M	ENSP00000330332:L200M	L	-	1	2	CCDC88C	90814051	0.999000	0.42202	0.943000	0.38184	0.936000	0.57629	1.906000	0.39887	0.294000	0.22547	0.462000	0.41574	CTG	.		0.632	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411650.1	XM_029353	
DNM1P47	100216544	broad.mit.edu	37	15	102292811	102292811	+	RNA	SNP	C	C	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr15:102292811C>A	ENST00000561463.1	+	0	857									DNM1 pseudogene 47									p.R133R(1)									CCTGCACTCGCGTGGGAACGA	0.607																																					.													Q3ZCN4_HUMAN,NS,carcinoma,0,3	.	.	1	Substitution - coding silent(1)	prostate(1)	.						.																																					0	.			CACTCGCGTGGGA	AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102292811C>A		Somatic	75	1		WXS	Illumina GAIIx	Phase_I	99	7	.		RNA	SNP	ENST00000561463.1	37																																																																																				.		0.607	DNM1P47-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417589.1	NG_009149	
DNM1P47	100216544	broad.mit.edu	37	15	102294715	102294715	+	RNA	SNP	C	C	T	rs377395363		TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr15:102294715C>T	ENST00000561463.1	+	0	2761									DNM1 pseudogene 47																		AGCAGGCAGACCAAGGAGTTC	0.587																																					.													.	.	.	0			.						.																																					0	.			GGCAGACCAAGGA	AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102294715C>T		Somatic	59	2		WXS	Illumina GAIIx	Phase_I	63	13	.		RNA	SNP	ENST00000561463.1	37																																																																																				.		0.587	DNM1P47-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417589.1	NG_009149	
UBE2Q2P2	100134869	broad.mit.edu	37	15	82664400	82664400	+	RNA	DEL	T	T	-	rs200314743	byFrequency	TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr15:82664400delT	ENST00000420908.3	+	0	233					NR_004847.2				ubiquitin-conjugating enzyme E2Q family member 2 pseudogene 2																		AACAAAAATCTTTTTTTTTTT	0.308													|||unknown(NO_COVERAGE)	2821	0.563299	0.4244	0.6081	5008	,	,		9793	0.497		0.6869	False		,,,				2504	0.6605				.													.	.	.	0			.						.																																					0	.			AAAATCTTTTTTT	BC066934		15q25.2	2014-04-10	2009-12-17	2009-12-17	ENSG00000225273	ENSG00000259429			37440	pseudogene	pseudogene			"""ubiquitin-conjugating enzyme E2Q family pseudogene 2"", ""ubiquitin-conjugating enzyme E2Q family member 2 pseudogene 3"""	UBE2QP2, UBE2Q2P3			Standard	NR_004847		Approved		uc002bgz.3		OTTHUMG00000172604		15.37:g.82664400delT		Somatic	8	0		WXS	Illumina GAIIx	Phase_I	12	5	.		RNA	DEL	ENST00000420908.3	37																																																																																				.		0.308	UBE2Q2P2-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000419405.1	NR_004847	
DNM1P47	100216544	broad.mit.edu	37	15	102299958	102299958	+	RNA	SNP	C	C	G			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr15:102299958C>G	ENST00000561463.1	+	0	8004									DNM1 pseudogene 47																		CTTCTCAGAGCTGCTGTCCAA	0.587																																					.													.	.	.	0			.						.																																					0	.			TCAGAGCTGCTGT	AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102299958C>G		Somatic	95	1		WXS	Illumina GAIIx	Phase_I	161	7	.		RNA	SNP	ENST00000561463.1	37																																																																																				.		0.587	DNM1P47-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417589.1	NG_009149	
RP11-51L5.5	0	broad.mit.edu	37	17	60365420	60365429	+	RNA	DEL	CCTTTGGTCT	CCTTTGGTCT	-	rs569563937|rs200738042	byFrequency	TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr17:60365420_60365429delCCTTTGGTCT	ENST00000602493.1	-	0	675																											CCCGAGTGTACCTTTGGTCTTTTAGAGTGT	0.319																																					.													.	.	.	0			.						.																																					0	.			AGTGTACCTTTGG																													17.37:g.60365420_60365429delCCTTTGGTCT		Somatic	7	0		WXS	Illumina GAIIx	Phase_I	6	2	.		RNA	DEL	ENST00000602493.1	37																																																																																				.		0.319	RP11-51L5.5-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000467668.1		
EMILIN2	84034	broad.mit.edu	37	18	2884988	2884988	+	Missense_Mutation	SNP	A	A	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr18:2884988A>T	ENST00000254528.3	+	3	443	c.284A>T	c.(283-285)tAt>tTt	p.Y95F		NM_032048.2	NP_114437.2	Q9BXX0	EMIL2_HUMAN	elastin microfibril interfacer 2	95	EMI. {ECO:0000255|PROSITE- ProRule:PRU00384}.				cell adhesion (GO:0007155)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)			breast(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(4)	48				READ - Rectum adenocarcinoma(2;0.1)		AGACCTAGATATGTCACTAGG	0.502																																					p.Y95F													.	EMILIN2	97	0			c.A284T						.						117.0	101.0	106.0					18																	2884988		2203	4300	6503	SO:0001583	missense	84034	exon3			CTAGATATGTCAC	AF270513	CCDS11828.1	18p11.3	2008-02-05			ENSG00000132205	ENSG00000132205		"""EMI domain containing"""	19881	protein-coding gene	gene with protein product		608928					Standard	NM_032048		Approved	FLJ33200, FOAP-10	uc002kln.3	Q9BXX0	OTTHUMG00000128525	ENST00000254528.3:c.284A>T	18.37:g.2884988A>T	ENSP00000254528:p.Tyr95Phe	Somatic	70	0		WXS	Illumina GAIIx	Phase_I	52	5	NM_032048	B2RMY3|Q8NBH3|Q96JQ4	Missense_Mutation	SNP	ENST00000254528.3	37	CCDS11828.1	.	.	.	.	.	.	.	.	.	.	A	17.97	3.517604	0.64634	.	.	ENSG00000132205	ENST00000254528	T	0.60040	0.22	5.83	4.65	0.58169	EMI domain (2);	0.089336	0.48767	N	0.000179	T	0.68997	0.3062	M	0.84433	2.695	0.47819	D	0.999524	P	0.50066	0.931	P	0.50825	0.651	T	0.71293	-0.4636	10	0.44086	T	0.13	-15.0753	11.9981	0.53214	0.8666:0.0:0.0:0.1334	.	95	Q9BXX0	EMIL2_HUMAN	F	95	ENSP00000254528:Y95F	ENSP00000254528:Y95F	Y	+	2	0	EMILIN2	2874988	1.000000	0.71417	0.085000	0.20634	0.707000	0.40811	5.616000	0.67709	0.989000	0.38761	0.528000	0.53228	TAT	.		0.502	EMILIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250337.2	NM_032048	
ZNF234	10780	broad.mit.edu	37	19	44661838	44661838	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr19:44661838G>T	ENST00000426739.2	+	6	1927	c.1669G>T	c.(1669-1671)Gcc>Tcc	p.A557S	ZNF234_ENST00000592437.1_Missense_Mutation_p.A557S	NM_006630.2	NP_006621.1	Q14588	ZN234_HUMAN	zinc finger protein 234	557					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)	23		Prostate(69;0.0435)				ACACCTTCAAGCCCATCAAAA	0.488																																					p.A557S													.	ZNF234	132	0			c.G1669T						.						80.0	86.0	84.0					19																	44661838		2196	4299	6495	SO:0001583	missense	10780	exon6			CTTCAAGCCCATC	X78927	CCDS46101.1	19q13	2013-01-08				ENSG00000263002		"""Zinc fingers, C2H2-type"", ""-"""	13027	protein-coding gene	gene with protein product		604750		ZNF269		7865130	Standard	NM_006630		Approved	HZF4	uc002oyl.4	Q14588		ENST00000426739.2:c.1669G>T	19.37:g.44661838G>T	ENSP00000400878:p.Ala557Ser	Somatic	51	0		WXS	Illumina GAIIx	Phase_I	44	3	NM_006630	A8K1C8|Q96IR4|Q9NS45|Q9NYT7	Missense_Mutation	SNP	ENST00000426739.2	37	CCDS46101.1	.	.	.	.	.	.	.	.	.	.	G	12.26	1.885576	0.33255	.	.	ENSG00000167380	ENST00000426739	T	0.07327	3.2	4.02	1.76	0.24704	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.10035	0.0246	N	0.12569	0.235	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.23084	-1.0198	9	0.09084	T	0.74	.	8.231	0.31597	0.2801:0.0:0.7199:0.0	.	557	Q14588	ZN234_HUMAN	S	557	ENSP00000400878:A557S	ENSP00000400878:A557S	A	+	1	0	ZNF226	49353678	0.000000	0.05858	0.012000	0.15200	0.982000	0.71751	-1.980000	0.01492	0.430000	0.26230	0.585000	0.79938	GCC	.		0.488	ZNF234-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460586.2		
FAR2P1	440905	broad.mit.edu	37	2	130805493	130805496	+	RNA	DEL	TTCT	TTCT	-	rs3058389		TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr2:130805493_130805496delTTCT	ENST00000325390.3	-	0	1855					NR_026758.1																						cacacacacattctcacacacaca	0.505																																					.													.	.	.	0			.						.																																					0	.			CACACATTCTCAC																													2.37:g.130805493_130805496delTTCT		Somatic	9	0		WXS	Illumina GAIIx	Phase_I	18	7	.		RNA	DEL	ENST00000325390.3	37																																																																																				.		0.505	AC018865.8-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000331630.3		
PLGLA	285189	broad.mit.edu	37	2	107003270	107003270	+	RNA	DEL	A	A	-	rs549808603	byFrequency	TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr2:107003270delA	ENST00000484422.1	+	0	103							Q15195	PLGA_HUMAN	plasminogen-like A (pseudogene)							extracellular region (GO:0005576)											ATATAATGTTAAAAAAAAAAA	0.403													|||unknown(NO_COVERAGE)	40	0.00798722	0.0098	0.0058	5008	,	,		19909	0.005		0.005	False		,,,				2504	0.0133				.													.	.	.	0			.						.																																					0	.			AATGTTAAAAAAA	U67178, M86872, M86873		2q12.2	2013-03-28	2013-03-28	2008-02-07	ENSG00000240935	ENSG00000240935			9074	pseudogene	pseudogene		612212	"""plasminogen pseudogene 2"", ""plasminogen-like A1"", ""plasminogen-like A"""	PLGP2, PLGLA1		1986355	Standard	NR_003506		Approved		uc002tdp.4	Q15195	OTTHUMG00000153188		2.37:g.107003270delA		Somatic	4	0		WXS	Illumina GAIIx	Phase_I	8	3	.		RNA	DEL	ENST00000484422.1	37																																																																																				.		0.403	PLGLA-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000331219.1	NR_003506.2	
FAM182B	728882	broad.mit.edu	37	20	25755549	25755549	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr20:25755549C>A	ENST00000376403.1	-	3	785	c.407G>T	c.(406-408)gGc>gTc	p.G136V	FAM182B_ENST00000376404.2_Intron|FAM182B_ENST00000478164.1_Intron			Q5T319	F182B_HUMAN	family with sequence similarity 182, member B	136										lung(1)	1						TGGTCTGCAGCCTTCCTGGGA	0.716																																					.													FAM182B,colon,carcinoma,0,1	FAM182B	6	0			.						.																																			SO:0001583	missense	0	.			CTGCAGCCTTCCT			20p11.1	2010-07-14			ENSG00000175170	ENSG00000175170			34503	pseudogene	pseudogene							Standard	NR_027061		Approved			Q5T319	OTTHUMG00000032136	ENST00000376403.1:c.407G>T	20.37:g.25755549C>A	ENSP00000365585:p.Gly136Val	Somatic	102	2		WXS	Illumina GAIIx	Phase_I	101	11	.	Q4G0Q1	Missense_Mutation	SNP	ENST00000376403.1	37		.	.	.	.	.	.	.	.	.	.	.	1.024	-0.684035	0.03353	.	.	ENSG00000175170	ENST00000376403	.	.	.	.	.	.	.	.	.	.	.	T	0.39064	0.1064	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	T	0.39187	-0.9626	3	0.87932	D	0	.	.	.	.	.	.	.	.	V	136	.	ENSP00000365585:G136V	G	-	2	0	FAM182B	25703549	0.129000	0.22400	0.158000	0.22627	0.158000	0.22134	-0.337000	0.07852	0.064000	0.16427	0.064000	0.15345	GGC	.		0.716	FAM182B-003	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000078463.2	NR_026714	
TRPC4AP	26133	broad.mit.edu	37	20	33632325	33632325	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr20:33632325G>A	ENST00000252015.2	-	7	937	c.848C>T	c.(847-849)gCa>gTa	p.A283V	TRPC4AP_ENST00000432634.2_Missense_Mutation_p.A244V|TRPC4AP_ENST00000451813.2_Missense_Mutation_p.A283V			Q8TEL6	TP4AP_HUMAN	transient receptor potential cation channel, subfamily C, member 4 associated protein	283	Interaction with TNFRSF1A. {ECO:0000250}.				calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|protein ubiquitination (GO:0016567)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process (GO:0006511)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|skin(1)|stomach(1)|urinary_tract(1)	32			BRCA - Breast invasive adenocarcinoma(18;0.00936)			GATTTCAGCTGCAGAAGGCCC	0.398																																					p.A283V													.	TRPC4AP	64	0			c.C848T						.						99.0	100.0	99.0					20																	33632325		2203	4300	6503	SO:0001583	missense	26133	exon7			TCAGCTGCAGAAG	AF055022	CCDS13246.1, CCDS46591.1	20q11.23	2014-06-13	2003-10-06	2003-10-08	ENSG00000100991	ENSG00000100991			16181	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 158"""	608430	"""chromosome 20 open reading frame 188"""	C20orf188			Standard	NM_015638		Approved	DKFZP727M231, DKFZp586C1223, dJ756N5.2, TRRP4AP, PPP1R158	uc002xbk.3	Q8TEL6	OTTHUMG00000032319	ENST00000252015.2:c.848C>T	20.37:g.33632325G>A	ENSP00000252015:p.Ala283Val	Somatic	68	0		WXS	Illumina GAIIx	Phase_I	67	4	NM_199368	E1P5Q0|E1P5Q1|Q96H82|Q9BVB8|Q9H429|Q9UFS6	Missense_Mutation	SNP	ENST00000252015.2	37	CCDS13246.1	.	.	.	.	.	.	.	.	.	.	G	6.892	0.534120	0.13188	.	.	ENSG00000100991	ENST00000252015;ENST00000451813;ENST00000432634;ENST00000541994	.	.	.	5.74	3.73	0.42828	.	0.173078	0.51477	D	0.000093	T	0.22399	0.0540	N	0.03608	-0.345	0.80722	D	1	B;B;B	0.13594	0.0;0.004;0.008	B;B;B	0.06405	0.0;0.002;0.002	T	0.17992	-1.0351	9	0.02654	T	1	.	9.0763	0.36525	0.0:0.3837:0.5014:0.115	.	244;283;283	B4E0Q1;E1P5Q0;Q8TEL6	.;.;TP4AP_HUMAN	V	283;283;244;268	.	ENSP00000252015:A283V	A	-	2	0	TRPC4AP	33095986	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.306000	0.65756	1.410000	0.46936	0.585000	0.79938	GCA	.		0.398	TRPC4AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078832.2	NM_015638	
KIAA0226	9711	broad.mit.edu	37	3	197403835	197403835	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr3:197403835G>T	ENST00000296343.5	-	18	2566	c.2567C>A	c.(2566-2568)aCt>aAt	p.T856N	KIAA0226_ENST00000389665.5_Missense_Mutation_p.T881N|KIAA0226_ENST00000273582.5_Missense_Mutation_p.T811N|MIR922_ENST00000401223.1_RNA	NM_014687.1	NP_055502.1	Q92622	RUBIC_HUMAN	KIAA0226	856					autophagy (GO:0006914)|cell death (GO:0008219)|endocytosis (GO:0006897)|negative regulation of autophagy (GO:0010507)|negative regulation of endocytosis (GO:0045806)	early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)				NS(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(143;8.26e-10)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.0446)		CCTGGTCGCAGTCAGGTCATT	0.597																																					p.T856N	Esophageal Squamous(3;167 355 3763 15924)												.	KIAA0226	136	0			c.C2567A						.						71.0	76.0	74.0					3																	197403835		2014	4176	6190	SO:0001583	missense	9711	exon18			GTCGCAGTCAGGT	D86979	CCDS43195.1, CCDS46987.1	3q29	2011-08-09			ENSG00000145016	ENSG00000145016			28991	protein-coding gene	gene with protein product	"""RUN domain and cysteine-rich domain containing, Beclin 1-interacting protein"""	613516				9039502, 19270693, 20826435	Standard	XM_005269374		Approved	rubicon, rundataxin	uc003fyc.2	Q92622	OTTHUMG00000155452	ENST00000296343.5:c.2567C>A	3.37:g.197403835G>T	ENSP00000296343:p.Thr856Asn	Somatic	48	0		WXS	Illumina GAIIx	Phase_I	31	3	NM_014687	Q96CK5	Missense_Mutation	SNP	ENST00000296343.5	37	CCDS43195.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	11.49|11.49|11.49	1.654625|1.654625|1.654625	0.29425|0.29425|0.29425	.|.|.	.|.|.	ENSG00000145016|ENSG00000145016|ENSG00000145016	ENST00000413360|ENST00000415452|ENST00000273582;ENST00000296343;ENST00000389665	.|.|.	.|.|.	.|.|.	5.95|5.95|5.95	5.08|5.08|5.08	0.68730|0.68730|0.68730	.|.|.	.|.|0.313409	.|.|0.34932	.|.|N	.|.|0.003569	T|T|T	0.24890|0.24890|0.24890	0.0604|0.0604|0.0604	N|N|N	0.12471|0.12471|0.12471	0.22|0.22|0.22	0.24063|0.24063|0.24063	N|N|N	0.996007|0.996007|0.996007	.|.|B;B;B	.|.|0.17038	.|.|0.02;0.001;0.011	.|.|B;B;B	.|.|0.19666	.|.|0.023;0.008;0.026	T|T|T	0.15407|0.15407|0.15407	-1.0438|-1.0438|-1.0438	5|5|9	.|.|0.24483	.|.|T	.|.|0.36	.|.|.	10.9725|10.9725|10.9725	0.47446|0.47446|0.47446	0.0733:0.1649:0.7618:0.0|0.0733:0.1649:0.7618:0.0|0.0733:0.1649:0.7618:0.0	.|.|.	.|.|881;811;856	.|.|Q92622-3;Q92622-2;Q92622	.|.|.;.;RUBIC_HUMAN	E|M|N	817|640|811;856;881	.|.|.	.|.|ENSP00000273582:T811N	D|L|T	-|-|-	3|1|2	2|2|0	KIAA0226|KIAA0226|KIAA0226	198888232|198888232|198888232	0.946000|0.946000|0.946000	0.32159|0.32159|0.32159	0.771000|0.771000|0.771000	0.31576|0.31576|0.31576	0.886000|0.886000|0.886000	0.51366|0.51366|0.51366	1.524000|1.524000|1.524000	0.35942|0.35942|0.35942	1.527000|1.527000|1.527000	0.49086|0.49086|0.49086	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GAC|CTG|ACT	.		0.597	KIAA0226-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000340184.1	XM_032901	
LOC102724392	102724392	broad.mit.edu	37	5	70673207	70673207	+	lincRNA	DEL	A	A	-	rs571177560		TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr5:70673207delA	ENST00000502659.2	-	0	698				RP11-136K7.3_ENST00000518473.1_lincRNA|PMCHL2_ENST00000450213.2_RNA																							ACTGTCACTTAAAAAAAAAAA	0.289																																					.													.	.	.	0			.						.																																					0	.			TCACTTAAAAAAA																													5.37:g.70673207delA		Somatic	6	0		WXS	Illumina GAIIx	Phase_I	7	3	.		RNA	DEL	ENST00000502659.2	37																																																																																				.		0.289	RP11-136K7.2-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000374679.1		
ESYT2	57488	broad.mit.edu;bcgsc.ca	37	7	158560431	158560435	+	Frame_Shift_Del	DEL	ATATT	ATATT	-			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr7:158560431_158560435delATATT	ENST00000251527.5	-	8	1043_1047	c.978_982delAATAT	c.(976-984)ataatatcafs	p.IS327fs		NM_020728.2	NP_065779.1	A0FGR8	ESYT2_HUMAN	extended synaptotagmin-like protein 2	355	Glycerophospholipid-binding barrel-like domain.				endocytosis (GO:0006897)|lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|membrane (GO:0016020)|organelle membrane contact site (GO:0044232)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|identical protein binding (GO:0042802)|phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(16)|prostate(2)	32						AGATAGTTTGATATTATATCCAAAA	0.42																																					p.326_328del													.	ESYT2	70	0			c.978_982del						.																																			SO:0001589	frameshift_variant	57488	exon8			AGTTTGATATTAT	AB033054	CCDS34791.1	7q36.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000117868	ENSG00000117868		"""Synaptotagmins"""	22211	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member B"""	FAM62B		17672888	Standard	NM_020728		Approved	KIAA1228, CHR2SYT	uc003wob.1	A0FGR8	OTTHUMG00000151436	ENST00000251527.5:c.978_982delAATAT	7.37:g.158560431_158560435delATATT	ENSP00000251527:p.Ile327fs	Somatic	83	0		WXS	Illumina GAIIx	Phase_I	72	9	NM_020728	A4D229|Q69YJ2|Q6UKI4|Q6ZTU0|Q6ZVU1|Q9BQS0|Q9NW47|Q9ULJ2	Frame_Shift_Del	DEL	ENST00000251527.5	37	CCDS34791.1																																																																																			.		0.420	ESYT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322647.1	NM_020728	
SMIM19	114926	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	42403821	42403821	+	Missense_Mutation	SNP	A	A	C			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr8:42403821A>C	ENST00000438528.3	+	3	206	c.157A>C	c.(157-159)Ata>Cta	p.I53L	SMIM19_ENST00000490331.2_Missense_Mutation_p.I53L|SMIM19_ENST00000417410.2_Missense_Mutation_p.I53L|SMIM19_ENST00000416469.2_Missense_Mutation_p.I53L|SMIM19_ENST00000414154.2_Missense_Mutation_p.I53L	NM_001135676.1	NP_001129148.1	Q96E16	SMI19_HUMAN	small integral membrane protein 19	53						integral component of membrane (GO:0016021)											AATTATGAGGATATTCAGTGT	0.368																																					p.I53L													.	.	.	0			c.A157C						.						105.0	102.0	103.0					8																	42403821		2203	4300	6503	SO:0001583	missense	114926	exon3			ATGAGGATATTCA	BC013035	CCDS6133.2	8p11.21	2013-03-08	2013-03-08	2013-03-08	ENSG00000176209	ENSG00000176209			25166	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 40"""	C8orf40		12477932	Standard	NM_001135674		Approved		uc011lcv.2	Q96E16	OTTHUMG00000157060	ENST00000438528.3:c.157A>C	8.37:g.42403821A>C	ENSP00000391549:p.Ile53Leu	Somatic	84	0		WXS	Illumina GAIIx	Phase_I	68	11	NM_001135675	B2R4S6|D3DSY4	Missense_Mutation	SNP	ENST00000438528.3	37	CCDS6133.2	.	.	.	.	.	.	.	.	.	.	A	34	5.330687	0.95733	.	.	ENSG00000176209	ENST00000438528;ENST00000518574;ENST00000417410;ENST00000414154;ENST00000416469;ENST00000490331	.	.	.	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.64907	0.2641	L	0.34521	1.04	0.58432	D	0.999999	P	0.51147	0.942	D	0.64595	0.927	T	0.64462	-0.6402	9	0.42905	T	0.14	.	14.1525	0.65395	1.0:0.0:0.0:0.0	.	53	Q96E16	CH040_HUMAN	L	53;3;53;53;53;53	.	ENSP00000408997:I53L	I	+	1	0	C8orf40	42522978	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.573000	0.74009	2.229000	0.72834	0.533000	0.62120	ATA	.		0.368	SMIM19-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347309.2	NM_138436	
CSMD3	114788	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	113988300	113988300	+	Missense_Mutation	SNP	C	C	T	rs112359948		TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr8:113988300C>T	ENST00000297405.5	-	7	1352	c.1108G>A	c.(1108-1110)Gtt>Att	p.V370I	CSMD3_ENST00000352409.3_Missense_Mutation_p.V370I|CSMD3_ENST00000455883.2_Intron|CSMD3_ENST00000343508.3_Missense_Mutation_p.V330I	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	370						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GTGCTAGCAACAGCAATAGCA	0.483										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.V370I													.	CSMD3	2325	0			c.G1108A						.						175.0	160.0	165.0					8																	113988300		2203	4300	6503	SO:0001583	missense	114788	exon7			TAGCAACAGCAAT	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.1108G>A	8.37:g.113988300C>T	ENSP00000297405:p.Val370Ile	Somatic	39	0		WXS	Illumina GAIIx	Phase_I	44	7	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	14.39	2.522403	0.44866	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000352409	T;T;T	0.19669	2.13;2.13;2.14	6.08	6.08	0.98989	.	0.255485	0.25639	N	0.029283	T	0.16428	0.0395	N	0.22421	0.69	0.26241	N	0.978873	B;B	0.22346	0.041;0.068	B;B	0.23419	0.021;0.046	T	0.14531	-1.0469	10	0.22109	T	0.4	.	16.0708	0.80928	0.0:0.8668:0.1332:0.0	.	370;330	Q7Z407;Q7Z407-2	CSMD3_HUMAN;.	I	330;370;370	ENSP00000345799:V330I;ENSP00000297405:V370I;ENSP00000343124:V370I	ENSP00000297405:V370I	V	-	1	0	CSMD3	114057476	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.650000	0.54424	2.890000	0.99128	0.655000	0.94253	GTT	C|0.500;T|0.500		0.483	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
MLLT3	4300	broad.mit.edu;bcgsc.ca	37	9	20414379	20414379	+	Silent	SNP	G	G	A	rs373338988		TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr9:20414379G>A	ENST00000380338.4	-	5	751	c.465C>T	c.(463-465)agC>agT	p.S155S	MLLT3_ENST00000475957.1_5'UTR|MLLT3_ENST00000429426.2_Silent_p.S152S|MLLT3_ENST00000355930.6_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	155	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.S155S(4)		central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctactgctgctgctgc	0.532			T	MLL	ALL																																p.S155S				Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	MLLT3,NS,carcinoma,0,8	MLLT3	125	4	Substitution - coding silent(4)	urinary_tract(1)|large_intestine(1)|lung(1)|kidney(1)	c.C465T						.						10.0	15.0	14.0					9																	20414379		1871	3851	5722	SO:0001819	synonymous_variant	4300	exon5			GCTACTGCTGCTG	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.465C>T	9.37:g.20414379G>A		Somatic	72	0		WXS	Illumina GAIIx	Phase_I	74	5	NM_004529	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	ENST00000380338.4	37	CCDS6494.1																																																																																			.		0.532	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051872.1	NM_004529	
MT-CYB	4519	broad.mit.edu	37	M	14900	14900	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chrM:14900G>A	ENST00000361789.2	+	1	154	c.154G>A	c.(154-156)Gcc>Acc	p.A52T	MT-TE_ENST00000387459.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-ND6_ENST00000361681.2_5'Flank|MT-TP_ENST00000387461.2_RNA|MT-TT_ENST00000387460.2_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	52					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						GACTATTCCTAGCCATACACT	0.527																																					p.A52T													.	.	.	0			c.G154A						.																																			SO:0001583	missense	4519	exon1			TTCCTAGCCATGC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.154G>A	M.37:g.14900G>A	ENSP00000354554:p.Ala52Thr	Somatic	96	1		WXS	Illumina GAIIx	Phase_I	315	5	ENST00000361789	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	37																																																																																				.		0.527	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
POLA1	5422	broad.mit.edu;ucsc.edu	37	X	24712122	24712122	+	Intron	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chrX:24712122G>T	ENST00000379059.3	+	1	40				POLA1_ENST00000379068.3_Splice_Site	NM_016937.3	NP_058633.2	P09884	DPOLA_HUMAN	polymerase (DNA directed), alpha 1, catalytic subunit						cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|lagging strand elongation (GO:0006273)|leading strand elongation (GO:0006272)|mitotic cell cycle (GO:0000278)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|translesion synthesis (GO:0019985)|viral process (GO:0016032)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleoside binding (GO:0001882)|nucleotide binding (GO:0000166)|protein kinase binding (GO:0019901)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|skin(2)	11					Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Nelarabine(DB01280)	GGGGCGAGTGGTGAGGGACAA	0.667																																					.													.	POLA1	117	0			.						.						32.0	22.0	26.0					X																	24712122		2187	4278	6465	SO:0001627	intron_variant	5422	.			CGAGTGGTGAGGG		CCDS14214.1	Xp22.1-p21.3	2014-01-30	2008-08-07	2006-09-26	ENSG00000101868	ENSG00000101868	2.7.7.7	"""DNA polymerases"""	9173	protein-coding gene	gene with protein product		312040	"""polymerase (DNA directed), alpha"", ""polymerase (DNA directed), alpha 1"", ""N syndrome (mental retardation, malformations, chromosome breakage)"""	POLA, NSX		1689958	Standard	NM_016937		Approved	p180	uc004dbl.3	P09884	OTTHUMG00000021277	ENST00000379059.3:c.25+19G>T	X.37:g.24712122G>T		Somatic	37	0		WXS	Illumina GAIIx	Phase_I	41	4	.	Q86UQ7	Splice_Site	SNP	ENST00000379059.3	37	CCDS14214.1	.	.	.	.	.	.	.	.	.	.	G	10.43	1.346797	0.24426	.	.	ENSG00000101868	ENST00000379068	.	.	.	4.3	4.3	0.51218	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.1328	0.48358	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	POLA1	24622043	1.000000	0.71417	0.999000	0.59377	0.083000	0.17756	4.425000	0.59875	2.100000	0.63781	0.513000	0.50165	.	.		0.667	POLA1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056111.1	NM_016937	
RP13-228J13.1	0	broad.mit.edu	37	X	154578865	154578865	+	RNA	DEL	G	G	-	rs150846040|rs563910	byFrequency	TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chrX:154578865delG	ENST00000412436.1	-	0	98				RP13-228J13.1_ENST00000444722.1_RNA|RP13-228J13.5_ENST00000453508.1_RNA																							TTTTCTCTCTGTTTTTTTTTT	0.418																																					.													.	.	.	0			.						.																																					0	.			CTCTCTGTTTTTT																													X.37:g.154578865delG		Somatic	19	0		WXS	Illumina GAIIx	Phase_I	24	6	.		RNA	DEL	ENST00000412436.1	37																																																																																				.		0.418	RP13-228J13.1-001	KNOWN	basic	antisense	antisense	OTTHUMT00000058799.1		
NAV2	89797	ucsc.edu;bcgsc.ca	37	11	20101694	20101694	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr11:20101694G>T	ENST00000396087.3	+	27	5531	c.5432G>T	c.(5431-5433)aGc>aTc	p.S1811I	NAV2_ENST00000396085.1_Missense_Mutation_p.S1755I|NAV2_ENST00000360655.4_Missense_Mutation_p.S1691I|NAV2_ENST00000527559.2_Missense_Mutation_p.S1740I|NAV2_ENST00000311043.8_Missense_Mutation_p.S819I|NAV2_ENST00000533917.1_Missense_Mutation_p.S819I|NAV2_ENST00000349880.4_Missense_Mutation_p.S1755I|NAV2_ENST00000540292.1_Missense_Mutation_p.S1742I	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	1811					glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						AGTGCCACCAGCCACTCCAGC	0.587																																					p.S1811I													.	NAV2	255	0			c.G5432T						.						67.0	61.0	63.0					11																	20101694		2203	4300	6503	SO:0001583	missense	89797	exon27			CCACCAGCCACTC	AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.5432G>T	11.37:g.20101694G>T	ENSP00000379396:p.Ser1811Ile	Somatic	27	0		WXS	Illumina HiSeq		26	4	NM_001244963	A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Missense_Mutation	SNP	ENST00000396087.3	37	CCDS58126.1	.	.	.	.	.	.	.	.	.	.	G	32	5.166546	0.94768	.	.	ENSG00000166833	ENST00000360655;ENST00000396085;ENST00000349880;ENST00000396087;ENST00000527559;ENST00000540292;ENST00000533917;ENST00000525322;ENST00000311043;ENST00000536595	D;D;D;D;D;D;D;D;D	0.94417	-3.42;-3.42;-3.42;-3.42;-3.42;-3.42;-3.42;-3.42;-3.42	5.71	4.8	0.61643	.	0.000000	0.64402	D	0.000001	D	0.96583	0.8885	M	0.74467	2.265	0.80722	D	1	D;D;D;D;D;D	0.76494	0.996;0.999;0.999;0.999;0.997;0.999	D;D;D;D;D;D	0.69654	0.924;0.949;0.952;0.965;0.965;0.965	D	0.96319	0.9235	9	.	.	.	.	14.2487	0.66004	0.071:0.0:0.929:0.0	.	1755;1811;819;804;1755;1691	A7E2D6;Q8IVL1;Q8IVL1-5;E9PNV5;Q8IVL1-3;Q8IVL1-4	.;NAV2_HUMAN;.;.;.;.	I	1691;1755;1755;1811;1740;1742;819;804;819;804	ENSP00000353871:S1691I;ENSP00000379394:S1755I;ENSP00000309577:S1755I;ENSP00000379396:S1811I;ENSP00000435395:S1740I;ENSP00000443489:S1742I;ENSP00000437316:S819I;ENSP00000437136:S804I;ENSP00000312169:S819I	.	S	+	2	0	NAV2	20058270	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	1.415000	0.47037	0.557000	0.71058	AGC	.		0.587	NAV2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324112.1	NM_145117	
TICRR	90381	ucsc.edu;bcgsc.ca	37	15	90138623	90138623	+	Splice_Site	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr15:90138623G>T	ENST00000268138.7	+	7	1786		c.e7-1		TICRR_ENST00000560985.1_Splice_Site			Q7Z2Z1	TICRR_HUMAN	TOPBP1-interacting checkpoint and replication regulator						cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|formation of translation preinitiation complex (GO:0001731)|mitotic DNA replication checkpoint (GO:0033314)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	chromatin binding (GO:0003682)										TGTTTTGGTAGGAGGGGTCCC	0.418																																					.													.	.	.	0			c.1682-1G>T						.						88.0	79.0	81.0					15																	90138623		1896	4119	6015	SO:0001630	splice_region_variant	90381	exon7			TTGGTAGGAGGGG	AK123612	CCDS10352.2	15q26.1	2012-07-11	2012-07-11	2012-07-11	ENSG00000140534	ENSG00000140534			28704	protein-coding gene	gene with protein product	"""TOPBP1-interacting replication-stimulating protein"", ""SLD3 homolog (S. cerevisiae)"""	613298	"""chromosome 15 open reading frame 42"""	C15orf42		20116089, 20080954	Standard	NM_152259		Approved	MGC45866, FLJ41618, Treslin, SLD3	uc002boe.3	Q7Z2Z1	OTTHUMG00000149648	ENST00000268138.7:c.1682-1G>T	15.37:g.90138623G>T		Somatic	36	0		WXS	Illumina HiSeq		40	4	NM_152259	B2RE07|B3KVV9|D3IUT4|Q8N4X8|Q8NCH6|Q9BU55	Splice_Site	SNP	ENST00000268138.7	37	CCDS10352.2	.	.	.	.	.	.	.	.	.	.	G	36	5.802370	0.96960	.	.	ENSG00000140534	ENST00000268138	.	.	.	5.79	5.79	0.91817	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0313	0.97540	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C15orf42	87939627	1.000000	0.71417	0.799000	0.32177	0.892000	0.51952	9.153000	0.94687	2.746000	0.94184	0.655000	0.94253	.	.		0.418	TICRR-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000312856.1	NM_152259	Intron
TCEA2	6919	ucsc.edu	37	20	62699440	62699440	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr20:62699440G>T	ENST00000343484.5	+	4	451	c.282G>T	c.(280-282)atG>atT	p.M94I	TCEA2_ENST00000395053.3_Missense_Mutation_p.M94I|TCEA2_ENST00000361317.2_Missense_Mutation_p.M67I|TCEA2_ENST00000465111.1_3'UTR	NM_003195.4	NP_003186.1	Q15560	TCEA2_HUMAN	transcription elongation factor A (SII), 2	94					DNA-templated transcription, elongation (GO:0006354)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription, elongation (GO:0032784)	centrosome (GO:0005813)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)	12	all_cancers(38;3.45e-11)|all_epithelial(29;9.12e-13)|Lung NSC(23;2e-09)|all_lung(23;6.77e-09)					GGAGGGGCATGCCTCTGCCCA	0.637																																					p.M94I													.	TCEA2	22	0			c.G282T						.						48.0	44.0	45.0					20																	62699440		2203	4300	6503	SO:0001583	missense	6919	exon4			GGGCATGCCTCTG	U86749	CCDS13553.1, CCDS13554.1	20q13.33	2011-01-25			ENSG00000171703	ENSG00000171703			11614	protein-coding gene	gene with protein product		604784				9441762, 8566795	Standard	NM_003195		Approved	TFIIS	uc021wgq.1	Q15560	OTTHUMG00000033026	ENST00000343484.5:c.282G>T	20.37:g.62699440G>T	ENSP00000343515:p.Met94Ile	Somatic	20	0		WXS	Illumina HiSeq		37	4	NM_003195	B3KNM1|Q8TD37|Q8TD38	Missense_Mutation	SNP	ENST00000343484.5	37	CCDS13553.1	.	.	.	.	.	.	.	.	.	.	G	7.291	0.611103	0.14066	.	.	ENSG00000171703	ENST00000361317;ENST00000343484;ENST00000395053;ENST00000339217;ENST00000415602;ENST00000440819;ENST00000458442	.	.	.	3.21	-1.73	0.08081	Transcription factor IIS, N-terminal (1);	2.080600	0.02258	N	0.067306	T	0.18800	0.0451	N	0.08118	0	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.14924	-1.0455	9	0.40728	T	0.16	-5.7804	4.0409	0.09751	0.3981:0.1757:0.4262:0.0	.	94;94;67;94	Q15560;Q6IB64;B3KNM1;Q86VL0	TCEA2_HUMAN;.;.;.	I	67;94;94;67;67;67;67	.	ENSP00000339432:M67I	M	+	3	0	TCEA2	62169884	0.000000	0.05858	0.224000	0.23877	0.448000	0.32197	0.052000	0.14163	-0.311000	0.08754	-1.259000	0.01468	ATG	.		0.637	TCEA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080277.2	NM_198723	
TCEB3	6924	bcgsc.ca	37	1	24082492	24082492	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr1:24082492G>T	ENST00000418390.2	+	8	2300	c.2029G>T	c.(2029-2031)Gca>Tca	p.A677S	TCEB3_ENST00000609199.1_Missense_Mutation_p.A651S	NM_003198.2	NP_003189.2	Q14241	ELOA1_HUMAN	transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)	677	Activation domain. {ECO:0000250}.				gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	19		Colorectal(325;3.46e-05)|Lung NSC(340;0.000112)|all_lung(284;0.00016)|Renal(390;0.000219)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;2.42e-24)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;4.74e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000973)|KIRC - Kidney renal clear cell carcinoma(1967;0.00334)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		TATCCAGTTCGCACATGCCAA	0.542																																					p.A677S													.	TCEB3	61	0			c.G2029T						.						74.0	66.0	69.0					1																	24082492		2203	4300	6503	SO:0001583	missense	6924	exon8			CAGTTCGCACATG	L47345	CCDS239.2	1p36.1	2010-06-22	2002-08-29		ENSG00000011007	ENSG00000011007			11620	protein-coding gene	gene with protein product		600786	"""transcription elongation factor B (SIII), polypeptide 3 (110kD, elongin A)"""			8586449, 7660129	Standard	NM_003198		Approved	SIII, TCEB3A	uc001bho.3	Q14241	OTTHUMG00000002957	ENST00000418390.2:c.2029G>T	1.37:g.24082492G>T	ENSP00000395574:p.Ala677Ser	Somatic	45	0		WXS	Illumina HiSeq	Phase_1	50	4	NM_003198	B2R7Q8|Q8IXH1	Missense_Mutation	SNP	ENST00000418390.2	37	CCDS239.2	.	.	.	.	.	.	.	.	.	.	G	19.93	3.918439	0.73098	.	.	ENSG00000011007	ENST00000418390	T	0.31510	1.49	5.61	5.61	0.85477	.	0.000000	0.64402	D	0.000013	T	0.47581	0.1453	L	0.41492	1.28	0.80722	D	1	D	0.58268	0.982	D	0.63957	0.92	T	0.22068	-1.0227	10	0.45353	T	0.12	-13.6305	19.9979	0.97390	0.0:0.0:1.0:0.0	.	677	Q14241	ELOA1_HUMAN	S	677	ENSP00000395574:A677S	ENSP00000395574:A677S	A	+	1	0	TCEB3	23955079	1.000000	0.71417	0.872000	0.34217	0.440000	0.31957	6.627000	0.74258	2.804000	0.96469	0.462000	0.41574	GCA	.		0.542	TCEB3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000008230.2	NM_003198	
ZC3H8	84524	bcgsc.ca	37	2	112991747	112991747	+	Missense_Mutation	SNP	G	G	T	rs371803574		TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr2:112991747G>T	ENST00000409573.2	-	5	700	c.571C>A	c.(571-573)Cgc>Agc	p.R191S	ZC3H8_ENST00000476902.1_5'Flank|ZC3H8_ENST00000272570.5_Missense_Mutation_p.R191S			Q8N5P1	ZC3H8_HUMAN	zinc finger CCCH-type containing 8	191					apoptotic process (GO:0006915)|negative regulation of T cell differentiation in thymus (GO:0033085)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|response to antibiotic (GO:0046677)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)|T cell homeostasis (GO:0043029)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)	7						TTTCCCTTGCGTTCCACTGTA	0.303																																					p.R191S													ZC3H8,NS,carcinoma,0,1	ZC3H8	17	0			c.C571A						.						98.0	88.0	91.0					2																	112991747		1846	4095	5941	SO:0001583	missense	84524	exon5			CCTTGCGTTCCAC	AF334161	CCDS46392.1	2q13	2012-07-05	2005-06-02	2005-06-02	ENSG00000144161	ENSG00000144161		"""Zinc fingers, CCCH-type domain containing"""	30941	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 8"""	ZC3HDC8		12477932	Standard	NM_032494		Approved	Fliz1	uc021vmw.1	Q8N5P1	OTTHUMG00000153270	ENST00000409573.2:c.571C>A	2.37:g.112991747G>T	ENSP00000386488:p.Arg191Ser	Somatic	60	0		WXS	Illumina HiSeq	Phase_1	66	4	NM_032494	Q9BZ75	Missense_Mutation	SNP	ENST00000409573.2	37	CCDS46392.1	.	.	.	.	.	.	.	.	.	.	G	19.59	3.855627	0.71834	.	.	ENSG00000144161	ENST00000409573;ENST00000272570	T;T	0.28895	1.59;1.59	5.04	4.11	0.48088	Zinc finger, CCCH-type (1);	0.371511	0.27645	N	0.018459	T	0.28665	0.0710	L	0.60455	1.87	0.32338	N	0.560092	P	0.37276	0.589	B	0.34038	0.174	T	0.41324	-0.9515	10	0.35671	T	0.21	-5.2812	12.6072	0.56529	0.0861:0.0:0.9139:0.0	.	191	Q8N5P1	ZC3H8_HUMAN	S	191	ENSP00000386488:R191S;ENSP00000272570:R191S	ENSP00000272570:R191S	R	-	1	0	ZC3H8	112708218	1.000000	0.71417	0.996000	0.52242	0.976000	0.68499	5.738000	0.68613	1.392000	0.46585	-0.345000	0.07892	CGC	.		0.303	ZC3H8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330521.3	NM_032494	
SPATS2L	26010	bcgsc.ca	37	2	201337558	201337558	+	Missense_Mutation	SNP	C	C	G			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr2:201337558C>G	ENST00000358677.5	+	12	1311	c.1064C>G	c.(1063-1065)aCa>aGa	p.T355R	SPATS2L_ENST00000451764.2_Missense_Mutation_p.T355R|SPATS2L_ENST00000409988.3_Missense_Mutation_p.T355R|SPATS2L_ENST00000409151.1_Missense_Mutation_p.T363R|SPATS2L_ENST00000409718.1_Missense_Mutation_p.T355R|SPATS2L_ENST00000360760.5_Missense_Mutation_p.T286R|SPATS2L_ENST00000409385.1_Missense_Mutation_p.T295R|SPATS2L_ENST00000460095.1_3'UTR|SPATS2L_ENST00000409140.3_Missense_Mutation_p.T355R|SPATS2L_ENST00000409755.3_Missense_Mutation_p.T385R	NM_001282735.1|NM_001282743.1|NM_001282744.1|NM_015535.2	NP_001269664.1|NP_001269672.1|NP_001269673.1|NP_056350.2	Q9NUQ6	SPS2L_HUMAN	spermatogenesis associated, serine-rich 2-like	355						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|protein complex (GO:0043234)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)	10						ATTGCAGTTACACATCCAAAG	0.493																																					p.T355R													.	SPATS2L	88	0			c.C1064G						.						77.0	82.0	80.0					2																	201337558		1992	4175	6167	SO:0001583	missense	26010	exon12			CAGTTACACATCC	AF193059	CCDS46483.1, CCDS46484.1, CCDS74621.1, CCDS74622.1	2q33.1	2009-06-12			ENSG00000196141	ENSG00000196141			24574	protein-coding gene	gene with protein product	"""DNA polymerase transactivated protein 6"""	613817				11230166	Standard	NM_001100422		Approved	DNAPTP6	uc002uvr.4	Q9NUQ6	OTTHUMG00000154589	ENST00000358677.5:c.1064C>G	2.37:g.201337558C>G	ENSP00000351503:p.Thr355Arg	Somatic	24	0		WXS	Illumina HiSeq	Phase_1	18	3	NM_001100423	A8K381|B4DRE6|B4DT67|B7WNZ7|Q53T22|Q8WV53|Q8WYG1|Q9NTW4	Missense_Mutation	SNP	ENST00000358677.5	37	CCDS46483.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.218737	0.79464	.	.	ENSG00000196141	ENST00000409718;ENST00000358677;ENST00000409988;ENST00000409385;ENST00000451764;ENST00000360760;ENST00000409140;ENST00000409755;ENST00000409151	.	.	.	5.39	5.39	0.77823	.	0.184854	0.38720	N	0.001589	T	0.48978	0.1530	N	0.08118	0	0.40900	D	0.984145	P;P;D	0.54772	0.934;0.589;0.968	P;B;P	0.55303	0.773;0.142;0.773	T	0.59904	-0.7366	9	0.87932	D	0	-20.3361	17.5251	0.87798	0.0:1.0:0.0:0.0	.	385;286;355	B4DT67;Q9NUQ6-2;Q9NUQ6	.;.;SPS2L_HUMAN	R	355;355;355;295;355;286;355;385;363	.	ENSP00000351503:T355R	T	+	2	0	SPATS2L	201045803	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.867000	0.63013	2.804000	0.96469	0.655000	0.94253	ACA	.		0.493	SPATS2L-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336208.3	NM_015535	
CYP51A1P1	83528	bcgsc.ca	37	3	82856647	82856647	+	IGR	SNP	A	A	G			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr3:82856647A>G								RP11-260O18.1 (343821 upstream) : None (None downstream)																							TTCTTTTTCAATTATAGAAAC	0.363																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			TTTTCAATTATAG																													3.37:g.82856647A>G		Somatic	48	0		WXS	Illumina HiSeq	Phase_1	30	12	.		RNA	SNP		37																																																																																				.	0	0.363								
UGT2B15	7366	bcgsc.ca	37	4	69519938	69519938	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr4:69519938C>A	ENST00000338206.5	-	5	1139	c.1130G>T	c.(1129-1131)gGa>gTa	p.G377V		NM_001076.3	NP_001067.2	P54855	UDB15_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B15	377					cellular glucuronidation (GO:0052695)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)									Acetaminophen(DB00316)|Dabigatran etexilate(DB06695)|Ezetimibe(DB00973)|Lorazepam(DB00186)|Morphine(DB00295)|Oxazepam(DB00842)|Valproic Acid(DB00313)	GCCATTGGTTCCACCATGAGT	0.388																																					p.G377V													.	UGT2B15	48	0			c.G1130T						.						152.0	154.0	153.0					4																	69519938		2203	4296	6499	SO:0001583	missense	7366	exon5			TTGGTTCCACCAT	AF180322	CCDS3524.1	4q13	2008-02-05	2005-07-20		ENSG00000196620	ENSG00000196620		"""UDP glucuronosyltransferases"""	12546	protein-coding gene	gene with protein product		600069	"""UDP glycosyltransferase 2 family, polypeptide B15"""			7835904	Standard	NM_001076		Approved	UGT2B8	uc021xow.1	P54855	OTTHUMG00000161507	ENST00000338206.5:c.1130G>T	4.37:g.69519938C>A	ENSP00000341045:p.Gly377Val	Somatic	135	0		WXS	Illumina HiSeq	Phase_1	81	4	NM_001076	A6NDX0|A6NNJ4|A8K054|P23765|Q9UK63	Missense_Mutation	SNP	ENST00000338206.5	37	CCDS3524.1	.	.	.	.	.	.	.	.	.	.	c	13.34	2.208739	0.39003	.	.	ENSG00000196620	ENST00000338206	D	0.96459	-4.02	2.57	2.57	0.30868	.	0.000000	0.64402	U	0.000001	D	0.98748	0.9579	H	0.98769	4.325	0.54753	D	0.999988	D	0.89917	1.0	D	0.97110	1.0	D	0.98196	1.0465	10	0.87932	D	0	.	10.831	0.46661	0.0:1.0:0.0:0.0	.	377	P54855	UDB15_HUMAN	V	377	ENSP00000341045:G377V	ENSP00000341045:G377V	G	-	2	0	UGT2B15	69202533	1.000000	0.71417	0.994000	0.49952	0.186000	0.23388	6.940000	0.75917	1.421000	0.47157	0.455000	0.32223	GGA	.		0.388	UGT2B15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365172.1	NM_001076	
GIGYF1	64599	bcgsc.ca	37	7	100285182	100285182	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr7:100285182C>T	ENST00000275732.5	-	4	1528	c.319G>A	c.(319-321)Gct>Act	p.A107T	GIGYF1_ENST00000471340.2_5'UTR	NM_022574.4	NP_072096.2	O75420	PERQ1_HUMAN	GRB10 interacting GYF protein 1	107					insulin-like growth factor receptor signaling pathway (GO:0048009)					central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					GGGGGGCCAGCCCCTTTCCCC	0.692																																					p.A107T													.	GIGYF1	113	0			c.G319A						.						16.0	18.0	17.0					7																	100285182		2190	4277	6467	SO:0001583	missense	64599	exon4			GGCCAGCCCCTTT	AF053356	CCDS34708.1	7q22	2008-02-11	2008-02-11	2008-02-11	ENSG00000146830	ENSG00000146830			9126	protein-coding gene	gene with protein product	"""GYF domain containing 1"""	612064	"""PERQ amino acid rich, with GYF domain 1"""	PERQ1		9799793, 12771153	Standard	NM_022574		Approved	GYF1	uc003uwg.1	O75420	OTTHUMG00000157036	ENST00000275732.5:c.319G>A	7.37:g.100285182C>T	ENSP00000275732:p.Ala107Thr	Somatic	24	0		WXS	Illumina HiSeq	Phase_1	12	3	NM_022574	Q6Y7W7|Q8WZ38	Missense_Mutation	SNP	ENST00000275732.5	37	CCDS34708.1	.	.	.	.	.	.	.	.	.	.	.	16.14	3.040139	0.55003	.	.	ENSG00000146830	ENST00000275732	D	0.82893	-1.66	4.97	2.02	0.26589	.	0.072305	0.56097	D	0.000026	T	0.65933	0.2739	N	0.19112	0.55	0.38173	D	0.939393	B	0.24186	0.099	B	0.19946	0.027	T	0.54029	-0.8354	10	0.10377	T	0.69	-3.9431	9.3897	0.38365	0.1525:0.5524:0.2951:0.0	.	107	O75420	PERQ1_HUMAN	T	107	ENSP00000275732:A107T	ENSP00000275732:A107T	A	-	1	0	GIGYF1	100123118	1.000000	0.71417	0.939000	0.37840	0.160000	0.22226	3.397000	0.52572	0.226000	0.20979	0.462000	0.41574	GCT	.		0.692	GIGYF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347205.2	NM_022574	
MPZL2	10205	bcgsc.ca	37	11	118133264	118133264	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr11:118133264G>T	ENST00000278937.2	-	3	453	c.325C>A	c.(325-327)Ctt>Att	p.L109I	MPZL2_ENST00000525647.1_5'Flank|MPZL2_ENST00000438295.2_Missense_Mutation_p.L109I	NM_005797.3	NP_005788.1	O60487	MPZL2_HUMAN	myelin protein zero-like 2	109	Ig-like V-type.				anatomical structure morphogenesis (GO:0009653)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)|T cell differentiation in thymus (GO:0033077)	cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|kidney(2)|large_intestine(5)|lung(2)|skin(1)	11	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.04e-05)		TTCCAGAGAAGGATGGAGGCA	0.542																																					p.L109I													.	MPZL2	20	0			c.C325A						.						151.0	111.0	125.0					11																	118133264		2200	4296	6496	SO:0001583	missense	10205	exon3			AGAGAAGGATGGA	AF275945	CCDS8393.1	11q24	2013-01-11	2007-08-01	2007-08-01		ENSG00000149573		"""Immunoglobulin superfamily / V-set domain containing"""	3496	protein-coding gene	gene with protein product		604873	"""epithelial V-like antigen 1"""	EVA1		9585423	Standard	NM_005797		Approved	EVA	uc001psn.3	O60487		ENST00000278937.2:c.325C>A	11.37:g.118133264G>T	ENSP00000278937:p.Leu109Ile	Somatic	52	0		WXS	Illumina HiSeq	Phase_1	46	4	NM_005797	A8K2R1	Missense_Mutation	SNP	ENST00000278937.2	37	CCDS8393.1	.	.	.	.	.	.	.	.	.	.	G	5.729	0.319006	0.10845	.	.	ENSG00000149573	ENST00000278937;ENST00000438295	T;T	0.66815	-0.23;-0.23	5.98	-10.5	0.00291	Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin V-set, subgroup (1);Immunoglobulin-like fold (1);	1.052770	0.07340	N	0.880666	T	0.30135	0.0755	N	0.04508	-0.205	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.10291	-1.0636	10	0.18276	T	0.48	.	3.0695	0.06225	0.221:0.1347:0.442:0.2022	.	109	O60487	MPZL2_HUMAN	I	109	ENSP00000278937:L109I;ENSP00000408362:L109I	ENSP00000278937:L109I	L	-	1	0	MPZL2	117638474	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-1.450000	0.02390	-2.133000	0.00813	-1.591000	0.00844	CTT	.		0.542	MPZL2-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392113.1	NM_005797	
MAPK6	5597	bcgsc.ca	37	15	52338592	52338592	+	5'UTR	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr15:52338592G>T	ENST00000261845.5	+	0	742					NM_002748.3	NP_002739.1	Q16659	MK06_HUMAN	mitogen-activated protein kinase 6						cell cycle (GO:0007049)|MAPK cascade (GO:0000165)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	20				all cancers(107;0.0028)		TCCTTTTGATGCCAGTTTTCT	0.353																																					.													.	MAPK6	70	0			.						.																																			SO:0001623	5_prime_UTR_variant	5597	.			TTTGATGCCAGTT	L77964	CCDS10147.1	15q21	2011-06-10			ENSG00000069956	ENSG00000069956		"""Mitogen-activated protein kinase cascade / Kinases"""	6879	protein-coding gene	gene with protein product		602904		PRKM6		8875998	Standard	NM_002748		Approved	ERK3, p97MAPK, HsT17250	uc002abp.3	Q16659	OTTHUMG00000131891	ENST00000261845.5:c.-66G>T	15.37:g.52338592G>T		Somatic	61	0		WXS	Illumina HiSeq	Phase_1	65	4	.	B2R945|B5BU65|Q68DH4|Q8IYN8	Missense_Mutation	SNP	ENST00000261845.5	37	CCDS10147.1																																																																																			.		0.353	MAPK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254841.2	NM_002748	
GRIN2A	2903	bcgsc.ca	37	16	9943747	9943747	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr16:9943747G>T	ENST00000396573.2	-	6	1503	c.1194C>A	c.(1192-1194)gaC>gaA	p.D398E	GRIN2A_ENST00000404927.2_Missense_Mutation_p.D398E|GRIN2A_ENST00000330684.3_Missense_Mutation_p.D398E|GRIN2A_ENST00000535259.1_Missense_Mutation_p.D241E|GRIN2A_ENST00000562109.1_Missense_Mutation_p.D398E|GRIN2A_ENST00000396575.2_Missense_Mutation_p.D398E	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	398					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CCGGCTCACAGTCGGAGAAGG	0.582																																					p.D398E													.	GRIN2A	366	0			c.C1194A						.						143.0	117.0	125.0					16																	9943747		2197	4300	6497	SO:0001583	missense	2903	exon6			CTCACAGTCGGAG		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.1194C>A	16.37:g.9943747G>T	ENSP00000379818:p.Asp398Glu	Somatic	25	0		WXS	Illumina HiSeq	Phase_1	36	4	NM_000833	O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	37	CCDS10539.1	.	.	.	.	.	.	.	.	.	.	G	16.45	3.127279	0.56721	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	T;T;T;T;T	0.07327	3.2;3.2;3.2;3.2;3.2	5.22	4.25	0.50352	.	0.000000	0.85682	D	0.000000	T	0.11239	0.0274	L	0.55743	1.74	0.46981	D	0.999276	B;B;P	0.51057	0.291;0.349;0.941	B;B;B	0.43754	0.144;0.068;0.43	T	0.04885	-1.0920	9	.	.	.	.	13.2853	0.60239	0.0779:0.0:0.9221:0.0	.	241;398;398	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	E	398;398;241;398;398	ENSP00000379818:D398E;ENSP00000385872:D398E;ENSP00000441572:D241E;ENSP00000332549:D398E;ENSP00000379820:D398E	.	D	-	3	2	GRIN2A	9851248	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	2.550000	0.45811	2.430000	0.82344	0.655000	0.94253	GAC	.		0.582	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		
ATP2A3	489	bcgsc.ca	37	17	3832041	3832041	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr17:3832041G>T	ENST00000352011.3	-	20	2950	c.2896C>A	c.(2896-2898)Cag>Aag	p.Q966K	ATP2A3_ENST00000397041.3_Missense_Mutation_p.Q966K|ATP2A3_ENST00000397039.1_Missense_Mutation_p.Q150K|ATP2A3_ENST00000397043.3_Missense_Mutation_p.Q966K|ATP2A3_ENST00000309890.7_Missense_Mutation_p.Q966K|ATP2A3_ENST00000397035.3_Missense_Mutation_p.Q966K|ATP2A3_ENST00000359983.3_Missense_Mutation_p.Q966K			Q93084	AT2A3_HUMAN	ATPase, Ca++ transporting, ubiquitous	966					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	36				LUAD - Lung adenocarcinoma(1115;0.000692)|Lung(3;0.0766)		ACCACCCACTGGCGCCCGCTC	0.627																																					p.Q966K	GBM(32;29 774 15719 37967)												.	ATP2A3	148	0			c.C2896A						.						22.0	16.0	18.0					17																	3832041		2166	4222	6388	SO:0001583	missense	489	exon20			CCCACTGGCGCCC		CCDS11041.1, CCDS11042.1, CCDS42234.1, CCDS45579.1, CCDS45580.1	17p13.3	2012-10-22			ENSG00000074370	ENSG00000074370	3.6.3.8	"""ATPases / P-type"""	813	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 3"", ""calcium pump 3"""	601929				8809064	Standard	NM_005173		Approved	SERCA3	uc002fwy.2	Q93084		ENST00000352011.3:c.2896C>A	17.37:g.3832041G>T	ENSP00000301387:p.Gln966Lys	Somatic	51	0		WXS	Illumina HiSeq	Phase_1	56	4	NM_174956	A8MZG0|D3DTJ8|O60900|O60901|O75501|O75502|Q16115|Q6JHX1|Q8TEX5|Q8TEX6	Missense_Mutation	SNP	ENST00000352011.3	37	CCDS11041.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.089805	0.76756	.	.	ENSG00000074370	ENST00000397043;ENST00000397039;ENST00000352011;ENST00000359983;ENST00000397041;ENST00000397045;ENST00000309890;ENST00000397035	D;D;D;D;D;D;D	0.89415	-2.51;-2.51;-2.51;-2.51;-2.51;-2.51;-2.51	3.96	2.98	0.34508	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.135202	0.53938	D	0.000057	D	0.94614	0.8264	M	0.88450	2.955	0.58432	D	0.999995	D;D;B;B;B;B;B	0.89917	1.0;0.99;0.136;0.165;0.136;0.136;0.136	D;D;B;B;B;B;B	0.91635	0.999;0.984;0.128;0.202;0.128;0.128;0.128	D	0.95197	0.8313	10	0.87932	D	0	.	12.9171	0.58213	0.0:0.0:0.836:0.164	.	75;966;966;966;966;966;966	Q6JHX1;Q93084-4;Q93084-2;Q93084;Q93084-6;G3XAE1;Q93084-3	.;.;.;AT2A3_HUMAN;.;.;.	K	966;150;966;966;966;966;966;966	ENSP00000380236:Q966K;ENSP00000380232:Q150K;ENSP00000301387:Q966K;ENSP00000353072:Q966K;ENSP00000380234:Q966K;ENSP00000312577:Q966K;ENSP00000380229:Q966K	ENSP00000312577:Q966K	Q	-	1	0	ATP2A3	3778790	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	7.687000	0.84139	1.244000	0.43870	-0.182000	0.12963	CAG	.		0.627	ATP2A3-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000438401.1	NM_174953	
C17orf51	339263	bcgsc.ca	37	17	21438800	21438800	+	Splice_Site	SNP	C	C	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr17:21438800C>A	ENST00000391411.5	-	2	685		c.e2-1		C17orf51_ENST00000412778.3_Splice_Site|RP11-822E23.8_ENST00000426261.2_RNA|C17orf51_ENST00000535846.1_Splice_Site|RP11-822E23.2_ENST00000579239.1_RNA	NM_001113434.3	NP_001106905.1	A8MQB3	CQ051_HUMAN	chromosome 17 open reading frame 51											endometrium(1)	1						GGAGATGATTCTGTAGAAATA	0.418																																					.													.	C17orf51	24	0			c.428-1G>T						.						64.0	51.0	55.0					17																	21438800		692	1591	2283	SO:0001630	splice_region_variant	339263	exon3			ATGATTCTGTAGA	BC010612	CCDS45629.1	17p11.2	2012-10-11			ENSG00000212719	ENSG00000212719			27904	protein-coding gene	gene with protein product							Standard	XM_005256621		Approved	FLJ12977, FLJ31874, FLJ33618	uc002gyw.4	A8MQB3	OTTHUMG00000132832	ENST00000391411.5:c.428-1G>T	17.37:g.21438800C>A		Somatic	60	0		WXS	Illumina HiSeq	Phase_1	52	4	NM_001113434	B2RN29|B5MCL4	Splice_Site	SNP	ENST00000391411.5	37	CCDS45629.1	.	.	.	.	.	.	.	.	.	.	C	7.237	0.600507	0.13939	.	.	ENSG00000212719	ENST00000391411;ENST00000412778	.	.	.	1.59	1.59	0.23543	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.5936	0.22659	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	C17orf51	21379393	0.023000	0.18921	0.827000	0.32855	0.114000	0.19823	0.558000	0.23469	1.163000	0.42636	0.591000	0.81541	.	.		0.418	C17orf51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256298.3	NM_001113434	Intron
ARIH2P1	390844	bcgsc.ca	37	18	26232046	26232046	+	IGR	SNP	G	G	A			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr18:26232046G>A								CDH2 (474636 upstream) : RP11-510D21.1 (132985 downstream)																							TCAACTGCTCGTTGAGGCTCG	0.428																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	390844	.			CTGCTCGTTGAGG																													18.37:g.26232046G>A		Somatic	18	0		WXS	Illumina HiSeq	Phase_1	22	6	.		RNA	SNP		37																																																																																				.	0	0.428								
FCGBP	8857	bcgsc.ca	37	19	40360905	40360905	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr19:40360905C>T	ENST00000221347.6	-	33	15510	c.15503G>A	c.(15502-15504)tGc>tAc	p.C5168Y		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	5168	Cys-rich.|TIL 12.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GACAGGGATGCAGACACCCTG	0.612																																					p.C5168Y													.	FCGBP	416	0			c.G15503A						.						69.0	66.0	67.0					19																	40360905		2203	4300	6503	SO:0001583	missense	8857	exon33			GGGATGCAGACAC	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.15503G>A	19.37:g.40360905C>T	ENSP00000221347:p.Cys5168Tyr	Somatic	71	0		WXS	Illumina HiSeq	Phase_1	59	4	NM_003890	O95784	Missense_Mutation	SNP	ENST00000221347.6	37	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	C	19.51	3.841408	0.71488	.	.	ENSG00000090920	ENST00000221347	D	0.98221	-4.8	4.77	4.77	0.60923	Protease inhibitor I8, cysteine-rich trypsin inhibitor-like (2);	0.000000	0.85682	D	0.000000	D	0.99417	0.9794	H	0.98866	4.355	0.47123	D	0.99932	D	0.89917	1.0	D	0.97110	1.0	D	0.98089	1.0408	10	0.87932	D	0	.	15.3345	0.74241	0.0:1.0:0.0:0.0	.	5168	Q9Y6R7	FCGBP_HUMAN	Y	5168	ENSP00000221347:C5168Y	ENSP00000221347:C5168Y	C	-	2	0	FCGBP	45052745	1.000000	0.71417	0.224000	0.23877	0.428000	0.31595	7.590000	0.82653	2.492000	0.84095	0.563000	0.77884	TGC	.		0.612	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
Unknown	0	bcgsc.ca	37	22	16402217	16402217	+	IGR	SNP	T	T	C			TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr22:16402217T>C								LA16c-2F2.8 (25162 upstream) : LA16c-23H5.4 (15051 downstream)																							GAGGGCCTTATGATGGCGATG	0.507																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			GCCTTATGATGGC																													22.37:g.16402217T>C		Somatic	116	1		WXS	Illumina HiSeq	Phase_1	109	11	.		RNA	SNP		37																																																																																				.	0	0.507								
KRAS	3845	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	25380277	25380278	+	Missense_Mutation	DNP	GA	GA	TT	rs121913238|rs397517037		TCGA-ZH-A8Y8-01A-51D-A417-09	TCGA-ZH-A8Y8-10A-01D-A41A-09	GA	GA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d81bfe5-4f95-43dd-9849-9201dae94d08	91c49302-1a35-47b6-b352-db1a5a128928	g.chr12:25380277_25380278GA>TT	ENST00000256078.4	-	3	243_244	c.180_181TC>AA	c.(178-183)ggTCaa>ggAAaa	p.Q61K	KRAS_ENST00000311936.3_Missense_Mutation_p.Q61K|KRAS_ENST00000557334.1_Intron|AC087239.1_ENST00000594112.1_5'Flank	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	61			Q -> H (in lung carcinoma; dbSNP:rs17851045). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:16533793, ECO:0000269|Ref.7}.|Q -> R (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.Q61K(32)|p.Q61E(10)|p.G60G(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			TACTCCTCTTGACCTGCTGTGT	0.411	Q61K(CALU6_LUNG)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.Q61K	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	.		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS_ENST00000256078,caecum,carcinoma,0,10	KRAS_ENST00000256078	0	43	Substitution - Missense(42)|Substitution - coding silent(1)	large_intestine(13)|lung(11)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(3)|urinary_tract(3)|prostate(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)|kidney(1)|pancreas(1)	c.T180A						.																																			SO:0001583	missense	3845	exon3	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	CTCTTGACCTGCT	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.180_181delinsTT	12.37:g.25380277_25380278delinsTT	ENSP00000256078:p.Gln61Lys	Somatic	39	0		WXS	Illumina HiSeq	.	40	8	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	DNP	ENST00000256078.4	37	CCDS8703.1																																																																																			.		0.411	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
