#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ZBTB7C	201501	hgsc.bcm.edu	37	18	45567074	45567075	+	Frame_Shift_Ins	INS	-	-	TTGA			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr18:45567074_45567075insTTGA	ENST00000588982.1	-	3	905_906	c.404_405insTCAA	c.(403-405)gagfs	p.E135fs	ZBTB7C_ENST00000535628.2_Frame_Shift_Ins_p.E135fs|ZBTB7C_ENST00000586438.1_Frame_Shift_Ins_p.E135fs|ZBTB7C_ENST00000590800.1_Frame_Shift_Ins_p.E135fs|ZBTB7C_ENST00000332053.2_Frame_Shift_Ins_p.E135fs			A1YPR0	ZBT7C_HUMAN	zinc finger and BTB domain containing 7C	135	Asp-rich.|Glu-rich.						metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(8)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						tgtcatcctcctcccccccgtc	0.579																																					p.E135fs												.	.	0			c.405_406insTCAA	18						.																																			43821073	SO:0001589	frameshift_variant	201501	exon2			Y14591	CCDS32830.1	18q21.1	2013-01-08		2005-04-07	ENSG00000184828	ENSG00000184828		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	31700	protein-coding gene	gene with protein product			"""zinc finger and BTB domain containing 36"""	ZBTB36			Standard	NM_001039360		Approved	ZNF857C	uc002ldb.3	A1YPR0		ENST00000588982.1:c.404_405insTCAA	18.37:g.45567074_45567075insTTGA	ENSP00000468782:p.Glu135fs	None		Capture	SOLID	Phase_I	43821072	NM_001039360	O73453	Frame_Shift_Ins	INS	ENST00000588982.1	37	CCDS32830.1																																																																																				ZBTB7C-025	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450731.1	NM_001039360	
TRA2A	29896	hgsc.bcm.edu	37	7	23545855	23545855	+	Silent	SNP	G	G	A			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr7:23545855G>A	ENST00000297071.4	-	6	888	c.672C>T	c.(670-672)ggC>ggT	p.G224G	TRA2A_ENST00000392502.4_Silent_p.G123G|TRA2A_ENST00000538367.1_Silent_p.G123G|TRA2A_ENST00000474586.1_5'Flank	NM_013293.3	NP_037425.1	Q13595	TRA2A_HUMAN	transformer 2 alpha homolog (Drosophila)	224	Linker.				mRNA splicing, via spliceosome (GO:0000398)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.G224G(1)		endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	10						cacctccaccgccgccgcctc	0.448																																					p.G224G	Pancreas(121;2137 2973 46590)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C672T	7						.						45.0	44.0	44.0					7																	23545855		2203	4300	6503	23512380	SO:0001819	synonymous_variant	29896	exon6			U53209	CCDS5383.1, CCDS64609.1, CCDS75569.1	7p15.3	2014-02-12			ENSG00000164548	ENSG00000164548		"""RNA binding motif (RRM) containing"""	16645	protein-coding gene	gene with protein product		602718				8799144, 9546399	Standard	XM_005249725		Approved	htra-2-alpha, tra2a, AWMS1	uc003swi.3	Q13595	OTTHUMG00000128459	ENST00000297071.4:c.672C>T	7.37:g.23545855G>A		Somatic		Capture	SOLID	Phase_I	23512380	NM_013293	B4DUA9	Silent	SNP	ENST00000297071.4	37	CCDS5383.1																																																																																				TRA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250257.1	NM_013293	
NPSR1	387129	hgsc.bcm.edu	37	7	34851443	34851443	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr7:34851443C>T	ENST00000360581.1	+	4	574	c.446C>T	c.(445-447)gCc>gTc	p.A149V	NPSR1_ENST00000381542.1_Intron|NPSR1_ENST00000381539.3_Missense_Mutation_p.A149V|NPSR1_ENST00000359791.1_Missense_Mutation_p.A149V|NPSR1_ENST00000531252.1_Missense_Mutation_p.A138V	NM_207172.1	NP_997055.1	Q6W5P4	NPSR1_HUMAN	neuropeptide S receptor 1	149						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|vasopressin receptor activity (GO:0005000)	p.A149V(2)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(7)	31					Halothane(DB01159)	AGATACCATGCCATCGTCTAC	0.478																																					p.A149V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C446T	7						.						239.0	188.0	205.0					7																	34851443		2203	4300	6503	34817968	SO:0001583	missense	387129	exon4			AY255536	CCDS5443.1, CCDS5444.1, CCDS75579.1, CCDS75580.1, CCDS75581.1	7p14.3	2012-08-08	2006-05-10	2006-05-10	ENSG00000187258	ENSG00000187258		"""GPCR / Class A : Neuropeptide receptors : S"""	23631	protein-coding gene	gene with protein product		608595	"""G protein-coupled receptor 154"""	GPR154		12679517, 15073379	Standard	NM_207173		Approved	PGR14, GPRA	uc003tei.1	Q6W5P4	OTTHUMG00000099383	ENST00000360581.1:c.446C>T	7.37:g.34851443C>T	ENSP00000353788:p.Ala149Val	Somatic		Capture	SOLID	Phase_I	34817968	NM_207172	A2RTZ4|Q2XP58|Q56H76|Q56H77|Q56H78|Q6JSL4|Q6JSL5|Q6JSL6|Q6JSL7|Q6JSL8|Q6W5P3|Q6ZMB8	Missense_Mutation	SNP	ENST00000360581.1	37	CCDS5444.1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.974529	0.92919	.	.	ENSG00000187258	ENST00000360581;ENST00000359791;ENST00000531252;ENST00000381539;ENST00000334481	T;T;T;T	0.52057	0.68;0.68;0.68;0.68	5.58	5.58	0.84498	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000002	T	0.72637	0.3485	M	0.84219	2.685	0.58432	D	0.999993	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.998;1.0	T	0.76484	-0.2942	10	0.87932	D	0	-26.8122	18.1286	0.89593	0.0:1.0:0.0:0.0	.	138;149;149;149	Q6W5P4-5;Q6W5P4-4;Q6W5P4-3;Q6W5P4	.;.;.;NPSR1_HUMAN	V	149;149;138;149;21	ENSP00000353788:A149V;ENSP00000352839:A149V;ENSP00000433258:A138V;ENSP00000370950:A149V	ENSP00000334093:A21V	A	+	2	0	NPSR1	34817968	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.666000	0.61554	2.616000	0.88540	0.655000	0.94253	GCC		NPSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216837.1	NM_207173	
KCNH2	3757	hgsc.bcm.edu	37	7	150644113	150644113	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr7:150644113G>A	ENST00000262186.5	-	14	3583	c.3182C>T	c.(3181-3183)gCc>gTc	p.A1061V	KCNH2_ENST00000330883.4_Missense_Mutation_p.A721V|KCNH2_ENST00000392968.2_Missense_Mutation_p.A965V	NM_000238.3	NP_000229.1	Q12809	KCNH2_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 2	1061					cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)	p.A1061V(1)		NS(1)|cervix(1)|endometrium(10)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	42	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	CAGGACAGTGGCCATGTCTGC	0.667																																					p.A721V	GBM(137;110 1844 13671 20123 45161)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2162T	7						.						40.0	43.0	42.0					7																	150644113		2203	4300	6503	150275046	SO:0001583	missense	3757	exon10			U04270	CCDS5910.1, CCDS5911.1	7q36.1	2014-09-17			ENSG00000055118	ENSG00000055118		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6251	protein-coding gene	gene with protein product		152427		LQT2		18616963, 7842012, 8159766, 16382104	Standard	NM_000238		Approved	Kv11.1, HERG, erg1	uc003wic.3	Q12809	OTTHUMG00000158341	ENST00000262186.5:c.3182C>T	7.37:g.150644113G>A	ENSP00000262186:p.Ala1061Val	Somatic		Capture	SOLID	Phase_I	150275046	NM_172057	A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Missense_Mutation	SNP	ENST00000262186.5	37	CCDS5910.1	.	.	.	.	.	.	.	.	.	.	G	15.03	2.713379	0.48517	.	.	ENSG00000055118	ENST00000330883;ENST00000392968;ENST00000262186	D;D;D	0.87491	-2.26;-2.26;-2.26	4.68	4.68	0.58851	.	0.171955	0.37761	N	0.001952	T	0.78162	0.4240	L	0.36672	1.1	0.52501	D	0.99995	P;P;P	0.43477	0.808;0.48;0.557	B;B;B	0.33960	0.173;0.173;0.154	T	0.79500	-0.1778	10	0.44086	T	0.13	.	11.3861	0.49787	0.0:0.1835:0.8165:0.0	.	965;1061;721	C4PFH9;Q12809;Q12809-2	.;KCNH2_HUMAN;.	V	721;965;1061	ENSP00000328531:A721V;ENSP00000376695:A965V;ENSP00000262186:A1061V	ENSP00000262186:A1061V	A	-	2	0	KCNH2	150275046	0.000000	0.05858	0.999000	0.59377	0.502000	0.33828	0.809000	0.27168	2.315000	0.78130	0.484000	0.47621	GCC		KCNH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350741.2	NM_000238	
TASP1	55617	hgsc.bcm.edu	37	20	13514769	13514769	+	Nonsense_Mutation	SNP	A	A	T			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr20:13514769A>T	ENST00000337743.4	-	9	815	c.695T>A	c.(694-696)tTg>tAg	p.L232*	TASP1_ENST00000480436.1_5'UTR|TASP1_ENST00000539805.1_Intron	NM_017714.2	NP_060184.2	Q9H6P5	TASP1_HUMAN	taspase, threonine aspartase, 1	232					positive regulation of transcription, DNA-templated (GO:0045893)		threonine-type endopeptidase activity (GO:0004298)	p.L232*(2)		NS(1)|breast(1)|endometrium(2)|large_intestine(11)|liver(1)|lung(11)|stomach(2)|urinary_tract(2)	31						TACCGTGTCCAAAGTGCCTGA	0.512																																					p.L232X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.T695A	20						.						166.0	141.0	149.0					20																	13514769		2203	4300	6503	13462769	SO:0001587	stop_gained	55617	exon9			AK000219	CCDS13116.1	20p12	2005-10-15	2005-10-15	2005-10-15	ENSG00000089123	ENSG00000089123	3.4.25.-		15859	protein-coding gene	gene with protein product		608270	"""chromosome 20 open reading frame 13"""	C20orf13		14636557	Standard	XR_430268		Approved	FLJ20212, dJ585I14.2	uc002woi.3	Q9H6P5	OTTHUMG00000031904	ENST00000337743.4:c.695T>A	20.37:g.13514769A>T	ENSP00000338624:p.Leu232*	Somatic		Capture	SOLID	Phase_I	13462769	NM_017714	B7Z690|B7Z963|Q5TDU9|Q9BQN0|Q9NQ08|Q9NTS6|Q9NXJ2	Nonsense_Mutation	SNP	ENST00000337743.4	37	CCDS13116.1	.	.	.	.	.	.	.	.	.	.	A	38	7.193181	0.98125	.	.	ENSG00000089123	ENST00000378157;ENST00000337743;ENST00000455532	.	.	.	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.5537	15.7943	0.78398	1.0:0.0:0.0:0.0	.	.	.	.	X	209;232;209	.	ENSP00000338624:L232X	L	-	2	0	TASP1	13462769	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.405000	0.90213	2.208000	0.71279	0.533000	0.62120	TTG		TASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078041.2	NM_017714	
FERMT1	55612	hgsc.bcm.edu	37	20	6088233	6088233	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr20:6088233delA	ENST00000217289.4	-	6	1583	c.795delT	c.(793-795)gatfs	p.D265fs	FERMT1_ENST00000536936.1_Frame_Shift_Del_p.D8fs	NM_017671.4	NP_060141.3	Q9BQL6	FERM1_HUMAN	fermitin family member 1	265	FERM.				cell adhesion (GO:0007155)|establishment of epithelial cell polarity (GO:0090162)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)		p.D265fs*16(2)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	17						GCAGCTGCTCATCCTCTTGGA	0.358																																					p.D265fs												.	.	2	Deletion - Frameshift(2)	large_intestine(2)	c.795delT	20						.						61.0	60.0	60.0					20																	6088233		2203	4300	6503	6036233	SO:0001589	frameshift_variant	55612	exon6			AK000123	CCDS13098.1	20p12.3	2013-01-10	2010-06-24	2007-12-14	ENSG00000101311	ENSG00000101311		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	15889	protein-coding gene	gene with protein product	"""kindlin-1"", ""kinderlin"""	607900	"""chromosome 20 open reading frame 42"", ""fermitin family homolog 1 (Drosophila)"""	C20orf42		12697302, 12789646	Standard	NM_017671		Approved	FLJ20116, URP1, KIND1, UNC112A	uc002wmr.3	Q9BQL6	OTTHUMG00000031826	ENST00000217289.4:c.795delT	20.37:g.6088233delA	ENSP00000217289:p.Asp265fs	Somatic		Capture	SOLID	Phase_I	6036233	NM_017671	D3DW10|Q8IX34|Q8IYH2|Q9NWM2|Q9NXQ3	Frame_Shift_Del	DEL	ENST00000217289.4	37	CCDS13098.1																																																																																				FERMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077908.2	NM_017671	
NINL	22981	hgsc.bcm.edu	37	20	25434251	25434251	+	Silent	SNP	G	G	A			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr20:25434251G>A	ENST00000278886.6	-	24	4058	c.3985C>T	c.(3985-3987)Ctg>Ttg	p.L1329L	NINL_ENST00000422516.1_Silent_p.L980L|NINL_ENST00000464285.1_5'UTR	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	1329					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)	p.L1329L(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						TCCTTCAGCAGCAGGTCGGAC	0.562																																					p.L1329L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3985T	20						.						83.0	73.0	76.0					20																	25434251		2203	4300	6503	25382251	SO:0001819	synonymous_variant	22981	exon24				CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.3985C>T	20.37:g.25434251G>A		Somatic		Capture	SOLID	Phase_I	25382251	NM_025176	A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Silent	SNP	ENST00000278886.6	37	CCDS33452.1																																																																																				NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078445.3	NM_025176	
RNASE1	6035	hgsc.bcm.edu	37	14	21270041	21270041	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr14:21270041T>C	ENST00000397967.4	-	2	693	c.187A>G	c.(187-189)Atg>Gtg	p.M63V	RNASE1_ENST00000397970.4_Missense_Mutation_p.M63V|RNASE1_ENST00000555698.1_Missense_Mutation_p.M23V|RNASE1_ENST00000412779.2_Missense_Mutation_p.M63V|RNASE1_ENST00000340900.3_Missense_Mutation_p.M63V	NM_002933.4	NP_002924.1	P07998	RNAS1_HUMAN	ribonuclease, RNase A family, 1 (pancreatic)	63					RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	extracellular vesicular exosome (GO:0070062)	nucleic acid binding (GO:0003676)|pancreatic ribonuclease activity (GO:0004522)	p.M63V(1)		central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	5	all_cancers(95;0.00671)	all_lung(585;0.235)	Epithelial(56;9.21e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0126)	Guanidine(DB00536)|L-Aspartic Acid(DB00128)	CCCTGTGTCATATTCCGGCGC	0.547																																					p.M63V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A187G	14						.						119.0	109.0	112.0					14																	21270041		2203	4300	6503	20339881	SO:0001583	missense	6035	exon2			BC005324	CCDS9559.1	14q11.2	2014-03-13			ENSG00000129538	ENSG00000129538	3.1.27.5	"""Ribonucleases, RNase A"""	10044	protein-coding gene	gene with protein product		180440		RNS1		8588814	Standard	NM_002933		Approved		uc001vyi.3	P07998	OTTHUMG00000029603	ENST00000397967.4:c.187A>G	14.37:g.21270041T>C	ENSP00000381057:p.Met63Val	Somatic		Capture	SOLID	Phase_I	20339881	NM_002933	B2R589|D3DS06|Q16830|Q16869|Q1KHR2|Q6ICS5|Q9UCB4|Q9UCB5	Missense_Mutation	SNP	ENST00000397967.4	37	CCDS9559.1	.	.	.	.	.	.	.	.	.	.	T	13.63	2.293541	0.40594	.	.	ENSG00000129538	ENST00000397967;ENST00000340900;ENST00000412779;ENST00000555698;ENST00000397970	T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02	5.02	3.86	0.44501	Ribonuclease A, domain (4);	0.185029	0.49916	D	0.000125	T	0.66268	0.2772	M	0.92833	3.35	0.30105	N	0.807081	P	0.48016	0.904	P	0.60012	0.867	T	0.68911	-0.5284	10	0.72032	D	0.01	-49.7426	8.7722	0.34740	0.0:0.0:0.1911:0.8089	.	63	P07998	RNAS1_HUMAN	V	63;63;63;23;63	ENSP00000381057:M63V;ENSP00000344193:M63V;ENSP00000399493:M63V;ENSP00000451058:M23V;ENSP00000381060:M63V	ENSP00000344193:M63V	M	-	1	0	RNASE1	20339881	0.770000	0.28543	0.744000	0.31058	0.019000	0.09904	0.810000	0.27183	0.926000	0.37118	0.459000	0.35465	ATG		RNASE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073791.3		
DAAM1	23002	hgsc.bcm.edu	37	14	59782009	59782009	+	Silent	SNP	A	A	G			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr14:59782009A>G	ENST00000395125.1	+	3	308	c.285A>G	c.(283-285)gaA>gaG	p.E95E	DAAM1_ENST00000351081.1_Silent_p.E95E|DAAM1_ENST00000360909.3_Silent_p.E95E	NM_014992.2	NP_055807.1	Q9Y4D1	DAAM1_HUMAN	dishevelled associated activator of morphogenesis 1	95	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin cytoskeleton organization (GO:0030036)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	identical protein binding (GO:0042802)	p.E95E(1)		breast(3)|cervix(3)|endometrium(5)|kidney(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.165)		ACCAGGAAGAAAACAAGGGAG	0.418																																					p.E95E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A285G	14						.						226.0	200.0	209.0					14																	59782009		2203	4300	6503	58851762	SO:0001819	synonymous_variant	23002	exon4			AB014566	CCDS9737.1, CCDS58323.1	14q22.3	2008-08-11			ENSG00000100592	ENSG00000100592			18142	protein-coding gene	gene with protein product		606626				11779461, 18162551	Standard	NM_014992		Approved	KIAA0666	uc031qou.1	Q9Y4D1	OTTHUMG00000140326	ENST00000395125.1:c.285A>G	14.37:g.59782009A>G		Somatic		Capture	SOLID	Phase_I	58851762	NM_014992	Q86U34|Q8N1Z8|Q8TB39	Silent	SNP	ENST00000395125.1	37	CCDS9737.1																																																																																				DAAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276942.2	NM_014992	
SERPINA10	51156	hgsc.bcm.edu	37	14	94756421	94756421	+	Silent	SNP	C	C	T			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr14:94756421C>T	ENST00000393096.1	-	2	975	c.510G>A	c.(508-510)aaG>aaA	p.K170K	SERPINA10_ENST00000554173.1_Silent_p.K170K|SERPINA10_ENST00000261994.4_Silent_p.K170K|SERPINA10_ENST00000554723.1_Silent_p.K210K	NM_016186.2	NP_057270.1	Q9UK55	ZPI_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10	170					blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.K170K(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	33		all_cancers(154;0.105)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)		CATCAAAATCCTTGTGGATGA	0.498																																					p.K170K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G510A	14						.						70.0	75.0	73.0					14																	94756421		2203	4300	6503	93826174	SO:0001819	synonymous_variant	51156	exon2			AF181467	CCDS9923.1	14q32.13	2014-02-18	2005-08-18		ENSG00000140093	ENSG00000140093		"""Serine (or cysteine) peptidase inhibitors"""	15996	protein-coding gene	gene with protein product		605271	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10"""			10460162, 9689066, 24172014	Standard	NM_016186		Approved	PZI, ZPI	uc001yct.3	Q9UK55	OTTHUMG00000171345	ENST00000393096.1:c.510G>A	14.37:g.94756421C>T		Somatic		Capture	SOLID	Phase_I	93826174	NM_016186	A5Z2A5|Q6UWX9|Q86U20	Silent	SNP	ENST00000393096.1	37	CCDS9923.1																																																																																				SERPINA10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413061.1	NM_016186	
WDR25	79446	hgsc.bcm.edu	37	14	100847916	100847916	+	Missense_Mutation	SNP	G	G	C			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr14:100847916G>C	ENST00000335290.6	+	2	881	c.655G>C	c.(655-657)Gag>Cag	p.E219Q	WDR25_ENST00000402312.3_Missense_Mutation_p.E219Q|WDR25_ENST00000554175.1_Missense_Mutation_p.E219Q|WDR25_ENST00000542471.2_5'Flank|WDR25_ENST00000554998.1_Missense_Mutation_p.E219Q	NM_024515.4	NP_078791.3	Q64LD2	WDR25_HUMAN	WD repeat domain 25	219								p.E219Q(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(8)|skin(1)	20		Melanoma(154;0.212)				GGGAGTGTCTGAGTTTATTCA	0.567																																					p.E219Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G655C	14						.						44.0	49.0	47.0					14																	100847916		2203	4300	6503	99917669	SO:0001583	missense	79446	exon2			BC007953	CCDS32157.1	14q32.32	2013-01-09				ENSG00000176473		"""WD repeat domain containing"""	21064	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 67"""	C14orf67		15587985	Standard	NM_001161476		Approved	MGC4645	uc001yhn.3	Q64LD2		ENST00000335290.6:c.655G>C	14.37:g.100847916G>C	ENSP00000334148:p.Glu219Gln	Somatic		Capture	SOLID	Phase_I	99917669	NM_001161476	A8K7E5|Q6NVV6|Q86TQ4|Q9BTK5	Missense_Mutation	SNP	ENST00000335290.6	37	CCDS32157.1	.	.	.	.	.	.	.	.	.	.	G	13.98	2.399469	0.42512	.	.	ENSG00000176473	ENST00000554998;ENST00000402312;ENST00000335290;ENST00000554175	T;T;T;T	0.24538	5.04;5.04;5.04;1.85	5.63	5.63	0.86233	WD40 repeat-like-containing domain (1);	0.109437	0.39909	N	0.001223	T	0.19005	0.0456	L	0.29908	0.895	0.80722	D	1	B	0.22480	0.07	B	0.19666	0.026	T	0.06075	-1.0847	10	0.21014	T	0.42	-28.4719	12.8809	0.58015	0.0:0.1634:0.8366:0.0	.	219	Q64LD2	WDR25_HUMAN	Q	219	ENSP00000450661:E219Q;ENSP00000385540:E219Q;ENSP00000334148:E219Q;ENSP00000450727:E219Q	ENSP00000334148:E219Q	E	+	1	0	WDR25	99917669	1.000000	0.71417	0.703000	0.30354	0.036000	0.12997	3.802000	0.55553	2.651000	0.90000	0.655000	0.94253	GAG		WDR25-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414312.1	NM_024515	
DNMT1	1786	hgsc.bcm.edu	37	19	10291211	10291211	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr19:10291211T>C	ENST00000340748.4	-	4	495	c.260A>G	c.(259-261)aAt>aGt	p.N87S	DNMT1_ENST00000359526.4_Missense_Mutation_p.N87S|DNMT1_ENST00000540357.1_Missense_Mutation_p.N87S			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1	87	DMAP-interaction.|Interaction with DMAP1.|Interaction with DNMT3A.|Interaction with the PRC2/EED-EZH2 complex. {ECO:0000250}.				cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.N87S(1)		breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	CAAATCTTTATTTAAAAGGGA	0.438																																					p.N87S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A260G	19						.						109.0	111.0	110.0					19																	10291211		2203	4300	6503	10152211	SO:0001583	missense	1786	exon4			X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.260A>G	19.37:g.10291211T>C	ENSP00000345739:p.Asn87Ser	Somatic		Capture	SOLID	Phase_I	10152211	NM_001130823	A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	Missense_Mutation	SNP	ENST00000340748.4	37	CCDS12228.1	.	.	.	.	.	.	.	.	.	.	t	17.35	3.368155	0.61513	.	.	ENSG00000130816	ENST00000359526;ENST00000540357;ENST00000340748	T;T;T	0.42131	0.98;0.98;0.98	5.59	4.58	0.56647	DMAP1-binding (1);	0.278298	0.35291	N	0.003302	T	0.43122	0.1233	N	0.19112	0.55	0.27465	N	0.953023	D;D;D	0.76494	0.998;0.998;0.999	D;D;D	0.79108	0.987;0.987;0.992	T	0.25572	-1.0128	10	0.22109	T	0.4	.	8.0237	0.30425	0.0:0.1598:0.0:0.8402	.	87;87;87	F5GX68;P26358-2;P26358	.;.;DNMT1_HUMAN	S	87	ENSP00000352516:N87S;ENSP00000440457:N87S;ENSP00000345739:N87S	ENSP00000345739:N87S	N	-	2	0	DNMT1	10152211	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	2.035000	0.41155	0.968000	0.38212	-0.256000	0.11100	AAT		DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451166.1	NM_001379	
RTBDN	83546	hgsc.bcm.edu	37	19	12940707	12940707	+	Silent	SNP	T	T	A			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr19:12940707T>A	ENST00000458671.2	-	2	239	c.87A>T	c.(85-87)ggA>ggT	p.G29G	RTBDN_ENST00000393233.2_5'UTR|RTBDN_ENST00000592204.1_Silent_p.G39G|RTBDN_ENST00000322912.5_Silent_p.G61G|RTBDN_ENST00000589272.1_Silent_p.G61G|CTD-2265O21.3_ENST00000588469.1_RNA	NM_001080997.2	NP_001074466.1	Q9BSG5	RTBDN_HUMAN	retbindin	29						extracellular region (GO:0005576)		p.G61G(1)		kidney(1)|large_intestine(5)|liver(1)|lung(4)|prostate(1)	12						GGCGGCTCCCTCCACAGGCTT	0.622																																					p.G61G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A183T	19						.						63.0	52.0	56.0					19																	12940707		2203	4300	6503	12801707	SO:0001819	synonymous_variant	83546	exon3			AY028917	CCDS12283.1, CCDS45994.1, CCDS59355.1, CCDS59356.1	19p13	2006-03-22				ENSG00000132026			30310	protein-coding gene	gene with protein product		609553				12107411	Standard	NM_001080997		Approved	FLJ36353	uc002mvj.4	Q9BSG5		ENST00000458671.2:c.87A>T	19.37:g.12940707T>A		Somatic		Capture	SOLID	Phase_I	12801707	NM_031429	F1T0I8|Q9BWT5	Silent	SNP	ENST00000458671.2	37	CCDS45994.1																																																																																				RTBDN-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000451513.1	NM_031429	
OR10H1	26539	hgsc.bcm.edu	37	19	15918177	15918177	+	Missense_Mutation	SNP	G	G	T	rs62619246	byFrequency	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr19:15918177G>T	ENST00000334920.2	-	1	759	c.671C>A	c.(670-672)gCc>gAc	p.A224D		NM_013940.2	NP_039228.1	Q9Y4A9	O10H1_HUMAN	olfactory receptor, family 10, subfamily H, member 1	224						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A224D(3)		cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|skin(2)|urinary_tract(1)	29						CAAGATGGCGGCCACGATGAA	0.582																																					p.A224D												.	.	3	Substitution - Missense(3)	kidney(3)	c.C671A	19						.						79.0	66.0	70.0					19																	15918177		2202	4279	6481	15779177	SO:0001583	missense	26539	exon1			AC004510	CCDS12335.1	19p13.1	2012-08-09				ENSG00000186723		"""GPCR / Class A : Olfactory receptors"""	8172	protein-coding gene	gene with protein product							Standard	NM_013940		Approved		uc002nbq.2	Q9Y4A9		ENST00000334920.2:c.671C>A	19.37:g.15918177G>T	ENSP00000335596:p.Ala224Asp	Somatic		Capture	SOLID	Phase_I	15779177	NM_013940	Q6IFQ2|Q96R59	Missense_Mutation	SNP	ENST00000334920.2	37	CCDS12335.1	121	0.0554029304029304	40	0.08130081300813008	15	0.04143646408839779	47	0.08216783216783216	19	0.025065963060686015	.	9.676	1.148119	0.21288	.	.	ENSG00000186723	ENST00000334920	T	0.38077	1.16	4.96	2.76	0.32466	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000141	T	0.05273	0.0140	M	0.82433	2.59	0.09310	N	1	D	0.53885	0.963	P	0.62649	0.905	T	0.04440	-1.0951	10	0.66056	D	0.02	.	5.0438	0.14473	0.1886:0.1747:0.6367:0.0	rs62619246	224	Q9Y4A9	O10H1_HUMAN	D	224	ENSP00000335596:A224D	ENSP00000335596:A224D	A	-	2	0	OR10H1	15779177	0.000000	0.05858	0.293000	0.24932	0.082000	0.17680	0.466000	0.22019	0.463000	0.27118	0.643000	0.83706	GCC		OR10H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460364.1		
NWD1	284434	hgsc.bcm.edu	37	19	16918828	16918828	+	Nonsense_Mutation	SNP	C	C	T	rs199995129		TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr19:16918828C>T	ENST00000552788.1	+	16	4168	c.4168C>T	c.(4168-4170)Cga>Tga	p.R1390*	NWD1_ENST00000549814.1_Nonsense_Mutation_p.R1348*|NWD1_ENST00000523826.1_Nonsense_Mutation_p.R1184*|NWD1_ENST00000339803.6_Nonsense_Mutation_p.R1255*|NWD1_ENST00000379808.3_Nonsense_Mutation_p.R1390*|NWD1_ENST00000524140.2_Nonsense_Mutation_p.R1390*			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	1390							ATP binding (GO:0005524)	p.R1255*(2)|p.R1390*(1)		NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						CCACAGGAGCCGAGTTGCCTG	0.582																																					p.R1390X												.	.	3	Substitution - Nonsense(3)	breast(2)|large_intestine(1)	c.C4168T	19						.	C	stop/ARG	0,4406		0,0,2203	111.0	106.0	108.0		4168	-2.3	0.0	19		108	1,8599	1.2+/-3.3	0,1,4299	yes	stop-gained	NWD1	NM_001007525.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		1390/1433	16918828	1,13005	2203	4300	6503	16779828	SO:0001587	stop_gained	284434	exon18			BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.4168C>T	19.37:g.16918828C>T	ENSP00000447224:p.Arg1390*	Somatic		Capture	SOLID	Phase_I	16779828	NM_001007525	C9J021|Q68CT3	Nonsense_Mutation	SNP	ENST00000552788.1	37		.	.	.	.	.	.	.	.	.	.	C	36	5.649784	0.96714	0.0	1.16E-4	ENSG00000188039	ENST00000420818;ENST00000524140;ENST00000549814;ENST00000379808;ENST00000523826;ENST00000552788;ENST00000339803	.	.	.	4.95	-2.35	0.06684	.	0.422063	0.19530	N	0.112066	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	-6.8702	5.7371	0.18073	0.6147:0.2013:0.0:0.184	.	.	.	.	X	1255;1390;1348;1390;1184;1390;1255	.	ENSP00000340159:R1255X	R	+	1	2	NWD1	16779828	0.082000	0.21442	0.000000	0.03702	0.056000	0.15407	0.348000	0.20031	-0.154000	0.11118	-0.181000	0.13052	CGA		NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000403569.1	NM_001007525	
SIN3B	23309	hgsc.bcm.edu	37	19	16940618	16940618	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr19:16940618C>T	ENST00000248054.5	+	2	158	c.137C>T	c.(136-138)aCc>aTc	p.T46I	SIN3B_ENST00000596802.1_Missense_Mutation_p.T46I|SIN3B_ENST00000379803.1_Missense_Mutation_p.T46I					SIN3 transcription regulator family member B									p.T46I(1)		endometrium(4)|kidney(2)|large_intestine(8)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26						GACGCCCTCACCTATCTGGAC	0.647																																					p.T46I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C137T	19						.						44.0	42.0	43.0					19																	16940618		2203	4300	6503	16801618	SO:0001583	missense	23309	exon2			AB014600	CCDS32946.1, CCDS74308.1	19p13.12	2013-08-21	2013-08-21						19354	protein-coding gene	gene with protein product		607777	"""SIN3 homolog B, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog B (yeast)"""			9734811	Standard	XM_005259832		Approved	KIAA0700	uc002ney.2	O75182		ENST00000248054.5:c.137C>T	19.37:g.16940618C>T	ENSP00000248054:p.Thr46Ile	Somatic		Capture	SOLID	Phase_I	16801618	NM_015260		Missense_Mutation	SNP	ENST00000248054.5	37		.	.	.	.	.	.	.	.	.	.	C	17.19	3.327104	0.60743	.	.	ENSG00000127511	ENST00000379803;ENST00000248054	T;T	0.47869	0.83;0.84	4.46	4.46	0.54185	.	0.162472	0.56097	D	0.000028	T	0.38585	0.1046	L	0.33668	1.02	0.40083	D	0.976167	B;B	0.30973	0.302;0.046	B;B	0.26969	0.075;0.075	T	0.43343	-0.9397	10	0.59425	D	0.04	-5.4626	16.5231	0.84322	0.0:1.0:0.0:0.0	.	46;46	O75182-2;O75182	.;SIN3B_HUMAN	I	46	ENSP00000369131:T46I;ENSP00000248054:T46I	ENSP00000248054:T46I	T	+	2	0	SIN3B	16801618	1.000000	0.71417	1.000000	0.80357	0.556000	0.35491	7.500000	0.81588	2.199000	0.70637	0.555000	0.69702	ACC		SIN3B-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000462846.1	NM_015260	
OR7G3	390883	hgsc.bcm.edu	37	19	9237557	9237557	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr19:9237557G>A	ENST00000305444.2	-	1	69	c.70C>T	c.(70-72)Cag>Tag	p.Q24*		NM_001001958.1	NP_001001958.1	Q8NG95	OR7G3_HUMAN	olfactory receptor, family 7, subfamily G, member 3	24						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q24*(1)		NS(2)|endometrium(1)|large_intestine(3)|liver(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15						AGGATGGGCTGCAGCTCCGGA	0.502																																					p.Q24X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C70T	19						.						81.0	78.0	79.0					19																	9237557		2203	4300	6503	9098557	SO:0001587	stop_gained	390883	exon1				CCDS32899.1	19p13.2	2013-09-24			ENSG00000170920	ENSG00000170920		"""GPCR / Class A : Olfactory receptors"""	8467	protein-coding gene	gene with protein product							Standard	NM_001001958		Approved	OST085	uc010xkl.2	Q8NG95	OTTHUMG00000165520	ENST00000305444.2:c.70C>T	19.37:g.9237557G>A	ENSP00000302867:p.Gln24*	Somatic		Capture	SOLID	Phase_I	9098557	NM_001001958	Q6IFJ6|Q96R99	Nonsense_Mutation	SNP	ENST00000305444.2	37	CCDS32899.1	.	.	.	.	.	.	.	.	.	.	G	17.72	3.459529	0.63401	.	.	ENSG00000170920	ENST00000305444	.	.	.	4.02	1.75	0.24633	.	0.000000	0.39834	U	0.001249	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	11.4699	0.50261	0.0:0.0:0.6734:0.3266	.	.	.	.	X	24	.	ENSP00000302867:Q24X	Q	-	1	0	OR7G3	9098557	0.704000	0.27836	0.266000	0.24541	0.023000	0.10783	1.082000	0.30803	0.434000	0.26340	0.558000	0.71614	CAG		OR7G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384611.1		
ZNF266	10781	hgsc.bcm.edu	37	19	9525382	9525382	+	Silent	SNP	G	G	A	rs376673203	byFrequency	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr19:9525382G>A	ENST00000592904.1	-	5	2295	c.219C>T	c.(217-219)aaC>aaT	p.N73N	ZNF266_ENST00000361451.2_Silent_p.N73N|ZNF266_ENST00000361151.1_Silent_p.N73N|ZNF266_ENST00000590306.1_Silent_p.N73N|ZNF266_ENST00000588933.1_Silent_p.N73N|ZNF266_ENST00000592292.1_Silent_p.N73N|ZNF266_ENST00000588221.1_Silent_p.N73N			Q14584	ZN266_HUMAN	zinc finger protein 266	73					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.N73N(1)		NS(1)|breast(2)|endometrium(2)|large_intestine(11)|lung(8)|ovary(1)|skin(2)|stomach(1)	28						CCTCCCCTCCGTTGTGGCTTC	0.413													G|||	2	0.000399361	0.0015	0.0	5008	,	,		21830	0.0		0.0	False		,,,				2504	0.0				p.N73N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C219T	19						.	G	,	3,4403	6.2+/-15.9	0,3,2200	104.0	81.0	89.0		219,219	0.2	0.0	19		89	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	ZNF266	NM_006631.2,NM_198058.1	,	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	,	73/550,73/550	9525382	3,13003	2203	4300	6503	9386382	SO:0001819	synonymous_variant	10781	exon11			X78924	CCDS12213.1	19p13.2	2013-01-08				ENSG00000174652		"""Zinc fingers, C2H2-type"""	13059	protein-coding gene	gene with protein product		604751				7865130	Standard	NM_006631		Approved	HZF1	uc002mlo.4	Q14584		ENST00000592904.1:c.219C>T	19.37:g.9525382G>A		Somatic		Capture	SOLID	Phase_I	9386382	NM_006631	A0AV90|A4FU85|Q6IQ07|Q6U8A5|Q8IVG3|Q8WVX1|Q96SX9	Silent	SNP	ENST00000592904.1	37	CCDS12213.1																																																																																				ZNF266-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449033.1		
OLFM2	93145	hgsc.bcm.edu	37	19	9967532	9967532	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr19:9967532C>T	ENST00000264833.4	-	5	823	c.638G>A	c.(637-639)cGc>cAc	p.R213H	OLFM2_ENST00000590841.1_Missense_Mutation_p.R135H	NM_058164.2	NP_477512.1	O95897	NOE2_HUMAN	olfactomedin 2	213	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				protein secretion (GO:0009306)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular region (GO:0005576)|synapse (GO:0045202)		p.R213H(1)		breast(1)|cervix(1)|endometrium(3)|large_intestine(8)|lung(9)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	31						GGAGCCGAAGCGGGACCCCAT	0.652																																					p.R213H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G638A	19						.						31.0	29.0	30.0					19																	9967532		2203	4300	6503	9828532	SO:0001583	missense	93145	exon5			AF131839	CCDS12221.1	19p13.2	2008-07-03				ENSG00000105088			17189	protein-coding gene	gene with protein product	"""noelin 2"""						Standard	NM_058164		Approved	OlfC, NOE2	uc002mmp.3	O95897		ENST00000264833.4:c.638G>A	19.37:g.9967532C>T	ENSP00000264833:p.Arg213His	Somatic		Capture	SOLID	Phase_I	9828532	NM_058164	Q6IMJ3|Q96FC2	Missense_Mutation	SNP	ENST00000264833.4	37	CCDS12221.1	.	.	.	.	.	.	.	.	.	.	C	31	5.089666	0.94149	.	.	ENSG00000105088	ENST00000264833	D	0.89050	-2.46	4.31	4.31	0.51392	Olfactomedin-like (3);	0.000000	0.85682	D	0.000000	D	0.92789	0.7707	M	0.63169	1.94	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.92398	0.5927	9	.	.	.	.	14.3171	0.66460	0.0:1.0:0.0:0.0	.	213	O95897	NOE2_HUMAN	H	213	ENSP00000264833:R213H	.	R	-	2	0	OLFM2	9828532	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.536000	0.82023	2.225000	0.72522	0.563000	0.77884	CGC		OLFM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451119.1		
ZNF71	58491	hgsc.bcm.edu	37	19	57133714	57133714	+	Silent	SNP	G	G	C	rs371602169		TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr19:57133714G>C	ENST00000328070.6	+	3	1293	c.1059G>C	c.(1057-1059)ccG>ccC	p.P353P		NM_021216.4	NP_067039.1	Q9NQZ8	ZNF71_HUMAN	zinc finger protein 71	353					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P353P(1)		endometrium(3)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	26				GBM - Glioblastoma multiforme(193;0.062)|Lung(386;0.0681)|LUSC - Lung squamous cell carcinoma(496;0.18)		GCGTGAAGCCGTTCGAGTGCA	0.632																																					p.P353P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1059C	19						.						86.0	77.0	80.0					19																	57133714		2203	4300	6503	61825526	SO:0001819	synonymous_variant	58491	exon3			X60074	CCDS12947.1	19q13.4	2013-01-08	2006-05-12			ENSG00000197951		"""Zinc fingers, C2H2-type"""	13141	protein-coding gene	gene with protein product		194545	"""zinc finger protein 71 (Cos26)"""			1639391	Standard	NM_021216		Approved	Cos26, EZFIT	uc002qnm.4	Q9NQZ8		ENST00000328070.6:c.1059G>C	19.37:g.57133714G>C		Somatic		Capture	SOLID	Phase_I	61825526	NM_021216	Q15919|Q9UC09|Q9UQD3	Silent	SNP	ENST00000328070.6	37	CCDS12947.1																																																																																				ZNF71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459798.2	NM_021216	
TOP1MT	116447	hgsc.bcm.edu	37	8	144398219	144398219	+	Nonsense_Mutation	SNP	G	G	A	rs200038590		TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr8:144398219G>A	ENST00000329245.4	-	11	1442	c.1408C>T	c.(1408-1410)Cga>Tga	p.R470*	AC087793.1_ENST00000585120.1_RNA|TOP1MT_ENST00000523676.1_Nonsense_Mutation_p.R372*|TOP1MT_ENST00000519148.1_Nonsense_Mutation_p.R372*|TOP1MT_ENST00000521193.1_Nonsense_Mutation_p.R372*	NM_052963.2	NP_443195.1	Q969P6	TOP1M_HUMAN	topoisomerase (DNA) I, mitochondrial	470					DNA replication (GO:0006260)|DNA topological change (GO:0006265)	chromosome (GO:0005694)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)	p.R470*(1)		endometrium(5)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	23	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)		Irinotecan(DB00762)|Topotecan(DB01030)	GGGGTTGCTCGCTGATGGTTG	0.597													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17062	0.0		0.0	False		,,,				2504	0.0				p.R470X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1408T	8						.	G	stop/ARG	0,4406		0,0,2203	184.0	161.0	169.0		1408	1.2	0.5	8		169	2,8598	2.2+/-6.3	0,2,4298	yes	stop-gained	TOP1MT	NM_052963.1		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		470/602	144398219	2,13004	2203	4300	6503	144469594	SO:0001587	stop_gained	116447	exon11			AF349018	CCDS6400.1, CCDS59115.1	8q24.3	2006-04-12				ENSG00000184428			29787	protein-coding gene	gene with protein product		606387				11526219	Standard	NM_052963		Approved		uc003yxz.4	Q969P6		ENST00000329245.4:c.1408C>T	8.37:g.144398219G>A	ENSP00000328835:p.Arg470*	Somatic		Capture	SOLID	Phase_I	144469594	NM_052963	B7ZAR5|E7ES89|Q86ST4|Q86V82	Nonsense_Mutation	SNP	ENST00000329245.4	37	CCDS6400.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	38	7.078656	0.98048	0.0	2.33E-4	ENSG00000184428	ENST00000329245;ENST00000521193;ENST00000519148;ENST00000523676	.	.	.	3.23	1.25	0.21368	.	0.424146	0.15691	U	0.249431	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.5529	5.3222	0.15887	0.1113:0.0:0.3698:0.5188	.	.	.	.	X	470;372;372;372	.	ENSP00000328835:R470X	R	-	1	2	TOP1MT	144469594	1.000000	0.71417	0.468000	0.27192	0.740000	0.42216	1.008000	0.29872	-0.002000	0.14469	0.609000	0.83330	CGA		TOP1MT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381247.3	NM_052963	
DPYSL2	1808	hgsc.bcm.edu	37	8	26484150	26484150	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr8:26484150G>A	ENST00000311151.5	+	5	908	c.496G>A	c.(496-498)Gtg>Atg	p.V166M	DPYSL2_ENST00000523027.1_Missense_Mutation_p.V130M|DPYSL2_ENST00000521913.1_Missense_Mutation_p.V130M	NM_001386.5	NP_001377.1	Q16555	DPYL2_HUMAN	dihydropyrimidinase-like 2	166					axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|endocytosis (GO:0006897)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|olfactory bulb development (GO:0021772)|positive regulation of glutamate secretion (GO:0014049)|pyrimidine nucleobase catabolic process (GO:0006208)|regulation of neuron differentiation (GO:0045664)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|signal transduction (GO:0007165)|spinal cord development (GO:0021510)|synaptic vesicle transport (GO:0048489)	axon (GO:0030424)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	dihydropyrimidinase activity (GO:0004157)	p.V166M(1)		breast(1)|endometrium(5)|large_intestine(8)|lung(3)|prostate(1)|skin(1)|stomach(1)	20		all_cancers(63;0.121)|Ovarian(32;2.68e-05)|all_epithelial(46;0.116)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;3.33e-10)|Colorectal(74;0.183)		TTCCTTCCTCGTGTACATGGC	0.423																																					p.V166M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G496A	8						.						148.0	135.0	139.0					8																	26484150		2203	4300	6503	26540067	SO:0001583	missense	1808	exon5			D78013	CCDS6051.1, CCDS59096.1	8p22-p21	2011-09-28			ENSG00000092964	ENSG00000092964			3014	protein-coding gene	gene with protein product		602463				8973361	Standard	NM_001197293		Approved	DRP-2, DHPRP2, CRMP2, DRP2	uc003xfa.3	Q16555	OTTHUMG00000099439	ENST00000311151.5:c.496G>A	8.37:g.26484150G>A	ENSP00000309539:p.Val166Met	Somatic		Capture	SOLID	Phase_I	26540067	NM_001386	A8K5H2|B4DR31|D3DSS7|O00424	Missense_Mutation	SNP	ENST00000311151.5	37	CCDS6051.1	.	.	.	.	.	.	.	.	.	.	G	17.54	3.416106	0.62511	.	.	ENSG00000092964	ENST00000521913;ENST00000311151;ENST00000522745;ENST00000523027	D;D;D;D	0.90620	-2.7;-2.7;-2.7;-2.7	5.78	5.78	0.91487	Amidohydrolase 1 (1);	0.204852	0.42294	D	0.000723	D	0.91026	0.7177	N	0.20807	0.61	0.80722	D	1	P;D;D	0.76494	0.953;0.999;0.999	B;P;P	0.62560	0.374;0.904;0.904	D	0.90183	0.4244	10	0.34782	T	0.22	-6.7398	20.0106	0.97448	0.0:0.0:1.0:0.0	.	166;166;222	Q53ET2;Q16555;Q59GB4	.;DPYL2_HUMAN;.	M	130;166;166;130	ENSP00000427985:V130M;ENSP00000309539:V166M;ENSP00000428909:V166M;ENSP00000431117:V130M	ENSP00000309539:V166M	V	+	1	0	DPYSL2	26540067	1.000000	0.71417	0.997000	0.53966	0.999000	0.98932	8.000000	0.88501	2.722000	0.93159	0.655000	0.94253	GTG		DPYSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216904.3	NM_001386	
TEX15	56154	hgsc.bcm.edu	37	8	30705823	30705823	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr8:30705823C>A	ENST00000256246.2	-	1	785	c.711G>T	c.(709-711)aaG>aaT	p.K237N	TEX15_ENST00000523186.1_5'Flank	NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	237					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)			p.K237N(1)		NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		AGTTTTTCATCTTTCCAGTAT	0.323																																					p.K237N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G711T	8						.						61.0	65.0	64.0					8																	30705823		2203	4299	6502	30825365	SO:0001583	missense	56154	exon1			AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.711G>T	8.37:g.30705823C>A	ENSP00000256246:p.Lys237Asn	Somatic		Capture	SOLID	Phase_I	30825365	NM_031271		Missense_Mutation	SNP	ENST00000256246.2	37	CCDS6080.1	.	.	.	.	.	.	.	.	.	.	C	7.147	0.582907	0.13749	.	.	ENSG00000133863	ENST00000256246	T	0.10763	2.84	5.3	-0.21	0.13176	.	0.523451	0.17069	N	0.188232	T	0.06005	0.0156	N	0.19112	0.55	0.09310	N	1	B	0.21225	0.053	B	0.19391	0.025	T	0.30327	-0.9982	10	0.87932	D	0	.	4.6293	0.12493	0.3407:0.4208:0.0:0.2385	.	237	Q9BXT5	TEX15_HUMAN	N	237	ENSP00000256246:K237N	ENSP00000256246:K237N	K	-	3	2	TEX15	30825365	0.000000	0.05858	0.003000	0.11579	0.521000	0.34408	-0.359000	0.07632	0.021000	0.15133	-0.140000	0.14226	AAG		TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1		
CPA6	57094	hgsc.bcm.edu	37	8	68396050	68396050	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr8:68396050C>T	ENST00000297770.4	-	8	1006	c.791G>A	c.(790-792)cGc>cAc	p.R264H	CPA6_ENST00000297769.4_Missense_Mutation_p.R116H|CPA6_ENST00000518549.1_Missense_Mutation_p.R264H	NM_020361.4	NP_065094.3	Q8N4T0	CBPA6_HUMAN	carboxypeptidase A6	264						proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.R264H(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(5)	26			Epithelial(68;0.04)|OV - Ovarian serous cystadenocarcinoma(28;0.0593)|all cancers(69;0.136)			TCCACGGCAGCGAAACCTTGA	0.418																																					p.R264H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G791A	8						.						201.0	179.0	186.0					8																	68396050		2203	4300	6503	68558604	SO:0001583	missense	57094	exon8			AF221594	CCDS6200.1	8q12.3	2012-02-10			ENSG00000165078	ENSG00000165078			17245	protein-coding gene	gene with protein product		609562				11836249	Standard	NM_020361		Approved	CPAH	uc003xxq.4	Q8N4T0	OTTHUMG00000164575	ENST00000297770.4:c.791G>A	8.37:g.68396050C>T	ENSP00000297770:p.Arg264His	Somatic		Capture	SOLID	Phase_I	68558604	NM_020361	Q8NEX8|Q8TDE8|Q9NRI9	Missense_Mutation	SNP	ENST00000297770.4	37	CCDS6200.1	.	.	.	.	.	.	.	.	.	.	C	10.13	1.266196	0.23136	.	.	ENSG00000165078	ENST00000297769;ENST00000297770;ENST00000518549	T;T;T	0.29917	1.55;1.55;3.97	5.18	-2.89	0.05665	Peptidase M14, carboxypeptidase A (2);	0.478710	0.24274	N	0.039962	T	0.12732	0.0309	N	0.11756	0.17	0.35270	D	0.780409	B;B;B	0.14438	0.004;0.01;0.0	B;B;B	0.08055	0.002;0.002;0.003	T	0.18272	-1.0342	10	0.23302	T	0.38	.	8.0938	0.30816	0.0:0.3008:0.1121:0.5871	.	264;116;264	Q8N4T0-2;Q8N4T0-3;Q8N4T0	.;.;CBPA6_HUMAN	H	116;264;264	ENSP00000297769:R116H;ENSP00000297770:R264H;ENSP00000431112:R264H	ENSP00000297769:R116H	R	-	2	0	CPA6	68558604	0.971000	0.33674	0.908000	0.35775	0.949000	0.60115	0.289000	0.18957	-0.887000	0.03961	-0.148000	0.13756	CGC		CPA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379296.2	NM_020361	
SCRIB	23513	hgsc.bcm.edu	37	8	144892857	144892857	+	Splice_Site	SNP	C	C	T			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr8:144892857C>T	ENST00000320476.3	-	12	1409	c.1403G>A	c.(1402-1404)cGg>cAg	p.R468Q	SCRIB_ENST00000377533.3_Splice_Site_p.R387Q|SCRIB_ENST00000356994.2_Splice_Site_p.R468Q|MIR937_ENST00000401271.1_RNA	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	468	Sufficient for targeting to adherens junction and to inhibit cell proliferation.				activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)		p.R468L(2)|p.R468Q(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			CCCTCATACCCGCTTCTCAGC	0.657																																					p.R468Q	Pancreas(51;966 1133 10533 14576 29674)											.	.	3	Substitution - Missense(3)	lung(2)|large_intestine(1)	c.G1403A	8						.						139.0	134.0	136.0					8																	144892857		2203	4300	6503	144964845	SO:0001630	splice_region_variant	23513	exon12			AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.1404+1G>A	8.37:g.144892857C>T		Somatic		Capture	SOLID	Phase_I	144964845	NM_015356	Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	Missense_Mutation	SNP	ENST00000320476.3	37	CCDS6411.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.932683	0.73442	.	.	ENSG00000180900	ENST00000356994;ENST00000320476;ENST00000377533	T;T;T	0.78246	-1.16;-1.16;-1.16	3.89	3.89	0.44902	.	.	.	.	.	D	0.84986	0.5594	L	0.60845	1.875	0.48236	D	0.999613	D;D	0.89917	1.0;0.999	D;D	0.72338	0.946;0.977	D	0.86459	0.1778	9	0.56958	D	0.05	.	15.2102	0.73219	0.0:1.0:0.0:0.0	.	468;468	Q14160;Q14160-3	SCRIB_HUMAN;.	Q	468;468;387	ENSP00000349486:R468Q;ENSP00000322938:R468Q;ENSP00000366756:R387Q	ENSP00000322938:R468Q	R	-	2	0	SCRIB	144964845	0.870000	0.30015	0.999000	0.59377	0.689000	0.40095	2.462000	0.45049	1.883000	0.54544	0.448000	0.29417	CGG		SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000382215.1	NM_015356	Missense_Mutation
IVL	3713	hgsc.bcm.edu	37	1	152883707	152883707	+	Silent	SNP	C	C	A	rs187809698		TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr1:152883707C>A	ENST00000368764.3	+	2	1498	c.1434C>A	c.(1432-1434)ggC>ggA	p.G478G	IVL_ENST00000392667.2_Silent_p.G332G			P07476	INVO_HUMAN	involucrin	478	39 X 10 AA approximate tandem repeats of [LP]-[EKG]-[LHVYQEK]-[PLSQE]-[EQDV]- [QHEKRGA]-Q-[EMVQLP]-[GKLE]-[QHVNLD].				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)	p.G478G(1)		breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			AGCAAGAGGGCCAGGTGAAGC	0.612																																					p.G478G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1434A	1						.						50.0	55.0	53.0					1																	152883707		2178	4266	6444	151150331	SO:0001819	synonymous_variant	3713	exon2			BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.1434C>A	1.37:g.152883707C>A		Somatic		Capture	SOLID	Phase_I	151150331	NM_005547	Q5T7P4	Silent	SNP	ENST00000368764.3	37	CCDS1030.1																																																																																				IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034664.1	NM_005547	
NES	10763	hgsc.bcm.edu	37	1	156640949	156640949	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr1:156640949C>T	ENST00000368223.3	-	4	3163	c.3031G>A	c.(3031-3033)Gag>Aag	p.E1011K		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	1011	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)	p.E1011K(1)		central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGGTGCCCCTCGCCTGGGATC	0.632																																					p.E1011K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3031A	1						.						164.0	181.0	175.0					1																	156640949		2203	4300	6503	154907573	SO:0001583	missense	10763	exon4			X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.3031G>A	1.37:g.156640949C>T	ENSP00000357206:p.Glu1011Lys	Somatic		Capture	SOLID	Phase_I	154907573	NM_006617	O00552|Q3LIF5|Q5SYZ6	Missense_Mutation	SNP	ENST00000368223.3	37	CCDS1151.1	.	.	.	.	.	.	.	.	.	.	C	12.16	1.855318	0.32791	.	.	ENSG00000132688	ENST00000368223	D	0.87966	-2.32	4.07	0.549	0.17213	.	.	.	.	.	T	0.62612	0.2442	L	0.45581	1.43	0.09310	N	1	B	0.20671	0.047	B	0.10450	0.005	T	0.48636	-0.9018	9	0.29301	T	0.29	.	3.1549	0.06500	0.1845:0.435:0.0:0.3805	.	1011	P48681	NEST_HUMAN	K	1011	ENSP00000357206:E1011K	ENSP00000357206:E1011K	E	-	1	0	NES	154907573	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.426000	0.07008	-0.214000	0.10078	0.563000	0.77884	GAG		NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082844.2	NM_006617	
POGK	57645	hgsc.bcm.edu	37	1	166819476	166819476	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr1:166819476G>A	ENST00000367875.1	+	5	2020	c.1660G>A	c.(1660-1662)Gcg>Acg	p.A554T	POGK_ENST00000536514.1_Missense_Mutation_p.A469T|POGK_ENST00000537173.1_Missense_Mutation_p.A436T|POGK_ENST00000367876.4_Missense_Mutation_p.A554T			Q9P215	POGK_HUMAN	pogo transposable element with KRAB domain	554	DDE.				multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.A554T(1)		endometrium(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	22						ggtcatggtcgcgtggaatag	0.557																																					p.A554T	GBM(76;192 1530 30153 48742)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1660A	1						.						38.0	31.0	34.0					1																	166819476		2192	4287	6479	165086100	SO:0001583	missense	57645	exon5			AB040946	CCDS1254.1	1q23.2	2013-01-08			ENSG00000143157	ENSG00000143157		"""-"""	18800	protein-coding gene	gene with protein product	"""KRAB box domain containing 2"""						Standard	NM_017542		Approved	KIAA15131, LST003, BASS2, KRBOX2	uc001gdt.1	Q9P215	OTTHUMG00000034325	ENST00000367875.1:c.1660G>A	1.37:g.166819476G>A	ENSP00000356849:p.Ala554Thr	Somatic		Capture	SOLID	Phase_I	165086100	NM_017542	Q5TIJ1|Q8TE07	Missense_Mutation	SNP	ENST00000367875.1	37	CCDS1254.1	.	.	.	.	.	.	.	.	.	.	G	19.41	3.823105	0.71143	.	.	ENSG00000143157	ENST00000537173;ENST00000536514;ENST00000367876;ENST00000367875	T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.32	5.22	4.3	0.51218	.	0.000000	0.46758	D	0.000274	T	0.67097	0.2857	L	0.47716	1.5	0.36699	D	0.880020	D;D;P	0.89917	0.999;1.0;0.944	P;D;P	0.75484	0.903;0.986;0.488	T	0.69269	-0.5189	8	.	.	.	-29.709	12.9968	0.58650	0.0:0.0:0.8376:0.1624	.	436;469;554	G3V1P0;B4DS22;Q9P215	.;.;POGK_HUMAN	T	436;469;554;554	ENSP00000442763:A436T;ENSP00000441187:A469T;ENSP00000356850:A554T;ENSP00000356849:A554T	.	A	+	1	0	POGK	165086100	0.988000	0.35896	0.104000	0.21259	0.961000	0.63080	3.998000	0.57024	1.411000	0.46957	0.650000	0.86243	GCG		POGK-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082888.1	NM_017542	
CDC73	79577	hgsc.bcm.edu	37	1	193218998	193218998	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr1:193218998A>G	ENST00000367435.3	+	16	1740	c.1556A>G	c.(1555-1557)gAc>gGc	p.D519G	CDC73_ENST00000477868.1_3'UTR	NM_024529.4	NP_078805.3	Q6P1J9	CDC73_HUMAN	cell division cycle 73	519	Interaction with POLR2A and PAF1.				cell cycle (GO:0007049)|cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein destabilization (GO:0031648)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|nucleus (GO:0005634)	RNA polymerase II core binding (GO:0000993)	p.D519G(1)		breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(14)|ovary(1)|pancreas(1)|parathyroid(51)|skin(1)|upper_aerodigestive_tract(1)	87						GAAACATTGGACAGGTAATTC	0.348																																					p.D519G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1556G	1						.						111.0	113.0	113.0					1																	193218998		2203	4300	6503	191485621	SO:0001583	missense	79577	exon16			AF312865	CCDS1382.1	1q25	2014-09-17	2013-01-17	2005-07-20	ENSG00000134371	ENSG00000134371			16783	protein-coding gene	gene with protein product	"""Paf1/RNA polymerase II complex component"""	607393	"""chromosome 1 open reading frame 28"", ""hyperparathyroidism 2 (with jaw tumor)"", ""cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"", ""hyperparathyroidism 1"""	C1orf28, HRPT2, HRPT1		11318611, 15632063, 18755853	Standard	NM_024529		Approved	parafibromin, FIHP	uc001gtb.3	Q6P1J9	OTTHUMG00000035676	ENST00000367435.3:c.1556A>G	1.37:g.193218998A>G	ENSP00000356405:p.Asp519Gly	Somatic		Capture	SOLID	Phase_I	191485621	NM_024529	A6NLZ8|B2RBR2|Q6PK51|Q96A07|Q9H245|Q9H5L7	Missense_Mutation	SNP	ENST00000367435.3	37	CCDS1382.1	.	.	.	.	.	.	.	.	.	.	A	16.43	3.121214	0.56613	.	.	ENSG00000134371	ENST00000367435	T	0.68025	-0.3	5.53	4.41	0.53225	.	0.048740	0.85682	D	0.000000	T	0.81336	0.4801	M	0.86343	2.81	0.80722	D	1	D	0.63880	0.993	D	0.64144	0.922	T	0.83225	-0.0066	10	0.72032	D	0.01	-18.3112	11.2519	0.49031	0.9286:0.0:0.0714:0.0	.	519	Q6P1J9	CDC73_HUMAN	G	519	ENSP00000356405:D519G	ENSP00000356405:D519G	D	+	2	0	CDC73	191485621	1.000000	0.71417	0.987000	0.45799	0.117000	0.20001	9.083000	0.94067	0.935000	0.37341	-0.326000	0.08463	GAC		CDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086696.2	NM_024529	
MYBPH	4608	hgsc.bcm.edu	37	1	203138403	203138403	+	Missense_Mutation	SNP	C	C	T	rs376574120		TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr1:203138403C>T	ENST00000255416.4	-	8	1265	c.1208G>A	c.(1207-1209)tGc>tAc	p.C403Y		NM_004997.2	NP_004988.2	Q13203	MYBPH_HUMAN	myosin binding protein H	403	Ig-like C2-type 2.				cell adhesion (GO:0007155)|regulation of striated muscle contraction (GO:0006942)	myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)	p.C403Y(1)		endometrium(5)|large_intestine(6)|lung(7)|skin(1)|urinary_tract(1)	20			BRCA - Breast invasive adenocarcinoma(75;0.153)	Colorectal(1306;0.0306)		TCGGACACTGCAGAACAACTG	0.632																																					p.C403Y	NSCLC(32;174 1025 14462 23899 42933)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1208A	1						.	C	TYR/CYS	0,4406		0,0,2203	51.0	46.0	48.0		1208	4.3	1.0	1		48	1,8599	1.2+/-3.3	0,1,4299	no	missense	MYBPH	NM_004997.2	194	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	403/478	203138403	1,13005	2203	4300	6503	201405026	SO:0001583	missense	4608	exon8			BC044226	CCDS30975.1	1q32.1	2013-02-11	2001-11-28		ENSG00000133055	ENSG00000133055		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7552	protein-coding gene	gene with protein product		160795	"""myosin-binding protein H"""			8486381	Standard	NM_004997		Approved		uc001gzh.1	Q13203	OTTHUMG00000042121	ENST00000255416.4:c.1208G>A	1.37:g.203138403C>T	ENSP00000255416:p.Cys403Tyr	Somatic		Capture	SOLID	Phase_I	201405026	NM_004997	Q16886|Q86YC5	Missense_Mutation	SNP	ENST00000255416.4	37	CCDS30975.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.062050	0.76187	0.0	1.16E-4	ENSG00000133055	ENST00000255416	D	0.84873	-1.91	5.26	4.34	0.51931	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000015	D	0.95287	0.8471	H	0.97983	4.12	0.58432	D	0.999997	D	0.89917	1.0	D	0.87578	0.998	D	0.96887	0.9650	10	0.87932	D	0	.	15.2415	0.73474	0.1417:0.8583:0.0:0.0	.	403	Q13203	MYBPH_HUMAN	Y	403	ENSP00000255416:C403Y	ENSP00000255416:C403Y	C	-	2	0	MYBPH	201405026	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.545000	0.67237	1.180000	0.42898	0.655000	0.94253	TGC		MYBPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100264.1	NM_004997	
NUDC	10726	hgsc.bcm.edu	37	1	27269399	27269399	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr1:27269399G>A	ENST00000321265.5	+	6	707	c.584G>A	c.(583-585)gGg>gAg	p.G195E		NM_006600.3	NP_006591.1	Q9Y266	NUDC_HUMAN	nudC nuclear distribution protein	195	CS. {ECO:0000255|PROSITE- ProRule:PRU00547}.				cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleoplasm (GO:0005654)				cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|ovary(1)	8				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;6.1e-51)|OV - Ovarian serous cystadenocarcinoma(117;2.87e-29)|Colorectal(126;5.74e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000281)|STAD - Stomach adenocarcinoma(196;0.000604)|KIRC - Kidney renal clear cell carcinoma(1967;0.000739)|READ - Rectum adenocarcinoma(331;0.0421)		CGGCTGAAAGGGAAGGACATG	0.612																																					p.G195E												.	.	0			c.G584A	1						.						55.0	54.0	54.0					1																	27269399		2203	4300	6503	27141986	SO:0001583	missense	10726	exon6				CCDS292.1	1p35-p34	2013-08-06	2013-08-06		ENSG00000090273	ENSG00000090273			8045	protein-coding gene	gene with protein product		610325	"""nuclear distribution gene C homolog (A. nidulans)"", ""nuclear distribution C homolog (A. nidulans)"""				Standard	NM_006600		Approved	NudC	uc001bng.2	Q9Y266	OTTHUMG00000004226	ENST00000321265.5:c.584G>A	1.37:g.27269399G>A	ENSP00000319664:p.Gly195Glu	None		Capture	SOLID	Phase_I	27141986	NM_006600	Q5QP31|Q5QP35|Q9H0N2|Q9Y2B6	Missense_Mutation	SNP	ENST00000321265.5	37	CCDS292.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.188834	0.78789	.	.	ENSG00000090273	ENST00000435827;ENST00000321265	T	0.56941	0.43	5.37	5.37	0.77165	CS-like domain (1);CS domain (1);HSP20-like chaperone (1);	0.000000	0.85682	D	0.000000	T	0.72203	0.3431	M	0.86178	2.8	0.80722	D	1	D;D	0.56746	0.968;0.977	P;P	0.56648	0.684;0.803	T	0.74993	-0.3474	10	0.45353	T	0.12	-0.0012	19.1769	0.93605	0.0:0.0:1.0:0.0	.	146;195	Q9H2R7;Q9Y266	.;NUDC_HUMAN	E	199;195	ENSP00000319664:G195E	ENSP00000319664:G195E	G	+	2	0	NUDC	27141986	1.000000	0.71417	1.000000	0.80357	0.397000	0.30659	9.475000	0.97721	2.542000	0.85734	0.551000	0.68910	GGG		NUDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012172.2		
SESN2	83667	hgsc.bcm.edu	37	1	28599955	28599955	+	Silent	SNP	C	C	T			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr1:28599955C>T	ENST00000253063.3	+	6	1158	c.837C>T	c.(835-837)tcC>tcT	p.S279S		NM_031459.4	NP_113647.1	P58004	SESN2_HUMAN	sestrin 2	279					autophagy (GO:0006914)|fatty acid beta-oxidation (GO:0006635)|glucose import (GO:0046323)|mitochondrial DNA metabolic process (GO:0032042)|protein kinase B signaling (GO:0043491)|regulation of cAMP-dependent protein kinase activity (GO:2000479)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of response to reactive oxygen species (GO:1901031)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|triglyceride homeostasis (GO:0070328)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.S279S(1)		cervix(1)|endometrium(3)|large_intestine(5)|lung(7)|ovary(2)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	27		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;4.76e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;2.98e-22)|Colorectal(126;3.04e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00279)|STAD - Stomach adenocarcinoma(196;0.00303)|BRCA - Breast invasive adenocarcinoma(304;0.00595)|READ - Rectum adenocarcinoma(331;0.0649)		AGGGGACGTCCCAGGAGGAGA	0.657																																					p.S279S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C837T	1						.						33.0	39.0	37.0					1																	28599955		2202	4300	6502	28472542	SO:0001819	synonymous_variant	83667	exon6			AY123223	CCDS321.1	1p35.2	2008-02-05			ENSG00000130766	ENSG00000130766			20746	protein-coding gene	gene with protein product		607767				12607115, 12203114	Standard	NM_031459		Approved	SES2, DKFZp761M0212, HI95, SEST2	uc001bps.3	P58004	OTTHUMG00000003532	ENST00000253063.3:c.837C>T	1.37:g.28599955C>T		Somatic		Capture	SOLID	Phase_I	28472542	NM_031459	Q5T7D0|Q96SI5	Silent	SNP	ENST00000253063.3	37	CCDS321.1																																																																																				SESN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009840.1		
DHCR24	1718	hgsc.bcm.edu	37	1	55319868	55319868	+	Missense_Mutation	SNP	G	G	A	rs201664445		TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr1:55319868G>A	ENST00000371269.3	-	7	1158	c.1060C>T	c.(1060-1062)Ctc>Ttc	p.L354F	DHCR24_ENST00000537443.1_Missense_Mutation_p.L138F|DHCR24_ENST00000535035.1_Missense_Mutation_p.L313F	NM_014762.3	NP_055577.1	Q15392	DHC24_HUMAN	24-dehydrocholesterol reductase	354					amyloid precursor protein catabolic process (GO:0042987)|apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cholesterol biosynthetic process (GO:0006695)|male genitalia development (GO:0030539)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|oxidation-reduction process (GO:0055114)|plasminogen activation (GO:0031639)|protein localization (GO:0008104)|Ras protein signal transduction (GO:0007265)|regulation of neuron death (GO:1901214)|response to hormone (GO:0009725)|response to oxidative stress (GO:0006979)|skin development (GO:0043588)|small molecule metabolic process (GO:0044281)|tissue development (GO:0009888)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	delta24(24-1) sterol reductase activity (GO:0000246)|delta24-sterol reductase activity (GO:0050614)|enzyme binding (GO:0019899)|flavin adenine dinucleotide binding (GO:0050660)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)|peptide antigen binding (GO:0042605)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)	p.L354F(1)		large_intestine(2)|liver(1)|lung(1)|pancreas(1)|prostate(1)|skin(1)	7						CAGCCAAAGAGGTAGCGGAAG	0.522													G|||	1	0.000199681	0.0	0.0	5008	,	,		22493	0.0		0.001	False		,,,				2504	0.0				p.L354F	Pancreas(39;516 1021 24601 30715 32780)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1060T	1						.						87.0	96.0	93.0					1																	55319868		2203	4300	6503	55092456	SO:0001583	missense	1718	exon7			AF261758	CCDS600.1	1p32.3	2008-02-05			ENSG00000116133	ENSG00000116133			2859	protein-coding gene	gene with protein product		606418				11519011	Standard	NM_014762		Approved	KIAA0018, seladin-1	uc001cyc.1	Q15392	OTTHUMG00000009989	ENST00000371269.3:c.1060C>T	1.37:g.55319868G>A	ENSP00000360316:p.Leu354Phe	Somatic		Capture	SOLID	Phase_I	55092456	NM_014762	B7Z817|D3DQ51|Q9HBA8	Missense_Mutation	SNP	ENST00000371269.3	37	CCDS600.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	13.98	2.398223	0.42512	.	.	ENSG00000116133	ENST00000371269;ENST00000537443;ENST00000535035	D;D;D	0.94000	-3.33;-2.27;-3.32	5.06	4.15	0.48705	.	0.452236	0.26173	N	0.025904	D	0.88310	0.6402	L	0.45137	1.4	0.50467	D	0.999879	B;B;B	0.29531	0.125;0.125;0.247	B;B;B	0.25405	0.055;0.055;0.06	D	0.84078	0.0383	10	0.27082	T	0.32	-29.1858	9.8545	0.41077	0.1597:0.0:0.8403:0.0	.	313;313;354	B7Z817;B7ZAV4;Q15392	.;.;DHC24_HUMAN	F	354;138;313	ENSP00000360316:L354F;ENSP00000439852:L138F;ENSP00000440191:L313F	ENSP00000360316:L354F	L	-	1	0	DHCR24	55092456	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.097000	0.41748	1.290000	0.44636	0.561000	0.74099	CTC		DHCR24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027680.1	NM_014762	
C8B	732	hgsc.bcm.edu	37	1	57395097	57395097	+	Missense_Mutation	SNP	C	C	G			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr1:57395097C>G	ENST00000371237.4	-	12	1822	c.1756G>C	c.(1756-1758)Gaa>Caa	p.E586Q	C8B_ENST00000543257.1_Missense_Mutation_p.E534Q|C8B_ENST00000535057.1_Missense_Mutation_p.E524Q	NM_000066.2	NP_000057	P07358	CO8B_HUMAN	complement component 8, beta polypeptide	586	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)|vesicle (GO:0031982)		p.E586Q(1)		breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	52						TCAAGTGTTTCTGAAGCAGGG	0.502																																					p.E586Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1756C	1						.						122.0	105.0	111.0					1																	57395097		2203	4300	6503	57167685	SO:0001583	missense	732	exon12			M16973	CCDS30730.1, CCDS60151.1, CCDS60152.1	1p32.2	2014-09-17			ENSG00000021852	ENSG00000021852		"""Complement system"""	1353	protein-coding gene	gene with protein product		120960					Standard	NM_000066		Approved		uc001cyp.3	P07358	OTTHUMG00000008305	ENST00000371237.4:c.1756G>C	1.37:g.57395097C>G	ENSP00000360281:p.Glu586Gln	Somatic		Capture	SOLID	Phase_I	57167685	NM_000066	A1L4K7	Missense_Mutation	SNP	ENST00000371237.4	37	CCDS30730.1	.	.	.	.	.	.	.	.	.	.	C	18.31	3.596753	0.66332	.	.	ENSG00000021852	ENST00000371237;ENST00000543257;ENST00000535057	T;T;T	0.21734	1.99;1.99;1.99	3.76	3.76	0.43208	.	0.050708	0.85682	D	0.000000	T	0.32224	0.0822	L	0.39147	1.195	0.58432	D	0.999999	D;D;D	0.69078	0.996;0.996;0.997	P;P;D	0.63597	0.907;0.907;0.916	T	0.02288	-1.1182	10	0.18276	T	0.48	-22.9715	15.8296	0.78741	0.0:1.0:0.0:0.0	.	534;524;586	F5H7G1;F5GY80;P07358	.;.;CO8B_HUMAN	Q	586;534;524	ENSP00000360281:E586Q;ENSP00000442548:E534Q;ENSP00000440113:E524Q	ENSP00000360281:E586Q	E	-	1	0	C8B	57167685	1.000000	0.71417	0.967000	0.41034	0.930000	0.56654	5.488000	0.66869	2.419000	0.82065	0.462000	0.41574	GAA		C8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022886.2		
NEGR1	257194	hgsc.bcm.edu	37	1	72400821	72400821	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr1:72400821G>A	ENST00000357731.5	-	2	589	c.350C>T	c.(349-351)aCg>aTg	p.T117M	NEGR1_ENST00000306821.3_De_novo_Start_InFrame|NEGR1_ENST00000434200.1_Missense_Mutation_p.T115M|NEGR1_ENST00000467479.1_5'UTR	NM_173808.2	NP_776169.2	Q7Z3B1	NEGR1_HUMAN	neuronal growth regulator 1	117	Ig-like C2-type 1.				feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|positive regulation of neuron projection development (GO:0010976)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)		p.T117M(1)		endometrium(1)|kidney(4)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)		AACAGAACACGTGTATGGGCC	0.418																																					p.T117M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C350T	1						.						127.0	115.0	119.0					1																	72400821		2203	4300	6503	72173409	SO:0001583	missense	257194	exon2			AK092307	CCDS661.1	1p31.1	2013-01-11			ENSG00000172260	ENSG00000172260		"""Immunoglobulin superfamily / I-set domain containing"""	17302	protein-coding gene	gene with protein product	"""a kindred of IgLON"", ""neurotractin"", ""IgLON family member 4"""	613173				10075727	Standard	NM_173808		Approved	KILON, MGC46680, Ntra, IGLON4	uc001dfw.3	Q7Z3B1	OTTHUMG00000009698	ENST00000357731.5:c.350C>T	1.37:g.72400821G>A	ENSP00000350364:p.Thr117Met	Somatic		Capture	SOLID	Phase_I	72173409	NM_173808	Q5VT21|Q6UY06|Q8N440|Q8NAQ3	Missense_Mutation	SNP	ENST00000357731.5	37	CCDS661.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.442648	0.83993	.	.	ENSG00000172260	ENST00000357731;ENST00000434200	T;T	0.33865	1.39;1.39	5.71	5.71	0.89125	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.36386	0.0965	L	0.38953	1.18	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.994;0.997	T	0.05022	-1.0911	10	0.06365	T	0.9	-8.7192	19.8408	0.96685	0.0:0.0:1.0:0.0	.	115;117	B4DI94;Q7Z3B1	.;NEGR1_HUMAN	M	117;115	ENSP00000350364:T117M;ENSP00000413294:T115M	ENSP00000350364:T117M	T	-	2	0	NEGR1	72173409	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.869000	0.99810	2.699000	0.92147	0.655000	0.94253	ACG		NEGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026722.4	NM_173808	
NID1	4811	hgsc.bcm.edu	37	1	236189410	236189410	+	Silent	SNP	C	C	T			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr1:236189410C>T	ENST00000264187.6	-	8	1852	c.1770G>A	c.(1768-1770)acG>acA	p.T590T	NID1_ENST00000366595.3_Silent_p.T590T	NM_002508.2	NP_002499.2	P14543	NID1_HUMAN	nidogen 1	590	Nidogen G2 beta-barrel. {ECO:0000255|PROSITE-ProRule:PRU00348}.				basement membrane organization (GO:0071711)|cell-matrix adhesion (GO:0007160)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|positive regulation of cell-substrate adhesion (GO:0010811)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|cell periphery (GO:0071944)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)	p.T590T(1)		breast(4)|endometrium(9)|kidney(1)|large_intestine(23)|lung(20)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(1)	66	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Urokinase(DB00013)	GCTCAGTCACCGTGTACTCCC	0.577																																					p.T590T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1770A	1						.						80.0	76.0	78.0					1																	236189410		2203	4300	6503	234256033	SO:0001819	synonymous_variant	4811	exon8			BC045606	CCDS1608.1	1q43	2011-05-08	2005-06-02	2005-06-02	ENSG00000116962	ENSG00000116962			7821	protein-coding gene	gene with protein product		131390	"""nidogen (enactin)"""	NID		2471408, 7557988	Standard	NM_002508		Approved	entactin	uc001hxo.3	P14543	OTTHUMG00000040071	ENST00000264187.6:c.1770G>A	1.37:g.236189410C>T		Somatic		Capture	SOLID	Phase_I	234256033	NM_002508	Q14942|Q59FL2|Q5TAF2|Q5TAF3|Q86XD7	Silent	SNP	ENST00000264187.6	37	CCDS1608.1																																																																																				NID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096647.2	NM_002508	
ACTN2	88	hgsc.bcm.edu	37	1	236925786	236925786	+	Missense_Mutation	SNP	G	G	A	rs201335965		TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr1:236925786G>A	ENST00000366578.4	+	21	2718	c.2552G>A	c.(2551-2553)cGt>cAt	p.R851H	ACTN2_ENST00000546208.1_Missense_Mutation_p.R345H|ACTN2_ENST00000542672.1_Missense_Mutation_p.R851H	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	851					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)	p.R851H(1)		endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			GAGGAGCTGCGTCGGGAGCTG	0.542																																					p.R851H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2552A	1						.	G	HIS/ARG	0,4406		0,0,2203	49.0	51.0	51.0		2552	5.4	1.0	1		51	1,8599	1.2+/-3.3	0,1,4299	no	missense	ACTN2	NM_001103.2	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	851/895	236925786	1,13005	2203	4300	6503	234992409	SO:0001583	missense	88	exon21			BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.2552G>A	1.37:g.236925786G>A	ENSP00000355537:p.Arg851His	Somatic		Capture	SOLID	Phase_I	234992409	NM_001103	B1ANE4|B2RCS5|Q86TF4|Q86TI8	Missense_Mutation	SNP	ENST00000366578.4	37	CCDS1613.1	.	.	.	.	.	.	.	.	.	.	G	33	5.200094	0.94997	0.0	1.16E-4	ENSG00000077522	ENST00000542672;ENST00000366578;ENST00000546208;ENST00000545611	T;T;T	0.52295	0.67;0.67;0.67	5.43	5.43	0.79202	EF-hand, Ca insensitive (1);EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.76695	0.4023	H	0.94582	3.555	0.80722	D	1	D;D;D;P	0.76494	0.99;0.999;0.996;0.919	D;D;D;P	0.72338	0.953;0.977;0.953;0.503	T	0.83062	-0.0147	10	0.87932	D	0	.	15.2475	0.73517	0.0:0.0:0.859:0.1409	.	636;851;621;851	B7Z4K1;B2RCS5;Q59FD9;P35609	.;.;.;ACTN2_HUMAN	H	851;851;345;620	ENSP00000443495:R851H;ENSP00000355537:R851H;ENSP00000438384:R345H	ENSP00000355537:R851H	R	+	2	0	ACTN2	234992409	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	7.736000	0.84948	2.721000	0.93114	0.655000	0.94253	CGT		ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096628.1	NM_001103	
VWA5A	4013	hgsc.bcm.edu	37	11	124015993	124015993	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr11:124015993A>G	ENST00000456829.2	+	18	2455	c.2204A>G	c.(2203-2205)cAc>cGc	p.H735R	VWA5A_ENST00000392748.1_Missense_Mutation_p.H735R|VWA5A_ENST00000360334.4_3'UTR	NM_001130142.1	NP_001123614.1	O00534	VMA5A_HUMAN	von Willebrand factor A domain containing 5A	735								p.H735R(1)		autonomic_ganglia(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	47						ATCTGGCTGCACAGCAATGGT	0.557																																					p.H735R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2204G	11						.						125.0	116.0	119.0					11																	124015993		2201	4299	6500	123521203	SO:0001583	missense	4013	exon17			AF002672	CCDS8444.1, CCDS8445.1	11q24.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000110002	ENSG00000110002			6658	protein-coding gene	gene with protein product		602929	"""loss of heterozygosity, 11, chromosomal region 2, gene A"""	LOH11CR2A		9417908, 14504409	Standard	NM_001130142		Approved	BCSC-1	uc001pzt.3	O00534	OTTHUMG00000165971	ENST00000456829.2:c.2204A>G	11.37:g.124015993A>G	ENSP00000407726:p.His735Arg	Somatic		Capture	SOLID	Phase_I	123521203	NM_014622	Q6UN19|Q6UN20|Q9BVF8	Missense_Mutation	SNP	ENST00000456829.2	37	CCDS8444.1	.	.	.	.	.	.	.	.	.	.	A	13.54	2.266774	0.40095	.	.	ENSG00000110002	ENST00000456829;ENST00000392748	T;T	0.28454	1.61;1.61	5.17	5.17	0.71159	.	0.506784	0.23171	N	0.051133	T	0.38532	0.1044	M	0.73962	2.25	0.80722	D	1	P	0.40360	0.714	B	0.43274	0.414	T	0.16928	-1.0386	10	0.25106	T	0.35	-12.2272	13.0063	0.58707	1.0:0.0:0.0:0.0	.	735	O00534	VMA5A_HUMAN	R	735	ENSP00000407726:H735R;ENSP00000376504:H735R	ENSP00000376504:H735R	H	+	2	0	VWA5A	123521203	0.999000	0.42202	0.728000	0.30774	0.217000	0.24651	5.915000	0.69973	2.175000	0.68902	0.533000	0.62120	CAC		VWA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387273.1	NM_014622	
PRRG4	79056	hgsc.bcm.edu	37	11	32858356	32858356	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr11:32858356G>T	ENST00000257836.3	+	3	509	c.256G>T	c.(256-258)Gaa>Taa	p.E86*		NM_024081.5	NP_076986.1	Q9BZD6	TMG4_HUMAN	proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane)	86	Gla. {ECO:0000255|PROSITE- ProRule:PRU00463}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)	p.E86*(1)		large_intestine(2)|lung(2)|prostate(2)|urinary_tract(1)	7	Breast(20;0.206)					TTTTGTGGATGAAGATAAAAC	0.358																																					p.E86X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G256T	11						.						71.0	71.0	71.0					11																	32858356		2202	4299	6501	32814932	SO:0001587	stop_gained	79056	exon3			AF326351	CCDS7881.1	11p13	2008-02-05			ENSG00000135378	ENSG00000135378			30799	protein-coding gene	gene with protein product		611690				11171957	Standard	NM_024081		Approved	TMG4	uc001mtx.3	Q9BZD6	OTTHUMG00000166219	ENST00000257836.3:c.256G>T	11.37:g.32858356G>T	ENSP00000257836:p.Glu86*	Somatic		Capture	SOLID	Phase_I	32814932	NM_024081		Nonsense_Mutation	SNP	ENST00000257836.3	37	CCDS7881.1	.	.	.	.	.	.	.	.	.	.	G	37	6.578121	0.97680	.	.	ENSG00000135378	ENST00000257836	.	.	.	5.58	3.71	0.42584	.	0.410369	0.28952	N	0.013620	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05436	T	0.98	-12.4412	7.4465	0.27213	0.1571:0.1801:0.6629:0.0	.	.	.	.	X	86	.	ENSP00000257836:E86X	E	+	1	0	PRRG4	32814932	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.333000	0.43912	1.360000	0.45960	0.462000	0.41574	GAA		PRRG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388446.1	NM_024081	
SLC1A2	6506	hgsc.bcm.edu	37	11	35302485	35302485	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr11:35302485C>T	ENST00000278379.3	-	9	1632	c.1350G>A	c.(1348-1350)atG>atA	p.M450I	SLC1A2_ENST00000479543.1_5'UTR|SLC1A2_ENST00000395753.1_Missense_Mutation_p.M441I|SLC1A2_ENST00000606205.1_Missense_Mutation_p.M450I|SLC1A2_ENST00000395750.1_Missense_Mutation_p.M441I|RP1-68D18.3_ENST00000532760.1_RNA	NM_004171.3	NP_004162.2	P43004	EAA2_HUMAN	solute carrier family 1 (glial high affinity glutamate transporter), member 2	450					adult behavior (GO:0030534)|cellular response to extracellular stimulus (GO:0031668)|D-aspartate import (GO:0070779)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|multicellular organism growth (GO:0035264)|multicellular organismal aging (GO:0010259)|positive regulation of glucose import (GO:0046326)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to wounding (GO:0009611)|synaptic transmission (GO:0007268)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)|visual behavior (GO:0007632)	axolemma (GO:0030673)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glutamate:sodium symporter activity (GO:0015501)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)	p.M450I(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(1)|urinary_tract(1)	24	all_lung(20;0.211)|all_epithelial(35;0.234)	all_hematologic(20;0.109)	STAD - Stomach adenocarcinoma(6;0.00731)			GAATGAGGAGCATGGTGACCA	0.597																																					p.M450I	NSCLC(100;1273 1575 12993 16869 47409)|Ovarian(164;45 1946 8965 30452 48454)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1350A	11						.						66.0	66.0	66.0					11																	35302485		2202	4298	6500	35259061	SO:0001583	missense	6506	exon9			AB209444	CCDS31459.1, CCDS55756.1	11p13-p12	2013-05-22			ENSG00000110436	ENSG00000110436		"""Solute carriers"""	10940	protein-coding gene	gene with protein product		600300				1448170	Standard	NM_004171		Approved	GLT-1, EAAT2	uc001mwd.3	P43004	OTTHUMG00000044391	ENST00000278379.3:c.1350G>A	11.37:g.35302485C>T	ENSP00000278379:p.Met450Ile	Somatic		Capture	SOLID	Phase_I	35259061	NM_004171	B4DQE9|Q14417|Q541G6|U3KQQ4	Missense_Mutation	SNP	ENST00000278379.3	37	CCDS31459.1	.	.	.	.	.	.	.	.	.	.	C	31	5.066096	0.93898	.	.	ENSG00000110436	ENST00000278379;ENST00000395750;ENST00000395753	T;T;T	0.58358	0.34;0.34;0.34	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.63780	0.2540	L	0.38953	1.18	0.80722	D	1	D;P	0.65815	0.995;0.623	D;P	0.64595	0.927;0.456	T	0.62369	-0.6869	10	0.44086	T	0.13	-31.2576	19.2381	0.93869	0.0:1.0:0.0:0.0	.	450;450	B4DQE9;P43004	.;EAA2_HUMAN	I	450;441;441	ENSP00000278379:M450I;ENSP00000379099:M441I;ENSP00000379102:M441I	ENSP00000278379:M450I	M	-	3	0	SLC1A2	35259061	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	7.818000	0.86416	2.550000	0.86006	0.555000	0.69702	ATG		SLC1A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258181.1	NM_004171	
TRIM44	54765	hgsc.bcm.edu	37	11	35747697	35747697	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr11:35747697G>T	ENST00000299413.5	+	3	1280	c.973G>T	c.(973-975)Gag>Tag	p.E325*	TRIM44_ENST00000532066.1_3'UTR	NM_017583.4	NP_060053.2	Q96DX7	TRI44_HUMAN	tripartite motif containing 44	325						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.E325*(1)		endometrium(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	18	all_lung(20;0.0317)|Lung NSC(22;0.0661)|all_epithelial(35;0.115)	all_hematologic(20;0.107)				TGAATCAGCTGAGCCAAAGGC	0.443																																					p.E325X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G973T	11						.						80.0	74.0	76.0					11																	35747697		2202	4298	6500	35704273	SO:0001587	stop_gained	54765	exon3			BC024031	CCDS31461.1	11p13	2011-04-20	2011-01-25		ENSG00000166326	ENSG00000166326		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19016	protein-coding gene	gene with protein product		612298	"""tripartite motif-containing 44"""				Standard	NM_017583		Approved	DIPB, MC7	uc001mwi.2	Q96DX7	OTTHUMG00000166312	ENST00000299413.5:c.973G>T	11.37:g.35747697G>T	ENSP00000299413:p.Glu325*	Somatic		Capture	SOLID	Phase_I	35704273	NM_017583	D3DR14|Q96QY2|Q9UGK0	Nonsense_Mutation	SNP	ENST00000299413.5	37	CCDS31461.1	.	.	.	.	.	.	.	.	.	.	G	40	7.974506	0.98591	.	.	ENSG00000166326	ENST00000299413	.	.	.	5.23	2.07	0.26955	.	0.000000	0.38326	N	0.001721	.	.	.	.	.	.	0.52099	D	0.999943	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-16.1448	2.587	0.04833	0.0949:0.1517:0.4042:0.3492	.	.	.	.	X	325	.	ENSP00000299413:E325X	E	+	1	0	TRIM44	35704273	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	1.389000	0.34453	1.188000	0.43014	-0.188000	0.12872	GAG		TRIM44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389081.1	NM_017583	
AHNAK	79026	hgsc.bcm.edu	37	11	62296450	62296450	+	Silent	SNP	C	C	T	rs201325865		TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr11:62296450C>T	ENST00000378024.4	-	5	5713	c.5439G>A	c.(5437-5439)ccG>ccA	p.P1813P	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	1813					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)	p.P1813P(1)		NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				CATCAACTTGCGGCCCTCTGA	0.502													C|||	1	0.000199681	0.0	0.0	5008	,	,		20420	0.0		0.001	False		,,,				2504	0.0				p.P1813P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G5439A	11						.						156.0	158.0	158.0					11																	62296450		2202	4299	6501	62053026	SO:0001819	synonymous_variant	79026	exon5			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.5439G>A	11.37:g.62296450C>T		Somatic		Capture	SOLID	Phase_I	62053026	NM_001620	A1A586	Silent	SNP	ENST00000378024.4	37	CCDS31584.1																																																																																				AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
ARHGAP32	9743	hgsc.bcm.edu	37	11	128839897	128839897	+	Silent	SNP	G	G	A			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr11:128839897G>A	ENST00000310343.9	-	22	5168	c.5169C>T	c.(5167-5169)gaC>gaT	p.D1723D	ARHGAP32_ENST00000524655.1_3'UTR|ARHGAP32_ENST00000392657.3_Silent_p.D1374D|ARHGAP32_ENST00000527272.1_Silent_p.D1374D	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	1723	Interaction with FYN.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)	p.D1374D(1)|p.D1723D(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						CTACATTATGGTCGTTGGGAG	0.517																																					p.D1374D												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C4122T	11						.						97.0	87.0	90.0					11																	128839897		2201	4297	6498	128345107	SO:0001819	synonymous_variant	9743	exon13			AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.5169C>T	11.37:g.128839897G>A		Somatic		Capture	SOLID	Phase_I	128345107	NM_014715	I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Silent	SNP	ENST00000310343.9	37	CCDS44769.1																																																																																				ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386151.3	NM_014715	
USP45	85015	hgsc.bcm.edu	37	6	99914576	99914576	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr6:99914576C>A	ENST00000327681.6	-	11	1611	c.1079G>T	c.(1078-1080)aGc>aTc	p.S360I	USP45_ENST00000539675.1_5'Flank|USP45_ENST00000500704.2_Missense_Mutation_p.S360I|USP45_ENST00000392738.2_Intron|USP45_ENST00000369233.2_Missense_Mutation_p.S360I	NM_001080481.1	NP_001073950.1	Q70EL2	UBP45_HUMAN	ubiquitin specific peptidase 45	360	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.S360I(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(6)|lung(2)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	22		all_cancers(76;0.000208)|Acute lymphoblastic leukemia(125;8.41e-11)|all_hematologic(75;2.56e-07)|all_epithelial(107;0.122)|Colorectal(196;0.133)		BRCA - Breast invasive adenocarcinoma(108;0.0718)		CATGACCGTGCTAGTTAATTC	0.308																																					p.S360I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1079T	6						.						173.0	155.0	161.0					6																	99914576		2202	4299	6501	100021297	SO:0001583	missense	85015	exon11			AL832030	CCDS34501.1	6q16.2	2008-02-05	2005-08-08		ENSG00000123552	ENSG00000123552		"""Ubiquitin-specific peptidases"""	20080	protein-coding gene	gene with protein product			"""ubiquitin specific protease 45"""			12838346	Standard	NM_001080481		Approved	MGC14793	uc003ppx.2	Q70EL2	OTTHUMG00000015267	ENST00000327681.6:c.1079G>T	6.37:g.99914576C>A	ENSP00000333376:p.Ser360Ile	Somatic		Capture	SOLID	Phase_I	100021297	NM_001080481	B2RXG0|Q5T062|Q86T44|Q86TC0|Q9BRU1	Missense_Mutation	SNP	ENST00000327681.6	37	CCDS34501.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.0|23.0	4.368372|4.368372	0.82463|0.82463	.|.	.|.	ENSG00000123552|ENSG00000123552	ENST00000496090|ENST00000500704;ENST00000327681;ENST00000369233	.|T;T;T	.|0.35789	.|1.29;1.29;1.29	5.83|5.83	5.83|5.83	0.93111|0.93111	.|Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	.|0.042002	.|0.85682	.|D	.|0.000000	T|T	0.68915|0.68915	0.3053|0.3053	H|H	0.94503|0.94503	3.545|3.545	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.79784	.|0.993	T|T	0.77555|0.77555	-0.2544|-0.2544	5|10	.|0.87932	.|D	.|0	.|.	20.1197|20.1197	0.97955|0.97955	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|360	.|Q70EL2	.|UBP45_HUMAN	S|I	71|360	.|ENSP00000424372:S360I;ENSP00000333376:S360I;ENSP00000358236:S360I	.|ENSP00000333376:S360I	A|S	-|-	1|2	0|0	USP45|USP45	100021297|100021297	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	4.507000|4.507000	0.60434|0.60434	2.747000|2.747000	0.94245|0.94245	0.585000|0.585000	0.79938|0.79938	GCA|AGC		USP45-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041609.2	NM_032929	
CEP85L	387119	hgsc.bcm.edu	37	6	118812924	118812924	+	Missense_Mutation	SNP	T	T	G			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr6:118812924T>G	ENST00000368491.3	-	6	1983	c.1362A>C	c.(1360-1362)gaA>gaC	p.E454D	CEP85L_ENST00000368488.5_Missense_Mutation_p.E457D|CEP85L_ENST00000360290.3_Missense_Mutation_p.E352D|CEP85L_ENST00000392500.3_Missense_Mutation_p.E457D|CEP85L_ENST00000419517.2_Missense_Mutation_p.E454D	NM_001042475.2	NP_001035940.1	Q5SZL2	CE85L_HUMAN	centrosomal protein 85kDa-like	454						centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.E454D(1)									GCTGTAAAACTTCTTTCTCAG	0.353																																					p.E454D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1362C	6						.						89.0	88.0	89.0					6																	118812924		2203	4300	6503	118919617	SO:0001583	missense	387119	exon6			AF308284	CCDS5119.2, CCDS43498.1, CCDS55052.1	6q22.31	2011-11-25	2011-11-25	2011-11-25	ENSG00000111860	ENSG00000111860			21638	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 204"""	C6orf204			Standard	NM_206921		Approved	NY-BR-15, bA57K17.2	uc003pya.2	Q5SZL2	OTTHUMG00000015465	ENST00000368491.3:c.1362A>C	6.37:g.118812924T>G	ENSP00000357477:p.Glu454Asp	Somatic		Capture	SOLID	Phase_I	118919617	NM_206921	A1A4E1|A2A3P2|A2IDE5|F8W6J2|G3V0H3|Q2TAM2|Q5T323|Q7Z5K7|Q9H289	Missense_Mutation	SNP	ENST00000368491.3	37	CCDS43498.1	.	.	.	.	.	.	.	.	.	.	T	14.98	2.696621	0.48202	.	.	ENSG00000111860	ENST00000368491;ENST00000368488;ENST00000434604;ENST00000392500;ENST00000360290;ENST00000419517	T;T;T;T;T;T	0.34667	2.69;2.69;2.69;1.64;1.35;1.66	6.08	-1.63	0.08345	.	0.049424	0.85682	D	0.000000	T	0.10208	0.0250	L	0.46741	1.465	0.29666	N	0.842824	B;B;B;B	0.21606	0.058;0.058;0.037;0.021	B;B;B;B	0.20184	0.028;0.028;0.024;0.016	T	0.17107	-1.0380	10	0.45353	T	0.12	-11.544	5.0501	0.14503	0.2119:0.4202:0.0:0.3678	.	457;454;457;454	Q5SZL2-2;G3V0H3;F8W6J2;Q5SZL2	.;.;.;CF204_HUMAN	D	454;457;457;457;352;454	ENSP00000357477:E454D;ENSP00000357474:E457D;ENSP00000392131:E457D;ENSP00000376288:E457D;ENSP00000353434:E352D;ENSP00000393317:E454D	ENSP00000353434:E352D	E	-	3	2	C6orf204	118919617	0.976000	0.34144	0.933000	0.37362	0.992000	0.81027	0.369000	0.20416	-0.677000	0.05231	-0.250000	0.11733	GAA		CEP85L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041996.2	NM_001042475	
SYNE1	23345	hgsc.bcm.edu	37	6	152765638	152765638	+	Missense_Mutation	SNP	T	T	G			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr6:152765638T>G	ENST00000367255.5	-	30	4346	c.3745A>C	c.(3745-3747)Att>Ctt	p.I1249L	SYNE1_ENST00000367248.3_Missense_Mutation_p.I1239L|SYNE1_ENST00000413186.2_Missense_Mutation_p.I1249L|SYNE1_ENST00000448038.1_Missense_Mutation_p.I1256L|SYNE1_ENST00000341594.5_Missense_Mutation_p.I1315L|SYNE1_ENST00000265368.4_Missense_Mutation_p.I1249L|SYNE1_ENST00000423061.1_Missense_Mutation_p.I1256L|SYNE1_ENST00000367253.4_Missense_Mutation_p.I1249L	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1249					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.I1249L(4)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GAGCCAGAAATTAATTCTTCG	0.343										HNSCC(10;0.0054)																											p.I1256L												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.A3766C	6						.						92.0	92.0	92.0					6																	152765638		2203	4300	6503	152807331	SO:0001583	missense	23345	exon30			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.3745A>C	6.37:g.152765638T>G	ENSP00000356224:p.Ile1249Leu	Somatic		Capture	SOLID	Phase_I	152807331	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	T	14.65	2.597284	0.46318	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253;ENST00000367248;ENST00000413186	T;T;T;T;T;D;D;D	0.87650	0.69;0.69;0.6;0.69;0.78;-2.14;-2.28;-2.28	5.96	5.96	0.96718	.	0.098580	0.44902	D	0.000418	T	0.77089	0.4079	M	0.61703	1.905	0.80722	D	1	B;B;B;B;B;B	0.25850	0.136;0.002;0.001;0.056;0.002;0.006	B;B;B;B;B;B	0.21708	0.036;0.005;0.005;0.027;0.005;0.019	T	0.75780	-0.3197	10	0.11182	T	0.66	.	16.4277	0.83824	0.0:0.0:0.0:1.0	.	1232;1249;1239;1249;1249;1256	B3W695;Q8NF91;F5GXQ8;Q8NF91-6;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.;.	L	1249;1256;1249;1256;1315;1249;1239;1249	ENSP00000356224:I1249L;ENSP00000396024:I1256L;ENSP00000265368:I1249L;ENSP00000390975:I1256L;ENSP00000341887:I1315L;ENSP00000356222:I1249L;ENSP00000356217:I1239L;ENSP00000414510:I1249L	ENSP00000265368:I1249L	I	-	1	0	SYNE1	152807331	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	1.982000	0.40638	2.279000	0.76181	0.533000	0.62120	ATT		SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
MAS1L	116511	hgsc.bcm.edu	37	6	29455322	29455322	+	Missense_Mutation	SNP	C	C	G	rs376853475		TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr6:29455322C>G	ENST00000377127.3	-	1	416	c.358G>C	c.(358-360)Gtg>Ctg	p.V120L		NM_052967.1	NP_443199.1	P35410	MAS1L_HUMAN	MAS1 proto-oncogene like, G protein-coupled receptor	120					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.V120L(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(7)|pancreas(1)|prostate(2)|skin(2)	28						AGATAGATCACGTCAGCAGCG	0.502																																					p.V120L	NSCLC(153;755 1987 3859 11251 32945)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G358C	6						.						70.0	66.0	67.0					6																	29455322		2203	4300	6503	29563301	SO:0001583	missense	116511	exon1			S78653	CCDS4661.1	6p22.1	2014-06-26	2014-06-26		ENSG00000204687	ENSG00000204687		"""GPCR / Class A : Orphans"""	13961	protein-coding gene	gene with protein product		607235	"""MAS1 oncogene-like"""				Standard	NM_052967		Approved	MAS-L, MRG, dJ994E9.2	uc011dlq.2	P35410	OTTHUMG00000031089	ENST00000377127.3:c.358G>C	6.37:g.29455322C>G	ENSP00000366331:p.Val120Leu	Somatic		Capture	SOLID	Phase_I	29563301	NM_052967	Q5SUN5	Missense_Mutation	SNP	ENST00000377127.3	37	CCDS4661.1	.	.	.	.	.	.	.	.	.	.	C	6.588	0.476854	0.12521	.	.	ENSG00000204687	ENST00000377127	T	0.25579	1.79	2.36	-4.72	0.03269	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.02533	0.0077	N	0.02539	-0.55	0.09310	N	1	B	0.21753	0.06	B	0.25405	0.06	T	0.45086	-0.9285	9	0.41790	T	0.15	.	5.653	0.17627	0.3653:0.4792:0.0:0.1555	.	120	P35410	MAS1L_HUMAN	L	120	ENSP00000366331:V120L	ENSP00000366331:V120L	V	-	1	0	MAS1L	29563301	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.582000	0.00905	-0.745000	0.04772	-1.423000	0.01107	GTG		MAS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076126.2	NM_052967	
BRPF3	27154	hgsc.bcm.edu	37	6	36181864	36181864	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr6:36181864G>A	ENST00000357641.6	+	8	2943	c.2690G>A	c.(2689-2691)cGc>cAc	p.R897H	BRPF3_ENST00000443324.2_Intron|BRPF3_ENST00000339717.7_Intron|BRPF3_ENST00000534400.1_Missense_Mutation_p.R897H|BRPF3_ENST00000534694.1_Intron|BRPF3_ENST00000543502.1_Intron	NM_015695.2	NP_056510.2	Q9ULD4	BRPF3_HUMAN	bromodomain and PHD finger containing, 3	897					blood coagulation (GO:0007596)|histone H3 acetylation (GO:0043966)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	cytosol (GO:0005829)|extracellular region (GO:0005576)|MOZ/MORF histone acetyltransferase complex (GO:0070776)	zinc ion binding (GO:0008270)	p.R897H(1)		breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	40						CCTTTGCAACGCTTGCTCAGT	0.542																																					p.R897H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2690A	6						.						105.0	100.0	102.0					6																	36181864		2203	4300	6503	36289842	SO:0001583	missense	27154	exon8			AB033112	CCDS34437.1	6p21.31	2008-02-05			ENSG00000096070	ENSG00000096070			14256	protein-coding gene	gene with protein product						10574462	Standard	NM_015695		Approved	KIAA1286	uc003olv.4	Q9ULD4	OTTHUMG00000014589	ENST00000357641.6:c.2690G>A	6.37:g.36181864G>A	ENSP00000350267:p.Arg897His	Somatic		Capture	SOLID	Phase_I	36289842	NM_015695	A6ND56|A6NJE2|B7ZLN5|E7EX85|Q17RB6|Q5R3K8	Missense_Mutation	SNP	ENST00000357641.6	37	CCDS34437.1	.	.	.	.	.	.	.	.	.	.	G	10.80	1.452117	0.26074	.	.	ENSG00000096070	ENST00000357641;ENST00000534400;ENST00000394572	T;T	0.16324	2.53;2.35	5.65	-0.707	0.11245	.	0.842352	0.11150	N	0.594192	T	0.02533	0.0077	N	0.08118	0	0.18873	N	0.999986	B	0.02656	0.0	B	0.01281	0.0	T	0.45101	-0.9284	10	0.41790	T	0.15	.	9.8397	0.40991	0.4291:0.0:0.5709:0.0	.	897	Q9ULD4	BRPF3_HUMAN	H	897;897;311	ENSP00000350267:R897H;ENSP00000436504:R897H	ENSP00000350267:R897H	R	+	2	0	BRPF3	36289842	0.018000	0.18449	0.276000	0.24689	0.685000	0.39939	0.970000	0.29383	-0.191000	0.10448	-0.422000	0.05995	CGC		BRPF3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000040335.3	NM_015695	
FILIP1	27145	hgsc.bcm.edu	37	6	76023659	76023659	+	Missense_Mutation	SNP	T	T	G			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr6:76023659T>G	ENST00000237172.7	-	5	2219	c.1889A>C	c.(1888-1890)aAg>aCg	p.K630T	FILIP1_ENST00000370020.1_Missense_Mutation_p.K531T|FILIP1_ENST00000393004.2_Missense_Mutation_p.K630T|FILIP1_ENST00000498523.1_5'UTR	NM_015687.2	NP_056502.1	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	630								p.K630T(1)		breast(3)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)	80						TGTTAGTTCCTTAATCTTATT	0.418																																					p.K630T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1889C	6						.						248.0	258.0	255.0					6																	76023659		2203	4300	6503	76080379	SO:0001583	missense	27145	exon5			AB033101	CCDS4984.1, CCDS75480.1	6q14.1	2008-02-05			ENSG00000118407	ENSG00000118407			21015	protein-coding gene	gene with protein product		607307				10574462	Standard	XM_005248713		Approved	FILIP, KIAA1275	uc003pia.3	Q7Z7B0	OTTHUMG00000015056	ENST00000237172.7:c.1889A>C	6.37:g.76023659T>G	ENSP00000237172:p.Lys630Thr	Somatic		Capture	SOLID	Phase_I	76080379	NM_015687	B2RMU6|Q5VUL6|Q86TC3|Q8N8B9|Q96SK6|Q9NVI8|Q9ULE5	Missense_Mutation	SNP	ENST00000237172.7	37	CCDS4984.1	.	.	.	.	.	.	.	.	.	.	T	12.53	1.965050	0.34659	.	.	ENSG00000118407	ENST00000393004;ENST00000237172;ENST00000370020	T;T;T	0.31769	1.49;1.49;1.48	5.85	4.49	0.54785	.	0.256303	0.44097	D	0.000492	T	0.31482	0.0798	M	0.77313	2.365	0.37164	D	0.902748	B;P;P	0.44044	0.321;0.825;0.692	B;P;P	0.50896	0.086;0.451;0.653	T	0.17837	-1.0356	10	0.49607	T	0.09	-19.9714	9.8234	0.40896	0.0:0.1029:0.0:0.8971	.	630;630;630	A8K2G7;Q7Z7B0;Q7Z7B0-2	.;FLIP1_HUMAN;.	T	630;630;531	ENSP00000376728:K630T;ENSP00000237172:K630T;ENSP00000359037:K531T	ENSP00000237172:K630T	K	-	2	0	FILIP1	76080379	1.000000	0.71417	0.991000	0.47740	0.646000	0.38490	2.639000	0.46570	0.841000	0.35020	0.383000	0.25322	AAG		FILIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041263.1	XM_029179	
IGF2R	3482	hgsc.bcm.edu	37	6	160450627	160450627	+	Silent	SNP	T	T	C			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr6:160450627T>C	ENST00000356956.1	+	7	970	c.822T>C	c.(820-822)ttT>ttC	p.F274F		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	274					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)	p.F274F(1)		breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	AGCTAGACTTTTGTGATGGTC	0.473																																					p.F274F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T822C	6						.						127.0	109.0	115.0					6																	160450627		2203	4300	6503	160370617	SO:0001819	synonymous_variant	3482	exon7			J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.822T>C	6.37:g.160450627T>C		Somatic		Capture	SOLID	Phase_I	160370617	NM_000876	Q7Z7G9|Q96PT5	Silent	SNP	ENST00000356956.1	37	CCDS5273.1																																																																																				IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1	NM_000876	
TMEM132E	124842	hgsc.bcm.edu	37	17	32959844	32959844	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr17:32959844C>A	ENST00000321639.5	+	7	1662	c.1334C>A	c.(1333-1335)cCc>cAc	p.P445H		NM_207313.1	NP_997196.1	Q6IEE7	T132E_HUMAN	transmembrane protein 132E	445						integral component of membrane (GO:0016021)		p.P445H(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(28)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	57				BRCA - Breast invasive adenocarcinoma(366;0.231)		GTCTGGGTCCCCAAGCTGCCC	0.597																																					p.P445H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1334A	17						.						181.0	162.0	168.0					17																	32959844		2203	4300	6503	29983957	SO:0001583	missense	124842	exon7			BN000149	CCDS11283.1	17q12	2012-11-01			ENSG00000181291	ENSG00000181291			26991	protein-coding gene	gene with protein product							Standard	NM_207313		Approved		uc002hif.3	Q6IEE7	OTTHUMG00000132927	ENST00000321639.5:c.1334C>A	17.37:g.32959844C>A	ENSP00000316532:p.Pro445His	Somatic		Capture	SOLID	Phase_I	29983957	NM_207313	Q8WUF4|Q8WVA5	Missense_Mutation	SNP	ENST00000321639.5	37	CCDS11283.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.631507	0.87660	.	.	ENSG00000181291	ENST00000321639	T	0.30182	1.54	4.71	4.71	0.59529	.	0.113166	0.64402	D	0.000007	T	0.61825	0.2378	M	0.86502	2.82	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.70008	-0.4990	10	0.87932	D	0	-30.1987	16.8574	0.86009	0.0:1.0:0.0:0.0	.	445	Q6IEE7	T132E_HUMAN	H	445	ENSP00000316532:P445H	ENSP00000316532:P445H	P	+	2	0	TMEM132E	29983957	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.651000	0.83577	2.446000	0.82766	0.551000	0.68910	CCC		TMEM132E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256440.2	NM_207313	
TP53	7157	hgsc.bcm.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000445888.2_Missense_Mutation_p.R175H|TP53_ENST00000413465.2_Missense_Mutation_p.R175H|TP53_ENST00000359597.4_Missense_Mutation_p.R175H|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000455263.2_Missense_Mutation_p.R175H|TP53_ENST00000420246.2_Missense_Mutation_p.R175H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R175H	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,lung,NS,Substitution - Missense,0	.	980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	c.G524A	17	GRCh37	CM062017|CM951224	TP53	M	rs28934578	.						50.0	50.0	50.0					17																	7578406		2203	4300	6503	7519131	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	17.37:g.7578406C>T	ENSP00000269305:p.Arg175His	Somatic		Capture	SOLID	Phase_I	7519131	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	TP53	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC		TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
SPATA20	64847	hgsc.bcm.edu	37	17	48626462	48626462	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr17:48626462C>T	ENST00000356488.4	+	5	610	c.527C>T	c.(526-528)cCc>cTc	p.P176L	SPATA20_ENST00000006658.6_Missense_Mutation_p.P192L|SPATA20_ENST00000393244.3_Missense_Mutation_p.P132L|SPATA20_ENST00000511937.1_3'UTR	NM_001258372.1	NP_001245301.1	Q8TB22	SPT20_HUMAN	spermatogenesis associated 20	176					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)	catalytic activity (GO:0003824)	p.P192L(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;9.38e-09)			AACCTCCAGCCCTTTGTCGGG	0.647																																					p.P192L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C575T	17						.						45.0	48.0	47.0					17																	48626462		2203	4300	6503	45981461	SO:0001583	missense	64847	exon6				CCDS11571.1, CCDS58563.1, CCDS58564.1	17q21.33	2011-03-17			ENSG00000006282	ENSG00000006282			26125	protein-coding gene	gene with protein product	"""hypothetical protein FLJ21347"""	613939				12477932	Standard	NM_022827		Approved	FLJ21347, SSP411, Tisp78	uc002ird.3	Q8TB22	OTTHUMG00000162162	ENST00000356488.4:c.527C>T	17.37:g.48626462C>T	ENSP00000348878:p.Pro176Leu	Somatic		Capture	SOLID	Phase_I	45981461	NM_022827	Q2TA99|Q2XUZ6|Q6P0P1|Q8WVW3|Q9H747	Missense_Mutation	SNP	ENST00000356488.4	37	CCDS58563.1	.	.	.	.	.	.	.	.	.	.	C	34	5.316648	0.95682	.	.	ENSG00000006282	ENST00000006658;ENST00000356488;ENST00000393244	T;T;T	0.55760	0.5;0.5;0.5	4.62	4.62	0.57501	Thioredoxin-like fold (2);Domain of unknown function DUF255 (1);	0.000000	0.85682	D	0.000000	T	0.80093	0.4560	M	0.93638	3.44	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.86353	0.1712	10	0.87932	D	0	-29.2715	17.8147	0.88628	0.0:1.0:0.0:0.0	.	202;176;192	B4DZC5;Q8TB22;Q8TB22-2	.;SPT20_HUMAN;.	L	192;176;132	ENSP00000006658:P192L;ENSP00000348878:P176L;ENSP00000376935:P132L	ENSP00000006658:P192L	P	+	2	0	SPATA20	45981461	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.549000	0.82163	2.282000	0.76494	0.561000	0.74099	CCC		SPATA20-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367651.1	NM_022827	
MRC2	9902	hgsc.bcm.edu	37	17	60753880	60753880	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr17:60753880C>T	ENST00000303375.5	+	11	2224	c.1822C>T	c.(1822-1824)Cgg>Tgg	p.R608W		NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	608	C-type lectin 3. {ECO:0000255|PROSITE- ProRule:PRU00040}.				collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)	p.R608W(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						CCACTGGAACCGGGACCAGCC	0.642																																					p.R608W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1822T	17						.						92.0	93.0	93.0					17																	60753880		2203	4300	6503	58107612	SO:0001583	missense	9902	exon11			AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.1822C>T	17.37:g.60753880C>T	ENSP00000307513:p.Arg608Trp	Somatic		Capture	SOLID	Phase_I	58107612	NM_006039	A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Missense_Mutation	SNP	ENST00000303375.5	37	CCDS11634.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.005674	0.74932	.	.	ENSG00000011028	ENST00000303375	T	0.55413	0.52	4.98	4.0	0.46444	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.85682	D	0.000000	T	0.64800	0.2631	L	0.50333	1.59	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.62609	-0.6818	10	0.33940	T	0.23	-42.5528	13.376	0.60739	0.2861:0.7138:0.0:0.0	.	608	Q9UBG0	MRC2_HUMAN	W	608	ENSP00000307513:R608W	ENSP00000307513:R608W	R	+	1	2	MRC2	58107612	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	2.201000	0.42734	1.315000	0.45114	0.543000	0.68304	CGG		MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445152.1		
NMRAL1	57407	hgsc.bcm.edu	37	16	4519368	4519368	+	Silent	SNP	G	G	A			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr16:4519368G>A	ENST00000574733.1	-	3	868	c.139C>T	c.(139-141)Ctg>Ttg	p.L47L	NMRAL1_ENST00000572391.1_Intron|NMRAL1_ENST00000574425.1_Silent_p.L47L|NMRAL1_ENST00000283429.6_Silent_p.L47L|NMRAL1_ENST00000404295.3_Silent_p.L47L			Q9HBL8	NMRL1_HUMAN	NmrA-like family domain containing 1	47						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.L47L(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|prostate(2)|stomach(1)	15						TGCAGCCTCAGCTCCTTTGCT	0.582																																					p.L47L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C139T	16						.						311.0	235.0	261.0					16																	4519368		2197	4300	6497	4459369	SO:0001819	synonymous_variant	57407	exon3			AF225419	CCDS10516.1	16p13.3	2013-10-11			ENSG00000153406	ENSG00000153406		"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	24987	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 48A, member 1"""					19027726	Standard	NM_020677		Approved	FLJ25918, HSCARG, SDR48A1	uc002cwo.3	Q9HBL8	OTTHUMG00000129468	ENST00000574733.1:c.139C>T	16.37:g.4519368G>A		Somatic		Capture	SOLID	Phase_I	4459369	NM_020677		Silent	SNP	ENST00000574733.1	37	CCDS10516.1																																																																																				NMRAL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438579.1	NM_020677	
TAOK2	9344	hgsc.bcm.edu	37	16	29998275	29998275	+	Silent	SNP	A	A	T			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr16:29998275A>T	ENST00000308893.4	+	16	3725	c.2682A>T	c.(2680-2682)gcA>gcT	p.A894A	TAOK2_ENST00000416441.2_Silent_p.A721A|TAOK2_ENST00000543033.1_Silent_p.A781A|TAOK2_ENST00000279394.3_Intron	NM_001252043.1|NM_016151.3	NP_001238972.1|NP_057235.2	Q9UL54	TAOK2_HUMAN	TAO kinase 2	894	Glu-rich.				actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|focal adhesion assembly (GO:0048041)|G2 DNA damage checkpoint (GO:0031572)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein targeting to membrane (GO:0006612)|regulation of cell growth (GO:0001558)|regulation of cell shape (GO:0008360)|response to stress (GO:0006950)|stress-activated MAPK cascade (GO:0051403)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleolus (GO:0005730)|nucleus (GO:0005634)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|mitogen-activated protein kinase kinase binding (GO:0031434)|protein serine/threonine kinase activity (GO:0004674)	p.A894A(1)		breast(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(3)|skin(1)	22						AGGGCCCAGCACTGACTCCCG	0.607																																					p.A894A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A2682T	16						.						73.0	76.0	75.0					16																	29998275		2197	4300	6497	29905776	SO:0001819	synonymous_variant	9344	exon16			AB020688	CCDS10662.1, CCDS10663.1, CCDS58448.1	16p11.2	2008-02-05			ENSG00000149930	ENSG00000149930			16835	protein-coding gene	gene with protein product		613199				10048485, 9786855	Standard	NM_016151		Approved	TAO1, KIAA0881, PSK, PSK1, TAO2, MAP3K17	uc002dva.2	Q9UL54	OTTHUMG00000132111	ENST00000308893.4:c.2682A>T	16.37:g.29998275A>T		Somatic		Capture	SOLID	Phase_I	29905776	NM_016151	A5PKY1|A7MCZ2|B2RN35|B7ZM88|O94957|Q6UW73|Q7LC09|Q9NSW2	Silent	SNP	ENST00000308893.4	37	CCDS10663.1																																																																																				TAOK2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255152.2	NM_016151	
ZFHX3	463	hgsc.bcm.edu	37	16	72828231	72828231	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr16:72828231G>A	ENST00000268489.5	-	9	9022	c.8350C>T	c.(8350-8352)Ccc>Tcc	p.P2784S	ZFHX3_ENST00000397992.5_Missense_Mutation_p.P1870S|RP5-991G20.4_ENST00000569195.1_RNA	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	2784					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.P2784S(1)		NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				GGTGAGAGGGGGACACCCTGA	0.493																																					p.P2784S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C8350T	16						.						77.0	80.0	79.0					16																	72828231		2198	4300	6498	71385732	SO:0001583	missense	463	exon9			D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.8350C>T	16.37:g.72828231G>A	ENSP00000268489:p.Pro2784Ser	Somatic		Capture	SOLID	Phase_I	71385732	NM_006885	D3DWS8|O15101|Q13719	Missense_Mutation	SNP	ENST00000268489.5	37	CCDS10908.1	.	.	.	.	.	.	.	.	.	.	G	8.461	0.855346	0.17106	.	.	ENSG00000140836	ENST00000268489;ENST00000397992	T;T	0.72394	-0.65;-0.64	5.96	5.96	0.96718	.	0.000000	0.49916	D	0.000132	T	0.37404	0.1002	N	0.00308	-1.67	0.45515	D	0.998475	B	0.14438	0.01	B	0.06405	0.002	T	0.44590	-0.9318	10	0.39692	T	0.17	.	13.5846	0.61921	0.0707:0.0:0.9293:0.0	.	2784	Q15911	ZFHX3_HUMAN	S	2784;1870	ENSP00000268489:P2784S;ENSP00000438926:P1870S	ENSP00000268489:P2784S	P	-	1	0	ZFHX3	71385732	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.045000	0.71020	2.823000	0.97156	0.650000	0.86243	CCC		ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
GLG1	2734	hgsc.bcm.edu	37	16	74499607	74499607	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr16:74499607G>C	ENST00000422840.2	-	19	2633	c.2634C>G	c.(2632-2634)taC>taG	p.Y878*	GLG1_ENST00000447066.2_Nonsense_Mutation_p.Y867*|Y_RNA_ENST00000384794.1_RNA|GLG1_ENST00000205061.5_Nonsense_Mutation_p.Y878*	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	878					blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.Y878*(2)		breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						TCATGAGGGTGTAGTCTAGCT	0.478																																					p.Y867X												.	.	2	Substitution - Nonsense(2)	ovary(1)|large_intestine(1)	c.C2601G	16						.						215.0	207.0	210.0					16																	74499607		2198	4300	6498	73057108	SO:0001587	stop_gained	2734	exon18				CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.2634C>G	16.37:g.74499607G>C	ENSP00000405984:p.Tyr878*	Somatic		Capture	SOLID	Phase_I	73057108	NM_001145666	B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Nonsense_Mutation	SNP	ENST00000422840.2	37	CCDS45527.1	.	.	.	.	.	.	.	.	.	.	G	38	6.994491	0.97990	.	.	ENSG00000090863	ENST00000205061;ENST00000447066;ENST00000422840	.	.	.	5.95	-4.71	0.03279	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.4652	15.2551	0.73579	0.4678:0.0:0.5322:0.0	.	.	.	.	X	878;867;878	.	ENSP00000205061:Y878X	Y	-	3	2	GLG1	73057108	0.029000	0.19370	0.939000	0.37840	0.949000	0.60115	-0.881000	0.04179	-0.753000	0.04721	-0.251000	0.11542	TAC		GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000435750.1	NM_012201	
ZNRF1	84937	hgsc.bcm.edu	37	16	75146286	75146286	+	IGR	SNP	G	G	T			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr16:75146286G>T	ENST00000335325.4	+	0	4620				LDHD_ENST00000450168.2_Missense_Mutation_p.Q475K|LDHD_ENST00000300051.4_Missense_Mutation_p.Q498K|RP11-252E2.1_ENST00000499110.1_RNA	NM_032268.4	NP_115644.1	Q8ND25	ZNRF1_HUMAN	zinc and ring finger 1, E3 ubiquitin protein ligase						proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|lysosome (GO:0005764)|membrane (GO:0016020)|synapse (GO:0045202)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Q498K(1)		breast(1)	1						ATGAGGCCTTGGGGGTCTAGC	0.612																																					p.Q498K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1492A	16						.						36.0	38.0	37.0					16																	75146286		2198	4300	6498	73703787	SO:0001628	intergenic_variant	197257	exon11			AF378524	CCDS10912.1	16q22.3	2013-01-09	2012-02-23		ENSG00000186187	ENSG00000186187		"""RING-type (C3HC4) zinc fingers"""	18452	protein-coding gene	gene with protein product		612060	"""zinc and ring finger 1"""				Standard	NM_032268		Approved	nin283, FLJ14846, DKFZp434E229	uc002fdl.1	Q8ND25	OTTHUMG00000137606		16.37:g.75146286G>T		Somatic		Capture	SOLID	Phase_I	73703787	NM_153486	D3DUJ9|Q9H083	Missense_Mutation	SNP	ENST00000335325.4	37	CCDS10912.1	.	.	.	.	.	.	.	.	.	.	G	0.043	-1.276683	0.01410	.	.	ENSG00000166816	ENST00000450168;ENST00000300051	D;D	0.81579	-1.51;-1.51	5.4	3.24	0.37175	Vanillyl-alcohol oxidase, C-terminal subdomain 2 (1);FAD-linked oxidase-like, C-terminal (1);FAD-linked oxidase, C-terminal (1);	1.059150	0.07362	N	0.884290	T	0.49355	0.1552	N	0.00419	-1.52	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.15009	-1.0452	10	0.02654	T	1	1.2829	12.954	0.58416	0.0:0.0:0.5924:0.4076	.	475;498	Q86WU2-2;Q86WU2	.;LDHD_HUMAN	K	475;498	ENSP00000417011:Q475K;ENSP00000300051:Q498K	ENSP00000300051:Q498K	Q	-	1	0	LDHD	73703787	0.954000	0.32549	0.279000	0.24732	0.237000	0.25408	1.806000	0.38892	1.233000	0.43693	0.655000	0.94253	CAA		ZNRF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269020.2		
MED12L	116931	hgsc.bcm.edu	37	3	151083644	151083644	+	Silent	SNP	C	C	T			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr3:151083644C>T	ENST00000474524.1	+	21	3125	c.3087C>T	c.(3085-3087)aaC>aaT	p.N1029N	MED12L_ENST00000273432.4_Silent_p.N889N|P2RY12_ENST00000302632.3_Intron	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	1029						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.N1029N(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CTAGGATTAACGACATAGCCA	0.378																																					p.N1029N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3087T	3						.						105.0	110.0	108.0					3																	151083644		2203	4300	6503	152566334	SO:0001819	synonymous_variant	116931	exon21			AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.3087C>T	3.37:g.151083644C>T		Somatic		Capture	SOLID	Phase_I	152566334	NM_053002	Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Silent	SNP	ENST00000474524.1	37	CCDS33876.1																																																																																				MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357707.2	NM_053002	
ZCWPW2	152098	hgsc.bcm.edu	37	3	28476698	28476698	+	Missense_Mutation	SNP	G	G	A	rs370104321		TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr3:28476698G>A	ENST00000383768.2	+	4	618	c.430G>A	c.(430-432)Gat>Aat	p.D144N	ZCWPW2_ENST00000421010.1_Missense_Mutation_p.D144N			Q504Y3	ZCPW2_HUMAN	zinc finger, CW type with PWWP domain 2	144	PWWP. {ECO:0000255|PROSITE- ProRule:PRU00162}.						zinc ion binding (GO:0008270)	p.D144N(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(6)|ovary(2)	17						ATTCCTGGGCGATCCCCATTC	0.383																																					p.D144N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G430A	3						.	G	ASN/ASP	0,4406		0,0,2203	111.0	114.0	113.0		430	2.9	1.0	3		113	1,8599	1.2+/-3.3	0,1,4299	no	missense	ZCWPW2	NM_001040432.1	23	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	144/357	28476698	1,13005	2203	4300	6503	28451702	SO:0001583	missense	152098	exon3			BC065764	CCDS33723.1	3p23	2005-08-22			ENSG00000206559	ENSG00000206559			23574	protein-coding gene	gene with protein product						14607086	Standard	XM_005264892		Approved	ZCW2	uc003cei.3	Q504Y3	OTTHUMG00000155705	ENST00000383768.2:c.430G>A	3.37:g.28476698G>A	ENSP00000373278:p.Asp144Asn	Somatic		Capture	SOLID	Phase_I	28451702	NM_001040432		Missense_Mutation	SNP	ENST00000383768.2	37	CCDS33723.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.17|14.17	2.455621|2.455621	0.43634|0.43634	0.0|0.0	1.16E-4|1.16E-4	ENSG00000206559|ENSG00000206559	ENST00000383768;ENST00000421010|ENST00000428875	T;T|.	0.73047|.	-0.71;-0.71|.	6.06|6.06	2.88|2.88	0.33553|0.33553	PWWP (2);|.	0.386348|.	0.25613|.	N|.	0.029471|.	T|T	0.31420|0.31420	0.0796|0.0796	L|L	0.29908|0.29908	0.895|0.895	0.27918|0.27918	N|N	0.938353|0.938353	B|.	0.28470|.	0.213|.	B|.	0.26517|.	0.07|.	T|T	0.20273|0.20273	-1.0280|-1.0280	9|5	.|.	.|.	.|.	-10.0984|-10.0984	6.6991|6.6991	0.23215|0.23215	0.1771:0.1518:0.6711:0.0|0.1771:0.1518:0.6711:0.0	.|.	144|.	Q504Y3|.	ZCPW2_HUMAN|.	N|Q	144|127	ENSP00000373278:D144N;ENSP00000412386:D144N|.	.|.	D|R	+|+	1|2	0|0	ZCWPW2|ZCWPW2	28451702|28451702	0.995000|0.995000	0.38212|0.38212	0.988000|0.988000	0.46212|0.46212	0.967000|0.967000	0.64934|0.64934	1.073000|1.073000	0.30691|0.30691	0.881000|0.881000	0.35993|0.35993	0.650000|0.650000	0.86243|0.86243	GAT|CGA		ZCWPW2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341318.1	XM_087384	
MASP1	5648	hgsc.bcm.edu	37	3	186961369	186961369	+	Silent	SNP	C	C	A			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr3:186961369C>A	ENST00000337774.5	-	9	1520	c.1131G>T	c.(1129-1131)ctG>ctT	p.L377L	MASP1_ENST00000392472.2_Silent_p.L264L|MASP1_ENST00000296280.6_Silent_p.L377L|MASP1_ENST00000495249.1_Intron	NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)	377	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)	p.L377L(2)		NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		AGAAGGTGATCAGCCCGTGTT	0.478																																					p.L377L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1131T	3						.						219.0	202.0	208.0					3																	186961369		2203	4300	6503	188444063	SO:0001819	synonymous_variant	5648	exon9			D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.1131G>T	3.37:g.186961369C>A		Somatic		Capture	SOLID	Phase_I	188444063	NM_139125	A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Silent	SNP	ENST00000337774.5	37	CCDS33907.1																																																																																				MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344262.1	NM_001879	
UTP20	27340	hgsc.bcm.edu	37	12	101679365	101679365	+	Silent	SNP	T	T	C			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr12:101679365T>C	ENST00000261637.4	+	3	318	c.144T>C	c.(142-144)ttT>ttC	p.F48F		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	48					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)	p.F48F(1)		NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						AAACCTACTTTTTTGAGGGTC	0.308																																					p.F48F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T144C	12						.						121.0	122.0	121.0					12																	101679365		2203	4300	6503	100203496	SO:0001819	synonymous_variant	27340	exon3			AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.144T>C	12.37:g.101679365T>C		Somatic		Capture	SOLID	Phase_I	100203496	NM_014503	Q9H3H4	Silent	SNP	ENST00000261637.4	37	CCDS9081.1																																																																																				UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408242.1	NM_014503	
ACAD10	80724	hgsc.bcm.edu	37	12	112174763	112174763	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr12:112174763C>T	ENST00000313698.4	+	12	1824	c.1669C>T	c.(1669-1671)Cgt>Tgt	p.R557C	ACAD10_ENST00000455480.2_Missense_Mutation_p.R588C|ACAD10_ENST00000413681.3_3'UTR|ACAD10_ENST00000549590.1_Missense_Mutation_p.R557C|ACAD10_ENST00000392636.2_Missense_Mutation_p.R159C	NM_025247.5	NP_079523.3	Q6JQN1	ACD10_HUMAN	acyl-CoA dehydrogenase family, member 10	557						mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|hydrolase activity (GO:0016787)|transferase activity, transferring phosphorus-containing groups (GO:0016772)	p.R557C(2)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(17)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(5)	47						TTCCTTTTTCCGTGTGGCTGC	0.532																																					p.R557C												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C1669T	12						.						122.0	111.0	114.0					12																	112174763		2203	4300	6503	110659146	SO:0001583	missense	80724	exon12			AY323912	CCDS31903.1, CCDS44973.1	12q24.12	2012-10-02	2010-04-30		ENSG00000111271	ENSG00000111271			21597	protein-coding gene	gene with protein product		611181	"""acyl-Coenzyme A dehydrogenase family, member 10"""			15560374	Standard	NM_025247		Approved	MGC5601	uc009zvx.3	Q6JQN1	OTTHUMG00000169602	ENST00000313698.4:c.1669C>T	12.37:g.112174763C>T	ENSP00000325137:p.Arg557Cys	Somatic		Capture	SOLID	Phase_I	110659146	NM_025247	G3XAJ0|Q8N828|Q8NAP2|Q96BX5	Missense_Mutation	SNP	ENST00000313698.4	37	CCDS31903.1	.	.	.	.	.	.	.	.	.	.	C	17.75	3.465647	0.63513	.	.	ENSG00000111271	ENST00000392636;ENST00000413681;ENST00000549590;ENST00000455480;ENST00000313698	T;T;T;T	0.38077	1.16;1.16;1.16;1.16	5.29	5.29	0.74685	Protein kinase-like domain (1);	0.112167	0.56097	D	0.000022	T	0.66906	0.2837	M	0.92122	3.275	0.54753	D	0.999987	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.965;0.942	T	0.73936	-0.3825	10	0.62326	D	0.03	.	11.9504	0.52952	0.2909:0.7091:0.0:0.0	.	588;557;557	G3XAJ0;Q6JQN1;Q6JQN1-2	.;ACD10_HUMAN;.	C	159;557;557;588;557	ENSP00000376411:R159C;ENSP00000446959:R557C;ENSP00000389813:R588C;ENSP00000325137:R557C	ENSP00000325137:R557C	R	+	1	0	ACAD10	110659146	1.000000	0.71417	0.997000	0.53966	0.650000	0.38633	1.984000	0.40658	2.483000	0.83821	0.561000	0.74099	CGT		ACAD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368307.1	NM_025247	
BCL7A	605	hgsc.bcm.edu	37	12	122497027	122497027	+	Missense_Mutation	SNP	G	G	C			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr12:122497027G>C	ENST00000261822.4	+	6	797	c.591G>C	c.(589-591)aaG>aaC	p.K197N	BCL7A_ENST00000538010.1_Missense_Mutation_p.K218N	NM_001024808.1	NP_001019979.1	Q4VC05	BCL7A_HUMAN	B-cell CLL/lymphoma 7A	197					negative regulation of transcription, DNA-templated (GO:0045892)			p.K218N(1)		haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000202)|Epithelial(86;0.000386)|BRCA - Breast invasive adenocarcinoma(302;0.231)		CCTCTAAAAAGATGAAACTGG	0.493			T	MYC	BNHL																																p.K218N	GBM(17;197 467 16477 23242 44349)		Dom	yes		12	12q24.1	605	B-cell CLL/lymphoma 7A		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G654C	12						.						83.0	80.0	81.0					12																	122497027		2203	4300	6503	120981410	SO:0001583	missense	605	exon6			X89984	CCDS9226.1, CCDS53841.1	12q24.1	2008-07-03			ENSG00000110987	ENSG00000110987			1004	protein-coding gene	gene with protein product		601406		BCL7		8605326, 9931421	Standard	NM_020993		Approved		uc001ubo.3	Q4VC05	OTTHUMG00000168951	ENST00000261822.4:c.591G>C	12.37:g.122497027G>C	ENSP00000261822:p.Lys197Asn	Somatic		Capture	SOLID	Phase_I	120981410	NM_020993	B4DJN6|B7ZB21|Q13843|Q14CT7	Missense_Mutation	SNP	ENST00000261822.4	37	CCDS53841.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.165145	0.78339	.	.	ENSG00000110987	ENST00000538010;ENST00000261822	T;T	0.60040	0.22;0.32	5.47	5.47	0.80525	.	0.358862	0.30979	N	0.008490	T	0.64571	0.2610	L	0.29908	0.895	0.58432	D	0.999997	D;P	0.71674	0.998;0.925	D;P	0.78314	0.991;0.621	T	0.67393	-0.5682	10	0.87932	D	0	.	12.646	0.56735	0.0759:0.0:0.9241:0.0	.	197;218	Q4VC05;Q4VC05-2	BCL7A_HUMAN;.	N	218;197	ENSP00000445868:K218N;ENSP00000261822:K197N	ENSP00000261822:K197N	K	+	3	2	BCL7A	120981410	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	5.055000	0.64282	2.549000	0.85964	0.655000	0.94253	AAG		BCL7A-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000401712.1		
ZNF664	144348	hgsc.bcm.edu	37	12	124497333	124497333	+	Silent	SNP	G	G	C			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr12:124497333G>C	ENST00000539644.1	+	6	2472	c.642G>C	c.(640-642)ctG>ctC	p.L214L	ZNF664_ENST00000538932.2_Silent_p.L214L|FAM101A_ENST00000545615.1_Intron|ZNF664_ENST00000337815.4_Silent_p.L214L|ZNF664_ENST00000392404.3_Silent_p.L214L			Q8N3J9	ZN664_HUMAN	zinc finger protein 664	214					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L214L(1)		breast(1)|large_intestine(5)|lung(6)|skin(1)	13	all_neural(191;0.101)|Medulloblastoma(191;0.163)			Epithelial(86;0.000239)|OV - Ovarian serous cystadenocarcinoma(86;0.000247)|all cancers(50;0.00155)|BRCA - Breast invasive adenocarcinoma(302;0.249)		GTTCGAGCCTGTGCATCCACC	0.527																																					p.L214L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G642C	12						.						102.0	102.0	102.0					12																	124497333		2203	4300	6503	123063286	SO:0001819	synonymous_variant	144348	exon6				CCDS9257.1	12q24.31	2013-05-10			ENSG00000179195	ENSG00000179195		"""Zinc fingers, C2H2-type"""	25406	protein-coding gene	gene with protein product			"""zinc finger protein 176"""	ZNF176		12477932	Standard	NM_001204298		Approved	ZFOC1, DKFZp761B128	uc001uga.3	Q8N3J9	OTTHUMG00000168596	ENST00000539644.1:c.642G>C	12.37:g.124497333G>C		Somatic		Capture	SOLID	Phase_I	123063286	NM_152437	B3KP97|Q15914|Q3ZCQ7	Silent	SNP	ENST00000539644.1	37	CCDS9257.1																																																																																				ZNF664-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400365.1	NM_152437	
UBC	7316	hgsc.bcm.edu	37	12	125398021	125398021	+	Silent	SNP	G	G	A	rs376386473		TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr12:125398021G>A	ENST00000538617.1	-	3	613	c.297C>T	c.(295-297)atC>atT	p.I99I	UBC_ENST00000339647.5_Silent_p.I99I|UBC_ENST00000536769.1_Silent_p.I99I|UBC_ENST00000536661.1_5'Flank|MIR5188_ENST00000583467.1_RNA|UBC_ENST00000546120.1_Silent_p.I99I			P0CG48	UBC_HUMAN	ubiquitin C	479	Ubiquitin-like 2. {ECO:0000255|PROSITE- ProRule:PRU00214}.				activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protease binding (GO:0002020)	p.I99I(1)		breast(3)|endometrium(4)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		TGACGTTCTCGATGGTGTCAC	0.557																																					p.I99I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C297T	12						.	G		0,4406		0,0,2203	288.0	249.0	262.0		297	-4.9	1.0	12		262	1,8599		0,1,4299	no	coding-synonymous	UBC	NM_021009.5		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		99/686	125398021	1,13005	2203	4300	6503	123963974	SO:0001819	synonymous_variant	7316	exon2				CCDS9260.1	12q24.3	2008-09-08			ENSG00000150991	ENSG00000150991			12468	protein-coding gene	gene with protein product	"""polyubiquitin-C"""	191340				1315303, 11872750	Standard	NM_021009		Approved		uc001ugs.4	P0CG48		ENST00000538617.1:c.297C>T	12.37:g.125398021G>A		Somatic		Capture	SOLID	Phase_I	123963974	NM_021009	P02248|P02249|P02250|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Silent	SNP	ENST00000538617.1	37																																																																																					UBC-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000400179.1	NM_021009	
KCNA1	3736	hgsc.bcm.edu	37	12	5021790	5021790	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr12:5021790C>T	ENST00000382545.3	+	2	2353	c.1246C>T	c.(1246-1248)Cac>Tac	p.H416Y	KCNA1_ENST00000543874.2_Intron	NM_000217.2	NP_000208.2	Q09470	KCNA1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)	416					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|juxtaparanode region of axon (GO:0044224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)	p.H416Y(1)		NS(1)|breast(3)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(23)|ovary(3)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63					Amitriptyline(DB00321)|Dalfampridine(DB06637)|Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Nifedipine(DB01115)|Sevoflurane(DB01236)	CTATTTCTACCACCGAGAAAC	0.522																																					p.H416Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1246T	12						.						253.0	254.0	254.0					12																	5021790		2203	4300	6503	4892051	SO:0001583	missense	3736	exon2			L02750	CCDS8535.1	12p13	2012-07-05			ENSG00000111262	ENSG00000111262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6218	protein-coding gene	gene with protein product		176260		AEMK		1349297, 8821794, 16382104	Standard	NM_000217		Approved	Kv1.1, RBK1, HUK1, MBK1	uc001qnh.3	Q09470	OTTHUMG00000044398	ENST00000382545.3:c.1246C>T	12.37:g.5021790C>T	ENSP00000371985:p.His416Tyr	Somatic		Capture	SOLID	Phase_I	4892051	NM_000217	A6NM83|Q3MIQ9	Missense_Mutation	SNP	ENST00000382545.3	37	CCDS8535.1	.	.	.	.	.	.	.	.	.	.	C	15.28	2.787722	0.49997	.	.	ENSG00000111262	ENST00000382545;ENST00000228858	D	0.96619	-4.07	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	D	0.98160	0.9392	M	0.90019	3.08	0.80722	D	1	D	0.60575	0.988	P	0.60473	0.875	D	0.98722	1.0709	10	0.62326	D	0.03	.	17.6066	0.88040	0.0:1.0:0.0:0.0	.	416	Q09470	KCNA1_HUMAN	Y	416	ENSP00000371985:H416Y	ENSP00000228858:H416Y	H	+	1	0	KCNA1	4892051	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.651000	0.83577	2.691000	0.91804	0.655000	0.94253	CAC		KCNA1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103343.2	NM_000217	
PTPRO	5800	hgsc.bcm.edu	37	12	15673190	15673190	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr12:15673190C>T	ENST00000281171.4	+	10	2165	c.1835C>T	c.(1834-1836)aCg>aTg	p.T612M	PTPRO_ENST00000348962.2_Missense_Mutation_p.T612M	NM_030667.2	NP_109592.1	Q16827	PTPRO_HUMAN	protein tyrosine phosphatase, receptor type, O	612	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell morphogenesis (GO:0000902)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|lamellipodium assembly (GO:0030032)|monocyte chemotaxis (GO:0002548)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron projection development (GO:0010977)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of glomerular filtration (GO:0003093)|slit diaphragm assembly (GO:0036060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)|Wnt-protein binding (GO:0017147)	p.T612M(1)		NS(2)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(11)|lung(30)|ovary(2)|prostate(1)|skin(17)|upper_aerodigestive_tract(1)	74		Hepatocellular(102;0.244)				ACCATGGTGACGTGGGGAGAT	0.478																																					p.T612M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1835T	12						.						139.0	127.0	131.0					12																	15673190		2203	4300	6503	15564457	SO:0001583	missense	5800	exon10			U20489	CCDS8674.1, CCDS8675.1, CCDS44837.1, CCDS53754.1	12p13-p12	2013-02-11			ENSG00000151490	ENSG00000151490		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9678	protein-coding gene	gene with protein product	"""osteoclastic transmembrane protein-tyrosine phosphatase"""	600579				7519601, 7665166, 21722858	Standard	NM_030667		Approved	PTPU2, GLEPP1, PTP-U2, PTP-oc, NPHS6	uc001rcv.2	Q16827	OTTHUMG00000168786	ENST00000281171.4:c.1835C>T	12.37:g.15673190C>T	ENSP00000281171:p.Thr612Met	Somatic		Capture	SOLID	Phase_I	15564457	NM_002848	A0AV39|Q13101|Q8IYG3|Q9UBF0|Q9UBT5	Missense_Mutation	SNP	ENST00000281171.4	37	CCDS8675.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.540150	0.85917	.	.	ENSG00000151490	ENST00000281171;ENST00000348962	T;T	0.58940	0.3;0.3	5.2	5.2	0.72013	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.51477	D	0.000084	T	0.65883	0.2734	L	0.27053	0.805	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.974	T	0.69514	-0.5125	10	0.87932	D	0	.	17.0929	0.86627	0.0:1.0:0.0:0.0	.	612;612	Q16827-2;Q16827	.;PTPRO_HUMAN	M	612	ENSP00000281171:T612M;ENSP00000343434:T612M	ENSP00000281171:T612M	T	+	2	0	PTPRO	15564457	1.000000	0.71417	0.987000	0.45799	0.986000	0.74619	6.978000	0.76147	2.689000	0.91719	0.655000	0.94253	ACG		PTPRO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401079.1		
KRAS	3845	hgsc.bcm.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12V	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35T	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	12.37:g.25398284C>A	ENSP00000256078:p.Gly12Val	Somatic		Capture	SOLID	Phase_I	25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
TUBA1C	84790	hgsc.bcm.edu	37	12	49666152	49666152	+	Silent	SNP	G	G	A	rs199599214	byFrequency	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr12:49666152G>A	ENST00000301072.6	+	4	767	c.492G>A	c.(490-492)aaG>aaA	p.K164K	RP11-161H23.5_ENST00000550468.2_RNA|TUBA1C_ENST00000541364.1_Silent_p.K234K	NM_032704.3	NP_116093.1	Q9BQE3	TBA1C_HUMAN	tubulin, alpha 1c	164					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.K164K(1)		endometrium(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)	13						ATGGCAAGAAGTCCAAGCTGG	0.547																																					p.K164K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G492A	12						.						56.0	58.0	57.0					12																	49666152		2203	4300	6503	47952419	SO:0001819	synonymous_variant	84790	exon4			BC004949	CCDS8782.1	12q13.12	2007-03-16	2007-02-12	2007-02-12		ENSG00000167553		"""Tubulins"""	20768	protein-coding gene	gene with protein product			"""tubulin, alpha 6"""	TUBA6		7821789	Standard	NM_032704		Approved	MGC14580, MGC10851, bcm948	uc001rtt.1	Q9BQE3		ENST00000301072.6:c.492G>A	12.37:g.49666152G>A		Somatic		Capture	SOLID	Phase_I	47952419	NM_032704		Silent	SNP	ENST00000301072.6	37	CCDS8782.1																																																																																				TUBA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404424.1	NM_032704	
KRT80	144501	hgsc.bcm.edu	37	12	52567500	52567500	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr12:52567500C>T	ENST00000394815.2	-	5	812	c.715G>A	c.(715-717)Ggc>Agc	p.G239S	KRT80_ENST00000313234.5_Missense_Mutation_p.G239S	NM_182507.2	NP_872313.2	Q6KB66	K2C80_HUMAN	keratin 80	239	Linker 12.|Rod.					cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.G274S(1)		endometrium(2)|large_intestine(2)|lung(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.108)		CTGTCCATGCCGACGGTCACC	0.672																																					p.G239S	GBM(178;2309 2916 15678 35873)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G715A	12						.						72.0	58.0	63.0					12																	52567500		2200	4298	6498	50853767	SO:0001583	missense	144501	exon5			BX537567	CCDS8821.2, CCDS41784.1	12q13.13	2013-01-16			ENSG00000167767	ENSG00000167767		"""-"", ""Intermediate filaments type II, keratins (basic)"""	27056	protein-coding gene	gene with protein product		611161				16831889	Standard	NM_001081492		Approved	KB20	uc001rzx.3	Q6KB66	OTTHUMG00000150193	ENST00000394815.2:c.715G>A	12.37:g.52567500C>T	ENSP00000378292:p.Gly239Ser	Somatic		Capture	SOLID	Phase_I	50853767	NM_182507	Q6P1A5|Q7Z3Q0	Missense_Mutation	SNP	ENST00000394815.2	37	CCDS8821.2	.	.	.	.	.	.	.	.	.	.	c	3.988	-0.005045	0.07773	.	.	ENSG00000167767	ENST00000313234;ENST00000394815	D;D	0.87729	-2.29;-2.29	4.23	2.41	0.29592	Filament (1);	0.609592	0.13696	N	0.369141	T	0.29491	0.0735	N	0.00000	-4.025	0.24406	N	0.994681	B;B;B	0.31817	0.135;0.037;0.341	B;B;B	0.19148	0.016;0.02;0.024	T	0.59558	-0.7432	10	0.02654	T	1	.	5.4572	0.16598	0.2653:0.5798:0.0:0.1549	.	239;239;274	Q6KB66-2;Q6KB66;Q6KB66-3	.;K2C80_HUMAN;.	S	239	ENSP00000369361:G239S;ENSP00000378292:G239S	ENSP00000369361:G239S	G	-	1	0	KRT80	50853767	0.838000	0.29461	0.102000	0.21198	0.210000	0.24377	1.087000	0.30865	0.571000	0.29365	-0.215000	0.12644	GGC		KRT80-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000316757.1	NM_182507	
KRT81	3887	hgsc.bcm.edu	37	12	52680262	52680262	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr12:52680262C>T	ENST00000327741.5	-	9	1363	c.1295G>A	c.(1294-1296)cGg>cAg	p.R432Q	KRT86_ENST00000544024.1_Intron|KRT86_ENST00000423955.2_Intron	NM_002281.3	NP_002272.2	Q14533	KRT81_HUMAN	keratin 81	432	Tail.					extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.R432Q(1)		breast(2)|endometrium(3)|large_intestine(3)|lung(6)|prostate(1)|stomach(1)	16				BRCA - Breast invasive adenocarcinoma(357;0.189)		GACCCCGCCCCGGGAGCTGCT	0.652																																					p.R432Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1295A	12						.						9.0	12.0	11.0					12																	52680262		2142	4200	6342	50966529	SO:0001583	missense	3887	exon9			X81420	CCDS31805.1	12q13	2013-01-16	2006-07-17	2006-07-17	ENSG00000205426	ENSG00000205426		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6458	protein-coding gene	gene with protein product	"""hard keratin type II 1"""	602153	"""keratin, hair, basic, 1"""	KRTHB1		7556444, 16831889	Standard	NM_002281		Approved	Hb-1	uc001sab.3	Q14533	OTTHUMG00000167574	ENST00000327741.5:c.1295G>A	12.37:g.52680262C>T	ENSP00000369349:p.Arg432Gln	Somatic		Capture	SOLID	Phase_I	50966529	NM_002281	Q14846|Q16274|Q17R48|Q8WU52|Q9BR74	Missense_Mutation	SNP	ENST00000327741.5	37	CCDS31805.1	.	.	.	.	.	.	.	.	.	.	C	15.70	2.910675	0.52439	.	.	ENSG00000205426	ENST00000327741;ENST00000389388	D	0.81579	-1.51	4.76	3.87	0.44632	.	0.000000	0.37219	U	0.002197	T	0.76364	0.3977	M	0.72894	2.215	0.28981	N	0.888635	B	0.27656	0.184	B	0.22152	0.038	T	0.68232	-0.5463	10	0.31617	T	0.26	.	10.6206	0.45478	0.0:0.9072:0.0:0.0928	.	432	Q14533	KRT81_HUMAN	Q	432	ENSP00000369349:R432Q	ENSP00000369349:R432Q	R	-	2	0	KRT81	50966529	0.390000	0.25213	0.973000	0.42090	0.895000	0.52256	0.613000	0.24299	1.123000	0.41961	0.456000	0.33151	CGG		KRT81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395128.2	NM_002281	
EEA1	8411	hgsc.bcm.edu	37	12	93213183	93213183	+	Silent	SNP	T	T	C			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr12:93213183T>C	ENST00000322349.8	-	14	1893	c.1629A>G	c.(1627-1629)gaA>gaG	p.E543E		NM_003566.3	NP_003557	Q15075	EEA1_HUMAN	early endosome antigen 1	543	Gln/Glu/Lys-rich.				early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|synaptic vesicle to endosome fusion (GO:0016189)|vesicle fusion (GO:0006906)	axonal spine (GO:0044308)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|recycling endosome (GO:0055037)|serine-pyruvate aminotransferase complex (GO:0005969)	1-phosphatidylinositol binding (GO:0005545)|calmodulin binding (GO:0005516)|GTP-dependent protein binding (GO:0030742)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)	p.E543E(1)		endometrium(5)|kidney(5)|large_intestine(11)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	36						CTCTTTCTTTTTCTAGTAATG	0.353																																					p.E543E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1629G	12						.						63.0	64.0	64.0					12																	93213183		2201	4298	6499	91737314	SO:0001819	synonymous_variant	8411	exon14			L40157	CCDS31874.1	12q22	2007-02-23	2007-02-23			ENSG00000102189		"""Zinc fingers, FYVE domain containing"""	3185	protein-coding gene	gene with protein product		605070	"""early endosome antigen 1, 162kD"""			7768953, 9697774	Standard	NM_003566		Approved	ZFYVE2	uc001tck.3	Q15075	OTTHUMG00000170110	ENST00000322349.8:c.1629A>G	12.37:g.93213183T>C		Somatic		Capture	SOLID	Phase_I	91737314	NM_003566	Q14221	Silent	SNP	ENST00000322349.8	37	CCDS31874.1																																																																																				EEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407304.1	NM_003566	
ZNF10	7556	hgsc.bcm.edu	37	12	133732214	133732214	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr12:133732214G>A	ENST00000248211.6	+	5	604	c.382G>A	c.(382-384)Gaa>Aaa	p.E128K	ZNF10_ENST00000402932.2_Missense_Mutation_p.E128K|CTD-2140B24.4_ENST00000540096.2_Missense_Mutation_p.E128K|ZNF268_ENST00000416488.1_Missense_Mutation_p.E128K|ZNF10_ENST00000426665.2_Missense_Mutation_p.E128K	NM_015394.4	NP_056209.2	P21506	ZNF10_HUMAN	zinc finger protein 10	128					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E128K(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|prostate(1)|skin(5)|urinary_tract(1)	26	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;1.28e-06)|all_epithelial(31;0.0051)|Lung NSC(355;0.00948)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		GTCATTAGAAGAAGTCTGGAA	0.393																																					p.E128K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G382A	12						.						95.0	91.0	92.0					12																	133732214		2203	4300	6503	132242287	SO:0001583	missense	7556	exon5			X52332, BC024182	CCDS9283.1	12q24.33	2013-01-08	2005-05-22		ENSG00000256223	ENSG00000256223		"""Zinc fingers, C2H2-type"", ""-"""	12879	protein-coding gene	gene with protein product		194538	"""zinc finger protein 10 (KOX 1)"""			7865130, 8262519	Standard	NM_015394		Approved	KOX1	uc001ulq.3	P21506	OTTHUMG00000167944	ENST00000248211.6:c.382G>A	12.37:g.133732214G>A	ENSP00000248211:p.Glu128Lys	Somatic		Capture	SOLID	Phase_I	132242287	NM_015394	B2RBS1|Q8TC91	Missense_Mutation	SNP	ENST00000248211.6	37	CCDS9283.1	.	.	.	.	.	.	.	.	.	.	G	17.56	3.420328	0.62622	.	.	ENSG00000256223;ENSG00000256223;ENSG00000256223;ENSG00000256223;ENSG00000090612	ENST00000248211;ENST00000426665;ENST00000402932;ENST00000537119;ENST00000416488	T;T;T;T;T	0.05580	3.42;3.42;3.61;4.51;5.74	4.44	3.55	0.40652	.	0.561058	0.14935	N	0.289873	T	0.04543	0.0124	L	0.27053	0.805	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.37430	-0.9706	9	.	.	.	.	6.8384	0.23949	0.2065:0.0:0.7935:0.0	.	128	P21506	ZNF10_HUMAN	K	128;128;128;86;128	ENSP00000248211:E128K;ENSP00000393814:E128K;ENSP00000384893:E128K;ENSP00000437397:E86K;ENSP00000409295:E128K	.	E	+	1	0	ZNF10;ZNF268	132242287	0.001000	0.12720	1.000000	0.80357	0.995000	0.86356	0.452000	0.21795	1.224000	0.43551	0.655000	0.94253	GAA		ZNF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397182.1	NM_015394	
EDC3	80153	hgsc.bcm.edu	37	15	74927838	74927838	+	Silent	SNP	C	C	A			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr15:74927838C>A	ENST00000315127.4	-	6	1285	c.1104G>T	c.(1102-1104)ctG>ctT	p.L368L	EDC3_ENST00000568176.1_Silent_p.L368L|EDC3_ENST00000426797.3_Silent_p.L368L	NM_001142444.1|NM_025083.3	NP_001135916.1|NP_079359.2	Q96F86	EDC3_HUMAN	enhancer of mRNA decapping 3	368	YjeF N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00719}.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)|membrane (GO:0016020)	identical protein binding (GO:0042802)|RNA binding (GO:0003723)	p.L368L(1)		breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	16						CAAAATTGGGCAGGAAAAGGA	0.507											OREG0023287	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L368L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1104T	15						.						178.0	143.0	155.0					15																	74927838		2197	4296	6493	72714891	SO:0001819	synonymous_variant	80153	exon7			BC011534	CCDS10267.1	15q24.1	2013-05-02	2013-05-02	2006-07-07	ENSG00000179151	ENSG00000179151			26114	protein-coding gene	gene with protein product		609842	"""yjeF domain containing (E.coli)"", ""LSM16 homolog (EDC3, S. cerevisiae)"", ""enhancer of mRNA decapping 3 homolog (S. cerevisiae)"""	YJDC, LSM16		15225602, 17533573, 22483619	Standard	NM_025083		Approved	FLJ21128, hYjeF_N2-15q23, YJEFN2	uc002aym.3	Q96F86	OTTHUMG00000142815	ENST00000315127.4:c.1104G>T	15.37:g.74927838C>A		Somatic	1156	Capture	SOLID	Phase_I	72714891	NM_001142444	B3KPH0|D3DW61|Q9H797	Silent	SNP	ENST00000315127.4	37	CCDS10267.1																																																																																				EDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286399.1	NM_025083	
NTRK3	4916	hgsc.bcm.edu	37	15	88679134	88679134	+	Silent	SNP	G	G	C			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr15:88679134G>C	ENST00000360948.2	-	8	1064	c.903C>G	c.(901-903)gtC>gtG	p.V301V	NTRK3_ENST00000558676.1_Silent_p.V301V|NTRK3_ENST00000394480.2_Silent_p.V301V|NTRK3_ENST00000542733.2_Silent_p.V203V|NTRK3_ENST00000557856.1_Silent_p.V301V|NTRK3_ENST00000355254.2_Silent_p.V301V|NTRK3_ENST00000540489.2_Silent_p.V301V|NTRK3_ENST00000357724.2_Silent_p.V301V|NTRK3_ENST00000317501.3_Silent_p.V301V	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	301					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.V301V(3)	ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			ACTTACAGTAGACAGTGAGGG	0.557			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																											p.V301V			Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.C903G	15						.						168.0	104.0	126.0					15																	88679134		2201	4299	6500	86480138	SO:0001819	synonymous_variant	4916	exon8			U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.903C>G	15.37:g.88679134G>C		Somatic		Capture	SOLID	Phase_I	86480138	NM_001007156	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Silent	SNP	ENST00000360948.2	37	CCDS32322.1																																																																																				NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding			
USP38	84640	hgsc.bcm.edu	37	4	144135083	144135083	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr4:144135083G>A	ENST00000307017.4	+	9	2460	c.1954G>A	c.(1954-1956)Ggt>Agt	p.G652S	USP38_ENST00000510377.1_Missense_Mutation_p.G652S	NM_032557.5	NP_115946.2	Q8NB14	UBP38_HUMAN	ubiquitin specific peptidase 38	652	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)	p.G652S(1)		breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	33	all_hematologic(180;0.158)					CTCTGTACCCGGTCCTTCAGA	0.438																																					p.G652S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1954A	4						.						171.0	189.0	183.0					4																	144135083		2203	4299	6502	144354533	SO:0001583	missense	84640	exon9			AF211481	CCDS3758.1	4q31.1	2008-02-05	2005-08-08		ENSG00000170185	ENSG00000170185		"""Ubiquitin-specific peptidases"""	20067	protein-coding gene	gene with protein product			"""ubiquitin specific protease 38"""			12838346	Standard	NM_032557		Approved	KIAA1891, HP43.8KD	uc003ijb.3	Q8NB14	OTTHUMG00000161420	ENST00000307017.4:c.1954G>A	4.37:g.144135083G>A	ENSP00000303434:p.Gly652Ser	Somatic		Capture	SOLID	Phase_I	144354533	NM_032557	B3KX93|Q3ZCV1|Q8NDF5|Q96DK6|Q96PZ6|Q9BY55	Missense_Mutation	SNP	ENST00000307017.4	37	CCDS3758.1	.	.	.	.	.	.	.	.	.	.	G	1.043	-0.678157	0.03378	.	.	ENSG00000170185	ENST00000510377;ENST00000307017	T;T	0.07444	3.19;3.19	5.52	2.87	0.33458	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.711693	0.13912	N	0.354164	T	0.06188	0.0160	L	0.27053	0.805	0.09310	N	1	B;B	0.14438	0.01;0.01	B;B	0.12156	0.004;0.007	T	0.43829	-0.9367	10	0.11794	T	0.64	-14.3679	11.0821	0.48066	0.2706:0.0:0.7294:0.0	.	652;652	Q8NB14;Q3ZCV1	UBP38_HUMAN;.	S	652	ENSP00000427647:G652S;ENSP00000303434:G652S	ENSP00000303434:G652S	G	+	1	0	USP38	144354533	0.095000	0.21747	0.000000	0.03702	0.058000	0.15608	0.764000	0.26532	0.292000	0.22492	-1.316000	0.01300	GGT		USP38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364869.1	NM_032557	
NPY2R	4887	hgsc.bcm.edu	37	4	156135125	156135125	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr4:156135125C>A	ENST00000329476.3	+	2	523	c.34C>A	c.(34-36)Cag>Aag	p.Q12K	NPY2R_ENST00000506608.1_Missense_Mutation_p.Q12K	NM_000910.2	NP_000901.1	P49146	NPY2R_HUMAN	neuropeptide Y receptor Y2	12					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral fear response (GO:0001662)|cardiac left ventricle morphogenesis (GO:0003214)|locomotory behavior (GO:0007626)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neurological system process (GO:0031645)|negative regulation of secretion (GO:0051048)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuropeptide signaling pathway (GO:0007218)|nitric oxide mediated signal transduction (GO:0007263)|outflow tract morphogenesis (GO:0003151)|positive regulation of cell adhesion (GO:0045785)|positive regulation of circadian sleep/wake cycle, non-REM sleep (GO:0046010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of peptide secretion (GO:0002793)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of sensory perception of pain (GO:0051930)|secretion (GO:0046903)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|neuropeptide Y receptor activity (GO:0004983)|peptide YY receptor activity (GO:0001601)|receptor activity (GO:0004872)	p.Q12K(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(17)|prostate(1)|skin(5)|urinary_tract(1)	36	all_hematologic(180;0.24)	Renal(120;0.0854)			Cysteamine(DB00847)	TGATGAGAACCAGACAGTGGA	0.463																																					p.Q12K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C34A	4						.						128.0	122.0	124.0					4																	156135125		2203	4300	6503	156354575	SO:0001583	missense	4887	exon2			U42766	CCDS3791.1	4q31	2012-08-08				ENSG00000185149		"""GPCR / Class A : Neuropeptide receptors : Y"""	7957	protein-coding gene	gene with protein product		162642				7559383	Standard	NM_000910		Approved		uc003ioq.3	P49146		ENST00000329476.3:c.34C>A	4.37:g.156135125C>A	ENSP00000332591:p.Gln12Lys	Somatic		Capture	SOLID	Phase_I	156354575	NM_000910	Q13281|Q13457|Q4W5G7|Q6AZZ6|Q9UE67	Missense_Mutation	SNP	ENST00000329476.3	37	CCDS3791.1	.	.	.	.	.	.	.	.	.	.	C	9.622	1.134204	0.21123	.	.	ENSG00000185149	ENST00000329476;ENST00000506608	T;T	0.69306	-0.39;-0.39	5.4	4.54	0.55810	.	0.297839	0.32802	N	0.005637	T	0.53351	0.1791	L	0.41236	1.265	0.28800	N	0.898811	B	0.06786	0.001	B	0.04013	0.001	T	0.42275	-0.9461	10	0.16420	T	0.52	.	10.4246	0.44369	0.1515:0.7025:0.146:0.0	.	12	P49146	NPY2R_HUMAN	K	12	ENSP00000332591:Q12K;ENSP00000426366:Q12K	ENSP00000332591:Q12K	Q	+	1	0	NPY2R	156354575	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.544000	0.36158	1.362000	0.46000	0.637000	0.83480	CAG		NPY2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365128.1	NM_000910	
EVC2	132884	hgsc.bcm.edu	37	4	5633668	5633670	+	In_Frame_Del	DEL	TCT	TCT	-			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	TCT	TCT	TCT	-	TCT	TCT	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr4:5633668_5633670delTCT	ENST00000344408.5	-	11	1613_1615	c.1560_1562delAGA	c.(1558-1563)gaagac>gac	p.E520del	EVC2_ENST00000344938.1_In_Frame_Del_p.E520del|EVC2_ENST00000310917.2_In_Frame_Del_p.E440del	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	520					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.E520delE(1)|p.D521N(1)		NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						TTTGGCAAAGTCTTCTTCTTGTT	0.473																																					p.440_441del												.	.	2	Substitution - Missense(1)|Deletion - In frame(1)	urinary_tract(1)|large_intestine(1)	c.1320_1322del	4						.																																			5684571	SO:0001651	inframe_deletion	132884	exon11			AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.1560_1562delAGA	4.37:g.5633674_5633676delTCT	ENSP00000342144:p.Glu520del	Somatic		Capture	SOLID	Phase_I	5684569	NM_001166136	Q86YT3|Q86YT4|Q8NG49	In_Frame_Del	DEL	ENST00000344408.5	37	CCDS3382.2																																																																																				EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289822.2	NM_147127	
ANAPC4	29945	hgsc.bcm.edu	37	4	25390357	25390357	+	Silent	SNP	A	A	G			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr4:25390357A>G	ENST00000315368.3	+	6	604	c.462A>G	c.(460-462)aaA>aaG	p.K154K	ANAPC4_ENST00000510092.1_Silent_p.K154K	NM_013367.2	NP_037499.2	Q9UJX5	APC4_HUMAN	anaphase promoting complex subunit 4	154					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)|ubiquitin-protein transferase activity (GO:0004842)	p.K154K(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)	27		Breast(46;0.0503)				ACACCTCAAAAATATTTAGGT	0.289																																					p.K154K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A462G	4						.						81.0	90.0	87.0					4																	25390357		2198	4290	6488	24999455	SO:0001819	synonymous_variant	29945	exon6			AF191338	CCDS3434.1, CCDS68684.1	4p15.31	2011-06-15			ENSG00000053900	ENSG00000053900		"""Anaphase promoting complex subunits"""	19990	protein-coding gene	gene with protein product		606947				6180011	Standard	NM_013367		Approved	APC4	uc003gro.3	Q9UJX5	OTTHUMG00000097753	ENST00000315368.3:c.462A>G	4.37:g.25390357A>G		Somatic		Capture	SOLID	Phase_I	24999455	NM_013367	A8K8H1|E9PCR4|Q6PCC6|Q9NSH6	Silent	SNP	ENST00000315368.3	37	CCDS3434.1																																																																																				ANAPC4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214986.1	NM_013367	
NFXL1	152518	hgsc.bcm.edu	37	4	47901001	47901001	+	Missense_Mutation	SNP	A	A	C			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr4:47901001A>C	ENST00000507489.1	-	7	1139	c.963T>G	c.(961-963)caT>caG	p.H321Q	NFXL1_ENST00000381538.3_Missense_Mutation_p.H321Q|NFXL1_ENST00000329043.3_Missense_Mutation_p.H321Q	NM_001278624.1	NP_001265553.1	Q6ZNB6	NFXL1_HUMAN	nuclear transcription factor, X-box binding-like 1	321						integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.H321Q(1)		NS(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(4)	27						TTTCACACTTATGTTGCCCAC	0.403																																					p.H321Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T963G	4						.						123.0	105.0	111.0					4																	47901001		2203	4300	6503	47595758	SO:0001583	missense	152518	exon7			AY134856	CCDS3478.2	4p12	2008-02-05			ENSG00000170448	ENSG00000170448			18726	protein-coding gene	gene with protein product	"""ovarian zinc finger protein"""						Standard	NM_152995		Approved	HOZFP	uc003gxp.3	Q6ZNB6	OTTHUMG00000128621	ENST00000507489.1:c.963T>G	4.37:g.47901001A>C	ENSP00000422037:p.His321Gln	Somatic		Capture	SOLID	Phase_I	47595758	NM_152995	B1Q2K1|Q86VG1|Q8WVH1	Missense_Mutation	SNP	ENST00000507489.1	37	CCDS3478.2	.	.	.	.	.	.	.	.	.	.	A	15.99	2.994886	0.54041	.	.	ENSG00000170448	ENST00000381538;ENST00000507489;ENST00000329043	D;D;D	0.99667	-6.34;-6.34;-6.34	5.03	1.23	0.21249	Zinc finger, NF-X1-type (2);	0.000000	0.85682	D	0.000000	D	0.99625	0.9863	H	0.97186	3.955	0.49798	D	0.999826	D	0.89917	1.0	D	0.97110	1.0	D	0.98905	1.0778	10	0.87932	D	0	-11.421	4.7897	0.13243	0.5389:0.1564:0.3047:0.0	.	321	Q6ZNB6	NFXL1_HUMAN	Q	321	ENSP00000370949:H321Q;ENSP00000422037:H321Q;ENSP00000333113:H321Q	ENSP00000333113:H321Q	H	-	3	2	NFXL1	47595758	1.000000	0.71417	0.990000	0.47175	0.655000	0.38815	2.841000	0.48223	0.248000	0.21435	-0.250000	0.11733	CAT		NFXL1-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361636.1	NM_152995	
AASDH	132949	hgsc.bcm.edu	37	4	57215816	57215816	+	Missense_Mutation	SNP	G	G	A	rs145747770		TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr4:57215816G>A	ENST00000205214.6	-	11	2281	c.2101C>T	c.(2101-2103)Cat>Tat	p.H701Y	AASDH_ENST00000502617.1_Missense_Mutation_p.H701Y|AASDH_ENST00000434343.2_Missense_Mutation_p.H216Y|AASDH_ENST00000513376.1_Missense_Mutation_p.H601Y|AASDH_ENST00000602986.1_Missense_Mutation_p.H548Y|AASDH_ENST00000451613.1_Missense_Mutation_p.H701Y	NM_181806.2	NP_861522.2	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	701					fatty acid metabolic process (GO:0006631)		acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)	p.H701Y(1)		endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	40	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				GAAGAGCAATGTCCTAACTTT	0.383																																					p.H701Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2101T	4						.						70.0	69.0	69.0					4																	57215816		2203	4300	6503	56910573	SO:0001583	missense	132949	exon11			AF516672	CCDS3504.1, CCDS68705.1, CCDS68706.1, CCDS75126.1, CCDS75127.1	4q12	2010-12-14			ENSG00000157426	ENSG00000157426	1.2.1.31	"""Acyl-CoA synthetase family"""	23993	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 4"""	614365				15865210, 12712191, 17762044	Standard	XM_005265721		Approved	NRPS998, LYS2, ACSF4	uc003hbn.3	Q4L235	OTTHUMG00000128841	ENST00000205214.6:c.2101C>T	4.37:g.57215816G>A	ENSP00000205214:p.His701Tyr	Somatic		Capture	SOLID	Phase_I	56910573	NM_181806	A5D8V3|A5PL22|Q63HK2|Q63HR7|Q6IPP8|Q6TFZ6|Q7Z5Y3|Q96BW4|Q9P064	Missense_Mutation	SNP	ENST00000205214.6	37	CCDS3504.1	.	.	.	.	.	.	.	.	.	.	G	3.664	-0.068956	0.07228	.	.	ENSG00000157426	ENST00000205214;ENST00000513376;ENST00000434343;ENST00000451613;ENST00000503808;ENST00000502617	T;T;T;T;T	0.11063	2.81;2.81;2.81;2.81;2.81	5.26	2.35	0.29111	.	0.962200	0.08643	N	0.915175	T	0.05960	0.0155	L	0.44542	1.39	0.09310	N	1	P;P;B;B	0.44578	0.838;0.478;0.34;0.229	B;B;B;B	0.31495	0.131;0.093;0.093;0.063	T	0.18871	-1.0323	10	0.09338	T	0.73	-0.1842	2.7227	0.05205	0.1526:0.116:0.4721:0.2593	.	548;701;701;701	E9PH98;Q4L235-4;Q4L235-3;Q4L235	.;.;.;ACSF4_HUMAN	Y	701;601;216;701;548;701	ENSP00000205214:H701Y;ENSP00000423760:H601Y;ENSP00000392158:H216Y;ENSP00000409656:H701Y;ENSP00000421171:H701Y	ENSP00000205214:H701Y	H	-	1	0	AASDH	56910573	0.000000	0.05858	0.001000	0.08648	0.019000	0.09904	0.384000	0.20668	0.774000	0.33427	-0.188000	0.12872	CAT		AASDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250780.1	NM_181806	
WDFY3	23001	hgsc.bcm.edu	37	4	85752605	85752605	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr4:85752605G>A	ENST00000295888.4	-	8	1137	c.730C>T	c.(730-732)Cgt>Tgt	p.R244C	WDFY3_ENST00000322366.6_Missense_Mutation_p.R244C	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	244					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)	p.R244C(1)		breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		AGACCATGACGAGATATGGTC	0.373																																					p.R244C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C730T	4						.						92.0	90.0	91.0					4																	85752605		2203	4300	6503	85971629	SO:0001583	missense	23001	exon8			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.730C>T	4.37:g.85752605G>A	ENSP00000295888:p.Arg244Cys	Somatic		Capture	SOLID	Phase_I	85971629	NM_014991	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	ENST00000295888.4	37	CCDS3609.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.564330	0.86335	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	T;T	0.17054	2.3;2.3	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.44644	0.1303	M	0.75447	2.3	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.68621	0.95;0.959	T	0.35375	-0.9791	10	0.72032	D	0.01	.	19.7198	0.96137	0.0:0.0:1.0:0.0	.	244;244	E2QRK8;Q8IZQ1	.;WDFY3_HUMAN	C	244	ENSP00000318466:R244C;ENSP00000295888:R244C	ENSP00000295888:R244C	R	-	1	0	WDFY3	85971629	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	5.296000	0.65698	2.740000	0.93945	0.455000	0.32223	CGT		WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991	
MAPK10	5602	hgsc.bcm.edu	37	4	86950356	86950356	+	Missense_Mutation	SNP	G	G	C			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr4:86950356G>C	ENST00000359221.3	-	13	1772	c.1246C>G	c.(1246-1248)Cct>Gct	p.P416A	MAPK10_ENST00000361569.2_Missense_Mutation_p.P416A|MAPK10_ENST00000395161.2_Missense_Mutation_p.P416A|MAPK10_ENST00000449047.2_Missense_Mutation_p.P271A|MAPK10_ENST00000395160.3_Missense_Mutation_p.P271A|MAPK10_ENST00000395166.1_Missense_Mutation_p.P378A|MAPK10_ENST00000395169.3_Missense_Mutation_p.P378A|MAPK10_ENST00000395157.3_Missense_Mutation_p.P271A			P53779	MK10_HUMAN	mitogen-activated protein kinase 10	416					activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|JUN phosphorylation (GO:0007258)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|JUN kinase activity (GO:0004705)|MAP kinase kinase activity (GO:0004708)	p.P271A(1)|p.P416A(1)		breast(1)|central_nervous_system(1)|stomach(1)	3		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.243)		OV - Ovarian serous cystadenocarcinoma(123;0.002)		GTACCTGAAGGAGAAGGCTGT	0.348																																					p.P271A												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C811G	4						.						220.0	204.0	210.0					4																	86950356		2203	4300	6503	87169380	SO:0001583	missense	5602	exon8			U07620	CCDS3612.1, CCDS3613.1, CCDS34026.1, CCDS43247.1	4q22-q23	2011-06-09			ENSG00000109339	ENSG00000109339	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6872	protein-coding gene	gene with protein product		602897		PRKM10		8654373, 12436199	Standard	NM_002753		Approved	JNK3, p493F12, p54bSAPK	uc003hpt.3	P53779	OTTHUMG00000130604	ENST00000359221.3:c.1246C>G	4.37:g.86950356G>C	ENSP00000352157:p.Pro416Ala	Somatic		Capture	SOLID	Phase_I	87169380	NM_138981	A6NFS3|A6NG28|B3KQ94|Q15707|Q49AP1	Missense_Mutation	SNP	ENST00000359221.3	37	CCDS34026.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.20|18.20	3.571650|3.571650	0.65765|0.65765	.|.	.|.	ENSG00000109339|ENSG00000109339	ENST00000395169;ENST00000359221;ENST00000395157;ENST00000361569;ENST00000395166;ENST00000395160;ENST00000449047;ENST00000395161|ENST00000515400	T;T;T;T;T;T;T;T|T	0.79554|0.74632	-0.8;-0.82;-1.28;-0.74;-0.8;-1.18;-0.76;-0.74|-0.86	5.96|5.96	5.96|5.96	0.96718|0.96718	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75561|0.75561	0.3866|0.3866	N|N	0.25144|0.25144	0.715|0.715	0.80722|0.80722	D|D	1|1	B;B;B;B;B|.	0.10296|.	0.0;0.0;0.0;0.003;0.001|.	B;B;B;B;B|.	0.10450|.	0.003;0.002;0.002;0.005;0.002|.	T|T	0.77480|0.77480	-0.2572|-0.2572	10|7	0.49607|0.87932	T|D	0.09|0	-10.1507|-10.1507	20.0073|20.0073	0.97437|0.97437	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	302;271;378;416;416|.	B7Z1Z1;Q499Y8;P53779-3;P53779-2;P53779|.	.;.;.;.;MK10_HUMAN|.	A|C	378;416;271;416;378;271;271;416|328	ENSP00000378598:P378A;ENSP00000352157:P416A;ENSP00000378586:P271A;ENSP00000355297:P416A;ENSP00000378595:P378A;ENSP00000378589:P271A;ENSP00000414469:P271A;ENSP00000378590:P416A|ENSP00000424154:S328C	ENSP00000352157:P416A|ENSP00000424154:S328C	P|S	-|-	1|2	0|0	MAPK10|MAPK10	87169380|87169380	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.767000|6.767000	0.74975|0.74975	2.824000|2.824000	0.97209|0.97209	0.655000|0.655000	0.94253|0.94253	CCT|TCC		MAPK10-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000361363.2		
GUCY1A3	2982	hgsc.bcm.edu	37	4	156618124	156618124	+	Silent	SNP	A	A	G			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr4:156618124A>G	ENST00000296518.7	+	3	314	c.105A>G	c.(103-105)ggA>ggG	p.G35G	GUCY1A3_ENST00000506455.1_Silent_p.G35G|GUCY1A3_ENST00000511108.1_Silent_p.G35G|GUCY1A3_ENST00000393832.3_5'UTR|GUCY1A3_ENST00000513574.1_Silent_p.G35G|GUCY1A3_ENST00000511507.1_Silent_p.G35G|GUCY1A3_ENST00000455639.2_Silent_p.G35G|GUCY1A3_ENST00000515602.1_3'UTR			Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3	35					blood circulation (GO:0008015)|blood coagulation (GO:0007596)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of cGMP biosynthetic process (GO:0030828)|regulation of blood pressure (GO:0008217)|relaxation of vascular smooth muscle (GO:0060087)|response to defense-related host nitric oxide production (GO:0052565)	guanylate cyclase complex, soluble (GO:0008074)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)|receptor activity (GO:0004872)	p.G35G(1)		central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|liver(2)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)		AGGCAGCAGGAAGCTCAGAGA	0.498																																					p.G35G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A105G	4						.						109.0	99.0	102.0					4																	156618124		2203	4300	6503	156837574	SO:0001819	synonymous_variant	2982	exon3				CCDS34085.1, CCDS54812.1	4q31.3-q33	2008-03-18				ENSG00000164116	4.6.1.2		4685	protein-coding gene	gene with protein product		139396		GUC1A3		1352257	Standard	NM_001130687		Approved	GC-SA3	uc003iow.3	Q02108		ENST00000296518.7:c.105A>G	4.37:g.156618124A>G		Somatic		Capture	SOLID	Phase_I	156837574	NM_001130682	D3DP19|D6RDW3|O43843|Q8TAH3	Silent	SNP	ENST00000296518.7	37	CCDS34085.1																																																																																				GUCY1A3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365786.2		
COL4A5	1287	hgsc.bcm.edu	37	X	107924167	107924167	+	Silent	SNP	G	G	A	rs368359594		TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chrX:107924167G>A	ENST00000361603.2	+	44	4294	c.4050G>A	c.(4048-4050)ccG>ccA	p.P1350P	COL4A5_ENST00000328300.6_Silent_p.P1356P	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	1350	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)	p.P1350P(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						AGGGGGAACCGGGACTTATTG	0.443									Alport syndrome with Diffuse Leiomyomatosis																												p.R1352Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G4055A	X						.	G	,	0,3835		0,0,1632,571	115.0	108.0	110.0		4050,4068	-0.4	1.0	X		110	1,6727		0,1,2427,1872	no	coding-synonymous,coding-synonymous	COL4A5	NM_000495.3,NM_033380.1	,	0,1,4059,2443	AA,AG,GG,G		0.0149,0.0,0.0095	,	1350/1686,1356/1692	107924167	1,10562	2203	4300	6503	107810823	SO:0001819	synonymous_variant	1287	exon44	Familial Cancer Database		M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.4050G>A	X.37:g.107924167G>A		Somatic		Capture	SOLID	Phase_I	107810823	NM_033380	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Silent	SNP	ENST00000361603.2	37	CCDS14543.1																																																																																				COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2		
AMOT	154796	hgsc.bcm.edu	37	X	112054559	112054559	+	Silent	SNP	T	T	C			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chrX:112054559T>C	ENST00000524145.1	-	4	1529	c.1455A>G	c.(1453-1455)aaA>aaG	p.K485K	AMOT_ENST00000371958.1_Silent_p.K253K|AMOT_ENST00000304758.1_Silent_p.K76K|AMOT_ENST00000371962.1_Silent_p.K253K|AMOT_ENST00000371959.3_Silent_p.K485K			Q4VCS5	AMOT_HUMAN	angiomotin	485					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)	p.K485K(1)|p.K76K(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						GGGCCTCTCTTTTGGAGGATG	0.488																																					p.K76K												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A228G	X						.						196.0	165.0	175.0					X																	112054559		2203	4300	6503	111941215	SO:0001819	synonymous_variant	154796	exon4			AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.1455A>G	X.37:g.112054559T>C		Somatic		Capture	SOLID	Phase_I	111941215	NM_133265	Q504X5|Q9HD27|Q9UPT1	Silent	SNP	ENST00000524145.1	37	CCDS48154.1																																																																																				AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378570.1	NM_133265	
IL13RA1	3597	hgsc.bcm.edu	37	X	117875003	117875003	+	Missense_Mutation	SNP	T	T	G			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chrX:117875003T>G	ENST00000371666.3	+	2	179	c.112T>G	c.(112-114)Ttg>Gtg	p.L38V	SNORA35_ENST00000458908.1_RNA|IL13RA1_ENST00000371642.1_Missense_Mutation_p.L38V	NM_001560.2	NP_001551.1	P78552	I13R1_HUMAN	interleukin 13 receptor, alpha 1	38	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of immunoglobulin production (GO:0002639)	interleukin-13 receptor complex (GO:0005898)|plasma membrane (GO:0005886)	interleukin-13 receptor activity (GO:0016515)	p.L38V(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(7)	12						TGTGACAAATTTGAGTGTCTC	0.373																																					p.L38V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T112G	X						.						107.0	103.0	104.0					X																	117875003		2203	4300	6503	117759031	SO:0001583	missense	3597	exon2			U62858	CCDS14573.1	Xq24	2008-02-05			ENSG00000131724	ENSG00000131724		"""Interleukins and interleukin receptors"", ""CD molecules"""	5974	protein-coding gene	gene with protein product	"""IL13 receptor alpha-1 chain"", ""CD213a1 antigen"""	300119				8910586, 9013879	Standard	NM_001560		Approved	IL-13Ra, NR4, CD213a1	uc004eqs.3	P78552	OTTHUMG00000022258	ENST00000371666.3:c.112T>G	X.37:g.117875003T>G	ENSP00000360730:p.Leu38Val	Somatic		Capture	SOLID	Phase_I	117759031	NM_001560	O95646|Q5JSL4|Q99656|Q9UDY5	Missense_Mutation	SNP	ENST00000371666.3	37	CCDS14573.1	.	.	.	.	.	.	.	.	.	.	T	12.48	1.949491	0.34377	.	.	ENSG00000131724	ENST00000371666;ENST00000371642	D;D	0.94828	-3.23;-3.53	5.76	4.53	0.55603	.	0.275715	0.26286	N	0.025248	D	0.86830	0.6027	N	0.17082	0.46	0.80722	D	1	B;B;B	0.26445	0.014;0.014;0.149	B;B;B	0.22386	0.021;0.021;0.039	T	0.82655	-0.0350	10	0.29301	T	0.29	-5.179	8.2157	0.31509	0.0:0.0:0.1992:0.8008	.	38;38;38	Q5JSL4;P78552;Q9UDY5	.;I13R1_HUMAN;.	V	38	ENSP00000360730:L38V;ENSP00000360705:L38V	ENSP00000360705:L38V	L	+	1	2	IL13RA1	117759031	1.000000	0.71417	0.998000	0.56505	0.886000	0.51366	0.629000	0.24538	1.935000	0.56089	0.486000	0.48141	TTG		IL13RA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058009.1	NM_001560	
CD40LG	959	hgsc.bcm.edu	37	X	135741420	135741420	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chrX:135741420C>A	ENST00000370629.2	+	5	688	c.632C>A	c.(631-633)aCc>aAc	p.T211N	CD40LG_ENST00000370628.2_Missense_Mutation_p.T190N	NM_000074.2	NP_000065.1	P29965	CD40L_HUMAN	CD40 ligand	211			T -> N (in HIGM1). {ECO:0000269|PubMed:7679801}.		B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|immunoglobulin secretion (GO:0048305)|inflammatory response (GO:0006954)|isotype switching (GO:0045190)|leukocyte cell-cell adhesion (GO:0007159)|negative regulation of apoptotic process (GO:0043066)|platelet activation (GO:0030168)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of interleukin-12 production (GO:0032735)|regulation of immune response (GO:0050776)|regulation of immunoglobulin secretion (GO:0051023)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	CD40 receptor binding (GO:0005174)	p.T211N(1)		endometrium(1)|kidney(1)|large_intestine(8)|lung(14)|skin(1)|stomach(1)	26	Acute lymphoblastic leukemia(192;0.000127)					GCTGCAAATACCCACAGTTCC	0.488									Immune Deficiency with Hyper-IgM																												p.T211N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C632A	X	GRCh37	CM930090	CD40LG	M		.						232.0	221.0	225.0					X																	135741420		2203	4300	6503	135569086	SO:0001583	missense	959	exon5	Familial Cancer Database	Hypogammaglobulinemia with Hyper-IgM, HIGM type I-V, XLHIGM	X67878	CCDS14659.1	Xq26	2014-09-17	2008-08-01	2005-01-14	ENSG00000102245	ENSG00000102245		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"", ""Endogenous ligands"""	11935	protein-coding gene	gene with protein product	"""CD40 antigen ligand"", ""tumor necrosis factor (ligand) superfamily member 5"", ""T-B cell-activating molecule"", ""TNF-related activation protein"", ""hyper-IgM syndrome"""	300386	"""tumor necrosis factor (ligand) superfamily, member 5 (hyper-IgM syndrome)"""	HIGM1, IMD3, TNFSF5		1427881, 7678782	Standard	NM_000074		Approved	CD40L, TRAP, gp39, hCD40L, CD154	uc004faa.3	P29965	OTTHUMG00000022512	ENST00000370629.2:c.632C>A	X.37:g.135741420C>A	ENSP00000359663:p.Thr211Asn	Somatic		Capture	SOLID	Phase_I	135569086	NM_000074		Missense_Mutation	SNP	ENST00000370629.2	37	CCDS14659.1	.	.	.	.	.	.	.	.	.	.	C	12.68	2.009300	0.35415	.	.	ENSG00000102245	ENST00000370629;ENST00000370628	D;D	0.98150	-4.75;-4.75	5.56	4.69	0.59074	Tumour necrosis factor (3);Tumour necrosis factor-like (2);	0.381390	0.26761	N	0.022631	D	0.96393	0.8823	L	0.52573	1.65	0.40775	D	0.983128	B;B	0.30973	0.021;0.302	B;B	0.38921	0.077;0.285	D	0.94812	0.7979	10	0.25751	T	0.34	-7.4596	15.171	0.72872	0.0:0.8619:0.1381:0.0	.	190;211	Q3L8U2;P29965	.;CD40L_HUMAN	N	211;190	ENSP00000359663:T211N;ENSP00000359662:T190N	ENSP00000359662:T190N	T	+	2	0	CD40LG	135569086	0.982000	0.34865	0.823000	0.32752	0.185000	0.23345	2.829000	0.48128	1.098000	0.41479	0.600000	0.82982	ACC		CD40LG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058501.1	NM_000074	
CDKL5	6792	hgsc.bcm.edu	37	X	18646618	18646618	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chrX:18646618G>A	ENST00000379989.3	+	19	2909	c.2624G>A	c.(2623-2625)cGg>cAg	p.R875Q	CDKL5_ENST00000379996.3_Missense_Mutation_p.R875Q	NM_001037343.1	NP_001032420.1	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	875					neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of Rac GTPase activity (GO:0032855)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite development (GO:0050773)	cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic growth cone (GO:0044294)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)	p.R875Q(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|skin(5)|stomach(1)	44	Hepatocellular(33;0.183)					TCAGAAATTCGGATTCACCCC	0.572																																					p.R875Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2624A	X						.						110.0	112.0	111.0					X																	18646618		2203	4300	6503	18556539	SO:0001583	missense	6792	exon18			Y15057	CCDS14186.1	Xp22	2011-11-04	2002-11-26	2002-11-29	ENSG00000008086	ENSG00000008086		"""Cyclin-dependent kinases"""	11411	protein-coding gene	gene with protein product		300203	"""serine/threonine kinase 9"""	STK9		9721213, 16935860	Standard	XM_005274584		Approved	EIEE2	uc004cym.3	O76039	OTTHUMG00000021214	ENST00000379989.3:c.2624G>A	X.37:g.18646618G>A	ENSP00000369325:p.Arg875Gln	Somatic		Capture	SOLID	Phase_I	18556539	NM_003159	G9B9X4|Q14198|Q5H985|Q8IYC7|Q9UJL6	Missense_Mutation	SNP	ENST00000379989.3	37	CCDS14186.1	.	.	.	.	.	.	.	.	.	.	G	18.44	3.625214	0.66901	.	.	ENSG00000008086	ENST00000379996;ENST00000379989	T;T	0.79033	-1.23;-1.23	5.67	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.62877	0.2464	L	0.34521	1.04	0.37153	D	0.902232	P	0.48503	0.911	B	0.28991	0.097	T	0.71813	-0.4479	10	0.87932	D	0	-8.9474	13.8966	0.63775	0.0751:0.0:0.9249:0.0	.	875	O76039	CDKL5_HUMAN	Q	875	ENSP00000369332:R875Q;ENSP00000369325:R875Q	ENSP00000369325:R875Q	R	+	2	0	CDKL5	18556539	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.092000	0.76930	1.146000	0.42352	0.513000	0.50165	CGG		CDKL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055945.2	NM_003159	
MAGEB18	286514	hgsc.bcm.edu	37	X	26157600	26157600	+	Missense_Mutation	SNP	A	A	C			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chrX:26157600A>C	ENST00000325250.1	+	2	685	c.498A>C	c.(496-498)gaA>gaC	p.E166D		NM_173699.3	NP_775970	Q96M61	MAGBI_HUMAN	melanoma antigen family B, 18	166	Interaction with LNX1.|MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.					cytoplasm (GO:0005737)		p.E166D(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(17)|skin(2)|stomach(1)|urinary_tract(2)	33						ATTTGAAGGAAGTGGATCCCA	0.433																																					p.E166D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A498C	X						.						56.0	44.0	48.0					X																	26157600		2202	4300	6502	26067521	SO:0001583	missense	286514	exon2			AK057361	CCDS14216.1	Xp21.3	2008-02-05			ENSG00000176774	ENSG00000176774			28515	protein-coding gene	gene with protein product							Standard	NM_173699		Approved	MGC33889	uc004dbq.2	Q96M61	OTTHUMG00000021282	ENST00000325250.1:c.498A>C	X.37:g.26157600A>C	ENSP00000314543:p.Glu166Asp	Somatic		Capture	SOLID	Phase_I	26067521	NM_173699		Missense_Mutation	SNP	ENST00000325250.1	37	CCDS14216.1	.	.	.	.	.	.	.	.	.	.	A	16.17	3.046638	0.55110	.	.	ENSG00000176774	ENST00000325250	T	0.08720	3.06	4.56	3.41	0.39046	.	0.000000	0.85682	D	0.000000	T	0.29223	0.0727	M	0.91872	3.25	0.30668	N	0.753723	D	0.60575	0.988	D	0.65573	0.936	T	0.32161	-0.9917	10	0.72032	D	0.01	.	6.0174	0.19611	0.886:0.0:0.114:0.0	.	166	Q96M61	MAGBI_HUMAN	D	166	ENSP00000314543:E166D	ENSP00000314543:E166D	E	+	3	2	MAGEB18	26067521	1.000000	0.71417	0.991000	0.47740	0.656000	0.38851	0.947000	0.29082	0.871000	0.35750	0.486000	0.48141	GAA		MAGEB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056120.1	NM_173699	
PHF8	23133	hgsc.bcm.edu	37	X	53970652	53970652	+	Missense_Mutation	SNP	T	T	G			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chrX:53970652T>G	ENST00000357988.5	-	20	3030	c.2672A>C	c.(2671-2673)aAg>aCg	p.K891T	PHF8_ENST00000338946.6_Missense_Mutation_p.K754T|PHF8_ENST00000338154.6_Missense_Mutation_p.K855T|PHF8_ENST00000322659.8_Missense_Mutation_p.K838T	NM_001184896.1	NP_001171825.1	Q9UPP1	PHF8_HUMAN	PHD finger protein 8	891					brain development (GO:0007420)|G1/S transition of mitotic cell cycle (GO:0000082)|histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of chromatin silencing at rDNA (GO:0061188)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	40						ACGGTCCTGCTTCGGCAGAGT	0.577																																					p.K838T												.	.	0			c.A2513C	X						.						58.0	45.0	49.0					X																	53970652		2203	4300	6503	53987377	SO:0001583	missense	23133	exon21			AB029034	CCDS14355.1, CCDS55418.1, CCDS55419.1, CCDS55420.1	Xp11.22	2013-01-28			ENSG00000172943	ENSG00000172943		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	20672	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1F"""	300560				10470851, 20023638, 20644565	Standard	NM_015107		Approved	ZNF422, KIAA1111, JHDM1F	uc004dsu.3	Q9UPP1	OTTHUMG00000021622	ENST00000357988.5:c.2672A>C	X.37:g.53970652T>G	ENSP00000350676:p.Lys891Thr	None		Capture	SOLID	Phase_I	53987377	NM_001184898	B3KMV4|B7Z911|Q5H9U5|Q5JPR9|Q5JPS0|Q5JPS2|Q5JPS3|Q5VUJ4|Q7Z6D4|Q9HAH2	Missense_Mutation	SNP	ENST00000357988.5	37	CCDS55420.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	18.50|18.50|18.50	3.637139|3.637139|3.637139	0.67130|0.67130|0.67130	.|.|.	.|.|.	ENSG00000172943|ENSG00000172943|ENSG00000172943	ENST00000443302|ENST00000357988;ENST00000338154;ENST00000338946;ENST00000396277;ENST00000322659|ENST00000396282	.|T;T;T;T|.	.|0.60171|.	.|0.21;0.21;0.21;0.21|.	4.86|4.86|4.86	4.86|4.86|4.86	0.63082|0.63082|0.63082	.|.|.	.|0.158098|.	.|0.53938|.	.|D|.	.|0.000041|.	T|T|T	0.56731|0.56731|0.56731	0.2005|0.2005|0.2005	L|L|L	0.41492|0.41492|0.41492	1.28|1.28|1.28	0.38002|0.38002|0.38002	D|D|D	0.934258|0.934258|0.934258	.|D;D;D;D;D|.	.|0.76494|.	.|0.999;0.996;0.998;0.999;0.994|.	.|D;P;D;D;P|.	.|0.78314|.	.|0.974;0.907;0.981;0.991;0.81|.	T|T|T	0.59316|0.59316|0.59316	-0.7477|-0.7477|-0.7477	5|10|5	.|0.72032|.	.|D|.	.|0.01|.	-8.5962|-8.5962|-8.5962	12.5953|12.5953|12.5953	0.56465|0.56465|0.56465	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.|.	.|377;855;754;790;891|.	.|B3KMV4;Q9UPP1-2;B7Z911;Q9UPP1-3;Q9UPP1|.	.|.;.;.;.;PHF8_HUMAN|.	D|T|R	618|891;855;754;784;838|759	.|ENSP00000350676:K891T;ENSP00000338868:K855T;ENSP00000340051:K754T;ENSP00000319473:K838T|.	.|ENSP00000319473:K838T|.	E|K|S	-|-|-	3|2|1	2|0|0	PHF8|PHF8|PHF8	53987377|53987377|53987377	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.997000|0.997000|0.997000	0.53966|0.53966|0.53966	0.548000|0.548000|0.548000	0.35241|0.35241|0.35241	2.906000|2.906000|2.906000	0.48735|0.48735|0.48735	1.610000|1.610000|1.610000	0.50200|0.50200|0.50200	0.427000|0.427000|0.427000	0.28365|0.28365|0.28365	GAA|AAG|AGC		PHF8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056784.2	NM_015107	
TAF1	6872	hgsc.bcm.edu	37	X	70597459	70597459	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chrX:70597459C>T	ENST00000373790.4	+	6	769	c.718C>T	c.(718-720)Cgt>Tgt	p.R240C	TAF1_ENST00000423759.1_Missense_Mutation_p.R261C|TAF1_ENST00000449580.1_Missense_Mutation_p.R240C|TAF1_ENST00000276072.3_Missense_Mutation_p.R261C	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	240	Protein kinase 1.				cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.R240C(1)		breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				CTAGGTGTTACGTTTTCTACG	0.463																																					p.R240C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C718T	X						.						124.0	94.0	104.0					X																	70597459		2203	4300	6503	70514184	SO:0001583	missense	6872	exon6				CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.718C>T	X.37:g.70597459C>T	ENSP00000362895:p.Arg240Cys	Somatic		Capture	SOLID	Phase_I	70514184	NM_138923	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Missense_Mutation	SNP	ENST00000373790.4	37	CCDS35325.1	.	.	.	.	.	.	.	.	.	.	.	20.5	4.005625	0.74932	.	.	ENSG00000147133	ENST00000373790;ENST00000449580;ENST00000423759;ENST00000276072	T;T;T;T	0.22134	1.97;2.07;2.05;1.99	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.48409	0.1498	M	0.72353	2.195	0.80722	D	1	P;D	0.89917	0.956;1.0	P;D	0.97110	0.489;1.0	T	0.49293	-0.8955	10	0.66056	D	0.02	.	18.4193	0.90584	0.0:1.0:0.0:0.0	.	240;261	P21675;P21675-2	TAF1_HUMAN;.	C	240;240;261;261	ENSP00000362895:R240C;ENSP00000389000:R240C;ENSP00000406549:R261C;ENSP00000276072:R261C	ENSP00000276072:R261C	R	+	1	0	TAF1	70514184	1.000000	0.71417	0.997000	0.53966	0.833000	0.47200	4.644000	0.61397	2.377000	0.81083	0.468000	0.43344	CGT		TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058995.2	NM_004606	
ATP7A	538	hgsc.bcm.edu	37	X	77245432	77245432	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chrX:77245432G>T	ENST00000341514.6	+	4	1469	c.1314G>T	c.(1312-1314)atG>atT	p.M438I	ATP7A_ENST00000350425.4_Intron|ATP7A_ENST00000343533.5_Missense_Mutation_p.M438I	NM_000052.5	NP_000043.4	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide	438	HMA 4. {ECO:0000255|PROSITE- ProRule:PRU00280}.				blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cartilage development (GO:0051216)|catecholamine metabolic process (GO:0006584)|cellular copper ion homeostasis (GO:0006878)|central nervous system neuron development (GO:0021954)|cerebellar Purkinje cell differentiation (GO:0021702)|collagen fibril organization (GO:0030199)|copper ion export (GO:0060003)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|dendrite morphogenesis (GO:0048813)|detoxification of copper ion (GO:0010273)|dopamine metabolic process (GO:0042417)|elastic fiber assembly (GO:0048251)|elastin biosynthetic process (GO:0051542)|epinephrine metabolic process (GO:0042414)|extracellular matrix organization (GO:0030198)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|lung alveolus development (GO:0048286)|mitochondrion organization (GO:0007005)|negative regulation of metalloenzyme activity (GO:0048553)|negative regulation of neuron apoptotic process (GO:0043524)|neuron projection morphogenesis (GO:0048812)|norepinephrine biosynthetic process (GO:0042421)|norepinephrine metabolic process (GO:0042415)|peptidyl-lysine modification (GO:0018205)|pigmentation (GO:0043473)|positive regulation of catalytic activity (GO:0043085)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of oxidoreductase activity (GO:0051353)|pyramidal neuron development (GO:0021860)|regulation of gene expression (GO:0010468)|regulation of oxidative phosphorylation (GO:0002082)|release of cytochrome c from mitochondria (GO:0001836)|removal of superoxide radicals (GO:0019430)|response to iron(III) ion (GO:0010041)|response to zinc ion (GO:0010043)|serotonin metabolic process (GO:0042428)|skin development (GO:0043588)|T-helper cell differentiation (GO:0042093)|transmembrane transport (GO:0055085)|tryptophan metabolic process (GO:0006568)|tyrosine metabolic process (GO:0006570)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper ion transmembrane transporter activity (GO:0005375)|copper-dependent protein binding (GO:0032767)|copper-exporting ATPase activity (GO:0004008)|superoxide dismutase copper chaperone activity (GO:0016532)	p.M438I(1)		breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(26)|pancreas(1)|prostate(1)|urinary_tract(1)	53					Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	TAGAAGACATGGGATTTGATG	0.373																																					p.M438I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1314T	X						.						66.0	61.0	63.0					X																	77245432		2203	4296	6499	77132088	SO:0001583	missense	538	exon4			L06133	CCDS35339.1, CCDS75997.1	Xq21.1	2012-10-22	2008-07-31		ENSG00000165240	ENSG00000165240	3.6.3.4	"""ATPases / P-type"""	869	protein-coding gene	gene with protein product	"""copper pump 1"", ""copper-transporting ATPase 1"""	300011	"""Menkes syndrome"""	MNK		10079817	Standard	NM_000052		Approved		uc004ecx.4	Q04656	OTTHUMG00000021885	ENST00000341514.6:c.1314G>T	X.37:g.77245432G>T	ENSP00000345728:p.Met438Ile	Somatic		Capture	SOLID	Phase_I	77132088	NM_000052	B1AT72|O00227|O00745|Q9BYY8	Missense_Mutation	SNP	ENST00000341514.6	37	CCDS35339.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.442622	0.83993	.	.	ENSG00000165240	ENST00000343533;ENST00000341514;ENST00000355691	D;D	0.84442	-1.85;-1.85	5.95	5.95	0.96441	Heavy metal-associated domain, HMA (3);Heavy metal-associated domain, copper ion-binding (1);	0.040721	0.85682	D	0.000000	D	0.87951	0.6307	L	0.48362	1.52	0.80722	D	1	P;B	0.37233	0.588;0.051	P;B	0.48524	0.58;0.098	D	0.87633	0.2517	10	0.62326	D	0.03	-11.8015	19.3392	0.94335	0.0:0.0:1.0:0.0	.	438;448	Q04656;Q59HD1	ATP7A_HUMAN;.	I	438;438;448	ENSP00000343026:M438I;ENSP00000345728:M438I	ENSP00000345728:M438I	M	+	3	0	ATP7A	77132088	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.519000	0.84933	0.594000	0.82650	ATG		ATP7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057306.1	NM_000052	
GABRA3	2556	hgsc.bcm.edu	37	X	151336816	151336816	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chrX:151336816C>T	ENST00000370314.4	-	10	1601	c.1363G>A	c.(1363-1365)Gtt>Att	p.V455I	RP11-329E24.6_ENST00000453915.1_RNA|GABRA3_ENST00000535043.1_Missense_Mutation_p.V455I	NM_000808.3	NP_000799.1	P34903	GBRA3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 3	455					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.V455I(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(6)	37	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	ATTTTGTCAACCTTGCTGACA	0.507																																					p.V455I	NSCLC(142;2578 2613 10251 16743)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1363A	X						.						263.0	205.0	225.0					X																	151336816		2203	4300	6503	151087472	SO:0001583	missense	2556	exon10				CCDS14706.1	Xq28	2012-06-22			ENSG00000011677	ENSG00000011677		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4077	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 3"""	305660					Standard	NM_000808		Approved		uc010ntk.1	P34903	OTTHUMG00000024183	ENST00000370314.4:c.1363G>A	X.37:g.151336816C>T	ENSP00000359337:p.Val455Ile	Somatic		Capture	SOLID	Phase_I	151087472	NM_000808	Q8TAF9	Missense_Mutation	SNP	ENST00000370314.4	37	CCDS14706.1	.	.	.	.	.	.	.	.	.	.	C	2.579	-0.297813	0.05532	.	.	ENSG00000011677	ENST00000370314;ENST00000370311;ENST00000535043	T;T;T	0.79554	-1.28;-1.28;-1.28	4.48	4.48	0.54585	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.064498	0.64402	D	0.000009	T	0.48352	0.1495	N	0.01277	-0.915	0.36837	D	0.887213	B	0.11235	0.004	B	0.17722	0.019	T	0.54735	-0.8249	10	0.02654	T	1	.	7.9981	0.30280	0.0:0.8822:0.0:0.1178	.	455	P34903	GBRA3_HUMAN	I	455	ENSP00000359337:V455I;ENSP00000359334:V455I;ENSP00000443527:V455I	ENSP00000359334:V455I	V	-	1	0	GABRA3	151087472	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.514000	0.45503	1.953000	0.56701	0.540000	0.68198	GTT		GABRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060921.1	NM_000808	
TTC27	55622	hgsc.bcm.edu	37	2	33045891	33045891	+	Silent	SNP	T	T	C			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr2:33045891T>C	ENST00000317907.4	+	20	2649	c.2418T>C	c.(2416-2418)ttT>ttC	p.F806F		NM_001193509.1|NM_017735.4	NP_001180438.1|NP_060205.3	Q6P3X3	TTC27_HUMAN	tetratricopeptide repeat domain 27	806								p.F806F(1)		breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38						AGCAACTttttacagatgtgg	0.338																																					p.F756F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2268C	2						.						35.0	33.0	34.0					2																	33045891		2090	4036	6126	32899395	SO:0001819	synonymous_variant	55622	exon20			BC063791, AK000279	CCDS33176.1	2p22.3	2013-01-10			ENSG00000018699	ENSG00000018699		"""Tetratricopeptide (TTC) repeat domain containing"""	25986	protein-coding gene	gene with protein product							Standard	NM_001193509		Approved	FLJ20272	uc002rom.3	Q6P3X3	OTTHUMG00000152134	ENST00000317907.4:c.2418T>C	2.37:g.33045891T>C		Somatic		Capture	SOLID	Phase_I	32899395	NM_001193509	A6NKJ0|Q96SS5|Q9BVF1|Q9NWR4|Q9NXG4	Silent	SNP	ENST00000317907.4	37	CCDS33176.1																																																																																				TTC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325395.1	NM_017735	
HECW2	57520	hgsc.bcm.edu	37	2	197183736	197183736	+	Silent	SNP	G	G	A	rs114435815		TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr2:197183736G>A	ENST00000260983.3	-	9	2060	c.1878C>T	c.(1876-1878)agC>agT	p.S626S	HECW2_ENST00000409111.1_Silent_p.S270S	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	626					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.S626S(1)		biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						TGCTGGCTTCGCTCACACTCT	0.592													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20784	0.0		0.0	False		,,,				2504	0.0				p.S626S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1878T	2						.	G		5,4401	9.9+/-24.2	0,5,2198	77.0	60.0	66.0		1878	-5.1	0.8	2	dbSNP_133	66	0,8600		0,0,4300	no	coding-synonymous	HECW2	NM_020760.1		0,5,6498	AA,AG,GG		0.0,0.1135,0.0384		626/1573	197183736	5,13001	2203	4300	6503	196891981	SO:0001819	synonymous_variant	57520	exon9			AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.1878C>T	2.37:g.197183736G>A		Somatic		Capture	SOLID	Phase_I	196891981	NM_020760	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Silent	SNP	ENST00000260983.3	37	CCDS33354.1																																																																																				HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3	NM_020760	
CCDC108	255101	hgsc.bcm.edu	37	2	219895922	219895922	+	Missense_Mutation	SNP	A	A	T			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr2:219895922A>T	ENST00000341552.5	-	8	1004	c.921T>A	c.(919-921)ttT>ttA	p.F307L	CCDC108_ENST00000441968.1_Missense_Mutation_p.F307L|CCDC108_ENST00000409865.3_Missense_Mutation_p.F296L|CCDC108_ENST00000453220.1_Missense_Mutation_p.F307L|CCDC108_ENST00000410037.1_Missense_Mutation_p.F242L	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	307						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)	p.F307L(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TAAGGGGCTGAAAGGTCACCT	0.652																																					p.F307L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T921A	2						.						37.0	38.0	38.0					2																	219895922		2203	4300	6503	219604166	SO:0001583	missense	255101	exon8			NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.921T>A	2.37:g.219895922A>T	ENSP00000340776:p.Phe307Leu	Somatic		Capture	SOLID	Phase_I	219604166	NM_194302	A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Missense_Mutation	SNP	ENST00000341552.5	37	CCDS2430.2	.	.	.	.	.	.	.	.	.	.	A	23.4	4.408745	0.83340	.	.	ENSG00000181378	ENST00000341552;ENST00000441968;ENST00000453220;ENST00000409865;ENST00000410037;ENST00000441164	T;T;T;T;T	0.36340	1.7;1.7;1.7;1.28;1.26	5.18	-1.52	0.08637	PapD-like (1);	0.166220	0.28425	N	0.015395	T	0.50956	0.1646	M	0.80746	2.51	0.80722	D	1	D;D	0.67145	0.996;0.996	P;P	0.58928	0.848;0.848	T	0.54990	-0.8210	10	0.52906	T	0.07	-7.781	10.9152	0.47131	0.3985:0.0:0.6015:0.0	.	296;307	E9PG25;Q6ZU64	.;CC108_HUMAN	L	307;307;307;296;242;241	ENSP00000340776:F307L;ENSP00000413377:F307L;ENSP00000409117:F307L;ENSP00000386945:F296L;ENSP00000386258:F242L	ENSP00000340776:F307L	F	-	3	2	CCDC108	219604166	1.000000	0.71417	0.989000	0.46669	0.643000	0.38383	0.923000	0.28757	-0.254000	0.09500	0.455000	0.32223	TTT		CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256598.4	NM_194302	
TNC	3371	hgsc.bcm.edu	37	9	117788870	117788870	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr9:117788870C>T	ENST00000350763.4	-	26	6685	c.6274G>A	c.(6274-6276)Gtg>Atg	p.V2092M	TNC_ENST00000345230.3_Missense_Mutation_p.V1455M|TNC_ENST00000542877.1_Missense_Mutation_p.V1729M|TNC_ENST00000423613.2_Missense_Mutation_p.V1819M|TNC_ENST00000535648.1_Missense_Mutation_p.V1637M|TNC_ENST00000537320.1_Missense_Mutation_p.V1455M|TNC_ENST00000341037.4_Missense_Mutation_p.V1910M|TNC_ENST00000340094.3_Missense_Mutation_p.V1728M|TNC_ENST00000346706.3_Missense_Mutation_p.V1546M	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	2092	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)	p.V2092M(1)		NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						GCATCTCCCACGCTGAACTTG	0.572																																					p.V2092M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6274A	9						.						135.0	101.0	112.0					9																	117788870		2203	4300	6503	116828691	SO:0001583	missense	3371	exon26				CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.6274G>A	9.37:g.117788870C>T	ENSP00000265131:p.Val2092Met	Somatic		Capture	SOLID	Phase_I	116828691	NM_002160	C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	ENST00000350763.4	37	CCDS6811.1	.	.	.	.	.	.	.	.	.	.	C	19.85	3.904071	0.72754	.	.	ENSG00000041982	ENST00000340094;ENST00000535648;ENST00000346706;ENST00000345230;ENST00000350763;ENST00000341037;ENST00000423613;ENST00000537320;ENST00000542877	D;D;D;D;D;D;D;D;D	0.82344	-1.6;-1.6;-1.6;-1.6;-1.6;-1.6;-1.6;-1.6;-1.6	5.61	4.7	0.59300	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.185812	0.47852	D	0.000210	D	0.92348	0.7572	M	0.91459	3.21	0.32065	N	0.595185	D;D	0.89917	1.0;1.0	D;D	0.87578	0.995;0.998	D	0.93340	0.6709	10	0.87932	D	0	.	13.9137	0.63883	0.0:0.9273:0.0:0.0727	.	1819;2092	E9PC84;P24821	.;TENA_HUMAN	M	1728;1637;1546;1455;2092;1910;1819;1455;1729	ENSP00000344400:V1728M;ENSP00000438152:V1637M;ENSP00000344555:V1546M;ENSP00000345861:V1455M;ENSP00000265131:V2092M;ENSP00000339553:V1910M;ENSP00000411406:V1819M;ENSP00000443478:V1455M;ENSP00000442242:V1729M	ENSP00000344400:V1728M	V	-	1	0	TNC	116828691	0.966000	0.33281	0.994000	0.49952	0.764000	0.43329	1.786000	0.38694	2.631000	0.89168	0.655000	0.94253	GTG		TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055418.2	NM_002160	
S1PR3	1903	hgsc.bcm.edu	37	9	91616866	91616866	+	Missense_Mutation	SNP	G	G	A	rs201650743		TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr9:91616866G>A	ENST00000375846.3	+	1	5446	c.751G>A	c.(751-753)Gtg>Atg	p.V251M	S1PR3_ENST00000358157.2_Missense_Mutation_p.V251M			Q99500	S1PR3_HUMAN	sphingosine-1-phosphate receptor 3	251					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|anatomical structure morphogenesis (GO:0009653)|cytokine production (GO:0001816)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of establishment of endothelial barrier (GO:1903141)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of interleukin-1 beta production (GO:0032651)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|integrin binding (GO:0005178)|lipid binding (GO:0008289)|sphingosine-1-phosphate receptor activity (GO:0038036)	p.V251M(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|skin(1)	34						TGTGGTGAGCGTGTTCATCGC	0.582													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20335	0.0		0.0	False		,,,				2504	0.0				p.V251M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G751A	9						.						180.0	110.0	134.0					9																	91616866		2203	4300	6503	90806686	SO:0001583	missense	1903	exon2			AF022139	CCDS6680.1	9q22.1-q22.2	2012-08-08	2008-04-30	2008-04-30	ENSG00000213694	ENSG00000213694		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	3167	protein-coding gene	gene with protein product	"""sphingosine-1-phosphate receptor 3"""	601965	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 3"""	EDG3		8878560, 9409733	Standard	NM_005226		Approved	EDG-3	uc004aqe.4	Q99500	OTTHUMG00000020173	ENST00000375846.3:c.751G>A	9.37:g.91616866G>A	ENSP00000365006:p.Val251Met	Somatic		Capture	SOLID	Phase_I	90806686	NM_005226	Q5SQD8|Q7Z5I2	Missense_Mutation	SNP	ENST00000375846.3	37	CCDS6680.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	21.8	4.203245	0.79127	.	.	ENSG00000213694	ENST00000358157;ENST00000375846	T;T	0.75821	-0.97;-0.97	5.11	4.2	0.49525	GPCR, rhodopsin-like superfamily (1);	0.068577	0.64402	D	0.000020	D	0.84492	0.5484	M	0.82193	2.58	0.58432	D	0.999996	D	0.69078	0.997	P	0.60415	0.874	D	0.86739	0.1953	10	0.87932	D	0	.	14.5134	0.67804	0.0741:0.0:0.9259:0.0	.	251	Q99500	S1PR3_HUMAN	M	251	ENSP00000350878:V251M;ENSP00000365006:V251M	ENSP00000350878:V251M	V	+	1	0	S1PR3	90806686	1.000000	0.71417	0.985000	0.45067	0.966000	0.64601	6.274000	0.72587	2.815000	0.96918	0.561000	0.74099	GTG		S1PR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052979.2	NM_005226	
PTGS1	5742	hgsc.bcm.edu	37	9	125143763	125143763	+	Missense_Mutation	SNP	T	T	A	rs200351496		TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr9:125143763T>A	ENST00000362012.2	+	6	615	c.610T>A	c.(610-612)Ttc>Atc	p.F204I	PTGS1_ENST00000373698.5_Missense_Mutation_p.F95I|PTGS1_ENST00000540753.1_Missense_Mutation_p.F179I|PTGS1_ENST00000223423.4_Missense_Mutation_p.F204I	NM_000962.3|NM_001271164.1|NM_001271367.1|NM_080591.2	NP_000953.2|NP_001258093.1|NP_001258296.1|NP_542158.1	P23219	PGH1_HUMAN	prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)	204					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|prostaglandin biosynthetic process (GO:0001516)|regulation of blood pressure (GO:0008217)|regulation of cell proliferation (GO:0042127)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)	dioxygenase activity (GO:0051213)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)|prostaglandin-endoperoxide synthase activity (GO:0004666)	p.F204I(1)		large_intestine(3)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	8					Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Antipyrine(DB01435)|Antrafenine(DB01419)|Balsalazide(DB01014)|Bortezomib(DB00188)|Bromfenac(DB00963)|Candesartan(DB00796)|Carprofen(DB00821)|Carvedilol(DB01136)|Chlorpropamide(DB00672)|Dapsone(DB00250)|Desmopressin(DB00035)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Diflunisal(DB00861)|Dihomo-gamma-linolenic acid(DB00154)|Diphenhydramine(DB01075)|Dronabinol(DB00470)|Eletriptan(DB00216)|Eszopiclone(DB00402)|Etodolac(DB00749)|Etoposide(DB00773)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|Hexobarbital(DB01355)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Icosapent(DB00159)|Ifosfamide(DB01181)|Imatinib(DB00619)|Indomethacin(DB00328)|Irbesartan(DB01029)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lornoxicam(DB06725)|Lumiracoxib(DB01283)|Magnesium salicylate(DB01397)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Minoxidil(DB00350)|Montelukast(DB00471)|Nabumetone(DB00461)|Naproxen(DB00788)|Nateglinide(DB00731)|Nepafenac(DB06802)|Niflumic Acid(DB04552)|Nortriptyline(DB00540)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Rosiglitazone(DB00412)|Salicylate-sodium(DB01398)|Salicylic acid(DB00936)|Salsalate(DB01399)|Sulfamethoxazole(DB01015)|Sulfasalazine(DB00795)|Sulindac(DB00605)|Suprofen(DB00870)|Tenoxicam(DB00469)|Terbinafine(DB00857)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Torasemide(DB00214)|Trabectedin(DB05109)|Triflusal(DB08814)|Trisalicylate-choline(DB01401)|Valproic Acid(DB00313)|Voriconazole(DB00582)|Zafirlukast(DB00549)|Zileuton(DB00744)|Zolpidem(DB00425)|Zopiclone(DB01198)	TGCACAACACTTCACCCACCA	0.577																																					p.F204I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T610A	9						.						74.0	78.0	77.0					9																	125143763		2203	4300	6503	124183584	SO:0001583	missense	5742	exon6			M59979	CCDS6842.1, CCDS6843.1, CCDS59520.1, CCDS59521.1, CCDS75895.1	9q32-q33.3	2008-02-05			ENSG00000095303	ENSG00000095303	1.14.99.1		9604	protein-coding gene	gene with protein product		176805				2512924, 1907252	Standard	NM_000962		Approved	COX1, PGHS-1, PTGHS	uc004bmg.2	P23219	OTTHUMG00000020605	ENST00000362012.2:c.610T>A	9.37:g.125143763T>A	ENSP00000354612:p.Phe204Ile	Somatic		Capture	SOLID	Phase_I	124183584	NM_000962	A8K1V7|B4DHQ2|B4E2S5|Q15122|Q3HY28|Q3HY29|Q5T7T6|Q5T7T7|Q5T7T8	Missense_Mutation	SNP	ENST00000362012.2	37	CCDS6842.1	.	.	.	.	.	.	.	.	.	.	T	32	5.129095	0.94473	.	.	ENSG00000095303	ENST00000540753;ENST00000362012;ENST00000223423;ENST00000373698	T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.79528	0.4461	M	0.80847	2.515	0.80722	D	1	D;D;D	0.89917	0.992;1.0;0.999	D;D;D	0.78314	0.968;0.991;0.984	T	0.82824	-0.0266	10	0.87932	D	0	-30.1601	14.4699	0.67509	0.0:0.0:0.0:1.0	.	179;204;204	B4DHQ2;P23219;P23219-2	.;PGH1_HUMAN;.	I	179;204;204;95	ENSP00000437709:F179I;ENSP00000354612:F204I;ENSP00000223423:F204I;ENSP00000362802:F95I	ENSP00000223423:F204I	F	+	1	0	PTGS1	124183584	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.997000	0.88414	2.068000	0.61886	0.459000	0.35465	TTC		PTGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053933.1		
F10	2159	hgsc.bcm.edu	37	13	113803354	113803354	+	Silent	SNP	C	C	A			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr13:113803354C>A	ENST00000375559.3	+	8	1028	c.990C>A	c.(988-990)acC>acA	p.T330T	F10_ENST00000375551.3_Missense_Mutation_p.P327H|F10_ENST00000409306.1_Missense_Mutation_p.P329H	NM_000504.3	NP_000495.1	P00742	FA10_HUMAN	coagulation factor X	330	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|blood coagulation, intrinsic pathway (GO:0007597)|cellular protein metabolic process (GO:0044267)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of cell migration (GO:0030335)|positive regulation of protein kinase B signaling (GO:0051897)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|intrinsic component of external side of plasma membrane (GO:0031233)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phospholipid binding (GO:0005543)|serine-type endopeptidase activity (GO:0004252)	p.T330T(1)		endometrium(2)|large_intestine(4)|lung(10)|pancreas(1)|stomach(1)	18	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.113)|all_lung(25;0.0364)|all_epithelial(44;0.0373)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0805)|Epithelial(84;0.231)		Antihemophilic Factor(DB00025)|Apixaban(DB06605)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Enoxaparin(DB01225)|Fondaparinux sodium(DB00569)|Heparin(DB01109)|Menadione(DB00170)|Rivaroxaban(DB06228)	GGCTCAAGACCCCCATCACCT	0.632																																					p.T330T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C990A	13						.						164.0	128.0	140.0					13																	113803354		2203	4300	6503	112851355	SO:0001819	synonymous_variant	2159	exon8				CCDS9530.1	13q34	2012-10-02			ENSG00000126218	ENSG00000126218	3.4.21.6		3528	protein-coding gene	gene with protein product		613872					Standard	XM_005268298		Approved		uc001vsx.3	P00742	OTTHUMG00000017374	ENST00000375559.3:c.990C>A	13.37:g.113803354C>A		Somatic		Capture	SOLID	Phase_I	112851355	NM_000504	Q14340	Silent	SNP	ENST00000375559.3	37	CCDS9530.1	.	.	.	.	.	.	.	.	.	.	C	7.786	0.710504	0.15239	.	.	ENSG00000126218	ENST00000409306;ENST00000375551	D;D	0.95853	-3.8;-3.83	5.25	-8.01	0.01122	.	.	.	.	.	D	0.90034	0.6888	.	.	.	0.50039	D	0.999844	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.65356	-0.6188	8	0.87932	D	0	.	8.4442	0.32833	0.2124:0.5898:0.1131:0.0847	.	329;327	B7ZBK1;Q5JVE8	.;.	H	329;327	ENSP00000387092:P329H;ENSP00000364701:P327H	ENSP00000364701:P327H	P	+	2	0	F10	112851355	0.000000	0.05858	0.379000	0.26080	0.000000	0.00434	-2.002000	0.01464	-1.310000	0.02312	-1.253000	0.01494	CCC		F10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045841.3		
C6	729	hgsc.bcm.edu	37	5	41201809	41201809	+	Missense_Mutation	SNP	C	C	G			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr5:41201809C>G	ENST00000263413.3	-	3	415	c.151G>C	c.(151-153)Gta>Cta	p.V51L	C6_ENST00000337836.5_Missense_Mutation_p.V51L	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	51	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)		p.V51L(1)		central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				TTATCTACTACTATTTGTCTG	0.378																																					p.V51L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G151C	5						.						87.0	88.0	88.0					5																	41201809		2203	4300	6503	41237566	SO:0001583	missense	729	exon3			J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.151G>C	5.37:g.41201809C>G	ENSP00000263413:p.Val51Leu	Somatic		Capture	SOLID	Phase_I	41237566	NM_000065		Missense_Mutation	SNP	ENST00000263413.3	37	CCDS3936.1	.	.	.	.	.	.	.	.	.	.	C	7.468	0.646124	0.14451	.	.	ENSG00000039537	ENST00000337836;ENST00000263413;ENST00000417809	T;T;T	0.54279	0.58;0.58;0.58	5.92	4.16	0.48862	.	0.948508	0.09005	N	0.862495	T	0.36524	0.0970	N	0.26162	0.8	0.09310	N	1	B	0.22746	0.074	B	0.23852	0.049	T	0.31251	-0.9950	10	0.26408	T	0.33	-3.1692	3.2051	0.06663	0.1413:0.5705:0.1369:0.1512	.	51	P13671	CO6_HUMAN	L	51	ENSP00000338861:V51L;ENSP00000263413:V51L;ENSP00000396565:V51L	ENSP00000263413:V51L	V	-	1	0	C6	41237566	0.000000	0.05858	0.024000	0.17045	0.880000	0.50808	-0.267000	0.08619	0.854000	0.35336	0.655000	0.94253	GTA		C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211592.1		
ADCY2	108	hgsc.bcm.edu	37	5	7414806	7414806	+	Missense_Mutation	SNP	T	T	G			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr5:7414806T>G	ENST00000338316.4	+	2	420	c.331T>G	c.(331-333)Ttg>Gtg	p.L111V		NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	111					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)	p.L111V(1)		NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						CCTCTTCTCGTTGGTGATATG	0.458																																					p.L111V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T331G	5						.						272.0	229.0	244.0					5																	7414806		2203	4300	6503	7467806	SO:0001583	missense	108	exon2			AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.331T>G	5.37:g.7414806T>G	ENSP00000342952:p.Leu111Val	Somatic		Capture	SOLID	Phase_I	7467806	NM_020546	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	ENST00000338316.4	37	CCDS3872.2	.	.	.	.	.	.	.	.	.	.	T	9.179	1.023136	0.19433	.	.	ENSG00000078295	ENST00000338316	T	0.78126	-1.15	5.0	-1.3	0.09259	.	0.080946	0.51477	N	0.000097	T	0.58779	0.2146	L	0.38531	1.155	0.80722	D	1	B	0.12630	0.006	B	0.12156	0.007	T	0.29610	-1.0006	10	0.14252	T	0.57	.	5.3102	0.15825	0.0:0.3446:0.3355:0.3199	.	111	Q08462	ADCY2_HUMAN	V	111	ENSP00000342952:L111V	ENSP00000342952:L111V	L	+	1	2	ADCY2	7467806	0.000000	0.05858	0.047000	0.18901	0.942000	0.58702	-0.708000	0.05035	-0.390000	0.07774	0.460000	0.39030	TTG		ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546	
RAB3C	115827	hgsc.bcm.edu	37	5	58021921	58021921	+	Silent	SNP	A	A	G			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr5:58021921A>G	ENST00000282878.4	+	3	514	c.345A>G	c.(343-345)gaA>gaG	p.E115E	RAB3C_ENST00000507977.1_3'UTR	NM_138453.2	NP_612462.1	Q96E17	RAB3C_HUMAN	RAB3C, member RAS oncogene family	115					antigen processing and presentation (GO:0019882)|GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)	p.E115E(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(6)|ovary(1)	21		all_cancers(5;9.93e-10)|all_epithelial(5;1.49e-10)|all_lung(5;8.97e-05)|Lung NSC(5;0.000139)|Prostate(74;0.0664)		OV - Ovarian serous cystadenocarcinoma(10;1.8e-34)		TTACAAATGAAGAATCCTTCA	0.403																																					p.E115E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A345G	5						.						119.0	114.0	115.0					5																	58021921		2203	4300	6503	58057678	SO:0001819	synonymous_variant	115827	exon3			AY026936	CCDS3976.1	5q13	2008-02-05			ENSG00000152932	ENSG00000152932		"""RAB, member RAS oncogene"""	30269	protein-coding gene	gene with protein product		612829				12296628	Standard	NM_138453		Approved		uc003jrp.3	Q96E17	OTTHUMG00000097053	ENST00000282878.4:c.345A>G	5.37:g.58021921A>G		Somatic		Capture	SOLID	Phase_I	58057678	NM_138453		Silent	SNP	ENST00000282878.4	37	CCDS3976.1																																																																																				RAB3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214156.2	NM_138453	
RASGRF2	5924	hgsc.bcm.edu	37	5	80388681	80388681	+	Silent	SNP	G	G	A			TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-A6-2683-01A-01W-0831-10	TCGA-A6-2683-10A-01W-0831-10	g.chr5:80388681G>A	ENST00000265080.4	+	10	1519	c.1452G>A	c.(1450-1452)tcG>tcA	p.S484S		NM_006909.2	NP_008840.1	O14827	RGRF2_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 2	484	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.S484S(1)		biliary_tract(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(28)|ovary(5)|prostate(3)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		GCCTGGGTTCGTTGTCTTTGA	0.378																																					p.S484S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1452A	5						.						114.0	114.0	114.0					5																	80388681		2203	4300	6503	80424437	SO:0001819	synonymous_variant	5924	exon10			AF023130	CCDS4052.1	5q13	2013-01-10			ENSG00000113319	ENSG00000113319		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9876	protein-coding gene	gene with protein product		606614					Standard	NM_006909		Approved	GRF2, Ras-GRF2	uc003kha.2	O14827	OTTHUMG00000119015	ENST00000265080.4:c.1452G>A	5.37:g.80388681G>A		Somatic		Capture	SOLID	Phase_I	80424437	NM_006909	B9EG89|Q9UK56	Silent	SNP	ENST00000265080.4	37	CCDS4052.1																																																																																				RASGRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239215.2	NM_006909	
