#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVarCov_SOL	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
GRID1	2894	hgsc.bcm.edu	37	10	87407113	87407113	+	Missense_Mutation	SNP	C	C	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr10:87407113C>T	ENST00000327946.7	-	13	2124	c.2039G>A	c.(2038-2040)gGc>gAc	p.G680D	RP11-93H12.4_ENST00000474115.2_RNA|GRID1_ENST00000536331.1_Missense_Mutation_p.G251D|RN7SKP238_ENST00000516483.1_RNA	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	680					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.G680D(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						CCGGACAGTGCCATAAGACAT	0.532										Multiple Myeloma(13;0.14)																											p.G680D		.											GRID1,colon,carcinoma,0,1	GRID1	0	1	Substitution - Missense(1)	large_intestine(1)	c.G2039A						.						258.0	239.0	245.0					10																	87407113		2203	4300	6503	SO:0001583	missense	2894	exon13			ACAGTGCCATAAG	AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.2039G>A	10.37:g.87407113C>T	ENSP00000330148:p.Gly680Asp	Somatic	46	0		WXS	Illumina HiSeq	.	42	3	NM_017551	B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	ENST00000327946.7	37	CCDS31236.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.032911	0.93575	.	.	ENSG00000182771	ENST00000327946;ENST00000536331	T;T	0.37235	1.21;1.21	5.92	5.92	0.95590	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.74152	0.3679	H	0.95950	3.745	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82026	-0.0661	10	0.87932	D	0	.	19.3095	0.94179	0.0:1.0:0.0:0.0	.	680	Q9ULK0	GRID1_HUMAN	D	680;251	ENSP00000330148:G680D;ENSP00000444455:G251D	ENSP00000330148:G680D	G	-	2	0	GRID1	87397093	1.000000	0.71417	0.999000	0.59377	0.895000	0.52256	7.487000	0.81328	2.810000	0.96702	0.650000	0.86243	GGC	.		0.532	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049148.3	XM_043613	
OR2T33	391195	hgsc.bcm.edu	37	1	248436680	248436680	+	Missense_Mutation	SNP	C	C	G			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr1:248436680C>G	ENST00000318021.2	-	1	458	c.437G>C	c.(436-438)tGt>tCt	p.C146S		NM_001004695.1	NP_001004695.1	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T, member 33	146						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C146F(1)		NS(2)|breast(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(41)|ovary(1)|prostate(1)|skin(4)	67	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CAGGAGCCAACACGACATGGT	0.577																																					p.C146S		.											OR2T33,NS,carcinoma,0,1	OR2T33	0	1	Substitution - Missense(1)	lung(1)	c.G437C						.						148.0	140.0	142.0					1																	248436680		2203	4300	6503	SO:0001583	missense	391195	exon1			AGCCAACACGACA		CCDS31109.1	1q44	2012-08-09			ENSG00000177212	ENSG00000177212		"""GPCR / Class A : Olfactory receptors"""	31255	protein-coding gene	gene with protein product							Standard	NM_001004695		Approved		uc010pzi.2	Q8NG76	OTTHUMG00000040458	ENST00000318021.2:c.437G>C	1.37:g.248436680C>G	ENSP00000324687:p.Cys146Ser	Somatic	76	0		WXS	Illumina HiSeq	.	73	4	NM_001004695	B2RNN0	Missense_Mutation	SNP	ENST00000318021.2	37	CCDS31109.1	.	.	.	.	.	.	.	.	.	.	-	0.001	-3.496698	0.00010	.	.	ENSG00000177212	ENST00000318021	T	0.35421	1.31	2.7	1.74	0.24563	GPCR, rhodopsin-like superfamily (1);	0.236656	0.21793	N	0.069040	T	0.11580	0.0282	N	0.01235	-0.94	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34477	-0.9827	10	0.02654	T	1	.	14.0285	0.64601	0.0:0.1611:0.8388:0.0	.	146	Q8NG76	O2T33_HUMAN	S	146	ENSP00000324687:C146S	ENSP00000324687:C146S	C	-	2	0	OR2T33	246503303	0.000000	0.05858	0.004000	0.12327	0.001000	0.01503	-0.176000	0.09811	0.004000	0.14682	-2.089000	0.00373	TGT	.		0.577	OR2T33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097354.1	NM_001004695	
NTF3	4908	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	5604050	5604050	+	Missense_Mutation	SNP	G	G	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr12:5604050G>T	ENST00000331010.6	+	1	753	c.670G>T	c.(670-672)Gtc>Ttc	p.V224F	NTF3_ENST00000423158.3_Missense_Mutation_p.V237F|NTF3_ENST00000535299.1_Intron	NM_002527.4	NP_002518.1	P20783	NTF3_HUMAN	neurotrophin 3	224					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell-cell signaling (GO:0007267)|enteric nervous system development (GO:0048484)|epidermis development (GO:0008544)|glial cell fate determination (GO:0007403)|induction of positive chemotaxis (GO:0050930)|mechanoreceptor differentiation (GO:0042490)|myelination (GO:0042552)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuromuscular synaptic transmission (GO:0007274)|peripheral nervous system development (GO:0007422)|positive chemotaxis (GO:0050918)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of glial cell differentiation (GO:0045687)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of receptor internalization (GO:0002092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of synaptic transmission (GO:0050804)|signal transduction (GO:0007165)|smooth muscle cell differentiation (GO:0051145)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasmic membrane-bounded vesicle (GO:0016023)|extracellular region (GO:0005576)	chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|receptor binding (GO:0005102)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(3)|upper_aerodigestive_tract(1)	22						CCAAACCTACGTCCGAGCACT	0.488																																					p.V237F	GBM(194;1104 2182 8339 9578 18493)	.											.	.	.	0			c.G709T						.						66.0	55.0	59.0					12																	5604050		2203	4300	6503	SO:0001583	missense	4908	exon2			ACCTACGTCCGAG		CCDS8538.1, CCDS44806.1	12p13	2014-01-30			ENSG00000185652	ENSG00000185652		"""Endogenous ligands"""	8023	protein-coding gene	gene with protein product		162660				1889806	Standard	NM_002527		Approved	NGF2	uc001qnk.4	P20783	OTTHUMG00000168649	ENST00000331010.6:c.670G>T	12.37:g.5604050G>T	ENSP00000328738:p.Val224Phe	Somatic	47	0		WXS	Illumina HiSeq	.	63	7	NM_001102654	B7Z1T5|Q6FH50	Missense_Mutation	SNP	ENST00000331010.6	37	CCDS8538.1	.	.	.	.	.	.	.	.	.	.	G	17.48	3.400895	0.62177	.	.	ENSG00000185652	ENST00000423158;ENST00000331010	T;T	0.74526	-0.85;-0.85	5.45	5.45	0.79879	Nerve growth factor-related (5);	0.000000	0.85682	D	0.000000	D	0.87641	0.6228	M	0.83384	2.64	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.88974	0.3403	10	0.72032	D	0.01	-33.0194	18.2818	0.90101	0.0:0.0:1.0:0.0	.	224;237	P20783;B7Z1T5	NTF3_HUMAN;.	F	237;224	ENSP00000397297:V237F;ENSP00000328738:V224F	ENSP00000328738:V224F	V	+	1	0	NTF3	5474311	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.869000	0.99810	2.583000	0.87209	0.650000	0.86243	GTC	.		0.488	NTF3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000400486.1		
TRPC4	7223	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	38357312	38357312	+	Missense_Mutation	SNP	C	C	G			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr13:38357312C>G	ENST00000379705.3	-	2	1016	c.159G>C	c.(157-159)gaG>gaC	p.E53D	TRPC4_ENST00000379679.1_Missense_Mutation_p.E53D|TRPC4_ENST00000338947.5_Missense_Mutation_p.E53D|TRPC4_ENST00000379673.2_Missense_Mutation_p.E53D|TRPC4_ENST00000447043.1_Missense_Mutation_p.E53D|TRPC4_ENST00000426868.2_Missense_Mutation_p.E53D|TRPC4_ENST00000358477.2_Missense_Mutation_p.E53D|TRPC4_ENST00000379681.3_Missense_Mutation_p.E53D|TRPC4_ENST00000355779.2_Missense_Mutation_p.E53D			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	53					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		tttcAGCTTCCTCTAGGGATT	0.388																																					p.E53D		.											.	.	.	0			c.G159C						.						140.0	144.0	143.0					13																	38357312		2203	4300	6503	SO:0001583	missense	7223	exon2			AGCTTCCTCTAGG	U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.159G>C	13.37:g.38357312C>G	ENSP00000369027:p.Glu53Asp	Somatic	55	0		WXS	Illumina HiSeq	.	52	7	NM_001135958	B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Missense_Mutation	SNP	ENST00000379705.3	37	CCDS9365.1	.	.	.	.	.	.	.	.	.	.	C	17.20	3.328444	0.60743	.	.	ENSG00000133107	ENST00000379705;ENST00000379681;ENST00000338947;ENST00000379679;ENST00000426868;ENST00000355779;ENST00000358477;ENST00000379673;ENST00000447043	T;T;T;T;T;T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16;-0.16;-0.16;-0.16;-0.16;-0.16	6.01	4.3	0.51218	Ankyrin repeat-containing domain (3);	0.044070	0.85682	D	0.000000	T	0.65176	0.2666	L	0.31845	0.965	0.42954	D	0.994387	P;P;P;P;P;P	0.52692	0.855;0.837;0.514;0.663;0.855;0.955	P;P;B;B;P;P	0.60886	0.64;0.457;0.199;0.199;0.64;0.88	T	0.66988	-0.5784	10	0.87932	D	0	-27.3296	9.8154	0.40849	0.0:0.7343:0.0:0.2657	.	53;53;53;53;53;53	Q9UBN4-3;Q9UBN4-4;Q9UBN4-5;Q9UBN4-6;Q9UBN4-2;Q9UBN4	.;.;.;.;.;TRPC4_HUMAN	D	53	ENSP00000369027:E53D;ENSP00000369003:E53D;ENSP00000342580:E53D;ENSP00000369001:E53D;ENSP00000410133:E53D;ENSP00000348025:E53D;ENSP00000351264:E53D;ENSP00000368995:E53D;ENSP00000414316:E53D	ENSP00000342580:E53D	E	-	3	2	TRPC4	37255312	0.978000	0.34361	1.000000	0.80357	0.995000	0.86356	0.271000	0.18626	0.896000	0.36366	-0.145000	0.13849	GAG	.		0.388	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044574.2	NM_003306	
MIOS	54468	hgsc.bcm.edu	37	7	7625410	7625410	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr7:7625410G>T	ENST00000340080.4	+	7	2213	c.1792G>T	c.(1792-1794)Gaa>Taa	p.E598*	MIOS_ENST00000405785.1_Nonsense_Mutation_p.E598*	NM_019005.3	NP_061878.3	Q9NXC5	MIO_HUMAN	missing oocyte, meiosis regulator, homolog (Drosophila)	598						lysosomal membrane (GO:0005765)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TCTGACAAGTGAAACAGGATC	0.343																																					p.E598X		.											.	.	.	0			c.G1792T						.						148.0	142.0	144.0					7																	7625410		1861	4095	5956	SO:0001587	stop_gained	54468	exon7			ACAAGTGAAACAG		CCDS43554.1	7p21.3	2011-09-12			ENSG00000164654	ENSG00000164654			21905	protein-coding gene	gene with protein product	"""WD repeat-containing protein mio"""	615359				14973288	Standard	NM_019005		Approved	FLJ20323	uc003srf.3	Q9NXC5	OTTHUMG00000152440	ENST00000340080.4:c.1792G>T	7.37:g.7625410G>T	ENSP00000339881:p.Glu598*	Somatic	60	0		WXS	Illumina HiSeq	.	77	4	NM_019005	B2RTV6|O75216|Q7L551|Q9H092	Nonsense_Mutation	SNP	ENST00000340080.4	37	CCDS43554.1	.	.	.	.	.	.	.	.	.	.	G	43	10.158585	0.99349	.	.	ENSG00000164654	ENST00000340080;ENST00000405785	.	.	.	5.36	4.48	0.54585	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	-18.0613	14.2079	0.65746	0.0722:0.0:0.9278:0.0	.	.	.	.	X	598	.	ENSP00000339881:E598X	E	+	1	0	MIOS	7591935	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.389000	0.97243	1.404000	0.46819	0.591000	0.81541	GAA	.		0.343	MIOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326218.1	NM_019005	
ZNF423	23090	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	49823430	49823430	+	Missense_Mutation	SNP	G	G	A	rs377503772		TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr16:49823430G>A	ENST00000561648.1	-	2	97	c.44C>T	c.(43-45)tCg>tTg	p.S15L	ZNF423_ENST00000562520.1_5'UTR|ZNF423_ENST00000563137.2_5'UTR|ZNF423_ENST00000262383.2_Missense_Mutation_p.S15L	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	15					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				CCAGGCCAGCGAGAAGTCTGA	0.582																																					p.S15L		.											ZNF423_ENST00000262383,colon,carcinoma,0,2	ZNF423_ENST00000262383	0	0			c.C44T						.	G	LEU/SER	0,4396		0,0,2198	45.0	43.0	43.0		44	5.3	1.0	16		43	1,8599		0,1,4299	no	missense	ZNF423	NM_015069.2	145	0,1,6497	AA,AG,GG		0.0116,0.0,0.0077	benign	15/1285	49823430	1,12995	2198	4300	6498	SO:0001583	missense	23090	exon2			GCCAGCGAGAAGT	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.44C>T	16.37:g.49823430G>A	ENSP00000455426:p.Ser15Leu	Somatic	55	0		WXS	Illumina HiSeq	.	59	7	NM_015069	O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	ENST00000561648.1	37	CCDS32445.1	.	.	.	.	.	.	.	.	.	.	G	15.60	2.881918	0.51908	0.0	1.16E-4	ENSG00000102935	ENST00000262383	T	0.08546	3.08	5.29	5.29	0.74685	.	0.348051	0.21608	N	0.071835	T	0.05410	0.0143	N	0.08118	0	0.33937	D	0.642803	B	0.11235	0.004	B	0.04013	0.001	T	0.30475	-0.9977	9	.	.	.	.	17.1203	0.86700	0.0:0.0:1.0:0.0	.	15	Q2M1K9	ZN423_HUMAN	L	15	ENSP00000262383:S15L	.	S	-	2	0	ZNF423	48380931	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.459000	0.60102	2.470000	0.83445	0.462000	0.41574	TCG	.		0.582	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069	
IQSEC1	9922	hgsc.bcm.edu	37	3	12942851	12942851	+	Intron	SNP	C	C	G	rs397988742|rs56387830		TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr3:12942851C>G	ENST00000273221.4	-	13	3064					NM_014869.5	NP_055684.3	Q6DN90	IQEC1_HUMAN	IQ motif and Sec7 domain 1						actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GGGGGGGTGGCCAGGGCTGGG	0.697																																					.		.											.,1	.	88	0			c.2976+1G>C						.						1.0	1.0	1.0					3																	12942851		180	413	593	SO:0001627	intron_variant	9922	exon15			GGGTGGCCAGGGC	BC010267	CCDS33703.1, CCDS74902.1	3p25.2	2011-09-23			ENSG00000144711	ENSG00000144711			29112	protein-coding gene	gene with protein product	"""brefeldin A-resistant ARF-GEF2"""	610166				9872452, 8619474	Standard	NM_001134382		Approved	KIAA0763, GEP100, BRAG2, ARF-GEP100	uc011auw.2	Q6DN90	OTTHUMG00000155398	ENST00000273221.4:c.2847+1421G>C	3.37:g.12942851C>G		Somatic	9	1		WXS	Illumina HiSeq	.	13	5	NM_001134382	O94863|Q96D85	Splice_Site	SNP	ENST00000273221.4	37	CCDS33703.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|-	0.001|0.001	-2.938040|-2.938040	0.00052|0.00052	.|.	.|.	ENSG00000144711|ENSG00000144711	ENST00000435445|ENST00000429247	.|T	.|0.43294	.|0.95	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.30230	.|0.0758	.|.	.|.	.|.	0.09310|0.09310	N|N	0.999997|0.999997	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.27971	.|-1.0058	.|4	.|0.29301	.|T	.|0.29	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|P	-1|993	.|ENSP00000402299:A993P	.|ENSP00000402299:A993P	.|A	-|-	.|1	.|0	IQSEC1|IQSEC1	12917851|12917851	0.031000|0.031000	0.19500|0.19500	0.001000|0.001000	0.08648|0.08648	0.028000|0.028000	0.11728|0.11728	-0.760000|-0.760000	0.04756|0.04756	0.000000|0.000000	0.14550|0.14550	0.000000|0.000000	0.15137|0.15137	.|GCC	.		0.697	IQSEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339865.2	NM_014869	
TCHH	7062	hgsc.bcm.edu	37	1	152085490	152085490	+	Missense_Mutation	SNP	C	C	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr1:152085490C>T	ENST00000368804.1	-	2	202	c.203G>A	c.(202-204)cGt>cAt	p.R68H		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	68	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.|S-100-like.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GAAATCGACACGCCCATTACT	0.443																																					p.R68H		.											TCHH,colon,carcinoma,0,1	TCHH	0	0			c.G203A						.						49.0	49.0	49.0					1																	152085490		1892	4115	6007	SO:0001583	missense	7062	exon3			TCGACACGCCCAT	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.203G>A	1.37:g.152085490C>T	ENSP00000357794:p.Arg68His	Somatic	44	0		WXS	Illumina HiSeq	.	35	2	NM_007113	Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	37	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	c	6.918	0.539101	0.13250	.	.	ENSG00000159450	ENST00000368804	T	0.14144	2.53	4.58	-5.67	0.02444	S100/Calbindin-D9k, conserved site (1);EF-hand-like domain (1);	.	.	.	.	T	0.01254	0.0041	N	0.03294	-0.36	0.09310	N	1	P	0.43412	0.806	B	0.40940	0.344	T	0.32322	-0.9911	9	0.18710	T	0.47	.	5.3817	0.16196	0.4226:0.1864:0.0:0.391	.	68	Q07283	TRHY_HUMAN	H	68	ENSP00000357794:R68H	ENSP00000357794:R68H	R	-	2	0	TCHH	150352114	0.000000	0.05858	0.000000	0.03702	0.496000	0.33645	-0.277000	0.08502	-1.233000	0.02551	-0.476000	0.04901	CGT	.		0.443	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
PRDM15	63977	hgsc.bcm.edu;broad.mit.edu	37	21	43279219	43279219	+	Silent	SNP	T	T	G			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr21:43279219T>G	ENST00000269844.3	-	10	1260	c.1150A>C	c.(1150-1152)Agg>Cgg	p.R384R	PRDM15_ENST00000398548.1_Intron|PRDM15_ENST00000447207.2_Intron|PRDM15_ENST00000538201.1_Intron|PRDM15_ENST00000422911.1_Intron	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15	384					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						CTGAGCCGCCTCACCAGGCCT	0.677																																					p.R384R		.											.	.	.	0			c.A1150C						.						40.0	26.0	31.0					21																	43279219		2203	4297	6500	SO:0001819	synonymous_variant	63977	exon10			GCCGCCTCACCAG	AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781	ENST00000269844.3:c.1150A>C	21.37:g.43279219T>G		Somatic	31	0		WXS	Illumina HiSeq	.	44	4	NM_022115	E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	Silent	SNP	ENST00000269844.3	37	CCDS13676.1																																																																																			.		0.677	PRDM15-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_022115	
BBS7	55212	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	122775917	122775917	+	Missense_Mutation	SNP	C	C	G			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr4:122775917C>G	ENST00000264499.4	-	7	843	c.660G>C	c.(658-660)caG>caC	p.Q220H	BBS7_ENST00000506636.1_Missense_Mutation_p.Q220H	NM_176824.2	NP_789794.1	Q8IWZ6	BBS7_HUMAN	Bardet-Biedl syndrome 7	220					brain development (GO:0007420)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|digestive tract morphogenesis (GO:0048546)|eye development (GO:0001654)|fat cell differentiation (GO:0045444)|heart looping (GO:0001947)|limb development (GO:0060173)|melanosome transport (GO:0032402)|nonmotile primary cilium assembly (GO:0035058)|palate development (GO:0060021)|pigment granule aggregation in cell center (GO:0051877)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein transport (GO:0015031)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|visual perception (GO:0007601)	axoneme (GO:0005930)|BBSome (GO:0034464)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(2)|prostate(1)|skin(2)	30						ATGTAGTAATCTGTATAAGCG	0.358									Bardet-Biedl syndrome																												p.Q220H		.											.	.	.	0			c.G660C						.						126.0	122.0	123.0					4																	122775917		2203	4300	6503	SO:0001583	missense	55212	exon7	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AGTAATCTGTATA	AF521644	CCDS3724.1, CCDS54799.1	4q27	2013-01-08			ENSG00000138686	ENSG00000138686			18758	protein-coding gene	gene with protein product		607590					Standard	NM_176824		Approved	FLJ10715, BBS2L1	uc003ied.3	Q8IWZ6	OTTHUMG00000133076	ENST00000264499.4:c.660G>C	4.37:g.122775917C>G	ENSP00000264499:p.Gln220His	Somatic	63	0		WXS	Illumina HiSeq	.	77	8	NM_018190	Q4W5P8|Q8N581|Q9NVI4	Missense_Mutation	SNP	ENST00000264499.4	37	CCDS3724.1	.	.	.	.	.	.	.	.	.	.	C	11.03	1.518933	0.27211	.	.	ENSG00000138686	ENST00000264499;ENST00000506636	T;T	0.70282	-0.47;-0.47	5.11	3.36	0.38483	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.128317	0.53938	D	0.000045	T	0.49745	0.1575	N	0.19112	0.55	0.40914	D	0.984255	B	0.13145	0.007	B	0.11329	0.006	T	0.43766	-0.9371	10	0.35671	T	0.21	-8.7986	4.9907	0.14213	0.1521:0.6216:0.0:0.2263	.	220	Q8IWZ6	BBS7_HUMAN	H	220	ENSP00000264499:Q220H;ENSP00000423626:Q220H	ENSP00000264499:Q220H	Q	-	3	2	BBS7	122995367	0.999000	0.42202	1.000000	0.80357	0.722000	0.41435	0.747000	0.26290	1.296000	0.44742	0.650000	0.86243	CAG	.		0.358	BBS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256716.1		
RYR2	6262	hgsc.bcm.edu	37	1	237732451	237732451	+	Silent	SNP	C	C	A			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr1:237732451C>A	ENST00000366574.2	+	29	3747	c.3430C>A	c.(3430-3432)Cgg>Agg	p.R1144R	RYR2_ENST00000360064.6_Silent_p.R1142R|RYR2_ENST00000542537.1_Silent_p.R1128R	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1144	4 X approximate repeats.|B30.2/SPRY 2. {ECO:0000255|PROSITE- ProRule:PRU00548}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.R1142W(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ATAGGCCCAGCGGTGGCATCA	0.532																																					p.R1144R		.											RYR2,NS,carcinoma,0,1	RYR2	0	1	Substitution - Missense(1)	pancreas(1)	c.C3430A						.						72.0	74.0	73.0					1																	237732451		2062	4199	6261	SO:0001819	synonymous_variant	6262	exon29			GCCCAGCGGTGGC	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.3430C>A	1.37:g.237732451C>A		Somatic	49	0		WXS	Illumina HiSeq	.	59	3	NM_001035	Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	37	CCDS55691.1																																																																																			.		0.532	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
NCOA6	23054	hgsc.bcm.edu	37	20	33345756	33345756	+	Silent	SNP	T	T	C			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr20:33345756T>C	ENST00000374796.2	-	8	3365	c.795A>G	c.(793-795)caA>caG	p.Q265Q	NCOA6_ENST00000359003.2_Silent_p.Q265Q			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	265	CREBBP-binding region.|Gln-rich.|NCOA1-binding region.|TBP/GTF2A-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.Q265Q(1)		NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						gttgttgttgttgctgctgct	0.537																																					p.Q265Q		.											NCOA6,bladder,carcinoma,0,2	NCOA6	0	1	Substitution - coding silent(1)	central_nervous_system(1)	c.A795G						.						62.0	52.0	55.0					20																	33345756		2203	4300	6503	SO:0001819	synonymous_variant	23054	exon7			TTGTTGTTGCTGC	AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.795A>G	20.37:g.33345756T>C		Somatic	34	1		WXS	Illumina HiSeq	.	37	2	NM_014071	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Silent	SNP	ENST00000374796.2	37	CCDS13241.1																																																																																			.		0.537	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078811.2	NM_014071	
STK36	27148	hgsc.bcm.edu;bcgsc.ca	37	2	219561301	219561301	+	Missense_Mutation	SNP	C	C	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr2:219561301C>T	ENST00000295709.3	+	22	2842	c.2563C>T	c.(2563-2565)Ctt>Ttt	p.L855F	STK36_ENST00000440309.1_Missense_Mutation_p.L855F|STK36_ENST00000392105.3_Intron|STK36_ENST00000392106.2_Intron	NM_015690.4	NP_056505.2			serine/threonine kinase 36											biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(20)|ovary(4)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	52		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)		CCTCCTTATCCTTCTGTTGCA	0.507																																					p.L855F		.											.	.	.	0			c.C2563T						.						170.0	150.0	157.0					2																	219561301		2203	4300	6503	SO:0001583	missense	27148	exon22			CTTATCCTTCTGT	AB033104	CCDS2421.1, CCDS58750.1	2q35	2010-06-25	2010-06-25		ENSG00000163482	ENSG00000163482			17209	protein-coding gene	gene with protein product	"""fused homolog (Drosophila)"""	607652	"""serine/threonine kinase 36 (fused homolog, Drosophila)"""			10806483	Standard	NM_001243313		Approved	KIAA1278, FU	uc002viu.3	Q9NRP7	OTTHUMG00000133079	ENST00000295709.3:c.2563C>T	2.37:g.219561301C>T	ENSP00000295709:p.Leu855Phe	Somatic	62	0		WXS	Illumina HiSeq	.	82	4	NM_015690		Missense_Mutation	SNP	ENST00000295709.3	37	CCDS2421.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.070037	0.76301	.	.	ENSG00000163482	ENST00000295709;ENST00000440309	T;T	0.78595	-1.19;-1.19	5.43	5.43	0.79202	.	0.000000	0.40728	N	0.001030	T	0.79387	0.4437	L	0.29908	0.895	0.80722	D	1	D	0.69078	0.997	D	0.63597	0.916	T	0.80339	-0.1424	10	0.72032	D	0.01	-14.991	11.5516	0.50723	0.0:0.9181:0.0:0.0819	.	855	Q9NRP7	STK36_HUMAN	F	855	ENSP00000295709:L855F;ENSP00000394095:L855F	ENSP00000295709:L855F	L	+	1	0	STK36	219269545	0.969000	0.33509	0.843000	0.33291	0.960000	0.62799	1.275000	0.33144	2.824000	0.97209	0.655000	0.94253	CTT	.		0.507	STK36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256723.2		
TEX14	56155	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	56699023	56699023	+	Missense_Mutation	SNP	C	C	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr17:56699023C>T	ENST00000240361.8	-	5	627	c.542G>A	c.(541-543)gGc>gAc	p.G181D	TEX14_ENST00000349033.5_Missense_Mutation_p.G181D|TEX14_ENST00000389934.3_Missense_Mutation_p.G181D			Q8IWB6	TEX14_HUMAN	testis expressed 14	181					attachment of spindle microtubules to kinetochore (GO:0008608)|intercellular bridge organization (GO:0043063)|male meiosis (GO:0007140)|mitotic sister chromatid separation (GO:0051306)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)	cell (GO:0005623)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|midbody (GO:0030496)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)			breast(6)|endometrium(5)|kidney(3)|large_intestine(22)|liver(1)|lung(24)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	81	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CTGCACGAGGCCCCCACACCA	0.612																																					p.G181D		.											.	.	.	0			c.G542A						.						58.0	52.0	54.0					17																	56699023		2203	4300	6503	SO:0001583	missense	56155	exon5			ACGAGGCCCCCAC	AF285601	CCDS32692.1, CCDS32693.1, CCDS56042.1	17q22	2013-09-20	2007-03-13		ENSG00000121101	ENSG00000121101			11737	protein-coding gene	gene with protein product	"""cancer/testis antigen 113"""	605792	"""testis expressed sequence 14"""			11279525, 12711554	Standard	NM_031272		Approved	CT113	uc010dcz.2	Q8IWB6	OTTHUMG00000179245	ENST00000240361.8:c.542G>A	17.37:g.56699023C>T	ENSP00000240361:p.Gly181Asp	Somatic	30	0		WXS	Illumina HiSeq	.	42	5	NM_198393	A6NH19|Q7RTP3|Q8ND97|Q9BXT9	Missense_Mutation	SNP	ENST00000240361.8	37	CCDS56042.1	.	.	.	.	.	.	.	.	.	.	C	16.33	3.092929	0.56075	.	.	ENSG00000121101	ENST00000240361;ENST00000389934;ENST00000349033	T;T;T	0.79749	-1.3;-1.3;-1.25	5.42	5.42	0.78866	.	0.260319	0.33691	N	0.004658	T	0.79058	0.4382	L	0.29908	0.895	0.27829	N	0.941501	P;P;P	0.45126	0.768;0.851;0.851	B;P;P	0.48982	0.393;0.597;0.597	T	0.76200	-0.3046	10	0.87932	D	0	-10.9605	16.3091	0.82863	0.0:1.0:0.0:0.0	.	181;181;181	Q8IWB6;Q8IWB6-3;Q8IWB6-2	TEX14_HUMAN;.;.	D	181	ENSP00000240361:G181D;ENSP00000374584:G181D;ENSP00000268910:G181D	ENSP00000240361:G181D	G	-	2	0	TEX14	54054022	0.673000	0.27539	0.994000	0.49952	0.132000	0.20833	1.393000	0.34497	2.700000	0.92200	0.563000	0.77884	GGC	.		0.612	TEX14-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445446.1		
TMEM116	89894	hgsc.bcm.edu;broad.mit.edu	37	12	112369579	112369579	+	Missense_Mutation	SNP	G	G	A			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr12:112369579G>A	ENST00000550831.3	-	10	952	c.584C>T	c.(583-585)aCg>aTg	p.T195M	TMEM116_ENST00000552374.2_Missense_Mutation_p.T287M|TMEM116_ENST00000549537.2_Missense_Mutation_p.T101M|TMEM116_ENST00000437003.2_Missense_Mutation_p.T195M|TMEM116_ENST00000354825.3_Missense_Mutation_p.T195M|TMEM116_ENST00000355445.3_Missense_Mutation_p.T252M	NM_138341.2	NP_612350.1	Q8NCL8	TM116_HUMAN	transmembrane protein 116	195						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|skin(1)	8						TTTGTGCTGCGTCCAGCCATA	0.507																																					p.T287M		.											TMEM116,colon,carcinoma,0,1	TMEM116	0	0			c.C860T						.						118.0	106.0	110.0					12																	112369579		2203	4300	6503	SO:0001583	missense	89894	exon11			TGCTGCGTCCAGC	AK074648	CCDS9157.1, CCDS55886.1, CCDS55887.1	12q24.13	2012-03-02			ENSG00000198270	ENSG00000198270			25084	protein-coding gene	gene with protein product						12477932	Standard	NM_001193453		Approved	FLJ90167	uc001ttd.2	Q8NCL8	OTTHUMG00000169606	ENST00000550831.3:c.584C>T	12.37:g.112369579G>A	ENSP00000450377:p.Thr195Met	Somatic	49	0		WXS	Illumina HiSeq	.	57	3	NM_001193531	G3V1W7|G5E985|Q6NSH5|Q8IZ66	Missense_Mutation	SNP	ENST00000550831.3	37	CCDS9157.1	.	.	.	.	.	.	.	.	.	.	g	24.4	4.524555	0.85600	.	.	ENSG00000198270	ENST00000355445;ENST00000354825;ENST00000550831;ENST00000437003;ENST00000549537;ENST00000552374	T;T;T;T;T;T	0.35421	1.31;1.31;1.31;1.31;1.31;1.31	5.65	5.65	0.86999	.	0.067905	0.56097	D	0.000023	T	0.60996	0.2312	M	0.66939	2.045	0.52501	D	0.999957	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.62464	-0.6849	10	0.87932	D	0	-16.4501	18.5035	0.90890	0.0:0.0:1.0:0.0	.	101;252;287;195	G3V1Z3;G5E985;G3V1W7;Q8NCL8	.;.;.;TM116_HUMAN	M	252;195;195;195;101;287	ENSP00000347620:T252M;ENSP00000346883:T195M;ENSP00000450377:T195M;ENSP00000395861:T195M;ENSP00000449163:T101M;ENSP00000447731:T287M	ENSP00000346883:T195M	T	-	2	0	TMEM116	110853962	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	5.849000	0.69465	2.680000	0.91292	0.467000	0.42956	ACG	.		0.507	TMEM116-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405026.3	NM_138341	
MCM3AP	8888	hgsc.bcm.edu;bcgsc.ca	37	21	47690365	47690365	+	Missense_Mutation	SNP	G	G	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr21:47690365G>T	ENST00000397708.1	-	10	2832	c.2578C>A	c.(2578-2580)Cag>Aag	p.Q860K	MCM3AP_ENST00000291688.1_Missense_Mutation_p.Q860K			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	860	SAC3 homology.				DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					GAAGCTGACTGGACCAGTTTG	0.413																																					p.Q860K		.											.	.	.	0			c.C2578A						.						87.0	85.0	85.0					21																	47690365		2203	4300	6503	SO:0001583	missense	8888	exon9			CTGACTGGACCAG	AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.2578C>A	21.37:g.47690365G>T	ENSP00000380820:p.Gln860Lys	Somatic	83	0		WXS	Illumina HiSeq	.	102	4	NM_003906	C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Missense_Mutation	SNP	ENST00000397708.1	37	CCDS13734.1	.	.	.	.	.	.	.	.	.	.	G	17.29	3.351369	0.61183	.	.	ENSG00000160294	ENST00000397708;ENST00000291688	T;T	0.26957	1.7;1.7	5.98	5.98	0.97165	.	0.280500	0.40144	N	0.001172	T	0.14614	0.0353	N	0.02334	-0.595	0.47994	D	0.999567	B	0.20550	0.046	B	0.31869	0.137	T	0.22906	-1.0203	10	0.09590	T	0.72	-18.4723	20.4366	0.99092	0.0:0.0:1.0:0.0	.	860	O60318	MCM3A_HUMAN	K	860	ENSP00000380820:Q860K;ENSP00000291688:Q860K	ENSP00000291688:Q860K	Q	-	1	0	MCM3AP	46514793	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.057000	0.76669	2.837000	0.97791	0.591000	0.81541	CAG	.		0.413	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207254.1	NM_003906	
SPHKAP	80309	hgsc.bcm.edu	37	2	228996763	228996763	+	Missense_Mutation	SNP	G	G	T	rs141195352		TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr2:228996763G>T	ENST00000392056.3	-	2	117	c.71C>A	c.(70-72)cCg>cAg	p.P24Q	SPHKAP_ENST00000344657.5_Missense_Mutation_p.P24Q	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	24						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		GCCCTGCTGCGGTTCCAAAAC	0.478																																					p.P24Q		.											SPHKAP_ENST00000392056,NS,carcinoma,+1,2	SPHKAP_ENST00000392056	+1	0			c.C71A						.						88.0	91.0	90.0					2																	228996763		2203	4300	6503	SO:0001583	missense	80309	exon2			TGCTGCGGTTCCA		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.71C>A	2.37:g.228996763G>T	ENSP00000375909:p.Pro24Gln	Somatic	59	0		WXS	Illumina HiSeq	.	52	3	NM_030623	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	37	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	G	5.138	0.211025	0.09757	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.55413	0.52;0.52	4.55	1.78	0.24846	.	1.862920	0.02479	N	0.088282	T	0.43765	0.1262	N	0.14661	0.345	0.09310	N	1	P;P	0.48407	0.854;0.91	B;P	0.47162	0.339;0.54	T	0.37337	-0.9710	10	0.42905	T	0.14	.	6.8536	0.24028	0.2869:0.0:0.7131:0.0	.	24;24	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	Q	24	ENSP00000375909:P24Q;ENSP00000339886:P24Q	ENSP00000339886:P24Q	P	-	2	0	SPHKAP	228705007	0.001000	0.12720	0.000000	0.03702	0.017000	0.09413	0.823000	0.27366	0.423000	0.26033	0.655000	0.94253	CCG	.		0.478	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623	
DDB2	1643	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	47236765	47236765	+	Missense_Mutation	SNP	T	T	G			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr11:47236765T>G	ENST00000256996.4	+	1	273	c.78T>G	c.(76-78)agT>agG	p.S26R	DDB2_ENST00000378601.3_Missense_Mutation_p.S26R|DDB2_ENST00000378603.3_Missense_Mutation_p.S26R|DDB2_ENST00000378600.3_Missense_Mutation_p.S26R	NM_000107.2	NP_000098.1	Q92466	DDB2_HUMAN	damage-specific DNA binding protein 2, 48kDa	26					DNA repair (GO:0006281)|histone H2A monoubiquitination (GO:0035518)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|protein autoubiquitination (GO:0051865)|protein polyubiquitination (GO:0000209)|pyrimidine dimer repair (GO:0006290)|response to UV (GO:0009411)|UV-damage excision repair (GO:0070914)	Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|nucleoplasm (GO:0005654)|protein complex (GO:0043234)	damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(1)	17						GGAGCAGGAGTCCCCTGGAGC	0.592			"""Mis, N"""			"""skin basal cell, skin squamous cell, melanoma"""		Direct reversal of damage;Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.S26R		.	yes	Rec		Xeroderma pigmentosum (E)	11	11p12	1643	damage-specific DNA binding protein 2		E	.	.	.	0			c.T78G						.						129.0	141.0	137.0					11																	47236765		2201	4298	6499	SO:0001583	missense	1643	exon1	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	CAGGAGTCCCCTG		CCDS7927.1, CCDS73284.1	11p12-p11	2014-09-17	2002-08-29			ENSG00000134574		"""WD repeat domain containing"""	2718	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group E protein"", ""UV-damaged DNA-binding protein 2"", ""DDB p48 subunit"""	600811	"""damage-specific DNA binding protein 2 (48kD)"""			8407967, 8530102	Standard	NM_000107		Approved	DDBB, UV-DDB2, FLJ34321	uc001neb.2	Q92466		ENST00000256996.4:c.78T>G	11.37:g.47236765T>G	ENSP00000256996:p.Ser26Arg	Somatic	34	0		WXS	Illumina HiSeq	.	64	8	NM_000107	B2R875|Q76E54|Q76E55|Q76E56|Q76E57	Missense_Mutation	SNP	ENST00000256996.4	37	CCDS7927.1	.	.	.	.	.	.	.	.	.	.	T	14.59	2.581297	0.46006	.	.	ENSG00000134574	ENST00000256996;ENST00000378603;ENST00000378600;ENST00000378601	T;T;T;T	0.77098	-0.44;-0.59;-1.07;0.94	4.19	1.73	0.24493	.	0.593042	0.18931	N	0.127216	T	0.66336	0.2779	L	0.36672	1.1	0.24575	N	0.993909	P;P;P	0.47677	0.899;0.899;0.838	B;P;B	0.45099	0.295;0.469;0.11	T	0.57106	-0.7868	10	0.40728	T	0.16	-7.2904	4.5908	0.12306	0.0:0.3866:0.0:0.6134	.	26;26;26	Q92466-4;Q92466-2;Q92466	.;.;DDB2_HUMAN	R	26	ENSP00000256996:S26R;ENSP00000367866:S26R;ENSP00000367863:S26R;ENSP00000367864:S26R	ENSP00000256996:S26R	S	+	3	2	DDB2	47193341	0.898000	0.30612	0.788000	0.31933	0.995000	0.86356	0.113000	0.15499	0.407000	0.25591	0.533000	0.62120	AGT	.		0.592	DDB2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_000107	
KIAA1109	84162	hgsc.bcm.edu;bcgsc.ca	37	4	123245634	123245634	+	Missense_Mutation	SNP	G	G	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr4:123245634G>T	ENST00000264501.4	+	64	11220	c.10847G>T	c.(10846-10848)cGa>cTa	p.R3616L	KIAA1109_ENST00000388738.3_Missense_Mutation_p.R3616L|KIAA1109_ENST00000455637.1_Missense_Mutation_p.R3616L			Q2LD37	K1109_HUMAN	KIAA1109	3616					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						AGTTACAGCCGATCAAAAAGC	0.378																																					p.R3616L		.											.	.	.	0			c.G10847T						.						89.0	80.0	83.0					4																	123245634		1828	4091	5919	SO:0001583	missense	84162	exon62			ACAGCCGATCAAA	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.10847G>T	4.37:g.123245634G>T	ENSP00000264501:p.Arg3616Leu	Somatic	90	0		WXS	Illumina HiSeq	.	87	4	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	37	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.4|25.4	4.639064|4.639064	0.87760|0.87760	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000306802|ENST00000264501;ENST00000388738;ENST00000455637;ENST00000438707	.|T;T;T;T	.|0.49139	.|1.92;1.92;1.28;0.79	5.83|5.83	4.98|4.98	0.66077|0.66077	.|.	.|0.187991	.|0.34750	.|N	.|0.003718	T|T	0.40498|0.40498	0.1119|0.1119	L|L	0.59436|0.59436	1.845|1.845	0.46678|0.46678	D|D	0.999155|0.999155	.|B;P	.|0.40515	.|0.275;0.719	.|B;B	.|0.26517	.|0.066;0.07	T|T	0.51810|0.51810	-0.8658|-0.8658	5|10	.|0.72032	.|D	.|0.01	.|.	15.326|15.326	0.74164|0.74164	0.0682:0.0:0.9318:0.0|0.0682:0.0:0.9318:0.0	.|.	.|3616;3616	.|Q2LD37-6;Q2LD37	.|.;K1109_HUMAN	Y|L	6|3616;3616;3616;299	.|ENSP00000264501:R3616L;ENSP00000373390:R3616L;ENSP00000389925:R3616L;ENSP00000410874:R299L	.|ENSP00000264501:R3616L	D|R	+|+	1|2	0|0	KIAA1109|KIAA1109	123465084|123465084	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.826000|0.826000	0.46750|0.46750	9.394000|9.394000	0.97261|0.97261	2.741000|2.741000	0.93983|0.93983	0.655000|0.655000	0.94253|0.94253	GAT|CGA	.		0.378	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
DGKA	1606	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	56335859	56335859	+	Missense_Mutation	SNP	A	A	C			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr12:56335859A>C	ENST00000331886.5	+	16	1782	c.1328A>C	c.(1327-1329)gAg>gCg	p.E443A	DGKA_ENST00000394147.1_Missense_Mutation_p.E443A|DGKA_ENST00000549079.2_3'UTR|DGKA_ENST00000551156.1_Missense_Mutation_p.E443A	NM_001345.4	NP_001336.2	P23743	DGKA_HUMAN	diacylglycerol kinase, alpha 80kDa	443	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)|phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|large_intestine(1)|lung(11)|ovary(4)|pancreas(1)|skin(3)|urinary_tract(1)	25					Vitamin E(DB00163)	TGGATTCTAGAGACCATTGGT	0.537																																					p.E443A		.											.	.	.	0			c.A1328C						.						217.0	193.0	201.0					12																	56335859		2203	4300	6503	SO:0001583	missense	1606	exon16			TTCTAGAGACCAT	AF064767	CCDS8896.1	12q13.3	2013-01-10	2002-08-29			ENSG00000065357	2.7.1.107	"""EF-hand domain containing"""	2849	protein-coding gene	gene with protein product		125855	"""diacylglycerol kinase, alpha (80kD)"""	DAGK, DAGK1		8180475, 7959783	Standard	NM_001345		Approved	DGK-alpha	uc001sim.3	P23743		ENST00000331886.5:c.1328A>C	12.37:g.56335859A>C	ENSP00000328405:p.Glu443Ala	Somatic	47	0		WXS	Illumina HiSeq	.	58	5	NM_201554	O75481|O75482|O75483|O95217|Q3ZE25|Q8IZ56|Q8N5Q2	Missense_Mutation	SNP	ENST00000331886.5	37	CCDS8896.1	.	.	.	.	.	.	.	.	.	.	A	16.72	3.201790	0.58234	.	.	ENSG00000065357	ENST00000331886;ENST00000555218;ENST00000394147;ENST00000551156;ENST00000552903	T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98	5.32	5.32	0.75619	Diacylglycerol kinase, catalytic domain (3);	0.098697	0.64402	D	0.000002	T	0.29652	0.0740	N	0.16790	0.44	0.80722	D	1	B;B	0.11235	0.002;0.004	B;B	0.18871	0.004;0.023	T	0.05869	-1.0859	10	0.36615	T	0.2	.	14.7093	0.69215	1.0:0.0:0.0:0.0	.	362;443	G3V4E1;P23743	.;DGKA_HUMAN	A	443;362;443;443;53	ENSP00000328405:E443A;ENSP00000451743:E362A;ENSP00000377703:E443A;ENSP00000450359:E443A;ENSP00000451518:E53A	ENSP00000328405:E443A	E	+	2	0	DGKA	54622126	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.691000	0.91279	2.371000	0.80710	0.533000	0.62120	GAG	.		0.537	DGKA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407291.1		
OR10AG1	282770	hgsc.bcm.edu	37	11	55735485	55735485	+	Missense_Mutation	SNP	C	C	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr11:55735485C>T	ENST00000312345.2	-	1	505	c.455G>A	c.(454-456)tGc>tAc	p.C152Y		NM_001005491.1	NP_001005491.1	Q8NH19	O10AG_HUMAN	olfactory receptor, family 10, subfamily AG, member 1	152						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C152F(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(24)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	40	Esophageal squamous(21;0.0137)					GAAAATTTGGCATGTTTCCCC	0.403																																					p.C152Y		.											OR10AG1,NS,carcinoma,0,1	OR10AG1	0	1	Substitution - Missense(1)	lung(1)	c.G455A						.						84.0	81.0	82.0					11																	55735485		2201	4296	6497	SO:0001583	missense	282770	exon1			ATTTGGCATGTTT	AB065594	CCDS31514.1	11q11	2012-08-09			ENSG00000174970	ENSG00000174970		"""GPCR / Class A : Olfactory receptors"""	19607	protein-coding gene	gene with protein product							Standard	NM_001005491		Approved		uc010rit.2	Q8NH19	OTTHUMG00000166824	ENST00000312345.2:c.455G>A	11.37:g.55735485C>T	ENSP00000311477:p.Cys152Tyr	Somatic	52	0		WXS	Illumina HiSeq	.	74	3	NM_001005491	B2RNH4|Q6IEU3	Missense_Mutation	SNP	ENST00000312345.2	37	CCDS31514.1	.	.	.	.	.	.	.	.	.	.	C	0.015	-1.564530	0.00903	.	.	ENSG00000174970	ENST00000312345	T	0.35973	1.28	5.47	0.21	0.15231	GPCR, rhodopsin-like superfamily (1);	1.243340	0.05325	N	0.527337	T	0.20659	0.0497	L	0.31476	0.935	0.09310	N	1	B	0.06786	0.001	B	0.11329	0.006	T	0.18085	-1.0348	10	0.02654	T	1	.	3.4742	0.07578	0.1904:0.2584:0.0:0.5511	.	152	Q8NH19	O10AG_HUMAN	Y	152	ENSP00000311477:C152Y	ENSP00000311477:C152Y	C	-	2	0	OR10AG1	55492061	0.000000	0.05858	0.079000	0.20413	0.736000	0.42039	-3.939000	0.00330	0.162000	0.19483	0.477000	0.44152	TGC	.		0.403	OR10AG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391531.1	NM_001005491	
ADAM21	8747	hgsc.bcm.edu	37	14	70924559	70924559	+	Missense_Mutation	SNP	G	G	A			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr14:70924559G>A	ENST00000603540.1	+	2	601	c.343G>A	c.(343-345)Gtg>Atg	p.V115M	ADAM21_ENST00000267499.3_Missense_Mutation_p.V115M|RP11-486O13.4_ENST00000556646.1_lincRNA	NM_003813.3	NP_003804.2	Q9UKJ8	ADA21_HUMAN	ADAM metallopeptidase domain 21	115					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.V115M(1)		central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	31				all cancers(60;0.00326)|BRCA - Breast invasive adenocarcinoma(234;0.00646)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		TCATGGTTACGTGGAGGCAGC	0.473																																					p.V115M		.											ADAM21,NS,NS,0,1	ADAM21	0	1	Substitution - Missense(1)	pancreas(1)	c.G343A						.						95.0	127.0	116.0					14																	70924559		2199	4300	6499	SO:0001583	missense	8747	exon2			GGTTACGTGGAGG	AF029900	CCDS9804.1	14q24.1	2008-09-05	2005-08-18		ENSG00000139985	ENSG00000139985		"""ADAM metallopeptidase domain containing"""	200	protein-coding gene	gene with protein product		603713	"""a disintegrin and metalloproteinase domain 21"""			9469942	Standard	NM_003813		Approved	ADAM31	uc001xmd.3	Q9UKJ8		ENST00000603540.1:c.343G>A	14.37:g.70924559G>A	ENSP00000474385:p.Val115Met	Somatic	30	0		WXS	Illumina HiSeq	.	47	2	NM_003813	O43507|Q2VPC6|Q32MR0	Missense_Mutation	SNP	ENST00000603540.1	37	CCDS9804.1	.	.	.	.	.	.	.	.	.	.	G	8.576	0.881257	0.17467	.	.	ENSG00000139985	ENST00000267499	T	0.17054	2.3	3.76	1.71	0.24356	Peptidase M12B, propeptide (1);	0.000000	0.38548	U	0.001641	T	0.34745	0.0908	M	0.80982	2.52	0.20196	N	0.99992	D	0.71674	0.998	D	0.70487	0.969	T	0.04005	-1.0985	10	0.46703	T	0.11	.	5.2331	0.15432	0.1846:0.0:0.6515:0.164	.	115	Q9UKJ8	ADA21_HUMAN	M	115	ENSP00000267499:V115M	ENSP00000267499:V115M	V	+	1	0	ADAM21	69994312	0.995000	0.38212	0.477000	0.27303	0.241000	0.25554	2.479000	0.45197	0.911000	0.36747	0.557000	0.71058	GTG	.		0.473	ADAM21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413008.3		
RTN4RL2	349667	hgsc.bcm.edu	37	11	57243730	57243730	+	Silent	SNP	C	C	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr11:57243730C>T	ENST00000335099.3	+	3	926	c.609C>T	c.(607-609)ggC>ggT	p.G203G	RP11-624G17.3_ENST00000528885.1_RNA	NM_178570.1	NP_848665.1			reticulon 4 receptor-like 2											NS(1)|endometrium(1)|large_intestine(2)|lung(2)	6						GCGGCCTGGGCAGCCTGGACC	0.682																																					p.G203G		.											.	.	.	0			c.C609T						.						32.0	34.0	33.0					11																	57243730		2166	4222	6388	SO:0001819	synonymous_variant	349667	exon3			CCTGGGCAGCCTG	BK001302	CCDS7957.1	11q12.1	2008-02-05			ENSG00000186907	ENSG00000186907			23053	protein-coding gene	gene with protein product		610462					Standard	NM_178570		Approved	NgR2, NGRH1	uc010rjt.2	Q86UN3	OTTHUMG00000167028	ENST00000335099.3:c.609C>T	11.37:g.57243730C>T		Somatic	20	0		WXS	Illumina HiSeq	.	40	4	NM_178570		Silent	SNP	ENST00000335099.3	37	CCDS7957.1																																																																																			.		0.682	RTN4RL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392537.1	NM_178570	
MICU1	10367	hgsc.bcm.edu	37	10	74283493	74283493	+	Intron	SNP	T	T	C			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr10:74283493T>C	ENST00000361114.5	-	5	634				MICU1_ENST00000398763.4_Intron|MICU1_ENST00000418483.2_Intron|MICU1_ENST00000401998.3_Intron|MICU1_ENST00000398761.4_Intron	NM_001195518.1|NM_006077.3	NP_001182447.1|NP_006068.2	Q9BPX6	MICU1_HUMAN	mitochondrial calcium uptake 1						calcium ion import (GO:0070509)|calcium ion transmembrane import into mitochondrion (GO:0036444)|defense response (GO:0006952)|mitochondrial calcium ion homeostasis (GO:0051560)|mitochondrial calcium ion transport (GO:0006851)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|protein homooligomerization (GO:0051260)	calcium channel complex (GO:0034704)|integral component of mitochondrial membrane (GO:0032592)|intracellular (GO:0005622)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|uniplex complex (GO:1990246)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)										ttttaatgaataaattttaat	0.289																																					.		.											.	.	.	0			.						.																																			SO:0001627	intron_variant	100302155	.			AATGAATAAATTT	Y17711	CCDS55714.1, CCDS55715.1	10q22.1	2013-01-10	2011-06-23	2011-06-23	ENSG00000107745	ENSG00000107745		"""EF-hand domain containing"""	1530	protein-coding gene	gene with protein product		605084	"""calcium binding atopy-related autoantigen 1"""	CBARA1		9806765, 20693986	Standard	NM_006077		Approved	CALC, EFHA3, FLJ12684	uc001jtb.2	Q9BPX6	OTTHUMG00000018437	ENST00000361114.5:c.537+10010A>G	10.37:g.74283493T>C		Somatic	62	0		WXS	Illumina HiSeq	.	70	10	.	A8MV96|B3KN20|B4DJH9|B4DPI1|B5MBY3|D3YTJ3|O75785|Q9H9N6|Q9UFX0	RNA	SNP	ENST00000361114.5	37	CCDS55715.1																																																																																			.		0.289	MICU1-002	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048586.1	NM_006077	
CDH12	1010	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	21842369	21842369	+	Missense_Mutation	SNP	C	C	A			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr5:21842369C>A	ENST00000382254.1	-	8	1801	c.715G>T	c.(715-717)Gcc>Tcc	p.A239S	CDH12_ENST00000521384.1_5'UTR|CDH12_ENST00000504376.2_Missense_Mutation_p.A239S|CDH12_ENST00000522262.1_Missense_Mutation_p.A199S	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	239	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						ATATCCTTGGCTTGGATGAGT	0.403										HNSCC(59;0.17)																											p.A239S		.											.	.	.	0			c.G715T						.						289.0	224.0	246.0					5																	21842369		2203	4300	6503	SO:0001583	missense	1010	exon8			CCTTGGCTTGGAT	L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.715G>T	5.37:g.21842369C>A	ENSP00000371689:p.Ala239Ser	Somatic	75	0		WXS	Illumina HiSeq	.	89	8	NM_004061	B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	ENST00000382254.1	37	CCDS3890.1	.	.	.	.	.	.	.	.	.	.	C	35	5.518665	0.96416	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	T;T;T	0.75477	-0.59;-0.59;-0.94	5.34	5.34	0.76211	Cadherin (5);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.91136	0.7209	H	0.96208	3.785	0.58432	D	0.999999	D;D	0.62365	0.989;0.991	P;D	0.83275	0.831;0.996	D	0.93770	0.7074	10	0.87932	D	0	.	19.0468	0.93022	0.0:1.0:0.0:0.0	.	199;239	B7Z2U6;P55289	.;CAD12_HUMAN	S	239;239;199	ENSP00000423577:A239S;ENSP00000371689:A239S;ENSP00000428786:A199S	ENSP00000371689:A239S	A	-	1	0	CDH12	21878126	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.666000	0.83877	2.480000	0.83734	0.655000	0.94253	GCC	.		0.403	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207139.1	NM_004061	
SPPL2C	162540	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	43923030	43923030	+	Missense_Mutation	SNP	C	C	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr17:43923030C>T	ENST00000329196.5	+	1	775	c.758C>T	c.(757-759)cCg>cTg	p.P253L	MAPT-AS1_ENST00000581125.1_RNA|MAPT-AS1_ENST00000579599.1_RNA|MAPT-AS1_ENST00000579244.1_RNA	NM_175882.2	NP_787078.2	Q8IUH8	SPP2C_HUMAN	signal peptide peptidase like 2C	253						endoplasmic reticulum membrane (GO:0005789)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)	aspartic-type endopeptidase activity (GO:0004190)|protein homodimerization activity (GO:0042803)										GACTTCACGCCGGCCATGACA	0.567																																					p.P253L		.											.	.	.	0			c.C758T						.						83.0	79.0	80.0					17																	43923030		2203	4300	6503	SO:0001583	missense	162540	exon1			TCACGCCGGCCAT		CCDS32673.1	17q21.31	2014-02-12			ENSG00000185294	ENSG00000185294			28902	protein-coding gene	gene with protein product	"""intramembrane protease 5"""	608284				12139484	Standard	NM_175882		Approved	IMP5	uc010wka.2	Q8IUH8		ENST00000329196.5:c.758C>T	17.37:g.43923030C>T	ENSP00000332488:p.Pro253Leu	Somatic	30	0		WXS	Illumina HiSeq	.	41	9	NM_175882	Q8TC67|Q8WVZ6	Missense_Mutation	SNP	ENST00000329196.5	37	CCDS32673.1	.	.	.	.	.	.	.	.	.	.	C	7.938	0.742242	0.15642	.	.	ENSG00000185294	ENST00000329196	T	0.16196	2.36	5.24	3.27	0.37495	.	0.000000	0.42420	D	0.000711	T	0.21427	0.0516	M	0.65677	2.01	0.80722	D	1	P	0.36378	0.55	B	0.40940	0.344	T	0.02093	-1.1215	10	0.87932	D	0	-29.6919	7.6613	0.28404	0.0:0.812:0.0:0.188	.	253	Q8IUH8	IMP5_HUMAN	L	253	ENSP00000332488:P253L	ENSP00000332488:P253L	P	+	2	0	AC217771.1	41278810	0.003000	0.15002	0.267000	0.24556	0.053000	0.15095	1.021000	0.30040	0.800000	0.34041	-0.136000	0.14681	CCG	.		0.567	SPPL2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441156.1	NM_175882	
UBAP2	55833	hgsc.bcm.edu	37	9	33989030	33989030	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr9:33989030G>T	ENST00000379238.1	-	5	500	c.383C>A	c.(382-384)tCg>tAg	p.S128*	UBAP2_ENST00000418786.2_Nonsense_Mutation_p.S128*|UBAP2_ENST00000539807.1_Intron|UBAP2_ENST00000360802.1_Nonsense_Mutation_p.S128*|UBAP2_ENST00000449054.1_Nonsense_Mutation_p.S128*|UBAP2_ENST00000379239.4_5'UTR					ubiquitin associated protein 2											endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(13)|ovary(3)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(29;0.00575)	GBM - Glioblastoma multiforme(74;0.168)		TCCACGACTCGATTCTTTCTC	0.398																																					p.S128X		.											UBAP2,NS,malignant_melanoma,0,1	UBAP2	0	0			c.C383A						.						257.0	233.0	241.0					9																	33989030		2203	4300	6503	SO:0001587	stop_gained	55833	exon5			CGACTCGATTCTT	AB040924	CCDS6547.1, CCDS75828.1	9p11.2	2008-02-05			ENSG00000137073	ENSG00000137073			14185	protein-coding gene	gene with protein product						8871400	Standard	NM_018449		Approved	KIAA1491, bA176F3.5, FLJ22435	uc003ztq.1	Q5T6F2	OTTHUMG00000000427	ENST00000379238.1:c.383C>A	9.37:g.33989030G>T	ENSP00000368540:p.Ser128*	Somatic	48	0		WXS	Illumina HiSeq	.	49	3	NM_018449		Nonsense_Mutation	SNP	ENST00000379238.1	37	CCDS6547.1	.	.	.	.	.	.	.	.	.	.	G	19.45	3.829045	0.71258	.	.	ENSG00000137073	ENST00000379238;ENST00000449054;ENST00000360802;ENST00000431417;ENST00000379260;ENST00000418786;ENST00000412543;ENST00000421278	.	.	.	5.27	2.35	0.29111	.	0.969053	0.08595	N	0.922417	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	2.3184	7.4582	0.27278	0.5915:0.0:0.4085:0.0	.	.	.	.	X	128;128;128;90;68;128;128;4	.	ENSP00000354039:S128X	S	-	2	0	UBAP2	33979030	0.019000	0.18553	0.013000	0.15412	0.034000	0.12701	1.877000	0.39598	0.177000	0.19895	0.650000	0.86243	TCG	.		0.398	UBAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001071.1	NM_018449	
LURAP1	541468	hgsc.bcm.edu	37	1	46685389	46685389	+	Missense_Mutation	SNP	G	G	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr1:46685389G>T	ENST00000371980.3	+	2	310	c.217G>T	c.(217-219)Gat>Tat	p.D73Y	POMGNT1_ENST00000371992.1_5'UTR|POMGNT1_ENST00000396420.3_5'UTR	NM_001013615.2	NP_001013633.1	Q96LR2	LURA1_HUMAN	leucine rich adaptor protein 1	73					actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)											GCGAGCCATCGATGTGAAGAT	0.587																																					p.D73Y		.											C1orf190,NS,carcinoma,0,1	C1orf190	0	0			c.G217T						.						80.0	74.0	76.0					1																	46685389		2203	4300	6503	SO:0001583	missense	541468	exon2			GCCATCGATGTGA	AK057892	CCDS30703.1	1p34.1	2012-02-01	2012-02-01	2012-02-01	ENSG00000171357	ENSG00000171357			32327	protein-coding gene	gene with protein product	"""leucine repeat adaptor protein 35a"""		"""chromosome 1 open reading frame 190"""	C1orf190		21048106	Standard	NM_001013615		Approved	FLJ25163, LRAP35a	uc010oma.2	Q96LR2	OTTHUMG00000007605	ENST00000371980.3:c.217G>T	1.37:g.46685389G>T	ENSP00000361048:p.Asp73Tyr	Somatic	25	0		WXS	Illumina HiSeq	.	46	2	NM_001013615		Missense_Mutation	SNP	ENST00000371980.3	37	CCDS30703.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.968182	0.92855	.	.	ENSG00000171357	ENST00000371980	.	.	.	5.82	5.82	0.92795	.	0.091985	0.64402	D	0.000001	T	0.78285	0.4259	L	0.60455	1.87	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.78687	-0.2107	9	0.87932	D	0	-12.2729	20.0956	0.97842	0.0:0.0:1.0:0.0	.	73	Q96LR2	LP35A_HUMAN	Y	73	.	ENSP00000361048:D73Y	D	+	1	0	C1orf190	46457976	1.000000	0.71417	0.993000	0.49108	0.991000	0.79684	9.720000	0.98763	2.746000	0.94184	0.650000	0.86243	GAT	.		0.587	LURAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020154.1	NM_001013615	
BRAF	673	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	140453136	140453136	+	Missense_Mutation	SNP	A	A	T	rs121913377|rs113488022|rs121913227|rs397516897		TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr7:140453136A>T	ENST00000288602.6	-	15	1859	c.1799T>A	c.(1798-1800)gTg>gAg	p.V600E		NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase	600	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		V -> D (in a melanoma cell line; requires 2 nucleotide substitutions). {ECO:0000269|PubMed:12068308}.|V -> E (in CRC; also found in sarcoma, metastatic melanoma, ovarian serous carcinoma, pilocytic astrocytoma; somatic mutation; most common mutation; constitutive and elevated kinase activity; efficiently induces cell transformation; suppression of mutation in melanoma causes growth arrest and promotes apoptosis; loss of regulation by PMRT5). {ECO:0000269|PubMed:12068308, ECO:0000269|PubMed:12198537, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17344846, ECO:0000269|PubMed:23263490, ECO:0000269|PubMed:24455489}.		activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.V600E(15453)|p.V600K(252)|p.V600R(44)|p.V600D(16)|p.V600A(12)|p.V600_K601>E(12)|p.V600G(11)|p.T599_R603>I(2)|p.V600Q(2)|p.V600_S605>EK(1)|p.V600_S605>DV(1)|p.V600_S605>D(1)|p.T599_V600insDFGLAT(1)	SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	TCGAGATTTCACTGTAGCTAG	0.368	V600D(K029AX_SKIN)|V600D(WM115_SKIN)|V600D(WM2664_SKIN)|V600E(8505C_THYROID)|V600E(A101D_SKIN)|V600E(A2058_SKIN)|V600E(A375_SKIN)|V600E(A673_BONE)|V600E(AM38_CENTRAL_NERVOUS_SYSTEM)|V600E(BCPAP_THYROID)|V600E(BHT101_THYROID)|V600E(BT474_BREAST)|V600E(C32_SKIN)|V600E(CL34_LARGE_INTESTINE)|V600E(COLO205_LARGE_INTESTINE)|V600E(COLO679_SKIN)|V600E(COLO741_SKIN)|V600E(COLO783_SKIN)|V600E(COLO800_SKIN)|V600E(COLO818_SKIN)|V600E(COLO829_SKIN)|V600E(COLO849_SKIN)|V600E(DBTRG05MG_CENTRAL_NERVOUS_SYSTEM)|V600E(DU4475_BREAST)|V600E(ES2_OVARY)|V600E(G361_SKIN)|V600E(GCT_SOFT_TISSUE)|V600E(HS294T_SKIN)|V600E(HS695T_SKIN)|V600E(HS939T_SKIN)|V600E(IGR1_SKIN)|V600E(IGR37_SKIN)|V600E(IGR39_SKIN)|V600E(K029AX_SKIN)|V600E(KG1C_CENTRAL_NERVOUS_SYSTEM)|V600E(LOXIMVI_SKIN)|V600E(MALME3M_SKIN)|V600E(MELHO_SKIN)|V600E(OUMS23_LARGE_INTESTINE)|V600E(RKO_LARGE_INTESTINE)|V600E(RPMI7951_SKIN)|V600E(RVH421_SKIN)|V600E(SH4_SKIN)|V600E(SIGM5_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|V600E(SKHEP1_LIVER)|V600E(SKMEL24_SKIN)|V600E(SKMEL28_SKIN)|V600E(SKMEL5_SKIN)|V600E(SW1417_LARGE_INTESTINE)|V600E(UACC257_SKIN)|V600E(UACC62_SKIN)|V600E(WM793_SKIN)|V600E(WM88_SKIN)|V600E(WM983B_SKIN)	61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												p.V600E	Colon(40;35 892 2973 5743 27438)	.		Dom	yes		7	7q34	673	v-raf murine sarcoma viral oncogene homolog B1	yes	E	BRAF,NS,adenoma,0,19815	BRAF	0	15808	Substitution - Missense(15790)|Complex - deletion inframe(17)|Insertion - In frame(1)	thyroid(7476)|skin(3822)|large_intestine(3288)|NS(360)|haematopoietic_and_lymphoid_tissue(336)|ovary(211)|lung(58)|eye(57)|central_nervous_system(53)|soft_tissue(30)|biliary_tract(18)|liver(17)|prostate(13)|breast(10)|upper_aerodigestive_tract(9)|endometrium(8)|pancreas(8)|testis(7)|small_intestine(7)|genital_tract(4)|stomach(4)|bone(3)|autonomic_ganglia(2)|oesophagus(2)|urinary_tract(2)|adrenal_gland(2)|pituitary(1)	c.T1799A						.						112.0	104.0	107.0					7																	140453136		2203	4300	6503	SO:0001583	missense	673	exon15	Familial Cancer Database	CFC, CFCS	GATTTCACTGTAG	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.1799T>A	7.37:g.140453136A>T	ENSP00000288602:p.Val600Glu	Somatic	90	0		WXS	Illumina HiSeq	.	102	17	NM_004333	A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	Missense_Mutation	SNP	ENST00000288602.6	37	CCDS5863.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.0|24.0	4.486113|4.486113	0.84854|0.84854	.|.	.|.	ENSG00000157764|ENSG00000157764	ENST00000288602|ENST00000496384	D|.	0.81739|.	-1.53|.	5.65|5.65	5.65|5.65	0.86999|0.86999	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.61565|.	0.2357|.	L|L	0.42245|0.42245	1.32|1.32	0.80722|0.80722	D|D	1|1	D|.	0.55385|.	0.971|.	D|.	0.66351|.	0.943|.	T|.	0.58160|.	-0.7685|.	10|.	0.87932|.	D|.	0|.	.|.	15.9326|15.9326	0.79675|0.79675	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	600|.	P15056|.	BRAF_HUMAN|.	E|R	600|208	ENSP00000288602:V600E|.	ENSP00000288602:V600E|.	V|X	-|-	2|1	0|0	BRAF|BRAF	140099605|140099605	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.197000|9.197000	0.94985|0.94985	2.169000|2.169000	0.68431|0.68431	0.529000|0.529000	0.55759|0.55759	GTG|TGA	.		0.368	BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348886.1	NM_004333	
FRG1	2483	hgsc.bcm.edu	37	4	190884267	190884267	+	Missense_Mutation	SNP	G	G	A	rs373037319		TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr4:190884267G>A	ENST00000226798.4	+	9	982	c.760G>A	c.(760-762)Gac>Aac	p.D254N		NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	254					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		ATTGAAAGCCGACAGATACTG	0.299																																					p.D254N		.											FRG1,middle_lobe,carcinoma,0,1	FRG1	0	0			c.G760A						.						99.0	111.0	107.0					4																	190884267		2203	4300	6503	SO:0001583	missense	2483	exon9			AAAGCCGACAGAT	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.760G>A	4.37:g.190884267G>A	ENSP00000226798:p.Asp254Asn	Somatic	49	2		WXS	Illumina HiSeq	.	67	6	NM_004477	A8K775	Missense_Mutation	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	21.9	4.222509	0.79464	.	.	ENSG00000109536	ENST00000226798	T	0.65916	-0.18	4.0	4.0	0.46444	.	0.000000	0.85682	D	0.000000	T	0.80994	0.4731	M	0.89715	3.055	0.80722	D	1	D	0.76494	0.999	D	0.66716	0.946	D	0.85581	0.1240	10	0.72032	D	0.01	-19.8783	14.0213	0.64558	0.0:0.0:1.0:0.0	.	254	Q14331	FRG1_HUMAN	N	254	ENSP00000226798:D254N	ENSP00000226798:D254N	D	+	1	0	FRG1	191121261	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	9.201000	0.95017	1.976000	0.57569	0.479000	0.44913	GAC	.		0.299	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
RTTN	25914	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	67742716	67742716	+	Missense_Mutation	SNP	G	G	A			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr18:67742716G>A	ENST00000255674.6	-	33	4722	c.4436C>T	c.(4435-4437)gCt>gTt	p.A1479V	RTTN_ENST00000437017.1_Missense_Mutation_p.A1479V|RTTN_ENST00000454359.1_3'UTR	NM_173630.3	NP_775901.3	Q86VV8	RTTN_HUMAN	rotatin	1479					determination of left/right symmetry (GO:0007368)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(35)|ovary(4)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Esophageal squamous(42;0.129)				ATATAAAAGAGCCTGAAGGGC	0.413																																					p.A1479V		.											.	.	.	0			c.C4436T						.						73.0	71.0	72.0					18																	67742716		1861	4084	5945	SO:0001583	missense	25914	exon33			AAAAGAGCCTGAA	AL117635	CCDS42443.1	18q22.1	2008-08-01				ENSG00000176225			18654	protein-coding gene	gene with protein product		610436				11900971	Standard	NM_173630		Approved	DKFZP434G145	uc002lkp.2	Q86VV8		ENST00000255674.6:c.4436C>T	18.37:g.67742716G>A	ENSP00000255674:p.Ala1479Val	Somatic	40	0		WXS	Illumina HiSeq	.	47	7	NM_173630	Q68CS9|Q6ZRL8|Q6ZTK3|Q86TG4|Q8N8N8|Q8TBQ4|Q96IN9|Q9UFJ4	Missense_Mutation	SNP	ENST00000255674.6	37	CCDS42443.1	.	.	.	.	.	.	.	.	.	.	G	19.55	3.849064	0.71603	.	.	ENSG00000176225	ENST00000255674;ENST00000437017	T;T	0.74842	-0.1;-0.88	5.52	4.65	0.58169	.	0.171085	0.51477	D	0.000093	T	0.79353	0.4431	L	0.54323	1.7	0.80722	D	1	D	0.71674	0.998	P	0.61874	0.895	T	0.75654	-0.3243	10	0.27785	T	0.31	.	12.0689	0.53605	0.0791:0.0:0.9209:0.0	.	1479	Q86VV8	RTTN_HUMAN	V	1479	ENSP00000255674:A1479V;ENSP00000399520:A1479V	ENSP00000255674:A1479V	A	-	2	0	RTTN	65893696	1.000000	0.71417	0.970000	0.41538	0.716000	0.41182	4.945000	0.63568	2.585000	0.87301	0.555000	0.69702	GCT	.		0.413	RTTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442988.1	NM_173630	
EPB41L5	57669	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	120861693	120861693	+	Intron	SNP	C	C	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr2:120861693C>T	ENST00000263713.5	+	16	1551				EPB41L5_ENST00000452780.1_Intron|EPB41L5_ENST00000443902.2_Intron|EPB41L5_ENST00000331393.4_Silent_p.A465A|EPB41L5_ENST00000443124.1_Silent_p.A465A	NM_020909.3	NP_065960.2	Q9HCM4	E41L5_HUMAN	erythrocyte membrane protein band 4.1 like 5						actomyosin structure organization (GO:0031032)|apical constriction (GO:0003383)|axial mesoderm morphogenesis (GO:0048319)|cellular response to transforming growth factor beta stimulus (GO:0071560)|ectoderm development (GO:0007398)|embryonic foregut morphogenesis (GO:0048617)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|in utero embryonic development (GO:0001701)|left/right axis specification (GO:0070986)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of protein binding (GO:0032091)|neural plate morphogenesis (GO:0001839)|paraxial mesoderm development (GO:0048339)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein binding (GO:0032092)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of establishment of protein localization (GO:0070201)|somite rostral/caudal axis specification (GO:0032525)|substrate-dependent cell migration, cell attachment to substrate (GO:0006931)|unidimensional cell growth (GO:0009826)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(5)|lung(12)|ovary(1)	26						ACACAAGGGCCTTGCCCCCAC	0.532																																					p.A465A		.											.	.	.	0			c.C1395T						.																																			SO:0001627	intron_variant	57669	exon17			AAGGGCCTTGCCC	AK023019	CCDS2130.1, CCDS54392.1, CCDS54393.1	2q14.2	2009-07-28			ENSG00000115109	ENSG00000115109			19819	protein-coding gene	gene with protein product		611730					Standard	NM_001184937		Approved	KIAA1548, FLJ12957, BE37, YMO1	uc002tmg.3	Q9HCM4	OTTHUMG00000131433	ENST00000263713.5:c.1337+3303C>T	2.37:g.120861693C>T		Somatic	52	0		WXS	Illumina HiSeq	.	49	8	NM_001184939	Q7Z5S1|Q8IZ12|Q9H975	Silent	SNP	ENST00000263713.5	37	CCDS2130.1																																																																																			.		0.532	EPB41L5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254230.2	NM_020909	
PKLR	5313	hgsc.bcm.edu;bcgsc.ca	37	1	155271160	155271160	+	Silent	SNP	G	G	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr1:155271160G>T	ENST00000342741.4	-	1	65	c.27C>A	c.(25-27)tcC>tcA	p.S9S	PKLR_ENST00000392414.3_5'Flank	NM_000298.5	NP_000289.1	P30613	KPYR_HUMAN	pyruvate kinase, liver and RBC	9					ATP biosynthetic process (GO:0006754)|carbohydrate metabolic process (GO:0005975)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|positive regulation of cellular metabolic process (GO:0031325)|pyruvate biosynthetic process (GO:0042866)|response to ATP (GO:0033198)|response to cAMP (GO:0051591)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to nutrient (GO:0007584)|response to other organism (GO:0051707)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|potassium ion binding (GO:0030955)|pyruvate kinase activity (GO:0004743)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_lung(78;6.99e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;3.18e-10)|all cancers(21;7.9e-10)|BRCA - Breast invasive adenocarcinoma(34;0.00116)|LUSC - Lung squamous cell carcinoma(543;0.127)		Pyruvic acid(DB00119)	GAAGCTGCAGGGATGATATGT	0.527																																					p.S9S		.											.	.	.	0			c.C27A						.						134.0	121.0	126.0					1																	155271160		2203	4300	6503	SO:0001819	synonymous_variant	5313	exon1			CTGCAGGGATGAT	BC025737, M15465	CCDS1109.1, CCDS44240.1	1q22	2012-10-02			ENSG00000143627	ENSG00000143627	2.7.1.40		9020	protein-coding gene	gene with protein product		609712				3566732	Standard	NM_000298		Approved		uc001fkb.4	P30613	OTTHUMG00000035875	ENST00000342741.4:c.27C>A	1.37:g.155271160G>T		Somatic	29	0		WXS	Illumina HiSeq	.	47	4	NM_000298	O75758|P11973	Silent	SNP	ENST00000342741.4	37	CCDS1109.1																																																																																			.		0.527	PKLR-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000087407.2	NM_000298	
RANBP2	5903	hgsc.bcm.edu	37	2	109379749	109379749	+	Silent	SNP	G	G	A	rs542711340	byFrequency	TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr2:109379749G>A	ENST00000283195.6	+	20	2880	c.2754G>A	c.(2752-2754)ccG>ccA	p.P918P		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	918					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.P918P(2)	RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						ATGCCTATCCGCAACAGATGC	0.453													g|||	3	0.000599042	0.0	0.0	5008	,	,		19150	0.0		0.0	False		,,,				2504	0.0031				p.P918P		.											RANBP2_ENST00000283195,rectum,carcinoma,0,2	RANBP2_ENST00000283195	0	2	Substitution - coding silent(2)	large_intestine(2)	c.G2754A						.						98.0	91.0	93.0					2																	109379749		2203	4300	6503	SO:0001819	synonymous_variant	5903	exon20			CTATCCGCAACAG	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.2754G>A	2.37:g.109379749G>A		Somatic	13	0		WXS	Illumina HiSeq	.	15	2	NM_006267	Q13074|Q15280|Q53TE2|Q59FH7	Silent	SNP	ENST00000283195.6	37	CCDS2079.1																																																																																			.		0.453	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
PIWIL3	440822	hgsc.bcm.edu	37	22	25161763	25161763	+	Intron	SNP	G	G	A			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr22:25161763G>A	ENST00000332271.5	-	2	395				PIWIL3_ENST00000532537.2_Intron|PIWIL3_ENST00000527701.1_Intron|PIWIL3_ENST00000533313.1_Intron	NM_001008496.3|NM_001255975.1	NP_001008496.2|NP_001242904.1	Q7Z3Z3	PIWL3_HUMAN	piwi-like RNA-mediated gene silencing 3						cell differentiation (GO:0030154)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	RNA binding (GO:0003723)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(15)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						AAAAAAAAAAGGAAAAATAAT	0.254																																					.		.											.	.	.	0			.						.																																			SO:0001627	intron_variant	7152	.			AAAAAAGGAAAAA	AB079368	CCDS33623.1	22q11.23	2013-02-15	2013-02-15		ENSG00000184571	ENSG00000184571		"""Argonaute/PIWI family"""	18443	protein-coding gene	gene with protein product		610314	"""piwi-like 3 (Drosophila)"""			12906857	Standard	NM_001008496		Approved	HIWI3	uc003abd.2	Q7Z3Z3	OTTHUMG00000150788	ENST00000332271.5:c.22-3275C>T	22.37:g.25161763G>A		Somatic	28	0		WXS	Illumina HiSeq	.	59	5	.		RNA	SNP	ENST00000332271.5	37	CCDS33623.1																																																																																			.		0.254	PIWIL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320084.2	NM_001008496	
SCN8A	6334	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	52200419	52200419	+	Missense_Mutation	SNP	C	C	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr12:52200419C>T	ENST00000354534.6	+	27	5327	c.5149C>T	c.(5149-5151)Cgc>Tgc	p.R1717C	SCN8A_ENST00000545061.1_Missense_Mutation_p.R1676C	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	1717					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	CATCCTAAACCGCCCCCCTGA	0.507																																					p.R1717C		.											.	.	.	0			c.C5149T						.						61.0	66.0	65.0					12																	52200419		2201	4298	6499	SO:0001583	missense	6334	exon27			CTAAACCGCCCCC	AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.5149C>T	12.37:g.52200419C>T	ENSP00000346534:p.Arg1717Cys	Somatic	49	0		WXS	Illumina HiSeq	.	48	8	NM_014191	B9VWG8|O95788|Q9NYX2|Q9UPB2	Missense_Mutation	SNP	ENST00000354534.6	37	CCDS44891.1	.	.	.	.	.	.	.	.	.	.	C	14.98	2.696039	0.48202	.	.	ENSG00000196876	ENST00000354534;ENST00000545061	D;D	0.96168	-3.93;-3.9	5.32	5.32	0.75619	Ion transport (1);	0.100333	0.64402	D	0.000001	D	0.94295	0.8167	L	0.39898	1.24	0.58432	D	0.999999	D	0.59357	0.985	P	0.49140	0.601	D	0.94574	0.7773	10	0.87932	D	0	.	15.905	0.79419	0.0:0.8649:0.1351:0.0	.	1717	Q9UQD0	SCN8A_HUMAN	C	1717;1676	ENSP00000346534:R1717C;ENSP00000440360:R1676C	ENSP00000346534:R1717C	R	+	1	0	SCN8A	50486686	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.328000	0.33758	2.941000	0.99782	0.655000	0.94253	CGC	.		0.507	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404372.3	NM_014191	
TLE3	7090	hgsc.bcm.edu	37	15	70371803	70371803	+	Intron	SNP	A	A	G			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr15:70371803A>G	ENST00000558939.1	-	5	1612				TLE3_ENST00000559929.1_Intron|TLE3_ENST00000559048.1_Intron|TLE3_ENST00000442299.2_Intron|TLE3_ENST00000440567.3_Intron|TLE3_ENST00000558379.1_Intron|TLE3_ENST00000557907.1_Intron|TLE3_ENST00000559191.1_Intron|TLE3_ENST00000317509.8_Intron|TLE3_ENST00000557997.1_Intron|TLE3_ENST00000558201.1_Intron|TLE3_ENST00000560589.1_Intron|TLE3_ENST00000451782.2_Intron|TLE3_ENST00000560939.1_Intron|TLE3_ENST00000539550.1_Intron|MIR629_ENST00000385230.1_RNA	NM_001282979.1|NM_001282980.1|NM_001282981.1	NP_001269908.1|NP_001269909.1|NP_001269910.1	Q04726	TLE3_HUMAN	transducin-like enhancer of split 3						Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						CCCCTGGGAAAGGGACATGAA	0.577																																					.		.											.	.	.	0			.						.						17.0	20.0	19.0					15																	70371803		1563	3580	5143	SO:0001627	intron_variant	693214	.			TGGGAAAGGGACA	M99438	CCDS45293.1, CCDS45294.1, CCDS58375.1, CCDS61689.1, CCDS61691.1, CCDS61692.1, CCDS73747.1	15q22	2014-03-07	2014-03-07			ENSG00000140332		"""WD repeat domain containing"""	11839	protein-coding gene	gene with protein product		600190	"""transducin-like enhancer of split 3, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005254623		Approved	ESG, ESG3, KIAA1547, HsT18976, GRG3	uc002asm.2	Q04726		ENST00000558939.1:c.235-3306T>C	15.37:g.70371803A>G		Somatic	17	0		WXS	Illumina HiSeq	.	22	4	.	B4DPT0|E9PD64|F8W964|Q6PI57|Q8IVV6|Q8WVR2|Q9HCM5	RNA	SNP	ENST00000558939.1	37	CCDS45293.1																																																																																			.		0.577	TLE3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000416913.1	NM_005078	
GRIK2	2898	hgsc.bcm.edu;broad.mit.edu	37	6	102074369	102074369	+	Missense_Mutation	SNP	G	G	A			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr6:102074369G>A	ENST00000421544.1	+	3	888	c.398G>A	c.(397-399)cGc>cAc	p.R133H	GRIK2_ENST00000369137.3_Missense_Mutation_p.R133H|GRIK2_ENST00000318991.6_Missense_Mutation_p.R133H|GRIK2_ENST00000413795.1_Missense_Mutation_p.R133H|GRIK2_ENST00000358361.3_Missense_Mutation_p.R133H|GRIK2_ENST00000369134.4_Missense_Mutation_p.R84H|GRIK2_ENST00000369138.1_Missense_Mutation_p.R133H	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	133					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	ATACAGACCCGCTGGAAGCAC	0.527																																					p.R133H		.											.	.	.	0			c.G398A						.						121.0	119.0	120.0					6																	102074369		2203	4300	6503	SO:0001583	missense	2898	exon3			AGACCCGCTGGAA		CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.398G>A	6.37:g.102074369G>A	ENSP00000397026:p.Arg133His	Somatic	16	0		WXS	Illumina HiSeq	.	44	4	NM_021956	A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Missense_Mutation	SNP	ENST00000421544.1	37	CCDS5048.1	.	.	.	.	.	.	.	.	.	.	G	16.01	3.001121	0.54254	.	.	ENSG00000164418	ENST00000421544;ENST00000413795;ENST00000369138;ENST00000358361;ENST00000369137;ENST00000318991;ENST00000403289;ENST00000369134;ENST00000540076	D;D;D;D;D;D;D	0.82619	-1.63;-1.63;-1.63;-1.63;-1.63;-1.63;-1.63	5.79	5.79	0.91817	Extracellular ligand-binding receptor (1);	0.173217	0.48767	D	0.000176	T	0.76941	0.4058	L	0.61387	1.9	0.46011	D	0.998815	B;B;B	0.16603	0.018;0.009;0.018	B;B;B	0.11329	0.005;0.006;0.003	T	0.71876	-0.4460	10	0.42905	T	0.14	.	20.024	0.97514	0.0:0.0:1.0:0.0	.	133;133;133	Q13002-5;Q13002;Q13002-2	.;GRIK2_HUMAN;.	H	133;133;133;133;133;133;133;84;95	ENSP00000397026:R133H;ENSP00000405596:R133H;ENSP00000358134:R133H;ENSP00000351128:R133H;ENSP00000358133:R133H;ENSP00000313276:R133H;ENSP00000358130:R84H	ENSP00000313276:R133H	R	+	2	0	GRIK2	102181062	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.082000	0.71318	2.718000	0.92993	0.655000	0.94253	CGC	.		0.527	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043718.1		
SLC19A3	80704	hgsc.bcm.edu	37	2	228564115	228564115	+	Missense_Mutation	SNP	T	T	C			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr2:228564115T>C	ENST00000258403.3	-	3	387	c.316A>G	c.(316-318)Atg>Gtg	p.M106V	SLC19A3_ENST00000409287.1_Intron|SLC19A3_ENST00000541617.1_Missense_Mutation_p.M102V	NM_025243.3	NP_079519.1	Q9BZV2	S19A3_HUMAN	solute carrier family 19 (thiamine transporter), member 3	106					small molecule metabolic process (GO:0044281)|thiamine transmembrane transport (GO:0071934)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	thiamine uptake transmembrane transporter activity (GO:0015403)	p.M106V(1)		breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|skin(3)	30		Renal(207;0.0112)|all_lung(227;0.0335)|Lung NSC(271;0.142)|all_hematologic(139;0.21)|Esophageal squamous(248;0.236)		Epithelial(121;1.58e-10)|all cancers(144;8.55e-08)|Lung(261;0.00948)|LUSC - Lung squamous cell carcinoma(224;0.0125)	L-Cysteine(DB00151)	ACAACCTGCATGGTCTTCACT	0.527																																					p.M106V		.											SLC19A3,NS,carcinoma,0,1	SLC19A3	0	1	Substitution - Missense(1)	lung(1)	c.A316G						.						122.0	121.0	122.0					2																	228564115		2203	4300	6503	SO:0001583	missense	80704	exon3			CCTGCATGGTCTT	AF271633	CCDS2468.1	2q37	2013-07-18	2013-07-18		ENSG00000135917	ENSG00000135917		"""Solute carriers"""	16266	protein-coding gene	gene with protein product	"""thiamine transporter 2"""	606152	"""solute carrier family 19, member 3"""			11136550, 15871139	Standard	XM_005246871		Approved	THTR2	uc002vpi.3	Q9BZV2	OTTHUMG00000133185	ENST00000258403.3:c.316A>G	2.37:g.228564115T>C	ENSP00000258403:p.Met106Val	Somatic	45	0		WXS	Illumina HiSeq	.	60	2	NM_025243		Missense_Mutation	SNP	ENST00000258403.3	37	CCDS2468.1	.	.	.	.	.	.	.	.	.	.	T	26.7	4.758319	0.89843	.	.	ENSG00000135917	ENST00000258403;ENST00000541617;ENST00000456524	T;T;T	0.80480	-1.38;-1.38;0.37	5.91	5.91	0.95273	Major facilitator superfamily domain, general substrate transporter (1);	0.068694	0.85682	D	0.000000	D	0.89546	0.6746	M	0.92555	3.32	0.80722	D	1	P;P	0.46395	0.743;0.877	P;P	0.51742	0.547;0.678	D	0.90947	0.4802	10	0.49607	T	0.09	-50.9321	16.3351	0.83056	0.0:0.0:0.0:1.0	.	102;106	F5H2M8;Q9BZV2	.;S19A3_HUMAN	V	106;102;106	ENSP00000258403:M106V;ENSP00000445519:M102V;ENSP00000399001:M106V	ENSP00000258403:M106V	M	-	1	0	SLC19A3	228272359	1.000000	0.71417	0.975000	0.42487	0.948000	0.59901	7.882000	0.87258	2.262000	0.75019	0.528000	0.53228	ATG	.		0.527	SLC19A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256894.1		
ABCA7	10347	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	1065137	1065137	+	Silent	SNP	G	G	A	rs367736927	byFrequency	TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr19:1065137G>A	ENST00000263094.6	+	46	6483	c.6252G>A	c.(6250-6252)gaG>gaA	p.E2084E	HMHA1_ENST00000586866.1_5'Flank|HMHA1_ENST00000590214.1_5'Flank|ABCA7_ENST00000433129.1_Silent_p.E2084E|HMHA1_ENST00000536472.1_5'Flank|HMHA1_ENST00000313093.2_5'Flank|HMHA1_ENST00000539243.2_5'Flank|ABCA7_ENST00000435683.2_Silent_p.E1946E	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	2084					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACGGCGTGGAGGACTTTTCCG	0.736											OREG0025112	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	2	0.000399361	0.0015	0.0	5008	,	,		12986	0.0		0.0	False		,,,				2504	0.0				p.E2084E		.											.	.	.	0			c.G6252A						.	G		2,4362		0,2,2180	17.0	19.0	18.0		6252	0.2	1.0	19		18	0,8570		0,0,4285	no	coding-synonymous	ABCA7	NM_019112.3		0,2,6465	AA,AG,GG		0.0,0.0458,0.0155		2084/2147	1065137	2,12932	2182	4285	6467	SO:0001819	synonymous_variant	10347	exon46			CGTGGAGGACTTT	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.6252G>A	19.37:g.1065137G>A		Somatic	28	0	593	WXS	Illumina HiSeq	.	42	7	NM_019112	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Silent	SNP	ENST00000263094.6	37	CCDS12055.1																																																																																			.		0.736	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
ZFAT	57623	hgsc.bcm.edu	37	8	135614580	135614580	+	Missense_Mutation	SNP	G	G	A			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr8:135614580G>A	ENST00000377838.3	-	6	1556	c.1382C>T	c.(1381-1383)gCc>gTc	p.A461V	ZFAT_ENST00000429442.2_Missense_Mutation_p.A449V|ZFAT_ENST00000520727.1_Missense_Mutation_p.A449V|ZFAT_ENST00000520356.1_Missense_Mutation_p.A449V|ZFAT_ENST00000520214.1_Missense_Mutation_p.A449V|ZFAT-AS1_ENST00000505776.1_RNA|ZFAT_ENST00000523399.1_Missense_Mutation_p.A399V	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	Q9P243	ZFAT_HUMAN	zinc finger and AT hook domain containing	461					hematopoietic progenitor cell differentiation (GO:0002244)|spongiotrophoblast layer development (GO:0060712)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.A449V(1)|p.A461V(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(9)|large_intestine(8)|lung(16)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			GCGGCAGACGGCACAGACGTA	0.602																																					p.A461V		.											ZFAT_ENST00000377838,NS,carcinoma,0,2	ZFAT_ENST00000377838	0	2	Substitution - Missense(2)	lung(2)	c.C1382T						.						45.0	47.0	46.0					8																	135614580		2105	4225	6330	SO:0001583	missense	57623	exon6			CAGACGGCACAGA	BC025423	CCDS43768.1, CCDS47924.1, CCDS43768.2, CCDS55275.1, CCDS55276.1	8q24.23	2008-06-05	2008-01-25	2008-01-25	ENSG00000066827	ENSG00000066827		"""Zinc fingers, C2H2-type"""	19899	protein-coding gene	gene with protein product		610931	"""zinc finger protein 406"""	ZNF406, ZFAT1		10819331, 18329245	Standard	NM_020863		Approved	KIAA1485	uc003yup.3	Q9P243	OTTHUMG00000164321	ENST00000377838.3:c.1382C>T	8.37:g.135614580G>A	ENSP00000367069:p.Ala461Val	Somatic	26	0		WXS	Illumina HiSeq	.	40	2	NM_020863	B7ZL15|E9PER3|Q3MIM5|Q6PJ01|Q75PJ6|Q75PJ7|Q75PJ9|Q86X64	Missense_Mutation	SNP	ENST00000377838.3	37	CCDS47924.1	.	.	.	.	.	.	.	.	.	.	G	18.85	3.711386	0.68730	.	.	ENSG00000066827	ENST00000520356;ENST00000520727;ENST00000429442;ENST00000377838;ENST00000520214;ENST00000523399;ENST00000398946	T;T;T;T;T;T	0.07908	3.15;3.15;3.15;3.15;3.15;3.15	5.9	5.9	0.94986	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	0.354191	0.30584	N	0.009311	T	0.15435	0.0372	N	0.20881	0.62	0.32414	N	0.550279	D;P;P;P	0.53462	0.96;0.951;0.787;0.801	P;P;B;B	0.58660	0.761;0.843;0.298;0.346	T	0.02184	-1.1199	10	0.30854	T	0.27	-13.188	19.2604	0.93966	0.0:0.0:1.0:0.0	.	399;449;449;461	E9PER3;E9PBN4;Q9P243-3;Q9P243	.;.;.;ZFAT_HUMAN	V	449;449;449;461;449;399;449	ENSP00000427879:A449V;ENSP00000427831:A449V;ENSP00000394501:A449V;ENSP00000367069:A461V;ENSP00000428483:A449V;ENSP00000429091:A399V	ENSP00000367069:A461V	A	-	2	0	ZFAT	135683762	0.945000	0.32115	0.477000	0.27303	0.802000	0.45316	4.314000	0.59166	2.793000	0.96121	0.563000	0.77884	GCC	.		0.602	ZFAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378272.1	NM_001029939	
PCDHGA4	56111	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	140735956	140735956	+	Missense_Mutation	SNP	A	A	G			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr5:140735956A>G	ENST00000571252.1	+	1	1189	c.1189A>G	c.(1189-1191)Acc>Gcc	p.T397A	PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018917.2	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4	397	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			acttgaaaagaCCTATGGAAA	0.423																																					p.T397A		.											.	.	.	0			c.A1189G						.						34.0	33.0	33.0					5																	140735956		1895	4100	5995	SO:0001583	missense	56111	exon1			GAAAAGACCTATG	AF152511	CCDS58979.1, CCDS58979.2, CCDS75331.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8702	other	protocadherin		606291				10380929	Standard	NM_018917		Approved	PCDH-GAMMA-A4		Q9Y5G9		ENST00000571252.1:c.1189A>G	5.37:g.140735956A>G	ENSP00000458570:p.Thr397Ala	Somatic	38	0		WXS	Illumina HiSeq	.	43	9	NM_018917	Q9Y5D3	Missense_Mutation	SNP	ENST00000571252.1	37	CCDS58979.1																																																																																			.		0.423	PCDHGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437959.1	NM_018917	
ZNF736	728927	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	63809199	63809199	+	Missense_Mutation	SNP	A	A	C			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr7:63809199A>C	ENST00000423484.2	+	4	1080	c.958A>C	c.(958-960)Aaa>Caa	p.K320Q	ZNF736_ENST00000355095.4_Missense_Mutation_p.K320Q			B4DX44	ZN736_HUMAN	zinc finger protein 736	320					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|stomach(1)|urinary_tract(1)	9						TGAATGTGGAAAAGCTTTTAA	0.398																																					p.K320Q		.											.	.	.	0			c.A958C						.						64.0	64.0	64.0					7																	63809199		692	1591	2283	SO:0001583	missense	728927	exon5			TGTGGAAAAGCTT		CCDS55114.1	7q11.21	2013-01-08			ENSG00000234444	ENSG00000234444		"""Zinc fingers, C2H2-type"", ""-"""	32467	protein-coding gene	gene with protein product							Standard	XM_006716104		Approved		uc011kdo.2	B4DX44	OTTHUMG00000156537	ENST00000423484.2:c.958A>C	7.37:g.63809199A>C	ENSP00000400852:p.Lys320Gln	Somatic	53	0		WXS	Illumina HiSeq	.	76	11	NM_001170905		Missense_Mutation	SNP	ENST00000423484.2	37	CCDS55114.1	.	.	.	.	.	.	.	.	.	.	a	12.25	1.882326	0.33255	.	.	ENSG00000234444	ENST00000355095;ENST00000423484	T;T	0.27256	1.68;1.68	1.16	1.16	0.20824	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.30198	0.0757	M	0.75615	2.305	0.22737	N	0.998796	P	0.47677	0.899	P	0.44897	0.463	T	0.16988	-1.0384	9	0.66056	D	0.02	.	6.0767	0.19919	1.0:0.0:0.0:0.0	.	320	B4DX44	ZN736_HUMAN	Q	320	ENSP00000347210:K320Q;ENSP00000400852:K320Q	ENSP00000347210:K320Q	K	+	1	0	ZNF736	63446634	0.986000	0.35501	0.022000	0.16811	0.008000	0.06430	2.526000	0.45607	0.471000	0.27319	0.260000	0.18958	AAA	.		0.398	ZNF736-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000344559.2	NM_001170905	
ALMS1	7840	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	73682297	73682297	+	Missense_Mutation	SNP	A	A	C			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr2:73682297A>C	ENST00000264448.6	+	9	7657	c.7546A>C	c.(7546-7548)Atg>Ctg	p.M2516L	ALMS1_ENST00000377715.1_Missense_Mutation_p.M2516L|ALMS1-IT1_ENST00000441587.2_RNA|ALMS1_ENST00000409009.1_Missense_Mutation_p.M2474L	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2516					endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						AGCCTGGAATATGAAGTTCAA	0.343																																					p.M2516L		.											.	.	.	0			c.A7546C						.						153.0	142.0	146.0					2																	73682297		1870	4101	5971	SO:0001583	missense	7840	exon9			TGGAATATGAAGT	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.7546A>C	2.37:g.73682297A>C	ENSP00000264448:p.Met2516Leu	Somatic	56	0		WXS	Illumina HiSeq	.	71	9	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	ENST00000264448.6	37	CCDS42697.1	.	.	.	.	.	.	.	.	.	.	C	0.867	-0.733406	0.03111	.	.	ENSG00000116127	ENST00000409009;ENST00000264448;ENST00000377715	T;T;T	0.11385	3.66;3.66;2.78	4.98	1.09	0.20402	.	0.405345	0.18225	N	0.147765	T	0.02342	0.0072	N	0.01168	-0.975	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.43988	-0.9357	10	0.02654	T	1	.	4.593	0.12317	0.4435:0.3916:0.0:0.1649	.	2516;2474;2516	Q8TCU4-3;B8ZZJ3;Q8TCU4	.;.;ALMS1_HUMAN	L	2474;2516;2516	ENSP00000386627:M2474L;ENSP00000264448:M2516L;ENSP00000366944:M2516L	ENSP00000264448:M2516L	M	+	1	0	ALMS1	73535805	0.993000	0.37304	0.996000	0.52242	0.914000	0.54420	-0.069000	0.11542	-0.101000	0.12219	-1.738000	0.00688	ATG	.		0.343	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
LY75	4065	hgsc.bcm.edu	37	2	160731975	160731975	+	Missense_Mutation	SNP	C	C	A	rs371478963		TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr2:160731975C>A	ENST00000263636.4	-	12	1981	c.1954G>T	c.(1954-1956)Gca>Tca	p.A652S	LY75-CD302_ENST00000505052.1_Missense_Mutation_p.A652S|LY75_ENST00000554112.1_Missense_Mutation_p.A652S|LY75_ENST00000553424.1_Missense_Mutation_p.A652S|LY75-CD302_ENST00000504764.1_Missense_Mutation_p.A652S	NM_002349.3	NP_002340.2	O60449	LY75_HUMAN	lymphocyte antigen 75	652	C-type lectin 4. {ECO:0000255|PROSITE- ProRule:PRU00040}.				endocytosis (GO:0006897)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(22)|prostate(7)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	59				COAD - Colon adenocarcinoma(177;0.132)		GAAAGACTTGCGGGGAAACTC	0.433																																					p.A652S		.											LY75,NS,carcinoma,0,1	LY75	0	0			c.G1954T						.						87.0	95.0	92.0					2																	160731975		2202	4300	6502	SO:0001583	missense	4065	exon12			GACTTGCGGGGAA	AF011333	CCDS2211.1	2q24	2011-08-30			ENSG00000054219	ENSG00000054219		"""CD molecules"", ""C-type lectin domain containing"""	6729	protein-coding gene	gene with protein product		604524				9553150	Standard	NM_002349		Approved	DEC-205, CLEC13B, CD205		O60449	OTTHUMG00000132025	ENST00000263636.4:c.1954G>T	2.37:g.160731975C>A	ENSP00000263636:p.Ala652Ser	Somatic	47	0		WXS	Illumina HiSeq	.	45	2	NM_002349	O75913|Q53R46|Q53TF5|Q7Z575|Q7Z577	Missense_Mutation	SNP	ENST00000263636.4	37	CCDS2211.1	.	.	.	.	.	.	.	.	.	.	C	0.009	-1.800902	0.00611	.	.	ENSG00000054219;ENSG00000054219;ENSG00000054219;ENSG00000248672;ENSG00000248672	ENST00000554112;ENST00000553424;ENST00000263636;ENST00000504764;ENST00000505052	T;T;T;T;T	0.08634	3.1;3.1;3.07;3.1;3.1	4.77	-3.78	0.04333	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (2);	0.930646	0.08722	N	0.903332	T	0.01092	0.0036	N	0.00047	-2.43	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.48080	-0.9066	10	0.02654	T	1	-0.5496	7.1888	0.25814	0.4226:0.1191:0.0:0.4583	.	270;652;652;652	Q59H44;O60449-3;O60449;O60449-2	.;.;LY75_HUMAN;.	S	652	ENSP00000451511:A652S;ENSP00000451446:A652S;ENSP00000263636:A652S;ENSP00000423463:A652S;ENSP00000421035:A652S	ENSP00000423463:A652S	A	-	1	0	LY75;LY75-CD302	160440221	0.126000	0.22350	0.054000	0.19295	0.360000	0.29518	0.343000	0.19944	-0.345000	0.08325	-2.190000	0.00312	GCA	.		0.433	LY75-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255035.1		
CORIN	10699	hgsc.bcm.edu	37	4	47625641	47625641	+	Silent	SNP	G	G	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr4:47625641G>T	ENST00000273857.4	-	19	2486	c.2487C>A	c.(2485-2487)ggC>ggA	p.G829G	CORIN_ENST00000515827.1_5'UTR|CORIN_ENST00000502252.1_Silent_p.G762G|CORIN_ENST00000505909.1_Silent_p.G792G|CORIN_ENST00000508498.1_Silent_p.G690G	NM_006587.2	NP_006578.2	Q9Y5Q5	CORIN_HUMAN	corin, serine peptidase	829	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				female pregnancy (GO:0007565)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of blood pressure (GO:0008217)|regulation of renal sodium excretion (GO:0035813)|regulation of systemic arterial blood pressure by atrial natriuretic peptide (GO:0003050)	cell surface (GO:0009986)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)	p.G829G(1)		NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(18)|lung(39)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	79						TGAGGACACAGCCACAGATAT	0.522																																					p.G829G		.											CORIN,medulla,primitive_neuroectodermal_tumour-medulloblastoma,0,1	CORIN	0	1	Substitution - coding silent(1)	central_nervous_system(1)	c.C2487A						.						108.0	103.0	105.0					4																	47625641		2203	4300	6503	SO:0001819	synonymous_variant	10699	exon19			GACACAGCCACAG	AF133845	CCDS3477.1, CCDS63958.1, CCDS75122.1	4p13-p12	2011-08-31	2005-08-17		ENSG00000145244	ENSG00000145244		"""Serine peptidases / Transmembrane"""	19012	protein-coding gene	gene with protein product		605236	"""corin, serine protease"""			10329693	Standard	NM_006587		Approved	PRSC, CRN, ATC2, Lrp4, TMPRSS10	uc003gxm.3	Q9Y5Q5	OTTHUMG00000099441	ENST00000273857.4:c.2487C>A	4.37:g.47625641G>T		Somatic	34	0		WXS	Illumina HiSeq	.	65	3	NM_006587	B0ZBE3|Q2TBD2|Q4W5E5|Q4W5G6|Q9UHY2	Silent	SNP	ENST00000273857.4	37	CCDS3477.1																																																																																			.		0.522	CORIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216906.2		
RHOBTB1	9886	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	62648582	62648582	+	Missense_Mutation	SNP	G	G	C			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr10:62648582G>C	ENST00000337910.5	-	6	1181	c.844C>G	c.(844-846)Cga>Gga	p.R282G	RHOBTB1_ENST00000357917.4_Missense_Mutation_p.R282G	NM_001242359.1|NM_014836.4	NP_001229288.1|NP_055651.1	O94844	RHBT1_HUMAN	Rho-related BTB domain containing 1	282	BTB 1. {ECO:0000255|PROSITE- ProRule:PRU00037}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)			endometrium(4)|large_intestine(6)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23	Prostate(12;0.0112)					AGGTAAATTCGATGTGCAAAG	0.433																																					p.R282G		.											.	.	.	0			c.C844G						.						101.0	103.0	102.0					10																	62648582		2203	4300	6503	SO:0001583	missense	9886	exon6			AAATTCGATGTGC	AB018283	CCDS7261.1	10q22.1	2013-01-08			ENSG00000072422	ENSG00000072422		"""BTB/POZ domain containing"""	18738	protein-coding gene	gene with protein product		607351				11222756	Standard	NM_014836		Approved	KIAA0740	uc001jlh.3	O94844	OTTHUMG00000018292	ENST00000337910.5:c.844C>G	10.37:g.62648582G>C	ENSP00000338671:p.Arg282Gly	Somatic	32	0		WXS	Illumina HiSeq	.	58	6	NM_014836		Missense_Mutation	SNP	ENST00000337910.5	37	CCDS7261.1	.	.	.	.	.	.	.	.	.	.	G	18.50	3.637268	0.67130	.	.	ENSG00000072422	ENST00000357917;ENST00000337910	T;T	0.30714	1.52;1.52	5.77	4.8	0.61643	BTB/POZ-like (2);BTB/POZ fold (2);	0.090716	0.45606	D	0.000357	T	0.38026	0.1025	M	0.69523	2.12	0.58432	D	0.99999	P	0.44309	0.832	P	0.44772	0.46	T	0.32375	-0.9909	10	0.87932	D	0	.	11.4211	0.49982	0.0:0.0:0.6084:0.3916	.	282	O94844	RHBT1_HUMAN	G	282	ENSP00000350595:R282G;ENSP00000338671:R282G	ENSP00000338671:R282G	R	-	1	2	RHOBTB1	62318588	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.535000	0.73838	2.718000	0.92993	0.460000	0.39030	CGA	.		0.433	RHOBTB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048220.1		
UGGT1	56886	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	128861520	128861520	+	Missense_Mutation	SNP	A	A	C			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr2:128861520A>C	ENST00000259253.6	+	3	256	c.209A>C	c.(208-210)gAa>gCa	p.E70A	UGGT1_ENST00000375990.3_Missense_Mutation_p.E46A	NM_020120.3	NP_064505.1	Q9NYU2	UGGG1_HUMAN	UDP-glucose glycoprotein glucosyltransferase 1	70					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)|unfolded protein binding (GO:0051082)			NS(1)|breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(14)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						TTTTTAGCAGAAGACAGTCAA	0.284																																					p.E70A		.											.	.	.	0			c.A209C						.						71.0	81.0	78.0					2																	128861520		2200	4299	6499	SO:0001583	missense	56886	exon3			TAGCAGAAGACAG	AF227905	CCDS2154.1	2q14.3	2009-07-23	2009-07-23	2009-07-23	ENSG00000136731	ENSG00000136731			15663	protein-coding gene	gene with protein product		605897	"""UDP-glucose ceramide glucosyltransferase-like 1"""	UGCGL1		10694380	Standard	NM_020120		Approved	HUGT1	uc002tps.3	Q9NYU2	OTTHUMG00000131570	ENST00000259253.6:c.209A>C	2.37:g.128861520A>C	ENSP00000259253:p.Glu70Ala	Somatic	138	0		WXS	Illumina HiSeq	.	229	29	NM_020120	Q53QP2|Q53SL3|Q8IW30|Q9H8I4	Missense_Mutation	SNP	ENST00000259253.6	37	CCDS2154.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.180291	0.78677	.	.	ENSG00000136731	ENST00000375990;ENST00000259253	T;T	0.08984	3.03;3.03	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.21468	0.0517	M	0.79693	2.465	0.80722	D	1	D	0.58970	0.984	P	0.53360	0.724	T	0.02238	-1.1190	10	0.30854	T	0.27	.	13.0038	0.58692	1.0:0.0:0.0:0.0	.	70	Q9NYU2	UGGG1_HUMAN	A	46;70	ENSP00000365158:E46A;ENSP00000259253:E70A	ENSP00000259253:E70A	E	+	2	0	UGGT1	128577990	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.632000	0.83247	2.062000	0.61559	0.477000	0.44152	GAA	.		0.284	UGGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254435.2	NM_020120	
CIT	11113	hgsc.bcm.edu;ucsc.edu	37	12	120139737	120139737	+	Missense_Mutation	SNP	G	G	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr12:120139737G>T	ENST00000261833.7	-	41	5257	c.5205C>A	c.(5203-5205)agC>agA	p.S1735R	CIT_ENST00000392521.2_Missense_Mutation_p.S1777R|CIT_ENST00000537607.1_5'UTR	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	1735	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		AGTGGATACAGCTGCAGGGCT	0.498																																					p.S1777R		.											.	.	.	0			c.C5331A						.						147.0	140.0	142.0					12																	120139737		2203	4300	6503	SO:0001583	missense	11113	exon42			GATACAGCTGCAG	AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.5205C>A	12.37:g.120139737G>T	ENSP00000261833:p.Ser1735Arg	Somatic	33	0		WXS	Illumina HiSeq	.	41	4	NM_001206999	Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Missense_Mutation	SNP	ENST00000261833.7	37	CCDS9192.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.3|25.3	4.624654|4.624654	0.87560|0.87560	.|.	.|.	ENSG00000122966|ENSG00000122966	ENST00000392520|ENST00000392521;ENST00000261833	.|T;T	.|0.05199	.|3.48;3.48	5.68|5.68	4.78|4.78	0.61160|0.61160	.|Citron-like (3);	.|0.047784	.|0.85682	.|D	.|0.000000	T|T	0.19087|0.19087	0.0458|0.0458	L|L	0.56769|0.56769	1.78|1.78	0.58432|0.58432	D|D	0.999998|0.999998	.|D;D;D	.|0.89917	.|1.0;0.997;0.999	.|D;D;D	.|0.91635	.|0.999;0.995;0.977	T|T	0.00033|0.00033	-1.2271|-1.2271	5|10	.|0.87932	.|D	.|0	.|.	10.294|10.294	0.43613|0.43613	0.1462:0.0:0.8538:0.0|0.1462:0.0:0.8538:0.0	.|.	.|1777;1735;1253	.|Q2M5E1;O14578;O14578-3	.|.;CTRO_HUMAN;.	D|R	1348|1777;1735	.|ENSP00000376306:S1777R;ENSP00000261833:S1735R	.|ENSP00000261833:S1735R	A|S	-|-	2|3	0|2	CIT|CIT	118624120|118624120	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.827000|5.827000	0.69300|0.69300	2.671000|2.671000	0.90904|0.90904	0.650000|0.650000	0.86243|0.86243	GCT|AGC	.		0.498	CIT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259410.4	NM_007174	
MTUS1	57509	hgsc.bcm.edu	37	8	17513428	17513428	+	Missense_Mutation	SNP	G	G	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr8:17513428G>T	ENST00000262102.6	-	9	3276	c.3052C>A	c.(3052-3054)Ctt>Att	p.L1018I	MTUS1_ENST00000544260.1_Missense_Mutation_p.L163I|MTUS1_ENST00000519263.1_Missense_Mutation_p.L964I|MTUS1_ENST00000400046.1_Missense_Mutation_p.L90I|MTUS1_ENST00000297488.6_Missense_Mutation_p.L184I|MTUS1_ENST00000518713.1_5'UTR|MTUS1_ENST00000381861.3_Missense_Mutation_p.L265I|MTUS1_ENST00000381869.3_Missense_Mutation_p.L964I	NM_001001924.2	NP_001001924.1	Q9ULD2	MTUS1_HUMAN	microtubule associated tumor suppressor 1	1018					cellular response to peptide hormone stimulus (GO:0071375)|regulation of macrophage chemotaxis (GO:0010758)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(14)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	36				Colorectal(111;0.0778)		GTGTCCCGAAGCTTTTCATAC	0.458																																					p.L1018I		.											.	.	.	0			c.C3052A						.						196.0	180.0	185.0					8																	17513428		1869	4116	5985	SO:0001583	missense	57509	exon9			CCCGAAGCTTTTC	AL096842	CCDS43716.1, CCDS43717.1, CCDS43718.1, CCDS43719.1, CCDS55204.1	8p22	2013-01-17	2009-10-20		ENSG00000129422	ENSG00000129422			29789	protein-coding gene	gene with protein product	"""AT2 receptor-interacting protein"", ""AT2R binding protein"", ""mitochondrial tumor suppressor gene 1"""	609589	"""mitochondrial tumor suppressor 1"""			10574462, 12692079	Standard	NM_001001931		Approved	MTSG1, KIAA1288, DKFZp586D1519, FLJ14295, ATIP1, MP44, ATBP, ICIS	uc003wxv.3	Q9ULD2	OTTHUMG00000163756	ENST00000262102.6:c.3052C>A	8.37:g.17513428G>T	ENSP00000262102:p.Leu1018Ile	Somatic	63	0		WXS	Illumina HiSeq	.	86	4	NM_001001924	A8K135|B2RBJ6|B3KWJ9|B4DH03|B9EGA1|D3DSP8|Q63HJ6|Q659F4|Q6PK49|Q6URW7|Q8N4M6|Q8WTT9|Q9H7T2	Missense_Mutation	SNP	ENST00000262102.6	37	CCDS43717.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.136828	0.77662	.	.	ENSG00000129422	ENST00000381869;ENST00000544260;ENST00000400046;ENST00000297488;ENST00000381861;ENST00000262102;ENST00000519263	T;T;T;T;T;T;T	0.37411	1.2;1.2;1.52;1.2;1.2;1.2;1.2	5.13	3.31	0.37934	.	0.133576	0.50627	D	0.000119	T	0.58221	0.2107	M	0.83012	2.62	0.80722	D	1	P;D;P;P	0.59767	0.936;0.986;0.633;0.633	P;D;P;P	0.64506	0.797;0.926;0.618;0.618	T	0.64521	-0.6388	10	0.72032	D	0.01	-8.9104	11.3084	0.49349	0.1483:0.0:0.8517:0.0	.	964;1018;265;184	Q9ULD2-2;Q9ULD2;Q9ULD2-6;Q9ULD2-3	.;MTUS1_HUMAN;.;.	I	964;163;90;184;265;1018;964	ENSP00000371293:L964I;ENSP00000445738:L163I;ENSP00000382921:L90I;ENSP00000297488:L184I;ENSP00000371285:L265I;ENSP00000262102:L1018I;ENSP00000430167:L964I	ENSP00000262102:L1018I	L	-	1	0	MTUS1	17557708	1.000000	0.71417	0.998000	0.56505	0.894000	0.52154	2.514000	0.45503	1.311000	0.45024	0.591000	0.81541	CTT	.		0.458	MTUS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000375247.1	XM_372031	
OR5I1	10798	hgsc.bcm.edu	37	11	55703506	55703506	+	Missense_Mutation	SNP	C	C	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr11:55703506C>T	ENST00000301532.3	-	1	370	c.371G>A	c.(370-372)cGc>cAc	p.R124H		NM_006637.1	NP_006628.1	Q13606	OR5I1_HUMAN	olfactory receptor, family 5, subfamily I, member 1	124					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(34)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						GGCGACATAGCGATCATAGGC	0.433																																					p.R124H		.											OR5I1,colon,carcinoma,0,2	OR5I1	0	0			c.G371A						.						66.0	67.0	67.0					11																	55703506		2201	4293	6494	SO:0001583	missense	10798	exon1			ACATAGCGATCAT	BC069093	CCDS7949.1	11q11	2012-08-09			ENSG00000167825	ENSG00000167825		"""GPCR / Class A : Olfactory receptors"""	8347	protein-coding gene	gene with protein product		608496				9017400, 9787077	Standard	NM_006637		Approved	HSOlf1, OLF1	uc010ris.2	Q13606	OTTHUMG00000166821	ENST00000301532.3:c.371G>A	11.37:g.55703506C>T	ENSP00000301532:p.Arg124His	Somatic	37	0		WXS	Illumina HiSeq	.	38	3	NM_006637	Q6IEU4	Missense_Mutation	SNP	ENST00000301532.3	37	CCDS7949.1	.	.	.	.	.	.	.	.	.	.	C	10.80	1.451578	0.26074	.	.	ENSG00000167825	ENST00000301532	T	0.77489	-1.1	4.94	3.07	0.35406	GPCR, rhodopsin-like superfamily (1);	0.139243	0.33534	N	0.004815	T	0.77598	0.4154	M	0.85373	2.75	0.32795	N	0.500701	B	0.14438	0.01	B	0.08055	0.003	T	0.78295	-0.2259	10	0.66056	D	0.02	.	9.6572	0.39932	0.0:0.8266:0.0:0.1734	.	124	Q13606	OR5I1_HUMAN	H	124	ENSP00000301532:R124H	ENSP00000301532:R124H	R	-	2	0	OR5I1	55460082	0.173000	0.23056	0.003000	0.11579	0.108000	0.19459	4.333000	0.59285	0.599000	0.29845	-0.154000	0.13518	CGC	.		0.433	OR5I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391528.1	NM_006637	
ZNF268	10795	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	133780814	133780814	+	Missense_Mutation	SNP	A	A	G			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr12:133780814A>G	ENST00000536435.2	+	6	2872	c.2542A>G	c.(2542-2544)Aaa>Gaa	p.K848E	ZNF268_ENST00000228289.5_Missense_Mutation_p.K848E|ZNF268_ENST00000541009.2_3'UTR|ZNF268_ENST00000537565.1_Missense_Mutation_p.K687E|ZNF268_ENST00000536899.2_3'UTR|ZNF268_ENST00000542986.2_3'UTR	NM_001165885.1|NM_003415.2	NP_001159357.1|NP_003406.1	Q14587	ZN268_HUMAN	zinc finger protein 268	848					cell differentiation (GO:0030154)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein heterodimerization activity (GO:0043497)|regulation of transcription, DNA-templated (GO:0006355)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(3)|endometrium(4)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(1)|skin(1)	24	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.000215)|all_epithelial(31;0.096)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		CTTCAGTGGGAAATTACGCCT	0.413																																					p.K848E		.											.	.	.	0			c.A2542G						.						133.0	130.0	131.0					12																	133780814		692	1591	2283	SO:0001583	missense	10795	exon6			AGTGGGAAATTAC	X78926	CCDS45012.1, CCDS53851.1, CCDS53852.1, CCDS53853.1, CCDS53854.1, CCDS59239.1, CCDS59240.1	12q24.33	2013-01-08				ENSG00000090612		"""Zinc fingers, C2H2-type"", ""-"""	13061	protein-coding gene	gene with protein product		604753				7865130	Standard	NM_003415		Approved	HZF3	uc010tcf.2	Q14587	OTTHUMG00000167946	ENST00000536435.2:c.2542A>G	12.37:g.133780814A>G	ENSP00000444412:p.Lys848Glu	Somatic	47	0		WXS	Illumina HiSeq	.	46	7	NM_001165881	Q8TDG8|Q96RH4|Q9BZJ9	Missense_Mutation	SNP	ENST00000536435.2	37	CCDS45012.1	.	.	.	.	.	.	.	.	.	.	A	7.494	0.651172	0.14516	.	.	ENSG00000090612	ENST00000541009;ENST00000228289;ENST00000537565;ENST00000541019	T;T	0.13420	2.59;2.59	3.75	3.75	0.43078	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.22513	0.0543	M	0.64404	1.975	0.09310	N	1	P;D	0.53885	0.938;0.963	B;P	0.49502	0.408;0.613	T	0.05419	-1.0886	8	.	.	.	.	11.8844	0.52594	1.0:0.0:0.0:0.0	.	848;687	Q14587;Q14587-2	ZN268_HUMAN;.	E	848;848;687;687	ENSP00000228289:K848E;ENSP00000445713:K687E	.	K	+	1	0	ZNF268	.	0.000000	0.05858	0.131000	0.22000	0.230000	0.25150	0.268000	0.18571	1.705000	0.51264	0.482000	0.46254	AAA	.		0.413	ZNF268-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397191.2	NM_152943	
ABCG2	9429	hgsc.bcm.edu	37	4	89060947	89060947	+	Silent	SNP	G	G	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr4:89060947G>T	ENST00000237612.3	-	2	746	c.201C>A	c.(199-201)atC>atA	p.I67I	ABCG2_ENST00000515655.1_Silent_p.I67I	NM_004827.2	NP_004818.2	Q9UNQ0	ABCG2_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 2 (Junior blood group)	67	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular iron ion homeostasis (GO:0006879)|drug export (GO:0046618)|drug transmembrane transport (GO:0006855)|embryonic process involved in female pregnancy (GO:0060136)|heme transport (GO:0015886)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|urate metabolic process (GO:0046415)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(13)|lung(10)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;7.02e-05)	Afatinib(DB08916)|Apixaban(DB06605)|Buprenorphine(DB00921)|Cabazitaxel(DB06772)|Carboplatin(DB00958)|Cisplatin(DB00515)|Cladribine(DB00242)|Clofarabine(DB00631)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Diethylstilbestrol(DB00255)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gefitinib(DB00317)|Glyburide(DB01016)|Hesperetin(DB01094)|Hydrocortisone(DB00741)|Imatinib(DB00619)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Lansoprazole(DB00448)|Leflunomide(DB01097)|Methotrexate(DB00563)|Mitoxantrone(DB01204)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Nilotinib(DB04868)|Nitrofurantoin(DB00698)|Novobiocin(DB01051)|Omeprazole(DB00338)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Pitavastatin(DB08860)|Ponatinib(DB08901)|Pravastatin(DB00175)|Prazosin(DB00457)|Rabeprazole(DB01129)|Regorafenib(DB08896)|Rilpivirine(DB08864)|Riluzole(DB00740)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Sorafenib(DB00398)|Sulfasalazine(DB00795)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Teniposide(DB00444)|Teriflunomide(DB08880)|Testosterone(DB00624)|Topotecan(DB01030)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vincristine(DB00541)|Vismodegib(DB08828)|Zafirlukast(DB00549)|Zidovudine(DB00495)	GTACATACTTGATATTCGATA	0.343																																					p.I67I		.											.	.	.	0			c.C201A						.						57.0	52.0	54.0					4																	89060947		2203	4300	6503	SO:0001819	synonymous_variant	9429	exon2			ATACTTGATATTC	AF103796	CCDS3628.1, CCDS58910.1	4q22.1	2014-08-27	2014-08-27		ENSG00000118777	ENSG00000118777		"""CD molecules"", ""ATP binding cassette transporters / subfamily G"""	74	protein-coding gene	gene with protein product		603756	"""ATP-binding cassette, sub-family G (WHITE), member 2"""			8894702, 9861027	Standard	NM_001257386		Approved	EST157481, MXR, BCRP, ABCP, CD338	uc003hrg.3	Q9UNQ0	OTTHUMG00000130601	ENST00000237612.3:c.201C>A	4.37:g.89060947G>T		Somatic	70	0		WXS	Illumina HiSeq	.	89	4	NM_004827	A0A1W3|A8K1T5|O95374|Q4W5I3|Q53ZQ1|Q569L4|Q5YLG4|Q86V64|Q8IX16|Q96LD6|Q96TA8|Q9BY73|Q9NUS0	Silent	SNP	ENST00000237612.3	37	CCDS3628.1																																																																																			.		0.343	ABCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253051.1	NM_004827	
C15orf48	84419	hgsc.bcm.edu	37	15	45725249	45725249	+	3'UTR	SNP	A	A	G			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr15:45725249A>G	ENST00000344300.3	+	0	477				RP11-519G16.5_ENST00000559553.1_RNA|MIR147B_ENST00000390185.1_RNA|C15orf48_ENST00000396650.2_3'UTR	NM_032413.3	NP_115789.1	Q9C002	NMES1_HUMAN	chromosome 15 open reading frame 48							mitochondrion (GO:0005739)|nucleus (GO:0005634)				large_intestine(1)|lung(2)|ovary(1)	4		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.67e-16)|GBM - Glioblastoma multiforme(94;1.71e-06)		AGAGTACTCTATAAATCTAGT	0.408																																					.		.											.	.	.	0			.						.						84.0	86.0	85.0					15																	45725249		2198	4298	6496	SO:0001624	3_prime_UTR_variant	100126311	.			TACTCTATAAATC		CCDS10124.1	15q21.1	2014-05-29			ENSG00000166920	ENSG00000166920			29898	protein-coding gene	gene with protein product	"""normal mucosa of esophagus specific 1"""	608409				12209954	Standard	NM_032413		Approved	NMES1	uc001zvh.4	Q9C002	OTTHUMG00000131424	ENST00000344300.3:c.*35A>G	15.37:g.45725249A>G		Somatic	43	0		WXS	Illumina HiSeq	.	75	7	.		RNA	SNP	ENST00000344300.3	37	CCDS10124.1																																																																																			.		0.408	C15orf48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254217.2	NM_032413	
SCTR	6344	hgsc.bcm.edu	37	2	120194651	120194651	+	IGR	SNP	A	A	C	rs3217464|rs201433053	byFrequency	TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr2:120194651A>C	ENST00000019103.5	-	0	1865				TMEM37_ENST00000306406.4_Missense_Mutation_p.T70P|TMEM37_ENST00000465296.1_3'UTR|TMEM37_ENST00000409826.1_Missense_Mutation_p.T82P	NM_002980.2	NP_002971.2	P47872	SCTR_HUMAN	secretin receptor						digestion (GO:0007586)|excretion (GO:0007588)|G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasmic microtubule (GO:0005881)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	secretin receptor activity (GO:0015055)	p.T70>SVP(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)	19					Secretin(DB00021)	CACCAACCAGACGATCTGCTT	0.672																																					p.T70P		.											.,15	.	40	1	Complex - insertion inframe(1)	ovary(1)	c.A208C						.						55.0	57.0	56.0					2																	120194651		2194	4280	6474	SO:0001628	intergenic_variant	140738	exon2			AACCAGACGATCT		CCDS2127.1	2q14.1	2012-08-10			ENSG00000080293	ENSG00000080293		"""GPCR / Class B : Glucagon receptors"""	10608	protein-coding gene	gene with protein product		182098				1646711	Standard	NM_002980		Approved		uc002tma.3	P47872	OTTHUMG00000131407		2.37:g.120194651A>C		Somatic	21	0		WXS	Illumina HiSeq	.	24	0	NM_183240	Q12961|Q13213|Q53T00	Missense_Mutation	SNP	ENST00000019103.5	37	CCDS2127.1	.	.	.	.	.	.	.	.	.	.	A	9.459	1.092496	0.20471	.	.	ENSG00000171227	ENST00000409826;ENST00000306406	.	.	.	4.6	3.41	0.39046	.	0.243493	0.37012	N	0.002288	T	0.33440	0.0863	L	0.44542	1.39	0.19300	N	0.999971	B	0.29085	0.232	B	0.28849	0.095	T	0.29792	-1.0000	9	0.66056	D	0.02	-4.3321	8.3489	0.32290	0.9087:0.0:0.0913:0.0	.	70	Q8WXS4	CCGL_HUMAN	P	82;70	.	ENSP00000303148:T70P	T	+	1	0	TMEM37	119911121	0.935000	0.31712	0.603000	0.28903	0.004000	0.04260	2.863000	0.48396	0.768000	0.33290	0.459000	0.35465	ACG	.		0.672	SCTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254198.2		
OR2T33	391195	hgsc.bcm.edu	37	1	248436682	248436682	+	Silent	SNP	C	C	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr1:248436682C>T	ENST00000318021.2	-	1	456	c.435G>A	c.(433-435)tcG>tcA	p.S145S		NM_001004695.1	NP_001004695.1	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T, member 33	145						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S145S(2)		NS(2)|breast(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(41)|ovary(1)|prostate(1)|skin(4)	67	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			GGAGCCAACACGACATGGTCA	0.572																																					p.S145S		.											OR2T33,NS,carcinoma,0,2	OR2T33	0	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.G435A						.						146.0	138.0	141.0					1																	248436682		2203	4300	6503	SO:0001819	synonymous_variant	391195	exon1			CCAACACGACATG		CCDS31109.1	1q44	2012-08-09			ENSG00000177212	ENSG00000177212		"""GPCR / Class A : Olfactory receptors"""	31255	protein-coding gene	gene with protein product							Standard	NM_001004695		Approved		uc010pzi.2	Q8NG76	OTTHUMG00000040458	ENST00000318021.2:c.435G>A	1.37:g.248436682C>T		Somatic	77	1		WXS	Illumina HiSeq	.	74	4	NM_001004695	B2RNN0	Silent	SNP	ENST00000318021.2	37	CCDS31109.1																																																																																			.		0.572	OR2T33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097354.1	NM_001004695	
SLC12A2	6558	hgsc.bcm.edu	37	5	127522246	127522246	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr5:127522246G>T	ENST00000262461.2	+	27	3751	c.3562G>T	c.(3562-3564)Gaa>Taa	p.E1188*	SLC12A2_ENST00000343225.4_Nonsense_Mutation_p.E1172*	NM_001046.2	NP_001037.1	P55011	S12A2_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 2	1188					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|branching involved in mammary gland duct morphogenesis (GO:0060444)|chloride transmembrane transport (GO:1902476)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|gamma-aminobutyric acid signaling pathway (GO:0007214)|hyperosmotic response (GO:0006972)|ion transport (GO:0006811)|mammary duct terminal end bud growth (GO:0060763)|multicellular organism growth (GO:0035264)|positive regulation of cell volume (GO:0045795)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transepithelial ammonium transport (GO:0070634)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ammonium transmembrane transporter activity (GO:0008519)|sodium:potassium:chloride symporter activity (GO:0008511)			breast(3)|endometrium(5)|kidney(5)|large_intestine(12)|lung(16)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)|Quinethazone(DB01325)	GGCATGGTTAGAAGCTCTATC	0.433																																					p.E1188X		.											.	.	.	0			c.G3562T						.						203.0	181.0	189.0					5																	127522246		2203	4300	6503	SO:0001587	stop_gained	6558	exon27			TGGTTAGAAGCTC		CCDS4144.1, CCDS58965.1	5q23.3	2014-06-13	2013-07-18		ENSG00000064651	ENSG00000064651		"""Solute carriers"""	10911	protein-coding gene	gene with protein product	"""bumetanide-sensitive sodium-(potassium)-chloride cotransporter 1"", ""basolateral Na-K-Cl symporter"", ""protein phosphatase 1, regulatory subunit 141"""	600840				7629105	Standard	NM_001256461		Approved	NKCC1, BSC, BSC2, PPP1R141	uc003kus.3	P55011	OTTHUMG00000128983	ENST00000262461.2:c.3562G>T	5.37:g.127522246G>T	ENSP00000262461:p.Glu1188*	Somatic	62	0		WXS	Illumina HiSeq	.	80	4	NM_001046	Q8N713|Q8WWH7	Nonsense_Mutation	SNP	ENST00000262461.2	37	CCDS4144.1	.	.	.	.	.	.	.	.	.	.	G	41	8.670440	0.98908	.	.	ENSG00000064651	ENST00000262461;ENST00000343225	.	.	.	5.48	5.48	0.80851	.	0.050826	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.5559	0.95347	0.0:0.0:1.0:0.0	.	.	.	.	X	1188;1172	.	ENSP00000262461:E1188X	E	+	1	0	SLC12A2	127550145	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.652000	0.98499	2.861000	0.98227	0.650000	0.86243	GAA	.		0.433	SLC12A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250972.1	NM_001046	
NPTN	27020	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	73889442	73889442	+	Silent	SNP	G	G	A			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr15:73889442G>A	ENST00000345330.4	-	2	557	c.360C>T	c.(358-360)aaC>aaT	p.N120N	NPTN_ENST00000545878.1_Silent_p.N120N|NPTN_ENST00000564551.1_Intron|NPTN_ENST00000542234.1_Intron|NPTN_ENST00000351217.6_Intron|NPTN_ENST00000563691.1_Silent_p.N120N|NPTN_ENST00000562924.1_Intron|NPTN_ENST00000287226.8_Silent_p.N120N	NM_001161363.1|NM_012428.3	NP_001154835.1|NP_036560.1	Q9Y639	NPTN_HUMAN	neuroplastin	120	Ig-like 1.				homophilic cell adhesion (GO:0007156)|long-term synaptic potentiation (GO:0060291)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein phosphorylation (GO:0001934)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)	cell adhesion molecule binding (GO:0050839)|type 1 fibroblast growth factor receptor binding (GO:0005105)			breast(2)|cervix(1)|endometrium(2)|large_intestine(2)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	13						TCTTGGGGTCGTTGCTGGCCC	0.562																																					p.N120N	Pancreas(101;1519 1568 9459 19537 41286)|Esophageal Squamous(143;1278 1787 35254 36835 44843)	.											NPTN,caecum,carcinoma,0,1	NPTN	0	0			c.C360T						.						143.0	79.0	101.0					15																	73889442		2198	4297	6495	SO:0001819	synonymous_variant	27020	exon2			GGGGTCGTTGCTG	AF035287	CCDS10249.1, CCDS10250.1, CCDS58379.1, CCDS58380.1	15q24.1	2013-01-29	2006-02-22	2006-02-22	ENSG00000156642	ENSG00000156642		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17867	protein-coding gene	gene with protein product		612820	"""stromal cell derived factor receptor 1"""	SDFR1		8619474, 9110174	Standard	NM_012428		Approved	SDR1, GP55, GP65, np65, np55	uc002avs.3	Q9Y639	OTTHUMG00000137586	ENST00000345330.4:c.360C>T	15.37:g.73889442G>A		Somatic	47	0		WXS	Illumina HiSeq	.	47	10	NM_001161363	B2RAL7|B7Z4D3|B7ZLL2|Q17R52|Q59EJ9|Q6NVX7|Q9Y640	Silent	SNP	ENST00000345330.4	37	CCDS10249.1																																																																																			.		0.562	NPTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268980.1	NM_012428	
SYNDIG1	79953	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	20	24524207	24524207	+	Missense_Mutation	SNP	G	G	C			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr20:24524207G>C	ENST00000376862.3	+	2	1107	c.474G>C	c.(472-474)gaG>gaC	p.E158D		NM_024893.1	NP_079169.1	Q9H7V2	SYNG1_HUMAN	synapse differentiation inducing 1	158					intracellular protein transport (GO:0006886)|positive regulation of synapse assembly (GO:0051965)|response to biotic stimulus (GO:0009607)|synaptic vesicle clustering (GO:0097091)	cell body (GO:0044297)|cell junction (GO:0030054)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	glutamate receptor binding (GO:0035254)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(1)|large_intestine(3)|lung(14)|prostate(1)|skin(3)	24						AGTTCCAGGAGCTGGAGGTCA	0.527																																					p.E158D		.											.	.	.	0			c.G474C						.						74.0	80.0	78.0					20																	24524207		2202	4298	6500	SO:0001583	missense	79953	exon2			CCAGGAGCTGGAG	AK024282	CCDS13164.1	20p11.21	2011-06-30	2011-06-30	2011-06-30	ENSG00000101463	ENSG00000101463			15885	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 5"", ""synapse differentiation induced gene 1"""	614311	"""chromosome 20 open reading frame 39"", ""transmembrane protein 90B"""	C20orf39, TMEM90B		20152115	Standard	NM_024893		Approved	FLJ14220, IFITMD5, SynDIG1	uc002wtw.1	Q9H7V2	OTTHUMG00000032104	ENST00000376862.3:c.474G>C	20.37:g.24524207G>C	ENSP00000366058:p.Glu158Asp	Somatic	30	0		WXS	Illumina HiSeq	.	39	4	NM_024893	Q6IA30|Q9H514	Missense_Mutation	SNP	ENST00000376862.3	37	CCDS13164.1	.	.	.	.	.	.	.	.	.	.	G	11.21	1.571510	0.28003	.	.	ENSG00000101463	ENST00000376862	D	0.91631	-2.88	5.7	0.302	0.15786	.	0.120960	0.53938	N	0.000043	D	0.84862	0.5566	L	0.43152	1.355	0.53688	D	0.999971	B	0.14012	0.009	B	0.14578	0.011	T	0.73972	-0.3814	10	0.59425	D	0.04	-27.4696	3.1745	0.06564	0.2112:0.1175:0.5504:0.1209	.	158	Q9H7V2	SYNG1_HUMAN	D	158	ENSP00000366058:E158D	ENSP00000366058:E158D	E	+	3	2	SYNDIG1	24472207	1.000000	0.71417	0.998000	0.56505	0.575000	0.36095	1.069000	0.30641	0.076000	0.16826	-0.136000	0.14681	GAG	.		0.527	SYNDIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078376.1	NM_024893	
ARHGAP28	79822	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	6873450	6873450	+	Missense_Mutation	SNP	G	G	C			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr18:6873450G>C	ENST00000383472.4	+	8	1101	c.997G>C	c.(997-999)Gga>Cga	p.G333R	ARHGAP28_ENST00000419673.2_Missense_Mutation_p.G174R|ARHGAP28_ENST00000418986.1_Missense_Mutation_p.G174R|RP11-146G7.2_ENST00000583659.1_RNA|ARHGAP28_ENST00000314319.3_Missense_Mutation_p.G174R|ARHGAP28_ENST00000262227.3_Missense_Mutation_p.G281R|ARHGAP28_ENST00000531294.1_Missense_Mutation_p.G169R|ARHGAP28_ENST00000532996.1_Missense_Mutation_p.G156R|ARHGAP28_ENST00000400091.2_Missense_Mutation_p.G333R			Q9P2N2	RHG28_HUMAN	Rho GTPase activating protein 28	333					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	37		Colorectal(10;0.168)				AACTGAAGCAGGAGATCTGTC	0.353																																					p.G174R		.											.	.	.	0			c.G520C						.						129.0	131.0	130.0					18																	6873450		2203	4300	6503	SO:0001583	missense	79822	exon7			GAAGCAGGAGATC	BC033668	CCDS32785.1	18p11.23	2011-06-29				ENSG00000088756		"""Rho GTPase activating proteins"""	25509	protein-coding gene	gene with protein product		610592				10718198	Standard	NM_001010000		Approved	KIAA1314, FLJ10312	uc002kne.3	Q9P2N2		ENST00000383472.4:c.997G>C	18.37:g.6873450G>C	ENSP00000372964:p.Gly333Arg	Somatic	43	0		WXS	Illumina HiSeq	.	73	9	NM_001010000	A8MQB7|A8MU88|Q6P160|Q8N4T3|Q9NW53	Missense_Mutation	SNP	ENST00000383472.4	37		.	.	.	.	.	.	.	.	.	.	G	20.9	4.059891	0.76074	.	.	ENSG00000088756	ENST00000400091;ENST00000262227;ENST00000419673;ENST00000531294;ENST00000314319;ENST00000418986;ENST00000532996;ENST00000383472	T;T;T;T;T;T	0.09445	3.16;3.12;3.04;3.03;3.04;2.98	5.26	4.38	0.52667	.	0.500026	0.24191	N	0.040702	T	0.30759	0.0775	M	0.71206	2.165	0.43550	D	0.995854	D;D;D;D	0.65815	0.964;0.991;0.995;0.995	P;P;D;D	0.66847	0.564;0.891;0.947;0.923	T	0.04737	-1.0930	10	0.72032	D	0.01	.	14.1891	0.65625	0.0726:0.0:0.9274:0.0	.	333;165;174;281	Q9P2N2;E9PRP2;F6VKJ9;Q9P2N2-2	RHG28_HUMAN;.;.;.	R	333;281;174;169;174;174;165;156	ENSP00000382963:G333R;ENSP00000262227:G281R;ENSP00000392660:G174R;ENSP00000437262:G169R;ENSP00000313506:G174R;ENSP00000406907:G174R	ENSP00000262227:G281R	G	+	1	0	ARHGAP28	6863450	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.331000	0.59273	1.352000	0.45808	-0.145000	0.13849	GGA	.		0.353	ARHGAP28-006	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000442123.3	XM_371108	
TUBB	203068	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	30691487	30691487	+	Silent	SNP	G	G	A			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr6:30691487G>A	ENST00000327892.8	+	4	954	c.648G>A	c.(646-648)aaG>aaA	p.K216K	TUBB_ENST00000396389.1_Silent_p.K198K|TUBB_ENST00000330914.3_Silent_p.K144K|TUBB_ENST00000396384.1_Silent_p.K144K|XXbac-BPG252P9.9_ENST00000607476.1_RNA|TUBB_ENST00000435534.1_Intron	NM_178014.2	NP_821133.1	P07437	TBB5_HUMAN	tubulin, beta class I	216				K -> R (in Ref. 1; no nucleotide entry and 2; AAB59507). {ECO:0000305}.	cell division (GO:0051301)|cellular component movement (GO:0006928)|cellular process (GO:0009987)|cytoskeleton-dependent intracellular transport (GO:0030705)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|natural killer cell mediated cytotoxicity (GO:0042267)|protein polymerization (GO:0051258)|spindle assembly (GO:0051225)	cell body (GO:0044297)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nuclear envelope lumen (GO:0005641)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|MHC class I protein binding (GO:0042288)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(1)|endometrium(1)|kidney(8)|large_intestine(3)|lung(1)|ovary(1)|urinary_tract(1)	16					Colchicine(DB01394)|Podofilox(DB01179)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)	GCACTCTGAAGCTGACCACAC	0.537																																					p.K216K		.											.	.	.	0			c.G648A						.						102.0	95.0	97.0					6																	30691487		2203	4300	6503	SO:0001819	synonymous_variant	203068	exon4			TCTGAAGCTGACC	AB062393	CCDS4687.1	6p21.33	2011-10-10	2011-10-10		ENSG00000196230	ENSG00000196230		"""Tubulins"""	20778	protein-coding gene	gene with protein product	"""class I beta-tubulin"", ""beta1-tubulin"""	191130	"""tubulin, beta polypeptide"", ""tubulin, beta"""			11504633, 8270253	Standard	NM_001293212		Approved	OK/SW-cl.56, MGC16435, M40, Tubb5	uc003nrl.3	P07437	OTTHUMG00000031059	ENST00000327892.8:c.648G>A	6.37:g.30691487G>A		Somatic	40	0		WXS	Illumina HiSeq	.	52	5	NM_178014	P05218|Q8WUC1|Q9CY33	Silent	SNP	ENST00000327892.8	37	CCDS4687.1																																																																																			.		0.537	TUBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076074.2	NM_178014	
RYR1	6261	hgsc.bcm.edu	37	19	39016093	39016093	+	Missense_Mutation	SNP	C	C	T	rs374061380		TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr19:39016093C>T	ENST00000359596.3	+	71	10577	c.10577C>T	c.(10576-10578)gCg>gTg	p.A3526V	RYR1_ENST00000355481.4_Missense_Mutation_p.A3521V|RYR1_ENST00000360985.3_Missense_Mutation_p.A3526V|AC067969.1_ENST00000597015.1_RNA			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	3526					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.A3526V(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	AATATGTGTGCGCCCACCGAC	0.642																																					p.A3526V		.											RYR1,colon,carcinoma,0,1	RYR1	0	1	Substitution - Missense(1)	large_intestine(1)	c.C10577T						.						105.0	87.0	93.0					19																	39016093		2203	4300	6503	SO:0001583	missense	6261	exon71			TGTGTGCGCCCAC	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.10577C>T	19.37:g.39016093C>T	ENSP00000352608:p.Ala3526Val	Somatic	26	0		WXS	Illumina HiSeq	.	47	2	NM_000540	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	C	17.17	3.321849	0.60634	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985;ENST00000538206	D;D;D	0.96940	-4.17;-4.18;-4.17	4.15	4.15	0.48705	.	0.085770	0.48286	U	0.000199	D	0.92708	0.7682	L	0.47016	1.485	0.42701	D	0.993616	P;P;P	0.51791	0.948;0.901;0.84	B;B;B	0.34418	0.182;0.182;0.089	D	0.93228	0.6615	10	0.42905	T	0.14	.	16.5643	0.84575	0.0:1.0:0.0:0.0	.	3526;3521;3526	P21817-3;P21817-2;P21817	.;.;RYR1_HUMAN	V	3526;3521;3526;446	ENSP00000352608:A3526V;ENSP00000347667:A3521V;ENSP00000354254:A3526V	ENSP00000347667:A3521V	A	+	2	0	RYR1	43707933	1.000000	0.71417	0.927000	0.36925	0.971000	0.66376	7.397000	0.79903	2.302000	0.77476	0.655000	0.94253	GCG	.		0.642	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
NBR2	10230	hgsc.bcm.edu	37	17	41283415	41283415	+	RNA	SNP	T	T	A			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr17:41283415T>A	ENST00000460115.1	+	0	224					NR_003108.1		O15453	NBR2_HUMAN	neighbor of BRCA1 gene 2 (non-protein coding)																		ataataataataaaaacaatG	0.388																																					.		.											.	.	.	0			.						.																																					10230	.			TAATAATAAAAAC	U88573		17q21	2012-10-16	2009-08-21		ENSG00000198496	ENSG00000198496		"""Long non-coding RNAs"""	20691	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 192"""		"""neighbor of BRCA1 gene 2"""			9215675, 15777733	Standard	NR_003108		Approved	NCRNA00192	uc002idf.3	O15453	OTTHUMG00000140395		17.37:g.41283415T>A		Somatic	20	0		WXS	Illumina HiSeq	.	38	6	.	Q3LRJ7	RNA	SNP	ENST00000460115.1	37																																																																																				.		0.388	NBR2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000277175.1	NR_003108	
DAXX	1616	hgsc.bcm.edu	37	6	33288173	33288173	+	Missense_Mutation	SNP	G	G	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr6:33288173G>T	ENST00000374542.5	-	4	1439	c.1235C>A	c.(1234-1236)tCc>tAc	p.S412Y	ZBTB22_ENST00000418724.1_5'Flank|DAXX_ENST00000266000.6_Missense_Mutation_p.S412Y|DAXX_ENST00000414083.2_Missense_Mutation_p.S337Y|ZBTB22_ENST00000431845.2_5'Flank|DAXX_ENST00000477162.1_5'UTR	NM_001141969.1|NM_001141970.1|NM_001350.4	NP_001135441.1|NP_001135442.1|NP_001341.1	Q9UER7	DAXX_HUMAN	death-domain associated protein	412	Interaction with histone H3.3.|Necessary for interaction with USP7.				activation of JUN kinase activity (GO:0007257)|androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|chromatin remodeling (GO:0006338)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|mitotic cytokinesis (GO:0000281)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of neuron death (GO:1901216)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|PML body (GO:0016605)|SWI/SNF superfamily-type complex (GO:0070603)	androgen receptor binding (GO:0050681)|enzyme binding (GO:0019899)|heat shock protein binding (GO:0031072)|histone binding (GO:0042393)|p53 binding (GO:0002039)|protein homodimerization activity (GO:0042803)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|receptor signaling protein activity (GO:0005057)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(2)|lung(7)|ovary(3)|pancreas(18)|prostate(3)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	55						AGAATCCAAGGAGGCTTCGGG	0.557			"""Mis, F, N"""		Pancreatic neuroendocrine tumors. Paediatric GBM																																p.S424Y		.		Rec	yes		6	6p21.3	1616	death-domain associated protein		E	DAXX,NS,carcinoma,0,1	DAXX	0	0			c.C1271A						.						92.0	91.0	91.0					6																	33288173		2203	4300	6503	SO:0001583	missense	1616	exon4			TCCAAGGAGGCTT	AF006041	CCDS4776.1, CCDS59008.1	6p21.3	2008-08-29	2008-08-29			ENSG00000204209			2681	protein-coding gene	gene with protein product		603186	"""death-associated protein 6"""			9407001, 9215629	Standard	NM_001141970		Approved	DAP6	uc011dre.2	Q9UER7		ENST00000374542.5:c.1235C>A	6.37:g.33288173G>T	ENSP00000363668:p.Ser412Tyr	Somatic	31	0		WXS	Illumina HiSeq	.	47	2	NM_001141970	B4E1I3|F5H082|O14747|O15141|O15208|Q5STK9|Q9BWI3	Missense_Mutation	SNP	ENST00000374542.5	37	CCDS4776.1	.	.	.	.	.	.	.	.	.	.	G	13.42	2.232506	0.39498	.	.	ENSG00000204209	ENST00000266000;ENST00000374542;ENST00000414083	.	.	.	4.28	4.28	0.50868	.	0.559138	0.17614	N	0.167980	T	0.70448	0.3225	M	0.65975	2.015	0.42964	D	0.994418	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.85130	0.997;0.977;0.977	T	0.73566	-0.3942	9	0.72032	D	0.01	-10.7953	12.0878	0.53708	0.0:0.0:1.0:0.0	.	424;412;412	B4E1C1;B2R7M0;Q9UER7	.;.;DAXX_HUMAN	Y	412;412;337	.	ENSP00000266000:S412Y	S	-	2	0	DAXX	33396151	1.000000	0.71417	1.000000	0.80357	0.821000	0.46438	1.790000	0.38734	2.227000	0.72691	0.549000	0.68633	TCC	.		0.557	DAXX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076403.1		
MUC5B	727897	hgsc.bcm.edu	37	11	1258389	1258389	+	Missense_Mutation	SNP	T	T	G			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr11:1258389T>G	ENST00000529681.1	+	25	3350	c.3292T>G	c.(3292-3294)Tcc>Gcc	p.S1098A	MUC5B_ENST00000447027.1_Missense_Mutation_p.S1101A	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	1098	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CGCCTGCCGCTCCCAGGTGGG	0.682																																					p.S1098A		.											MUC5B,NS,carcinoma,0,2	MUC5B	0	0			c.T3292G						.						10.0	15.0	13.0					11																	1258389		1897	4084	5981	SO:0001583	missense	727897	exon25			TGCCGCTCCCAGG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.3292T>G	11.37:g.1258389T>G	ENSP00000436812:p.Ser1098Ala	Somatic	16	1		WXS	Illumina HiSeq	.	32	4	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	T	5.715	0.316511	0.10845	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.76839	-1.05;-1.05	4.38	-4.2	0.03823	von Willebrand factor, type D domain (1);Uncharacterised domain, cysteine-rich (2);	.	.	.	.	T	0.59473	0.2196	N	0.10645	0.015	0.27479	N	0.952642	B;P;P	0.48089	0.026;0.905;0.905	B;P;P	0.47376	0.027;0.545;0.545	T	0.57613	-0.7781	9	0.87932	D	0	.	6.1245	0.20172	0.0:0.2029:0.3546:0.4425	.	1098;1791;1101	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	A	1098;1101;1099;1168	ENSP00000436812:S1098A;ENSP00000415793:S1101A	ENSP00000343037:S1099A	S	+	1	0	MUC5B	1214965	0.000000	0.05858	0.074000	0.20217	0.008000	0.06430	-0.169000	0.09911	-0.576000	0.05974	-0.648000	0.03929	TCC	.		0.682	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
GARNL3	84253	hgsc.bcm.edu	37	9	130152985	130152985	+	Missense_Mutation	SNP	C	C	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr9:130152985C>T	ENST00000373387.4	+	27	3161	c.2809C>T	c.(2809-2811)Cgg>Tgg	p.R937W	GARNL3_ENST00000314904.5_3'UTR|GARNL3_ENST00000496711.1_3'UTR|GARNL3_ENST00000435213.2_Missense_Mutation_p.R915W	NM_032293.4	NP_115669.3	Q5VVW2	GARL3_HUMAN	GTPase activating Rap/RanGAP domain-like 3	937					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)|small GTPase regulator activity (GO:0005083)			NS(1)|central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(24)|ovary(1)|skin(1)|urinary_tract(2)	41						ACCCCGGAAGCGGTTAGAAGA	0.572																																					p.R937W		.											GARNL3,NS,carcinoma,0,1	GARNL3	0	0			c.C2809T						.						88.0	101.0	97.0					9																	130152985		2203	4300	6503	SO:0001583	missense	84253	exon27			CGGAAGCGGTTAG	BC034983	CCDS6869.2, CCDS69663.1	9q34.13	2009-09-14	2004-08-09		ENSG00000136895	ENSG00000136895			25425	protein-coding gene	gene with protein product			"""GTPase activating RANGAP domain-like 3"""			11230166	Standard	NM_032293		Approved	DKFZp761J1523, bA356B19.1	uc011mae.2	Q5VVW2	OTTHUMG00000020700	ENST00000373387.4:c.2809C>T	9.37:g.130152985C>T	ENSP00000362485:p.Arg937Trp	Somatic	35	0		WXS	Illumina HiSeq	.	40	2	NM_032293	B4DEP7|B7Z3Q6|Q8IYU1|Q8N951|Q8ND89|Q9BQH6	Missense_Mutation	SNP	ENST00000373387.4	37	CCDS6869.2	.	.	.	.	.	.	.	.	.	.	C	17.72	3.458407	0.63401	.	.	ENSG00000136895	ENST00000435213;ENST00000373387	D;D	0.87729	-2.28;-2.29	5.97	5.97	0.96955	.	0.457912	0.24750	N	0.035912	T	0.76863	0.4047	N	0.19112	0.55	0.80722	D	1	P;P	0.44260	0.83;0.83	B;B	0.33521	0.092;0.165	T	0.76977	-0.2759	9	.	.	.	.	17.158	0.86796	0.0:1.0:0.0:0.0	.	937;915	Q5VVW2;B7Z3Q6	GARL3_HUMAN;.	W	915;937	ENSP00000396205:R915W;ENSP00000362485:R937W	.	R	+	1	2	GARNL3	129192806	1.000000	0.71417	0.995000	0.50966	0.926000	0.56050	4.167000	0.58209	2.836000	0.97738	0.655000	0.94253	CGG	.		0.572	GARNL3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054151.3	NM_032293	
GINM1	116254	hgsc.bcm.edu;bcgsc.ca	37	6	149911865	149911865	+	Missense_Mutation	SNP	G	G	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr6:149911865G>T	ENST00000367419.5	+	8	1005	c.884G>T	c.(883-885)gGa>gTa	p.G295V	RP1-12G14.7_ENST00000419134.1_RNA	NM_138785.3	NP_620140.1	Q9NU53	GINM1_HUMAN	glycoprotein integral membrane 1	295						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											TATTTCAGAGGAATTCTTCAG	0.348																																					p.G295V		.											.	.	.	0			c.G884T						.						68.0	66.0	67.0					6																	149911865		2203	4300	6503	SO:0001583	missense	116254	exon8			TCAGAGGAATTCT	BC014320	CCDS5216.1	6q24.3	2012-07-20	2012-07-20	2012-07-20	ENSG00000055211	ENSG00000055211			21074	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 72"""	C6orf72			Standard	NM_138785		Approved	dJ12G14.2	uc003qmq.1	Q9NU53	OTTHUMG00000015789	ENST00000367419.5:c.884G>T	6.37:g.149911865G>T	ENSP00000356389:p.Gly295Val	Somatic	52	0		WXS	Illumina HiSeq	.	73	4	NM_138785	B2RDY7|E1P5A2	Missense_Mutation	SNP	ENST00000367419.5	37	CCDS5216.1	.	.	.	.	.	.	.	.	.	.	G	18.31	3.595982	0.66332	.	.	ENSG00000055211	ENST00000367419	.	.	.	5.77	4.89	0.63831	.	0.256928	0.39909	N	0.001229	T	0.63390	0.2507	M	0.71581	2.175	0.80722	D	1	D	0.76494	0.999	D	0.74023	0.982	T	0.67166	-0.5739	8	.	.	.	-13.5397	9.5488	0.39297	0.0742:0.1435:0.7823:0.0	.	295	Q9NU53	CF072_HUMAN	V	295	.	.	G	+	2	0	C6orf72	149953558	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	2.678000	0.46900	1.417000	0.47077	0.655000	0.94253	GGA	.		0.348	GINM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042644.1	NM_138785	
PI15	51050	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	75737721	75737721	+	Silent	SNP	C	C	A			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr8:75737721C>A	ENST00000260113.2	+	2	416	c.237C>A	c.(235-237)ggC>ggA	p.G79G	RP11-758M4.4_ENST00000518128.1_RNA|PI15_ENST00000523773.1_Silent_p.G79G|RP11-758M4.4_ENST00000523860.1_RNA	NM_015886.3	NP_056970.1	O43692	PI15_HUMAN	peptidase inhibitor 15	79	SCP.					extracellular vesicular exosome (GO:0070062)	peptidase inhibitor activity (GO:0030414)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|skin(1)	30	Breast(64;0.137)		BRCA - Breast invasive adenocarcinoma(89;0.104)|Epithelial(68;0.118)			AAGTTCGGGGCAAAGTGTTCC	0.393																																					p.G79G		.											.	.	.	0			c.C237A						.						50.0	45.0	47.0					8																	75737721		2203	4300	6503	SO:0001819	synonymous_variant	51050	exon2			TCGGGGCAAAGTG	D45027	CCDS6218.1	8q13.3	2005-08-17	2005-08-17		ENSG00000137558	ENSG00000137558			8946	protein-coding gene	gene with protein product		607076	"""protease inhibitor 15"""			8882727, 9473672	Standard	XM_005251255		Approved	P25TI	uc003yal.3	O43692	OTTHUMG00000164528	ENST00000260113.2:c.237C>A	8.37:g.75737721C>A		Somatic	56	0		WXS	Illumina HiSeq	.	81	9	NM_015886	Q68CY1	Silent	SNP	ENST00000260113.2	37	CCDS6218.1																																																																																			.		0.393	PI15-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379115.1	NM_015886	
SELENBP1	8991	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	151339353	151339353	+	Missense_Mutation	SNP	G	G	A			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr1:151339353G>A	ENST00000368868.5	-	6	600	c.509C>T	c.(508-510)aCg>aTg	p.T170M	SELENBP1_ENST00000447402.3_Missense_Mutation_p.T108M|SELENBP1_ENST00000435071.1_Missense_Mutation_p.T106M|SELENBP1_ENST00000426705.2_Missense_Mutation_p.T212M|SELENBP1_ENST00000473693.1_5'Flank	NM_003944.3	NP_003935.2	Q13228	SBP1_HUMAN	selenium binding protein 1	170					protein transport (GO:0015031)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	selenium binding (GO:0008430)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(11)|prostate(1)|urinary_tract(1)	20	Lung SC(34;0.00471)|Ovarian(49;0.00871)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			CACCTCGAACGTCTCCCCATC	0.587																																					p.T212M		.											.	.	.	0			c.C635T						.						170.0	148.0	156.0					1																	151339353		2203	4300	6503	SO:0001583	missense	8991	exon6			TCGAACGTCTCCC	U29091	CCDS995.1, CCDS58027.1, CCDS60266.1	1q21.3	2014-05-19			ENSG00000143416	ENSG00000143416			10719	protein-coding gene	gene with protein product		604188				9027582	Standard	NM_003944		Approved	hSP56, hSBP, LPSB	uc010pcy.3	Q13228	OTTHUMG00000012498	ENST00000368868.5:c.509C>T	1.37:g.151339353G>A	ENSP00000357861:p.Thr170Met	Somatic	45	0		WXS	Illumina HiSeq	.	49	4	NM_001258289	A6NML9|A6PVW9|B2RDR3|B4DKP6|B4E1F3|Q49AQ8|Q96GX7	Missense_Mutation	SNP	ENST00000368868.5	37	CCDS995.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.74|17.74	3.464447|3.464447	0.63513|0.63513	.|.	.|.	ENSG00000143416|ENSG00000143416	ENST00000424475|ENST00000368868;ENST00000447402;ENST00000435071;ENST00000458566;ENST00000426705	.|T;T;T;T;T	.|0.36699	.|1.24;1.24;1.24;2.29;2.29	5.32|5.32	5.32|5.32	0.75619|0.75619	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.64627|0.64627	0.2615|0.2615	M|M	0.91920|0.91920	3.255|3.255	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D;D;D	.|0.91635	.|0.999;0.993;0.993;0.989;0.988;0.972;0.992	T|T	0.73069|0.73069	-0.4099|-0.4099	5|10	.|0.87932	.|D	.|0	-6.3685|-6.3685	17.9421|17.9421	0.89028|0.89028	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|108;212;130;154;23;106;170	.|B4E1F3;A6PVW9;A6PVW8;A6PVX1;B4DPI7;Q13228-2;Q13228	.|.;.;.;.;.;.;SBP1_HUMAN	C|M	131|170;108;106;154;212	.|ENSP00000357861:T170M;ENSP00000413960:T108M;ENSP00000408263:T106M;ENSP00000406222:T154M;ENSP00000397261:T212M	.|ENSP00000357861:T170M	R|T	-|-	1|2	0|0	SELENBP1|SELENBP1	149605977|149605977	1.000000|1.000000	0.71417|0.71417	0.958000|0.958000	0.39756|0.39756	0.336000|0.336000	0.28762|0.28762	5.313000|5.313000	0.65798|0.65798	2.644000|2.644000	0.89710|0.89710	0.561000|0.561000	0.74099|0.74099	CGT|ACG	.		0.587	SELENBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034904.4		
BRCA2	675	hgsc.bcm.edu	37	13	32913479	32913479	+	Missense_Mutation	SNP	G	G	A	rs397507753|rs587781763		TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr13:32913479G>A	ENST00000380152.3	+	11	5220	c.4987G>A	c.(4987-4989)Gtc>Atc	p.V1663I	BRCA2_ENST00000544455.1_Missense_Mutation_p.V1663I			P51587	BRCA2_HUMAN	breast cancer 2, early onset	1663	Interaction with POLH.				brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		CCCTTATTCAGTCATTGAAAA	0.323			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											p.V1663I	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	.	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	.	.	.	0			c.G4987A	GRCh37	CD014646	BRCA2	D		.						33.0	35.0	34.0					13																	32913479		2197	4285	6482	SO:0001583	missense	675	exon11	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	TATTCAGTCATTG	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.4987G>A	13.37:g.32913479G>A	ENSP00000369497:p.Val1663Ile	Somatic	50	0		WXS	Illumina HiSeq	.	78	4	NM_000059	O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	ENST00000380152.3	37	CCDS9344.1	.	.	.	.	.	.	.	.	.	.	G	8.592	0.884871	0.17540	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	T;T	0.00737	5.76;5.76	5.96	2.04	0.26737	.	1.179790	0.05954	N	0.639459	T	0.00936	0.0031	L	0.38175	1.15	0.09310	N	1	B	0.21821	0.061	B	0.12837	0.008	T	0.48790	-0.9004	10	0.34782	T	0.22	.	7.381	0.26856	0.3318:0.1258:0.5423:0.0	.	1663	P51587	BRCA2_HUMAN	I	1663	ENSP00000369497:V1663I;ENSP00000439902:V1663I	ENSP00000369497:V1663I	V	+	1	0	BRCA2	31811479	0.000000	0.05858	0.002000	0.10522	0.338000	0.28826	0.265000	0.18515	0.412000	0.25729	0.655000	0.94253	GTC	.		0.323	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059	
PYGB	5834	hgsc.bcm.edu	37	20	25269107	25269107	+	Missense_Mutation	SNP	G	G	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr20:25269107G>T	ENST00000216962.4	+	15	1925	c.1815G>T	c.(1813-1815)atG>atT	p.M605I		NM_002862.3	NP_002853.2	P11216	PYGB_HUMAN	phosphorylase, glycogen; brain	605					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	glycogen phosphorylase activity (GO:0008184)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	31						GGACTGTTATGATTGGGGGCA	0.597																																					p.M605I		.											PYGB,NS,carcinoma,0,1	PYGB	0	0			c.G1815T						.						149.0	141.0	144.0					20																	25269107		2203	4300	6503	SO:0001583	missense	5834	exon15			TGTTATGATTGGG		CCDS13171.1	20p11.21	2013-03-01			ENSG00000100994	ENSG00000100994	2.4.1.1	"""Glycogen phosphorylases"""	9723	protein-coding gene	gene with protein product	"""glycogen phosphorylase, brain form"""	138550					Standard	NM_002862		Approved		uc002wup.3	P11216	OTTHUMG00000032117	ENST00000216962.4:c.1815G>T	20.37:g.25269107G>T	ENSP00000216962:p.Met605Ile	Somatic	33	0		WXS	Illumina HiSeq	.	45	2	NM_002862	Q96AK1|Q9NPX8	Missense_Mutation	SNP	ENST00000216962.4	37	CCDS13171.1	.	.	.	.	.	.	.	.	.	.	G	3.990	-0.004719	0.07773	.	.	ENSG00000100994	ENST00000216962	D	0.90197	-2.63	4.14	3.19	0.36642	.	0.035568	0.85682	N	0.000000	T	0.71126	0.3303	N	0.01493	-0.835	0.80722	D	1	B	0.06786	0.001	B	0.09377	0.004	T	0.67284	-0.5709	10	0.02654	T	1	-53.7915	11.8766	0.52550	0.0871:0.0:0.9129:0.0	.	605	P11216	PYGB_HUMAN	I	605	ENSP00000216962:M605I	ENSP00000216962:M605I	M	+	3	0	PYGB	25217107	1.000000	0.71417	0.995000	0.50966	0.990000	0.78478	4.372000	0.59530	1.097000	0.41459	0.563000	0.77884	ATG	.		0.597	PYGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078415.2	NM_002862	
SLC22A10	387775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	63057875	63057875	+	Missense_Mutation	SNP	G	G	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr11:63057875G>T	ENST00000332793.6	+	1	240	c.238G>T	c.(238-240)Gac>Tac	p.D80Y	SLC22A10_ENST00000526800.1_Missense_Mutation_p.D28Y|SLC22A10_ENST00000525620.1_Intron|SLC22A10_ENST00000535888.1_Intron|SLC22A10_ENST00000544661.1_5'UTR	NM_001039752.3	NP_001034841.3	Q63ZE4	S22AA_HUMAN	solute carrier family 22, member 10	80						integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28					Conjugated Estrogens(DB00286)|Probenecid(DB01032)|Salicylic acid(DB00936)	TATCCCACTAGACTCAAATCT	0.493																																					p.D80Y		.											.	.	.	0			c.G238T						.						111.0	115.0	114.0					11																	63057875		2201	4298	6499	SO:0001583	missense	387775	exon1			CCACTAGACTCAA	AP003420	CCDS41661.1	11q12.3	2013-05-22	2008-01-11		ENSG00000184999	ENSG00000184999		"""Solute carriers"""	18057	protein-coding gene	gene with protein product		607580	"""solute carrier family 22 (organic anion/cation transporter), member 10"""			11327718	Standard	NM_001039752		Approved	OAT5, hOAT5	uc009yor.3	Q63ZE4	OTTHUMG00000165197	ENST00000332793.6:c.238G>T	11.37:g.63057875G>T	ENSP00000327569:p.Asp80Tyr	Somatic	48	0		WXS	Illumina HiSeq	.	78	8	NM_001039752	Q68CJ0	Missense_Mutation	SNP	ENST00000332793.6	37	CCDS41661.1	.	.	.	.	.	.	.	.	.	.	G	11.74	1.728369	0.30593	.	.	ENSG00000184999	ENST00000332793;ENST00000526800	T;T	0.70164	1.09;-0.46	2.89	2.89	0.33648	.	0.069273	0.56097	U	0.000032	D	0.85124	0.5625	H	0.96269	3.795	0.80722	D	1	P;D	0.89917	0.845;1.0	P;D	0.85130	0.619;0.997	D	0.87462	0.2408	10	0.87932	D	0	.	9.5401	0.39246	0.0:0.0:1.0:0.0	.	28;80	E9PJB1;Q63ZE4	.;S22AA_HUMAN	Y	80;28	ENSP00000327569:D80Y;ENSP00000433908:D28Y	ENSP00000327569:D80Y	D	+	1	0	SLC22A10	62814451	1.000000	0.71417	0.095000	0.20976	0.175000	0.22909	3.037000	0.49775	1.662000	0.50781	0.579000	0.79373	GAC	.		0.493	SLC22A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382622.3	NM_001039752	
SHC4	399694	hgsc.bcm.edu;ucsc.edu	37	15	49254750	49254750	+	Missense_Mutation	SNP	C	C	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr15:49254750C>T	ENST00000332408.4	-	1	891	c.463G>A	c.(463-465)Gca>Aca	p.A155T		NM_203349.3	NP_976224.3	Q6S5L8	SHC4_HUMAN	SHC (Src homology 2 domain containing) family, member 4	155	CH2.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of cell proliferation (GO:0008284)|regulation of gene expression (GO:0010468)|stem cell differentiation (GO:0048863)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(2)|large_intestine(8)|lung(11)|ovary(3)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	29		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)		AGGGCGGTTGCCCTGTGTCCC	0.627																																					p.A155T		.											.	.	.	0			c.G463A						.						90.0	79.0	82.0					15																	49254750		2197	4295	6492	SO:0001583	missense	399694	exon1			CGGTTGCCCTGTG	AY358250	CCDS10130.1	15q21.1-q21.2	2013-02-14			ENSG00000185634	ENSG00000185634		"""SH2 domain containing"""	16743	protein-coding gene	gene with protein product	"""rai-like protein"""						Standard	NM_203349		Approved	RaLP	uc001zxb.1	Q6S5L8	OTTHUMG00000131513	ENST00000332408.4:c.463G>A	15.37:g.49254750C>T	ENSP00000329668:p.Ala155Thr	Somatic	43	0		WXS	Illumina HiSeq	.	42	4	NM_203349	Q6UXQ3|Q8IYW3	Missense_Mutation	SNP	ENST00000332408.4	37	CCDS10130.1	.	.	.	.	.	.	.	.	.	.	C	10.70	1.423418	0.25639	.	.	ENSG00000185634	ENST00000332408	T	0.05025	3.51	3.81	-1.82	0.07857	.	1.859030	0.02635	N	0.104762	T	0.03871	0.0109	N	0.08118	0	0.09310	N	0.999999	B	0.13145	0.007	B	0.10450	0.005	T	0.42137	-0.9469	10	0.18710	T	0.47	-17.1636	9.0225	0.36209	0.0:0.3721:0.4765:0.1514	.	155	Q6S5L8	SHC4_HUMAN	T	155	ENSP00000329668:A155T	ENSP00000329668:A155T	A	-	1	0	SHC4	47042042	0.000000	0.05858	0.005000	0.12908	0.057000	0.15508	0.378000	0.20569	-0.328000	0.08539	0.655000	0.94253	GCA	.		0.627	SHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254371.1	NM_203349	
ANKRD26P1	124149	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	16	46562259	46562259	+	IGR	SNP	C	C	G			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr16:46562259C>G								ANKRD26P1 (10396 upstream) : RNU6-845P (27741 downstream)																							TGTTGAAAAGCCTTTAGAATA	0.323																																					.		.											.	.	.	0			.						.																																			SO:0001628	intergenic_variant	124149	.			GAAAAGCCTTTAG																													16.37:g.46562259C>G		Somatic	95	0		WXS	Illumina HiSeq	.	122	13	.		RNA	SNP		37		.	.	.	.	.	.	.	.	.	.	C	2.837	-0.241228	0.05906	.	.	ENSG00000255675	ENST00000543951	.	.	.	2.29	-2.55	0.06288	.	.	.	.	.	T	0.10078	0.0247	.	.	.	0.28694	N	0.9044449999999999	.	.	.	.	.	.	T	0.30179	-0.9987	4	0.10902	T	0.67	.	0.2807	0.00244	0.2072:0.3031:0.2041:0.2857	.	.	.	.	S	266	.	ENSP00000441655:R266S	R	-	3	2	ANKRD26P1	45119760	0.001000	0.12720	0.004000	0.12327	0.409000	0.31022	-1.794000	0.01753	-0.648000	0.05437	0.205000	0.17691	AGG	.	0	0.323								
PIEZO2	63895	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	10797478	10797478	+	Missense_Mutation	SNP	T	T	A			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr18:10797478T>A	ENST00000503781.3	-	12	1420	c.1421A>T	c.(1420-1422)gAa>gTa	p.E474V	PIEZO2_ENST00000580640.1_Missense_Mutation_p.E474V|PIEZO2_ENST00000302079.6_Missense_Mutation_p.E474V	NM_022068.2	NP_071351.2	Q9H5I5	PIEZ2_HUMAN	piezo-type mechanosensitive ion channel component 2	474	Glu-rich.				cation transport (GO:0006812)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|regulation of membrane potential (GO:0042391)|response to mechanical stimulus (GO:0009612)	integral component of membrane (GO:0016021)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)										GCTCCTttcttcttcaaattc	0.353																																					p.E474V		.											.	.	.	0			c.A1421T						.						250.0	211.0	223.0					18																	10797478		692	1591	2283	SO:0001583	missense	63895	exon12			CTTTCTTCTTCAA	AK027056		18p11.21	2012-11-19	2011-08-31	2011-08-31	ENSG00000154864	ENSG00000154864			26270	protein-coding gene	gene with protein product		613629	"""chromosome 18 open reading frame 30"", ""chromosome 18 open reading frame 58"", ""family with sequence similarity 38, member B"""	FAM38B2, C18orf30, C18orf58, FAM38B		20813920, 21056836, 21299953	Standard	NM_022068		Approved	FLJ23403, FLJ23144, HsT748, HsT771, FLJ34907	uc002kos.2	Q9H5I5	OTTHUMG00000178507	ENST00000503781.3:c.1421A>T	18.37:g.10797478T>A	ENSP00000421377:p.Glu474Val	Somatic	85	0		WXS	Illumina HiSeq	.	104	10	NM_022068	B7Z812|M4GPJ9|Q6ZS91|Q8N787|Q8NAR6|Q9H5R4	Missense_Mutation	SNP	ENST00000503781.3	37		.	.	.	.	.	.	.	.	.	.	T	12.09	1.832501	0.32421	.	.	ENSG00000154864	ENST00000302079	T	0.74002	-0.8	5.31	4.16	0.48862	.	0.474876	0.24111	N	0.041457	T	0.65565	0.2703	N	0.24115	0.695	0.80722	D	1	.	.	.	.	.	.	T	0.60732	-0.7205	8	0.30854	T	0.27	-0.9962	10.2683	0.43468	0.0:0.0804:0.0:0.9196	.	.	.	.	V	474	ENSP00000303316:E474V	ENSP00000303316:E474V	E	-	2	0	FAM38B	10787478	1.000000	0.71417	0.993000	0.49108	0.793000	0.44817	1.312000	0.33574	0.972000	0.38314	0.528000	0.53228	GAA	.		0.353	PIEZO2-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000442385.4	NM_022068	
MT-ND6	4541	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	M	14384	14384	+	Missense_Mutation	SNP	G	G	A			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chrM:14384G>A	ENST00000361681.2	-	1	289	c.290C>T	c.(289-291)gCg>gTg	p.A97V	MT-TP_ENST00000387461.2_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA			P03923	NU6M_HUMAN	mitochondrially encoded NADH dehydrogenase 6	97					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain (GO:0070469)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(10)|kidney(17)|urinary_tract(1)	29						CTACCTCCATCGCTAACCCCA	0.468																																					p.A97V		.											.	.	.	0			c.C290T						.																																			SO:0001583	missense	0	exon1			TCCATCGCTAACC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198695	ENSG00000198695	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7462	protein-coding gene	gene with protein product	"""complex I ND6 subunit"", ""NADH-ubiquinone oxidoreductase chain 6"""	516006	"""NADH dehydrogenase 6"""	MTND6			Standard			Approved	NAD6, ND6		P03923		ENST00000361681.2:c.290C>T	M.37:g.14384G>A	ENSP00000354665:p.Ala97Val	Somatic	79	0		WXS	Illumina HiSeq	.	206	92	ENST00000361681	Q34774|Q8HG30	Missense_Mutation	SNP	ENST00000361681.2	37																																																																																				.		0.468	MT-ND6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024037	
THSD4	79875	hgsc.bcm.edu	37	15	71952877	71952877	+	Silent	SNP	C	C	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr15:71952877C>T	ENST00000355327.3	+	8	1295	c.1161C>T	c.(1159-1161)ggC>ggT	p.G387G	THSD4_ENST00000357769.4_Silent_p.G27G|THSD4_ENST00000261862.6_Silent_p.G387G|THSD4_ENST00000567838.1_3'UTR			Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4	387					elastic fiber assembly (GO:0048251)	extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)			breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						AGAGCATTGGCTGTGATGACT	0.478																																					p.G387G		.											.	.	.	0			c.C1161T						.						177.0	175.0	175.0					15																	71952877		1957	4168	6125	SO:0001819	synonymous_variant	79875	exon7			CATTGGCTGTGAT	AK023772	CCDS10238.2, CCDS66817.1	15q23	2009-11-09			ENSG00000187720	ENSG00000187720			25835	protein-coding gene	gene with protein product		614476				19734141	Standard	NM_001286429		Approved	FVSY9334, PRO34005, FLJ13710, ADAMTSL6	uc002atb.1	Q6ZMP0	OTTHUMG00000133389	ENST00000355327.3:c.1161C>T	15.37:g.71952877C>T		Somatic	44	0		WXS	Illumina HiSeq	.	73	3	NM_024817	B2RTY3|B4DR13|Q6MZI3|Q6UXZ8|Q9H8E4	Silent	SNP	ENST00000355327.3	37	CCDS10238.2																																																																																			.		0.478	THSD4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257253.2	NM_024817	
TM6SF2	53345	hgsc.bcm.edu	37	19	19377337	19377337	+	Missense_Mutation	SNP	G	G	A			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr19:19377337G>A	ENST00000389363.4	-	9	958	c.886C>T	c.(886-888)Cca>Tca	p.P296S	AC138430.4_ENST00000586064.2_RNA|TM6SF2_ENST00000586107.1_5'Flank	NM_001001524.2	NP_001001524.2	Q9BZW4	TM6S2_HUMAN	transmembrane 6 superfamily member 2	296						integral component of membrane (GO:0016021)		p.P296S(1)		breast(2)|kidney(1)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	14			Epithelial(12;0.0151)			GCCCAGTCTGGAAGCCAGGAG	0.577																																					p.P296S		.											TM6SF2,NS,carcinoma,0,1	TM6SF2	0	1	Substitution - Missense(1)	lung(1)	c.C886T						.						71.0	83.0	79.0					19																	19377337		2129	4248	6377	SO:0001583	missense	53345	exon9			AGTCTGGAAGCCA	AF255923	CCDS42528.1	19p13.3-p12	2008-02-05							11861	protein-coding gene	gene with protein product		606563				11124529	Standard	NM_001001524		Approved	Lpr4	uc002nmd.1	Q9BZW4		ENST00000389363.4:c.886C>T	19.37:g.19377337G>A	ENSP00000374014:p.Pro296Ser	Somatic	33	0		WXS	Illumina HiSeq	.	63	2	NM_001001524	Q0IJ64	Missense_Mutation	SNP	ENST00000389363.4	37	CCDS42528.1	.	.	.	.	.	.	.	.	.	.	G	13.72	2.319891	0.41096	.	.	ENSG00000213996	ENST00000389363;ENST00000269990	T	0.22945	1.93	5.34	5.34	0.76211	.	0.172029	0.27262	U	0.020173	T	0.39759	0.1090	M	0.72894	2.215	0.33789	D	0.625256	D	0.52996	0.957	P	0.54431	0.752	T	0.52808	-0.8526	10	0.31617	T	0.26	-15.0799	11.1392	0.48392	0.0857:0.0:0.9143:0.0	.	296	Q9BZW4	TM6S2_HUMAN	S	296	ENSP00000374014:P296S	ENSP00000269990:P296S	P	-	1	0	TM6SF2	19238337	1.000000	0.71417	0.990000	0.47175	0.825000	0.46686	2.568000	0.45965	2.505000	0.84491	0.561000	0.74099	CCA	.		0.577	TM6SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460122.2	NM_203510	
ZNF569	148266	hgsc.bcm.edu	37	19	37905042	37905042	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr19:37905042G>T	ENST00000316950.6	-	6	1075	c.518C>A	c.(517-519)tCa>tAa	p.S173*	ZNF569_ENST00000392149.2_Nonsense_Mutation_p.S173*|ZNF569_ENST00000392150.2_Nonsense_Mutation_p.S14*	NM_152484.2	NP_689697.2	Q5MCW4	ZN569_HUMAN	zinc finger protein 569	173					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|endometrium(4)|large_intestine(16)|lung(11)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ATTACCATATGATTTCACAGG	0.348																																					p.S173X		.											.	.	.	0			c.C518A						.						83.0	81.0	82.0					19																	37905042		2203	4300	6503	SO:0001587	stop_gained	148266	exon6			CCATATGATTTCA	AL833408	CCDS12503.1	19q13.12	2013-09-20			ENSG00000196437	ENSG00000196437		"""Zinc fingers, C2H2-type"", ""-"""	24737	protein-coding gene	gene with protein product		613904				12477932	Standard	NM_152484		Approved	FLJ32053, ZAP1	uc002ogi.3	Q5MCW4	OTTHUMG00000048172	ENST00000316950.6:c.518C>A	19.37:g.37905042G>T	ENSP00000325018:p.Ser173*	Somatic	46	0		WXS	Illumina HiSeq	.	74	4	NM_152484	A8K1S2|Q15925|Q17RR6|Q96MQ2	Nonsense_Mutation	SNP	ENST00000316950.6	37	CCDS12503.1	.	.	.	.	.	.	.	.	.	.	G	36	5.878724	0.97055	.	.	ENSG00000196437	ENST00000316950;ENST00000392150	.	.	.	3.0	1.96	0.26148	.	0.563638	0.13488	N	0.384166	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.12103	T	0.63	.	9.6688	0.40000	0.1132:0.0:0.8868:0.0	.	.	.	.	X	173;14	.	ENSP00000325018:S173X	S	-	2	0	ZNF569	42596882	0.040000	0.19996	0.076000	0.20297	0.392000	0.30506	1.479000	0.35453	0.838000	0.34948	-0.229000	0.12294	TCA	.		0.348	ZNF569-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109594.2	NM_152484	
KIAA2026	158358	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	6007401	6007401	+	Silent	SNP	G	G	A			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr9:6007401G>A	ENST00000399933.3	-	1	386	c.387C>T	c.(385-387)ttC>ttT	p.F129F	KIAA2026_ENST00000381461.2_Silent_p.F129F|MIR4665_ENST00000581132.1_RNA	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	129										breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		GCTGCTGCGGGAAGGCGCGAC	0.711																																					p.F129F		.											.	.	.	0			c.C387T						.						15.0	18.0	17.0					9																	6007401		1889	4084	5973	SO:0001819	synonymous_variant	158358	exon1			CTGCGGGAAGGCG	AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.387C>T	9.37:g.6007401G>A		Somatic	26	0		WXS	Illumina HiSeq	.	37	9	NM_001017969	A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Silent	SNP	ENST00000399933.3	37																																																																																				.		0.711	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051652.2	NM_001017969	
TTN	7273	hgsc.bcm.edu;broad.mit.edu	37	2	179454980	179454980	+	Missense_Mutation	SNP	C	C	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr2:179454980C>T	ENST00000591111.1	-	254	56773	c.56549G>A	c.(56548-56550)gGc>gAc	p.G18850D	TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.G11426D|TTN_ENST00000342992.6_Missense_Mutation_p.G17923D|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.G11551D|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.G11618D|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.G20491D|TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000591332.1_RNA			Q8WZ42	TITIN_HUMAN	titin	18850	Ig-like 107.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GATAGTTTGGCCTACTCTCAC	0.443																																					p.G20491D		.											.	.	.	0			c.G61472A						.						199.0	182.0	188.0					2																	179454980		1968	4145	6113	SO:0001583	missense	7273	exon304			GTTTGGCCTACTC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.56549G>A	2.37:g.179454980C>T	ENSP00000465570:p.Gly18850Asp	Somatic	58	0		WXS	Illumina HiSeq	.	87	4	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	13.53	2.264480	0.39995	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.80566	-1.39;-1.39;-1.39;-1.39	5.96	5.96	0.96718	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.91136	0.7209	M	0.84219	2.685	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.91296	0.5063	9	0.87932	D	0	.	20.3955	0.98984	0.0:1.0:0.0:0.0	.	11426;11551;11618;18850	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	D	17923;11426;11618;11551;11424	ENSP00000343764:G17923D;ENSP00000434586:G11426D;ENSP00000340554:G11618D;ENSP00000352154:G11551D	ENSP00000340554:G11618D	G	-	2	0	TTN	179163226	1.000000	0.71417	0.998000	0.56505	0.978000	0.69477	7.770000	0.85390	2.830000	0.97506	0.655000	0.94253	GGC	.		0.443	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
CCDC171	203238	hgsc.bcm.edu	37	9	15784546	15784546	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr9:15784546G>T	ENST00000380701.3	+	21	3449	c.3121G>T	c.(3121-3123)Gaa>Taa	p.E1041*	CCDC171_ENST00000297641.3_Nonsense_Mutation_p.E1041*	NM_173550.2	NP_775821.2	Q6TFL3	CC171_HUMAN	coiled-coil domain containing 171	1041								p.E1041*(1)									TGCATGTGAAGAACTAAATAA	0.368																																					p.E1041X		.											C9orf93,rectum,carcinoma,0,1	C9orf93	0	1	Substitution - Nonsense(1)	large_intestine(1)	c.G3121T						.						85.0	76.0	80.0					9																	15784546		2203	4300	6503	SO:0001587	stop_gained	203238	exon21			TGTGAAGAACTAA	AY422473	CCDS6481.1	9p22.2	2012-03-26	2012-03-26	2012-03-26	ENSG00000164989	ENSG00000164989			29828	protein-coding gene	gene with protein product	"""myosin tail domain containing protein"""		"""chromosome 9 open reading frame 93"""	C9orf93		14702039	Standard	NM_173550		Approved	FLJ39267, FLJ46740, Em:AL513423.1, bA778P13.1, bA536D16.1	uc003zmd.3	Q6TFL3	OTTHUMG00000019584	ENST00000380701.3:c.3121G>T	9.37:g.15784546G>T	ENSP00000370077:p.Glu1041*	Somatic	33	0		WXS	Illumina HiSeq	.	70	3	NM_173550	B7ZM22|Q5SU58|Q6P1W1|Q6ZR13|Q8N1Z4|Q8N8L3|Q8TBR2	Nonsense_Mutation	SNP	ENST00000380701.3	37	CCDS6481.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	46|46	12.105303|12.105303	0.99636|0.99636	.|.	.|.	ENSG00000164989|ENSG00000164989	ENST00000297641;ENST00000380689;ENST00000380701|ENST00000449575;ENST00000432954	.|.	.|.	.|.	5.04|5.04	5.04|5.04	0.67666|0.67666	.|.	0.050057|.	0.85682|.	D|.	0.000000|.	.|T	.|0.74581	.|0.3735	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.73760	.|-0.3881	.|4	0.42905|.	T|.	0.14|.	-6.7623|-6.7623	18.7422|18.7422	0.91777|0.91777	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|N	1041;308;1041|280;94	.|.	ENSP00000297641:E1041X|.	E|K	+|+	1|3	0|2	C9orf93|C9orf93	15774546|15774546	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.437000|7.437000	0.80417|0.80417	2.500000|2.500000	0.84329|0.84329	0.655000|0.655000	0.94253|0.94253	GAA|AAG	.		0.368	CCDC171-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051768.4	NM_173550	
CAND1	55832	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	67700164	67700164	+	Nonsense_Mutation	SNP	C	C	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr12:67700164C>T	ENST00000545606.1	+	10	3153	c.2716C>T	c.(2716-2718)Cag>Tag	p.Q906*		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	906					cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		ACCCAAAAGGCAGTATCTTTT	0.413																																					p.Q906X		.											.	.	.	0			c.C2716T						.						81.0	77.0	78.0					12																	67700164		2203	4300	6503	SO:0001587	stop_gained	55832	exon10			AAAAGGCAGTATC		CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.2716C>T	12.37:g.67700164C>T	ENSP00000442318:p.Gln906*	Somatic	61	0		WXS	Illumina HiSeq	.	78	13	NM_018448	B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Nonsense_Mutation	SNP	ENST00000545606.1	37	CCDS8977.1	.	.	.	.	.	.	.	.	.	.	C	41	8.759348	0.98943	.	.	ENSG00000111530	ENST00000545606;ENST00000299218;ENST00000544619	.	.	.	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-6.9177	19.7049	0.96069	0.0:1.0:0.0:0.0	.	.	.	.	X	906;906;446	.	.	Q	+	1	0	CAND1	65986431	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.757000	0.85209	2.655000	0.90218	0.591000	0.81541	CAG	.		0.413	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402105.1	NM_018448	
MUC5B	727897	hgsc.bcm.edu	37	11	1258387	1258387	+	Missense_Mutation	SNP	G	G	A	rs202160055		TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr11:1258387G>A	ENST00000529681.1	+	25	3348	c.3290G>A	c.(3289-3291)cGc>cAc	p.R1097H	MUC5B_ENST00000447027.1_Missense_Mutation_p.R1100H	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	1097	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GCCGCCTGCCGCTCCCAGGTG	0.682																																					p.R1097H		.											MUC5B,NS,carcinoma,+1,2	MUC5B	+1	0			c.G3290A						.						10.0	16.0	14.0					11																	1258387		1900	4086	5986	SO:0001583	missense	727897	exon25			CCTGCCGCTCCCA	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.3290G>A	11.37:g.1258387G>A	ENSP00000436812:p.Arg1097His	Somatic	17	2		WXS	Illumina HiSeq	.	34	4	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	G	6.941	0.543406	0.13250	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.72505	-0.66;-0.66	4.38	-0.728	0.11162	von Willebrand factor, type D domain (1);Uncharacterised domain, cysteine-rich (2);	.	.	.	.	T	0.30198	0.0757	N	0.00135	-2.02	0.26154	N	0.980103	B;B;B	0.24132	0.004;0.098;0.098	B;B;B	0.12837	0.001;0.008;0.008	T	0.37934	-0.9684	9	0.87932	D	0	.	8.5449	0.33415	0.6733:0.0:0.3267:0.0	rs35573593	1097;1790;1100	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	H	1097;1100;1098;1167	ENSP00000436812:R1097H;ENSP00000415793:R1100H	ENSP00000343037:R1098H	R	+	2	0	MUC5B	1214963	0.002000	0.14202	0.101000	0.21167	0.007000	0.05969	0.139000	0.16036	-0.476000	0.06842	-0.379000	0.06801	CGC	.		0.682	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
KIF9-AS1	285352	hgsc.bcm.edu	37	3	47263939	47263939	+	RNA	SNP	A	A	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr3:47263939A>T	ENST00000429315.3	+	0	329					NR_033373.1				KIF9 antisense RNA 1																		tttttttttaattttttgaga	0.408																																					.		.											.	.	.	0			.						.						114.0	117.0	116.0					3																	47263939		692	1591	2283			285352	.			TTTTTAATTTTTT			3p21.31	2012-11-19			ENSG00000227398	ENSG00000227398		"""Long non-coding RNAs"""	26822	non-coding RNA	RNA, long non-coding							Standard	NR_033373		Approved	FLJ39534	uc003cqw.2		OTTHUMG00000156533		3.37:g.47263939A>T		Somatic	24	0		WXS	Illumina HiSeq	.	51	4	.		RNA	SNP	ENST00000429315.3	37																																																																																				.		0.408	KIF9-AS1-001	KNOWN	basic	antisense	antisense	OTTHUMT00000344527.3		
ZNRF3	84133	hgsc.bcm.edu	37	22	29445659	29445659	+	Missense_Mutation	SNP	G	G	A			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr22:29445659G>A	ENST00000544604.2	+	8	1665	c.1490G>A	c.(1489-1491)cGt>cAt	p.R497H	ZNRF3_ENST00000406323.3_Missense_Mutation_p.R397H|ZNRF3_ENST00000402174.1_Missense_Mutation_p.R397H|ZNRF3_ENST00000332811.4_Missense_Mutation_p.R397H	NM_001206998.1	NP_001193927.1	Q9ULT6	ZNRF3_HUMAN	zinc and ring finger 3	497					canonical Wnt signaling pathway (GO:0060070)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|protein ubiquitination (GO:0016567)|stem cell proliferation (GO:0072089)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	integral component of plasma membrane (GO:0005887)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(4)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	28						GGCCCGGCCCGTGCCTTTCCT	0.687																																					p.R497H		.											ZNRF3,NS,carcinoma,0,1	ZNRF3	0	0			c.G1490A						.						17.0	20.0	19.0					22																	29445659		2061	4177	6238	SO:0001583	missense	84133	exon8			CGGCCCGTGCCTT	AB051436	CCDS42999.1, CCDS56225.1	22q12.1	2013-01-09			ENSG00000183579	ENSG00000183579		"""RING-type (C3HC4) zinc fingers"""	18126	protein-coding gene	gene with protein product		612062				10574461	Standard	NM_032173		Approved	KIAA1133, BK747E2.3, FLJ22057, RNF203	uc003aeg.3	Q9ULT6	OTTHUMG00000151009	ENST00000544604.2:c.1490G>A	22.37:g.29445659G>A	ENSP00000443824:p.Arg497His	Somatic	7	0		WXS	Illumina HiSeq	.	15	2	NM_001206998	B3KU18|Q6ICH1|Q6NTF8|Q8WU18	Missense_Mutation	SNP	ENST00000544604.2	37	CCDS56225.1	.	.	.	.	.	.	.	.	.	.	G	7.629	0.678463	0.14841	.	.	ENSG00000183579	ENST00000544604;ENST00000332811;ENST00000462485;ENST00000402174;ENST00000406323	T;T;T;T	0.79454	-1.27;-1.27;-1.27;-1.27	5.53	4.52	0.55395	.	0.100028	0.64402	D	0.000003	T	0.68128	0.2967	L	0.43152	1.355	0.39596	D	0.969668	B	0.26744	0.158	B	0.19946	0.027	T	0.66826	-0.5825	10	0.45353	T	0.12	-1.8037	9.9362	0.41552	0.1543:0.0:0.8457:0.0	.	497	Q9ULT6	ZNRF3_HUMAN	H	497;397;204;397;397	ENSP00000443824:R497H;ENSP00000328614:R397H;ENSP00000384456:R397H;ENSP00000384553:R397H	ENSP00000328614:R397H	R	+	2	0	ZNRF3	27775659	1.000000	0.71417	0.777000	0.31699	0.007000	0.05969	3.454000	0.52986	1.336000	0.45506	-0.137000	0.14449	CGT	.		0.687	ZNRF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320943.2	XM_290972	
FAM193A	8603	hgsc.bcm.edu	37	4	2698298	2698298	+	Missense_Mutation	SNP	G	G	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr4:2698298G>T	ENST00000324666.5	+	16	2963	c.2612G>T	c.(2611-2613)cGa>cTa	p.R871L	FAM193A_ENST00000382839.3_Missense_Mutation_p.R871L|FAM193A_ENST00000502458.1_Missense_Mutation_p.R893L|FAM193A_ENST00000505311.1_Missense_Mutation_p.R871L|FAM193A_ENST00000545951.1_Missense_Mutation_p.R871L	NM_001256666.1	NP_001243595.1	P78312	F193A_HUMAN	family with sequence similarity 193, member A	871								p.R871Q(1)		NS(2)|breast(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(12)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	40						GCAGCGAAGCGAGCAAGGCAT	0.552																																					p.R893L		.											FAM193A,NS,carcinoma,0,1	FAM193A	0	1	Substitution - Missense(1)	lung(1)	c.G2678T						.						60.0	57.0	58.0					4																	2698298		2203	4300	6503	SO:0001583	missense	8603	exon17			CGAAGCGAGCAAG	AB000459	CCDS33943.1, CCDS58874.1, CCDS58875.1, CCDS58876.1	4p16.3	2009-09-04	2009-09-04	2009-09-04					16822	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 8"""	C4orf8		9734812	Standard	NR_046335		Approved	RES4-22	uc010ick.3	P78312		ENST00000324666.5:c.2612G>T	4.37:g.2698298G>T	ENSP00000324587:p.Arg871Leu	Somatic	42	0		WXS	Illumina HiSeq	.	41	2	NM_001256667	B7ZM85|B9EGR0|E9PFA1|O43607|P78311|P78313|Q9UEG8	Missense_Mutation	SNP	ENST00000324666.5	37	CCDS58875.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.107830	0.77096	.	.	ENSG00000125386	ENST00000382839;ENST00000324666;ENST00000545951;ENST00000502458;ENST00000513350	T;T;T;T;T	0.50277	0.78;1.18;0.76;0.78;0.75	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.69115	0.3075	M	0.71036	2.16	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.998;0.998;0.998;0.998;0.998	T	0.72357	-0.4318	10	0.72032	D	0.01	-16.0167	17.8501	0.88744	0.0:0.0:1.0:0.0	.	871;893;871;893;871	B9EGR0;E9PFA1;P78312;B7ZM85;P78312-2	.;.;F193A_HUMAN;.;.	L	871;871;871;893;725	ENSP00000372290:R871L;ENSP00000324587:R871L;ENSP00000443617:R871L;ENSP00000427505:R893L;ENSP00000427260:R725L	ENSP00000324587:R871L	R	+	2	0	FAM193A	2668096	1.000000	0.71417	0.937000	0.37676	0.263000	0.26337	9.644000	0.98468	2.464000	0.83262	0.603000	0.83216	CGA	.		0.552	FAM193A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360903.1	NM_003704	
CA10	56934	hgsc.bcm.edu;bcgsc.ca	37	17	49710967	49710967	+	Silent	SNP	G	G	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr17:49710967G>T	ENST00000285273.4	-	9	1945	c.834C>A	c.(832-834)atC>atA	p.I278I	CA10_ENST00000571918.1_5'Flank|CA10_ENST00000570565.1_Silent_p.I203I|CA10_ENST00000442502.2_Silent_p.I278I|CA10_ENST00000340813.6_Silent_p.I284I|CA10_ENST00000451037.2_Silent_p.I278I	NM_001082533.1	NP_001076002.1	Q9NS85	CAH10_HUMAN	carbonic anhydrase X	278					brain development (GO:0007420)					cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|skin(3)|stomach(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)		Zonisamide(DB00909)	TGCTCAGAAAGATCTGAGATG	0.512																																					p.I278I		.											CA10,NS,carcinoma,0,1	CA10	0	0			c.C834A						.						108.0	93.0	98.0					17																	49710967		2203	4300	6503	SO:0001819	synonymous_variant	56934	exon9			CAGAAAGATCTGA	AF288385	CCDS32684.1	17q21	2012-08-21			ENSG00000154975	ENSG00000154975		"""Carbonic anhydrases"""	1369	protein-coding gene	gene with protein product		604642				8673298, 9921901	Standard	NM_020178		Approved	CARPX, CA-RPX, HUCEP-15	uc002itx.4	Q9NS85	OTTHUMG00000177544	ENST00000285273.4:c.834C>A	17.37:g.49710967G>T		Somatic	42	0		WXS	Illumina HiSeq	.	60	4	NM_001082534	B2R7J0|B4DGL6	Silent	SNP	ENST00000285273.4	37	CCDS32684.1																																																																																			.		0.512	CA10-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000437480.1	NM_020178	
FGFRL1	53834	hgsc.bcm.edu;broad.mit.edu	37	4	1018129	1018129	+	Missense_Mutation	SNP	G	G	A			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr4:1018129G>A	ENST00000398484.2	+	7	1329	c.749G>A	c.(748-750)gGc>gAc	p.G250D	FGFRL1_ENST00000264748.6_Missense_Mutation_p.G250D|FGFRL1_ENST00000504138.1_Missense_Mutation_p.G250D|FGFRL1_ENST00000510644.1_Missense_Mutation_p.G250D			Q8N441	FGRL1_HUMAN	fibroblast growth factor receptor-like 1	250	Ig-like C2-type 3.				diaphragm development (GO:0060539)|heart valve morphogenesis (GO:0003179)|negative regulation of cell proliferation (GO:0008285)|skeletal system development (GO:0001501)|ventricular septum morphogenesis (GO:0060412)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)			endometrium(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	13			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GTGCTCACAGGCACGCACCCC	0.697																																					p.G250D		.											.	.	.	0			c.G749A						.						49.0	47.0	48.0					4																	1018129		2201	4276	6477	SO:0001583	missense	53834	exon6			TCACAGGCACGCA		CCDS3344.1	4p16	2013-01-11			ENSG00000127418	ENSG00000127418		"""Immunoglobulin superfamily / I-set domain containing"""	3693	protein-coding gene	gene with protein product		605830					Standard	NM_021923		Approved		uc003gcg.3	Q8N441	OTTHUMG00000118998	ENST00000398484.2:c.749G>A	4.37:g.1018129G>A	ENSP00000381498:p.Gly250Asp	Somatic	38	0		WXS	Illumina HiSeq	.	43	4	NM_001004356	B2RAU9|Q6PJN1|Q9BXN7|Q9H4D7	Missense_Mutation	SNP	ENST00000398484.2	37	CCDS3344.1	.	.	.	.	.	.	.	.	.	.	g	20.1	3.932480	0.73442	.	.	ENSG00000127418	ENST00000398484;ENST00000542622;ENST00000510644;ENST00000504138;ENST00000264748	T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16	5.24	5.24	0.73138	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.84696	0.5529	L	0.42245	1.32	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86244	0.1645	10	0.87932	D	0	-34.657	17.8483	0.88737	0.0:0.0:1.0:0.0	.	250	Q8N441	FGRL1_HUMAN	D	250;220;250;250;250	ENSP00000381498:G250D;ENSP00000425025:G250D;ENSP00000423091:G250D;ENSP00000264748:G250D	ENSP00000264748:G250D	G	+	2	0	FGFRL1	1008129	1.000000	0.71417	0.995000	0.50966	0.326000	0.28443	5.223000	0.65283	2.461000	0.83175	0.567000	0.79289	GGC	.		0.697	FGFRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239195.2	NM_021923	
AURKA	6790	hgsc.bcm.edu	37	20	54963211	54963211	+	Splice_Site	SNP	C	C	G			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr20:54963211C>G	ENST00000347343.2	-	2	310		c.e2+1		AURKA_ENST00000395915.3_Splice_Site|AURKA_ENST00000395911.1_Splice_Site|AURKA_ENST00000371356.2_Splice_Site|AURKA_ENST00000395914.1_Splice_Site|AURKA_ENST00000395909.4_Splice_Site|AURKA_ENST00000395907.1_Splice_Site|AURKA_ENST00000312783.6_Splice_Site|AURKA_ENST00000395913.3_Splice_Site	NM_003600.2	NP_003591.2	O14965	AURKA_HUMAN	aurora kinase A						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|anterior/posterior axis specification (GO:0009948)|centrosome localization (GO:0051642)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic centrosome separation (GO:0007100)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein binding (GO:0032091)|negative regulation of spindle checkpoint (GO:0090233)|neuron projection extension (GO:1990138)|positive regulation of mitosis (GO:0045840)|positive regulation of oocyte maturation (GO:1900195)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein autophosphorylation (GO:0046777)|protein localization to centrosome (GO:0071539)|protein phosphorylation (GO:0006468)|regulation of centrosome cycle (GO:0046605)|regulation of protein stability (GO:0031647)|spindle assembly involved in female meiosis I (GO:0007057)|spindle stabilization (GO:0043146)	axon hillock (GO:0043203)|centrosome (GO:0005813)|cytosol (GO:0005829)|germinal vesicle (GO:0042585)|meiotic spindle (GO:0072687)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole centrosome (GO:0031616)	ATP binding (GO:0005524)|histone serine kinase activity (GO:0035174)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)	p.?(1)		breast(2)|cervix(1)|endometrium(1)|large_intestine(4)|lung(9)|ovary(2)|prostate(1)|skin(2)	22			Colorectal(105;0.202)			ATTCAATTTACCTTAACAGGT	0.358																																					.	Melanoma(34;439 1292 51416 52695)|GBM(144;1525 2517 48902 51835)|Esophageal Squamous(191;569 2880 14195 30540)	.											AURKA,NS,carcinoma,0,1	AURKA	0	1	Unknown(1)	lung(1)	c.42+1G>C						.						110.0	116.0	114.0					20																	54963211		2203	4300	6503	SO:0001630	splice_region_variant	6790	exon4			AATTTACCTTAAC	BC001280	CCDS13451.1	20q13	2012-07-23	2003-07-21	2003-07-23	ENSG00000087586	ENSG00000087586		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	11393	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 47"", ""Aurora-A kinase"""	603072	"""serine/threonine kinase 15"", "" serine/threonine kinase 6"""	STK15, STK6		9174055, 9771714	Standard	NM_003600		Approved	BTAK, AurA, STK7, ARK1, PPP1R47, AIK	uc002xxi.1	O14965	OTTHUMG00000032796	ENST00000347343.2:c.42+1G>C	20.37:g.54963211C>G		Somatic	69	1		WXS	Illumina HiSeq	.	75	4	NM_198434	E1P5F9|O60445|O75873|Q9BQD6|Q9UPG5	Splice_Site	SNP	ENST00000347343.2	37	CCDS13451.1	.	.	.	.	.	.	.	.	.	.	C	15.47	2.843515	0.51057	.	.	ENSG00000087586	ENST00000395909;ENST00000395914;ENST00000347343;ENST00000395915;ENST00000312783;ENST00000371356;ENST00000395913;ENST00000395911;ENST00000395907;ENST00000441357;ENST00000420474;ENST00000422322;ENST00000456249;ENST00000451915	.	.	.	4.53	4.53	0.55603	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.6225	0.56612	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	AURKA	54396618	1.000000	0.71417	1.000000	0.80357	0.767000	0.43475	3.235000	0.51328	2.329000	0.79093	0.585000	0.79938	.	.		0.358	AURKA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079804.3	NM_003600	Intron
SPEG	10290	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	220329177	220329177	+	Missense_Mutation	SNP	C	C	T	rs539214212		TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr2:220329177C>T	ENST00000312358.7	+	9	2860	c.2728C>T	c.(2728-2730)Cgc>Tgc	p.R910C	SPEG_ENST00000396688.1_Missense_Mutation_p.R61C|SPEG_ENST00000396689.2_Missense_Mutation_p.R61C|SPEG_ENST00000485813.1_3'UTR|SPEG_ENST00000396698.1_Missense_Mutation_p.R806C|SPEG_ENST00000396695.2_Missense_Mutation_p.R118C|SPEG_ENST00000396686.1_Missense_Mutation_p.R61C	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	910	Ig-like 3.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		CCAGCCCGTGCGCCCAGACCA	0.657																																					p.R910C		.											SPEG,NS,carcinoma,-1,1	SPEG	-1	0			c.C2728T						.						54.0	61.0	59.0					2																	220329177		2061	4197	6258	SO:0001583	missense	10290	exon9			CCCGTGCGCCCAG	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.2728C>T	2.37:g.220329177C>T	ENSP00000311684:p.Arg910Cys	Somatic	22	0		WXS	Illumina HiSeq	.	30	4	NM_005876	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	ENST00000312358.7	37	CCDS42824.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.592270	0.86953	.	.	ENSG00000072195	ENST00000312358;ENST00000265327;ENST00000396698;ENST00000396695;ENST00000396688;ENST00000396686;ENST00000396689	T;T;T;T;T;T	0.68903	-0.36;-0.36;-0.36;-0.36;-0.36;-0.36	5.1	5.1	0.69264	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.40640	N	0.001052	T	0.77685	0.4167	M	0.62209	1.925	0.52099	D	0.999948	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.973;0.931;0.994	T	0.79009	-0.1978	10	0.62326	D	0.03	.	11.3349	0.49498	0.2308:0.7692:0.0:0.0	.	910;118;806	Q15772;Q15772-3;B9ZVR7	SPEG_HUMAN;.;.	C	910;910;806;118;61;61;61	ENSP00000311684:R910C;ENSP00000379926:R806C;ENSP00000379923:R118C;ENSP00000379919:R61C;ENSP00000379917:R61C;ENSP00000379920:R61C	ENSP00000265327:R910C	R	+	1	0	SPEG	220037421	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	5.347000	0.65998	2.381000	0.81170	0.561000	0.74099	CGC	.		0.657	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876	
PTH2	113091	hgsc.bcm.edu	37	19	49926533	49926533	+	Missense_Mutation	SNP	G	G	C	rs200733272|rs371950649	byFrequency	TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr19:49926533G>C	ENST00000270631.1	-	1	165	c.64C>G	c.(64-66)Ctg>Gtg	p.L22V	CTD-3148I10.1_ENST00000576655.1_5'Flank	NM_178449.3	NP_848544.1	Q96A98	TIP39_HUMAN	parathyroid hormone 2	22					neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)		p.L22V(2)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(262;0.0015)|GBM - Glioblastoma multiforme(486;0.044)|Lung(386;0.0785)|LUSC - Lung squamous cell carcinoma(496;0.0836)		GGCACCACcagcagcagcagc	0.692													g|||	17	0.00339457	0.003	0.0043	5008	,	,		11369	0.004		0.002	False		,,,				2504	0.0041				p.L22V		.											PTH2,NS,carcinoma,0,9	PTH2	0	2	Substitution - Missense(2)	endometrium(2)	c.C64G						.		VAL/LEU	12,4376		0,12,2182	12.0	16.0	14.0		64	3.3	0.0	19		14	11,8561		0,11,4275	no	missense	PTH2	NM_178449.3	32	0,23,6457	CC,CG,GG		0.1283,0.2735,0.1775	possibly-damaging	22/101	49926533	23,12937	2194	4286	6480	SO:0001583	missense	113091	exon1			CCACCAGCAGCAG	AY037555	CCDS12763.1	19q13.33	2013-02-28				ENSG00000142538		"""Endogenous ligands"""	30828	protein-coding gene	gene with protein product	"""tuberoinfundibular 39 residues"""	608386				11861531	Standard	NM_178449		Approved	TIP39	uc002pnn.1	Q96A98		ENST00000270631.1:c.64C>G	19.37:g.49926533G>C	ENSP00000270631:p.Leu22Val	Somatic	53	0		WXS	Illumina HiSeq	.	93	4	NM_178449	Q96DJ4	Missense_Mutation	SNP	ENST00000270631.1	37	CCDS12763.1	.	.	.	.	.	.	.	.	.	.	g	6.292	0.421904	0.11928	0.002735	0.001283	ENSG00000142538	ENST00000270631	.	.	.	4.3	3.26	0.37387	.	0.489236	0.15528	U	0.257640	T	0.26521	0.0648	L	0.27053	0.805	0.09310	N	1	P	0.46142	0.873	B	0.39419	0.299	T	0.08066	-1.0740	9	0.87932	D	0	-7.2733	12.3672	0.55234	0.0:0.1717:0.8283:0.0	.	22	Q96A98	TIP39_HUMAN	V	22	.	ENSP00000270631:L22V	L	-	1	2	PTH2	54618345	0.088000	0.21588	0.012000	0.15200	0.011000	0.07611	-0.504000	0.06375	0.947000	0.37659	-0.370000	0.07254	CTG	.		0.692	PTH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465366.1	NM_178449	
DZIP3	9666	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	108361320	108361320	+	Missense_Mutation	SNP	C	C	G			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr3:108361320C>G	ENST00000361582.3	+	13	1330	c.1100C>G	c.(1099-1101)aCt>aGt	p.T367S	DZIP3_ENST00000463306.1_Missense_Mutation_p.T367S	NM_014648.3	NP_055463.1	Q86Y13	DZIP3_HUMAN	DAZ interacting zinc finger protein 3	367					protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(21)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	45						ATAACTGATACTGATATAAGA	0.244																																					p.T367S		.											.	.	.	0			c.C1100G						.						20.0	19.0	20.0					3																	108361320		2106	4122	6228	SO:0001583	missense	9666	exon13			CTGATACTGATAT	AF279370	CCDS2952.1	3q13.13	2013-05-22	2013-05-22		ENSG00000198919	ENSG00000198919		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30938	protein-coding gene	gene with protein product	"""human RNA-binding ubiquitin ligase of 138 kDa"", ""protein phosphatase 1, regulatory subunit 66"""	608672	"""DAZ interacting protein 3, zinc finger"""			9734811, 12538761	Standard	NM_014648		Approved	hRUL138, PPP1R66	uc003dxd.3	Q86Y13	OTTHUMG00000159232	ENST00000361582.3:c.1100C>G	3.37:g.108361320C>G	ENSP00000355028:p.Thr367Ser	Somatic	73	0		WXS	Illumina HiSeq	.	117	6	NM_014648	B3KN01|O75162|Q6P3R9|Q6PH82|Q86Y14|Q86Y15|Q86Y16|Q8IWI0|Q96RS9	Missense_Mutation	SNP	ENST00000361582.3	37	CCDS2952.1	.	.	.	.	.	.	.	.	.	.	C	11.16	1.555844	0.27827	.	.	ENSG00000198919	ENST00000361582;ENST00000479138;ENST00000463306	T;T;T	0.39592	1.07;1.07;1.07	4.93	3.0	0.34707	.	0.257891	0.28001	N	0.016989	T	0.21841	0.0526	N	0.12182	0.205	0.25656	N	0.986055	B;P	0.34864	0.001;0.473	B;B	0.24848	0.006;0.056	T	0.22591	-1.0212	10	0.87932	D	0	-14.1257	11.2103	0.48795	0.0:0.6407:0.3593:0.0	.	367;367	C9J9M8;Q86Y13	.;DZIP3_HUMAN	S	367	ENSP00000355028:T367S;ENSP00000418115:T367S;ENSP00000419981:T367S	ENSP00000355028:T367S	T	+	2	0	DZIP3	109844010	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.649000	0.24843	1.433000	0.47394	0.655000	0.94253	ACT	.		0.244	DZIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353968.1	NM_014648	
NLRP8	126205	hgsc.bcm.edu	37	19	56466176	56466176	+	Missense_Mutation	SNP	C	C	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr19:56466176C>T	ENST00000291971.3	+	3	823	c.752C>T	c.(751-753)aCg>aTg	p.T251M	NLRP8_ENST00000590542.1_Missense_Mutation_p.T251M	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	251	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)	p.T251M(1)		breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		GTGAACCAGACGACAGACCAG	0.512																																					p.T251M		.											NLRP8_ENST00000291971,bladder,carcinoma,0,1	NLRP8_ENST00000291971	0	1	Substitution - Missense(1)	urinary_tract(1)	c.C752T						.						145.0	138.0	141.0					19																	56466176		2203	4300	6503	SO:0001583	missense	126205	exon3			ACCAGACGACAGA	AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.752C>T	19.37:g.56466176C>T	ENSP00000291971:p.Thr251Met	Somatic	28	1		WXS	Illumina HiSeq	.	69	3	NM_176811	Q7RTR4	Missense_Mutation	SNP	ENST00000291971.3	37	CCDS12937.1	.	.	.	.	.	.	.	.	.	.	c	7.212	0.595529	0.13875	.	.	ENSG00000179709	ENST00000291971	T	0.23552	1.9	2.04	-4.08	0.03963	NACHT nucleoside triphosphatase (1);	.	.	.	.	T	0.09158	0.0226	N	0.05383	-0.06	0.09310	N	1	B;B	0.23540	0.087;0.064	B;B	0.24394	0.024;0.053	T	0.15321	-1.0441	9	0.25106	T	0.35	.	1.0658	0.01611	0.1357:0.261:0.2708:0.3325	.	251;251	Q86W28-2;Q86W28	.;NALP8_HUMAN	M	251	ENSP00000291971:T251M	ENSP00000291971:T251M	T	+	2	0	NLRP8	61157988	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.211000	0.09332	-2.972000	0.00286	-0.279000	0.10071	ACG	.		0.512	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457462.1	NM_176811	
PCDHB16	57717	hgsc.bcm.edu	37	5	140563836	140563836	+	Missense_Mutation	SNP	G	G	A	rs535302272	byFrequency	TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr5:140563836G>A	ENST00000361016.2	+	1	2857	c.1702G>A	c.(1702-1704)Ggc>Agc	p.G568S		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	568	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCTGCAGAACGGCTCCGCGCC	0.711													G|||	2	0.000399361	0.0008	0.0	5008	,	,		13663	0.0		0.0	False		,,,				2504	0.001				p.G568S		.											PCDHB16,NS,carcinoma,0,1	PCDHB16	0	0			c.G1702A						.						14.0	17.0	16.0					5																	140563836		1969	3923	5892	SO:0001583	missense	57717	exon1			CAGAACGGCTCCG	AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.1702G>A	5.37:g.140563836G>A	ENSP00000354293:p.Gly568Ser	Somatic	61	1		WXS	Illumina HiSeq	.	69	3	NM_020957	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	ENST00000361016.2	37	CCDS4251.1	.	.	.	.	.	.	.	.	.	.	g	12.66	2.005258	0.35415	.	.	ENSG00000196963	ENST00000361016	T	0.60797	0.16	4.12	2.28	0.28536	Cadherin (1);Cadherin-like (1);	1.832600	0.03875	N	0.276324	T	0.41719	0.1171	N	0.20807	0.61	0.09310	N	1	B	0.22003	0.063	B	0.17979	0.02	T	0.27123	-1.0083	10	0.45353	T	0.12	.	3.1416	0.06457	0.2646:0.0:0.4112:0.3242	.	568	Q9NRJ7	PCDBG_HUMAN	S	568	ENSP00000354293:G568S	ENSP00000354293:G568S	G	+	1	0	PCDHB16	140544020	0.000000	0.05858	0.984000	0.44739	0.978000	0.69477	0.941000	0.29005	0.212000	0.20703	0.479000	0.44913	GGC	.		0.711	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957	
PRG4	10216	hgsc.bcm.edu	37	1	186276262	186276262	+	Missense_Mutation	SNP	A	A	C	rs572823944|rs554943190	byFrequency	TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr1:186276262A>C	ENST00000445192.2	+	7	1456	c.1411A>C	c.(1411-1413)Acc>Ccc	p.T471P	PRG4_ENST00000367485.4_Missense_Mutation_p.T378P|PRG4_ENST00000367484.3_Intron|PRG4_ENST00000367483.4_Missense_Mutation_p.T430P|PRG4_ENST00000367486.3_Missense_Mutation_p.T428P	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	471	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						TGCACCCACCACCAAGGAGCC	0.652														9	0.00179712	0.0038	0.0	5008	,	,		9353	0.0		0.002	False		,,,				2504	0.002				p.T471P		.											.,1	.	259	0			c.A1411C						.						86.0	94.0	92.0					1																	186276262		2203	4298	6501	SO:0001583	missense	10216	exon7			CCCACCACCAAGG	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.1411A>C	1.37:g.186276262A>C	ENSP00000399679:p.Thr471Pro	Somatic	86	2		WXS	Illumina HiSeq	.	97	5	NM_005807	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Missense_Mutation	SNP	ENST00000445192.2	37	CCDS1369.1	.	.	.	.	.	.	.	.	.	.	-	4.705	0.131095	0.08981	.	.	ENSG00000116690	ENST00000367486;ENST00000367482;ENST00000367483;ENST00000367485;ENST00000445192	T;T;T;T	0.05925	3.37;3.49;3.38;3.47	2.65	-5.29	0.02747	.	0.892392	0.09179	N	0.837745	T	0.03783	0.0107	L	0.33189	0.99	0.21762	N	0.999557	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.0;0.001	T	0.42632	-0.9440	9	.	.	.	-0.0017	3.2687	0.06874	0.5477:0.2197:0.1343:0.0983	.	337;378;471;430	Q92954-4;Q92954-3;Q92954;Q92954-2	.;.;PRG4_HUMAN;.	P	428;337;430;378;471	ENSP00000356456:T428P;ENSP00000356453:T430P;ENSP00000356455:T378P;ENSP00000399679:T471P	.	T	+	1	0	PRG4	184542885	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.223000	0.17719	-1.906000	0.01089	0.092000	0.15492	ACC	.		0.652	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807	
PTPN4	5775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	120620118	120620118	+	Missense_Mutation	SNP	G	G	C			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr2:120620118G>C	ENST00000263708.2	+	3	916	c.145G>C	c.(145-147)Gat>Cat	p.D49H		NM_002830.3	NP_002821.1	P29074	PTN4_HUMAN	protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)	49	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)			endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|urinary_tract(1)	30					Alendronate(DB00630)	ACAGAAACATGATCAGGGGCA	0.348																																					p.D49H		.											.	.	.	0			c.G145C						.						129.0	119.0	123.0					2																	120620118		2203	4300	6503	SO:0001583	missense	5775	exon3			AAACATGATCAGG		CCDS2129.1	2q14.2	2011-06-09			ENSG00000088179	ENSG00000088179		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9656	protein-coding gene	gene with protein product		176878				1648233	Standard	NM_002830		Approved	PTPMEG	uc002tmf.2	P29074	OTTHUMG00000131436	ENST00000263708.2:c.145G>C	2.37:g.120620118G>C	ENSP00000263708:p.Asp49His	Somatic	56	0		WXS	Illumina HiSeq	.	70	9	NM_002830	B2RBV8|Q9UDA7	Missense_Mutation	SNP	ENST00000263708.2	37	CCDS2129.1	.	.	.	.	.	.	.	.	.	.	G	13.74	2.326223	0.41197	.	.	ENSG00000088179	ENST00000263708;ENST00000420482;ENST00000488279	T;T;T	0.77229	-1.08;-1.08;-1.08	5.28	5.28	0.74379	FERM, N-terminal (1);Band 4.1 domain (1);FERM domain (1);	0.205916	0.50627	D	0.000110	T	0.72391	0.3454	L	0.55834	1.745	0.80722	D	1	B	0.06786	0.001	B	0.12837	0.008	T	0.69150	-0.5221	10	0.48119	T	0.1	.	11.2127	0.48808	0.0859:0.0:0.9141:0.0	.	49	P29074	PTN4_HUMAN	H	49	ENSP00000263708:D49H;ENSP00000405763:D49H;ENSP00000438445:D49H	ENSP00000263708:D49H	D	+	1	0	PTPN4	120336588	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	5.557000	0.67313	2.465000	0.83290	0.561000	0.74099	GAT	.		0.348	PTPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254233.2		
GRB14	2888	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	165476280	165476280	+	Missense_Mutation	SNP	G	G	T	rs139841108		TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr2:165476280G>T	ENST00000263915.3	-	2	779	c.241C>A	c.(241-243)Cct>Act	p.P81T		NM_004490.2	NP_004481.2	Q14449	GRB14_HUMAN	growth factor receptor-bound protein 14	81					blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			breast(3)|endometrium(2)|large_intestine(6)|lung(10)|ovary(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32						TCAGGAAAAGGGTTTGGAATA	0.338																																					p.P81T		.											.	.	.	0			c.C241A						.						153.0	156.0	155.0					2																	165476280		2203	4300	6503	SO:0001583	missense	2888	exon2			GAAAAGGGTTTGG		CCDS2222.1	2q22-q24	2013-02-14			ENSG00000115290	ENSG00000115290		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4565	protein-coding gene	gene with protein product		601524				8812444	Standard	XM_005246477		Approved		uc002ucl.3	Q14449	OTTHUMG00000132135	ENST00000263915.3:c.241C>A	2.37:g.165476280G>T	ENSP00000263915:p.Pro81Thr	Somatic	81	0		WXS	Illumina HiSeq	.	70	17	NM_004490	B7Z7F9|Q7Z6I1	Missense_Mutation	SNP	ENST00000263915.3	37	CCDS2222.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.951395	0.73787	.	.	ENSG00000115290	ENST00000263915;ENST00000446413;ENST00000424693	T;T;T	0.70516	0.97;0.39;-0.49	5.45	5.45	0.79879	.	0.000000	0.64402	D	0.000011	D	0.82393	0.5027	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.83452	0.0049	10	0.62326	D	0.03	-5.523	17.0497	0.86515	0.0:0.0:1.0:0.0	.	81	Q14449	GRB14_HUMAN	T	81;36;23	ENSP00000263915:P81T;ENSP00000416786:P36T;ENSP00000401702:P23T	ENSP00000263915:P81T	P	-	1	0	GRB14	165184526	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.864000	0.69575	2.548000	0.85928	0.655000	0.94253	CCT	.		0.338	GRB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255180.2		
MUC21	394263	hgsc.bcm.edu	37	6	30954701	30954701	+	Missense_Mutation	SNP	G	G	A			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr6:30954701G>A	ENST00000376296.3	+	2	990	c.749G>A	c.(748-750)aGt>aAt	p.S250N	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	250	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						ACACCCTCCAGTGGGGCCGGC	0.642																																					p.S250N		.											.	.	.	0			c.G749A						.						135.0	139.0	138.0					6																	30954701		2203	4300	6503	SO:0001583	missense	394263	exon2			CCTCCAGTGGGGC	AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.749G>A	6.37:g.30954701G>A	ENSP00000365473:p.Ser250Asn	Somatic	71	0		WXS	Illumina HiSeq	.	72	4	NM_001010909	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Missense_Mutation	SNP	ENST00000376296.3	37	CCDS34388.1	.	.	.	.	.	.	.	.	.	.	G	11.45	1.643436	0.29246	.	.	ENSG00000204544	ENST00000376296	T	0.03242	4.0	4.3	-4.76	0.03229	.	.	.	.	.	T	0.00724	0.0024	N	0.24115	0.695	0.09310	N	1	B	0.29988	0.264	B	0.24701	0.055	T	0.44997	-0.9291	8	.	.	.	.	8.3658	0.32385	0.3257:0.5183:0.156:0.0	rs9262363;rs9262363	250	Q5SSG8	MUC21_HUMAN	N	250	ENSP00000365473:S250N	.	S	+	2	0	MUC21	31062680	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-2.496000	0.00970	-0.734000	0.04843	-0.326000	0.08463	AGT	.		0.642	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
TATDN3	128387	hgsc.bcm.edu	37	1	212988490	212988490	+	Missense_Mutation	SNP	C	C	A			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr1:212988490C>A	ENST00000366974.4	+	10	911	c.817C>A	c.(817-819)Cag>Aag	p.Q273K	TATDN3_ENST00000366973.4_Missense_Mutation_p.Q272K|TATDN3_ENST00000526641.1_Missense_Mutation_p.Q252K|TATDN3_ENST00000526997.1_3'UTR|TATDN3_ENST00000531963.1_3'UTR|TATDN3_ENST00000532324.1_Missense_Mutation_p.Q280K|TATDN3_ENST00000525569.1_3'UTR	NM_001042552.2|NM_001042553.2|NM_001146169.1|NM_001146171.1	NP_001036017.1|NP_001036018.1|NP_001139641.1|NP_001139643.1	Q17R31	TATD3_HUMAN	TatD DNase domain containing 3	273					DNA catabolic process (GO:0006308)	intracellular organelle (GO:0043229)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(6)	9				OV - Ovarian serous cystadenocarcinoma(81;0.00699)|all cancers(67;0.0118)|GBM - Glioblastoma multiforme(131;0.0801)|Epithelial(68;0.104)		ACACTTGCTCCAGAAATAGCT	0.393																																					p.Q280K		.											TATDN3,NS,malignant_melanoma,0,1	TATDN3	0	0			c.C838A						.						81.0	82.0	82.0					1																	212988490		2203	4300	6503	SO:0001583	missense	128387	exon10			TTGCTCCAGAAAT	AL832248	CCDS31019.1, CCDS41465.1, CCDS53475.1, CCDS53476.1, CCDS53477.1	1q32.3	2008-02-05			ENSG00000203705	ENSG00000203705			27010	protein-coding gene	gene with protein product							Standard	NM_001042552		Approved		uc001hjo.2	Q17R31	OTTHUMG00000036805	ENST00000366974.4:c.817C>A	1.37:g.212988490C>A	ENSP00000355941:p.Gln273Lys	Somatic	32	0		WXS	Illumina HiSeq	.	46	2	NM_001146171	A6NGS3|B7Z1C1|B7Z978|B7ZLQ6|E9PJE5|E9PNH3|G3V151|Q4G0L1	Missense_Mutation	SNP	ENST00000366974.4	37	CCDS31019.1	.	.	.	.	.	.	.	.	.	.	C	2.801	-0.249074	0.05867	.	.	ENSG00000203705	ENST00000532324;ENST00000366974;ENST00000526641;ENST00000366973	.	.	.	5.3	4.37	0.52481	.	0.845757	0.10921	N	0.619468	T	0.35653	0.0939	N	0.11201	0.11	0.35482	D	0.798282	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.06405	0.0;0.0;0.002;0.001;0.0	T	0.26815	-1.0092	9	0.25751	T	0.34	-16.0357	14.0278	0.64597	0.1526:0.8474:0.0:0.0	.	220;252;280;272;273	B7Z2Z9;E9PNH3;G3V151;Q17R31-2;Q17R31	.;.;.;.;TATD3_HUMAN	K	280;273;252;272	.	ENSP00000355940:Q272K	Q	+	1	0	TATDN3	211055113	0.001000	0.12720	0.172000	0.22920	0.566000	0.35808	1.019000	0.30014	1.193000	0.43086	0.563000	0.77884	CAG	.		0.393	TATDN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000089396.2	XM_375838	
SLC43A3	29015	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	57184113	57184113	+	Silent	SNP	T	T	C			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr11:57184113T>C	ENST00000395123.2	-	9	1006	c.702A>G	c.(700-702)gaA>gaG	p.E234E	SLC43A3_ENST00000533524.1_Silent_p.E247E|SLC43A3_ENST00000529554.1_Silent_p.E234E|SLC43A3_ENST00000352187.1_Silent_p.E234E|SLC43A3_ENST00000528098.1_5'UTR|SLC43A3_ENST00000395124.1_Silent_p.E234E	NM_001278201.1|NM_014096.2	NP_001265130.1|NP_054815.2	Q8NBI5	S43A3_HUMAN	solute carrier family 43, member 3	234					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(10)|lung(4)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	27						TTTCCTTCTCTTCCTTTGTGG	0.542																																					p.E234E		.											.	.	.	0			c.A702G						.						196.0	160.0	172.0					11																	57184113		2201	4296	6497	SO:0001819	synonymous_variant	29015	exon9			CTTCTCTTCCTTT	AL157431	CCDS7956.1, CCDS60784.1	11q11	2013-05-22			ENSG00000134802	ENSG00000134802		"""Solute carriers"""	17466	protein-coding gene	gene with protein product	"""likely ortholog of mouse embryonic epithelial gene 1"""					7531438, 11704567	Standard	NM_017611		Approved	SEEEG-1, Eeg1, DKFZp762A227, FOAP-13, PRO1659	uc001nki.3	Q8NBI5	OTTHUMG00000167113	ENST00000395123.2:c.702A>G	11.37:g.57184113T>C		Somatic	12	0		WXS	Illumina HiSeq	.	29	6	NM_017611	B4DNR8|E7EQD2|Q9NSS4	Silent	SNP	ENST00000395123.2	37	CCDS7956.1																																																																																			.		0.542	SLC43A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000393057.1	NM_017611	
DEFB126	81623	hgsc.bcm.edu	37	20	126314	126314	+	Missense_Mutation	SNP	C	C	G			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr20:126314C>G	ENST00000382398.3	+	2	577	c.317C>G	c.(316-318)cCc>cGc	p.P106R	DEFB126_ENST00000542572.1_3'UTR	NM_030931.3	NP_112193.1	Q9BYW3	DB126_HUMAN	defensin, beta 126	106					defense response to bacterium (GO:0042742)	cell surface (GO:0009986)|extracellular region (GO:0005576)|glycocalyx (GO:0030112)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(1)	4		all_cancers(10;7.65e-05)|Lung NSC(37;0.0417)|all_epithelial(17;0.0676)|all_lung(30;0.0713)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.122)			GCTCCTACCCCCGTTTCTCCC	0.458																																					p.P106R		.											DEFB126,NS,carcinoma,0,1	DEFB126	0	0			c.C317G						.						108.0	109.0	109.0					20																	126314		2203	4300	6503	SO:0001583	missense	81623	exon2			CTACCCCCGTTTC		CCDS12990.1	20p13	2010-03-30	2002-05-09	2002-05-10	ENSG00000125788	ENSG00000125788		"""Defensins, beta"""	15900	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 8"""	C20orf8		11854508	Standard	NM_030931		Approved	bA530N10.1, DEFB-26	uc002wcx.3	Q9BYW3	OTTHUMG00000031616	ENST00000382398.3:c.317C>G	20.37:g.126314C>G	ENSP00000371835:p.Pro106Arg	Somatic	19	0		WXS	Illumina HiSeq	.	35	2	NM_030931	Q562G3|Q9H1M5	Missense_Mutation	SNP	ENST00000382398.3	37	CCDS12990.1	.	.	.	.	.	.	.	.	.	.	C	5.857	0.342300	0.11069	.	.	ENSG00000125788	ENST00000382398	T	0.40225	1.04	1.54	0.534	0.17127	.	.	.	.	.	T	0.23370	0.0565	N	0.19112	0.55	0.09310	N	1	B	0.26195	0.144	B	0.13407	0.009	T	0.14980	-1.0453	9	0.44086	T	0.13	0.0422	5.6779	0.17759	0.0:0.655:0.345:0.0	.	106	Q9BYW3	DB126_HUMAN	R	106	ENSP00000371835:P106R	ENSP00000371835:P106R	P	+	2	0	DEFB126	74314	0.000000	0.05858	0.011000	0.14972	0.008000	0.06430	0.034000	0.13776	0.202000	0.20498	-0.264000	0.10439	CCC	.		0.458	DEFB126-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077428.2	NM_030931	
USP9X	8239	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	41088540	41088540	+	Nonsense_Mutation	SNP	C	C	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chrX:41088540C>T	ENST00000324545.8	+	42	7729	c.7096C>T	c.(7096-7098)Cga>Tga	p.R2366*	USP9X_ENST00000378308.2_Nonsense_Mutation_p.R2366*	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	2366					axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						TCCAGATGACCGAGATGGGCT	0.348																																					p.R2366X	Ovarian(172;1807 2695 35459 49286)	.											.	.	.	0			c.C7096T						.						34.0	29.0	31.0					X																	41088540		2058	4239	6297	SO:0001587	stop_gained	8239	exon42			GATGACCGAGATG	X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.7096C>T	X.37:g.41088540C>T	ENSP00000316357:p.Arg2366*	Somatic	58	0		WXS	Illumina HiSeq	.	79	17	NM_001039591	O75550|Q8WWT3|Q8WX12	Nonsense_Mutation	SNP	ENST00000324545.8	37	CCDS43930.1	.	.	.	.	.	.	.	.	.	.	C	52	18.645916	0.99908	.	.	ENSG00000124486	ENST00000378308;ENST00000324545	.	.	.	5.27	4.4	0.53042	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.8524	0.52419	0.4996:0.5003:0.0:0.0	.	.	.	.	X	2366	.	ENSP00000316357:R2366X	R	+	1	2	USP9X	40973484	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.237000	0.43061	1.070000	0.40811	0.600000	0.82982	CGA	.		0.348	USP9X-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056250.4	NM_004652	
LMOD2	442721	hgsc.bcm.edu	37	7	123303794	123303794	+	Nonsense_Mutation	SNP	C	C	T	rs375457267		TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr7:123303794C>T	ENST00000458573.2	+	3	1796	c.1639C>T	c.(1639-1641)Cga>Tga	p.R547*		NM_207163.1	NP_997046.1	Q6P5Q4	LMOD2_HUMAN	leiomodin 2 (cardiac)	547						cytoskeleton (GO:0005856)											AGAAGCCCTGCGATAAAAACA	0.348																																					p.R547X		.											.	.	.	0			c.C1639T						.	C	stop/ARG	1,3679		0,1,1839	106.0	101.0	102.0		1639	4.4	1.0	7		102	0,8186		0,0,4093	no	stop-gained	LMOD2	NM_207163.1		0,1,5932	TT,TC,CC		0.0,0.0272,0.0084		547/548	123303794	1,11865	1840	4093	5933	SO:0001587	stop_gained	442721	exon3			GCCCTGCGATAAA	AC006333	CCDS47693.1	7q31.32	2008-08-08			ENSG00000170807	ENSG00000170807			6648	protein-coding gene	gene with protein product		608006					Standard	NM_207163		Approved		uc003vky.2	Q6P5Q4	OTTHUMG00000157149	ENST00000458573.2:c.1639C>T	7.37:g.123303794C>T	ENSP00000411932:p.Arg547*	Somatic	36	0		WXS	Illumina HiSeq	.	90	4	NM_207163	A4D0W9|A4D0Y2|Q8WVJ8	Nonsense_Mutation	SNP	ENST00000458573.2	37	CCDS47693.1	.	.	.	.	.	.	.	.	.	.	C	36	5.780176	0.96929	2.72E-4	0.0	ENSG00000170807	ENST00000458573;ENST00000444702;ENST00000332074	.	.	.	5.27	4.37	0.52481	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	.	14.8072	0.69965	0.1496:0.8504:0.0:0.0	.	.	.	.	X	547;507;498	.	ENSP00000405123:R498X	R	+	1	2	LMOD2	123091030	1.000000	0.71417	0.995000	0.50966	0.715000	0.41141	4.133000	0.57983	1.143000	0.42306	0.655000	0.94253	CGA	.		0.348	LMOD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348525.1		
ESPNP	284729	broad.mit.edu	37	1	17018972	17018979	+	RNA	DEL	GGGCGGTG	GGGCGGTG	-	rs2610628|rs553531169|rs72126374|rs2773202	byFrequency	TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr1:17018972_17018979delGGGCGGTG	ENST00000492551.1	-	0	1938					NR_026567.1				espin pseudogene																		gcgggcgggcgggcggTGGCGGCGGCTG	0.75																																					.													.	.	.	0			.						.																																					0	.			GCGGGCGGGCGGT	AL035288		1p36.13	2013-05-22			ENSG00000268869	ENSG00000268869			23285	pseudogene	pseudogene						15286153	Standard	NR_026567		Approved		uc001azn.1		OTTHUMG00000000803		1.37:g.17018972_17018979delGGGCGGTG		Somatic	24	0		WXS	Illumina GAIIx	Phase_I	34	8	.		RNA	DEL	ENST00000492551.1	37																																																																																				.		0.750	ESPNP-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000326311.1		
COX20	116228	broad.mit.edu	37	1	245009651	245009651	+	IGR	DEL	A	A	-	rs564493595		TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr1:245009651delA	ENST00000411948.2	+	0	2631				HNRNPU-AS1_ENST00000489705.1_RNA|HNRNPU-AS1_ENST00000475997.1_RNA	NM_198076.4	NP_932342.1	Q5RI15	COX20_HUMAN	COX20 cytochrome C oxidase assembly factor							integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)											cgcctgtactaaaaaaaaaaa	0.507																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			TGTACTAAAAAAA	BC062419	CCDS31080.1	1q44	2013-05-24	2013-05-23	2012-02-24	ENSG00000203667	ENSG00000203667		"""Mitochondrial respiratory chain complex assembly factors"""	26970	protein-coding gene	gene with protein product		614698	"""family with sequence similarity 36, member A"", ""COX20 Cox2 chaperone homolog (S. cerevisiae)"""	FAM36A		22356826, 23125284	Standard	NM_198076		Approved	FLJ43269	uc001iar.3	Q5RI15	OTTHUMG00000040401		1.37:g.245009651delA		Somatic	5	0		WXS	Illumina GAIIx	Phase_I	9	4	.	Q8WV86	RNA	DEL	ENST00000411948.2	37	CCDS31080.1																																																																																			A|0.500;-|0.500		0.507	COX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097174.1	NM_198076	
RNF220	55182	broad.mit.edu	37	1	44877854	44877854	+	Missense_Mutation	SNP	G	G	A			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr1:44877854G>A	ENST00000355387.2	+	2	535	c.85G>A	c.(85-87)Gca>Aca	p.A29T	RNF220_ENST00000361799.2_Missense_Mutation_p.A29T|RNF220_ENST00000372247.2_Missense_Mutation_p.A29T			Q5VTB9	RN220_HUMAN	ring finger protein 220	29					protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(1)|large_intestine(3)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	29						GATGGTCCTGGCATCCACGGC	0.552																																					p.A29T													.	RNF220	56	0			c.G85A						.						117.0	95.0	103.0					1																	44877854		2203	4300	6503	SO:0001583	missense	55182	exon2			GTCCTGGCATCCA	AK056424	CCDS510.1	1p34.1	2008-06-13	2008-06-13	2008-06-13	ENSG00000187147	ENSG00000187147		"""RING-type (C3HC4) zinc fingers"""	25552	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 164"""	C1orf164		11042152	Standard	NM_018150		Approved	FLJ10597	uc001clv.1	Q5VTB9	OTTHUMG00000007697	ENST00000355387.2:c.85G>A	1.37:g.44877854G>A	ENSP00000347548:p.Ala29Thr	Somatic	25	0		WXS	Illumina GAIIx	Phase_I	33	3	NM_018150	B3KPJ3|B4DLZ9|E9PCS1|Q4KMX2|Q9NVP6	Missense_Mutation	SNP	ENST00000355387.2	37	CCDS510.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.783861	0.90282	.	.	ENSG00000187147	ENST00000355387;ENST00000361799;ENST00000453887;ENST00000372247	.	.	.	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	T	0.67785	0.2930	L	0.27053	0.805	0.80722	D	1	D	0.63880	0.993	D	0.70935	0.971	T	0.69416	-0.5151	9	0.87932	D	0	.	20.6086	0.99469	0.0:0.0:1.0:0.0	.	29	Q5VTB9	RN220_HUMAN	T	29	.	ENSP00000347548:A29T	A	+	1	0	RNF220	44650441	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.476000	0.97823	2.880000	0.98712	0.655000	0.94253	GCA	.		0.552	RNF220-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000020683.4	NM_018150	
OR2L2	26246	broad.mit.edu	37	1	248202088	248202088	+	Silent	SNP	C	C	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr1:248202088C>T	ENST00000366479.2	+	1	615	c.519C>T	c.(517-519)atC>atT	p.I173I	OR2L13_ENST00000366478.2_Intron	NM_001004686.2	NP_001004686.1	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L, member 2	173						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(28)|ovary(1)|skin(4)|urinary_tract(1)	42	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			CCAGAGCCATCAATCATTTTT	0.433																																					p.I173I													.	OR2L2	115	0			c.C519T						.						213.0	194.0	200.0					1																	248202088		2203	4300	6503	SO:0001819	synonymous_variant	26246	exon1			AGCCATCAATCAT	X64978	CCDS31103.1	1q44	2012-08-09			ENSG00000203663	ENSG00000203663		"""GPCR / Class A : Olfactory receptors"""	8266	protein-coding gene	gene with protein product				OR2L4P, OR2L12		1370859	Standard	NM_001004686		Approved	HTPCRH07, HSHTPCRH07	uc001idw.3	Q8NH16	OTTHUMG00000040214	ENST00000366479.2:c.519C>T	1.37:g.248202088C>T		Somatic	57	0		WXS	Illumina GAIIx	Phase_I	78	5	NM_001004686	Q2M3T5	Silent	SNP	ENST00000366479.2	37	CCDS31103.1																																																																																			.		0.433	OR2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096871.1	NM_001004686	
LINC00200	399706	broad.mit.edu	37	10	1206472	1206472	+	lincRNA	DEL	T	T	-			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr10:1206472delT	ENST00000425630.1	+	0	223					NR_015376.2				long intergenic non-protein coding RNA 200																		CAAGCCAGGATTTTTTTTTTT	0.448																																					.													.	.	.	0			.						.			87,212,2505		6,0,75,8,196,1117	41.0	37.0	38.0			-1.8	0.0	10	dbSNP_134	40	117,342,4127		16,1,84,19,303,1870	no	intergenic				22,1,159,27,499,2987	A1A1,A1A2,A1R,A2A2,A2R,RR		10.0087,10.6633,10.2571			1206472	204,554,6632	692	1591	2283			0	.			CCAGGATTTTTTT	AK097673		10p15.3	2012-10-12	2011-08-11	2011-08-11	ENSG00000229205	ENSG00000229205		"""Long non-coding RNAs"""	30974	non-coding RNA	RNA, long non-coding			"""chromosome 10 open reading frame 139"", ""non-protein coding RNA 200"""	C10orf139, NCRNA00200			Standard	NR_015376		Approved	FLJ40354	uc010qag.1		OTTHUMG00000017539		10.37:g.1206472delT		Somatic	9	0		WXS	Illumina GAIIx	Phase_I	12	4	.		RNA	DEL	ENST00000425630.1	37																																																																																				.		0.448	LINC00200-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000046417.2	NR_015376	
HSD17B7P2	158160	broad.mit.edu	37	10	38654432	38654432	+	RNA	SNP	A	A	G	rs2257765		TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr10:38654432A>G	ENST00000494540.1	+	0	599					NR_003086.1				hydroxysteroid (17-beta) dehydrogenase 7 pseudogene 2																		TCATCTCGCAATGCAAGGAAA	0.453																																					.													.	.	.	0			.						.																																					0	.			CTCGCAATGCAAG			10p11.1	2011-06-29			ENSG00000099251	ENSG00000099251			28120	pseudogene	pseudogene						10544267	Standard	NR_003086		Approved	HSD17B7, bA291L22.1	uc010qex.1		OTTHUMG00000017993		10.37:g.38654432A>G		Somatic	35	0		WXS	Illumina GAIIx	Phase_I	60	3	.		RNA	SNP	ENST00000494540.1	37																																																																																				A|1.000;|0.000		0.453	HSD17B7P2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000047631.2	NR_003086	
ATM	472	broad.mit.edu	37	11	108115752	108115752	+	Splice_Site	SNP	A	A	G			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr11:108115752A>G	ENST00000452508.2	+	8	1089	c.900A>G	c.(898-900)aaA>aaG	p.K300K	ATM_ENST00000278616.4_Splice_Site_p.K300K			Q13315	ATM_HUMAN	ATM serine/threonine kinase	300					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	CCCAAGAAAAAGGTATAAAGG	0.303			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											p.K300K			yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	.	ATM	1657	0			c.A900G						.						26.0	28.0	28.0					11																	108115752		2191	4292	6483	SO:0001630	splice_region_variant	472	exon7	Familial Cancer Database	AT, Louis-Bar syndrome	AGAAAAAGGTATA	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.901+1A>G	11.37:g.108115752A>G		Somatic	77	0		WXS	Illumina GAIIx	Phase_I	139	4	NM_000051	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Splice_Site	SNP	ENST00000452508.2	37	CCDS31669.1																																																																																			.		0.303	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	Silent
ANKK1	255239	broad.mit.edu	37	11	113270133	113270133	+	Missense_Mutation	SNP	T	T	A			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr11:113270133T>A	ENST00000303941.3	+	8	1536	c.1442T>A	c.(1441-1443)gTc>gAc	p.V481D		NM_178510.1	NP_848605.1	Q8NFD2	ANKK1_HUMAN	ankyrin repeat and kinase domain containing 1	481							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|stomach(1)	29		all_cancers(61;1.53e-11)|all_epithelial(67;3e-06)|Melanoma(852;4.04e-05)|all_hematologic(158;0.000315)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0461)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Prostate(24;0.194)		BRCA - Breast invasive adenocarcinoma(274;4.82e-06)|Epithelial(105;5.41e-05)|all cancers(92;0.000442)|OV - Ovarian serous cystadenocarcinoma(223;0.238)		CGGCTTCTGGTCTCCCGTCAG	0.607																																					p.V481D													.	ANKK1	83	0			c.T1442A						.						15.0	18.0	17.0					11																	113270133		2052	4193	6245	SO:0001583	missense	255239	exon8			TTCTGGTCTCCCG	AJ541797	CCDS44734.1	11q23.2	2013-01-10			ENSG00000170209	ENSG00000170209		"""Ankyrin repeat domain containing"""	21027	protein-coding gene	gene with protein product		608774				15146457	Standard	NM_178510		Approved	X-kinase	uc001pny.3	Q8NFD2	OTTHUMG00000167715	ENST00000303941.3:c.1442T>A	11.37:g.113270133T>A	ENSP00000306678:p.Val481Asp	Somatic	21	0		WXS	Illumina GAIIx	Phase_I	22	3	NM_178510		Missense_Mutation	SNP	ENST00000303941.3	37	CCDS44734.1	.	.	.	.	.	.	.	.	.	.	T	17.43	3.387334	0.61956	.	.	ENSG00000170209	ENST00000303941	T	0.19394	2.15	4.59	4.59	0.56863	Ankyrin repeat-containing domain (4);	0.245464	0.27802	N	0.017791	T	0.44477	0.1295	M	0.73372	2.23	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	T	0.45512	-0.9256	10	0.87932	D	0	-39.4532	13.3058	0.60351	0.0:0.0:0.0:1.0	.	481	Q8NFD2	ANKK1_HUMAN	D	481	ENSP00000306678:V481D	ENSP00000306678:V481D	V	+	2	0	ANKK1	112775343	0.999000	0.42202	1.000000	0.80357	0.571000	0.35966	3.257000	0.51500	1.941000	0.56285	0.377000	0.23210	GTC	.		0.607	ANKK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395830.1	NM_178510	
MUC2	4583	broad.mit.edu	37	11	1093232	1093232	+	Missense_Mutation	SNP	T	T	G			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr11:1093232T>G	ENST00000441003.2	+	30	5078	c.5051T>G	c.(5050-5052)gTg>gGg	p.V1684G	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Missense_Mutation_p.V1651G	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	accactacGGTGaccccaacc	0.627																																					p.V1684G													.	MUC2	614	0			c.T5051G						.						88.0	151.0	129.0					11																	1093232		1823	3303	5126	SO:0001583	missense	4583	exon30			CTACGGTGACCCC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5051T>G	11.37:g.1093232T>G	ENSP00000415183:p.Val1684Gly	Somatic	164	2		WXS	Illumina GAIIx	Phase_I	237	5	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	T	2.900	-0.227662	0.06022	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.08634	3.16;3.07	1.43	-0.485	0.12067	.	0.626184	0.11283	N	0.580104	T	0.04048	0.0113	.	.	.	0.09310	N	1	B	0.17465	0.022	B	0.08055	0.003	T	0.44697	-0.9311	9	0.23302	T	0.38	.	3.4815	0.07603	0.0:0.447:0.0:0.553	.	1684	E7EUV1	.	G	1684;1651	ENSP00000415183:V1684G;ENSP00000351956:V1651G	ENSP00000351956:V1651G	V	+	2	0	MUC2	1083232	0.000000	0.05858	0.001000	0.08648	0.050000	0.14768	-3.726000	0.00382	-0.038000	0.13624	0.155000	0.16302	GTG	.		0.627	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
CRTAM	56253	broad.mit.edu	37	11	122733141	122733141	+	Missense_Mutation	SNP	G	G	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr11:122733141G>T	ENST00000533709.1	+	1	131	c.25G>T	c.(25-27)Gta>Tta	p.V9L	CRTAM_ENST00000227348.4_Intron					cytotoxic and regulatory T cell molecule											breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|pancreas(1)|prostate(1)	19		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.28e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0308)		GCTCTCTATAGTAGCAGAATT	0.438																																					.													.	CRTAM	50	0			.						.						51.0	49.0	50.0					11																	122733141		2202	4299	6501	SO:0001583	missense	56253	.			TCTATAGTAGCAG	AF001622	CCDS8437.1	11q24.1	2013-01-11			ENSG00000109943	ENSG00000109943		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	24313	protein-coding gene	gene with protein product	"""class I MHC restricted T cell associated molecule"""	612597				10811014, 16300832	Standard	NM_019604		Approved	CD355	uc001pyj.3	O95727	OTTHUMG00000166026	ENST00000533709.1:c.25G>T	11.37:g.122733141G>T	ENSP00000433728:p.Val9Leu	Somatic	40	0		WXS	Illumina GAIIx	Phase_I	43	3	.		Missense_Mutation	SNP	ENST00000533709.1	37		.	.	.	.	.	.	.	.	.	.	G	21.3	4.132630	0.77662	.	.	ENSG00000109943	ENST00000533709	T	0.37058	1.22	4.2	2.15	0.27550	.	.	.	.	.	T	0.30386	0.0763	.	.	.	0.09310	N	1	P	0.45126	0.851	B	0.44224	0.444	T	0.17228	-1.0376	8	0.62326	D	0.03	.	4.2788	0.10822	0.1179:0.0:0.6551:0.227	.	9	O95727-2	.	L	9	ENSP00000433728:V9L	ENSP00000433728:V9L	V	+	1	0	CRTAM	122238351	0.934000	0.31675	0.036000	0.18154	0.930000	0.56654	1.480000	0.35464	1.129000	0.42072	0.655000	0.94253	GTA	.		0.438	CRTAM-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000387508.1	NM_019604	
RP11-713N11.5	0	broad.mit.edu	37	12	25168090	25168090	+	lincRNA	DEL	T	T	-	rs11352951		TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr12:25168090delT	ENST00000556060.1	+	0	137																											ACTGGTTTTGTTTTTTTTTTT	0.323																																					.													.	.	.	0			.						.																																					0	.			GTTTTGTTTTTTT																													12.37:g.25168090delT		Somatic	7	0		WXS	Illumina GAIIx	Phase_I	11	1	.		RNA	DEL	ENST00000556060.1	37																																																																																				.		0.323	RP11-713N11.5-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000410589.1		
OVOS2	144203	broad.mit.edu;bcgsc.ca	37	12	31266007	31266007	+	RNA	SNP	C	C	G			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr12:31266007C>G	ENST00000542490.1	-	0	836																				central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(25)|prostate(3)|stomach(3)|urinary_tract(1)	41						ACTGTCTGCTCGACCAAAAAC	0.398																																					.													.	.	.	0			.						.																																					0	.			TCTGCTCGACCAA																													12.37:g.31266007C>G		Somatic	199	0		WXS	Illumina GAIIx	Phase_I	263	19	.		RNA	SNP	ENST00000542490.1	37																																																																																				.		0.398	RP11-551L14.1-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000400342.1		
SAV1	60485	broad.mit.edu	37	14	51107521	51107521	+	Nonsense_Mutation	SNP	A	A	C			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr14:51107521A>C	ENST00000324679.4	-	4	1260	c.897T>G	c.(895-897)taT>taG	p.Y299*	RN7SL452P_ENST00000482923.2_RNA	NM_021818.3	NP_068590.1	Q9H4B6	SAV1_HUMAN	salvador family WW domain containing protein 1	299					hair follicle development (GO:0001942)|hippo signaling (GO:0035329)|intestinal epithelial cell differentiation (GO:0060575)|keratinocyte differentiation (GO:0030216)|lung epithelial cell differentiation (GO:0060487)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of epithelial cell proliferation (GO:0050680)|positive regulation of apoptotic process (GO:0043065)|regulation of stem cell maintenance (GO:2000036)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)				breast(1)|kidney(2)|lung(2)|prostate(1)	6	all_epithelial(31;0.000611)|Breast(41;0.0333)					CTGCAGTATGATATGGATTTG	0.448																																					p.Y299X													.	SAV1	18	0			c.T897G						.						196.0	182.0	187.0					14																	51107521		2203	4300	6503	SO:0001587	stop_gained	60485	exon4			AGTATGATATGGA	AK023071	CCDS9701.1	14q13-q23	2014-04-14	2014-04-14		ENSG00000151748	ENSG00000151748			17795	protein-coding gene	gene with protein product	"""WW domain-containing adaptor 45"""	607203	"""salvador homolog 1 (Drosophila)"""			12202036, 11027580	Standard	NM_021818		Approved	WW45, WWP4, salvador	uc001wyh.2	Q9H4B6	OTTHUMG00000140293	ENST00000324679.4:c.897T>G	14.37:g.51107521A>C	ENSP00000324729:p.Tyr299*	Somatic	73	0		WXS	Illumina GAIIx	Phase_I	80	3	NM_021818	A8K4B8|D3DSB6|Q6IA58|Q9H949|Q9HAK9	Nonsense_Mutation	SNP	ENST00000324679.4	37	CCDS9701.1	.	.	.	.	.	.	.	.	.	.	A	39	7.679269	0.98428	.	.	ENSG00000151748	ENST00000555720;ENST00000324679;ENST00000535862	.	.	.	5.79	-0.37	0.12530	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.0994	10.9068	0.47084	0.3829:0.0:0.6171:0.0	.	.	.	.	X	231;299;266	.	ENSP00000324729:Y299X	Y	-	3	2	SAV1	50177271	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	1.409000	0.34680	0.038000	0.15604	0.533000	0.62120	TAT	.		0.448	SAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276879.1		
SLC8A3	6547	broad.mit.edu	37	14	70634323	70634323	+	Missense_Mutation	SNP	T	T	G			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr14:70634323T>G	ENST00000381269.2	-	2	1570	c.817A>C	c.(817-819)Att>Ctt	p.I273L	SLC8A3_ENST00000357887.3_Missense_Mutation_p.I273L|SLC8A3_ENST00000534137.1_Missense_Mutation_p.I273L|SLC8A3_ENST00000356921.2_Missense_Mutation_p.I273L|SLC8A3_ENST00000528359.1_Missense_Mutation_p.I273L	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	273					blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		TCTATGATAATTCCTCGGTGT	0.478																																					p.I273L													.	SLC8A3	234	0			c.A817C						.						159.0	145.0	150.0					14																	70634323		2203	4300	6503	SO:0001583	missense	6547	exon2			TGATAATTCCTCG	AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.817A>C	14.37:g.70634323T>G	ENSP00000370669:p.Ile273Leu	Somatic	49	0		WXS	Illumina GAIIx	Phase_I	38	3	NM_183002	Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Missense_Mutation	SNP	ENST00000381269.2	37	CCDS35498.1	.	.	.	.	.	.	.	.	.	.	T	10.20	1.284253	0.23392	.	.	ENSG00000100678	ENST00000356921;ENST00000381269;ENST00000357887;ENST00000534137;ENST00000528359	T;T;T;T;T	0.35421	1.39;1.31;1.45;1.39;1.45	5.71	4.55	0.56014	.	0.117295	0.64402	D	0.000016	T	0.35770	0.0943	M	0.65975	2.015	0.44241	D	0.99708	B;B;B;B	0.16603	0.006;0.018;0.002;0.004	B;B;B;B	0.21360	0.034;0.031;0.015;0.015	T	0.11060	-1.0603	10	0.24483	T	0.36	.	10.9713	0.47441	0.0:0.0758:0.0:0.9242	.	273;273;273;273	P57103-2;P57103;Q96QG2;Q96QG1	.;NAC3_HUMAN;.;.	L	273	ENSP00000349392:I273L;ENSP00000370669:I273L;ENSP00000350560:I273L;ENSP00000436688:I273L;ENSP00000433531:I273L	ENSP00000349392:I273L	I	-	1	0	SLC8A3	69704076	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.833000	0.55790	0.968000	0.38212	0.459000	0.35465	ATT	.		0.478	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390736.1		
MYO9A	4649	broad.mit.edu	37	15	72190344	72190344	+	Missense_Mutation	SNP	C	C	G			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr15:72190344C>G	ENST00000356056.5	-	25	4972	c.4500G>C	c.(4498-4500)agG>agC	p.R1500S	MYO9A_ENST00000444904.1_Missense_Mutation_p.R1481S|MYO9A_ENST00000566885.1_Missense_Mutation_p.R1120S|MYO9A_ENST00000563542.1_5'UTR|MYO9A_ENST00000424560.1_Missense_Mutation_p.R1500S|MYO9A_ENST00000564571.1_Missense_Mutation_p.R1500S	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	1500	Tail.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						ACTGTTTTTGCCTTTCTTCCT	0.388																																					p.R1500S													.	MYO9A	203	0			c.G4500C						.						99.0	95.0	97.0					15																	72190344		2199	4297	6496	SO:0001583	missense	4649	exon25			TTTTTGCCTTTCT	AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.4500G>C	15.37:g.72190344C>G	ENSP00000348349:p.Arg1500Ser	Somatic	44	0		WXS	Illumina GAIIx	Phase_I	69	3	NM_006901	B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	ENST00000356056.5	37	CCDS10239.1	.	.	.	.	.	.	.	.	.	.	C	17.43	3.386504	0.61956	.	.	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904	D;D;D	0.86694	-2.08;-2.16;-2.08	5.88	2.87	0.33458	.	.	.	.	.	D	0.86268	0.5892	L	0.27053	0.805	0.44201	D	0.997029	D;D;P	0.89917	0.993;1.0;0.919	P;D;B	0.72075	0.88;0.976;0.395	T	0.82824	-0.0266	9	0.40728	T	0.16	.	6.7724	0.23601	0.1134:0.62:0.0:0.2666	.	1481;1500;1500	B2RTY4-2;B2RTY4-4;B2RTY4	.;.;MYO9A_HUMAN	S	1500;1500;1481	ENSP00000348349:R1500S;ENSP00000399162:R1500S;ENSP00000398250:R1481S	ENSP00000348349:R1500S	R	-	3	2	MYO9A	69977398	0.995000	0.38212	1.000000	0.80357	0.997000	0.91878	0.426000	0.21363	0.778000	0.33520	0.644000	0.83932	AGG	.		0.388	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257308.1	NM_006901	
LOC283683	283683	broad.mit.edu	37	15	23114284	23114284	+	RNA	SNP	T	T	G			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr15:23114284T>G	ENST00000557922.1	-	0	148					NR_040057.1																						TTCCTCCCAGTTCTCAGGCCT	0.433																																					.													.	.	.	0			.						.																																					0	.			TCCCAGTTCTCAG																													15.37:g.23114284T>G		Somatic	113	0		WXS	Illumina GAIIx	Phase_I	142	4	.		RNA	SNP	ENST00000557922.1	37																																																																																				.		0.433	RP11-566K19.6-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000415896.1		
LOC645752	645752	broad.mit.edu	37	15	78212618	78212618	+	lincRNA	SNP	A	A	G	rs201050938	byFrequency	TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr15:78212618A>G	ENST00000565869.1	+	0	111				RP11-114H24.2_ENST00000567226.1_RNA																							TGTAACCGCCACTGGAGGACC	0.562																																					.													.	.	.	0			.						.																																					0	.			ACCGCCACTGGAG																													15.37:g.78212618A>G		Somatic	103	0		WXS	Illumina GAIIx	Phase_I	102	4	.		RNA	SNP	ENST00000565869.1	37																																																																																				G|1.000;|0.000		0.562	RP11-114H24.7-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000421587.1		
SLCO3A1	28232	broad.mit.edu	37	15	92706141	92706141	+	Missense_Mutation	SNP	G	G	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr15:92706141G>T	ENST00000318445.6	+	10	2123	c.1909G>T	c.(1909-1911)Gcc>Tcc	p.A637S	RP11-152L20.3_ENST00000561674.1_RNA|SLCO3A1_ENST00000555549.1_3'UTR|RP11-24J19.1_ENST00000557683.1_RNA|SLCO3A1_ENST00000424469.2_Missense_Mutation_p.A637S	NM_013272.3	NP_037404.2	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family, member 3A1	637					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	25	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)		Alprostadil(DB00770)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Iloprost(DB01088)|Methotrexate(DB00563)	CAAATCCTTCGCCTTCATCCT	0.547																																					p.A637S													.	SLCO3A1	84	0			c.G1909T						.						138.0	97.0	111.0					15																	92706141		2198	4298	6496	SO:0001583	missense	28232	exon10			TCCTTCGCCTTCA	AB031050	CCDS10371.1, CCDS45354.1	15q26	2013-05-22	2003-11-25	2003-11-26	ENSG00000176463	ENSG00000176463		"""Solute carriers"""	10952	protein-coding gene	gene with protein product		612435	"""solute carrier family 21 (organic anion transporter), member 11"""	SLC21A11			Standard	NM_001145044		Approved	OATP-D, OATP3A1	uc002bqx.2	Q9UIG8	OTTHUMG00000149846	ENST00000318445.6:c.1909G>T	15.37:g.92706141G>T	ENSP00000320634:p.Ala637Ser	Somatic	27	0		WXS	Illumina GAIIx	Phase_I	36	3	NM_013272	A8K4A7|B3KPY5|B3KUR7|C6G486|Q9BW73|Q9GZV2	Missense_Mutation	SNP	ENST00000318445.6	37	CCDS10371.1	.	.	.	.	.	.	.	.	.	.	G	15.82	2.946330	0.53079	.	.	ENSG00000176463	ENST00000318445;ENST00000424469;ENST00000555549	D;D	0.81659	-1.52;-1.52	5.44	4.51	0.55191	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	T	0.80628	0.4659	N	0.24115	0.695	0.80722	D	1	D;D;P	0.89917	0.978;1.0;0.785	P;D;B	0.87578	0.869;0.998;0.347	T	0.75054	-0.3453	10	0.05959	T	0.93	.	16.1686	0.81788	0.0:0.1336:0.8664:0.0	.	579;637;637	Q9UIG8-3;Q9UIG8-2;Q9UIG8	.;.;SO3A1_HUMAN	S	637;637;356	ENSP00000320634:A637S;ENSP00000387846:A637S	ENSP00000320634:A637S	A	+	1	0	SLCO3A1	90507145	1.000000	0.71417	0.720000	0.30636	0.927000	0.56198	9.195000	0.94971	1.266000	0.44231	-0.175000	0.13238	GCC	.		0.547	SLCO3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313529.1	NM_013272	
SALL1	6299	broad.mit.edu	37	16	51173869	51173869	+	Missense_Mutation	SNP	A	A	C			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr16:51173869A>C	ENST00000251020.4	-	2	2297	c.2264T>G	c.(2263-2265)gTc>gGc	p.V755G	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Missense_Mutation_p.V658G|SALL1_ENST00000541611.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	755					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			AGCACGATGGACACTGTAGTG	0.532																																					p.V755G	GBM(103;1352 1446 1855 4775 8890)												.	SALL1	301	0			c.T2264G						.						77.0	79.0	78.0					16																	51173869		2198	4300	6498	SO:0001583	missense	6299	exon2			CGATGGACACTGT	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.2264T>G	16.37:g.51173869A>C	ENSP00000251020:p.Val755Gly	Somatic	55	0		WXS	Illumina GAIIx	Phase_I	57	5	NM_002968	Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	A	16.27	3.074515	0.55646	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.10288	2.89;2.89	5.17	5.17	0.71159	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.27313	0.0670	L	0.55481	1.735	0.80722	D	1	D	0.69078	0.997	D	0.66196	0.942	T	0.00934	-1.1509	10	0.66056	D	0.02	.	15.0529	0.71888	1.0:0.0:0.0:0.0	.	755	Q9NSC2	SALL1_HUMAN	G	755;658;719	ENSP00000251020:V755G;ENSP00000407914:V658G	ENSP00000251020:V755G	V	-	2	0	SALL1	49731370	1.000000	0.71417	0.993000	0.49108	0.787000	0.44495	9.339000	0.96797	1.959000	0.56917	0.248000	0.18094	GTC	.		0.532	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968	
SPATA20	64847	broad.mit.edu	37	17	48626266	48626266	+	Missense_Mutation	SNP	G	G	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr17:48626266G>T	ENST00000356488.4	+	4	492	c.409G>T	c.(409-411)Gtg>Ttg	p.V137L	SPATA20_ENST00000511937.1_3'UTR|SPATA20_ENST00000006658.6_Missense_Mutation_p.V153L|SPATA20_ENST00000393244.3_Missense_Mutation_p.V93L	NM_001258372.1	NP_001245301.1	Q8TB22	SPT20_HUMAN	spermatogenesis associated 20	137					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)	catalytic activity (GO:0003824)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;9.38e-09)			CTTTGTGAGTGTGAAGGTAGA	0.582																																					p.V153L													.	SPATA20	59	0			c.G457T						.						174.0	129.0	144.0					17																	48626266		2203	4300	6503	SO:0001583	missense	64847	exon5			GTGAGTGTGAAGG		CCDS11571.1, CCDS58563.1, CCDS58564.1	17q21.33	2011-03-17			ENSG00000006282	ENSG00000006282			26125	protein-coding gene	gene with protein product	"""hypothetical protein FLJ21347"""	613939				12477932	Standard	NM_022827		Approved	FLJ21347, SSP411, Tisp78	uc002ird.3	Q8TB22	OTTHUMG00000162162	ENST00000356488.4:c.409G>T	17.37:g.48626266G>T	ENSP00000348878:p.Val137Leu	Somatic	39	0		WXS	Illumina GAIIx	Phase_I	47	3	NM_022827	Q2TA99|Q2XUZ6|Q6P0P1|Q8WVW3|Q9H747	Missense_Mutation	SNP	ENST00000356488.4	37	CCDS58563.1	.	.	.	.	.	.	.	.	.	.	G	15.55	2.867965	0.51588	.	.	ENSG00000006282	ENST00000006658;ENST00000356488;ENST00000393244	T;T;T	0.54479	0.57;0.57;0.57	4.72	2.69	0.31865	Thioredoxin-like fold (2);Domain of unknown function DUF255 (1);	0.227351	0.36815	N	0.002386	T	0.67869	0.2939	M	0.85099	2.735	0.35484	D	0.798435	D;P;P	0.54601	0.967;0.835;0.659	P;P;P	0.62014	0.897;0.612;0.477	T	0.76438	-0.2959	10	0.72032	D	0.01	-32.1228	7.5465	0.27770	0.254:0.0:0.746:0.0	.	137;137;153	B4DZC5;Q8TB22;Q8TB22-2	.;SPT20_HUMAN;.	L	153;137;93	ENSP00000006658:V153L;ENSP00000348878:V137L;ENSP00000376935:V93L	ENSP00000006658:V153L	V	+	1	0	SPATA20	45981265	0.999000	0.42202	0.910000	0.35882	0.199000	0.23934	3.572000	0.53849	2.167000	0.68274	0.436000	0.28706	GTG	.		0.582	SPATA20-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367651.1	NM_022827	
ANKRD62	342850	broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	12096211	12096211	+	Missense_Mutation	SNP	T	T	G			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr18:12096211T>G	ENST00000587848.2	+	4	689	c.524T>G	c.(523-525)cTt>cGt	p.L175R	RNU6-324P_ENST00000363957.1_RNA|ANKRD62_ENST00000314074.8_Missense_Mutation_p.L161R			A6NC57	ANR62_HUMAN	ankyrin repeat domain 62	175										breast(2)|haematopoietic_and_lymphoid_tissue(1)	3						CATACATCACTTTTACTCGCT	0.318																																					.													.	.	.	0			.						.																																			SO:0001583	missense	342850	.			CATCACTTTTACT	BX648696	CCDS67439.1	18p11.21	2014-01-21			ENSG00000181626	ENSG00000181626		"""Ankyrin repeat domain containing"""	35241	protein-coding gene	gene with protein product							Standard	XM_003959949		Approved	DKFZp779B1634	uc031rhk.1	A6NC57	OTTHUMG00000180673	ENST00000587848.2:c.524T>G	18.37:g.12096211T>G	ENSP00000467740:p.Leu175Arg	Somatic	80	0		WXS	Illumina GAIIx	Phase_I	110	14	.		Missense_Mutation	SNP	ENST00000587848.2	37		.	.	.	.	.	.	.	.	.	.	T	11.47	1.648368	0.29336	.	.	ENSG00000181626	ENST00000314074	T	0.80824	-1.42	1.61	1.61	0.23674	.	1.044270	0.07842	U	0.963063	T	0.77177	0.4092	.	.	.	0.21147	N	0.999777	.	.	.	.	.	.	T	0.68093	-0.5500	7	0.87932	D	0	.	5.294	0.15743	0.0:0.0:0.0:1.0	.	.	.	.	R	161	ENSP00000326572:L161R	ENSP00000326572:L161R	L	+	2	0	ANKRD62	12086211	0.697000	0.27767	0.407000	0.26434	0.048000	0.14542	3.296000	0.51802	0.984000	0.38629	0.260000	0.18958	CTT	.		0.318	ANKRD62-003	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000452521.2	XM_001715728	
SMARCA4	6597	broad.mit.edu	37	19	11141508	11141508	+	Missense_Mutation	SNP	G	G	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr19:11141508G>T	ENST00000429416.3	+	26	3766	c.3485G>T	c.(3484-3486)gGc>gTc	p.G1162V	SMARCA4_ENST00000413806.3_Missense_Mutation_p.G1162V|SMARCA4_ENST00000344626.4_Missense_Mutation_p.G1162V|SMARCA4_ENST00000590574.1_Missense_Mutation_p.G1162V|SMARCA4_ENST00000444061.3_Missense_Mutation_p.G1162V|SMARCA4_ENST00000358026.2_Missense_Mutation_p.G1162V|SMARCA4_ENST00000541122.2_Missense_Mutation_p.G1162V|SMARCA4_ENST00000589677.1_Missense_Mutation_p.G1162V|SMARCA4_ENST00000450717.3_Missense_Mutation_p.G1162V	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	1162	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				GGGGGGCTCGGCCTGAACCTC	0.612			"""F, N, Mis"""		NSCLC																																p.G1162V				Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	SMARCA4_ENST00000358026,right_upper_lobe,carcinoma,+1,3	SMARCA4	502	1	Unknown(1)	lung(1)	c.G3485T						.						24.0	25.0	25.0					19																	11141508		2196	4296	6492	SO:0001583	missense	6597	exon25			GGCTCGGCCTGAA	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.3485G>T	19.37:g.11141508G>T	ENSP00000395654:p.Gly1162Val	Somatic	79	0		WXS	Illumina GAIIx	Phase_I	99	5	NM_003072	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	37	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.602416	0.87157	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	D;D;D;D;D;D;D	0.97598	-4.45;-4.45;-4.45;-4.45;-4.45;-4.45;-4.45	4.59	4.59	0.56863	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.99381	0.9782	H	0.99982	5.21	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.97655	1.0157	10	0.87932	D	0	-37.1265	16.3247	0.82975	0.0:0.0:1.0:0.0	.	1162;1162;1162;1162;1162;382;1162;1162	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;B4E0F1;A7E2E1;P51532	.;.;.;.;.;.;.;SMCA4_HUMAN	V	1162;1162;1226;1162;1162;1162;1162;1162	ENSP00000395654:G1162V;ENSP00000350720:G1162V;ENSP00000343896:G1162V;ENSP00000445036:G1162V;ENSP00000392837:G1162V;ENSP00000397783:G1162V;ENSP00000414727:G1162V	ENSP00000343896:G1162V	G	+	2	0	SMARCA4	11002508	1.000000	0.71417	0.944000	0.38274	0.993000	0.82548	9.356000	0.97091	2.389000	0.81357	0.563000	0.77884	GGC	.		0.612	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072	
AC105399.2	0	broad.mit.edu	37	2	78020197	78020198	+	RNA	DEL	TC	TC	-	rs373550616		TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr2:78020197_78020198delTC	ENST00000422418.1	+	0	402_403																											ATACTAAAAATCCTaaaaaaaa	0.322																																					.													.	.	.	0			.						.																																					0	.			TAAAAATCCTAAA																													2.37:g.78020197_78020198delTC		Somatic	6	0		WXS	Illumina GAIIx	Phase_I	9	2	.		RNA	DEL	ENST00000422418.1	37																																																																																				.		0.322	AC105399.2-002	PUTATIVE	basic	processed_transcript	pseudogene	OTTHUMT00000328256.1		
FAM179A	165186	broad.mit.edu;bcgsc.ca	37	2	29274737	29274737	+	Silent	SNP	C	C	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr2:29274737C>T	ENST00000379558.4	+	20	3189	c.2838C>T	c.(2836-2838)agC>agT	p.S946S	FAM179A_ENST00000465300.1_3'UTR|FAM179A_ENST00000403861.2_Silent_p.S891S	NM_199280.2	NP_954974.2	Q6ZUX3	F179A_HUMAN	family with sequence similarity 179, member A	946										breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						CTGGACCCAGCGGGAACATCC	0.652																																					p.S946S													.	FAM179A	106	0			c.C2838T						.						13.0	15.0	14.0					2																	29274737		1962	4135	6097	SO:0001819	synonymous_variant	165186	exon20			ACCCAGCGGGAAC	AK125239, AK125744	CCDS1769.2	2p23.2	2008-10-30			ENSG00000189350	ENSG00000189350			33715	protein-coding gene	gene with protein product						16344560	Standard	NM_199280		Approved	FLJ43249, LOC165186	uc010ezl.3	Q6ZUX3	OTTHUMG00000128432	ENST00000379558.4:c.2838C>T	2.37:g.29274737C>T		Somatic	76	0		WXS	Illumina GAIIx	Phase_I	92	8	NM_199280	Q6ZUF5	Silent	SNP	ENST00000379558.4	37	CCDS1769.2																																																																																			.		0.652	FAM179A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317848.4	NM_199280	
FSIP2	401024	broad.mit.edu;bcgsc.ca	37	2	186661056	186661056	+	Missense_Mutation	SNP	C	C	A			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr2:186661056C>A	ENST00000424728.1	+	16	9193	c.9193C>A	c.(9193-9195)Cag>Aag	p.Q3065K	AC008174.3_ENST00000429929.1_RNA|FSIP2_ENST00000343098.5_Missense_Mutation_p.Q3154K|AC008174.3_ENST00000436557.1_RNA			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	3065										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						GGAAAACATACAGAATATCCT	0.308																																					p.Q3154K													.	FSIP2	251	0			c.C9460A						.																																			SO:0001583	missense	401024	exon16			AACATACAGAATA	AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.9193C>A	2.37:g.186661056C>A	ENSP00000401306:p.Gln3065Lys	Somatic	62	0		WXS	Illumina GAIIx	Phase_I	77	9	NM_173651	Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	ENST00000424728.1	37		.	.	.	.	.	.	.	.	.	.	C	1.457	-0.563367	0.03939	.	.	ENSG00000188738	ENST00000343098;ENST00000424728;ENST00000326147	T;T	0.50548	0.74;0.75	5.32	2.48	0.30137	.	0.404750	0.21230	N	0.077997	T	0.48696	0.1514	L	0.52573	1.65	0.09310	N	0.999999	.	.	.	.	.	.	T	0.42666	-0.9438	8	0.72032	D	0.01	.	10.2674	0.43462	0.1287:0.5781:0.2932:0.0	.	.	.	.	K	3154;3065;3065	ENSP00000344403:Q3154K;ENSP00000401306:Q3065K	ENSP00000321903:Q3065K	Q	+	1	0	FSIP2	186369301	0.137000	0.22531	0.064000	0.19789	0.001000	0.01503	0.188000	0.17018	0.080000	0.16959	-1.466000	0.01016	CAG	.		0.308	FSIP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000332778.3	NM_173651	
IRS1	3667	broad.mit.edu	37	2	227660543	227660543	+	Missense_Mutation	SNP	C	C	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr2:227660543C>T	ENST00000305123.5	-	1	3932	c.2912G>A	c.(2911-2913)gGg>gAg	p.G971E	IRS1_ENST00000498335.1_5'Flank	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	971			G -> R (in dbSNP:rs1801278). {ECO:0000269|PubMed:14671192, ECO:0000269|PubMed:14707024, ECO:0000269|PubMed:15590636, ECO:0000269|PubMed:8104271}.		cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		GCTAGCAGCCCCGGGAGGTGC	0.652																																					p.G971E													.	IRS1	141	0			c.G2912A						.						41.0	48.0	46.0					2																	227660543		2203	4300	6503	SO:0001583	missense	3667	exon1			GCAGCCCCGGGAG		CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.2912G>A	2.37:g.227660543C>T	ENSP00000304895:p.Gly971Glu	Somatic	18	0		WXS	Illumina GAIIx	Phase_I	23	3	NM_005544		Missense_Mutation	SNP	ENST00000305123.5	37	CCDS2463.1	.	.	.	.	.	.	.	.	.	.	C	11.09	1.537287	0.27475	.	.	ENSG00000169047	ENST00000305123	T	0.55052	0.54	5.39	5.39	0.77823	.	0.244505	0.30639	N	0.009181	T	0.26593	0.0650	N	0.03608	-0.345	0.09310	N	0.999999	B	0.19200	0.034	B	0.20184	0.028	T	0.09662	-1.0664	10	0.25751	T	0.34	-19.979	8.0205	0.30406	0.0:0.8355:0.0:0.1645	.	971	P35568	IRS1_HUMAN	E	971	ENSP00000304895:G971E	ENSP00000304895:G971E	G	-	2	0	IRS1	227368787	0.182000	0.23173	0.584000	0.28653	0.847000	0.48162	3.363000	0.52321	2.804000	0.96469	0.655000	0.94253	GGG	.		0.652	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256886.3	NM_005544	
FAM182B	728882	broad.mit.edu	37	20	25755510	25755510	+	Missense_Mutation	SNP	C	C	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr20:25755510C>T	ENST00000376403.1	-	3	824	c.446G>A	c.(445-447)cGc>cAc	p.R149H	FAM182B_ENST00000478164.1_Intron|FAM182B_ENST00000376404.2_Intron			Q5T319	F182B_HUMAN	family with sequence similarity 182, member B	149										lung(1)	1						CCTTCCATCGCGGCCACCATG	0.706																																					.													.	FAM182B	6	0			.						.																																			SO:0001583	missense	0	.			CCATCGCGGCCAC			20p11.1	2010-07-14			ENSG00000175170	ENSG00000175170			34503	pseudogene	pseudogene							Standard	NR_027061		Approved			Q5T319	OTTHUMG00000032136	ENST00000376403.1:c.446G>A	20.37:g.25755510C>T	ENSP00000365585:p.Arg149His	Somatic	141	1		WXS	Illumina GAIIx	Phase_I	173	5	.	Q4G0Q1	Missense_Mutation	SNP	ENST00000376403.1	37		.	.	.	.	.	.	.	.	.	.	.	2.423	-0.332565	0.05314	.	.	ENSG00000175170	ENST00000376403	.	.	.	.	.	.	.	.	.	.	.	T	0.18425	0.0442	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.30822	-0.9965	3	0.15066	T	0.55	.	.	.	.	.	.	.	.	H	149	.	ENSP00000365585:R149H	R	-	2	0	FAM182B	25703510	0.001000	0.12720	0.047000	0.18901	0.048000	0.14542	-1.599000	0.02085	0.064000	0.16427	0.064000	0.15345	CGC	.		0.706	FAM182B-003	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000078463.2	NR_026714	
MSANTD2P1	100130310	broad.mit.edu	37	21	24474482	24474482	+	lincRNA	DEL	A	A	-			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr21:24474482delA	ENST00000421604.1	+	0	297																											actccatctcaaaaaaaaaat	0.403																																					.													.	.	.	0			.						.																																					0	.			CATCTCAAAAAAA																													21.37:g.24474482delA		Somatic	8	0		WXS	Illumina GAIIx	Phase_I	6	2	.		RNA	DEL	ENST00000421604.1	37																																																																																				.		0.403	AP001255.2-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000171055.1		
BAGE2	85319	broad.mit.edu	37	21	11058603	11058603	+	RNA	DEL	G	G	-	rs201542455|rs57429001		TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr21:11058603delG	ENST00000470054.1	-	0	324							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		AAAACCTAAAGATTTTTTTTT	0.269																																					.													.	.	.	0			.						.																																					85319	.			CCTAAAGATTTTT	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11058603delG		Somatic	7	1		WXS	Illumina GAIIx	Phase_I	19	10	.	A8K925|Q08ER0	RNA	DEL	ENST00000470054.1	37																																																																																				.		0.269	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000157417.3	NM_182482	
HSCB	150274	broad.mit.edu	37	22	29138126	29138126	+	Missense_Mutation	SNP	T	T	G			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr22:29138126T>G	ENST00000216027.3	+	1	108	c.43T>G	c.(43-45)Ttt>Gtt	p.F15V	CHEK2_ENST00000382580.2_5'Flank|HSCB_ENST00000398941.2_Missense_Mutation_p.F15V|CHEK2_ENST00000544772.1_5'UTR|CHEK2_ENST00000328354.6_5'Flank|CHEK2_ENST00000382566.1_5'Flank|CHEK2_ENST00000348295.3_5'Flank|CHEK2_ENST00000382565.1_5'Flank|CHEK2_ENST00000405598.1_5'Flank|CHEK2_ENST00000382578.1_5'Flank	NM_172002.3	NP_741999.3	Q8IWL3	HSC20_HUMAN	HscB mitochondrial iron-sulfur cluster co-chaperone	15					iron-sulfur cluster assembly (GO:0016226)|protein folding (GO:0006457)|protein oligomerization (GO:0051259)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			kidney(1)|lung(2)|skin(1)	4						GGTGTGGGGGTTTTGGCCGAC	0.642																																					p.F15V													.	HSCB	16	0			c.T43G						.						12.0	14.0	13.0					22																	29138126		2200	4292	6492	SO:0001583	missense	150274	exon1			TGGGGGTTTTGGC	AY191719	CCDS13845.1	22q12.1	2013-09-12	2013-09-12		ENSG00000100209	ENSG00000100209		"""Heat shock proteins / DNAJ (HSP40)"""	28913	protein-coding gene	gene with protein product	"""DnaJ (Hsp40) homolog, subfamily C, member 20"""	608142	"""HscB iron-sulfur cluster co-chaperone homolog (E. coli)"""			12938016, 16952052	Standard	NM_172002		Approved	HSC20, DNAJC20, Jac1	uc003aea.3	Q8IWL3	OTTHUMG00000151092	ENST00000216027.3:c.43T>G	22.37:g.29138126T>G	ENSP00000216027:p.Phe15Val	Somatic	35	5		WXS	Illumina GAIIx	Phase_I	55	9	NM_172002	Q9BWS7	Missense_Mutation	SNP	ENST00000216027.3	37	CCDS13845.1	.	.	.	.	.	.	.	.	.	.	T	8.543	0.873796	0.17322	.	.	ENSG00000100209	ENST00000216027;ENST00000398941	T;T	0.39592	1.66;1.07	4.54	-4.53	0.03462	.	1.764330	0.02726	N	0.114550	T	0.15349	0.0370	N	0.00926	-1.1	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.18999	-1.0319	10	0.23891	T	0.37	0.0023	8.9514	0.35792	0.0:0.5184:0.269:0.2127	.	15	Q8IWL3	HSC20_HUMAN	V	15	ENSP00000216027:F15V;ENSP00000381914:F15V	ENSP00000216027:F15V	F	+	1	0	HSCB	27468126	0.006000	0.16342	0.000000	0.03702	0.023000	0.10783	-0.354000	0.07681	-1.049000	0.03234	-1.235000	0.01560	TTT	.		0.642	HSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321263.1	NM_172002	
PICK1	9463	broad.mit.edu	37	22	38463728	38463728	+	Silent	SNP	C	C	T	rs554539204		TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr22:38463728C>T	ENST00000404072.3	+	5	647	c.300C>T	c.(298-300)caC>caT	p.H100H	RP5-1039K5.13_ENST00000445483.1_RNA|PICK1_ENST00000468288.1_3'UTR|PICK1_ENST00000356976.3_Silent_p.H100H	NM_001039583.1|NM_001039584.1	NP_001034672.1|NP_001034673.1	Q9NRD5	PICK1_HUMAN	protein interacting with PRKCA 1	100	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				ATP catabolic process (GO:0006200)|cellular response to decreased oxygen levels (GO:0036294)|cellular response to glucose starvation (GO:0042149)|dendritic spine maintenance (GO:0097062)|dendritic spine organization (GO:0097061)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|glial cell development (GO:0021782)|long term synaptic depression (GO:0060292)|monoamine transport (GO:0015844)|negative regulation of Arp2/3 complex-mediated actin nucleation (GO:0034316)|neuronal ion channel clustering (GO:0045161)|positive regulation of receptor internalization (GO:0002092)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|protein targeting (GO:0006605)|receptor clustering (GO:0043113)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endocytic vesicle membrane (GO:0030666)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	actin filament binding (GO:0051015)|Arp2/3 complex binding (GO:0071933)|ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein kinase C binding (GO:0005080)|receptor binding (GO:0005102)			cervix(1)|endometrium(3)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13	Melanoma(58;0.045)					TGACCATCCACTACAACAAGC	0.607													C|||	1	0.000199681	0.0	0.0	5008	,	,		17887	0.0		0.0	False		,,,				2504	0.001				p.H100H													.	PICK1	30	0			c.C300T						.						113.0	93.0	100.0					22																	38463728		2203	4300	6503	SO:0001819	synonymous_variant	9463	exon5			CATCCACTACAAC	AL049654	CCDS13965.1	22q13.1	2006-02-14	2006-02-14	2006-02-14	ENSG00000100151	ENSG00000100151			9394	protein-coding gene	gene with protein product		605926	"""protein kinase C, alpha binding protein"", ""protein interacting with PRKCA"""	PRKCABP		10340301, 10591208	Standard	XM_006724377		Approved	dJ1039K5, MGC15204	uc003aus.3	Q9NRD5	OTTHUMG00000151159	ENST00000404072.3:c.300C>T	22.37:g.38463728C>T		Somatic	20	0		WXS	Illumina GAIIx	Phase_I	35	3	NM_012407	B3KS52|O95906	Silent	SNP	ENST00000404072.3	37	CCDS13965.1																																																																																			.		0.607	PICK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321569.2	NM_012407	
RP11-526A4.1	0	broad.mit.edu;bcgsc.ca	37	4	150469687	150469687	+	lincRNA	SNP	T	T	A			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr4:150469687T>A	ENST00000511993.1	-	0	1579																											ATTGGGGAGCTCATTTCTTTC	0.343																																					.													.	.	.	0			.						.																																					0	.			GGGAGCTCATTTC																													4.37:g.150469687T>A		Somatic	81	0		WXS	Illumina GAIIx	Phase_I	101	8	.		RNA	SNP	ENST00000511993.1	37																																																																																				.		0.343	RP11-526A4.1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000364766.1		
SLC9A3	6550	broad.mit.edu	37	5	476666	476666	+	Missense_Mutation	SNP	G	G	A			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr5:476666G>A	ENST00000264938.3	-	12	1891	c.1882C>T	c.(1882-1884)Cgg>Tgg	p.R628W	CTD-2228K2.7_ENST00000607005.1_RNA|CTD-2228K2.7_ENST00000607286.1_RNA|CTD-2228K2.7_ENST00000606288.1_RNA|CTD-2228K2.7_ENST00000606319.1_RNA|SLC9A3_ENST00000514375.1_Missense_Mutation_p.R619W	NM_004174.2	NP_004165.2	P48764	SL9A3_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3	628	Interaction with PDZD3. {ECO:0000250}.				ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|sodium:proton antiporter activity (GO:0015385)			NS(2)|biliary_tract(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(16)|prostate(3)|skin(2)|urinary_tract(1)	37			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			ACCTCCTGCCGCGGCTTGTAC	0.701																																					p.R628W													.	SLC9A3	89	0			c.C1882T						.						35.0	34.0	34.0					5																	476666		2203	4300	6503	SO:0001583	missense	6550	exon12			CCTGCCGCGGCTT		CCDS3855.1, CCDS64116.1	5p15.3	2013-05-22	2012-03-22		ENSG00000066230	ENSG00000066230		"""Solute carriers"""	11073	protein-coding gene	gene with protein product		182307	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3"""	NHE3		8096830	Standard	NM_004174		Approved		uc003jbe.2	P48764	OTTHUMG00000090315	ENST00000264938.3:c.1882C>T	5.37:g.476666G>A	ENSP00000264938:p.Arg628Trp	Somatic	13	0		WXS	Illumina GAIIx	Phase_I	19	3	NM_004174	B7ZKR2|E9PF67|Q3MIW3	Missense_Mutation	SNP	ENST00000264938.3	37	CCDS3855.1	.	.	.	.	.	.	.	.	.	.	G	13.17	2.158107	0.38119	.	.	ENSG00000066230	ENST00000264938;ENST00000514375	T;T	0.79247	-1.25;-1.25	4.8	-0.0633	0.13777	.	0.164075	0.52532	D	0.000069	D	0.86201	0.5876	M	0.86864	2.845	0.22926	N	0.99855	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.94	T	0.76857	-0.2804	10	0.87932	D	0	.	8.1004	0.30854	0.0886:0.0:0.3697:0.5417	.	619;628	E9PF67;P48764	.;SL9A3_HUMAN	W	628;619	ENSP00000264938:R628W;ENSP00000422983:R619W	ENSP00000264938:R628W	R	-	1	2	SLC9A3	529666	0.291000	0.24352	0.211000	0.23655	0.152000	0.21847	1.773000	0.38563	0.052000	0.16007	0.561000	0.74099	CGG	.		0.701	SLC9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206677.2	NM_004174	
SEC63	11231	broad.mit.edu	37	6	108214765	108214765	+	Nonsense_Mutation	SNP	A	A	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr6:108214765A>T	ENST00000369002.4	-	16	1774	c.1595T>A	c.(1594-1596)tTa>tAa	p.L532*		NM_007214.4	NP_009145.1	Q9UGP8	SEC63_HUMAN	SEC63 homolog (S. cerevisiae)	532	SEC63 1.				liver development (GO:0001889)|multicellular organismal aging (GO:0010259)|nitrogen compound metabolic process (GO:0006807)|posttranslational protein targeting to membrane (GO:0006620)|posttranslational protein targeting to membrane, translocation (GO:0031204)|protein targeting to membrane (GO:0006612)|renal system development (GO:0072001)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)	p.L532*(2)		endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(87;5.35e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0294)		BRCA - Breast invasive adenocarcinoma(108;0.0079)|Epithelial(106;0.0356)|all cancers(137;0.0525)|OV - Ovarian serous cystadenocarcinoma(136;0.054)		TTTTTTTTTTAAAGGTTTCTT	0.368																																					p.L532X													SEC63,NS,carcinoma,0,1	SEC63	79	2	Substitution - Nonsense(2)	lung(1)|kidney(1)	c.T1595A						.						114.0	119.0	117.0					6																	108214765		2202	4300	6502	SO:0001587	stop_gained	11231	exon16			TTTTTTAAAGGTT	BC048287	CCDS5061.1	6q21	2011-09-05	2006-09-12		ENSG00000025796	ENSG00000025796		"""Heat shock proteins / DNAJ (HSP40)"""	21082	protein-coding gene	gene with protein product		608648	"""SEC63-like (S. cerevisiae)"""			10219736, 10543453	Standard	NM_007214		Approved	SEC63L, PRO2507, ERdj2, DNAJC23	uc003psc.4	Q9UGP8	OTTHUMG00000015316	ENST00000369002.4:c.1595T>A	6.37:g.108214765A>T	ENSP00000357998:p.Leu532*	Somatic	94	1		WXS	Illumina GAIIx	Phase_I	110	5	NM_007214	O95380|Q5THN4|Q86VS9|Q8IWL0|Q9NTE0	Nonsense_Mutation	SNP	ENST00000369002.4	37	CCDS5061.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	37|37	6.342620|6.342620	0.97489|0.97489	.|.	.|.	ENSG00000025796|ENSG00000025796	ENST00000423697|ENST00000369002;ENST00000437345	.|.	.|.	.|.	5.38|5.38	3.01|3.01	0.34805|0.34805	.|.	.|0.323197	.|0.31989	.|N	.|0.006744	T|.	0.17450|.	0.0419|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.07673|.	-1.0760|.	4|.	0.10636|0.14656	T|T	0.68|0.56	-2.4355|-2.4355	7.8269|7.8269	0.29320|0.29320	0.7741:0.0:0.2259:0.0|0.7741:0.0:0.2259:0.0	.|.	.|.	.|.	.|.	L|X	391|532;183	.|.	ENSP00000394572:F391L|ENSP00000357998:L532X	F|L	-|-	3|2	2|0	SEC63|SEC63	108321458|108321458	0.977000|0.977000	0.34250|0.34250	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	2.787000|2.787000	0.47798|0.47798	0.991000|0.991000	0.38814|0.38814	0.460000|0.460000	0.39030|0.39030	TTT|TTA	.		0.368	SEC63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041705.4	NM_007214	
EGFR	1956	broad.mit.edu	37	7	55249090	55249090	+	Silent	SNP	C	C	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr7:55249090C>T	ENST00000275493.2	+	20	2565	c.2388C>T	c.(2386-2388)ggC>ggT	p.G796G	EGFR_ENST00000442591.1_Intron|EGFR_ENST00000454757.2_Silent_p.G743G|EGFR-AS1_ENST00000442411.1_RNA|EGFR_ENST00000455089.1_Silent_p.G751G	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	796	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	TGCCCTTCGGCTGCCTCCTGG	0.587		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																											p.G796G			yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	EGFR,colon,carcinoma,+2,8	EGFR	20426	0			c.C2388T						.						95.0	82.0	86.0					7																	55249090		2203	4300	6503	SO:0001819	synonymous_variant	1956	exon20	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	CTTCGGCTGCCTC		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.2388C>T	7.37:g.55249090C>T		Somatic	24	0		WXS	Illumina GAIIx	Phase_I	30	3	NM_005228	O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Silent	SNP	ENST00000275493.2	37	CCDS5514.1																																																																																			.		0.587	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228	
GTF2IRD2P1	401375	broad.mit.edu	37	7	72663998	72663998	+	RNA	SNP	T	T	G			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr7:72663998T>G	ENST00000425256.1	-	0	902									GTF2I repeat domain containing 2 pseudogene 1																		ATAGCCGGGGTCCTTGAATAC	0.488																																					.													.	.	.	0			.						.																																					0	.			CCGGGGTCCTTGA	AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72663998T>G		Somatic	36	0		WXS	Illumina GAIIx	Phase_I	51	3	.		RNA	SNP	ENST00000425256.1	37																																																																																				T|0.500;G|0.500		0.488	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000345921.1	NR_002164	
GPR85	54329	broad.mit.edu	37	7	112723989	112723989	+	Missense_Mutation	SNP	G	G	C			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr7:112723989G>C	ENST00000297146.3	-	3	1391	c.788C>G	c.(787-789)gCa>gGa	p.A263G	GPR85_ENST00000501255.2_Missense_Mutation_p.A263G|GPR85_ENST00000449591.1_Missense_Mutation_p.A263G|GPR85_ENST00000424100.1_Missense_Mutation_p.A263G|GPR85_ENST00000487573.1_5'Flank	NM_001146266.1	NP_001139738.1	P60893	GPR85_HUMAN	G protein-coupled receptor 85	263					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	17						TGTGGTGTTTGCATTTTGCCT	0.478																																					p.A263G													.	GPR85	49	0			c.C788G						.						144.0	156.0	152.0					7																	112723989		2203	4300	6503	SO:0001583	missense	0	exon3			GTGTTTGCATTTT	AF250237	CCDS5758.1	7q31	2012-08-21			ENSG00000164604	ENSG00000164604		"""GPCR / Class A : Orphans"""	4536	protein-coding gene	gene with protein product		605188				10978537, 10833454	Standard	NM_018970		Approved	SREB2	uc003vgp.1	P60893	OTTHUMG00000156933	ENST00000297146.3:c.788C>G	7.37:g.112723989G>C	ENSP00000297146:p.Ala263Gly	Somatic	27	0		WXS	Illumina GAIIx	Phase_I	42	3	NM_001146265	Q9JHI6|Q9NPD1	Missense_Mutation	SNP	ENST00000297146.3	37	CCDS5758.1	.	.	.	.	.	.	.	.	.	.	G	3.150	-0.174413	0.06421	.	.	ENSG00000164604	ENST00000501255;ENST00000297146;ENST00000424100;ENST00000449591	T;T;T;T	0.37915	1.17;1.17;1.17;1.17	5.52	4.59	0.56863	GPCR, rhodopsin-like superfamily (1);	0.106404	0.64402	D	0.000005	T	0.13927	0.0337	N	0.01874	-0.695	0.46701	D	0.999166	B	0.02656	0.0	B	0.04013	0.001	T	0.15350	-1.0440	10	0.02654	T	1	.	16.1594	0.81686	0.0:0.1332:0.8668:0.0	.	263	P60893	GPR85_HUMAN	G	263	ENSP00000445808:A263G;ENSP00000297146:A263G;ENSP00000396763:A263G;ENSP00000401178:A263G	ENSP00000297146:A263G	A	-	2	0	GPR85	112511225	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.832000	0.69337	2.765000	0.95021	0.650000	0.86243	GCA	.		0.478	GPR85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346650.2		
ATAD2	29028	broad.mit.edu	37	8	124340548	124340548	+	Silent	SNP	A	A	G			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr8:124340548A>G	ENST00000287394.5	-	25	3857	c.3750T>C	c.(3748-3750)aaT>aaC	p.N1250N	ATAD2_ENST00000521903.1_Silent_p.N568N	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	1250					ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			CTTCAAGCTCATTCTCTATAT	0.363																																					p.N1250N													.	ATAD2	160	0			c.T3750C						.						103.0	99.0	100.0					8																	124340548		2203	4300	6503	SO:0001819	synonymous_variant	29028	exon25			AAGCTCATTCTCT	BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.3750T>C	8.37:g.124340548A>G		Somatic	47	0		WXS	Illumina GAIIx	Phase_I	50	3	NM_014109	Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Silent	SNP	ENST00000287394.5	37	CCDS6343.1																																																																																			.		0.363	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381766.2	NM_014109	
ABHD17B	51104	broad.mit.edu	37	9	74489678	74489678	+	Missense_Mutation	SNP	T	T	C			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr9:74489678T>C	ENST00000333421.6	-	2	430	c.319A>G	c.(319-321)Atg>Gtg	p.M107V	ABHD17B_ENST00000377041.2_Missense_Mutation_p.M107V	NM_001025780.1	NP_001020951.1	Q5VST6	AB17B_HUMAN	abhydrolase domain containing 17B	107						extracellular region (GO:0005576)|membrane (GO:0016020)	hydrolase activity (GO:0016787)										AAGCTGCTCATTTGACCAAGA	0.388																																					p.M107V													.	FAM108B1	24	0			c.A319G						.						161.0	150.0	154.0					9																	74489678		2203	4300	6503	SO:0001583	missense	51104	exon2			TGCTCATTTGACC	AF151825	CCDS35042.1, CCDS35043.1	9q21.2	2013-03-15	2013-03-15	2013-03-15	ENSG00000107362	ENSG00000107362		"""Abhydrolase domain containing"""	24278	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 77"", ""family with sequence similarity 108, member B1"""	C9orf77, FAM108B1		10810093	Standard	XM_006717134		Approved	CGI-67	uc004ail.3	Q5VST6	OTTHUMG00000020001	ENST00000333421.6:c.319A>G	9.37:g.74489678T>C	ENSP00000330222:p.Met107Val	Somatic	33	0		WXS	Illumina GAIIx	Phase_I	42	3	NM_016014	A8KAJ5|Q5VST7|Q86YB6|Q8IY03|Q9Y377	Missense_Mutation	SNP	ENST00000333421.6	37	CCDS35043.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.083384	0.76642	.	.	ENSG00000107362	ENST00000377041;ENST00000333421	T;T	0.22336	1.96;1.96	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.46425	0.1392	M	0.67517	2.055	0.80722	D	1	D;D	0.65815	0.995;0.994	D;D	0.70016	0.967;0.944	T	0.40496	-0.9560	10	0.87932	D	0	-12.8476	16.8222	0.85835	0.0:0.0:0.0:1.0	.	107;107	Q5VST6;Q5VST6-2	F108B_HUMAN;.	V	107	ENSP00000366240:M107V;ENSP00000330222:M107V	ENSP00000330222:M107V	M	-	1	0	FAM108B1	73679498	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.997000	0.88414	2.371000	0.80710	0.533000	0.62120	ATG	.		0.388	ABHD17B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052625.1	NM_016014	
NUDT10	170685	broad.mit.edu	37	X	51076024	51076024	+	Silent	SNP	G	G	A	rs143435240		TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chrX:51076024G>A	ENST00000376006.3	+	2	427	c.207G>A	c.(205-207)gaG>gaA	p.E69E	NUDT10_ENST00000356450.2_Silent_p.E69E	NM_153183.2	NP_694853.1	Q9BW91	NUDT9_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 10	234					ADP catabolic process (GO:0046032)|IDP catabolic process (GO:0046709)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrial matrix (GO:0005759)	adenosine-diphosphatase activity (GO:0043262)|ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)	p.E69E(8)		cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(1)|prostate(3)|upper_aerodigestive_tract(1)	16	Ovarian(276;0.236)					TGTACGAAGAGGCGGGAGTCA	0.657																																					p.E69E	NSCLC(90;1817 2035 37909 38249)												.	NUDT10	28	8	Substitution - coding silent(8)	endometrium(5)|cervix(1)|prostate(1)|lung(1)	c.G207A						.						52.0	62.0	59.0					X																	51076024		2203	4300	6503	SO:0001819	synonymous_variant	170685	exon2			CGAAGAGGCGGGA	AF469196	CCDS35278.1	Xp11.22-p11.1	2014-05-20			ENSG00000122824	ENSG00000122824		"""Nudix motif containing"""	17621	protein-coding gene	gene with protein product		300527				12105228	Standard	NM_153183		Approved	DIPP3a, hDIPP3alpha	uc004dph.3	Q8NFP7	OTTHUMG00000021530	ENST00000376006.3:c.207G>A	X.37:g.51076024G>A		Somatic	55	0		WXS	Illumina GAIIx	Phase_I	59	4	NM_153183	Q8NBN1|Q8NCB9|Q8NG25	Silent	SNP	ENST00000376006.3	37	CCDS35278.1																																																																																			.		0.657	NUDT10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056578.1	NM_153183	
FREM2	341640	ucsc.edu;bcgsc.ca	37	13	39433640	39433640	+	Missense_Mutation	SNP	G	G	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr13:39433640G>T	ENST00000280481.7	+	14	7648	c.7432G>T	c.(7432-7434)Gta>Tta	p.V2478L		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	2478					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TGGCTCCCGGGTACAGTGCGC	0.527																																					p.V2478L													FREM2,caecum,carcinoma,-1,1	FREM2	385	0			c.G7432T						.						99.0	91.0	94.0					13																	39433640		2203	4300	6503	SO:0001583	missense	341640	exon14			TCCCGGGTACAGT	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.7432G>T	13.37:g.39433640G>T	ENSP00000280481:p.Val2478Leu	Somatic	28	0		WXS	Illumina HiSeq		25	4	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.216372	0.79352	.	.	ENSG00000150893	ENST00000280481	T	0.29142	1.58	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.54127	0.1839	M	0.86178	2.8	0.80722	D	1	D;P	0.58268	0.982;0.948	P;P	0.51193	0.662;0.46	T	0.59263	-0.7487	10	0.72032	D	0.01	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	2478;2478	Q5SZK8-2;Q5SZK8	.;FREM2_HUMAN	L	2478	ENSP00000280481:V2478L	ENSP00000280481:V2478L	V	+	1	0	FREM2	38331640	1.000000	0.71417	0.143000	0.22291	0.600000	0.36913	5.476000	0.66793	2.937000	0.99478	0.650000	0.86243	GTA	.		0.527	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
KRT8P21	126811	bcgsc.ca	37	1	73571831	73571831	+	IGR	SNP	T	T	G			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr1:73571831T>G								RP4-660H19.1 (207008 upstream) : RN7SKP19 (85455 downstream)																							AGCTACGTCCTGGGCTCCAGC	0.592																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	126811	.			ACGTCCTGGGCTC																													1.37:g.73571831T>G		Somatic	58	0		WXS	Illumina HiSeq	Phase_1	54	7	.		RNA	SNP		37																																																																																				.	0	0.592								
ALLC	55821	bcgsc.ca	37	2	3730548	3730548	+	Missense_Mutation	SNP	G	G	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr2:3730548G>T	ENST00000252505.3	+	7	557	c.395G>T	c.(394-396)tGg>tTg	p.W132L		NM_018436.3	NP_060906.3	Q8N6M5	ALLC_HUMAN	allantoicase	151					allantoin catabolic process (GO:0000256)		allantoicase activity (GO:0004037)			breast(4)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	30	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)		TCCGACGACTGGAGTTACTTG	0.423										HNSCC(21;0.051)																											p.W132L													ALLC,NS,carcinoma,+1,2	ALLC	61	0			c.G395T						.						136.0	136.0	136.0					2																	3730548		1900	4122	6022	SO:0001583	missense	55821	exon7			ACGACTGGAGTTA	AF215924	CCDS46223.1	2p25.3	2008-02-05			ENSG00000151360	ENSG00000151360			17377	protein-coding gene	gene with protein product		612396				11054555	Standard	NM_018436		Approved	ALC	uc010ewt.3	Q8N6M5	OTTHUMG00000151485	ENST00000252505.3:c.395G>T	2.37:g.3730548G>T	ENSP00000252505:p.Trp132Leu	Somatic	62	0		WXS	Illumina HiSeq	Phase_1	66	4	NM_018436	Q53T95|Q5RL81|Q96RE6|Q9NZA7	Missense_Mutation	SNP	ENST00000252505.3	37	CCDS46223.1	.	.	.	.	.	.	.	.	.	.	G	13.84	2.357252	0.41801	.	.	ENSG00000151360	ENST00000252505	.	.	.	5.44	4.56	0.56223	Allantoicase domain (1);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	D	0.87366	0.6159	H	0.97540	4.025	0.51767	D	0.999937	D	0.89917	1.0	D	0.87578	0.998	D	0.90888	0.4759	9	0.87932	D	0	-23.26	12.5218	0.56065	0.0821:0.0:0.9179:0.0	.	151	Q8N6M5	ALLC_HUMAN	L	132	.	ENSP00000252505:W132L	W	+	2	0	ALLC	3708423	1.000000	0.71417	0.497000	0.27552	0.067000	0.16453	5.158000	0.64917	1.428000	0.47296	-0.216000	0.12614	TGG	.		0.423	ALLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322855.1		
C2orf16	84226	bcgsc.ca	37	2	27804408	27804408	+	Missense_Mutation	SNP	C	C	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr2:27804408C>T	ENST00000408964.2	+	1	5020	c.4969C>T	c.(4969-4971)Ccc>Tcc	p.P1657S	ZNF512_ENST00000556601.1_5'Flank|ZNF512_ENST00000416005.2_5'Flank|ZNF512_ENST00000355467.4_5'Flank|ZNF512_ENST00000379717.1_5'Flank|AC074091.1_ENST00000408604.1_RNA|RP11-158I13.2_ENST00000505973.1_RNA|ZNF512_ENST00000413371.2_5'Flank	NM_032266.3	NP_115642.3	Q68DN1	CB016_HUMAN	chromosome 2 open reading frame 16	1657	27 X 8 AA approximative tandem repeat of P-S-E-R-S-H-H-S.|Arg-rich.					extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(33)|urinary_tract(1)	47	Acute lymphoblastic leukemia(172;0.155)					CCATCGCAGTCCCTCAGAGAG	0.582																																					p.P1657S													.	C2orf16	357	0			c.C4969T						.						160.0	161.0	161.0					2																	27804408		1896	4121	6017	SO:0001583	missense	84226	exon1			CGCAGTCCCTCAG	AL136898	CCDS42666.1	2p23.3	2013-09-20			ENSG00000221843	ENSG00000221843			25275	protein-coding gene	gene with protein product	"""P-S-E-R-S-H-H-S repeats containing"""						Standard	NM_032266		Approved	DKFZp434G118	uc002rkz.4	Q68DN1	OTTHUMG00000159099	ENST00000408964.2:c.4969C>T	2.37:g.27804408C>T	ENSP00000386190:p.Pro1657Ser	Somatic	40	0		WXS	Illumina HiSeq	Phase_1	60	5	NM_032266	B9EIQ4|Q53S01|Q8ND64|Q9H088	Missense_Mutation	SNP	ENST00000408964.2	37	CCDS42666.1	.	.	.	.	.	.	.	.	.	.	C	7.022	0.558838	0.13436	.	.	ENSG00000221843	ENST00000408964	T	0.05382	3.45	3.24	-5.41	0.02648	.	.	.	.	.	T	0.05135	0.0137	L	0.54323	1.7	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.40440	-0.9563	9	0.30078	T	0.28	.	2.7023	0.05152	0.1316:0.3017:0.3881:0.1786	.	1657	Q68DN1	CB016_HUMAN	S	1657	ENSP00000386190:P1657S	ENSP00000386190:P1657S	P	+	1	0	C2orf16	27657912	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.950000	0.03889	-1.507000	0.01803	-0.643000	0.03959	CCC	.		0.582	C2orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353292.1	NM_032266	
WDR19	57728	bcgsc.ca	37	4	39226502	39226502	+	Splice_Site	SNP	A	A	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr4:39226502A>T	ENST00000399820.3	+	15	1633		c.e15-1		WDR19_ENST00000288634.7_Splice_Site	NM_025132.3	NP_079408.3	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19						ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium assembly (GO:0042384)|digestive system development (GO:0055123)|ear morphogenesis (GO:0042471)|embryonic camera-type eye development (GO:0031076)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|in utero embryonic development (GO:0001701)|intraciliary retrograde transport (GO:0035721)|myotome development (GO:0061055)|neurological system process (GO:0050877)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|motile cilium (GO:0031514)|nonmotile primary cilium (GO:0031513)|photoreceptor connecting cilium (GO:0032391)				large_intestine(1)	1						TTTTTTTTTTAGACTGGTGTC	0.313																																					.													.	WDR19	96	0			c.1480-2A>T						.						16.0	15.0	16.0					4																	39226502		1783	4061	5844	SO:0001630	splice_region_variant	57728	exon15			TTTTTTAGACTGG	AB046858, AY029257	CCDS47042.1	4p14	2014-02-21			ENSG00000157796	ENSG00000157796		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	18340	protein-coding gene	gene with protein product	"""intraflagellar transport 144 homolog (Chlamydomonas)"""	608151				12906858, 22019273	Standard	XM_005262658		Approved	Pwdmp, KIAA1638, FLJ23127, ORF26, DYF-2, Oseg6, IFT144, NPHP13	uc003gtv.3	Q8NEZ3	OTTHUMG00000160466	ENST00000399820.3:c.1480-1A>T	4.37:g.39226502A>T		Somatic	49	3		WXS	Illumina HiSeq	Phase_1	71	11	NM_025132	B5MEF2|Q8N5B4|Q9H5S0|Q9HCD4	Splice_Site	SNP	ENST00000399820.3	37	CCDS47042.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.231736	0.79688	.	.	ENSG00000157796	ENST00000399820;ENST00000288634	.	.	.	5.97	5.97	0.96955	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0245	0.71659	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	WDR19	38902897	1.000000	0.71417	0.997000	0.53966	0.909000	0.53808	8.335000	0.90031	2.285000	0.76669	0.477000	0.44152	.	.		0.313	WDR19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360689.1		Intron
HSP90AA4P	3323	bcgsc.ca	37	4	190396081	190396081	+	RNA	SNP	G	G	C			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr4:190396081G>C	ENST00000378770.1	+	0	992							Q58FG1	HS904_HUMAN	heat shock protein 90kDa alpha (cytosolic), class A member 4, pseudogene						protein folding (GO:0006457)|response to stress (GO:0006950)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)										TTCCTTTATTGACACCTTAAG	0.448																																					.													.	.	.	0			.						.																																					3323	.			TTTATTGACACCT			4q35.2	2011-04-15	2011-04-15	2006-02-24	ENSG00000205100	ENSG00000205100			5255	pseudogene	pseudogene			"""heat shock 90kD protein 1, alpha-like 2"", ""heat shock 90kDa protein 1, alpha-like 2"""	HSPCAL2		1740332, 16269234	Standard	NG_003014		Approved			Q58FG1	OTTHUMG00000160204		4.37:g.190396081G>C		Somatic	63	0		WXS	Illumina HiSeq	Phase_1	55	8	.		RNA	SNP	ENST00000378770.1	37																																																																																				.		0.448	HSP90AA4P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000359634.1	NG_003014	
Unknown	0	bcgsc.ca	37	6	27705332	27705332	+	IGR	SNP	G	G	A			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr6:27705332G>A								TRNAI6 (106021 upstream) : HIST1H2BL (69924 downstream)																							CCTTGGTAGCGTACAGATCAG	0.358																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			GGTAGCGTACAGA																													6.37:g.27705332G>A		Somatic	83	0		WXS	Illumina HiSeq	Phase_1	122	12	.		RNA	SNP		37																																																																																				.	0	0.358								
Unknown	0	bcgsc.ca	37	7	56358084	56358084	+	IGR	SNP	G	G	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr7:56358084G>T								AC073136.1 (20540 upstream) : RNU6-1335P (49839 downstream)																							AACAAGCCTTGGTGAGGAATC	0.418																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			AGCCTTGGTGAGG																													7.37:g.56358084G>T		Somatic	51	0		WXS	Illumina HiSeq	Phase_1	58	4	.		RNA	SNP		37																																																																																				.	0	0.418								
TBPL2	387332	bcgsc.ca	37	14	55903453	55903453	+	Missense_Mutation	SNP	C	C	T			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr14:55903453C>T	ENST00000247219.5	-	2	504	c.434G>A	c.(433-435)gGc>gAc	p.G145D		NM_199047.2	NP_950248.1			TATA box binding protein like 2											endometrium(2)|kidney(1)|large_intestine(1)|lung(4)	8						GCTGTTTAAGCCCAGCCCAAC	0.498																																					p.G145D													.	TBPL2	27	0			c.G434A						.						231.0	192.0	205.0					14																	55903453		2203	4300	6503	SO:0001583	missense	387332	exon2			TTTAAGCCCAGCC	AY457923	CCDS9724.1	14q22.2	2004-06-03			ENSG00000182521	ENSG00000182521			19841	protein-coding gene	gene with protein product		608964				14634207	Standard	NM_199047		Approved	TRF3, TBP2	uc001xby.3	Q6SJ96	OTTHUMG00000140313	ENST00000247219.5:c.434G>A	14.37:g.55903453C>T	ENSP00000247219:p.Gly145Asp	Somatic	94	0		WXS	Illumina HiSeq	Phase_1	67	4	NM_199047		Missense_Mutation	SNP	ENST00000247219.5	37	CCDS9724.1	.	.	.	.	.	.	.	.	.	.	C	2.167	-0.390907	0.04932	.	.	ENSG00000182521	ENST00000247219	T	0.43688	0.94	4.92	-3.24	0.05094	.	1.654650	0.02849	N	0.128910	T	0.22742	0.0549	N	0.25647	0.755	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.05937	-1.0855	10	0.10902	T	0.67	2.1044	0.5814	0.00712	0.209:0.3172:0.1998:0.2741	.	145	Q6SJ96	TBPL2_HUMAN	D	145	ENSP00000247219:G145D	ENSP00000247219:G145D	G	-	2	0	TBPL2	54973206	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-0.029000	0.12329	-0.542000	0.06249	-0.181000	0.13052	GGC	.		0.498	TBPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276916.1	NM_199047	
LILRB5	10990	bcgsc.ca	37	19	54754843	54754843	+	Intron	SNP	A	A	G			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr19:54754843A>G	ENST00000316219.5	-	13	1734				CTD-2337J16.1_ENST00000595133.1_lincRNA|LILRB5_ENST00000450632.1_Missense_Mutation_p.S598P|LILRB5_ENST00000449561.2_Intron|LILRB5_ENST00000345866.6_Intron	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5						cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GGGGGTGGGGAGGCCTGGGGG	0.607																																					.													.	LILRB5	176	0			.						.						43.0	42.0	42.0					19																	54754843		2191	4270	6461	SO:0001627	intron_variant	10990	.			GTGGGGAGGCCTG	AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.1627-47T>C	19.37:g.54754843A>G		Somatic	49	1		WXS	Illumina HiSeq	Phase_1	79	14	.	Q8N760	Missense_Mutation	SNP	ENST00000316219.5	37	CCDS12885.1	.	.	.	.	.	.	.	.	.	.	A	10.02	1.237390	0.22711	.	.	ENSG00000105609	ENST00000450632	T	0.00497	6.98	1.74	-0.656	0.11436	.	.	.	.	.	T	0.00328	0.0010	.	.	.	0.09310	N	1	B	0.24576	0.106	B	0.17433	0.018	T	0.45702	-0.9243	8	0.87932	D	0	.	1.6956	0.02861	0.475:0.0:0.2022:0.3228	.	598	C9JMK7	.	P	598	ENSP00000414225:S598P	ENSP00000414225:S598P	S	-	1	0	LILRB5	59446655	0.000000	0.05858	0.043000	0.18650	0.608000	0.37181	-0.873000	0.04214	-0.256000	0.09473	0.332000	0.21555	TCC	.		0.607	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142877.2		
RABGAP1	23637	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	125752410	125752411	+	Missense_Mutation	DNP	GC	GC	CT			TCGA-ZU-A8S4-01A-11D-A417-09	TCGA-ZU-A8S4-10A-01D-A41A-09	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	bd3b04ff-8026-44bb-9b86-c43ac8d4153c	ab65e654-58a5-4d99-b72e-78211c8d1c86	g.chr9:125752410_125752411GC>CT	ENST00000373647.4	+	6	975_976	c.841_842GC>CT	c.(841-843)GCa>CTa	p.A281L		NM_012197.3	NP_036329.3	Q9Y3P9	RBGP1_HUMAN	RAB GTPase activating protein 1	281	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				cell cycle (GO:0007049)|positive regulation of GTPase activity (GO:0043547)|regulation of GTP catabolic process (GO:0033124)	centrosome (GO:0005813)|cytosol (GO:0005829)|microtubule associated complex (GO:0005875)	DNA binding (GO:0003677)|GTPase activator activity (GO:0005096)|Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)|tubulin binding (GO:0015631)			breast(3)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|prostate(4)|stomach(3)|upper_aerodigestive_tract(1)	41						AGCCACTGCTGCACCCCAGACT	0.436																																					p.A281L		.											.	.	.	0			c.C842T						.																																			SO:0001583	missense	23637	exon6			CTGCTGCACCCCA	AJ011679	CCDS6848.2	9q34.11	2013-07-09			ENSG00000011454	ENSG00000011454			17155	protein-coding gene	gene with protein product	"""rab6 GTPase activating protein (GAP and centrosome-associated)"", ""TBC1 domain family, member 11"""	615882				10202141	Standard	NM_012197		Approved	GAPCenA, TBC1D11	uc011lzh.2	Q9Y3P9	OTTHUMG00000020633	Exception_encountered	9.37:g.125752410_125752411delinsCT	ENSP00000362751:p.Ala281Leu	Somatic	61	0		WXS	Illumina HiSeq	.	67	5	NM_012197	B9A6L2|Q05CW2|Q6ZMY1|Q9HA28|Q9P0E2|Q9UG67	Missense_Mutation	DNP	ENST00000373647.4	37	CCDS6848.2																																																																																			.		0.436	RABGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053976.3	NM_012197	
