#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ANK3	288	hgsc.bcm.edu	37	10	61815427	61815428	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	-	-	-	C	-	-	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr10:61815427_61815428insC	ENST00000280772.2	-	42	13244_13245	c.13053_13054insG	c.(13051-13056)gggtctfs	p.S4352fs	RP11-388P9.2_ENST00000414383.1_RNA|ANK3_ENST00000373827.2_Frame_Shift_Ins_p.S1836fs|ANK3_ENST00000503366.1_Frame_Shift_Ins_p.S1843fs|ANK3_ENST00000355288.2_Frame_Shift_Ins_p.S976fs	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	4352					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.S4352fs*2(1)|p.S976fs*2(1)		NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						TTTTGCTCAGACCCACTGGACC	0.500																																					p.S4352fs												.	.	2	Insertion - Frameshift(2)	large_intestine(2)	c.13054_13055insG	10						.																																			61485434	SO:0001589	frameshift_variant	288	exon42			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.13054dupG	10.37:g.61815430_61815430dupC	ENSP00000280772:p.Ser4352fs	Somatic		Capture	SOLID	Phase_I	61485433	NM_020987	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Frame_Shift_Ins	INS	ENST00000280772.2	37	CCDS7258.1																																																																																				ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
ADCY1	107	hgsc.bcm.edu	37	7	45725776	45725776	+	Silent	SNP	C	C	T	rs369554390		TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr7:45725776C>T	ENST00000297323.7	+	13	2311	c.2289C>T	c.(2287-2289)taC>taT	p.Y763Y		NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)	763					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)	p.Y763Y(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	CCACGTCCTACATCCTCGTTC	0.557																																					p.Y763Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2289T	7						.	C		0,4406		0,0,2203	89.0	84.0	86.0		2289	2.1	1.0	7		86	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ADCY1	NM_021116.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		763/1120	45725776	1,13005	2203	4300	6503	45692301	SO:0001819	synonymous_variant	107	exon13			L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.2289C>T	7.37:g.45725776C>T		Somatic		Capture	SOLID	Phase_I	45692301	NM_021116	A4D2L8|Q75MI1	Silent	SNP	ENST00000297323.7	37	CCDS34631.1																																																																																				ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340055.2	NM_021116	
IGFBP3	3486	hgsc.bcm.edu	37	7	45956214	45956214	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr7:45956214T>C	ENST00000275521.6	-	3	816	c.683A>G	c.(682-684)aAt>aGt	p.N228S	IGFBP3_ENST00000381083.4_Missense_Mutation_p.N234S|IGFBP3_ENST00000465642.1_5'Flank|IGFBP3_ENST00000381086.5_Missense_Mutation_p.N131S	NM_000598.4|NM_001013398.1	NP_000589.2|NP_001013416.1	P17936	IBP3_HUMAN	insulin-like growth factor binding protein 3	228	Thyroglobulin type-1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				apoptotic process (GO:0006915)|cellular protein metabolic process (GO:0044267)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of signal transduction (GO:0009968)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|osteoblast differentiation (GO:0001649)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of myoblast differentiation (GO:0045663)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of glucose metabolic process (GO:0010906)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|insulin-like growth factor binding protein complex (GO:0016942)|nucleus (GO:0005634)	insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|metal ion binding (GO:0046872)|protein tyrosine phosphatase activator activity (GO:0008160)	p.N228S(1)		large_intestine(6)|lung(7)|pancreas(1)|prostate(3)	17					Mecasermin(DB01277)	ACTCAGCACATTGAGGAACTT	0.473																																					p.N228S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A683G	7						.						198.0	168.0	178.0					7																	45956214		2203	4300	6503	45922739	SO:0001583	missense	3486	exon3				CCDS5505.1, CCDS34632.1	7p12.3	2014-09-17			ENSG00000146674	ENSG00000146674			5472	protein-coding gene	gene with protein product	"""growth hormone-dependent binding protein"", ""acid stable subunit of the 140 K IGF complex"", ""binding protein 53"", ""binding protein 29"", ""IGF-binding protein 3"""	146732				1695633	Standard	NM_000598		Approved	IBP3, BP-53	uc003tnr.3	P17936	OTTHUMG00000023769	ENST00000275521.6:c.683A>G	7.37:g.45956214T>C	ENSP00000275521:p.Asn228Ser	Somatic		Capture	SOLID	Phase_I	45922739	NM_000598	A4D2F5|D3DVM0|Q2V509|Q6P1M6|Q9UCL4	Missense_Mutation	SNP	ENST00000275521.6	37	CCDS5505.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.75|13.75	2.329046|2.329046	0.41197|0.41197	.|.	.|.	ENSG00000146674|ENSG00000146674	ENST00000428530|ENST00000545032;ENST00000275521;ENST00000381086;ENST00000438491;ENST00000442142;ENST00000381083;ENST00000433047;ENST00000448817	.|T;T;T;T	.|0.62788	.|0.0;0.0;0.0;0.07	4.83|4.83	2.43|2.43	0.29744|0.29744	.|Thyroglobulin type-1 (4);	.|0.226647	.|0.43110	.|D	.|0.000615	T|T	0.44561|0.44561	0.1299|0.1299	N|N	0.13327|0.13327	0.33|0.33	0.09310|0.09310	N|N	1|1	.|B;B;B	.|0.28801	.|0.118;0.223;0.223	.|B;B;B	.|0.37692	.|0.071;0.256;0.256	T|T	0.34950|0.34950	-0.9808|-0.9808	5|10	.|0.25751	.|T	.|0.34	-18.3974|-18.3974	7.578|7.578	0.27948|0.27948	0.0:0.1825:0.0:0.8175|0.0:0.1825:0.0:0.8175	.|.	.|131;228;213	.|B3KWK7;P17936;B4DN53	.|.;IBP3_HUMAN;.	V|S	80|205;228;131;214;126;234;200;118	.|ENSP00000275521:N228S;ENSP00000370476:N131S;ENSP00000370473:N234S;ENSP00000389668:N118S	.|ENSP00000275521:N228S	M|N	-|-	1|2	0|0	IGFBP3|IGFBP3	45922739|45922739	1.000000|1.000000	0.71417|0.71417	0.190000|0.190000	0.23270|0.23270	0.952000|0.952000	0.60782|0.60782	5.740000|5.740000	0.68629|0.68629	0.222000|0.222000	0.20900|0.20900	0.533000|0.533000	0.62120|0.62120	ATG|AAT		IGFBP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251356.3	NM_001013398	
CYP3A7	1551	hgsc.bcm.edu	37	7	99328687	99328687	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr7:99328687G>A	ENST00000336374.2	-	2	162	c.160C>T	c.(160-162)Cgt>Tgt	p.R54C		NM_000765.3	NP_000756.2	P24462	CP3A7_HUMAN	cytochrome P450, family 3, subfamily A, polypeptide 7	54					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxygen binding (GO:0019825)	p.R54C(1)		autonomic_ganglia(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	32	Lung NSC(181;0.0144)|Esophageal squamous(72;0.0166)|all_lung(186;0.0228)				Alfentanil(DB00802)|Alprazolam(DB00404)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amlodipine(DB00381)|Aprepitant(DB00673)|Aripiprazole(DB01238)|Astemizole(DB00637)|Atorvastatin(DB01076)|Buprenorphine(DB00921)|Buspirone(DB00490)|Caffeine(DB00201)|Carbamazepine(DB00564)|Chloramphenicol(DB00446)|Chlorphenamine(DB01114)|Cilostazol(DB01166)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisapride(DB00604)|Clarithromycin(DB01211)|Clotrimazole(DB00257)|Cocaine(DB00907)|Codeine(DB00318)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapsone(DB00250)|Delavirdine(DB00705)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diltiazem(DB00343)|Docetaxel(DB01248)|Dolutegravir(DB08930)|Domperidone(DB01184)|Eplerenone(DB00700)|Erythromycin(DB00199)|Estradiol(DB00783)|Ethosuximide(DB00593)|Ethylmorphine(DB01466)|Felodipine(DB01023)|Fentanyl(DB00813)|Finasteride(DB01216)|Fluconazole(DB00196)|Fluticasone Propionate(DB00588)|Fluvoxamine(DB00176)|Gestodene(DB06730)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ifosfamide(DB01181)|Iloperidone(DB04946)|Imatinib(DB00619)|Imipramine(DB00458)|Indinavir(DB00224)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lercanidipine(DB00528)|Levomethadyl Acetate(DB01227)|Lidocaine(DB00281)|Lovastatin(DB00227)|Methadone(DB00333)|Midazolam(DB00683)|Mifepristone(DB00834)|Nateglinide(DB00731)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nifedipine(DB01115)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Norethindrone(DB00717)|Norfloxacin(DB01059)|Ondansetron(DB00904)|Oxazepam(DB00842)|Oxycodone(DB00497)|Paclitaxel(DB01229)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Praziquantel(DB01058)|Progesterone(DB00396)|Propranolol(DB00571)|Quetiapine(DB01224)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Rifapentine(DB01201)|Risperidone(DB00734)|Ritonavir(DB00503)|Salmeterol(DB00938)|Saquinavir(DB01232)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sorafenib(DB00398)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telithromycin(DB00976)|Temsirolimus(DB06287)|Testosterone(DB00624)|Trazodone(DB00656)|Tretinoin(DB00755)|Triazolam(DB00897)|Verapamil(DB00661)|Vincristine(DB00541)|Voriconazole(DB00582)|Zalcitabine(DB00943)|Zaleplon(DB00962)|Ziprasidone(DB00246)|Zolpidem(DB00425)	CTCACCTTACGGAAGGACAAA	0.423																																					p.R54C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C160T	7						.						92.0	82.0	86.0					7																	99328687		2203	4300	6503	99166623	SO:0001583	missense	1551	exon2			AF315325	CCDS5673.1	7q21-q22.1	2007-12-14	2003-01-14		ENSG00000160870	ENSG00000160870		"""Cytochrome P450s"""	2640	protein-coding gene	gene with protein product		605340	"""cytochrome P450, subfamily IIIA, polypeptide 7"""			2722762	Standard	NM_000765		Approved	CP37, P450-HFLA		P24462	OTTHUMG00000156726	ENST00000336374.2:c.160C>T	7.37:g.99328687G>A	ENSP00000337450:p.Arg54Cys	Somatic		Capture	SOLID	Phase_I	99166623	NM_000765	A4D288|Q9H241	Missense_Mutation	SNP	ENST00000336374.2	37	CCDS5673.1	.	.	.	.	.	.	.	.	.	.	G	13.60	2.286909	0.40494	.	.	ENSG00000160870	ENST00000292414;ENST00000336374	T	0.07114	3.22	3.5	0.561	0.17285	.	0.655633	0.12709	U	0.445663	T	0.24160	0.0585	M	0.91196	3.185	0.09310	N	1	D	0.64830	0.994	P	0.58077	0.832	T	0.09840	-1.0656	10	0.59425	D	0.04	.	3.1257	0.06406	0.2399:0.0:0.5515:0.2086	.	54	P24462	CP3A7_HUMAN	C	54	ENSP00000337450:R54C	ENSP00000292414:R54C	R	-	1	0	CYP3A7	99166623	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	0.081000	0.14823	-0.003000	0.14444	-0.350000	0.07774	CGT		CYP3A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345484.1		
STRA8	346673	hgsc.bcm.edu	37	7	134927534	134927534	+	Splice_Site	SNP	G	G	A			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr7:134927534G>A	ENST00000275764.3	+	3	260	c.260G>A	c.(259-261)tGg>tAg	p.W87*		NM_182489.1	NP_872295.1			stimulated by retinoic acid 8									p.W87*(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|skin(1)|urinary_tract(1)	16						TATCCTCAGTGGCAGGTTCTG	0.512																																					p.W87X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G260A	7						.						93.0	92.0	92.0					7																	134927534		2203	4300	6503	134578074	SO:0001630	splice_region_variant	346673	exon3			AF513502	CCDS5839.1	7q33	2012-12-07	2012-12-07		ENSG00000146857	ENSG00000146857			30653	protein-coding gene	gene with protein product		609987	"""stimulated by retinoic acid gene 8 homolog (mouse)"", ""stimulated by retinoic acid 8 homolog (mouse)"""			12489526	Standard	NM_182489		Approved		uc011kpx.2	Q7Z7C7	OTTHUMG00000155415	ENST00000275764.3:c.259-1G>A	7.37:g.134927534G>A		Somatic		Capture	SOLID	Phase_I	134578074	NM_182489		Nonsense_Mutation	SNP	ENST00000275764.3	37	CCDS5839.1	.	.	.	.	.	.	.	.	.	.	G	17.04	3.286551	0.59867	.	.	ENSG00000146857	ENST00000275764	.	.	.	5.14	4.2	0.49525	.	0.404866	0.23879	N	0.043673	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.3448	8.486	0.33071	0.0871:0.0:0.7573:0.1556	.	.	.	.	X	87	.	ENSP00000275764:W87X	W	+	2	0	STRA8	134578074	1.000000	0.71417	1.000000	0.80357	0.528000	0.34623	4.027000	0.57239	2.410000	0.81850	0.455000	0.32223	TGG		STRA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340028.1	NM_182489	Nonsense_Mutation
PCSK2	5126	hgsc.bcm.edu	37	20	17207954	17207954	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr20:17207954A>G	ENST00000262545.2	+	1	319	c.4A>G	c.(4-6)Aag>Gag	p.K2E	PCSK2_ENST00000536609.1_Missense_Mutation_p.K2E|PCSK2_ENST00000377899.1_Intron	NM_002594.3	NP_002585.2	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	2					cellular protein metabolic process (GO:0044267)|embryo development (GO:0009790)|enkephalin processing (GO:0034230)|insulin processing (GO:0030070)|islet amyloid polypeptide processing (GO:0034231)|nervous system development (GO:0007399)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	dendrite (GO:0030425)|extracellular space (GO:0005615)|membrane (GO:0016020)|perikaryon (GO:0043204)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)	p.K2E(1)		breast(2)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|lung(17)|ovary(3)|pancreas(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	53					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	AAGAAGGATGAAGGGTGGTTG	0.532																																					p.K2E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4G	20						.						77.0	81.0	80.0					20																	17207954		2203	4300	6503	17155954	SO:0001583	missense	5126	exon1			AK312341	CCDS13125.1, CCDS56179.1, CCDS56180.1	20p11.2	2008-08-01			ENSG00000125851	ENSG00000125851			8744	protein-coding gene	gene with protein product	"""neuroendocrine convertase 2"", ""KEX2-like endoprotease 2"""	162151		NEC2		1765368	Standard	NM_001201528		Approved	PC2, SPC2	uc002wpm.3	P16519	OTTHUMG00000031941	ENST00000262545.2:c.4A>G	20.37:g.17207954A>G	ENSP00000262545:p.Lys2Glu	Somatic		Capture	SOLID	Phase_I	17155954	NM_002594	B1ANH9|B4DFQ3|Q14927|Q5JYQ1|Q8IWA8|Q9NQG3|Q9NUG1|Q9UJC6	Missense_Mutation	SNP	ENST00000262545.2	37	CCDS13125.1	.	.	.	.	.	.	.	.	.	.	A	5.651	0.304735	0.10678	.	.	ENSG00000125851	ENST00000262545;ENST00000536609	T;T	0.72394	-0.4;-0.65	5.64	1.78	0.24846	.	1.022020	0.07850	N	0.964429	T	0.45013	0.1321	N	0.08118	0	0.09310	N	0.999994	B;B	0.20261	0.003;0.043	B;B	0.19946	0.011;0.027	T	0.30475	-0.9977	10	0.02654	T	1	-9.7843	7.5172	0.27608	0.6366:0.2798:0.0835:0.0	.	2;2	B4DFQ3;P16519	.;NEC2_HUMAN	E	2	ENSP00000262545:K2E;ENSP00000437458:K2E	ENSP00000262545:K2E	K	+	1	0	PCSK2	17155954	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.678000	0.25277	0.415000	0.25817	0.533000	0.62120	AAG		PCSK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078120.2	NM_002594	
SLC12A5	57468	hgsc.bcm.edu	37	20	44676667	44676667	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr20:44676667C>T	ENST00000454036.2	+	16	2073	c.2024C>T	c.(2023-2025)gCg>gTg	p.A675V	SLC12A5_ENST00000243964.3_Missense_Mutation_p.A652V	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	675					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)	p.A652V(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	TCTCTCAGTGCGGCTCGCTAT	0.607																																					p.A652V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1955T	20						.						85.0	66.0	72.0					20																	44676667		2203	4300	6503	44110074	SO:0001583	missense	57468	exon16			AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.2024C>T	20.37:g.44676667C>T	ENSP00000387694:p.Ala675Val	Somatic		Capture	SOLID	Phase_I	44110074	NM_020708	A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Missense_Mutation	SNP	ENST00000454036.2	37	CCDS46610.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.123116	0.77436	.	.	ENSG00000124140	ENST00000454036;ENST00000243964	D;D	0.98732	-5.1;-5.1	3.92	3.92	0.45320	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.98532	0.9510	L	0.58428	1.81	0.80722	D	1	D;D	0.69078	0.997;0.984	D;P	0.63381	0.914;0.651	D	0.99116	1.0848	10	0.66056	D	0.02	.	14.669	0.68929	0.0:1.0:0.0:0.0	.	675;652	Q9H2X9;Q9H2X9-2	S12A5_HUMAN;.	V	675;652	ENSP00000387694:A675V;ENSP00000243964:A652V	ENSP00000243964:A652V	A	+	2	0	SLC12A5	44110074	1.000000	0.71417	0.890000	0.34922	0.341000	0.28922	7.592000	0.82676	1.992000	0.58205	0.455000	0.32223	GCG		SLC12A5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000471538.1		
FAM65C	140876	hgsc.bcm.edu	37	20	49232571	49232571	+	Missense_Mutation	SNP	G	G	A	rs147229572	byFrequency	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr20:49232571G>A	ENST00000327979.2	-	4	715	c.304C>T	c.(304-306)Cgc>Tgc	p.R102C	MIR1302-5_ENST00000408164.1_RNA|FAM65C_ENST00000045083.2_Missense_Mutation_p.R102C|FAM65C_ENST00000535356.1_Missense_Mutation_p.R106C			Q96MK2	FA65C_HUMAN	family with sequence similarity 65, member C	102								p.R102C(2)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(1)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TCTTTGTGGCGTCCAGACAGG	0.542													G|||	2	0.000399361	0.0	0.0	5008	,	,		19561	0.0		0.0	False		,,,				2504	0.002				p.R102C												.	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.C304T	20						.	G	CYS/ARG	4,4402	8.1+/-20.4	0,4,2199	105.0	91.0	96.0		304	-0.7	0.1	20	dbSNP_134	96	0,8600		0,0,4300	no	missense	FAM65C	NM_080829.2	180	0,4,6499	AA,AG,GG		0.0,0.0908,0.0308	benign	102/947	49232571	4,13002	2203	4300	6503	48665978	SO:0001583	missense	140876	exon4			AL133230	CCDS13431.2	20q13.13	2011-11-24	2008-06-13	2008-06-13	ENSG00000042062	ENSG00000042062			16168	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 175"", ""chromosome 20 open reading frame 176"""	C20orf175, C20orf176			Standard	XM_005260294		Approved	dJ530I15.2, dJ530I15.3	uc002xvm.3	Q96MK2	OTTHUMG00000032724	ENST00000327979.2:c.304C>T	20.37:g.49232571G>A	ENSP00000332663:p.Arg102Cys	Somatic		Capture	SOLID	Phase_I	48665978	NM_080829	Q5QPB6|Q9NQQ2	Missense_Mutation	SNP	ENST00000327979.2	37	CCDS13431.2	.	.	.	.	.	.	.	.	.	.	G	10.88	1.474409	0.26423	9.08E-4	0.0	ENSG00000042062	ENST00000327979;ENST00000045083;ENST00000535356	T;T;T	0.02216	4.39;4.39;4.39	5.07	-0.7	0.11273	.	0.321942	0.34700	N	0.003757	T	0.01627	0.0052	L	0.27053	0.805	0.22693	N	0.998845	B;B	0.09022	0.002;0.001	B;B	0.06405	0.002;0.002	T	0.43310	-0.9399	10	0.49607	T	0.09	-14.0537	5.2312	0.15422	0.3895:0.0:0.4795:0.131	.	106;102	F5H0X2;Q96MK2	.;FA65C_HUMAN	C	102;102;106	ENSP00000332663:R102C;ENSP00000045083:R102C;ENSP00000439802:R106C	ENSP00000045083:R102C	R	-	1	0	FAM65C	48665978	0.983000	0.35010	0.123000	0.21794	0.734000	0.41952	2.692000	0.47018	-0.057000	0.13199	-0.263000	0.10527	CGC		FAM65C-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257962.1		
MYT1	4661	hgsc.bcm.edu	37	20	62839475	62839475	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr20:62839475C>T	ENST00000328439.1	+	7	1290	c.926C>T	c.(925-927)cCt>cTt	p.P309L	MYT1_ENST00000536311.1_Missense_Mutation_p.P309L|MYT1_ENST00000360149.4_Intron	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.P309L(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					gaggCAGCTCCTGATGTGATC	0.572																																					p.P309L	GBM(59;481 1041 20555 21139 33705)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C926T	20						.						75.0	76.0	76.0					20																	62839475		2203	4300	6503	62309919	SO:0001583	missense	4661	exon7			M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.926C>T	20.37:g.62839475C>T	ENSP00000327465:p.Pro309Leu	Somatic		Capture	SOLID	Phase_I	62309919	NM_004535	B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Missense_Mutation	SNP	ENST00000328439.1	37	CCDS13558.1	.	.	.	.	.	.	.	.	.	.	c	5.790	0.330040	0.10956	.	.	ENSG00000196132	ENST00000328439;ENST00000536311	T;T	0.70516	-0.49;-0.49	4.6	4.6	0.57074	.	21.670500	0.00783	U	0.001284	T	0.73984	0.3657	L	0.54323	1.7	0.45477	D	0.998448	B	0.26635	0.155	B	0.28139	0.086	T	0.44620	-0.9316	10	0.32370	T	0.25	-0.479	17.4572	0.87610	0.0:1.0:0.0:0.0	.	309	Q01538	MYT1_HUMAN	L	309	ENSP00000327465:P309L;ENSP00000442412:P309L	ENSP00000327465:P309L	P	+	2	0	MYT1	62309919	0.021000	0.18746	0.003000	0.11579	0.020000	0.10135	2.873000	0.48475	2.122000	0.65172	0.552000	0.68991	CCT		MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080297.1	NM_004535	
OR6S1	341799	hgsc.bcm.edu	37	14	21109754	21109755	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	AC	AC	AC	-	AC	AC	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr14:21109754_21109755delAC	ENST00000320704.3	-	1	95_96	c.96_97delGT	c.(94-99)gtgtttfs	p.F33fs		NM_001001968.1	NP_001001968.1	Q8NH40	OR6S1_HUMAN	olfactory receptor, family 6, subfamily S, member 1	33						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F33fs*21(1)		kidney(1)|large_intestine(3)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23	all_cancers(95;0.00304)		Epithelial(56;1.23e-06)|all cancers(55;1.01e-05)	GBM - Glioblastoma multiforme(265;0.0135)		ACAAGAAGAAACACAGAAAATA	0.475																																					p.32_33del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.96_97del	14						.																																			20179595	SO:0001589	frameshift_variant	341799	exon1			AL163636	CCDS32038.1	14q11.2	2013-09-24			ENSG00000181803	ENSG00000181803		"""GPCR / Class A : Olfactory receptors"""	15363	protein-coding gene	gene with protein product							Standard	NM_001001968		Approved	OR6S1Q	uc001vxv.1	Q8NH40	OTTHUMG00000171010	ENST00000320704.3:c.96_97delGT	14.37:g.21109756_21109757delAC	ENSP00000313110:p.Phe33fs	Somatic		Capture	SOLID	Phase_I	20179594	NM_001001968	Q6IFJ9	Frame_Shift_Del	DEL	ENST00000320704.3	37	CCDS32038.1																																																																																				OR6S1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411227.1		
NOVA1	4857	hgsc.bcm.edu	37	14	26917331	26917331	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr14:26917331G>T	ENST00000539517.2	-	5	1675	c.1358C>A	c.(1357-1359)gCa>gAa	p.A453E	NOVA1_ENST00000267422.7_Missense_Mutation_p.A331E|NOVA1_ENST00000465357.2_Missense_Mutation_p.A429E	NM_002515.2	NP_002506.2	P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1	456	KH 3. {ECO:0000255|PROSITE- ProRule:PRU00117}.				locomotory behavior (GO:0007626)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA metabolic process (GO:0051252)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.A453E(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(265;0.0135)		CTGTATCCTTGCACCAGTCAA	0.443																																					p.A453E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1358A	14						.						164.0	133.0	143.0					14																	26917331		2203	4300	6503	25987171	SO:0001583	missense	4857	exon5			U04840	CCDS9635.1, CCDS32060.1, CCDS32061.1	14q12	2006-06-09			ENSG00000139910	ENSG00000139910			7886	protein-coding gene	gene with protein product		602157				8558240	Standard	NM_006489		Approved		uc001wpy.3	P51513	OTTHUMG00000029385	ENST00000539517.2:c.1358C>A	14.37:g.26917331G>T	ENSP00000438875:p.Ala453Glu	Somatic		Capture	SOLID	Phase_I	25987171	NM_002515	A8K0S4|A8K4Q7|D3DS81|D3DS82|Q6B004	Missense_Mutation	SNP	ENST00000539517.2	37	CCDS32061.1	.	.	.	.	.	.	.	.	.	.	G	16.89	3.248467	0.59103	.	.	ENSG00000139910	ENST00000465357;ENST00000539517;ENST00000267422	T;T;T	0.39229	1.09;1.09;1.09	5.92	5.92	0.95590	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.072739	0.56097	D	0.000026	T	0.80347	0.4606	H	0.98664	4.295	0.80722	D	1	D;D;D	0.76494	0.991;0.999;0.999	D;D;D	0.91635	0.992;0.999;0.999	D	0.87278	0.2290	10	0.87932	D	0	-6.1177	20.3151	0.98650	0.0:0.0:1.0:0.0	.	456;429;453	P51513;D3DS81;P51513-4	NOVA1_HUMAN;.;.	E	429;453;331	ENSP00000447391:A429E;ENSP00000438875:A453E;ENSP00000267422:A331E	ENSP00000267422:A331E	A	-	2	0	NOVA1	25987171	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.809000	0.96659	0.467000	0.42956	GCA		NOVA1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000073261.3	NM_006491	
SLC5A5	6528	hgsc.bcm.edu	37	19	18001745	18001745	+	Missense_Mutation	SNP	G	G	A	rs570968775	byFrequency	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr19:18001745G>A	ENST00000222248.3	+	14	2049	c.1702G>A	c.(1702-1704)Gca>Aca	p.A568T		NM_000453.2	NP_000444.1	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium/iodide cotransporter), member 5	568					cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|iodide transport (GO:0015705)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	iodide transmembrane transporter activity (GO:0015111)|sodium:iodide symporter activity (GO:0008507)	p.A568T(1)		NS(2)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						GTGGGACCTCGCACGGCAGAC	0.592													G|||	2	0.000399361	0.0015	0.0	5008	,	,		15903	0.0		0.0	False		,,,				2504	0.0				p.A568T	Melanoma(65;1008 1708 7910 46650)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1702A	19						.						114.0	111.0	112.0					19																	18001745		2203	4300	6503	17862745	SO:0001583	missense	6528	exon14				CCDS12368.1	19p13.11	2013-07-19	2013-07-19		ENSG00000105641	ENSG00000105641		"""Solute carriers"""	11040	protein-coding gene	gene with protein product		601843	"""solute carrier family 5 (sodium iodide symporter), member 5"""			9231811	Standard	NM_000453		Approved	NIS	uc002nhr.4	Q92911		ENST00000222248.3:c.1702G>A	19.37:g.18001745G>A	ENSP00000222248:p.Ala568Thr	Somatic		Capture	SOLID	Phase_I	17862745	NM_000453	O43702|Q2M335|Q9NYB6	Missense_Mutation	SNP	ENST00000222248.3	37	CCDS12368.1	.	.	.	.	.	.	.	.	.	.	G	8.859	0.946508	0.18356	.	.	ENSG00000105641	ENST00000222248	D	0.85088	-1.94	4.71	-3.38	0.04883	.	99.577500	0.00166	N	0.000007	T	0.68430	0.3000	N	0.12182	0.205	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.59611	-0.7422	10	0.10902	T	0.67	.	5.113	0.14819	0.5474:0.0:0.3142:0.1385	.	568	Q92911	SC5A5_HUMAN	T	568	ENSP00000222248:A568T	ENSP00000222248:A568T	A	+	1	0	SLC5A5	17862745	0.000000	0.05858	0.000000	0.03702	0.634000	0.38068	-0.063000	0.11655	-0.811000	0.04369	0.491000	0.48974	GCA		SLC5A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466690.1		
APLP1	333	hgsc.bcm.edu	37	19	36362583	36362583	+	Missense_Mutation	SNP	C	C	T	rs375567499		TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr19:36362583C>T	ENST00000221891.4	+	5	799	c.607C>T	c.(607-609)Cgt>Tgt	p.R203C	APLP1_ENST00000537454.2_Missense_Mutation_p.R164C|APLP1_ENST00000586861.1_Missense_Mutation_p.R197C|NPHS1_ENST00000591817.1_5'Flank	NM_001024807.1|NM_005166.3	NP_001019978.1|NP_005157.1	P51693	APLP1_HUMAN	amyloid beta (A4) precursor-like protein 1	203					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular response to norepinephrine stimulus (GO:0071874)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|mRNA polyadenylation (GO:0006378)|negative regulation of cAMP biosynthetic process (GO:0030818)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|regulation of translation (GO:0006417)	basement membrane (GO:0005604)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|alpha-2B adrenergic receptor binding (GO:0031695)|alpha-2C adrenergic receptor binding (GO:0031696)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|transition metal ion binding (GO:0046914)	p.R203C(1)		breast(4)|endometrium(2)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	33	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GGATCGGTTCCGTGGTGTGGA	0.637																																					p.R203C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C607T	19						.	C	CYS/ARG,CYS/ARG	0,4406		0,0,2203	118.0	105.0	109.0		607,607	4.4	1.0	19		109	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	APLP1	NM_001024807.1,NM_005166.3	180,180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	203/652,203/651	36362583	1,13005	2203	4300	6503	41054423	SO:0001583	missense	333	exon5			U48437	CCDS32997.1	19q	2008-07-15							597	protein-coding gene	gene with protein product	"""amyloid-like protein 1"", ""amyloid precursor-like protein 1"""	104775				8432545	Standard	NM_001024807		Approved	APLP	uc002ocf.3	P51693		ENST00000221891.4:c.607C>T	19.37:g.36362583C>T	ENSP00000221891:p.Arg203Cys	Somatic		Capture	SOLID	Phase_I	41054423	NM_001024807	O00113|Q96A92	Missense_Mutation	SNP	ENST00000221891.4	37	CCDS32997.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.055892	0.76074	0.0	1.16E-4	ENSG00000105290	ENST00000537454;ENST00000221891	D;D	0.94793	-3.45;-3.52	4.41	4.41	0.53225	Amyloidogenic glycoprotein, extracellular (1);Amyloidogenic glycoprotein, copper-binding (3);	0.000000	0.38005	N	0.001850	D	0.96506	0.8860	M	0.67953	2.075	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.995;0.999;0.999	D	0.97053	0.9765	10	0.87932	D	0	-1.2006	14.4685	0.67499	0.0:1.0:0.0:0.0	.	197;164;203;203	B7Z4G8;F5GZ08;P51693-2;P51693	.;.;.;APLP1_HUMAN	C	164;203	ENSP00000441501:R164C;ENSP00000221891:R203C	ENSP00000221891:R203C	R	+	1	0	APLP1	41054423	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.630000	0.46494	2.006000	0.58801	0.462000	0.41574	CGT		APLP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452564.1	NM_001024807	
ZNF260	339324	hgsc.bcm.edu	37	19	37005860	37005860	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr19:37005860T>C	ENST00000523638.1	-	3	1402	c.281A>G	c.(280-282)cAg>cGg	p.Q94R	ZNF260_ENST00000593142.1_Missense_Mutation_p.Q94R|ZNF260_ENST00000588993.1_Missense_Mutation_p.Q94R|ZNF260_ENST00000592282.1_Missense_Mutation_p.Q94R	NM_001166036.1|NM_001166037.1|NM_001166038.1	NP_001159508.1|NP_001159509.1|NP_001159510.1	Q3ZCT1	ZN260_HUMAN	zinc finger protein 260	94					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q94R(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)	15	Esophageal squamous(110;0.162)					GTTTTCCTTCTGGCTGAAGGC	0.398																																					p.Q94R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A281G	19						.						117.0	109.0	112.0					19																	37005860		2203	4300	6503	41697700	SO:0001583	missense	339324	exon3			AK122854	CCDS33003.1	19q13.12	2013-01-08				ENSG00000254004		"""Zinc fingers, C2H2-type"""	13499	protein-coding gene	gene with protein product		613749					Standard	NM_001166036		Approved	ozrf1, Zfp260	uc002oed.2	Q3ZCT1		ENST00000523638.1:c.281A>G	19.37:g.37005860T>C	ENSP00000429803:p.Gln94Arg	Somatic		Capture	SOLID	Phase_I	41697700	NM_001166037	Q0VF43	Missense_Mutation	SNP	ENST00000523638.1	37	CCDS33003.1	.	.	.	.	.	.	.	.	.	.	T	2.116	-0.402600	0.04865	.	.	ENSG00000254004	ENST00000523638	T	0.01139	5.28	4.72	1.41	0.22369	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.00784	0.0026	N	0.16708	0.43	0.09310	N	0.999998	B	0.32781	0.384	B	0.29716	0.106	T	0.49303	-0.8954	9	0.23891	T	0.37	.	3.8914	0.09120	0.1603:0.1839:0.0:0.6558	.	94	Q3ZCT1	ZN260_HUMAN	R	94	ENSP00000429803:Q94R	ENSP00000429803:Q94R	Q	-	2	0	ZNF260	41697700	0.000000	0.05858	0.936000	0.37596	0.014000	0.08584	0.248000	0.18198	0.348000	0.23949	-0.250000	0.11733	CAG		ZNF260-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109564.2	NM_001012756	
AXL	558	hgsc.bcm.edu	37	19	41762482	41762482	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr19:41762482T>C	ENST00000301178.4	+	18	2352	c.2162T>C	c.(2161-2163)cTa>cCa	p.L721P	AXL_ENST00000359092.3_Missense_Mutation_p.L712P|AXL_ENST00000593513.1_Missense_Mutation_p.L453P	NM_001278599.1|NM_021913.3	NP_001265528.1|NP_068713	P30530	UFO_HUMAN	AXL receptor tyrosine kinase	721	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic cell clearance (GO:0043277)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to extracellular stimulus (GO:0031668)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interferon-alpha (GO:0035457)|cellular response to lipopolysaccharide (GO:0071222)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte homeostasis (GO:0034101)|forebrain cell migration (GO:0021885)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|natural killer cell differentiation (GO:0001779)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of tumor necrosis factor production (GO:0032720)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of protein kinase B signaling (GO:0051897)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|phosphatidylserine binding (GO:0001786)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.L712P(1)		breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	48						ATTGAGAGTCTAGCTGACCGT	0.567																																					p.L721P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2162C	19						.						224.0	160.0	181.0					19																	41762482		2203	4300	6503	46454322	SO:0001583	missense	558	exon18			M76125	CCDS12574.1, CCDS12575.1, CCDS62677.1	19q13.1	2013-02-11				ENSG00000167601	2.7.10.1	"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	905	protein-coding gene	gene with protein product		109135				1656220	Standard	NM_021913		Approved	UFO, JTK11	uc010ehj.3	P30530		ENST00000301178.4:c.2162T>C	19.37:g.41762482T>C	ENSP00000301178:p.Leu721Pro	Somatic		Capture	SOLID	Phase_I	46454322	NM_021913	Q8N5L2|Q9UD27	Missense_Mutation	SNP	ENST00000301178.4	37	CCDS12575.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.352748	0.82132	.	.	ENSG00000167601	ENST00000301178;ENST00000359092	D;D	0.85339	-1.97;-1.97	4.49	4.49	0.54785	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000007	D	0.94162	0.8127	H	0.95574	3.69	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.99;0.992	D	0.95514	0.8588	10	0.87932	D	0	-4.2927	13.1778	0.59637	0.0:0.0:0.0:1.0	.	712;721	P30530-2;P30530	.;UFO_HUMAN	P	721;712	ENSP00000301178:L721P;ENSP00000351995:L712P	ENSP00000301178:L721P	L	+	2	0	AXL	46454322	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.743000	0.85020	2.004000	0.58718	0.482000	0.46254	CTA		AXL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463323.2		
DKKL1	27120	hgsc.bcm.edu	37	19	49869073	49869073	+	Silent	SNP	G	G	A			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr19:49869073G>A	ENST00000221498.2	+	4	753	c.348G>A	c.(346-348)gaG>gaA	p.E116E	AC010524.2_ENST00000599433.1_RNA|DKKL1_ENST00000594268.1_Intron	NM_014419.3	NP_055234.1	Q9UK85	DKKL1_HUMAN	dickkopf-like 1	116					anatomical structure morphogenesis (GO:0009653)|positive regulation of fat cell differentiation (GO:0045600)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	signal transducer activity (GO:0004871)	p.E116D(1)|p.E116E(1)		large_intestine(2)|upper_aerodigestive_tract(1)	3		all_lung(116;1.66e-06)|Lung NSC(112;5.89e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0456)		AGACAGGAGAGGTGCTGATCT	0.557																																					p.E41E												.	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(1)|endometrium(1)	c.G123A	19						.						104.0	91.0	95.0					19																	49869073		2203	4300	6503	54560885	SO:0001819	synonymous_variant	27120	exon4			AB047816	CCDS12762.1	19q13.3	2010-10-12	2010-10-12		ENSG00000104901	ENSG00000104901			16528	protein-coding gene	gene with protein product	"""cancer/testis antigen 34"", ""soggy"""	605418	"""dickkopf-like 1 (soggy)"""			10570958	Standard	NM_001197301		Approved	SGY-1, CT34	uc002pnk.3	Q9UK85		ENST00000221498.2:c.348G>A	19.37:g.49869073G>A		Somatic		Capture	SOLID	Phase_I	54560885	NM_001197302		Silent	SNP	ENST00000221498.2	37	CCDS12762.1																																																																																				DKKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465454.2	NM_014419	
KLK4	9622	hgsc.bcm.edu	37	19	51411737	51411737	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr19:51411737C>T	ENST00000324041.1	-	4	489	c.490G>A	c.(490-492)Gtg>Atg	p.V164M	KLK4_ENST00000431178.2_Intron|KLK4_ENST00000597441.1_5'Flank	NM_004917.3	NP_004908.3	Q9Y5K2	KLK4_HUMAN	kallikrein-related peptidase 4	164	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				amelogenesis (GO:0097186)|extracellular matrix disassembly (GO:0022617)|protein catabolic process (GO:0030163)|proteolysis (GO:0006508)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.V164M(1)		autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(8)	19		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00624)|GBM - Glioblastoma multiforme(134;0.00878)		CACTGCAGCACGGTAGGCATT	0.637																																					p.V164M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G490A	19						.						121.0	103.0	109.0					19																	51411737		2203	4300	6503	56103549	SO:0001583	missense	9622	exon4			AF113141	CCDS12809.1	19q13.41	2014-09-04	2006-10-27		ENSG00000167749	ENSG00000167749		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6365	protein-coding gene	gene with protein product		603767	"""kallikrein 4 (prostase, enamel matrix, prostate)"""	PRSS17		10077646, 10438493, 16800724, 10863090, 9465170	Standard	XM_005259441		Approved	EMSP, EMSP1, PSTS, KLK-L1	uc002pua.1	Q9Y5K2	OTTHUMG00000182964	ENST00000324041.1:c.490G>A	19.37:g.51411737C>T	ENSP00000326159:p.Val164Met	Somatic		Capture	SOLID	Phase_I	56103549	NM_004917	Q4VB16|Q96RU5|Q9GZL6|Q9UBJ6	Missense_Mutation	SNP	ENST00000324041.1	37	CCDS12809.1	.	.	.	.	.	.	.	.	.	.	c	13.69	2.311525	0.40895	.	.	ENSG00000167749	ENST00000324041	D	0.89485	-2.52	3.79	-1.38	0.09027	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	1.166990	0.06753	N	0.780305	D	0.90741	0.7094	M	0.62723	1.935	0.09310	N	1	D	0.71674	0.998	P	0.60012	0.867	T	0.79914	-0.1602	10	0.52906	T	0.07	.	6.0276	0.19663	0.0:0.3258:0.4732:0.201	.	164	Q9Y5K2	KLK4_HUMAN	M	164	ENSP00000326159:V164M	ENSP00000326159:V164M	V	-	1	0	KLK4	56103549	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.344000	0.07780	-0.222000	0.09958	-0.291000	0.09656	GTG		KLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464449.1	NM_004917	
PIP5K1C	23396	hgsc.bcm.edu	37	19	3646020	3646020	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr19:3646020C>T	ENST00000335312.3	-	11	1385	c.1297G>A	c.(1297-1299)Gag>Aag	p.E433K	PIP5K1C_ENST00000537021.1_Missense_Mutation_p.E433K|PIP5K1C_ENST00000589578.1_Missense_Mutation_p.E433K|PIP5K1C_ENST00000539785.1_Missense_Mutation_p.E433K	NM_001195733.1|NM_012398.2	NP_001182662.1|NP_036530.1	O60331	PI51C_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type I, gamma	433	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				actin cytoskeleton organization (GO:0030036)|adherens junction assembly (GO:0034333)|axon guidance (GO:0007411)|clathrin-mediated endocytosis (GO:0072583)|cytoskeletal anchoring at plasma membrane (GO:0007016)|neutrophil chemotaxis (GO:0030593)|phagocytosis (GO:0006909)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet aggregation (GO:0070527)|single organismal cell-cell adhesion (GO:0016337)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle exocytosis (GO:0016079)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|uropod (GO:0001931)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)	p.E433K(1)		large_intestine(3)|ovary(1)|skin(3)|stomach(2)	9		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.95e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0026)|STAD - Stomach adenocarcinoma(1328;0.183)		AAAAAGCGCTCGGCATAGAAG	0.627																																					p.E433K	Esophageal Squamous(135;99 1744 12852 27186 39851)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1297A	19						.						69.0	71.0	70.0					19																	3646020		2203	4300	6503	3597020	SO:0001583	missense	23396	exon11			AB011161	CCDS32872.1, CCDS56074.1, CCDS74257.1	19p13.3	2012-10-02			ENSG00000186111	ENSG00000186111			8996	protein-coding gene	gene with protein product		606102				9535851	Standard	NM_001195733		Approved	PIP5Kgamma, KIAA0589, LCCS3	uc002lyj.2	O60331	OTTHUMG00000180870	ENST00000335312.3:c.1297G>A	19.37:g.3646020C>T	ENSP00000335333:p.Glu433Lys	Somatic		Capture	SOLID	Phase_I	3597020	NM_001195733	B7Z9E7|C6GIJ7|C6GIJ8|Q7LE07	Missense_Mutation	SNP	ENST00000335312.3	37	CCDS32872.1	.	.	.	.	.	.	.	.	.	.	c	17.82	3.483594	0.63962	.	.	ENSG00000186111	ENST00000335312;ENST00000539785;ENST00000537021	T;T;T	0.28666	1.6;1.6;1.6	3.98	3.98	0.46160	Phosphatidylinositol-4-phosphate 5-kinase, core (2);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	0.053444	0.64402	U	0.000001	T	0.20740	0.0499	N	0.17764	0.52	0.44207	D	0.997035	B;B	0.28291	0.172;0.206	B;B	0.25884	0.038;0.064	T	0.05801	-1.0863	10	0.31617	T	0.26	-30.0609	15.4003	0.74834	0.0:1.0:0.0:0.0	.	433;433	O60331-3;O60331	.;PI51C_HUMAN	K	433	ENSP00000335333:E433K;ENSP00000445992:E433K;ENSP00000444779:E433K	ENSP00000335333:E433K	E	-	1	0	PIP5K1C	3597020	1.000000	0.71417	0.989000	0.46669	0.939000	0.58152	7.586000	0.82596	1.941000	0.56285	0.306000	0.20318	GAG		PIP5K1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453432.2	NM_012398	
NLRP4	147945	hgsc.bcm.edu	37	19	56369458	56369458	+	Silent	SNP	C	C	T	rs577037043		TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr19:56369458C>T	ENST00000301295.6	+	3	1121	c.699C>T	c.(697-699)ttC>ttT	p.F233F	NLRP4_ENST00000346986.5_Silent_p.F233F|NLRP4_ENST00000587891.1_Silent_p.F158F	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	233	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)	p.F233F(1)		breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		TCGACAGCTTCGAAGAGCTGC	0.547													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18261	0.0		0.0	False		,,,				2504	0.0				p.F233F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C699T	19						.						81.0	82.0	82.0					19																	56369458		2203	4300	6503	61061270	SO:0001819	synonymous_variant	147945	exon3			AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.699C>T	19.37:g.56369458C>T		Somatic		Capture	SOLID	Phase_I	61061270	NM_134444	Q86W87|Q96AY6	Silent	SNP	ENST00000301295.6	37	CCDS12936.1																																																																																				NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457367.2	NM_134444	
TRIM55	84675	hgsc.bcm.edu	37	8	67066483	67066483	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr8:67066483C>T	ENST00000315962.4	+	9	1811	c.1438C>T	c.(1438-1440)Cgg>Tgg	p.R480W	TRIM55_ENST00000350034.4_Intron|TRIM55_ENST00000276573.7_Missense_Mutation_p.R480W|TRIM55_ENST00000353317.5_Intron	NM_184085.1	NP_908973.1	Q9BYV6	TRI55_HUMAN	tripartite motif containing 55	480					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)	p.R480W(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	39		Lung NSC(129;0.138)|all_lung(136;0.221)	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)			TTCGAATGTACGGAAGGCAGA	0.567																																					p.R480W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1438T	8						.						74.0	70.0	71.0					8																	67066483		2203	4300	6503	67229037	SO:0001583	missense	84675	exon9			AJ291712	CCDS6184.1, CCDS6185.1, CCDS6186.1, CCDS6187.1	8q13.1	2013-01-09	2011-01-25	2004-11-17	ENSG00000147573	ENSG00000147573		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	14215	protein-coding gene	gene with protein product		606469	"""ring finger protein 29"", ""tripartite motif-containing 55"""	RNF29		11243782	Standard	NM_033058		Approved	MURF-2	uc003xvv.3	Q9BYV6	OTTHUMG00000164473	ENST00000315962.4:c.1438C>T	8.37:g.67066483C>T	ENSP00000323913:p.Arg480Trp	Somatic		Capture	SOLID	Phase_I	67229037	NM_184085	B3KRC0|B3KRJ3|Q53XX3|Q8IUD9|Q8IUE4|Q96DV2|Q96DV3|Q9BYV5	Missense_Mutation	SNP	ENST00000315962.4	37	CCDS6184.1	.	.	.	.	.	.	.	.	.	.	C	17.17	3.321604	0.60634	.	.	ENSG00000147573	ENST00000315962;ENST00000276573	T;T	0.32272	1.51;1.46	5.89	5.89	0.94794	.	0.240977	0.29799	N	0.011164	T	0.18676	0.0448	N	0.14661	0.345	0.80722	D	1	D;D	0.60160	0.978;0.987	B;B	0.39152	0.153;0.292	T	0.02813	-1.1107	10	0.87932	D	0	.	13.0362	0.58873	0.2006:0.7994:0.0:0.0	.	480;480	Q9BYV6;Q9BYV6-3	TRI55_HUMAN;.	W	480	ENSP00000323913:R480W;ENSP00000276573:R480W	ENSP00000276573:R480W	R	+	1	2	TRIM55	67229037	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	3.615000	0.54167	2.801000	0.96364	0.650000	0.86243	CGG		TRIM55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378921.1	NM_184085	
EXOSC10	5394	hgsc.bcm.edu	37	1	11147910	11147910	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr1:11147910C>T	ENST00000376936.4	-	8	941	c.892G>A	c.(892-894)Gtg>Atg	p.V298M	EXOSC10_ENST00000304457.7_Missense_Mutation_p.V298M|EXOSC10_ENST00000544779.1_Missense_Mutation_p.V298M	NM_001001998.1	NP_001001998.1	Q01780	EXOSX_HUMAN	exosome component 10	298					CUT catabolic process (GO:0071034)|dosage compensation by inactivation of X chromosome (GO:0009048)|histone mRNA catabolic process (GO:0071044)|maturation of 5.8S rRNA (GO:0000460)|nuclear mRNA surveillance (GO:0071028)|nuclear polyadenylation-dependent rRNA catabolic process (GO:0071035)|nuclear retention of unspliced pre-mRNA at the site of transcription (GO:0071048)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)	cytoplasm (GO:0005737)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	3'-5' exonuclease activity (GO:0008408)|exoribonuclease activity (GO:0004532)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.V298M(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|stomach(3)|upper_aerodigestive_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.18e-07)|COAD - Colon adenocarcinoma(227;8.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000315)|Kidney(185;0.000832)|KIRC - Kidney renal clear cell carcinoma(229;0.00269)|READ - Rectum adenocarcinoma(331;0.0526)|STAD - Stomach adenocarcinoma(313;0.202)		TTGAGTTCCACGAGTTCATCC	0.373																																					p.V298M	Colon(179;105 1987 14326 27364 29542)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G892A	1						.						108.0	105.0	106.0					1																	11147910		2203	4300	6503	11070497	SO:0001583	missense	5394	exon8			BC073788	CCDS126.1, CCDS30584.1	1p36.22	2008-02-05	2004-06-16	2004-06-18	ENSG00000171824	ENSG00000171824			9138	protein-coding gene	gene with protein product	"""polymyositis/scleroderma autoantigen 2 (100kD)"""	605960	"""polymyositis/scleroderma autoantigen 2, 100kDa"""	PMSCL2		1383382, 1644924	Standard	NM_001001998		Approved	PM-Scl, PM/Scl-100, Rrp6p, RRP6, p2, p3, p4	uc001asa.3	Q01780	OTTHUMG00000002123	ENST00000376936.4:c.892G>A	1.37:g.11147910C>T	ENSP00000366135:p.Val298Met	Somatic		Capture	SOLID	Phase_I	11070497	NM_001001998	B1AKQ0|B1AKQ1|Q15158	Missense_Mutation	SNP	ENST00000376936.4	37	CCDS30584.1	.	.	.	.	.	.	.	.	.	.	C	19.39	3.817558	0.70912	.	.	ENSG00000171824	ENST00000376936;ENST00000304457;ENST00000544779	T;T;T	0.63255	-0.03;-0.03;-0.03	6.17	6.17	0.99709	-5&apos (2);Ribonuclease H-like (1); exonuclease (2);3&apos (2);	0.051548	0.85682	D	0.000000	T	0.58637	0.2136	L	0.39397	1.21	0.80722	D	1	P;P	0.45011	0.817;0.848	B;B	0.40782	0.23;0.34	T	0.59241	-0.7491	10	0.48119	T	0.1	-28.2667	19.8676	0.96824	0.0:1.0:0.0:0.0	.	298;298	Q01780-2;Q01780	.;EXOSX_HUMAN	M	298	ENSP00000366135:V298M;ENSP00000307307:V298M;ENSP00000439473:V298M	ENSP00000307307:V298M	V	-	1	0	EXOSC10	11070497	1.000000	0.71417	0.964000	0.40570	0.802000	0.45316	7.722000	0.84778	2.941000	0.99782	0.655000	0.94253	GTG		EXOSC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000006078.1	NM_001001998	
SPAG17	200162	hgsc.bcm.edu	37	1	118526448	118526448	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr1:118526448G>A	ENST00000336338.5	-	42	5923	c.5858C>T	c.(5857-5859)tCt>tTt	p.S1953F	SPAG17_ENST00000492438.1_5'UTR	NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1953						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)		p.S1953F(1)		NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		ATTAAGATCAGATGTATCTTG	0.348																																					p.S1953F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5858T	1						.						152.0	142.0	145.0					1																	118526448		2202	4300	6502	118327971	SO:0001583	missense	200162	exon42				CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.5858C>T	1.37:g.118526448G>A	ENSP00000337804:p.Ser1953Phe	Somatic		Capture	SOLID	Phase_I	118327971	NM_206996	Q8NAZ1|Q9NT21	Missense_Mutation	SNP	ENST00000336338.5	37	CCDS899.1	.	.	.	.	.	.	.	.	.	.	G	11.59	1.683931	0.29872	.	.	ENSG00000155761	ENST00000336338;ENST00000437255	T	0.20598	2.06	4.9	-0.505	0.11993	.	1.075620	0.07025	N	0.827489	T	0.07413	0.0187	M	0.70595	2.14	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.40213	-0.9575	10	0.45353	T	0.12	.	1.1453	0.01774	0.1735:0.1512:0.3627:0.3126	.	1953	Q6Q759	SPG17_HUMAN	F	1953;433	ENSP00000337804:S1953F	ENSP00000337804:S1953F	S	-	2	0	SPAG17	118327971	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	0.028000	0.13644	-0.169000	0.10834	-0.274000	0.10170	TCT		SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033723.1	NM_206996	
ITGA10	8515	hgsc.bcm.edu	37	1	145533509	145533509	+	Silent	SNP	G	G	A			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr1:145533509G>A	ENST00000369304.3	+	12	1567	c.1392G>A	c.(1390-1392)caG>caA	p.Q464Q	ITGA10_ENST00000539363.1_Silent_p.Q321Q|ITGA10_ENST00000538811.1_Silent_p.Q333Q	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	464					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)	p.Q464Q(1)		NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TCGCCTTCCAGCTTAAGAAAG	0.562																																					p.Q464Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1392A	1						.						52.0	56.0	54.0					1																	145533509		2203	4300	6503	144244866	SO:0001819	synonymous_variant	8515	exon12			AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.1392G>A	1.37:g.145533509G>A		Somatic		Capture	SOLID	Phase_I	144244866	NM_003637	B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Silent	SNP	ENST00000369304.3	37	CCDS918.1																																																																																				ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038537.2	NM_003637	
POGZ	23126	hgsc.bcm.edu	37	1	151378125	151378125	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr1:151378125G>T	ENST00000271715.2	-	19	3700	c.3386C>A	c.(3385-3387)tCt>tAt	p.S1129Y	POGZ_ENST00000531094.1_Missense_Mutation_p.S1067Y|POGZ_ENST00000392723.1_Missense_Mutation_p.S1076Y|POGZ_ENST00000368863.2_Missense_Mutation_p.S1034Y|POGZ_ENST00000409503.1_Missense_Mutation_p.S1120Y|POGZ_ENST00000361398.3_Missense_Mutation_p.S1076Y|POGZ_ENST00000491586.1_Missense_Mutation_p.S1085Y|POGZ_ENST00000540984.1_Missense_Mutation_p.S491Y	NM_001194937.1|NM_015100.3	NP_001181866.1|NP_055915.2	Q7Z3K3	POGZ_HUMAN	pogo transposable element with ZNF domain	1129	DDE.				kinetochore assembly (GO:0051382)|mitotic sister chromatid cohesion (GO:0007064)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S1129Y(1)		NS(1)|breast(1)|endometrium(10)|kidney(3)|large_intestine(10)|liver(2)|lung(11)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	47	Lung SC(34;0.00471)|Ovarian(49;0.00672)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			CAGGAACAAAGAGATCTCATC	0.478																																					p.S1034Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3101A	1						.						128.0	113.0	118.0					1																	151378125		2203	4300	6503	149644749	SO:0001583	missense	23126	exon17			AB007930	CCDS997.1, CCDS998.1, CCDS44222.1, CCDS44222.2, CCDS53365.1, CCDS53366.1	1q21.1	2013-07-22			ENSG00000143442	ENSG00000143442			18801	protein-coding gene	gene with protein product	"""zinc finger protein 280E"", ""putative protein product of Nbla00003"""	614787				10976766	Standard	NM_015100		Approved	KIAA0461, ZNF635m, ZNF280E	uc001eyd.2	Q7Z3K3	OTTHUMG00000012499	ENST00000271715.2:c.3386C>A	1.37:g.151378125G>T	ENSP00000271715:p.Ser1129Tyr	Somatic		Capture	SOLID	Phase_I	149644749	NM_145796	B4DTP8|B4DYL9|B7ZBY5|E9PM80|O75049|Q3LIC4|Q5SZS1|Q5SZS2|Q5SZS3|Q5SZS4|Q8TDZ7|Q9Y4X7	Missense_Mutation	SNP	ENST00000271715.2	37	CCDS997.1	.	.	.	.	.	.	.	.	.	.	G	12.27	1.887340	0.33348	.	.	ENSG00000143442	ENST00000392723;ENST00000271715;ENST00000361398;ENST00000368863;ENST00000409503;ENST00000531094;ENST00000540984;ENST00000491586	T;T;T;T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87	5.97	5.97	0.96955	.	0.000000	0.64402	D	0.000002	T	0.51398	0.1672	L	0.40543	1.245	0.53688	D	0.999975	D;D;D;D;D;D	0.71674	0.998;0.998;0.998;0.998;0.994;0.998	D;D;D;D;D;D	0.79108	0.987;0.987;0.992;0.992;0.989;0.987	T	0.51568	-0.8689	10	0.87932	D	0	-18.7185	18.9877	0.92779	0.0:0.0:1.0:0.0	.	1067;1120;1034;1085;1076;1129	E9PM80;B7ZBY5;Q7Z3K3-5;Q7Z3K3-3;Q7Z3K3-2;Q7Z3K3	.;.;.;.;.;POGZ_HUMAN	Y	1076;1129;1076;1034;1120;1067;491;1085	ENSP00000376484:S1076Y;ENSP00000271715:S1129Y;ENSP00000354467:S1076Y;ENSP00000357856:S1034Y;ENSP00000386836:S1120Y;ENSP00000431259:S1067Y;ENSP00000443547:S491Y;ENSP00000418408:S1085Y	ENSP00000271715:S1129Y	S	-	2	0	POGZ	149644749	1.000000	0.71417	1.000000	0.80357	0.192000	0.23643	6.844000	0.75390	2.828000	0.97474	0.655000	0.94253	TCT		POGZ-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034915.2	NM_207171	
EPHX1	2052	hgsc.bcm.edu	37	1	226027015	226027015	+	Silent	SNP	G	G	A			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr1:226027015G>A	ENST00000366837.4	+	5	886	c.690G>A	c.(688-690)ctG>ctA	p.L230L	EPHX1_ENST00000272167.5_Silent_p.L230L|RP11-285F7.2_ENST00000424332.1_RNA	NM_000120.3	NP_000111.1	P07099	HYEP_HUMAN	epoxide hydrolase 1, microsomal (xenobiotic)	230					aromatic compound catabolic process (GO:0019439)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cis-stilbene-oxide hydrolase activity (GO:0033961)|epoxide hydrolase activity (GO:0004301)	p.L230L(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	28	Breast(184;0.197)					GGGGGTCCCTGATCTGCACTA	0.557																																					p.L230L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G690A	1						.						73.0	83.0	80.0					1																	226027015		2203	4300	6503	224093638	SO:0001819	synonymous_variant	2052	exon5			J03518	CCDS1547.1	1q42.1	2009-07-10			ENSG00000143819	ENSG00000143819	3.3.2.9		3401	protein-coding gene	gene with protein product		132810		EPHX		9925921	Standard	NM_000120		Approved		uc001hpk.3	P07099	OTTHUMG00000037743	ENST00000366837.4:c.690G>A	1.37:g.226027015G>A		Somatic		Capture	SOLID	Phase_I	224093638	NM_001136018	B2R8N0|Q5VTJ6|Q9NP75|Q9NPE7|Q9NQU6|Q9NQU7|Q9NQU8|Q9NQU9|Q9NQV0|Q9NQV1|Q9NQV2	Silent	SNP	ENST00000366837.4	37	CCDS1547.1																																																																																				EPHX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092064.1	NM_000120	
C8B	732	hgsc.bcm.edu	37	1	57422511	57422511	+	Missense_Mutation	SNP	C	C	T	rs12067507	byFrequency	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr1:57422511C>T	ENST00000371237.4	-	3	388	c.322G>A	c.(322-324)Gaa>Aaa	p.E108K	C8B_ENST00000543257.1_Missense_Mutation_p.E56K|C8B_ENST00000535057.1_Missense_Mutation_p.E46K	NM_000066.2	NP_000057	P07358	CO8B_HUMAN	complement component 8, beta polypeptide	108	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.		E -> K (in dbSNP:rs12067507).		complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)|vesicle (GO:0031982)		p.E108K(1)		breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	52						ACACAGTCTTCGACTTCCTTG	0.498													C|||	208	0.0415335	0.0575	0.0331	5008	,	,		20252	0.0		0.0547	False		,,,				2504	0.0552				p.E108K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G322A	1						.	C	LYS/GLU	288,4118	159.2+/-191.8	8,272,1923	257.0	237.0	244.0		322	4.5	0.9	1	dbSNP_120	244	479,8121	140.5+/-197.0	14,451,3835	yes	missense	C8B	NM_000066.2	56	22,723,5758	TT,TC,CC		5.5698,6.5365,5.8973	probably-damaging	108/592	57422511	767,12239	2203	4300	6503	57195099	SO:0001583	missense	732	exon3			M16973	CCDS30730.1, CCDS60151.1, CCDS60152.1	1p32.2	2014-09-17			ENSG00000021852	ENSG00000021852		"""Complement system"""	1353	protein-coding gene	gene with protein product		120960					Standard	NM_000066		Approved		uc001cyp.3	P07358	OTTHUMG00000008305	ENST00000371237.4:c.322G>A	1.37:g.57422511C>T	ENSP00000360281:p.Glu108Lys	Somatic		Capture	SOLID	Phase_I	57195099	NM_000066	A1L4K7	Missense_Mutation	SNP	ENST00000371237.4	37	CCDS30730.1	90	0.04120879120879121	34	0.06910569105691057	16	0.04419889502762431	0	0.0	40	0.052770448548812667	C	24.7	4.557566	0.86231	0.065365	0.055698	ENSG00000021852	ENST00000371237;ENST00000543257;ENST00000535057	T;T;T	0.27557	2.16;2.16;1.66	5.41	4.47	0.54385	.	0.101764	0.64402	D	0.000002	T	0.05181	0.0138	L	0.37697	1.125	0.58432	D	0.999996	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.987;0.997;0.97	T	0.00918	-1.1515	10	0.35671	T	0.21	-27.0469	15.8821	0.79211	0.0:0.864:0.136:0.0	rs12067507;rs52799290;rs56715593;rs12067507	56;46;108	F5H7G1;F5GY80;P07358	.;.;CO8B_HUMAN	K	108;56;46	ENSP00000360281:E108K;ENSP00000442548:E56K;ENSP00000440113:E46K	ENSP00000360281:E108K	E	-	1	0	C8B	57195099	0.990000	0.36364	0.911000	0.35937	0.704000	0.40688	2.981000	0.49329	1.370000	0.46153	0.650000	0.86243	GAA		C8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022886.2		
SLC35F3	148641	hgsc.bcm.edu	37	1	234452357	234452357	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr1:234452357G>A	ENST00000366617.3	+	4	859	c.631G>A	c.(631-633)Gcc>Acc	p.A211T	SLC35F3_ENST00000366618.3_Missense_Mutation_p.A280T			Q8IY50	S35F3_HUMAN	solute carrier family 35, member F3	211					thiamine transport (GO:0015888)	integral component of membrane (GO:0016021)		p.A280T(2)		breast(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|urinary_tract(1)	32	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)			GATTGTGGCCGCCATCCTCGC	0.582																																					p.A280T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G838A	1						.						290.0	288.0	289.0					1																	234452357		2203	4300	6503	232518980	SO:0001583	missense	148641	exon5				CCDS1600.1, CCDS73050.1	1q42.3	2013-05-22			ENSG00000183780	ENSG00000183780		"""Solute carriers"""	23616	protein-coding gene	gene with protein product							Standard	XM_005273070		Approved	FLJ37712	uc001hvy.1	Q8IY50	OTTHUMG00000037929	ENST00000366617.3:c.631G>A	1.37:g.234452357G>A	ENSP00000355576:p.Ala211Thr	Somatic		Capture	SOLID	Phase_I	232518980	NM_173508	Q5TDD6|Q8N9C9	Missense_Mutation	SNP	ENST00000366617.3	37		.	.	.	.	.	.	.	.	.	.	G	36	5.647260	0.96714	.	.	ENSG00000183780	ENST00000366618;ENST00000366617	T;T	0.63096	-0.02;-0.02	5.73	5.73	0.89815	Drug/metabolite transporter (1);	0.000000	0.85682	D	0.000000	T	0.72938	0.3523	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.74166	-0.3753	10	0.62326	D	0.03	-24.8442	19.8785	0.96886	0.0:0.0:1.0:0.0	.	211;280	Q8IY50;Q8IY50-2	S35F3_HUMAN;.	T	280;211	ENSP00000355577:A280T;ENSP00000355576:A211T	ENSP00000355576:A211T	A	+	1	0	SLC35F3	232518980	1.000000	0.71417	0.985000	0.45067	0.908000	0.53690	9.860000	0.99555	2.695000	0.91970	0.655000	0.94253	GCC		SLC35F3-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000128322.1	NM_173508	
BTBD10	84280	hgsc.bcm.edu	37	11	13443359	13443359	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr11:13443359C>A	ENST00000278174.5	-	3	373	c.128G>T	c.(127-129)gGa>gTa	p.G43V	BTBD10_ENST00000528120.1_5'UTR|BTBD10_ENST00000530907.1_Missense_Mutation_p.G51V|BTBD10_ENST00000532261.1_5'UTR	NM_032320.5	NP_115696.2	Q9BSF8	BTBDA_HUMAN	BTB (POZ) domain containing 10	43						nucleus (GO:0005634)		p.G43V(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(7)|prostate(1)	20				Epithelial(150;0.0214)		GTGGTCAACTCCTCCTTTAGC	0.393																																					p.G43V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G128T	11						.						89.0	78.0	82.0					11																	13443359		2200	4294	6494	13399935	SO:0001583	missense	84280	exon3			AY221959	CCDS7811.1, CCDS73261.1	11p15.2	2013-01-24			ENSG00000148925	ENSG00000148925		"""BTB/POZ domain containing"""	21445	protein-coding gene	gene with protein product		615933				15556295	Standard	XM_005253164		Approved	GMRP1, GMRP-1, MGC13007	uc001mkz.3	Q9BSF8	OTTHUMG00000165787	ENST00000278174.5:c.128G>T	11.37:g.13443359C>A	ENSP00000278174:p.Gly43Val	Somatic		Capture	SOLID	Phase_I	13399935	NM_032320	B7Z228|Q86WG1	Missense_Mutation	SNP	ENST00000278174.5	37	CCDS7811.1	.	.	.	.	.	.	.	.	.	.	C	10.83	1.459782	0.26248	.	.	ENSG00000148925	ENST00000278174;ENST00000530907;ENST00000529708;ENST00000526841	T;T	0.29655	1.56;1.57	5.11	1.0	0.19881	.	0.407398	0.23926	N	0.043189	T	0.11452	0.0279	N	0.08118	0	0.80722	D	1	B;B;B;B	0.06786	0.001;0.001;0.001;0.001	B;B;B;B	0.06405	0.002;0.002;0.002;0.002	T	0.14117	-1.0484	10	0.21014	T	0.42	-30.3318	3.2577	0.06837	0.1985:0.4645:0.2448:0.0922	.	12;51;43;43	B7Z2J1;B7Z228;D3DQW7;Q9BSF8	.;.;.;BTBDA_HUMAN	V	43;51;43;43	ENSP00000278174:G43V;ENSP00000431186:G51V	ENSP00000278174:G43V	G	-	2	0	BTBD10	13399935	0.997000	0.39634	0.889000	0.34880	0.892000	0.51952	0.677000	0.25262	0.016000	0.14998	-0.136000	0.14681	GGA		BTBD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386200.1	NM_032320	
ABCC8	6833	hgsc.bcm.edu	37	11	17426153	17426153	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr11:17426153C>T	ENST00000389817.3	-	28	3531	c.3463G>A	c.(3463-3465)Gtc>Atc	p.V1155I	ABCC8_ENST00000302539.4_Missense_Mutation_p.V1156I			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	1155	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)	p.V1155I(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	TAGGAGATGACGGCCAGGGCT	0.597																																					p.V1155I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3463A	11						.						97.0	66.0	76.0					11																	17426153		2200	4293	6493	17382729	SO:0001583	missense	6833	exon28			L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.3463G>A	11.37:g.17426153C>T	ENSP00000374467:p.Val1155Ile	Somatic		Capture	SOLID	Phase_I	17382729	NM_000352	A6NMX8|E3UYX6|O75948|Q16583	Missense_Mutation	SNP	ENST00000389817.3	37	CCDS31437.1	.	.	.	.	.	.	.	.	.	.	C	18.59	3.655879	0.67586	.	.	ENSG00000006071	ENST00000389817;ENST00000302539	D;D	0.90197	-2.63;-2.63	5.32	5.32	0.75619	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.89972	0.6870	L	0.58583	1.82	0.80722	D	1	B	0.24092	0.097	B	0.27262	0.078	D	0.87259	0.2278	10	0.52906	T	0.07	.	19.0064	0.92852	0.0:1.0:0.0:0.0	.	1155	Q09428	ABCC8_HUMAN	I	1155;1156	ENSP00000374467:V1155I;ENSP00000303960:V1156I	ENSP00000303960:V1156I	V	-	1	0	ABCC8	17382729	1.000000	0.71417	0.993000	0.49108	0.987000	0.75469	7.805000	0.86005	2.477000	0.83638	0.514000	0.50259	GTC		ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389093.1	NM_000352	
SPA17	53340	hgsc.bcm.edu	37	11	124545187	124545187	+	Silent	SNP	C	C	T	rs368335369		TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr11:124545187C>T	ENST00000532692.1	+	1	1448	c.27C>T	c.(25-27)caC>caT	p.H9H	SIAE_ENST00000545756.1_5'Flank|SIAE_ENST00000525730.1_5'UTR|SPA17_ENST00000227135.2_Silent_p.H9H|SIAE_ENST00000263593.3_5'Flank			Q15506	SP17_HUMAN	sperm autoantigenic protein 17	9					binding of sperm to zona pellucida (GO:0007339)|epithelial cilium movement (GO:0003351)|single fertilization (GO:0007338)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|membrane (GO:0016020)|motile cilium (GO:0031514)|primary cilium (GO:0072372)		p.H9H(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)	5	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0223)		CCAACACCCACTACCGAATTC	0.418													C|||	1	0.000199681	0.0	0.0	5008	,	,		17550	0.0		0.0	False		,,,				2504	0.001				p.H9H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C27T	11						.	C	,	0,4402		0,0,2201	112.0	108.0	109.0		,27	-0.2	1.0	11		109	1,8597	1.2+/-3.3	0,1,4298	no	utr-5,coding-synonymous	SPA17,SIAE	NM_001199922.1,NM_017425.3	,	0,1,6499	TT,TC,CC		0.0116,0.0,0.0077	,	,9/152	124545187	1,12999	2201	4299	6500	124050397	SO:0001819	synonymous_variant	53340	exon2			AF334735	CCDS8450.1	11q24.2	2009-03-12			ENSG00000064199	ENSG00000064199			11210	protein-coding gene	gene with protein product	"""cancer/testis antigen 22"""	608621				8688458	Standard	NM_017425		Approved	SP17, CT22	uc001qap.3	Q15506	OTTHUMG00000165927	ENST00000532692.1:c.27C>T	11.37:g.124545187C>T		Somatic		Capture	SOLID	Phase_I	124050397	NM_017425	B2R4F2|Q9BXF7	Silent	SNP	ENST00000532692.1	37	CCDS8450.1																																																																																				SPA17-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387075.1	NM_017425	
TUBE1	51175	hgsc.bcm.edu	37	6	112393121	112393121	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr6:112393121C>T	ENST00000368662.5	-	11	1331	c.1253G>A	c.(1252-1254)aGg>aAg	p.R418K	TUBE1_ENST00000604814.1_5'UTR	NM_016262.4	NP_057346.1	Q9UJT0	TBE_HUMAN	tubulin, epsilon 1	418					centrosome cycle (GO:0007098)|protein polymerization (GO:0051258)	microtubule (GO:0005874)|pericentriolar material (GO:0000242)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.R418K(1)|p.R418M(1)		cervix(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	12		all_cancers(87;0.0101)|all_hematologic(75;0.000258)|Colorectal(196;0.0466)|all_epithelial(87;0.1)		all cancers(137;0.0217)|OV - Ovarian serous cystadenocarcinoma(136;0.0613)|Epithelial(106;0.0636)|GBM - Glioblastoma multiforme(226;0.0972)|BRCA - Breast invasive adenocarcinoma(108;0.246)	Vinblastine(DB00570)	CTTGTAGAGCCTCATGAATCT	0.348																																					p.R418K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1253A	6						.						76.0	78.0	77.0					6																	112393121		2203	4300	6503	112499814	SO:0001583	missense	51175	exon11			AF201334	CCDS5100.1	6q21	2005-11-03			ENSG00000074935	ENSG00000074935		"""Tubulins"""	20775	protein-coding gene	gene with protein product		607345				10620804	Standard	NM_016262		Approved	dJ142L7.2, FLJ22589, TUBE	uc003pvq.3	Q9UJT0	OTTHUMG00000015382	ENST00000368662.5:c.1253G>A	6.37:g.112393121C>T	ENSP00000357651:p.Arg418Lys	Somatic		Capture	SOLID	Phase_I	112499814	NM_016262	Q5H8W8|Q8NEG3	Missense_Mutation	SNP	ENST00000368662.5	37	CCDS5100.1	.	.	.	.	.	.	.	.	.	.	C	5.120	0.207830	0.09704	.	.	ENSG00000074935	ENST00000368662	T	0.75704	-0.96	5.84	5.84	0.93424	Tubulin, C-terminal (1);Tubulin/FtsZ, C-terminal (1);	0.047323	0.85682	D	0.000000	T	0.31796	0.0808	N	0.02158	-0.66	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.41645	-0.9497	10	0.87932	D	0	.	7.3496	0.26682	0.1693:0.7441:0.0:0.0867	.	418	Q9UJT0	TBE_HUMAN	K	418	ENSP00000357651:R418K	ENSP00000357651:R418K	R	-	2	0	TUBE1	112499814	1.000000	0.71417	0.999000	0.59377	0.954000	0.61252	1.022000	0.30052	2.751000	0.94390	0.655000	0.94253	AGG		TUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041867.1	NM_016262	
TRMT11	60487	hgsc.bcm.edu	37	6	126319441	126319441	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr6:126319441G>A	ENST00000334379.5	+	5	488	c.367G>A	c.(367-369)Gag>Aag	p.E123K	TRMT11_ENST00000450358.1_Missense_Mutation_p.E123K|TRMT11_ENST00000368332.3_Missense_Mutation_p.E123K	NM_001031712.2	NP_001026882.2	Q7Z4G4	TRM11_HUMAN	tRNA methyltransferase 11 homolog (S. cerevisiae)	123					tRNA processing (GO:0008033)		methyltransferase activity (GO:0008168)|tRNA binding (GO:0000049)	p.E123K(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				GBM - Glioblastoma multiforme(226;0.0356)		GACACAAGAAGAGAAAATCAA	0.299																																					p.E123K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G367A	6						.						39.0	39.0	39.0					6																	126319441		2175	4292	6467	126361134	SO:0001583	missense	60487	exon5			AF182423	CCDS35496.1	6q11.1-q22.33	2009-06-15	2006-11-28	2006-11-28	ENSG00000066651	ENSG00000066651			21080	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 75"""	C6orf75			Standard	XM_006715546		Approved	MDS024, dJ187J11.2, TRM11, TRMT11-1	uc003qam.3	Q7Z4G4	OTTHUMG00000015515	ENST00000334379.5:c.367G>A	6.37:g.126319441G>A	ENSP00000333934:p.Glu123Lys	Somatic		Capture	SOLID	Phase_I	126361134	NM_001031712	E1P570|Q5JY11|Q6PGQ5|Q9HC13	Missense_Mutation	SNP	ENST00000334379.5	37	CCDS35496.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.006604	0.93287	.	.	ENSG00000066651	ENST00000334379;ENST00000450358;ENST00000368332;ENST00000444121;ENST00000446681	T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84	5.95	5.95	0.96441	.	0.135400	0.64402	D	0.000003	T	0.51787	0.1695	M	0.79805	2.47	0.58432	D	0.999991	P;B	0.36330	0.548;0.179	P;B	0.44518	0.452;0.077	T	0.54768	-0.8244	10	0.52906	T	0.07	-24.7641	16.8291	0.85939	0.0:0.1366:0.8634:0.0	.	123;123	Q7Z4G4-2;Q7Z4G4	.;TRM11_HUMAN	K	123;123;123;60;60	ENSP00000333934:E123K;ENSP00000405140:E123K;ENSP00000357316:E123K;ENSP00000406230:E60K;ENSP00000415724:E60K	ENSP00000333934:E123K	E	+	1	0	TRMT11	126361134	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.626000	0.83164	2.824000	0.97209	0.655000	0.94253	GAG		TRMT11-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_021820	
IL22RA2	116379	hgsc.bcm.edu	37	6	137476133	137476133	+	Silent	SNP	C	C	T	rs140915731		TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr6:137476133C>T	ENST00000296980.2	-	5	717	c.417G>A	c.(415-417)tcG>tcA	p.S139S	IL22RA2_ENST00000339602.3_Silent_p.S107S|IL22RA2_ENST00000349184.4_Silent_p.S107S	NM_052962.2	NP_443194.1	Q969J5	I22R2_HUMAN	interleukin 22 receptor, alpha 2	139	Fibronectin type-III 2.				cytokine-mediated signaling pathway (GO:0019221)|negative regulation of inflammatory response (GO:0050728)|regulation of tyrosine phosphorylation of Stat3 protein (GO:0042516)	cytosol (GO:0005829)|extracellular space (GO:0005615)	interleukin-22 binding (GO:0042017)|interleukin-22 receptor activity (GO:0042018)	p.S139S(1)		endometrium(1)|large_intestine(1)|lung(3)	5	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000313)|OV - Ovarian serous cystadenocarcinoma(155;0.00407)		AGCTCCCAGCCGAGGCCGCCC	0.517																																					p.S107S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G321A	6						.	C	,,	0,4406		0,0,2203	134.0	125.0	128.0		417,321,321	-11.5	0.0	6	dbSNP_134	128	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	IL22RA2	NM_052962.2,NM_181309.1,NM_181310.1	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	139/264,107/232,107/131	137476133	1,13005	2203	4300	6503	137517826	SO:0001819	synonymous_variant	116379	exon4			AY044429	CCDS5182.1, CCDS5183.1, CCDS5184.1	6q24.1-q24.2	2008-02-05			ENSG00000164485	ENSG00000164485		"""Interleukins and interleukin receptors"""	14901	protein-coding gene	gene with protein product		606648				11481447, 11390454	Standard	NM_181309		Approved	CRF2-S1, IL-22BP	uc003qhl.3	Q969J5	OTTHUMG00000015655	ENST00000296980.2:c.417G>A	6.37:g.137476133C>T		Somatic		Capture	SOLID	Phase_I	137517826	NM_181310	Q08AH7|Q6UWM1|Q96A41|Q96QR0	Silent	SNP	ENST00000296980.2	37	CCDS5182.1																																																																																				IL22RA2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000042399.1		
TMEM63B	55362	hgsc.bcm.edu	37	6	44107273	44107273	+	Silent	SNP	C	C	T			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr6:44107273C>T	ENST00000259746.9	+	7	660	c.477C>T	c.(475-477)atC>atT	p.I159I	TMEM63B_ENST00000527188.1_3'UTR|TMEM63B_ENST00000323267.6_Silent_p.I159I			Q5T3F8	CSCL2_HUMAN	transmembrane protein 63B	159					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	nucleotide binding (GO:0000166)	p.I159I(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(2)|prostate(2)|stomach(4)	35	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0215)			GGCACATCATCGGGCTGCTGG	0.597																																					p.I159I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C477T	6						.						148.0	112.0	124.0					6																	44107273		2203	4300	6503	44215251	SO:0001819	synonymous_variant	55362	exon7			BC022095	CCDS34461.1	6p21.1	2008-02-05	2005-07-25	2005-07-25	ENSG00000137216	ENSG00000137216			17735	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 110"""	C6orf110			Standard	XM_005249211		Approved	DKFZp434P0531, dJ421H19.2	uc003owr.3	Q5T3F8	OTTHUMG00000014757	ENST00000259746.9:c.477C>T	6.37:g.44107273C>T		Somatic		Capture	SOLID	Phase_I	44215251	NM_018426	B9EGU3|Q5T3F9|Q6AHX4|Q6P5A0|Q8N219|Q8NDE1|Q9NSG5	Silent	SNP	ENST00000259746.9	37	CCDS34461.1	.	.	.	.	.	.	.	.	.	.	C	6.398	0.441608	0.12164	.	.	ENSG00000137216	ENST00000371893	.	.	.	4.41	-2.26	0.06867	.	.	.	.	.	T	0.43255	0.1239	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50491	-0.8822	4	.	.	.	.	11.3697	0.49692	0.0:0.3655:0.0:0.6345	.	.	.	.	L	88	.	.	S	+	2	0	TMEM63B	44215251	0.001000	0.12720	0.989000	0.46669	0.445000	0.32107	-1.500000	0.02283	-0.356000	0.08187	-0.254000	0.11334	TCG		TMEM63B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040712.2	XM_166410	
PKHD1	5314	hgsc.bcm.edu	37	6	51890409	51890409	+	Missense_Mutation	SNP	G	G	A	rs191201723		TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr6:51890409G>A	ENST00000371117.3	-	32	4474	c.4199C>T	c.(4198-4200)tCg>tTg	p.S1400L	PKHD1_ENST00000340994.4_Missense_Mutation_p.S1400L	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	1400	IPT/TIG 9.				cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)	p.S1400L(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					ACCACATGCCGAACCCTGCGA	0.498													G|||	1	0.000199681	0.0008	0.0	5008	,	,		23496	0.0		0.0	False		,,,				2504	0.0				p.S1400L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4199T	6						.	G	LEU/SER,LEU/SER	0,4406		0,0,2203	93.0	92.0	92.0		4199,4199	5.0	0.0	6		92	1,8599		0,1,4299	no	missense,missense	PKHD1	NM_138694.3,NM_170724.2	145,145	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	1400/4075,1400/3397	51890409	1,13005	2203	4300	6503	51998368	SO:0001583	missense	5314	exon32			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.4199C>T	6.37:g.51890409G>A	ENSP00000360158:p.Ser1400Leu	Somatic		Capture	SOLID	Phase_I	51998368	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	11.03	1.517962	0.27211	0.0	1.16E-4	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	T;T	0.78364	-1.17;-1.17	5.87	5.01	0.66863	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.080418	0.53938	N	0.000042	T	0.68016	0.2955	M	0.81341	2.54	0.28731	N	0.902496	P;P	0.38504	0.495;0.634	B;B	0.35312	0.187;0.2	T	0.69254	-0.5193	10	0.87932	D	0	.	13.9069	0.63841	0.0726:0.0:0.9274:0.0	.	1400;1400	P08F94-2;P08F94	.;PKHD1_HUMAN	L	1400	ENSP00000360158:S1400L;ENSP00000341097:S1400L	ENSP00000341097:S1400L	S	-	2	0	PKHD1	51998368	0.994000	0.37717	0.030000	0.17652	0.003000	0.03518	3.692000	0.54727	1.489000	0.48450	0.655000	0.94253	TCG		PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
HTR1E	3354	hgsc.bcm.edu	37	6	87725663	87725663	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr6:87725663G>A	ENST00000305344.5	+	2	1314	c.611G>A	c.(610-612)cGg>cAg	p.R204Q		NM_000865.2	NP_000856.1	P28566	5HT1E_HUMAN	5-hydroxytryptamine (serotonin) receptor 1E, G protein-coupled	204					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.R204Q(1)		breast(3)|endometrium(2)|kidney(3)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(3)	41		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)		BRCA - Breast invasive adenocarcinoma(108;0.055)	Aripiprazole(DB01238)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ketamine(DB01221)|Loxapine(DB00408)|Methysergide(DB00247)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	CTCTATTACCGGATTTACCAC	0.453																																					p.R204Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G611A	6						.						96.0	94.0	94.0					6																	87725663		2203	4300	6503	87782382	SO:0001583	missense	3354	exon2				CCDS5006.1	6q14-q15	2013-06-19	2012-02-03		ENSG00000168830	ENSG00000168830		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5291	protein-coding gene	gene with protein product		182132	"""5-hydroxytryptamine (serotonin) receptor 1E"""			1608964	Standard	NM_000865		Approved	5-HT1E	uc003pli.3	P28566	OTTHUMG00000015154	ENST00000305344.5:c.611G>A	6.37:g.87725663G>A	ENSP00000307766:p.Arg204Gln	Somatic		Capture	SOLID	Phase_I	87782382	NM_000865	E1P503|Q9P1Y1	Missense_Mutation	SNP	ENST00000305344.5	37	CCDS5006.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.095383	0.76870	.	.	ENSG00000168830	ENST00000305344;ENST00000369584	T;T	0.38887	1.11;1.11	4.51	4.51	0.55191	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	U	0.000033	T	0.48607	0.1509	L	0.53729	1.69	0.35878	D	0.828761	D	0.64830	0.994	P	0.62491	0.903	T	0.53767	-0.8392	10	0.52906	T	0.07	.	17.2072	0.86921	0.0:0.0:1.0:0.0	.	204	P28566	5HT1E_HUMAN	Q	204	ENSP00000307766:R204Q;ENSP00000358597:R204Q	ENSP00000307766:R204Q	R	+	2	0	HTR1E	87782382	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	6.977000	0.76141	2.071000	0.62044	0.404000	0.27445	CGG		HTR1E-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472488.2	NM_000865	
SYNE1	23345	hgsc.bcm.edu	37	6	152806047	152806047	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr6:152806047G>A	ENST00000367255.5	-	13	1709	c.1108C>T	c.(1108-1110)Caa>Taa	p.Q370*	SYNE1_ENST00000367253.4_Nonsense_Mutation_p.Q370*|SYNE1_ENST00000423061.1_Nonsense_Mutation_p.Q377*|SYNE1_ENST00000466159.2_Nonsense_Mutation_p.Q370*|SYNE1_ENST00000448038.1_Nonsense_Mutation_p.Q377*|SYNE1_ENST00000413186.2_Nonsense_Mutation_p.Q370*|SYNE1_ENST00000265368.4_Nonsense_Mutation_p.Q370*|SYNE1_ENST00000341594.5_Nonsense_Mutation_p.Q370*|SYNE1_ENST00000367248.3_Nonsense_Mutation_p.Q360*	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	370					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.Q370*(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TGTAATGGTTGTATTAAATGT	0.368										HNSCC(10;0.0054)																											p.Q377X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C1129T	6						.						165.0	148.0	154.0					6																	152806047		2203	4300	6503	152847740	SO:0001587	stop_gained	23345	exon13			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.1108C>T	6.37:g.152806047G>A	ENSP00000356224:p.Gln370*	Somatic		Capture	SOLID	Phase_I	152847740	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Nonsense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	G	37	6.345003	0.97494	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253;ENST00000367248;ENST00000413186;ENST00000466159;ENST00000537750	.	.	.	5.53	5.53	0.82687	.	0.000000	0.53938	D	0.000041	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	.	19.4479	0.94855	0.0:0.0:1.0:0.0	.	.	.	.	X	370;377;370;377;370;370;360;370;370;353	.	ENSP00000265368:Q370X	Q	-	1	0	SYNE1	152847740	1.000000	0.71417	0.942000	0.38095	0.827000	0.46813	9.215000	0.95146	2.599000	0.87857	0.561000	0.74099	CAA		SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
IFI35	3430	hgsc.bcm.edu	37	17	41165087	41165087	+	Missense_Mutation	SNP	C	C	G			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr17:41165087C>G	ENST00000415816.2	+	3	367	c.144C>G	c.(142-144)atC>atG	p.I48M	IFI35_ENST00000438323.2_Missense_Mutation_p.I48M	NM_005533.4	NP_005524.2	P80217	IN35_HUMAN	interferon-induced protein 35	48					cytokine-mediated signaling pathway (GO:0019221)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleus (GO:0005634)		p.I48M(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)	8		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.157)		TGCCCAAGATCCCCCTGGTAT	0.557																																					p.I48M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C144G	17						.						143.0	142.0	142.0					17																	41165087		2203	4300	6503	38418613	SO:0001583	missense	3430	exon3			BC001356	CCDS11450.1	17q21	2006-04-05			ENSG00000068079	ENSG00000068079			5399	protein-coding gene	gene with protein product		600735					Standard	NM_005533		Approved	IFP35	uc021txx.1	P80217	OTTHUMG00000167720	ENST00000415816.2:c.144C>G	17.37:g.41165087C>G	ENSP00000394579:p.Ile48Met	Somatic		Capture	SOLID	Phase_I	38418613	NM_005533	C9JGX1|Q92984|Q99537|Q9BV98	Missense_Mutation	SNP	ENST00000415816.2	37		.	.	.	.	.	.	.	.	.	.	C	4.073	0.011338	0.07912	.	.	ENSG00000068079	ENST00000415816;ENST00000438323	T;T	0.41758	0.99;0.99	5.03	1.56	0.23342	Interferon induced 35kDa, N-terminal (1);	1.727610	0.02662	N	0.107591	T	0.35595	0.0937	L	0.44542	1.39	0.09310	N	1	P	0.37276	0.589	B	0.37304	0.246	T	0.23762	-1.0179	10	0.41790	T	0.15	.	2.8522	0.05561	0.332:0.4305:0.1458:0.0917	.	48	P80217	IN35_HUMAN	M	48	ENSP00000394579:I48M;ENSP00000395590:I48M	ENSP00000394579:I48M	I	+	3	3	IFI35	38418613	0.000000	0.05858	0.115000	0.21578	0.071000	0.16799	-0.819000	0.04462	0.656000	0.30886	0.561000	0.74099	ATC		IFI35-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000395851.1	NM_005533	
NPTX1	4884	hgsc.bcm.edu	37	17	78444661	78444661	+	Silent	SNP	G	G	A			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr17:78444661G>A	ENST00000306773.4	-	5	1408	c.1251C>T	c.(1249-1251)taC>taT	p.Y417Y	NPTX1_ENST00000575212.1_5'Flank	NM_002522.3	NP_002513.2	Q15818	NPTX1_HUMAN	neuronal pentraxin I	417	Pentaxin.				axonogenesis involved in innervation (GO:0060385)|cellular response to glucose stimulus (GO:0071333)|cellular response to potassium ion (GO:0035865)|central nervous system development (GO:0007417)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial transport (GO:0006839)|synaptic transmission (GO:0007268)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)	p.Y417Y(1)		kidney(1)|large_intestine(2)|liver(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(1)	11	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0487)			TGGCCCCTCCGTAGATCTCGA	0.667																																					p.Y417Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1251T	17						.						74.0	66.0	69.0					17																	78444661		2203	4300	6503	76059256	SO:0001819	synonymous_variant	4884	exon5			U61849	CCDS32762.1	17q25.3	2008-05-14				ENSG00000171246			7952	protein-coding gene	gene with protein product		602367				8884281	Standard	NM_002522		Approved		uc002jyp.1	Q15818		ENST00000306773.4:c.1251C>T	17.37:g.78444661G>A		Somatic		Capture	SOLID	Phase_I	76059256	NM_002522	B3KXH3|Q5FWE6	Silent	SNP	ENST00000306773.4	37	CCDS32762.1																																																																																				NPTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438051.1		
RPTOR	57521	hgsc.bcm.edu	37	17	78681705	78681705	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr17:78681705G>A	ENST00000306801.3	+	4	775	c.413G>A	c.(412-414)cGt>cAt	p.R138H	RPTOR_ENST00000537330.1_5'UTR|RPTOR_ENST00000570891.1_Missense_Mutation_p.R138H|RPTOR_ENST00000544334.2_Missense_Mutation_p.R138H	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	138					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.R138L(1)|p.R138H(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						ACGTCCTTACGTCGCAACGCC	0.562																																					p.R138H												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G413A	17						.						70.0	60.0	64.0					17																	78681705		2203	4300	6503	76296300	SO:0001583	missense	57521	exon4				CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.413G>A	17.37:g.78681705G>A	ENSP00000307272:p.Arg138His	Somatic		Capture	SOLID	Phase_I	76296300	NM_020761	B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Missense_Mutation	SNP	ENST00000306801.3	37	CCDS11773.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.630173	0.87660	.	.	ENSG00000141564	ENST00000306801;ENST00000544334	T;T	0.60797	0.16;0.21	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	D	0.83431	0.5253	H	0.94306	3.52	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.989;0.999	D	0.88101	0.2819	10	0.72032	D	0.01	.	18.975	0.92731	0.0:0.0:1.0:0.0	.	138;138	F5H7J5;Q8N122	.;RPTOR_HUMAN	H	138	ENSP00000307272:R138H;ENSP00000442479:R138H	ENSP00000307272:R138H	R	+	2	0	RPTOR	76296300	1.000000	0.71417	0.269000	0.24586	0.536000	0.34869	9.713000	0.98740	2.485000	0.83878	0.655000	0.94253	CGT		RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438125.1	NM_020761	
NME9	347736	hgsc.bcm.edu	37	3	138037034	138037034	+	Missense_Mutation	SNP	C	C	T	rs200732318		TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr3:138037034C>T	ENST00000333911.3	-	4	250	c.223G>A	c.(223-225)Gaa>Aaa	p.E75K	NME9_ENST00000341790.5_Intron|NME9_ENST00000484930.1_Intron|NME9_ENST00000383180.2_Missense_Mutation_p.E53K|NME9_ENST00000317876.4_Missense_Mutation_p.E53K|NME9_ENST00000536478.1_Missense_Mutation_p.E53K			Q86XW9	TXND6_HUMAN	NME/NM23 family member 9	75	Thioredoxin.				cell redox homeostasis (GO:0045454)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|UTP biosynthetic process (GO:0006228)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)	p.E53K(2)									CTGTACTTTTCGAGGACATCA	0.458													C|||	1	0.000199681	0.0	0.0	5008	,	,		19100	0.0		0.001	False		,,,				2504	0.0				p.E53K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G157A	3						.						126.0	111.0	116.0					3																	138037034		2203	4300	6503	139519724	SO:0001583	missense	347736	exon6			AF196568	CCDS3099.1	3q22.3	2012-05-18	2012-05-18	2011-08-24	ENSG00000181322	ENSG00000181322			21343	protein-coding gene	gene with protein product			"""thioredoxin domain containing 6"", ""NME gene family member 9"", ""NME family member 9"""	TXNDC6		12569107, 19852809	Standard	NM_178130		Approved	TXL-2, NM23-H9	uc003ese.1	Q86XW9	OTTHUMG00000159823	ENST00000333911.3:c.223G>A	3.37:g.138037034C>T	ENSP00000335444:p.Glu75Lys	Somatic		Capture	SOLID	Phase_I	139519724	NM_178130	Q7Z4A8|Q8N1V7	Missense_Mutation	SNP	ENST00000333911.3	37		2|2	9.157509157509158E-4|9.157509157509158E-4	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	2|2	0.002638522427440633|0.002638522427440633	C|C	14.13|14.13	2.442601|2.442601	0.43326|0.43326	.|.	.|.	ENSG00000181322|ENSG00000181322	ENST00000383180;ENST00000317876;ENST00000536478;ENST00000333911;ENST00000475751|ENST00000474690	T;T;T;T;T|.	0.14516|.	4.02;4.02;4.02;2.5;2.5|.	4.97|4.97	2.17|2.17	0.27698|0.27698	Thioredoxin domain (1);Thioredoxin-like fold (2);|.	0.571376|.	0.18525|.	N|.	0.138647|.	T|T	0.19604|0.19604	0.0471|0.0471	N|N	0.11892|0.11892	0.195|0.195	0.09310|0.09310	N|N	0.999996|0.999996	B;B|.	0.32800|.	0.377;0.385|.	B;B|.	0.28638|.	0.06;0.092|.	T|T	0.26985|0.26985	-1.0087|-1.0087	10|5	0.52906|.	T|.	0.07|.	-2.7624|-2.7624	7.4647|7.4647	0.27314|0.27314	0.0:0.6435:0.0:0.3565|0.0:0.6435:0.0:0.3565	.|.	75;53|.	Q86XW9;Q86XW9-2|.	TXND6_HUMAN;.|.	K|Q	53;53;53;75;75|44	ENSP00000372667:E53K;ENSP00000321929:E53K;ENSP00000440143:E53K;ENSP00000335444:E75K;ENSP00000419147:E75K|.	ENSP00000321929:E53K|.	E|R	-|-	1|2	0|0	TXNDC6|TXNDC6	139519724|139519724	0.970000|0.970000	0.33590|0.33590	0.494000|0.494000	0.27515|0.27515	0.803000|0.803000	0.45373|0.45373	2.295000|2.295000	0.43576|0.43576	0.143000|0.143000	0.18926|0.18926	0.491000|0.491000	0.48974|0.48974	GAA|CGA		NME9-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000357583.1	NM_178130	
RAD18	56852	hgsc.bcm.edu	37	3	8988905	8988905	+	Splice_Site	SNP	G	G	A			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr3:8988905G>A	ENST00000264926.2	-	4	381	c.265C>T	c.(265-267)Cgg>Tgg	p.R89W	RAD18_ENST00000495087.1_5'UTR	NM_020165.3	NP_064550.3	Q9NS91	RAD18_HUMAN	RAD18 E3 ubiquitin protein ligase	89					DNA repair (GO:0006281)|negative regulation of DNA recombination (GO:0045910)|protein ubiquitination (GO:0016567)|response to UV (GO:0009411)|spermatogenesis (GO:0007283)	chromatin (GO:0000785)|nucleus (GO:0005634)|replication fork (GO:0005657)|XY body (GO:0001741)	damaged DNA binding (GO:0003684)|ligase activity (GO:0016874)|polyubiquitin binding (GO:0031593)|ubiquitin protein ligase binding (GO:0031625)|Y-form DNA binding (GO:0000403)|zinc ion binding (GO:0008270)	p.R89W(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|prostate(1)|skin(3)	15				OV - Ovarian serous cystadenocarcinoma(96;0.0552)		AAATCATACCGTGCAAAATTC	0.368								Rad6 pathway																													p.R89W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C265T	3						.						212.0	225.0	221.0					3																	8988905		2202	4300	6502	8963905	SO:0001630	splice_region_variant	56852	exon4				CCDS2571.1	3p25-p24	2014-08-04	2014-08-04		ENSG00000070950	ENSG00000070950		"""RING-type (C3HC4) zinc fingers"""	18278	protein-coding gene	gene with protein product		605256	"""RAD18 homolog (S. cerevisiae)"""			10884424, 10908344	Standard	NM_020165		Approved	RNF73	uc003brd.3	Q9NS91	OTTHUMG00000090545	ENST00000264926.2:c.266+1C>T	3.37:g.8988905G>A		Somatic		Capture	SOLID	Phase_I	8963905	NM_020165	Q58F55|Q9NRT6	Missense_Mutation	SNP	ENST00000264926.2	37	CCDS2571.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.368240	0.82463	.	.	ENSG00000070950	ENST00000264926;ENST00000413832	T;T	0.31769	1.48;2.18	6.04	5.12	0.69794	.	0.052177	0.85682	D	0.000000	T	0.52549	0.1741	M	0.72894	2.215	0.54753	D	0.999984	D	0.89917	1.0	D	0.79784	0.993	T	0.53063	-0.8491	10	0.87932	D	0	-13.2827	11.7952	0.52096	0.0:0.0:0.8252:0.1748	.	89	Q9NS91	RAD18_HUMAN	W	89	ENSP00000264926:R89W;ENSP00000412261:R89W	ENSP00000264926:R89W	R	-	1	2	RAD18	8963905	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.934000	0.56553	2.873000	0.98535	0.561000	0.74099	CGG		RAD18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207071.2	NM_020165	Missense_Mutation
SERPINI1	5274	hgsc.bcm.edu	37	3	167506962	167506962	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr3:167506962G>T	ENST00000295777.5	+	2	477	c.46G>T	c.(46-48)Gct>Tct	p.A16S	SERPINI1_ENST00000446050.2_Missense_Mutation_p.A16S	NM_005025.4	NP_005016.1	Q99574	NEUS_HUMAN	serpin peptidase inhibitor, clade I (neuroserpin), member 1	16					cell death (GO:0008219)|central nervous system development (GO:0007417)|negative regulation of endopeptidase activity (GO:0010951)|peripheral nervous system development (GO:0007422)|regulation of cell adhesion (GO:0030155)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.A16S(1)		NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(7)|skin(2)	20						GCAAAGTATGGCTACAGGGGC	0.378																																					p.A16S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G46T	3						.						75.0	76.0	76.0					3																	167506962		2203	4300	6503	168989656	SO:0001583	missense	5274	exon2			Z81326	CCDS3203.1	3q26.1	2014-02-18	2005-08-18		ENSG00000163536	ENSG00000163536		"""Serine (or cysteine) peptidase inhibitors"""	8943	protein-coding gene	gene with protein product		602445	"""serine (or cysteine) proteinase inhibitor, clade I (neuroserpin), member 1"""	PI12		24172014	Standard	NM_005025		Approved	neuroserpin	uc003ffa.4	Q99574	OTTHUMG00000158450	ENST00000295777.5:c.46G>T	3.37:g.167506962G>T	ENSP00000295777:p.Ala16Ser	Somatic		Capture	SOLID	Phase_I	168989656	NM_001122752	A8K217|D3DNP1|Q6AHZ4	Missense_Mutation	SNP	ENST00000295777.5	37	CCDS3203.1	.	.	.	.	.	.	.	.	.	.	G	0.017	-1.493915	0.01009	.	.	ENSG00000163536	ENST00000472941;ENST00000446050;ENST00000295777;ENST00000472747	T;D;D;D	0.84298	-1.04;-1.83;-1.83;-1.53	5.23	2.07	0.26955	Serpin domain (1);	0.413619	0.29389	N	0.012287	T	0.71584	0.3357	N	0.22421	0.69	0.21473	N	0.999674	B	0.27559	0.181	B	0.20184	0.028	T	0.51888	-0.8648	10	0.13108	T	0.6	.	12.1529	0.54059	0.2368:0.0:0.7632:0.0	.	16	Q99574	NEUS_HUMAN	S	16	ENSP00000420133:A16S;ENSP00000397373:A16S;ENSP00000295777:A16S;ENSP00000420561:A16S	ENSP00000295777:A16S	A	+	1	0	SERPINI1	168989656	0.998000	0.40836	0.002000	0.10522	0.001000	0.01503	2.720000	0.47252	-0.054000	0.13266	-0.797000	0.03246	GCT		SERPINI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351056.1		
TAS2R13	50838	hgsc.bcm.edu	37	12	11061548	11061548	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr12:11061548G>A	ENST00000390677.2	-	1	613	c.350C>T	c.(349-351)cCt>cTt	p.P117L	PRR4_ENST00000536668.1_Intron	NM_023920.2	NP_076409.1	Q9NYV9	T2R13_HUMAN	taste receptor, type 2, member 13	117					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|positive regulation of cytokinesis (GO:0032467)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)	p.P117L(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(2)|skin(1)	9						GAGAAAAGCAGGGCTAGAGAA	0.338																																					p.P117L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C350T	12						.						53.0	58.0	56.0					12																	11061548		2203	4300	6503	10952815	SO:0001583	missense	50838	exon1			AF227137	CCDS8635.1	12p13	2012-08-22			ENSG00000212128	ENSG00000212128		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14919	protein-coding gene	gene with protein product		604792				10761934, 10766242	Standard	NM_023920		Approved	T2R13, TRB3	uc001qzg.1	Q9NYV9		ENST00000390677.2:c.350C>T	12.37:g.11061548G>A	ENSP00000375095:p.Pro117Leu	Somatic		Capture	SOLID	Phase_I	10952815	NM_023920	Q4G0I5|Q502V8|Q645X2	Missense_Mutation	SNP	ENST00000390677.2	37	CCDS8635.1	.	.	.	.	.	.	.	.	.	.	G	0.170	-1.072475	0.01918	.	.	ENSG00000212128	ENST00000390677	T	0.35236	1.32	3.3	1.34	0.21922	.	0.669254	0.12892	U	0.430518	T	0.23688	0.0573	L	0.51914	1.62	0.09310	N	1	B	0.15930	0.015	B	0.20577	0.03	T	0.37888	-0.9686	10	0.02654	T	1	.	3.7879	0.08707	0.1336:0.0:0.6276:0.2388	.	117	Q9NYV9	T2R13_HUMAN	L	117	ENSP00000375095:P117L	ENSP00000375095:P117L	P	-	2	0	TAS2R13	10952815	0.000000	0.05858	0.000000	0.03702	0.301000	0.27625	-0.358000	0.07641	0.182000	0.20032	0.655000	0.94253	CCT		TAS2R13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400229.1		
STAB2	55576	hgsc.bcm.edu	37	12	104144470	104144470	+	Silent	SNP	C	C	T	rs577176538		TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr12:104144470C>T	ENST00000388887.2	+	60	6756	c.6552C>T	c.(6550-6552)gaC>gaT	p.D2184D	RP11-341G23.4_ENST00000551299.1_RNA	NM_017564.9	NP_060034.9			stabilin 2									p.D2184D(1)		NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						GCCATGCAGACGCCAAATGTG	0.572													C|||	1	0.000199681	0.0	0.0	5008	,	,		22312	0.0		0.0	False		,,,				2504	0.001				p.D2184D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C6552T	12						.						77.0	65.0	69.0					12																	104144470		2203	4300	6503	102668600	SO:0001819	synonymous_variant	55576	exon60			AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.6552C>T	12.37:g.104144470C>T		Somatic		Capture	SOLID	Phase_I	102668600	NM_017564		Silent	SNP	ENST00000388887.2	37	CCDS31888.1																																																																																				STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1		
PKP2	5318	hgsc.bcm.edu	37	12	33031217	33031217	+	Silent	SNP	G	G	T			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr12:33031217G>T	ENST00000070846.6	-	3	621	c.597C>A	c.(595-597)atC>atA	p.I199I	PKP2_ENST00000340811.4_Silent_p.I199I	NM_004572.3	NP_004563.2	Q99959	PKP2_HUMAN	plakophilin 2	199					adherens junction maintenance (GO:0034334)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential (GO:0086001)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cell-cell signaling involved in cardiac conduction (GO:0086019)|desmosome assembly (GO:0002159)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|intermediate filament bundle assembly (GO:0045110)|lipid homeostasis (GO:0055088)|maintenance of organ identity (GO:0048496)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of tight junction assembly (GO:2000810)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	adherens junction (GO:0005912)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|protein kinase C binding (GO:0005080)|sodium channel regulator activity (GO:0017080)	p.I199I(1)		NS(1)|breast(2)|endometrium(1)|kidney(9)|large_intestine(8)|lung(21)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	50	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					TGACCCCCACGATCTCGGAAC	0.597																																					p.I199I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C597A	12						.						129.0	110.0	117.0					12																	33031217		2203	4300	6503	32922484	SO:0001819	synonymous_variant	5318	exon3			X97675	CCDS8731.1, CCDS31771.1	12p11	2014-09-17				ENSG00000057294		"""Armadillo repeat containing"""	9024	protein-coding gene	gene with protein product		602861				8922383	Standard	NM_001005242		Approved		uc001rlj.4	Q99959	OTTHUMG00000169500	ENST00000070846.6:c.597C>A	12.37:g.33031217G>T		Somatic		Capture	SOLID	Phase_I	32922484	NM_004572	A0AV37|B8QFA1|B8QGS6|B8QGS7|D3DUW9|Q4VC01|Q99960	Silent	SNP	ENST00000070846.6	37	CCDS8731.1																																																																																				PKP2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404449.1	NM_004572	
TMEM132D	121256	hgsc.bcm.edu	37	12	129569098	129569098	+	Silent	SNP	G	G	A	rs376143160		TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr12:129569098G>A	ENST00000422113.2	-	6	1919	c.1593C>T	c.(1591-1593)tcC>tcT	p.S531S	TMEM132D_ENST00000389441.4_Silent_p.S69S	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	531					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.S531S(1)		NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		GCTCGGTGTCGGAGACCTCGA	0.597																																					p.S531S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1593T	12						.	A		1,4405	2.1+/-5.4	0,1,2202	93.0	69.0	77.0		1593	-9.6	0.0	12		77	0,8600		0,0,4300	no	coding-synonymous	TMEM132D	NM_133448.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		531/1100	129569098	1,13005	2203	4300	6503	128135051	SO:0001819	synonymous_variant	121256	exon6			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.1593C>T	12.37:g.129569098G>A		Somatic		Capture	SOLID	Phase_I	128135051	NM_133448	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Silent	SNP	ENST00000422113.2	37	CCDS9266.1																																																																																				TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448	
NDST3	9348	hgsc.bcm.edu	37	4	119154232	119154232	+	Missense_Mutation	SNP	A	A	C			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr4:119154232A>C	ENST00000296499.5	+	9	2288	c.1885A>C	c.(1885-1887)Aaa>Caa	p.K629Q	NDST3_ENST00000433996.2_Missense_Mutation_p.K548Q	NM_004784.2	NP_004775.1	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3	629	Heparan sulfate N-sulfotransferase 3.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)	p.K629Q(1)		NS(1)|breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	54						CCCCAGCCCAAAAACCTTTGA	0.363																																					p.K629Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1885C	4						.						140.0	139.0	139.0					4																	119154232		2203	4300	6503	119373680	SO:0001583	missense	9348	exon9			AF074924	CCDS3708.1	4q26	2008-08-04			ENSG00000164100	ENSG00000164100		"""Sulfotransferases, membrane-bound"""	7682	protein-coding gene	gene with protein product		603950				9915799	Standard	NM_004784		Approved	HSST3	uc003ibx.3	O95803	OTTHUMG00000132959	ENST00000296499.5:c.1885A>C	4.37:g.119154232A>C	ENSP00000296499:p.Lys629Gln	Somatic		Capture	SOLID	Phase_I	119373680	NM_004784	B4DI67|Q4W5C1|Q4W5D0|Q6UWC5|Q9UP21	Missense_Mutation	SNP	ENST00000296499.5	37	CCDS3708.1	.	.	.	.	.	.	.	.	.	.	A	15.23	2.771359	0.49680	.	.	ENSG00000164100	ENST00000296499;ENST00000433996	D;T	0.82526	-1.62;0.55	5.64	5.64	0.86602	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	D	0.83631	0.5296	L	0.57536	1.79	0.23232	N	0.998077	P;P	0.51351	0.944;0.589	P;P	0.50970	0.655;0.589	T	0.77011	-0.2746	10	0.37606	T	0.19	.	10.2441	0.43330	0.926:0.0:0.074:0.0	.	548;629	B4DI67;O95803	.;NDST3_HUMAN	Q	629;548	ENSP00000296499:K629Q;ENSP00000396625:K548Q	ENSP00000296499:K629Q	K	+	1	0	NDST3	119373680	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.088000	0.50175	2.136000	0.66102	0.519000	0.50382	AAA		NDST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256517.4	NM_004784	
FBXW7	55294	hgsc.bcm.edu	37	4	153247289	153247289	+	Missense_Mutation	SNP	G	G	C	rs149680468		TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr4:153247289G>C	ENST00000281708.4	-	10	2742	c.1513C>G	c.(1513-1515)Cgc>Ggc	p.R505G	FBXW7_ENST00000603548.1_Missense_Mutation_p.R505G|FBXW7_ENST00000603841.1_Missense_Mutation_p.R505G|FBXW7_ENST00000263981.5_Missense_Mutation_p.R425G|FBXW7_ENST00000393956.3_Missense_Mutation_p.R329G|FBXW7_ENST00000296555.5_Missense_Mutation_p.R387G	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	505			R -> L (in an ovarian cancer cell line). {ECO:0000269|PubMed:11565033, ECO:0000269|PubMed:16959974}.		cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.R505C(60)|p.R505G(18)|p.R425C(14)|p.R266C(13)|p.R425G(9)|p.R266G(9)|p.R387G(6)|p.R387C(3)|p.R505S(3)|p.R387S(1)|p.?(1)|p.R425S(1)|p.R266S(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				TGAACACAGCGGACTGCTGCA	0.468			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																p.R425G			Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	FBXW7,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0	.	139	Substitution - Missense(138)|Unknown(1)	haematopoietic_and_lymphoid_tissue(44)|large_intestine(26)|endometrium(20)|urinary_tract(15)|lung(15)|upper_aerodigestive_tract(8)|skin(8)|ovary(2)|biliary_tract(1)	c.C1273G	4						.						167.0	156.0	160.0					4																	153247289		2203	4300	6503	153466739	SO:0001583	missense	55294	exon9			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1513C>G	4.37:g.153247289G>C	ENSP00000281708:p.Arg505Gly	Somatic		Capture	SOLID	Phase_I	153466739	NM_018315	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	ENST00000281708.4	37	CCDS3777.1	.	.	.	.	.	.	.	.	.	.	G	17.95	3.513685	0.64522	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.62105	0.05;0.05;0.05;0.05	5.72	4.88	0.63580	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.101576	0.64402	D	0.000001	T	0.78679	0.4321	M	0.75085	2.285	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.81858	-0.0739	10	0.87932	D	0	-12.0024	15.0746	0.72066	0.0681:0.0:0.9319:0.0	.	329;505;387;425	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	G	505;387;425;329	ENSP00000281708:R505G;ENSP00000296555:R387G;ENSP00000263981:R425G;ENSP00000377528:R329G	ENSP00000263981:R425G	R	-	1	0	FBXW7	153466739	1.000000	0.71417	1.000000	0.80357	0.556000	0.35491	9.772000	0.98984	1.559000	0.49555	-0.145000	0.13849	CGC		FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1		
HELQ	113510	hgsc.bcm.edu	37	4	84376655	84376655	+	Silent	SNP	C	C	T			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr4:84376655C>T	ENST00000295488.3	-	1	354	c.192G>A	c.(190-192)caG>caA	p.Q64Q	HELQ_ENST00000440639.2_5'UTR|HELQ_ENST00000510985.1_Silent_p.Q64Q|MRPS18C_ENST00000507349.1_5'Flank|MRPS18C_ENST00000507019.1_5'Flank|MRPS18C_ENST00000295491.4_5'Flank	NM_133636.2	NP_598375	Q8TDG4	HELQ_HUMAN	helicase, POLQ-like	64					double-strand break repair via homologous recombination (GO:0000724)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.Q64Q(1)		breast(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(10)|lung(17)|ovary(2)|skin(2)	38						GTAGAAGGGGCTGTACCTCAA	0.607								Other identified genes with known or suspected DNA repair function																													p.Q64Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G192A	4						.						132.0	130.0	130.0					4																	84376655		2203	4300	6503	84595679	SO:0001819	synonymous_variant	113510	exon1			AF436845	CCDS3603.1, CCDS75158.1	4q21.23	2009-02-26			ENSG00000163312	ENSG00000163312			18536	protein-coding gene	gene with protein product		606769				11751861	Standard	XM_005262711		Approved	Hel308	uc003hom.3	Q8TDG4	OTTHUMG00000130423	ENST00000295488.3:c.192G>A	4.37:g.84376655C>T		Somatic		Capture	SOLID	Phase_I	84595679	NM_133636	Q05DF9|Q502W9|Q659B8|Q6ZQX4|Q6ZTS4|Q96EX7	Silent	SNP	ENST00000295488.3	37	CCDS3603.1																																																																																				HELQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252810.1	NM_133636	
DDX60	55601	hgsc.bcm.edu	37	4	169214963	169214963	+	Missense_Mutation	SNP	G	G	C			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr4:169214963G>C	ENST00000393743.3	-	7	1148	c.857C>G	c.(856-858)tCt>tGt	p.S286C		NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	286					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)	p.S286C(2)		breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		TTCCTGACCAGAGGAGGGCTC	0.383																																					p.S286C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C857G	4						.						108.0	115.0	113.0					4																	169214963		2203	4300	6503	169451538	SO:0001583	missense	55601	exon7			AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.857C>G	4.37:g.169214963G>C	ENSP00000377344:p.Ser286Cys	Somatic		Capture	SOLID	Phase_I	169451538	NM_017631	Q6PK35|Q9NVE3	Missense_Mutation	SNP	ENST00000393743.3	37	CCDS34097.1	.	.	.	.	.	.	.	.	.	.	G	8.405	0.842898	0.16963	.	.	ENSG00000137628	ENST00000393743	T	0.18960	2.18	4.16	3.31	0.37934	.	0.457314	0.18671	N	0.134458	T	0.17152	0.0412	L	0.43152	1.355	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.16276	-1.0408	10	0.59425	D	0.04	.	7.3586	0.26733	0.0:0.1861:0.6216:0.1923	.	286	Q8IY21	DDX60_HUMAN	C	286	ENSP00000377344:S286C	ENSP00000377344:S286C	S	-	2	0	DDX60	169451538	0.011000	0.17503	0.004000	0.12327	0.015000	0.08874	1.935000	0.40173	1.096000	0.41439	0.563000	0.77884	TCT		DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364622.1	NM_017631	
KLHL13	90293	hgsc.bcm.edu	37	X	117043325	117043325	+	Missense_Mutation	SNP	G	G	C			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chrX:117043325G>C	ENST00000262820.3	-	5	2214	c.1305C>G	c.(1303-1305)caC>caG	p.H435Q	KLHL13_ENST00000371878.1_Missense_Mutation_p.H384Q|KLHL13_ENST00000371882.1_Missense_Mutation_p.H384Q|KLHL13_ENST00000371876.1_Missense_Mutation_p.H384Q|KLHL13_ENST00000469946.1_Missense_Mutation_p.H384Q|KLHL13_ENST00000541812.1_Missense_Mutation_p.H419Q|KLHL13_ENST00000540167.1_Missense_Mutation_p.H419Q|KLHL13_ENST00000545703.1_Missense_Mutation_p.H393Q|KLHL13_ENST00000539496.1_Missense_Mutation_p.H438Q	NM_033495.3	NP_277030.2	Q9P2N7	KLH13_HUMAN	kelch-like family member 13	435					cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)		p.H435Q(1)		NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	34						GGGCACTTAGGTGGAAGAAGG	0.403																																					p.H429Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1287G	X						.						55.0	47.0	50.0					X																	117043325		2203	4300	6503	116927353	SO:0001583	missense	90293	exon5			AB037730	CCDS14571.1, CCDS55479.1, CCDS55480.1, CCDS55481.1	Xq23-q24	2013-01-30	2013-01-30	2004-02-18	ENSG00000003096	ENSG00000003096		"""Kelch-like"", ""BTB/POZ domain containing"""	22931	protein-coding gene	gene with protein product		300655	"""BTB and kelch domain containing 2, KIAA1309"", ""kelch-like 13 (Drosophila)"""	BKLHD2, KIAA1309		10718198	Standard	NM_033495		Approved	FLJ10262	uc011mtp.2	Q9P2N7	OTTHUMG00000022252	ENST00000262820.3:c.1305C>G	X.37:g.117043325G>C	ENSP00000262820:p.His435Gln	Somatic		Capture	SOLID	Phase_I	116927353	NM_001168300	B3KV78|B3KWM7|B7Z3S9|B7Z5P2|B7Z802|D3DWH6|Q6P2E3|Q96QI7|Q9UDN9	Missense_Mutation	SNP	ENST00000262820.3	37	CCDS14571.1	.	.	.	.	.	.	.	.	.	.	G	9.408	1.079669	0.20309	.	.	ENSG00000003096	ENST00000371882;ENST00000371876;ENST00000371878;ENST00000447671;ENST00000541812;ENST00000540167;ENST00000539496;ENST00000262820;ENST00000545703;ENST00000469946	T;T;T;T;T;T;T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17;-0.17;-0.17;-0.17;-0.17;-0.17;-0.17	5.02	5.02	0.67125	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	T	0.66703	0.2816	L	0.43923	1.385	0.58432	D	0.999998	B;P;B;B	0.48911	0.027;0.917;0.027;0.015	B;P;B;B	0.52159	0.026;0.691;0.026;0.044	T	0.68352	-0.5431	10	0.49607	T	0.09	.	17.4247	0.87524	0.0:0.0:1.0:0.0	.	419;438;429;435	Q9P2N7-3;Q9P2N7-5;Q9P2N7-4;Q9P2N7	.;.;.;KLH13_HUMAN	Q	384;384;384;384;419;419;438;435;393;384	ENSP00000360949:H384Q;ENSP00000360943:H384Q;ENSP00000360945:H384Q;ENSP00000412640:H384Q;ENSP00000444450:H419Q;ENSP00000441029:H419Q;ENSP00000443191:H438Q;ENSP00000262820:H435Q;ENSP00000440707:H393Q;ENSP00000419803:H384Q	ENSP00000262820:H435Q	H	-	3	2	KLHL13	116927353	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.696000	0.61774	2.297000	0.77311	0.594000	0.82650	CAC		KLHL13-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_033495	
RHOXF1	158800	hgsc.bcm.edu	37	X	119243190	119243190	+	Missense_Mutation	SNP	C	C	A	rs2301977	byFrequency	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chrX:119243190C>A	ENST00000217999.2	-	3	589	c.515G>T	c.(514-516)cGt>cTt	p.R172L	RP4-755D9.1_ENST00000553843.1_RNA	NM_139282.1	NP_644811.1	Q8NHV9	RHXF1_HUMAN	Rhox homeobox family, member 1	172			R -> H (in dbSNP:rs2301977).		gamete generation (GO:0007276)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|sexual reproduction (GO:0019953)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R172L(1)		NS(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	10						TGGGTCAGCACGTAGTTCATT	0.473																																					p.R172L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G515T	X						.						128.0	99.0	109.0					X																	119243190		2203	4300	6503	119127218	SO:0001583	missense	158800	exon3				CCDS14593.1	Xq24	2011-06-20			ENSG00000101883	ENSG00000101883		"""Homeoboxes / PRD class"""	29993	protein-coding gene	gene with protein product		300446				11980563, 12490318	Standard	NM_139282		Approved	OTEX, PEPP1	uc004esk.2	Q8NHV9	OTTHUMG00000022290	ENST00000217999.2:c.515G>T	X.37:g.119243190C>A	ENSP00000217999:p.Arg172Leu	Somatic		Capture	SOLID	Phase_I	119127218	NM_139282	O95030|Q3SYE0	Missense_Mutation	SNP	ENST00000217999.2	37	CCDS14593.1	.	.	.	.	.	.	.	.	.	.	C	1.062	-0.672568	0.03403	.	.	ENSG00000101883	ENST00000217999	D	0.90788	-2.73	2.93	-1.67	0.08238	.	.	.	.	.	T	0.74390	0.3710	N	0.11560	0.145	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.60188	-0.7312	8	0.21014	T	0.42	-0.6778	1.3052	0.02087	0.1277:0.1719:0.2919:0.4084	.	172	Q8NHV9	RHXF1_HUMAN	L	172	ENSP00000217999:R172L	ENSP00000217999:R172L	R	-	2	0	RHOXF1	119127218	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.501000	0.06398	-0.524000	0.06400	-2.358000	0.00240	CGT		RHOXF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058083.2	NM_139282	
GPR112	139378	hgsc.bcm.edu	37	X	135429633	135429633	+	Silent	SNP	C	C	T	rs112635659		TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chrX:135429633C>T	ENST00000394143.1	+	6	4059	c.3768C>T	c.(3766-3768)tcC>tcT	p.S1256S	GPR112_ENST00000394141.1_Silent_p.S1051S|GPR112_ENST00000370652.1_Silent_p.S1256S|GPR112_ENST00000412101.1_Silent_p.S1051S|GPR112_ENST00000287534.4_Silent_p.S1193S	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	1256					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.S1256S(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					TCTTATCTTCCGACAAAGACC	0.443																																					p.S1256S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3768T	X						.			0,3835		0,0,0,1632,571	161.0	137.0	145.0		3768	-1.6	0.0	X	dbSNP_132	145	2,6726		0,1,1,2427,1871	no	coding-synonymous	GPR112	NM_153834.3		0,1,1,4059,2442	TT,TC,T,CC,C		0.0297,0.0,0.0189		1256/3081	135429633	2,10561	2203	4300	6503	135257299	SO:0001819	synonymous_variant	139378	exon6			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.3768C>T	X.37:g.135429633C>T		Somatic		Capture	SOLID	Phase_I	135257299	NM_153834	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Silent	SNP	ENST00000394143.1	37	CCDS35409.1																																																																																				GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1		
KLHL15	80311	hgsc.bcm.edu	37	X	24024791	24024791	+	Missense_Mutation	SNP	C	C	G			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chrX:24024791C>G	ENST00000328046.8	-	3	275	c.20G>C	c.(19-21)gGa>gCa	p.G7A		NM_030624.2	NP_085127.2	Q96M94	KLH15_HUMAN	kelch-like family member 15	7					protein ubiquitination (GO:0016567)			p.G7A(1)		autonomic_ganglia(1)|breast(1)|endometrium(8)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)	22						GGAACAGAATCCTTCCACGTC	0.413																																					p.G7A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G20C	X						.						37.0	29.0	32.0					X																	24024791		2202	4300	6502	23934712	SO:0001583	missense	80311	exon3			AB051464	CCDS35217.1	Xp22.1-p21	2013-01-30	2013-01-30		ENSG00000174010	ENSG00000174010		"""Kelch-like"", ""BTB/POZ domain containing"""	29347	protein-coding gene	gene with protein product			"""kelch-like 15 (Drosophila)"""			11214970, 14702039	Standard	NM_030624		Approved	KIAA1677	uc004dba.4	Q96M94	OTTHUMG00000021261	ENST00000328046.8:c.20G>C	X.37:g.24024791C>G	ENSP00000332791:p.Gly7Ala	Somatic		Capture	SOLID	Phase_I	23934712	NM_030624	Q32MN3|Q8NDA3|Q96BM6|Q9C0I6	Missense_Mutation	SNP	ENST00000328046.8	37	CCDS35217.1	.	.	.	.	.	.	.	.	.	.	c	13.51	2.259568	0.39995	.	.	ENSG00000174010	ENST00000328046	T	0.72394	-0.65	5.74	4.85	0.62838	BTB/POZ fold (1);	0.051490	0.85682	D	0.000000	T	0.52629	0.1746	N	0.13299	0.325	0.37258	D	0.906854	B	0.16802	0.019	B	0.14578	0.011	T	0.52881	-0.8516	10	0.15066	T	0.55	.	15.2336	0.73411	0.1407:0.8593:0.0:0.0	.	7	Q96M94	KLH15_HUMAN	A	7	ENSP00000332791:G7A	ENSP00000332791:G7A	G	-	2	0	KLHL15	23934712	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	4.246000	0.58740	2.410000	0.81850	0.597000	0.82753	GGA		KLHL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056078.1	XM_040383	
SUV39H1	6839	hgsc.bcm.edu	37	X	48564664	48564664	+	Silent	SNP	C	C	T			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chrX:48564664C>T	ENST00000376687.3	+	4	1027	c.837C>T	c.(835-837)acC>acT	p.T279T	SUV39H1_ENST00000482260.1_3'UTR|AF196970.3_ENST00000416061.1_RNA|SUV39H1_ENST00000337852.6_Silent_p.T290T|SUV39H1_ENST00000453214.2_Missense_Mutation_p.P127L	NM_003173.2	NP_003164.1	O43463	SUV91_HUMAN	suppressor of variegation 3-9 homolog 1 (Drosophila)	279	Mediates interaction with MECOM. {ECO:0000250}.|SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				cell cycle (GO:0007049)|cell differentiation (GO:0030154)|chromatin organization (GO:0006325)|chromatin silencing at rDNA (GO:0000183)|histone H3-K9 dimethylation (GO:0036123)|histone H3-K9 trimethylation (GO:0036124)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin silencing complex (GO:0005677)|chromosome, centromeric region (GO:0000775)|condensed nuclear chromosome (GO:0000794)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|rDNA heterochromatin (GO:0033553)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|protein N-terminus binding (GO:0047485)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.T279T(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	14						AGATCATTACCTCAGAGGAGG	0.607																																					p.T279T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C837T	X						.						61.0	55.0	57.0					X																	48564664		2203	4300	6503	48449608	SO:0001819	synonymous_variant	6839	exon4			AF019968	CCDS14304.1, CCDS65252.1	Xp11.23	2011-07-01	2001-11-28		ENSG00000101945	ENSG00000101945		"""Chromatin-modifying enzymes / K-methyltransferases"""	11479	protein-coding gene	gene with protein product		300254	"""suppressor of variegation 3-9 (Drosophila) homolog 1"""	SUV39H		10202156	Standard	NM_001282166		Approved	KMT1A	uc004dkn.3	O43463	OTTHUMG00000022701	ENST00000376687.3:c.837C>T	X.37:g.48564664C>T		Somatic		Capture	SOLID	Phase_I	48449608	NM_003173	B2R6E8|B4DST0|Q53G60|Q6FHK6	Silent	SNP	ENST00000376687.3	37	CCDS14304.1	.	.	.	.	.	.	.	.	.	.	C	6.507	0.461733	0.12342	.	.	ENSG00000101945	ENST00000448548;ENST00000453214	.	.	.	4.39	3.5	0.40072	.	.	.	.	.	T	0.52565	0.1742	.	.	.	0.33720	D	0.616857	.	.	.	.	.	.	T	0.65681	-0.6109	5	0.72032	D	0.01	.	4.9186	0.13858	0.2093:0.675:0.0:0.1158	.	.	.	.	L	276;127	.	ENSP00000410043:P276L	P	+	2	0	SUV39H1	48449608	0.674000	0.27549	1.000000	0.80357	0.422000	0.31414	0.176000	0.16782	2.024000	0.59613	0.287000	0.19450	CCT		SUV39H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058909.1	NM_003173	
KLF8	11279	hgsc.bcm.edu	37	X	56310886	56310886	+	Missense_Mutation	SNP	G	G	C			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chrX:56310886G>C	ENST00000468660.1	+	6	1327	c.1039G>C	c.(1039-1041)Gac>Cac	p.D347H	KLF8_ENST00000374928.3_3'UTR	NM_007250.4	NP_009181.2	O95600	KLF8_HUMAN	Kruppel-like factor 8	347					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D347H(1)		kidney(4)|large_intestine(6)|lung(5)|ovary(1)	16						TTCTCGTTCTGACCACCTGTC	0.557																																					p.D347H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1039C	X						.						71.0	57.0	62.0					X																	56310886		2203	4300	6503	56327611	SO:0001583	missense	11279	exon6			U28282	CCDS14373.1, CCDS55428.1	Xp11.21	2013-01-08			ENSG00000102349	ENSG00000102349		"""Zinc fingers, C2H2-type"", ""Kruppel-like transcription factors"""	6351	protein-coding gene	gene with protein product		300286					Standard	NM_007250		Approved	BKLF3, ZNF741, DXS741	uc004dur.3	O95600	OTTHUMG00000021666	ENST00000468660.1:c.1039G>C	X.37:g.56310886G>C	ENSP00000417303:p.Asp347His	Somatic		Capture	SOLID	Phase_I	56327611	NM_007250	B4DJN3|E7EQQ8|L0R3U8|L0R4U2|Q2M246|Q59GV5|Q5HYQ5|Q5JXP7|Q6MZJ7|Q9UGC4	Missense_Mutation	SNP	ENST00000468660.1	37	CCDS14373.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.201707	0.79015	.	.	ENSG00000102349	ENST00000468660	T	0.54866	0.55	3.93	3.93	0.45458	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000001	T	0.62097	0.2400	L	0.38531	1.155	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.66329	-0.5951	10	0.87932	D	0	.	13.3786	0.60754	0.0:0.0:1.0:0.0	.	347	O95600	KLF8_HUMAN	H	347	ENSP00000417303:D347H	ENSP00000417303:D347H	D	+	1	0	KLF8	56327611	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.036000	0.93758	1.938000	0.56188	0.597000	0.82753	GAC		KLF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056887.2	NM_007250	
ARHGEF9	23229	hgsc.bcm.edu	37	X	62857963	62857963	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chrX:62857963C>T	ENST00000253401.6	-	10	2296	c.1496G>A	c.(1495-1497)cGc>cAc	p.R499H	ARHGEF9_ENST00000374870.4_Missense_Mutation_p.R397H|ARHGEF9_ENST00000495564.1_5'UTR|ARHGEF9_ENST00000374872.1_Missense_Mutation_p.R478H|ARHGEF9_ENST00000437457.2_Missense_Mutation_p.R446H|ARHGEF9_ENST00000433323.2_Missense_Mutation_p.R226H|ARHGEF9_ENST00000374878.1_Intron	NM_015185.2	NP_056000.1	O43307	ARHG9_HUMAN	Cdc42 guanine nucleotide exchange factor (GEF) 9	499					apoptotic signaling pathway (GO:0097190)|ion transmembrane transport (GO:0034220)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R497H(2)|p.R499H(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(14)|ovary(5)|pancreas(1)|skin(1)	35						TGACTGGCTGCGCTTGGGTTC	0.493																																					p.R397H												.	.	3	Substitution - Missense(3)	lung(2)|large_intestine(1)	c.G1190A	X						.						72.0	62.0	65.0					X																	62857963		2203	4300	6503	62774688	SO:0001583	missense	23229	exon9			AB007884	CCDS35315.1, CCDS55429.1, CCDS55430.1	Xq11.1	2013-01-10			ENSG00000131089	ENSG00000131089		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14561	protein-coding gene	gene with protein product	"""collybistin"""	300429				10559246, 9455477	Standard	NM_015185		Approved	KIAA0424, PEM-2	uc011mot.2	O43307	OTTHUMG00000021700	ENST00000253401.6:c.1496G>A	X.37:g.62857963C>T	ENSP00000253401:p.Arg499His	Somatic		Capture	SOLID	Phase_I	62774688	NM_001173480	A8K1S8|B4DHC7|F8W7P8|Q5JSL6	Missense_Mutation	SNP	ENST00000253401.6	37	CCDS35315.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.645618	0.87958	.	.	ENSG00000131089	ENST00000253401;ENST00000437457;ENST00000374870;ENST00000433323;ENST00000374872	T;T;T;T;T	0.76968	-0.91;-1.06;-0.77;-0.61;-1.0	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	D	0.84325	0.5447	L	0.56199	1.76	0.54753	D	0.999989	D;D;D	0.89917	1.0;0.998;0.997	P;P;P	0.62435	0.902;0.902;0.861	D	0.86055	0.1528	10	0.72032	D	0.01	.	16.5115	0.84287	0.0:1.0:0.0:0.0	.	446;499;499	B4DHC7;O43307;A8K1S8	.;ARHG9_HUMAN;.	H	499;446;397;226;478	ENSP00000253401:R499H;ENSP00000399994:R446H;ENSP00000364004:R397H;ENSP00000404478:R226H;ENSP00000364006:R478H	ENSP00000253401:R499H	R	-	2	0	ARHGEF9	62774688	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.271000	0.78506	2.205000	0.71048	0.429000	0.28392	CGC		ARHGEF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056937.1		
ATRX	546	hgsc.bcm.edu	37	X	76938436	76938436	+	Missense_Mutation	SNP	G	G	A	rs376906761		TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chrX:76938436G>A	ENST00000373344.5	-	9	2526	c.2312C>T	c.(2311-2313)gCg>gTg	p.A771V	ATRX_ENST00000395603.3_Missense_Mutation_p.A733V|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	771					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.A771V(1)|p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						ATCTTTCCCCGCCTGAGTCTT	0.353			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																														p.A771V			Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	.	.	2	Substitution - Missense(1)|Unknown(1)	large_intestine(1)|bone(1)	c.C2312T	X						.	G	VAL/ALA,VAL/ALA	1,3834		0,1,1631,571	126.0	130.0	129.0		2312,2198	-0.2	0.0	X		129	0,6719		0,0,2425,1869	no	missense,missense	ATRX	NM_000489.3,NM_138270.2	64,64	0,1,4056,2440	AA,AG,GG,G		0.0,0.0261,0.0095	benign,benign	771/2493,733/2455	76938436	1,10553	2203	4294	6497	76825092	SO:0001583	missense	546	exon9			U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.2312C>T	X.37:g.76938436G>A	ENSP00000362441:p.Ala771Val	Somatic		Capture	SOLID	Phase_I	76825092	NM_000489	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	ENST00000373344.5	37	CCDS14434.1	.	.	.	.	.	.	.	.	.	.	G	0.181	-1.062611	0.01950	2.61E-4	0.0	ENSG00000085224	ENST00000373344;ENST00000395603;ENST00000400862	D;D	0.92199	-2.98;-2.99	5.95	-0.165	0.13355	.	1.297550	0.05127	N	0.491805	D	0.83225	0.5208	N	0.14661	0.345	0.09310	N	1	B;B;B;B	0.28128	0.031;0.201;0.052;0.031	B;B;B;B	0.24269	0.015;0.052;0.023;0.015	T	0.70000	-0.4992	10	0.39692	T	0.17	3.5007	5.9912	0.19465	0.0612:0.3128:0.4065:0.2194	.	771;703;733;771	A4LAA3;P46100-6;P46100-4;P46100	.;.;.;ATRX_HUMAN	V	771;733;698	ENSP00000362441:A771V;ENSP00000378967:A733V	ENSP00000362441:A771V	A	-	2	0	ATRX	76825092	0.000000	0.05858	0.000000	0.03702	0.139000	0.21198	0.618000	0.24373	-0.535000	0.06307	0.513000	0.50165	GCG		ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489	
TBX22	50945	hgsc.bcm.edu	37	X	79278618	79278618	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chrX:79278618G>A	ENST00000373294.5	+	2	263	c.235G>A	c.(235-237)Ggc>Agc	p.G79S	TBX22_ENST00000373291.1_5'UTR|TBX22_ENST00000442340.1_5'UTR|TBX22_ENST00000373296.3_Missense_Mutation_p.G79S	NM_016954.2	NP_058650.1	Q9Y458	TBX22_HUMAN	T-box 22	79					multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G79S(1)		breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(13)|lung(38)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						CAGCGACAGCGGCTACGGCAA	0.502																																					p.G79S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G235A	X						.						45.0	43.0	44.0					X																	79278618		2203	4299	6502	79165274	SO:0001583	missense	50945	exon3			AL031000	CCDS14445.1, CCDS43975.1	Xq21.1	2011-02-11			ENSG00000122145	ENSG00000122145		"""T-boxes"""	11600	protein-coding gene	gene with protein product		300307	"""cleft palate and/or ankyloglossia"""	CPX, CLPA		11559848, 14729838	Standard	NM_001109878		Approved		uc004edj.1	Q9Y458	OTTHUMG00000021901	ENST00000373294.5:c.235G>A	X.37:g.79278618G>A	ENSP00000362390:p.Gly79Ser	Somatic		Capture	SOLID	Phase_I	79165274	NM_001109878	Q5JZ06|Q96LC0|Q9HBF1	Missense_Mutation	SNP	ENST00000373294.5	37	CCDS14445.1	.	.	.	.	.	.	.	.	.	.	G	4.808	0.150144	0.09185	.	.	ENSG00000122145	ENST00000373296;ENST00000373294	D;D	0.86366	-2.11;-2.11	4.11	-2.03	0.07365	.	2.051580	0.02487	N	0.089068	T	0.77432	0.4129	L	0.28274	0.84	0.20638	N	0.99987	B	0.18610	0.029	B	0.10450	0.005	T	0.63256	-0.6678	10	0.08599	T	0.76	.	8.5743	0.33590	0.5781:0.0:0.4219:0.0	.	79	Q9Y458	TBX22_HUMAN	S	79	ENSP00000362393:G79S;ENSP00000362390:G79S	ENSP00000362390:G79S	G	+	1	0	TBX22	79165274	0.004000	0.15560	0.000000	0.03702	0.007000	0.05969	0.021000	0.13489	-0.746000	0.04766	-0.191000	0.12829	GGC		TBX22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057334.1	NM_016954	
TMEM185A	84548	hgsc.bcm.edu	37	X	148693049	148693049	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chrX:148693049G>A	ENST00000316916.8	-	2	440	c.136C>T	c.(136-138)Cca>Tca	p.P46S	TMEM185A_ENST00000507237.1_Missense_Mutation_p.P46S|TMEM185A_ENST00000536359.1_Intron	NM_032508.2	NP_115897.1	Q8NFB2	T185A_HUMAN	transmembrane protein 185A	46						dendrite (GO:0030425)|integral component of membrane (GO:0016021)		p.P46S(1)		kidney(1)|large_intestine(3)|lung(10)|ovary(1)	15	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					AGCCATATTGGAGCAAAGACA	0.468																																					p.P46S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C136T	X						.						216.0	207.0	210.0					X																	148693049		2203	4299	6502	148500850	SO:0001583	missense	84548	exon2			AF353675	CCDS14689.1, CCDS55523.1, CCDS76041.1	Xq28	2014-01-28	2007-02-05	2007-02-05	ENSG00000155984	ENSG00000269556			17125	protein-coding gene	gene with protein product		300031	"""chromosome X open reading frame 13"", ""family with sequence similarity 11, member A"""	CXorf13, FAM11A		12404111	Standard	NM_032508		Approved		uc022cgl.1	Q8NFB2	OTTHUMG00000022625	ENST00000316916.8:c.136C>T	X.37:g.148693049G>A	ENSP00000359449:p.Pro46Ser	Somatic		Capture	SOLID	Phase_I	148500850	NM_032508	B3KTZ3|Q3SYH1|Q96CW3|Q96KE8	Missense_Mutation	SNP	ENST00000316916.8	37	CCDS14689.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.800111	0.90538	.	.	ENSG00000155984	ENST00000316916;ENST00000507237	T;T	0.78003	-1.14;-1.14	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	D	0.88437	0.6436	M	0.80422	2.495	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90311	0.4337	10	0.87932	D	0	.	16.2802	0.82672	0.0:0.0:1.0:0.0	.	46	Q8NFB2	T185A_HUMAN	S	46	ENSP00000359449:P46S;ENSP00000427766:P46S	ENSP00000359449:P46S	P	-	1	0	TMEM185A	148500850	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	9.238000	0.95380	2.040000	0.60383	0.594000	0.82650	CCA		TMEM185A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058710.4	NM_032508	
ARHGAP15	55843	hgsc.bcm.edu	37	2	144008151	144008151	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr2:144008151C>A	ENST00000295095.6	+	6	623	c.456C>A	c.(454-456)agC>agA	p.S152R		NM_018460.3	NP_060930.3	Q53QZ3	RHG15_HUMAN	Rho GTPase activating protein 15	152	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)	p.S152R(1)		endometrium(1)|kidney(5)|large_intestine(8)|liver(2)|lung(15)|ovary(1)|skin(2)	34				BRCA - Breast invasive adenocarcinoma(221;0.151)		AAAAATCGAGCAGAAAGAATG	0.353																																					p.S152R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C456A	2						.						105.0	106.0	106.0					2																	144008151		2203	4300	6503	143724621	SO:0001583	missense	55843	exon6			AY219338	CCDS2184.1	2q22.2-q22.3	2013-01-10			ENSG00000075884	ENSG00000075884		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	21030	protein-coding gene	gene with protein product		610578				12650940, 11042152	Standard	NM_018460		Approved	BM046	uc002tvm.4	Q53QZ3	OTTHUMG00000131845	ENST00000295095.6:c.456C>A	2.37:g.144008151C>A	ENSP00000295095:p.Ser152Arg	Somatic		Capture	SOLID	Phase_I	143724621	NM_018460	Q53R36|Q53RD7|Q53RT6|Q53SX9|Q584N9|Q6PJE6|Q86WP1|Q8IXX1|Q9NRL8|Q9NZ77|Q9NZ91	Missense_Mutation	SNP	ENST00000295095.6	37	CCDS2184.1	.	.	.	.	.	.	.	.	.	.	C	17.06	3.292379	0.59976	.	.	ENSG00000075884	ENST00000295095	T	0.79845	-1.31	5.62	3.81	0.43845	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.041971	0.85682	D	0.000000	D	0.89298	0.6675	M	0.82323	2.585	0.47659	D	0.99948	D;D	0.89917	1.0;0.998	D;D	0.81914	0.995;0.957	D	0.89761	0.3947	10	0.87932	D	0	.	12.6544	0.56780	0.0:0.8637:0.0:0.1363	.	152;152	B4E0R3;Q53QZ3	.;RHG15_HUMAN	R	152	ENSP00000295095:S152R	ENSP00000295095:S152R	S	+	3	2	ARHGAP15	143724621	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	1.542000	0.36137	0.719000	0.32188	-0.439000	0.05793	AGC		ARHGAP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254793.2	NM_018460	
TNFAIP6	7130	hgsc.bcm.edu	37	2	152226604	152226604	+	Silent	SNP	C	C	T			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr2:152226604C>T	ENST00000243347.3	+	4	540	c.465C>T	c.(463-465)taC>taT	p.Y155Y	RN7SL124P_ENST00000498656.2_RNA|MIR4773-1_ENST00000585225.1_RNA	NM_007115.3	NP_009046.2	P98066	TSG6_HUMAN	tumor necrosis factor, alpha-induced protein 6	155	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|inflammatory response (GO:0006954)|signal transduction (GO:0007165)		hyaluronic acid binding (GO:0005540)	p.Y155Y(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.131)	Hyaluronan(DB08818)	CAAATGAGTACGAAGATAACC	0.393																																					p.Y155Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C465T	2						.						149.0	149.0	149.0					2																	152226604		2203	4300	6503	151934850	SO:0001819	synonymous_variant	7130	exon4				CCDS2193.1	2q23.3	2008-11-18			ENSG00000123610	ENSG00000123610			11898	protein-coding gene	gene with protein product		600410				1730767, 8568267, 15060082	Standard	NM_007115		Approved	TSG6, TSG-6	uc002txk.3	P98066	OTTHUMG00000131884	ENST00000243347.3:c.465C>T	2.37:g.152226604C>T		Somatic		Capture	SOLID	Phase_I	151934850	NM_007115	Q53TI7|Q8WWI9	Silent	SNP	ENST00000243347.3	37	CCDS2193.1																																																																																				TNFAIP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254834.2	NM_007115	
TTN	7273	hgsc.bcm.edu	37	2	179611639	179611639	+	Intron	SNP	C	C	T	rs150492317		TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr2:179611639C>T	ENST00000591111.1	-	46	10585				TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590773.1_RNA|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.R5163H|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Intron|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R5163H(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGAATCGGAACGCCATATTTC	0.388																																					p.R5163H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G15488A	2						.	T	,,HIS/ARG,,	0,4406		0,0,2203	121.0	119.0	120.0		,,15488,,	4.2	0.9	2	dbSNP_134	120	1,8597	1.2+/-3.3	0,1,4298	yes	intron,intron,missense,intron,intron	TTN	NM_003319.4,NM_133378.4,NM_133379.3,NM_133432.3,NM_133437.3	,,29,,	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	,,,,	,,5163/5605,,	179611639	1,13003	2203	4299	6502	179319884	SO:0001627	intron_variant	7273	exon46			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10361-4991G>A	2.37:g.179611639C>T		Somatic		Capture	SOLID	Phase_I	179319884	NM_133379	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	c	5.845	0.340101	0.11069	0.0	1.16E-4	ENSG00000155657	ENST00000360870;ENST00000306136	T	0.61859	0.07	5.95	4.19	0.49359	.	.	.	.	.	T	0.40297	0.1111	L	0.29908	0.895	0.80722	D	1	B	0.31625	0.332	B	0.19946	0.027	T	0.23368	-1.0190	9	0.42905	T	0.14	.	8.9496	0.35781	0.0:0.7584:0.1194:0.1222	.	5163	Q8WZ42-6	.	H	5163;444	ENSP00000354117:R5163H	ENSP00000304714:R444H	R	-	2	0	TTN	179319884	0.002000	0.14202	0.908000	0.35775	0.481000	0.33189	0.210000	0.17455	0.883000	0.36040	-0.713000	0.03633	CGT		TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
CALCRL	10203	hgsc.bcm.edu	37	2	188216984	188216984	+	Missense_Mutation	SNP	T	T	G			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr2:188216984T>G	ENST00000409998.1	-	14	1766	c.985A>C	c.(985-987)Aat>Cat	p.N329H	CALCRL_ENST00000410068.1_Missense_Mutation_p.N329H|CALCRL_ENST00000392370.3_Missense_Mutation_p.N329H|AC007319.1_ENST00000412276.1_RNA|AC007319.1_ENST00000453517.1_RNA			Q16602	CALRL_HUMAN	calcitonin receptor-like	329					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|angiogenesis (GO:0001525)|calcium ion transport (GO:0006816)|cAMP biosynthetic process (GO:0006171)|cellular response to sucrose stimulus (GO:0071329)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|heart development (GO:0007507)|negative regulation of inflammatory response (GO:0050728)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|regulation of muscle contraction (GO:0006937)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	adrenomedullin receptor activity (GO:0001605)|calcitonin gene-related polypeptide receptor activity (GO:0001635)|calcitonin receptor activity (GO:0004948)|G-protein coupled receptor activity (GO:0004930)|protein transporter activity (GO:0008565)	p.N329H(1)		endometrium(1)|large_intestine(7)|lung(21)|ovary(1)|prostate(1)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(96;0.227)			ATGTACAGATTGGATTCCGCT	0.388																																					p.N329H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A985C	2						.						81.0	73.0	76.0					2																	188216984		2203	4299	6502	187925229	SO:0001583	missense	10203	exon13			U17473	CCDS2293.1	2q21.1-q21.3	2012-08-10			ENSG00000064989	ENSG00000064989		"""GPCR / Class B : Calcitonin receptors"""	16709	protein-coding gene	gene with protein product		114190				7818539, 8626685	Standard	NM_005795		Approved	CGRPR, CRLR	uc010frt.4	Q16602	OTTHUMG00000132636	ENST00000409998.1:c.985A>C	2.37:g.188216984T>G	ENSP00000386972:p.Asn329His	Somatic		Capture	SOLID	Phase_I	187925229	NM_005795	A8K6G5|A8KAD3|Q53S02|Q53TS5	Missense_Mutation	SNP	ENST00000409998.1	37	CCDS2293.1	.	.	.	.	.	.	.	.	.	.	T	9.476	1.096811	0.20552	.	.	ENSG00000064989	ENST00000392370;ENST00000409998;ENST00000410068	T;T;T	0.37058	1.22;1.22;1.22	5.7	1.82	0.25136	GPCR, family 2-like (1);	0.158393	0.42420	N	0.000708	T	0.22589	0.0545	N	0.20401	0.57	0.38907	D	0.957454	B	0.02656	0.0	B	0.12837	0.008	T	0.06862	-1.0803	10	0.23302	T	0.38	.	12.9594	0.58449	0.0:0.0:0.4371:0.5629	.	329	Q16602	CALRL_HUMAN	H	329	ENSP00000376177:N329H;ENSP00000386972:N329H;ENSP00000387190:N329H	ENSP00000376177:N329H	N	-	1	0	CALCRL	187925229	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	4.342000	0.59341	0.052000	0.16007	0.528000	0.53228	AAT		CALCRL-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334648.1	NM_005795	
COL6A3	1293	hgsc.bcm.edu	37	2	238258800	238258800	+	Missense_Mutation	SNP	C	C	T	rs398124131		TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr2:238258800C>T	ENST00000295550.4	-	28	7321	c.6869G>A	c.(6868-6870)cGt>cAt	p.R2290H	COL6A3_ENST00000346358.4_Missense_Mutation_p.R2090H|COL6A3_ENST00000472056.1_Missense_Mutation_p.R1683H|COL6A3_ENST00000347401.3_Missense_Mutation_p.R2089H|COL6A3_ENST00000409809.1_Missense_Mutation_p.R2084H|COL6A3_ENST00000353578.4_Missense_Mutation_p.R2084H	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2290	Collagen-like 4.|Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.R2290H(1)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CGTCTCCCCACGAGGGCCCCG	0.597													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16648	0.0		0.0	False		,,,				2504	0.0				p.R1683H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5048A	2						.						93.0	83.0	87.0					2																	238258800		2203	4300	6503	237923539	SO:0001583	missense	1293	exon25			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.6869G>A	2.37:g.238258800C>T	ENSP00000295550:p.Arg2290His	Somatic		Capture	SOLID	Phase_I	237923539	NM_057166	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	C	15.01	2.707029	0.48412	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	D;D;D;D;D;D	0.96104	-3.4;-3.91;-3.25;-3.4;-3.25;-3.91	5.38	5.38	0.77491	.	0.000000	0.45361	D	0.000377	D	0.98204	0.9406	M	0.90759	3.145	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.997;0.999;0.998	D	0.98988	1.0807	10	0.72032	D	0.01	.	19.1613	0.93533	0.0:1.0:0.0:0.0	.	1683;1683;2084;2290	E9PFQ6;B7ZMJ7;P12111-2;P12111	.;.;.;CO6A3_HUMAN	H	2290;2089;2084;1683;2084;2090	ENSP00000295550:R2290H;ENSP00000315609:R2089H;ENSP00000315873:R2084H;ENSP00000418285:R1683H;ENSP00000386844:R2084H;ENSP00000295546:R2090H	ENSP00000295550:R2290H	R	-	2	0	COL6A3	237923539	0.997000	0.39634	0.655000	0.29622	0.580000	0.36256	3.997000	0.57016	2.507000	0.84556	0.655000	0.94253	CGT		COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
PTPRD	5789	hgsc.bcm.edu	37	9	8499754	8499754	+	Missense_Mutation	SNP	T	T	G			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr9:8499754T>G	ENST00000381196.4	-	22	2758	c.2215A>C	c.(2215-2217)Aaa>Caa	p.K739Q	PTPRD_ENST00000355233.5_Intron|PTPRD_ENST00000471274.1_5'UTR|PTPRD_ENST00000486161.1_Intron|PTPRD_ENST00000360074.4_Missense_Mutation_p.K726Q|PTPRD_ENST00000540109.1_Missense_Mutation_p.K739Q|PTPRD_ENST00000397606.3_Intron|PTPRD_ENST00000356435.5_Missense_Mutation_p.K739Q|PTPRD_ENST00000397611.3_Intron|PTPRD_ENST00000537002.1_Intron|PTPRD_ENST00000397617.3_Intron|PTPRD_ENST00000358503.5_Missense_Mutation_p.K726Q	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	739	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.K739Q(1)		NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		CCATGCTGTTTATTGGGCACG	0.502										TSP Lung(15;0.13)																											p.K739Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2215C	9						.						175.0	152.0	160.0					9																	8499754		2203	4300	6503	8489754	SO:0001583	missense	5789	exon25			X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.2215A>C	9.37:g.8499754T>G	ENSP00000370593:p.Lys739Gln	Somatic		Capture	SOLID	Phase_I	8489754	NM_002839	B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	ENST00000381196.4	37	CCDS43786.1	.	.	.	.	.	.	.	.	.	.	T	11.11	1.543229	0.27563	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000540109	T;T;T;T;T	0.56776	0.44;0.44;0.44;0.44;0.44	5.69	4.53	0.55603	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.054692	0.64402	D	0.000001	T	0.53658	0.1810	L	0.43923	1.385	0.45747	D	0.998642	P;P;P	0.51653	0.947;0.801;0.908	P;B;P	0.51135	0.66;0.339;0.574	T	0.49551	-0.8928	9	.	.	.	.	12.87	0.57960	0.0:0.0:0.136:0.864	.	726;739;739	G3XAE2;Q2HXI4;P23468	.;.;PTPRD_HUMAN	Q	739;739;726;726;739	ENSP00000370593:K739Q;ENSP00000348812:K739Q;ENSP00000353187:K726Q;ENSP00000351293:K726Q;ENSP00000438164:K739Q	.	K	-	1	0	PTPRD	8489754	1.000000	0.71417	0.990000	0.47175	0.991000	0.79684	5.881000	0.69706	0.959000	0.37980	0.482000	0.46254	AAA		PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3		
SLC24A2	25769	hgsc.bcm.edu	37	9	19786271	19786271	+	Silent	SNP	G	G	A			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr9:19786271G>A	ENST00000341998.2	-	1	655	c.594C>T	c.(592-594)atC>atT	p.I198I	SLC24A2_ENST00000286344.3_Silent_p.I198I	NM_001193288.2|NM_020344.3	NP_001180217.1|NP_065077.1	Q9UI40	NCKX2_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 2	198					cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	cadmium ion binding (GO:0046870)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium, potassium:sodium antiporter activity (GO:0008273)|manganese ion binding (GO:0030145)|nickel cation binding (GO:0016151)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|symporter activity (GO:0015293)	p.I198I(1)		endometrium(3)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33				GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)		TGCTGTGAGCGATAAATACCC	0.458																																					p.I198I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C594T	9						.						87.0	85.0	85.0					9																	19786271		2203	4300	6503	19776271	SO:0001819	synonymous_variant	25769	exon2			AF097366	CCDS6493.1, CCDS55297.1	9p22.1	2013-05-22			ENSG00000155886	ENSG00000155886		"""Solute carriers"""	10976	protein-coding gene	gene with protein product		609838				10662833	Standard	NM_020344		Approved	NCKX2	uc003zoa.2	Q9UI40	OTTHUMG00000019646	ENST00000341998.2:c.594C>T	9.37:g.19786271G>A		Somatic		Capture	SOLID	Phase_I	19776271	NM_020344	B7ZLL8|Q9NTN5|Q9NZQ4	Silent	SNP	ENST00000341998.2	37	CCDS6493.1																																																																																				SLC24A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051866.2	NM_020344	
ZNF658	26149	hgsc.bcm.edu	37	9	40774157	40774157	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr9:40774157C>A	ENST00000602553.1	-	5	1412	c.1118G>T	c.(1117-1119)aGa>aTa	p.R373I	ZNF658_ENST00000441795.1_Missense_Mutation_p.R371I|ZNF658_ENST00000377626.3_Missense_Mutation_p.R373I			Q5TYW1	ZN658_HUMAN	zinc finger protein 658	373					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R373I(1)		breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	46				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		TGTGTGAATTCTCTGATGTGC	0.393																																					p.R373I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1118T	9						.						183.0	189.0	187.0					9																	40774157		2203	4300	6503	40764157	SO:0001583	missense	26149	exon5			AA482262	CCDS75846.1	9p13.1	2013-01-08			ENSG00000196409	ENSG00000274349		"""Zinc fingers, C2H2-type"", ""-"""	25226	protein-coding gene	gene with protein product							Standard	NM_033160		Approved	MGC35232, DKFZp572C163, FLJ32813	uc004abs.2	Q5TYW1	OTTHUMG00000013392	ENST00000602553.1:c.1118G>T	9.37:g.40774157C>A	ENSP00000473484:p.Arg373Ile	Somatic		Capture	SOLID	Phase_I	40764157	NM_033160	Q6PIP3|Q96M55|Q9H9S6|Q9UG02	Missense_Mutation	SNP	ENST00000602553.1	37	CCDS35023.1	.	.	.	.	.	.	.	.	.	.	c	13.39	2.221766	0.39300	.	.	ENSG00000196409	ENST00000441795;ENST00000377626	T;T	0.18502	2.21;2.21	1.96	0.0106	0.14083	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.28267	0.0698	L	0.56769	1.78	0.28420	N	0.917796	D;D	0.71674	0.998;0.989	D;P	0.66351	0.943;0.737	T	0.12656	-1.0539	9	0.45353	T	0.12	.	4.0821	0.09931	0.23:0.6233:0.0:0.1467	.	373;373	Q5TYW1-2;Q5TYW1	.;ZN658_HUMAN	I	371;373	ENSP00000408462:R371I;ENSP00000366853:R373I	ENSP00000366853:R373I	R	-	2	0	ZNF658	40764157	0.000000	0.05858	0.069000	0.20011	0.078000	0.17371	0.034000	0.13776	0.018000	0.15052	-1.265000	0.01443	AGA		ZNF658-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467800.1	NM_033160	
ZNF484	83744	hgsc.bcm.edu	37	9	95608904	95608904	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr9:95608904C>T	ENST00000375495.3	-	5	2313	c.2165G>A	c.(2164-2166)tGt>tAt	p.C722Y	ZNF484_ENST00000332591.6_Missense_Mutation_p.C686Y|ANKRD19P_ENST00000473204.1_RNA|ZNF484_ENST00000395505.2_Missense_Mutation_p.C686Y|ZNF484_ENST00000395506.3_Missense_Mutation_p.C724Y	NM_031486.2	NP_113674.1	Q5JVG2	ZN484_HUMAN	zinc finger protein 484	722					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.C722Y(1)		NS(1)|breast(1)|cervix(1)|kidney(8)|large_intestine(10)|lung(10)|prostate(2)	33						ACATTCATTACAAATATAGGG	0.393																																					p.C686Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2057A	9						.						58.0	61.0	60.0					9																	95608904		2203	4300	6503	94648725	SO:0001583	missense	83744	exon4			AK091203	CCDS35066.1, CCDS35067.1, CCDS59136.1	9q22.32	2013-01-08			ENSG00000127081	ENSG00000127081		"""Zinc fingers, C2H2-type"", ""-"""	23385	protein-coding gene	gene with protein product							Standard	NM_001007101		Approved	BA526D8.4, FLJ33884	uc004asu.2	Q5JVG2	OTTHUMG00000020236	ENST00000375495.3:c.2165G>A	9.37:g.95608904C>T	ENSP00000364645:p.Cys722Tyr	Somatic		Capture	SOLID	Phase_I	94648725	NM_001007101	B1AL89|B4DRI2	Missense_Mutation	SNP	ENST00000375495.3	37	CCDS35066.1	.	.	.	.	.	.	.	.	.	.	.	15.44	2.833001	0.50951	.	.	ENSG00000127081	ENST00000395505;ENST00000395506;ENST00000375495;ENST00000332591	D;D;D;D	0.85088	-1.94;-1.94;-1.94;-1.94	2.32	2.32	0.28847	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94072	0.8100	H	0.97158	3.95	0.40975	D	0.984731	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94733	0.7911	9	0.87932	D	0	.	10.7577	0.46247	0.0:1.0:0.0:0.0	.	724;722	B4DRI2;Q5JVG2	.;ZN484_HUMAN	Y	686;724;722;686	ENSP00000378881:C686Y;ENSP00000378882:C724Y;ENSP00000364645:C722Y;ENSP00000364646:C686Y	ENSP00000364646:C686Y	C	-	2	0	ZNF484	94648725	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	6.394000	0.73223	1.596000	0.50062	0.551000	0.68910	TGT		ZNF484-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000053111.2	XM_046861	
DNM1	1759	hgsc.bcm.edu	37	9	131010867	131010867	+	Silent	SNP	C	C	T			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr9:131010867C>T	ENST00000372923.3	+	19	2003	c.1911C>T	c.(1909-1911)agC>agT	p.S637S	DNM1_ENST00000341179.7_Silent_p.S637S|DNM1_ENST00000486160.1_Silent_p.S637S|DNM1_ENST00000475805.1_Silent_p.S637S|DNM1_ENST00000393594.3_Silent_p.S637S	NM_004408.2	NP_004399.2	Q05193	DYN1_HUMAN	dynamin 1	637					endocytosis (GO:0006897)|endosome organization (GO:0007032)|GTP catabolic process (GO:0006184)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)	extracellular vesicular exosome (GO:0070062)|membrane coat (GO:0030117)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.S637S(2)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(15)|lung(6)|ovary(2)|urinary_tract(2)	32						GGCAGGCCAGCGAGACCGAGG	0.592																																					p.A637V	GBM(113;146 1575 2722 28670 29921)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1910T	9						.						79.0	68.0	72.0					9																	131010867		2203	4300	6503	130050688	SO:0001819	synonymous_variant	1759	exon18			L07807	CCDS6895.1, CCDS43882.1, CCDS75911.1, CCDS75912.1	9q34	2013-01-10			ENSG00000106976	ENSG00000106976		"""Pleckstrin homology (PH) domain containing"""	2972	protein-coding gene	gene with protein product		602377		DNM		2144893, 9143509	Standard	XM_005251763		Approved		uc022bob.1	Q05193	OTTHUMG00000020733	ENST00000372923.3:c.1911C>T	9.37:g.131010867C>T		Somatic		Capture	SOLID	Phase_I	130050688	NM_001005336	A6NLM6|Q5SYX0|Q5SYX2|Q6P3T6|Q86VD2	Silent	SNP	ENST00000372923.3	37	CCDS6895.1																																																																																				DNM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054367.1	NM_004408	
SACS	26278	hgsc.bcm.edu	37	13	23907183	23907183	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr13:23907183G>T	ENST00000382292.3	-	9	11105	c.10832C>A	c.(10831-10833)gCt>gAt	p.A3611D	SACS_ENST00000382298.3_Missense_Mutation_p.A3611D|SACS_ENST00000402364.1_Missense_Mutation_p.A2861D			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	3611					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)	p.A3464D(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		TTCTGTATTAGCCCTCACACT	0.343																																					p.A3611D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C10832A	13						.						63.0	66.0	65.0					13																	23907183		2203	4299	6502	22805183	SO:0001583	missense	26278	exon10			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.10832C>A	13.37:g.23907183G>T	ENSP00000371729:p.Ala3611Asp	Somatic		Capture	SOLID	Phase_I	22805183	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	37	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	G	22.8	4.339806	0.81911	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.88664	-2.26;-2.41;-2.26	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	D	0.91888	0.7432	L	0.29908	0.895	0.58432	D	0.999996	D	0.89917	1.0	D	0.85130	0.997	D	0.92343	0.5883	10	0.72032	D	0.01	.	20.2946	0.98546	0.0:0.0:1.0:0.0	.	3611	Q9NZJ4	SACS_HUMAN	D	3611;2861;3611	ENSP00000371729:A3611D;ENSP00000385844:A2861D;ENSP00000371735:A3611D	ENSP00000371729:A3611D	A	-	2	0	SACS	22805183	1.000000	0.71417	0.999000	0.59377	0.977000	0.68977	9.869000	0.99810	2.804000	0.96469	0.462000	0.41574	GCT		SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
ZC3H13	23091	hgsc.bcm.edu	37	13	46549603	46549612	+	Frame_Shift_Del	DEL	CTCTCTCTCC	CTCTCTCTCC	-			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	CTCTCTCTCC	CTCTCTCTCC	CTCTCTCTCC	-	CTCTCTCTCC	CTCTCTCTCC	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr13:46549603_46549612delCTCTCTCTCC	ENST00000242848.4	-	12	2622_2631	c.2274_2283delGGAGAGAGAG	c.(2272-2283)agggagagagagfs	p.RERE770fs	ZC3H13_ENST00000282007.3_Frame_Shift_Del_p.RERE770fs			Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	770	Arg/Glu-rich.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.R758fs*104(1)		cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|lung(25)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	79		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		cccgttctcgctctctctccctctctctct	0.524																																					p.758_761del	Esophageal Squamous(187;747 2077 11056 31291 44172)											.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.2274_2283del	13						.																																			45447613	SO:0001589	frameshift_variant	23091	exon12			AB020660	CCDS9400.1	13q14.11	2012-07-05	2006-05-15	2006-05-15	ENSG00000123200	ENSG00000123200		"""Zinc fingers, CCCH-type domain containing"""	20368	protein-coding gene	gene with protein product			"""KIAA0853"""	KIAA0853		10048485	Standard	XM_005266301		Approved	DKFZp434D1812	uc001vas.1	Q5T200	OTTHUMG00000016863	ENST00000242848.4:c.2274_2283delGGAGAGAGAG	13.37:g.46549603_46549612delCTCTCTCTCC	ENSP00000242848:p.Arg770fs	Somatic		Capture	SOLID	Phase_I	45447604	NM_015070	A2A323|O94936|Q5T1Z9|Q7Z7J3|Q8NDT6|Q9H0L6	Frame_Shift_Del	DEL	ENST00000242848.4	37																																																																																					ZC3H13-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000044789.1	NM_015070	
MCM10	55388	hgsc.bcm.edu	37	10	13217573	13217573	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr10:13217573G>A	ENST00000484800.2	+	6	762	c.659G>A	c.(658-660)cGg>cAg	p.R220Q	MCM10_ENST00000378714.3_Missense_Mutation_p.R219Q|MCM10_ENST00000378694.1_Missense_Mutation_p.R219Q			Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	220					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)	p.R220Q(1)		central_nervous_system(1)|large_intestine(4)|ovary(2)|skin(1)|stomach(1)	9						ACGATTTCTCGGAACAAACCT	0.468																																					p.R219Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G656A	10						.						121.0	120.0	121.0					10																	13217573		2203	4300	6503	13257579	SO:0001583	missense	55388	exon6			AB042719	CCDS7095.1, CCDS7096.1	10p13	2008-08-01	2007-04-04		ENSG00000065328	ENSG00000065328			18043	protein-coding gene	gene with protein product		609357	"""MCM10 minichromosome maintenance deficient 10 (S. cerevisiae)"""			11095689, 17699597	Standard	NM_018518		Approved	PRO2249, CNA43, DNA43	uc001ima.3	Q7L590	OTTHUMG00000017694	ENST00000484800.2:c.659G>A	10.37:g.13217573G>A	ENSP00000418268:p.Arg220Gln	Somatic		Capture	SOLID	Phase_I	13257579	NM_018518	A8K9I6|B7ZKZ8|Q3MIR3|Q7LD55|Q96GX4|Q96NB6|Q9H0D7|Q9H3P9|Q9P177	Missense_Mutation	SNP	ENST00000484800.2	37	CCDS7096.1	.	.	.	.	.	.	.	.	.	.	G	2.875	-0.233170	0.05983	.	.	ENSG00000065328	ENST00000378714;ENST00000361282;ENST00000484800;ENST00000378694	T;T;T	0.14266	2.52;2.53;2.52	5.42	2.56	0.30785	.	0.428037	0.27258	N	0.020182	T	0.04952	0.0133	N	0.02011	-0.69	0.24874	N	0.992265	B;B;B	0.24882	0.113;0.072;0.043	B;B;B	0.24269	0.017;0.052;0.023	T	0.42050	-0.9474	10	0.13108	T	0.6	-13.7509	12.5664	0.56312	0.1857:0.0:0.8143:0.0	.	219;219;220	Q5T670;Q7L590-2;Q7L590	.;.;MCM10_HUMAN	Q	219;220;220;219	ENSP00000367986:R219Q;ENSP00000418268:R220Q;ENSP00000367966:R219Q	ENSP00000354945:R220Q	R	+	2	0	MCM10	13257579	1.000000	0.71417	0.396000	0.26296	0.002000	0.02628	2.544000	0.45761	0.097000	0.17492	-1.731000	0.00696	CGG		MCM10-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356853.1	NM_182751	
DUSP5	1847	hgsc.bcm.edu	37	10	112266749	112266749	+	Silent	SNP	C	C	G	rs547369264		TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr10:112266749C>G	ENST00000369583.3	+	3	869	c.585C>G	c.(583-585)tcC>tcG	p.S195S	DUSP5_ENST00000468749.1_3'UTR	NM_004419.3	NP_004410.3	Q16690	DUS5_HUMAN	dual specificity phosphatase 5	195	Tyrosine-protein phosphatase.				endoderm formation (GO:0001706)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.S195S(2)		kidney(2)|large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)	13		Breast(234;0.0848)		Epithelial(162;0.000276)|all cancers(201;0.00465)|BRCA - Breast invasive adenocarcinoma(275;0.12)		ACCATGCATCCAAGTGCGAGT	0.547																																					p.S195S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C585G	10						.						218.0	212.0	214.0					10																	112266749		2203	4300	6503	112256739	SO:0001819	synonymous_variant	1847	exon3			U16996	CCDS7566.1	10q25	2011-06-09			ENSG00000138166	ENSG00000138166		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3071	protein-coding gene	gene with protein product		603069				7806236	Standard	NM_004419		Approved	HVH3	uc001kzd.3	Q16690	OTTHUMG00000019040	ENST00000369583.3:c.585C>G	10.37:g.112266749C>G		Somatic		Capture	SOLID	Phase_I	112256739	NM_004419	Q12997|Q5T603	Silent	SNP	ENST00000369583.3	37	CCDS7566.1																																																																																				DUSP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050333.1	NM_004419	
APC	324	hgsc.bcm.edu	37	5	112162834	112162834	+	Nonsense_Mutation	SNP	C	C	T	rs570514864		TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr5:112162834C>T	ENST00000457016.1	+	12	1818	c.1438C>T	c.(1438-1440)Caa>Taa	p.Q480*	APC_ENST00000508376.2_Nonsense_Mutation_p.Q480*|APC_ENST00000257430.4_Nonsense_Mutation_p.Q480*|CTC-554D6.1_ENST00000520401.1_5'Flank			P25054	APC_HUMAN	adenomatous polyposis coli	480	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Q480*(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AGAATTATTGCAAGTGGACTG	0.378		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Q462X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	2	Substitution - Nonsense(1)|Unknown(1)	large_intestine(1)|skin(1)	c.C1384T	5	GRCh37	CM040977	APC	M		.						109.0	100.0	103.0					5																	112162834		2202	4300	6502	112190733	SO:0001587	stop_gained	324	exon10	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.1438C>T	5.37:g.112162834C>T	ENSP00000413133:p.Gln480*	Somatic		Capture	SOLID	Phase_I	112190733	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	40	8.062090	0.98635	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-14.1611	20.1731	0.98165	0.0:1.0:0.0:0.0	.	.	.	.	X	480;462;480;480;480	.	ENSP00000257430:Q480X	Q	+	1	0	APC	112190733	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.768000	0.95171	0.655000	0.94253	CAA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
EGR1	1958	hgsc.bcm.edu	37	5	137803578	137803578	+	Silent	SNP	G	G	A			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr5:137803578G>A	ENST00000239938.4	+	2	1712	c.1440G>A	c.(1438-1440)tcG>tcA	p.S480S		NM_001964.2	NP_001955.1	P18146	EGR1_HUMAN	early growth response 1	480					BMP signaling pathway (GO:0030509)|cellular response to antibiotic (GO:0071236)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to gamma radiation (GO:0071480)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heparin (GO:0071504)|cellular response to hyperoxia (GO:0071455)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|cellular response to isoquinoline alkaloid (GO:0071317)|cellular response to mechanical stimulus (GO:0071260)|cellular response to mycophenolic acid (GO:0071506)|cellular response to steroid hormone stimulus (GO:0071383)|circadian rhythm (GO:0007623)|cytokine-mediated signaling pathway (GO:0019221)|glomerular mesangial cell proliferation (GO:0072110)|interleukin-1-mediated signaling pathway (GO:0070498)|learning or memory (GO:0007611)|long-term synaptic potentiation (GO:0060291)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte differentiation (GO:0048709)|positive regulation of glomerular metanephric mesangial cell proliferation (GO:0072303)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of protein sumoylation (GO:0033233)|response to amphetamine (GO:0001975)|response to carbon monoxide (GO:0034465)|response to cocaine (GO:0042220)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to norepinephrine (GO:0071873)|response to nutrient levels (GO:0031667)|skeletal muscle cell differentiation (GO:0035914)|T cell differentiation (GO:0030217)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|histone acetyltransferase binding (GO:0035035)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.S480S(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|ovary(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			ccggctcctcgacctacccat	0.642																																					p.S480S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1440A	5						.						137.0	119.0	125.0					5																	137803578		2203	4300	6503	137831477	SO:0001819	synonymous_variant	1958	exon2			M62829	CCDS4206.1	5q23-q31	2013-01-08			ENSG00000120738	ENSG00000120738		"""Zinc fingers, C2H2-type"""	3238	protein-coding gene	gene with protein product	"""nerve growth factor-induced protein A"", ""transcription factor ETR103"", ""zinc finger protein 225"", ""early growth response protein 1"""	128990				3127059	Standard	NM_001964		Approved	TIS8, G0S30, NGFI-A, KROX-24, ZIF-268, AT225, ZNF225	uc003ldb.1	P18146	OTTHUMG00000129197	ENST00000239938.4:c.1440G>A	5.37:g.137803578G>A		Somatic		Capture	SOLID	Phase_I	137831477	NM_001964		Silent	SNP	ENST00000239938.4	37	CCDS4206.1																																																																																				EGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251274.1	NM_001964	
PCDHB6	56130	hgsc.bcm.edu	37	5	140530309	140530309	+	Silent	SNP	C	C	T			TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2677-01A-01W-0831-10	TCGA-A6-2677-10A-01W-0831-10	g.chr5:140530309C>T	ENST00000231136.1	+	1	471	c.471C>T	c.(469-471)caC>caT	p.H157H	PCDHB6_ENST00000543635.1_Silent_p.H21H	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	157	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.H157H(1)		cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AAATGGCACACGATTTAGACA	0.483																																					p.H157H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C471T	5						.						140.0	151.0	147.0					5																	140530309		2203	4300	6503	140510493	SO:0001819	synonymous_variant	56130	exon1			AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.471C>T	5.37:g.140530309C>T		Somatic		Capture	SOLID	Phase_I	140510493	NM_018939	B2R8R9	Silent	SNP	ENST00000231136.1	37	CCDS4248.1																																																																																				PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251818.2	NM_018939	
