#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PYROXD2	84795	broad.mit.edu	37	10	100152252	100152252	+	Silent	SNP	C	C	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr10:100152252C>T	ENST00000370575.4	-	10	1047	c.999G>A	c.(997-999)gtG>gtA	p.V333V	PYROXD2_ENST00000483923.1_5'UTR|MIR1287_ENST00000408492.1_RNA	NM_032709.2	NP_116098.2	Q8N2H3	PYRD2_HUMAN	pyridine nucleotide-disulphide oxidoreductase domain 2	333							oxidoreductase activity (GO:0016491)	p.V333V(1)		central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	12						TTTTGCTTCTCACCTCTGTGC	0.552																																					p.V333V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G999A	10						.						269.0	183.0	212.0					10																	100152252		2203	4300	6503	100142242	SO:0001819	synonymous_variant	84795	exon10			AK074429	CCDS7474.1	10q24.2	2009-04-22	2009-04-22	2009-04-22	ENSG00000119943	ENSG00000119943			23517	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 33"""	C10orf33			Standard	NM_032709		Approved	FLJ23849	uc001kpc.3	Q8N2H3	OTTHUMG00000018877	ENST00000370575.4:c.999G>A	10.37:g.100152252C>T		Somatic		Capture	Illumina HiSeq	Phase_I	100142242	NM_032709	D3DR61|Q5TAA9|Q9BRQ1	Silent	SNP	ENST00000370575.4	37	CCDS7474.1																																																																																				PYROXD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049782.2	NM_032709	
FBXO18	84893	broad.mit.edu	37	10	5956157	5956157	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr10:5956157C>G	ENST00000362091.4	+	8	1436	c.1321C>G	c.(1321-1323)Ctt>Gtt	p.L441V	FBXO18_ENST00000397269.3_5'UTR|FBXO18_ENST00000379999.5_Missense_Mutation_p.L492V	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18	441					DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)	p.L492V(1)		NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						AACCATCCAACTTACACATGA	0.413																																					p.L492V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1474G	10						.						126.0	126.0	126.0					10																	5956157		2203	4300	6503	5996163	SO:0001583	missense	84893	exon9			AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.1321C>G	10.37:g.5956157C>G	ENSP00000355415:p.Leu441Val	Somatic		Capture	Illumina HiSeq	Phase_I	5996163	NM_032807	Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	Missense_Mutation	SNP	ENST00000362091.4	37	CCDS7072.1	.	.	.	.	.	.	.	.	.	.	C	17.81	3.481066	0.63849	.	.	ENSG00000134452	ENST00000362091;ENST00000544954;ENST00000379999;ENST00000379994	D;D;D	0.88046	-2.33;-2.33;-2.33	5.34	5.34	0.76211	.	0.000000	0.64402	D	0.000001	D	0.92388	0.7584	M	0.64997	1.995	0.80722	D	1	D;D;D	0.76494	0.999;0.997;0.994	D;P;P	0.70227	0.968;0.905;0.804	D	0.92337	0.5878	10	0.52906	T	0.07	-7.2408	18.6551	0.91450	0.0:1.0:0.0:0.0	.	492;441;367	Q8NFZ0-2;Q8NFZ0;Q2TAK1	.;FBX18_HUMAN;.	V	441;178;492;178	ENSP00000355415:L441V;ENSP00000369335:L492V;ENSP00000369330:L178V	ENSP00000355415:L441V	L	+	1	0	FBXO18	5996163	0.793000	0.28825	0.941000	0.38009	0.809000	0.45718	1.479000	0.35453	2.496000	0.84212	0.561000	0.74099	CTT		FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046596.1	NM_032807	
PRKCQ	5588	broad.mit.edu	37	10	6470304	6470304	+	Silent	SNP	G	G	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr10:6470304G>A	ENST00000263125.5	-	18	2085	c.1986C>T	c.(1984-1986)agC>agT	p.S662S	PRKCQ_ENST00000397176.2_Silent_p.S599S|PRKCQ_ENST00000539722.1_Silent_p.S537S	NM_001282644.1|NM_006257.3	NP_001269573.1|NP_006248.1	Q04759	KPCT_HUMAN	protein kinase C, theta	662	AGC-kinase C-terminal.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of T cell apoptotic process (GO:0070233)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of T-helper 2 cell activation (GO:2000570)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of transcription, DNA-templated (GO:0006355)|rhodopsin mediated signaling pathway (GO:0016056)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)	p.S662S(1)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(2)	45					Tamoxifen(DB00675)	TGTCGAAATTGCTGCAGTCAA	0.398																																					p.S662S	Ovarian(50;572 1126 10530 25349 30594)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1986T	10						.						177.0	184.0	182.0					10																	6470304		2203	4300	6503	6510310	SO:0001819	synonymous_variant	5588	exon18			L07032	CCDS7079.1, CCDS55701.1, CCDS60482.1	10p15	2009-07-10			ENSG00000065675	ENSG00000065675	2.7.11.1		9410	protein-coding gene	gene with protein product		600448				8444877	Standard	NM_001282645		Approved		uc001ijj.2	Q04759	OTTHUMG00000017623	ENST00000263125.5:c.1986C>T	10.37:g.6470304G>A		Somatic		Capture	Illumina HiSeq	Phase_I	6510310	NM_006257	B4DF52|Q14DH6|Q3MJF1|Q64FY5|Q9H508|Q9H549	Silent	SNP	ENST00000263125.5	37	CCDS7079.1	.	.	.	.	.	.	.	.	.	.	G	7.799	0.713139	0.15306	.	.	ENSG00000065675	ENST00000397178	.	.	.	5.3	4.39	0.52855	.	.	.	.	.	T	0.68760	0.3036	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.67333	-0.5697	4	.	.	.	.	13.8861	0.63710	0.0755:0.0:0.9245:0.0	.	.	.	.	V	435	.	.	A	-	2	0	PRKCQ	6510310	1.000000	0.71417	1.000000	0.80357	0.679000	0.39708	3.270000	0.51600	2.480000	0.83734	0.561000	0.74099	GCA		PRKCQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046665.1	NM_006257	
GJD4	219770	broad.mit.edu	37	10	35896721	35896721	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr10:35896721G>A	ENST00000321660.1	+	2	438	c.280G>A	c.(280-282)Gtc>Atc	p.V94I	RP11-425A6.5_ENST00000609313.1_RNA	NM_153368.2	NP_699199.2	Q96KN9	CXD4_HUMAN	gap junction protein, delta 4, 40.1kDa	94					cell communication (GO:0007154)|regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014717)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)		p.V94I(1)		central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16						CGTCTTCAGCGTCTATGTCCT	0.716																																					p.V94I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G280A	10						.						97.0	81.0	87.0					10																	35896721		2203	4300	6503	35936727	SO:0001583	missense	219770	exon2			AJ414564	CCDS7191.1	10p11.22	2007-11-27			ENSG00000177291	ENSG00000177291		"""Ion channels / Gap junction proteins (connexins)"""	23296	protein-coding gene	gene with protein product	"""connexin 40.1"""	611922				12477932	Standard	NM_153368		Approved	CX40.1, FLJ90023	uc001iyy.1	Q96KN9	OTTHUMG00000017957	ENST00000321660.1:c.280G>A	10.37:g.35896721G>A	ENSP00000315070:p.Val94Ile	Somatic		Capture	Illumina HiSeq	Phase_I	35936727	NM_153368	Q8N2R7	Missense_Mutation	SNP	ENST00000321660.1	37	CCDS7191.1	.	.	.	.	.	.	.	.	.	.	G	12.95	2.090755	0.36855	.	.	ENSG00000177291	ENST00000321660	D	0.99070	-5.39	6.11	4.21	0.49690	Connexin, N-terminal (1);	0.549637	0.21254	N	0.077586	D	0.95592	0.8567	N	0.25245	0.725	0.09310	N	1	P	0.50272	0.933	B	0.37780	0.258	D	0.91257	0.5034	10	0.51188	T	0.08	.	8.2261	0.31570	0.1522:0.1315:0.7163:0.0	.	94	Q96KN9	CXD4_HUMAN	I	94	ENSP00000315070:V94I	ENSP00000315070:V94I	V	+	1	0	GJD4	35936727	0.667000	0.27484	0.001000	0.08648	0.011000	0.07611	1.052000	0.30429	0.854000	0.35336	0.655000	0.94253	GTC		GJD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047576.1	NM_153368	
TMEM72	643236	broad.mit.edu	37	10	45430219	45430219	+	Silent	SNP	C	C	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr10:45430219C>T	ENST00000544540.1	+	4	595	c.111C>T	c.(109-111)agC>agT	p.S37S	RP11-285G1.9_ENST00000425541.2_lincRNA|TMEM72-AS1_ENST00000450287.2_RNA			A0PK05	TMM72_HUMAN	transmembrane protein 72	155						integral component of membrane (GO:0016021)		p.S155S(2)		breast(2)|kidney(1)|large_intestine(2)|lung(10)	15						CCTCTAGCAGCGCTGTGAGCA	0.602																																					p.S155S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C465T	10						.						100.0	106.0	104.0					10																	45430219		1568	3582	5150	44750225	SO:0001819	synonymous_variant	643236	exon5			AB235418	CCDS41504.1	10q11.21	2008-10-24	2008-08-21	2008-08-21	ENSG00000187783	ENSG00000187783			31658	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 127"""	C10orf127			Standard	NM_001123376		Approved	bA285G1.3, KSP37	uc001jbn.2	A0PK05	OTTHUMG00000018067	ENST00000544540.1:c.111C>T	10.37:g.45430219C>T		Somatic		Capture	Illumina HiSeq	Phase_I	44750225	NM_001123376	A1L181|Q5T740	Silent	SNP	ENST00000544540.1	37																																																																																					TMEM72-201	KNOWN	basic	protein_coding	protein_coding		NM_001123376	
RBP3	5949	broad.mit.edu	37	10	48390214	48390214	+	Missense_Mutation	SNP	C	C	T	rs527361141		TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr10:48390214C>T	ENST00000224600.4	-	1	777	c.664G>A	c.(664-666)Ggt>Agt	p.G222S	AL731561.2_ENST00000581861.1_RNA	NM_002900.2	NP_002891.1	P10745	RET3_HUMAN	retinol binding protein 3, interstitial	222	4 X approximate tandem repeats.				lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transport (GO:0006810)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interphotoreceptor matrix (GO:0033165)|vesicle (GO:0031982)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|serine-type peptidase activity (GO:0008236)	p.G222S(1)		central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(30)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59					Vitamin A(DB00162)	TTGTCGGCACCGTACCTTTCT	0.622													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19474	0.0		0.0	False		,,,				2504	0.0				p.G222S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G664A	10						.						98.0	86.0	90.0					10																	48390214		2203	4300	6503	48010220	SO:0001583	missense	5949	exon1			M22453	CCDS73119.1	10q11.2	2014-05-06	2001-11-28		ENSG00000107618	ENSG00000265203			9921	protein-coding gene	gene with protein product		180290	"""retinol-binding protein 3, interstitial"""				Standard	NM_002900		Approved	D10S64, D10S65, D10S66, RP66	uc001jez.3	P10745	OTTHUMG00000188321	ENST00000224600.4:c.664G>A	10.37:g.48390214C>T	ENSP00000224600:p.Gly222Ser	Somatic		Capture	Illumina HiSeq	Phase_I	48010220	NM_002900	Q0QD34|Q5VSR0|Q8IXN0	Missense_Mutation	SNP	ENST00000224600.4	37	CCDS7218.1	.	.	.	.	.	.	.	.	.	.	C	8.376	0.836528	0.16891	.	.	ENSG00000107618	ENST00000224600	T	0.62498	0.02	5.71	-3.53	0.04667	Interphotoreceptor retinol-binding (2);	0.383954	0.33895	N	0.004457	T	0.46073	0.1374	N	0.10972	0.075	0.21184	N	0.999763	P	0.46277	0.875	P	0.55222	0.771	T	0.51857	-0.8652	10	0.02654	T	1	-4.9106	14.0492	0.64725	0.0:0.5713:0.0:0.4287	.	222	P10745	RET3_HUMAN	S	222	ENSP00000224600:G222S	ENSP00000224600:G222S	G	-	1	0	RBP3	48010220	0.112000	0.22096	0.015000	0.15790	0.763000	0.43281	0.085000	0.14912	-0.390000	0.07774	-0.150000	0.13652	GGT		RBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047888.1	NM_002900	
ERCC6	2074	broad.mit.edu	37	10	50684289	50684289	+	Missense_Mutation	SNP	A	A	T	rs55986153		TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr10:50684289A>T	ENST00000355832.5	-	12	2432	c.2354T>A	c.(2353-2355)gTt>gAt	p.V785D	ERCC6_ENST00000542458.1_Missense_Mutation_p.V155D	NM_000124.2	NP_000115.1	Q03468	ERCC6_HUMAN	excision repair cross-complementation group 6	785					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|photoreceptor cell maintenance (GO:0045494)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of protein tyrosine kinase activity (GO:0061098)|pyrimidine dimer repair (GO:0006290)|regulation of DNA-templated transcription, elongation (GO:0032784)|response to gamma radiation (GO:0010332)|response to oxidative stress (GO:0006979)|response to superoxide (GO:0000303)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein N-terminus binding (GO:0047485)|protein tyrosine kinase activator activity (GO:0030296)	p.V785D(1)		breast(5)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						AATCCTGTAAACTTCTTTGGA	0.388								Direct reversal of damage;Nucleotide excision repair (NER)																													p.V785D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2354A	10						.						61.0	60.0	60.0					10																	50684289		2203	4300	6503	50354295	SO:0001583	missense	2074	exon12			L04791	CCDS7229.1	10q11	2014-09-17	2014-03-07		ENSG00000225830	ENSG00000225830			3438	protein-coding gene	gene with protein product	"""Cockayne syndrome B protein"""	609413	"""excision repair cross-complementing rodent repair deficiency, complementation group 6"""	CKN2		1339317, 19179336	Standard	NM_000124		Approved	CSB, RAD26, ARMD5	uc001jhs.5	Q03468	OTTHUMG00000018195	ENST00000355832.5:c.2354T>A	10.37:g.50684289A>T	ENSP00000348089:p.Val785Asp	Somatic		Capture	Illumina HiSeq	Phase_I	50354295	NM_000124	D3DX94|Q5W0L9	Missense_Mutation	SNP	ENST00000355832.5	37	CCDS7229.1	.	.	.	.	.	.	.	.	.	.	A	25.6	4.656702	0.88154	.	.	ENSG00000225830	ENST00000355832;ENST00000539110;ENST00000542458	T;T	0.76709	-1.04;-1.04	5.18	5.18	0.71444	SNF2-related (1);	.	.	.	.	D	0.86041	0.5838	M	0.67517	2.055	0.80722	D	1	D	0.63880	0.993	D	0.67900	0.954	D	0.87768	0.2603	9	0.87932	D	0	-18.0355	15.0171	0.71594	1.0:0.0:0.0:0.0	.	785	Q03468	ERCC6_HUMAN	D	785;34;155	ENSP00000348089:V785D;ENSP00000445134:V155D	ENSP00000348089:V785D	V	-	2	0	ERCC6	50354295	1.000000	0.71417	0.974000	0.42286	0.983000	0.72400	9.108000	0.94275	1.959000	0.56917	0.374000	0.22700	GTT		ERCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047990.1	NM_000124	
OGDHL	55753	broad.mit.edu	37	10	50959882	50959882	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr10:50959882C>T	ENST00000374103.4	-	6	825	c.740G>A	c.(739-741)cGc>cAc	p.R247H	OGDHL_ENST00000419399.1_Missense_Mutation_p.R190H|OGDHL_ENST00000432695.1_Missense_Mutation_p.R38H	NM_018245.2	NP_060715.2	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like	247					glycolytic process (GO:0006096)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)	p.R247H(1)		central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	61						CCTCATGGAGCGCACTAGCCG	0.622																																					p.R190H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G569A	10						.						73.0	77.0	76.0					10																	50959882		2203	4300	6503	50629888	SO:0001583	missense	55753	exon5			AK001713	CCDS7234.1, CCDS44390.1, CCDS44391.1	10q11.23	2013-09-20			ENSG00000197444	ENSG00000197444			25590	protein-coding gene	gene with protein product						10574462	Standard	NM_018245		Approved	FLJ10851	uc001jie.3	Q9ULD0	OTTHUMG00000018200	ENST00000374103.4:c.740G>A	10.37:g.50959882C>T	ENSP00000363216:p.Arg247His	Somatic		Capture	Illumina HiSeq	Phase_I	50629888	NM_001143996	A8K2G1|B4DKG2|B4E193|Q8TAN9|Q9NVA0	Missense_Mutation	SNP	ENST00000374103.4	37	CCDS7234.1	.	.	.	.	.	.	.	.	.	.	C	16.36	3.102681	0.56183	.	.	ENSG00000197444	ENST00000374103;ENST00000419399;ENST00000432695	D;D;D	0.95853	-3.83;-3.83;-3.83	5.57	5.57	0.84162	Dehydrogenase, E1 component (1);	0.000000	0.85682	D	0.000000	D	0.95265	0.8464	M	0.66439	2.03	0.80722	D	1	P;P;P	0.45672	0.705;0.705;0.864	B;B;B	0.43658	0.237;0.237;0.426	D	0.94823	0.7989	10	0.44086	T	0.13	.	19.5544	0.95335	0.0:1.0:0.0:0.0	.	190;38;247	Q9ULD0-2;Q9ULD0-3;Q9ULD0	.;.;OGDHL_HUMAN	H	247;190;38	ENSP00000363216:R247H;ENSP00000401356:R190H;ENSP00000390240:R38H	ENSP00000363216:R247H	R	-	2	0	OGDHL	50629888	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.781000	0.68964	2.627000	0.88993	0.655000	0.94253	CGC		OGDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048007.1	NM_018245	
LRRTM3	347731	broad.mit.edu	37	10	68687737	68687737	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr10:68687737G>T	ENST00000361320.4	+	2	1641	c.1063G>T	c.(1063-1065)Gtg>Ttg	p.V355L	CTNNA3_ENST00000433211.2_Intron|CTNNA3_ENST00000373744.4_Intron	NM_178011.3	NP_821079.3	Q86VH5	LRRT3_HUMAN	leucine rich repeat transmembrane neuronal 3	355	LRRCT.				positive regulation of beta-amyloid formation (GO:1902004)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.V355L(2)		breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	41						GATCGATGCAGTGAAGAACTA	0.478																																					p.V355L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1063T	10						.						70.0	72.0	71.0					10																	68687737		2203	4300	6503	68357743	SO:0001583	missense	347731	exon2			BX640611	CCDS7270.1	10q22.1	2007-01-22				ENSG00000198739			19410	protein-coding gene	gene with protein product		610869				12676565	Standard	XR_247527		Approved		uc001jmz.1	Q86VH5		ENST00000361320.4:c.1063G>T	10.37:g.68687737G>T	ENSP00000355187:p.Val355Leu	Somatic		Capture	Illumina HiSeq	Phase_I	68357743	NM_178011	A8K2A3|Q2NKX7|Q6N0A3	Missense_Mutation	SNP	ENST00000361320.4	37	CCDS7270.1	.	.	.	.	.	.	.	.	.	.	G	15.66	2.900308	0.52227	.	.	ENSG00000198739	ENST00000361320;ENST00000373722	T	0.47177	0.85	5.94	5.94	0.96194	.	0.000000	0.64402	D	0.000009	T	0.59487	0.2197	L	0.61218	1.895	0.52099	D	0.999947	P;D	0.54772	0.879;0.968	P;P	0.54346	0.688;0.749	T	0.50030	-0.8875	10	0.18710	T	0.47	.	19.1373	0.93433	0.0:0.0:1.0:0.0	.	355;355	Q86VH5;Q86VH5-2	LRRT3_HUMAN;.	L	355	ENSP00000355187:V355L	ENSP00000355187:V355L	V	+	1	0	LRRTM3	68357743	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.978000	0.63799	2.820000	0.97059	0.650000	0.86243	GTG		LRRTM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048277.2	NM_178011	
CHST15	51363	broad.mit.edu	37	10	125805630	125805630	+	Silent	SNP	C	C	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr10:125805630C>T	ENST00000346248.5	-	2	741	c.99G>A	c.(97-99)gcG>gcA	p.A33A	CHST15_ENST00000435907.1_Silent_p.A33A|CHST15_ENST00000421115.1_Silent_p.A33A|CHST15_ENST00000462406.1_5'UTR	NM_015892.4	NP_056976.2	Q7LFX5	CHSTF_HUMAN	carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15	33					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|hexose biosynthetic process (GO:0019319)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase activity (GO:0050659)	p.A33A(1)		endometrium(4)|kidney(1)|large_intestine(11)|lung(6)|ovary(3)|stomach(1)	26						ACGTGGGGCACGCCTGGTGAC	0.532																																					p.A33A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G99A	10						.						58.0	56.0	56.0					10																	125805630		2203	4300	6503	125795620	SO:0001819	synonymous_variant	51363	exon2			AB011170	CCDS7638.1	10q26	2009-07-09			ENSG00000182022	ENSG00000182022	2.8.2.33	"""Sulfotransferases, membrane-bound"""	18137	protein-coding gene	gene with protein product	"""B cell RAG associated protein"", ""N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase"""	608277				9628581, 9754571, 11572857	Standard	NM_014863		Approved	GALNAC4S-6ST, BRAG, KIAA0598	uc001lhm.4	Q7LFX5	OTTHUMG00000019208	ENST00000346248.5:c.99G>A	10.37:g.125805630C>T		Somatic		Capture	Illumina HiSeq	Phase_I	125795620	NM_015892	O60338|O60474|Q86VM4	Silent	SNP	ENST00000346248.5	37	CCDS7638.1																																																																																				CHST15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050856.1	NM_015892	
CADM1	23705	broad.mit.edu	37	11	115049396	115049396	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr11:115049396A>G	ENST00000452722.3	-	9	1198	c.1178T>C	c.(1177-1179)aTc>aCc	p.I393T	CADM1_ENST00000536727.1_Missense_Mutation_p.I394T|CADM1_ENST00000331581.6_Missense_Mutation_p.I422T|CADM1_ENST00000542447.2_Missense_Mutation_p.I365T|CADM1_ENST00000537140.1_5'UTR|CADM1_ENST00000537058.1_Missense_Mutation_p.I404T	NM_014333.3	NP_055148.3			cell adhesion molecule 1									p.I393T(1)		cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(9)|ovary(2)|skin(1)	32	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		CCCCAGAATGATGAGCAAGCA	0.552																																					p.I393T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1178C	11						.						158.0	145.0	149.0					11																	115049396		2201	4296	6497	114554606	SO:0001583	missense	23705	exon9			AB017563	CCDS8373.1, CCDS53711.1, CCDS73397.1, CCDS73398.1, CCDS73399.1	11q23.2	2013-01-29	2007-02-07	2007-02-07	ENSG00000182985	ENSG00000182985		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5951	protein-coding gene	gene with protein product	"""nectin-like 2"""	605686	"""tumor suppressor in lung cancer 1"", ""immunoglobulin superfamily, member 4"""	TSLC1, IGSF4		10610705	Standard	NM_014333		Approved	NECL2, ST17, BL2, SYNCAM, IGSF4A, Necl-2, SYNCAM1, RA175	uc001ppi.4	Q9BY67	OTTHUMG00000168202	ENST00000452722.3:c.1178T>C	11.37:g.115049396A>G	ENSP00000395359:p.Ile393Thr	Somatic		Capture	Illumina HiSeq	Phase_I	114554606	NM_014333		Missense_Mutation	SNP	ENST00000452722.3	37	CCDS8373.1	.	.	.	.	.	.	.	.	.	.	A	17.47	3.398837	0.62177	.	.	ENSG00000182985	ENST00000542447;ENST00000452722;ENST00000537058;ENST00000536727;ENST00000404468;ENST00000331581;ENST00000541325	T;T;T;T;T	0.73575	-0.76;-0.16;0.19;-0.19;-0.06	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	D	0.85115	0.5623	M	0.75085	2.285	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;0.993;0.999;0.981	D;D;D;D	0.85130	0.997;0.977;0.98;0.95	D	0.85593	0.1247	10	0.45353	T	0.12	.	14.8691	0.70441	1.0:0.0:0.0:0.0	.	404;366;393;365	F5H0J4;A4FVB5;Q9BY67;A0A4Z1	.;.;CADM1_HUMAN;.	T	365;393;404;394;324;422;78	ENSP00000439176:I365T;ENSP00000395359:I393T;ENSP00000439817:I404T;ENSP00000440322:I394T;ENSP00000329797:I422T	ENSP00000329797:I422T	I	-	2	0	CADM1	114554606	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.761000	0.91691	2.115000	0.64714	0.533000	0.62120	ATC		CADM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398753.2	NM_014333	
TRIM68	55128	broad.mit.edu	37	11	4621926	4621926	+	Silent	SNP	G	G	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr11:4621926G>A	ENST00000300747.5	-	7	1327	c.1038C>T	c.(1036-1038)atC>atT	p.I346I		NM_018073.6	NP_060543.5	Q6AZZ1	TRI68_HUMAN	tripartite motif containing 68	346	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				protein autoubiquitination (GO:0051865)|regulation of androgen receptor signaling pathway (GO:0060765)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|histone acetyltransferase binding (GO:0035035)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.I346I(1)		breast(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(4)|ovary(1)|urinary_tract(1)	15		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;9.49e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0288)|LUSC - Lung squamous cell carcinoma(625;0.192)		TTCCCAGGACGATATTATAGC	0.527																																					p.I346I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1038T	11						.						59.0	60.0	60.0					11																	4621926		2201	4298	6499	4578502	SO:0001819	synonymous_variant	55128	exon7			AF360739	CCDS31356.1	11p15.4	2013-01-09	2011-01-25	2004-11-17		ENSG00000167333		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	21161	protein-coding gene	gene with protein product		613184	"""ring finger protein 137"", ""tripartite motif-containing 68"""	RNF137		11597395	Standard	NM_018073		Approved	SS-56, FLJ10369	uc001lzf.2	Q6AZZ1		ENST00000300747.5:c.1038C>T	11.37:g.4621926G>A		Somatic		Capture	Illumina HiSeq	Phase_I	4578502	NM_018073	A6NI19|A8K551|B3KPM5|B4DVK4|Q8WZ70|Q96LE5|Q96PF7|Q9H9C2|Q9NW18	Silent	SNP	ENST00000300747.5	37	CCDS31356.1																																																																																				TRIM68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385948.1	NM_018073	
OR52N1	79473	broad.mit.edu	37	11	5809592	5809592	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr11:5809592A>C	ENST00000317078.1	-	1	454	c.455T>G	c.(454-456)cTt>cGt	p.L152R	TRIM5_ENST00000380027.1_Intron	NM_001001913.1	NP_001001913.1	Q8NH53	O52N1_HUMAN	olfactory receptor, family 52, subfamily N, member 1	152						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L152R(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(15)|prostate(2)|skin(3)	31		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)		CACACCCCTAAGAAAAGTGAG	0.517																																					p.L152R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T455G	11						.						121.0	104.0	110.0					11																	5809592		2201	4296	6497	5766168	SO:0001583	missense	79473	exon1			AB065538	CCDS31398.1	11p15.4	2012-08-09			ENSG00000181001	ENSG00000181001		"""GPCR / Class A : Olfactory receptors"""	14853	protein-coding gene	gene with protein product							Standard	NM_001001913		Approved		uc010qzo.2	Q8NH53	OTTHUMG00000168800	ENST00000317078.1:c.455T>G	11.37:g.5809592A>C	ENSP00000322823:p.Leu152Arg	Somatic		Capture	Illumina HiSeq	Phase_I	5766168	NM_001001913	Q6IFF6	Missense_Mutation	SNP	ENST00000317078.1	37	CCDS31398.1	.	.	.	.	.	.	.	.	.	.	A	9.874	1.199761	0.22121	.	.	ENSG00000181001	ENST00000317078	T	0.45276	0.9	4.59	3.46	0.39613	GPCR, rhodopsin-like superfamily (1);	0.498524	0.16680	N	0.203974	T	0.68888	0.3050	H	0.94734	3.575	0.09310	N	1	P	0.46277	0.875	P	0.61003	0.882	T	0.61874	-0.6973	10	0.72032	D	0.01	.	9.0909	0.36610	0.9113:0.0:0.0887:0.0	.	152	Q8NH53	O52N1_HUMAN	R	152	ENSP00000322823:L152R	ENSP00000322823:L152R	L	-	2	0	OR52N1	5766168	0.000000	0.05858	0.042000	0.18584	0.142000	0.21351	-0.669000	0.05262	0.892000	0.36259	0.496000	0.49642	CTT		OR52N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401142.1	NM_001001913	
OR52E4	390081	broad.mit.edu	37	11	5906168	5906168	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr11:5906168G>A	ENST00000316987.2	+	1	668	c.646G>A	c.(646-648)Gcc>Acc	p.A216T		NM_001005165.1	NP_001005165.1	Q8NGH9	O52E4_HUMAN	olfactory receptor, family 52, subfamily E, member 4	216						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A216T(1)		autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(7)|liver(2)|lung(13)|ovary(2)|prostate(1)|skin(2)	30		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.24e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GATCTTAATTGCCTCTTCCTA	0.448																																					p.A216T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G646A	11						.						338.0	286.0	304.0					11																	5906168		2201	4296	6497	5862744	SO:0001583	missense	390081	exon1			AB065817	CCDS31401.1	11p15.4	2012-08-09			ENSG00000180974	ENSG00000180974		"""GPCR / Class A : Olfactory receptors"""	15213	protein-coding gene	gene with protein product							Standard	NM_001005165		Approved		uc010qzs.2	Q8NGH9	OTTHUMG00000168804	ENST00000316987.2:c.646G>A	11.37:g.5906168G>A	ENSP00000321426:p.Ala216Thr	Somatic		Capture	Illumina HiSeq	Phase_I	5862744	NM_001005165	Q6IFG0	Missense_Mutation	SNP	ENST00000316987.2	37	CCDS31401.1	.	.	.	.	.	.	.	.	.	.	G	2.504	-0.314479	0.05422	.	.	ENSG00000180974	ENST00000316987	T	0.00123	8.7	5.15	2.22	0.28083	GPCR, rhodopsin-like superfamily (1);	0.130115	0.34460	N	0.003960	T	0.00144	0.0004	L	0.38649	1.16	0.09310	N	1	B	0.06786	0.001	B	0.15052	0.012	T	0.18840	-1.0324	10	0.31617	T	0.26	.	10.1987	0.43071	0.0704:0.0:0.6849:0.2448	.	216	Q8NGH9	O52E4_HUMAN	T	216	ENSP00000321426:A216T	ENSP00000321426:A216T	A	+	1	0	OR52E4	5862744	0.000000	0.05858	0.034000	0.17996	0.013000	0.08279	-4.057000	0.00304	0.054000	0.16065	-0.852000	0.03032	GCC		OR52E4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401146.1	NM_001005165	
OR5M3	219482	broad.mit.edu	37	11	56237478	56237478	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr11:56237478A>C	ENST00000312240.2	-	1	536	c.496T>G	c.(496-498)Ttc>Gtc	p.F166V		NM_001004742.2	NP_001004742.2	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M, member 3	166						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F166V(1)		NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(15)|ovary(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	37	Esophageal squamous(21;0.00448)					TTTCCACAGAAGTACAAGCCG	0.393																																					p.F166V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T496G	11						.						109.0	98.0	102.0					11																	56237478		2201	4295	6496	55994054	SO:0001583	missense	219482	exon1			AB065746	CCDS31532.1	11q11	2012-08-09			ENSG00000174937	ENSG00000174937		"""GPCR / Class A : Olfactory receptors"""	14806	protein-coding gene	gene with protein product							Standard	NM_001004742		Approved		uc010rjk.2	Q8NGP4	OTTHUMG00000166875	ENST00000312240.2:c.496T>G	11.37:g.56237478A>C	ENSP00000312208:p.Phe166Val	Somatic		Capture	Illumina HiSeq	Phase_I	55994054	NM_001004742	B2RNM7|Q6IEW4|Q96RC0	Missense_Mutation	SNP	ENST00000312240.2	37	CCDS31532.1	.	.	.	.	.	.	.	.	.	.	A	16.83	3.231911	0.58777	.	.	ENSG00000174937	ENST00000312240	T	0.00145	8.67	5.22	2.83	0.33086	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000142	T	0.00552	0.0018	H	0.94886	3.595	0.25362	N	0.988772	D	0.89917	1.0	D	0.97110	1.0	T	0.40117	-0.9580	10	0.87932	D	0	-21.1363	5.1044	0.14775	0.7543:0.0:0.0867:0.159	.	166	Q8NGP4	OR5M3_HUMAN	V	166	ENSP00000312208:F166V	ENSP00000312208:F166V	F	-	1	0	OR5M3	55994054	0.149000	0.22717	0.996000	0.52242	0.777000	0.43975	0.830000	0.27462	0.284000	0.22305	0.448000	0.29417	TTC		OR5M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391639.1	NM_001004742	
CLP1	10978	broad.mit.edu	37	11	57428426	57428426	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr11:57428426C>G	ENST00000302731.4	+	3	724	c.604C>G	c.(604-606)Ctg>Gtg	p.L202V	CLP1_ENST00000533682.1_Missense_Mutation_p.L266V|CLP1_ENST00000529430.1_Missense_Mutation_p.L277V|CLP1_ENST00000525602.1_Missense_Mutation_p.L266V	NM_001142597.1|NM_006831.2	NP_001136069.1|NP_006822.1	Q5KU26	COL12_HUMAN	cleavage and polyadenylation factor I subunit 1	0					carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)	p.L266V(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|stomach(1)	15						GTACAATGAACTGAAACGGGA	0.552																																					p.L202V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C604G	11						.						137.0	126.0	130.0					11																	57428426		2201	4296	6497	57185002	SO:0001583	missense	10978	exon3			BC000446	CCDS7964.1, CCDS44600.1	11q12.1	2012-10-02	2012-10-02		ENSG00000172409	ENSG00000172409	2.7.1.78		16999	protein-coding gene	gene with protein product	"""ATP/GTPbinding protein"", ""polyribonucleotide 5'-hydroxyl-kinase"""	608757	"""CLP1, cleavage and polyadenylation factor I subunit, homolog (S. cerevisiae)"""			8896421, 11060040	Standard	NM_006831		Approved	HEAB, hClp1	uc001nkw.3	Q92989	OTTHUMG00000167146	ENST00000302731.4:c.604C>G	11.37:g.57428426C>G	ENSP00000304704:p.Leu202Val	Somatic		Capture	Illumina HiSeq	Phase_I	57185002	NM_001142597	Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Missense_Mutation	SNP	ENST00000302731.4	37	CCDS44600.1	.	.	.	.	.	.	.	.	.	.	C	18.55	3.647806	0.67358	.	.	ENSG00000172409	ENST00000529430;ENST00000533682;ENST00000525602;ENST00000302731	T;T;T;T	0.57752	0.38;0.38;0.38;0.38	5.9	3.01	0.34805	Pre-mRNA cleavage complex II Clp1 (1);	0.000000	0.85682	D	0.000000	T	0.73125	0.3547	M	0.90425	3.115	0.80722	D	1	D;D	0.89917	1.0;0.991	D;D	0.91635	0.999;0.976	T	0.72197	-0.4363	10	0.56958	D	0.05	-15.541	7.8535	0.29468	0.1324:0.7269:0.0:0.1407	.	202;266	Q92989-2;Q92989	.;CLP1_HUMAN	V	277;266;266;202	ENSP00000433406:L277V;ENSP00000434995:L266V;ENSP00000436066:L266V;ENSP00000304704:L202V	ENSP00000304704:L202V	L	+	1	2	CLP1	57185002	1.000000	0.71417	0.995000	0.50966	0.961000	0.63080	2.636000	0.46545	0.394000	0.25230	-0.142000	0.14014	CTG		CLP1-003	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000393465.1	NM_006831	
NRXN2	9379	broad.mit.edu	37	11	64419044	64419044	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr11:64419044C>G	ENST00000377551.1	-	13	2812	c.2601G>C	c.(2599-2601)gaG>gaC	p.E867D	NRXN2_ENST00000265459.6_Missense_Mutation_p.E867D|AP001092.4_ENST00000433606.1_RNA|NRXN2_ENST00000409571.1_Missense_Mutation_p.E860D|NRXN2_ENST00000377559.3_Missense_Mutation_p.E827D			Q9P2S2	NRX2A_HUMAN	neurexin 2	867	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)	p.E867D(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						TAAACCGCCGCTCCGTCATGA	0.582											OREG0021057	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E867D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2601C	11						.						59.0	47.0	51.0					11																	64419044		2201	4297	6498	64175620	SO:0001583	missense	9379	exon14				CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.2601G>C	11.37:g.64419044C>G	ENSP00000366774:p.Glu867Asp	Somatic	1076	Capture	Illumina HiSeq	Phase_I	64175620	NM_015080	A7E2C1|Q9Y2D6	Missense_Mutation	SNP	ENST00000377551.1	37	CCDS8077.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.438041	0.83885	.	.	ENSG00000110076	ENST00000377551;ENST00000377559;ENST00000265459;ENST00000345863;ENST00000409571	T;T;T;T	0.78003	-1.14;-1.14;-1.14;-1.14	4.93	4.93	0.64822	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.43260	U	0.000594	D	0.84924	0.5580	M	0.72894	2.215	0.58432	D	0.999993	D;D;P	0.76494	0.983;0.999;0.946	P;D;P	0.76575	0.807;0.988;0.796	D	0.84572	0.0656	10	0.45353	T	0.12	.	9.3075	0.37885	0.0:0.9016:0.0:0.0984	.	827;867;613	Q9P2S2-2;Q9P2S2;E7EV67	.;NRX2A_HUMAN;.	D	867;827;867;827;860	ENSP00000366774:E867D;ENSP00000366782:E827D;ENSP00000265459:E867D;ENSP00000386416:E860D	ENSP00000265459:E867D	E	-	3	2	NRXN2	64175620	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	2.737000	0.47393	2.276000	0.75962	0.561000	0.74099	GAG		NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104967.3	NM_015080	
SPTBN2	6712	broad.mit.edu	37	11	66455019	66455019	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr11:66455019C>T	ENST00000533211.1	-	35	6932	c.6601G>A	c.(6601-6603)Gag>Aag	p.E2201K	SPTBN2_ENST00000529997.1_Missense_Mutation_p.E2201K|SPTBN2_ENST00000309996.2_Missense_Mutation_p.E2201K			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	2201					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)	p.E2201K(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						TGGGCTGACTCGGTAGACCTG	0.687																																					p.E2201K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6601A	11						.						44.0	50.0	48.0					11																	66455019		2200	4292	6492	66211595	SO:0001583	missense	6712	exon34			AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.6601G>A	11.37:g.66455019C>T	ENSP00000432568:p.Glu2201Lys	Somatic		Capture	Illumina HiSeq	Phase_I	66211595	NM_006946	O14872|O14873	Missense_Mutation	SNP	ENST00000533211.1	37	CCDS8150.1	.	.	.	.	.	.	.	.	.	.	C	11.87	1.769051	0.31320	.	.	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000529997;ENST00000443262	T;T;T	0.70399	-0.47;-0.47;-0.48	5.04	5.04	0.67666	.	0.152001	0.46442	D	0.000291	T	0.47116	0.1428	N	0.19112	0.55	0.09310	N	1	P	0.40083	0.702	B	0.29785	0.107	T	0.43114	-0.9411	10	0.07813	T	0.8	.	13.0913	0.59167	0.0:0.8385:0.1615:0.0	.	2201	O15020	SPTN2_HUMAN	K	2201;2201;2201;745	ENSP00000432568:E2201K;ENSP00000311489:E2201K;ENSP00000433593:E2201K	ENSP00000311489:E2201K	E	-	1	0	SPTBN2	66211595	0.000000	0.05858	0.335000	0.25508	0.015000	0.08874	0.957000	0.29215	2.629000	0.89072	0.655000	0.94253	GAG		SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393892.2	NM_006946	
SUV420H1	51111	broad.mit.edu	37	11	67925963	67925963	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr11:67925963C>T	ENST00000304363.4	-	11	2203	c.1850G>A	c.(1849-1851)gGa>gAa	p.G617E		NM_017635.3	NP_060105	Q4FZB7	SV421_HUMAN	suppressor of variegation 4-20 homolog 1 (Drosophila)	617					histone H4-K20 trimethylation (GO:0034773)|muscle organ development (GO:0007517)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)	histone methyltransferase activity (H4-K20 specific) (GO:0042799)|histone-lysine N-methyltransferase activity (GO:0018024)	p.G617E(1)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(15)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46						CACAAGTTTTCCTTGTCGTGA	0.468																																					p.G617E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1850A	11						.						124.0	110.0	115.0					11																	67925963		2200	4294	6494	67682539	SO:0001583	missense	51111	exon11			AL512763	CCDS31623.1, CCDS44660.1	11q13.2	2011-07-01			ENSG00000110066	ENSG00000110066		"""Chromatin-modifying enzymes / K-methyltransferases"""	24283	protein-coding gene	gene with protein product		610881				10810093, 11401438	Standard	NM_016028		Approved	CGI-85, KMT5B	uc001onm.1	Q4FZB7	OTTHUMG00000150484	ENST00000304363.4:c.1850G>A	11.37:g.67925963C>T	ENSP00000305899:p.Gly617Glu	Somatic		Capture	Illumina HiSeq	Phase_I	67682539	NM_017635	B7WNX7|Q3SX56|Q4V775|Q6P150|Q96E44|Q9BUL0|Q9H022|Q9H2K3|Q9NXV3|Q9Y393	Missense_Mutation	SNP	ENST00000304363.4	37	CCDS31623.1	.	.	.	.	.	.	.	.	.	.	C	18.83	3.707442	0.68615	.	.	ENSG00000110066	ENST00000304363	T	0.44881	0.91	4.88	2.94	0.34122	.	0.493832	0.24771	N	0.035736	T	0.35624	0.0938	N	0.24115	0.695	0.58432	D	0.999999	D	0.56746	0.977	P	0.54460	0.753	T	0.08330	-1.0727	10	0.36615	T	0.2	-11.1891	5.5482	0.17076	0.1468:0.6366:0.1414:0.0752	.	617	Q4FZB7	SV421_HUMAN	E	617	ENSP00000305899:G617E	ENSP00000305899:G617E	G	-	2	0	SUV420H1	67682539	0.223000	0.23663	0.010000	0.14722	0.929000	0.56500	1.330000	0.33781	0.598000	0.29829	0.491000	0.48974	GGA		SUV420H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318319.1	NM_017635	
PCF11	51585	broad.mit.edu	37	11	82882914	82882914	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr11:82882914C>A	ENST00000298281.4	+	9	4167	c.3715C>A	c.(3715-3717)Cca>Aca	p.P1239T		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	1239					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)		p.P1239T(1)		cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						ACAGTTTTTACCAGTTCATCC	0.328																																					p.P1239T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3715A	11						.						144.0	139.0	141.0					11																	82882914		1830	4083	5913	82560562	SO:0001583	missense	51585	exon9			AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.3715C>A	11.37:g.82882914C>A	ENSP00000298281:p.Pro1239Thr	Somatic		Capture	Illumina HiSeq	Phase_I	82560562	NM_015885	A6H8W7|O43671|Q6P0X8	Missense_Mutation	SNP	ENST00000298281.4	37	CCDS44689.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.508455	0.85282	.	.	ENSG00000165494	ENST00000298281;ENST00000530906	T;T	0.51071	1.74;0.72	5.53	5.53	0.82687	.	0.000000	0.56097	D	0.000033	T	0.58906	0.2155	L	0.34521	1.04	0.45777	D	0.998663	D	0.89917	1.0	D	0.83275	0.996	T	0.53236	-0.8467	9	.	.	.	-11.2584	17.592	0.87999	0.0:1.0:0.0:0.0	.	1239	O94913	PCF11_HUMAN	T	1239;24	ENSP00000298281:P1239T;ENSP00000437076:P24T	.	P	+	1	0	PCF11	82560562	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.152000	0.50677	2.756000	0.94617	0.655000	0.94253	CCA		PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392548.2	NM_015885	
AMICA1	120425	broad.mit.edu	37	11	118071189	118071189	+	Splice_Site	SNP	C	C	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr11:118071189C>A	ENST00000356289.5	-	7	1084	c.911G>T	c.(910-912)aGt>aTt	p.S304I	AMICA1_ENST00000292067.7_Splice_Site_p.S294I|AMICA1_ENST00000526620.1_Splice_Site_p.S265I|AMICA1_ENST00000533261.1_Splice_Site_p.S293I	NM_001098526.1	NP_001091996.1	Q86YT9	JAML1_HUMAN	adhesion molecule, interacts with CXADR antigen 1	304					blood coagulation (GO:0007596)|gamma-delta T cell activation (GO:0046629)|heterophilic cell-cell adhesion (GO:0007157)|leukocyte migration (GO:0050900)|monocyte extravasation (GO:0035696)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|protein homodimerization activity (GO:0042803)	p.S294I(1)		central_nervous_system(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|stomach(2)	20	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		AGCCCTGTACCTCTTATTTCC	0.522																																					p.S294I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G881T	11						.						80.0	75.0	77.0					11																	118071189		2200	4296	6496	117576399	SO:0001630	splice_region_variant	120425	exon6			AY138965, AY358362	CCDS8391.1, CCDS41723.1, CCDS66240.1	11q23.3	2013-01-11				ENSG00000160593		"""Immunoglobulin superfamily / V-set domain containing"""	19084	protein-coding gene	gene with protein product		609770				12975309	Standard	NM_001098526		Approved	Gm638, AMICA	uc001psk.2	Q86YT9		ENST00000356289.5:c.911+1G>T	11.37:g.118071189C>A		Somatic		Capture	Illumina HiSeq	Phase_I	117576399	NM_153206	B0YIV1|B0YIV2|Q496M1|Q5DTC6|Q7Z499|Q8N9I7|Q8NF70	Missense_Mutation	SNP	ENST00000356289.5	37	CCDS41723.1	.	.	.	.	.	.	.	.	.	.	C	16.00	2.997206	0.54147	.	.	ENSG00000160593	ENST00000356289;ENST00000292067;ENST00000533261;ENST00000526620	D;D;D;D	0.98381	-4.45;-4.46;-4.63;-4.9	5.07	5.07	0.68467	.	0.130684	0.36268	N	0.002693	D	0.97791	0.9275	L	0.34521	1.04	0.41498	D	0.988267	D;D;D;D;D	0.76494	0.998;0.998;0.999;0.999;0.999	D;D;D;D;D	0.80764	0.994;0.994;0.946;0.946;0.976	D	0.97504	1.0062	9	.	.	.	-7.3028	13.9447	0.64077	0.0:1.0:0.0:0.0	.	304;265;304;293;294	B4DVI6;E9PKK2;Q86YT9;E9PR26;Q86YT9-2	.;.;JAML1_HUMAN;.;.	I	304;294;293;265	ENSP00000348635:S304I;ENSP00000292067:S294I;ENSP00000436117:S293I;ENSP00000431218:S265I	.	S	-	2	0	AMICA1	117576399	1.000000	0.71417	0.987000	0.45799	0.198000	0.23893	3.549000	0.53681	2.341000	0.79615	0.462000	0.41574	AGT		AMICA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392105.2	NM_153206	Missense_Mutation
TMEM52B	120939	broad.mit.edu	37	12	10342695	10342695	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr12:10342695C>G	ENST00000381923.2	+	6	912	c.508C>G	c.(508-510)Cca>Gca	p.P170A	TMEM52B_ENST00000536952.1_Missense_Mutation_p.P170A|TMEM52B_ENST00000298530.3_Missense_Mutation_p.P150A			Q4KMG9	TM52B_HUMAN	transmembrane protein 52B	170						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.P150A(1)									GCAGCTGCCTCCAACAGAGAA	0.478																																					p.P150A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C448G	12						.						56.0	56.0	56.0					12																	10342695		2203	4300	6503	10233962	SO:0001583	missense	120939	exon4			AY358845	CCDS8619.1, CCDS66314.1	12p13.2	2012-08-15	2012-08-15	2012-08-15	ENSG00000165685	ENSG00000165685			26438	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 59"""	C12orf59		12975309	Standard	XM_005253299		Approved	FLJ31166	uc001qxq.3	Q4KMG9	OTTHUMG00000168410	ENST00000381923.2:c.508C>G	12.37:g.10342695C>G	ENSP00000371348:p.Pro170Ala	Somatic		Capture	Illumina HiSeq	Phase_I	10233962	NM_153022	Q96NA7	Missense_Mutation	SNP	ENST00000381923.2	37		.	.	.	.	.	.	.	.	.	.	C	8.888	0.953330	0.18431	.	.	ENSG00000165685	ENST00000381923;ENST00000298530;ENST00000536952	.	.	.	4.56	3.66	0.41972	.	0.461267	0.21578	N	0.072286	T	0.33352	0.0860	L	0.57536	1.79	0.26025	N	0.981818	P;P	0.36909	0.573;0.573	B;B	0.33454	0.164;0.164	T	0.22695	-1.0209	9	0.38643	T	0.18	-6.294	6.2081	0.20613	0.0:0.6819:0.2157:0.1023	.	170;150	Q4KMG9;Q4KMG9-2	CL059_HUMAN;.	A	170;150;170	.	ENSP00000298530:P150A	P	+	1	0	C12orf59	10233962	0.001000	0.12720	0.686000	0.30086	0.152000	0.21847	0.521000	0.22893	1.226000	0.43582	0.536000	0.68110	CCA		TMEM52B-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000399645.1	NM_153022	
DAO	1610	broad.mit.edu	37	12	109283296	109283296	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr12:109283296G>T	ENST00000228476.3	+	4	565	c.361G>T	c.(361-363)Gag>Tag	p.E121*	DAO_ENST00000551281.1_Intron	NM_001917.4	NP_001908.3	P14920	OXDA_HUMAN	D-amino-acid oxidase	121					cellular nitrogen compound metabolic process (GO:0034641)|D-alanine catabolic process (GO:0055130)|D-serine catabolic process (GO:0036088)|D-serine metabolic process (GO:0070178)|dopamine biosynthetic process (GO:0042416)|glyoxylate metabolic process (GO:0046487)|leucine metabolic process (GO:0006551)|proline catabolic process (GO:0006562)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	cofactor binding (GO:0048037)|D-amino-acid oxidase activity (GO:0003884)|FAD binding (GO:0071949)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)	p.E121*(1)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|prostate(2)|skin(1)	26					Flavin adenine dinucleotide(DB03147)	GACCCCCAGAGAGCTGGATAT	0.542																																					p.E121X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G361T	12						.						88.0	81.0	84.0					12																	109283296		2203	4300	6503	107807425	SO:0001587	stop_gained	1610	exon4			D11370	CCDS9122.1	12q24.11	2013-09-20			ENSG00000110887	ENSG00000110887	1.4.3.3		2671	protein-coding gene	gene with protein product		124050				1356107, 8182053	Standard	NM_001917		Approved	DAMOX	uc001tnr.4	P14920	OTTHUMG00000169360	ENST00000228476.3:c.361G>T	12.37:g.109283296G>T	ENSP00000228476:p.Glu121*	Somatic		Capture	Illumina HiSeq	Phase_I	107807425	NM_001917	B2R7I5|Q16758|Q8N6R2	Nonsense_Mutation	SNP	ENST00000228476.3	37	CCDS9122.1	.	.	.	.	.	.	.	.	.	.	G	31	5.092738	0.94149	.	.	ENSG00000110887	ENST00000228476;ENST00000547166	.	.	.	6.06	6.06	0.98353	.	0.044478	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-14.0279	19.1989	0.93701	0.0:0.0:1.0:0.0	.	.	.	.	X	121	.	ENSP00000228476:E121X	E	+	1	0	DAO	107807425	1.000000	0.71417	0.957000	0.39632	0.594000	0.36715	8.897000	0.92532	2.882000	0.98803	0.655000	0.94253	GAG		DAO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403682.1		
PRMT8	56341	broad.mit.edu	37	12	3701496	3701496	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr12:3701496T>C	ENST00000382622.3	+	9	1469	c.1079T>C	c.(1078-1080)aTg>aCg	p.M360T	PRMT8_ENST00000261252.4_3'UTR|PRMT8_ENST00000452611.2_Missense_Mutation_p.M351T	NM_019854.4	NP_062828.3	Q9NR22	ANM8_HUMAN	protein arginine methyltransferase 8	360	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				histone arginine methylation (GO:0034969)|histone H4-R3 methylation (GO:0043985)|histone methylation (GO:0016571)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|regulation of protein binding (GO:0043393)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	histone methyltransferase activity (H4-R3 specific) (GO:0044020)|histone-arginine N-methyltransferase activity (GO:0008469)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)	p.M360T(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)	37			OV - Ovarian serous cystadenocarcinoma(31;0.0109)|COAD - Colon adenocarcinoma(12;0.0264)			ACCATATCCATGAAGCCAAAT	0.562																																					p.M360T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1079C	12						.						89.0	90.0	90.0					12																	3701496		2203	4300	6503	3571757	SO:0001583	missense	56341	exon9			AF263539	CCDS8521.2, CCDS58200.1	12p13.3	2006-03-03	2006-02-16	2006-02-16	ENSG00000111218	ENSG00000111218		"""Protein arginine methyltransferases"""	5188	protein-coding gene	gene with protein product		610086	"""HMT1 hnRNP methyltransferase-like 3 (S. cerevisiae)"", ""HMT1 hnRNP methyltransferase-like 4 (S. cerevisiae)"""	HRMT1L3, HRMT1L4		16051612	Standard	NM_019854		Approved		uc001qmf.4	Q9NR22	OTTHUMG00000128493	ENST00000382622.3:c.1079T>C	12.37:g.3701496T>C	ENSP00000372067:p.Met360Thr	Somatic		Capture	Illumina HiSeq	Phase_I	3571757	NM_019854	B2RDP0|Q8TBJ8	Missense_Mutation	SNP	ENST00000382622.3	37	CCDS8521.2	.	.	.	.	.	.	.	.	.	.	T	18.13	3.555457	0.65425	.	.	ENSG00000111218	ENST00000452611;ENST00000382622	T;T	0.78246	-1.16;-1.16	5.38	5.38	0.77491	.	0.040036	0.85682	D	0.000000	T	0.81702	0.4878	M	0.81682	2.555	0.80722	D	1	P;B	0.36733	0.567;0.093	B;B	0.43301	0.415;0.237	T	0.82333	-0.0509	10	0.45353	T	0.12	.	13.3387	0.60533	0.0:0.0:0.0:1.0	.	351;360	Q9NR22-2;Q9NR22	.;ANM8_HUMAN	T	351;360	ENSP00000414507:M351T;ENSP00000372067:M360T	ENSP00000372067:M360T	M	+	2	0	PRMT8	3571757	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.984000	0.88150	2.030000	0.59900	0.533000	0.62120	ATG		PRMT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250297.2	NM_019854	
COL2A1	1280	broad.mit.edu	37	12	48368605	48368605	+	Silent	SNP	G	G	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr12:48368605G>A	ENST00000380518.3	-	52	4091	c.3927C>T	c.(3925-3927)gaC>gaT	p.D1309D	COL2A1_ENST00000493991.1_5'UTR|COL2A1_ENST00000337299.6_Silent_p.D1240D	NM_001844.4|NM_033150.2	NP_001835.3|NP_149162.2	P02458	CO2A1_HUMAN	collagen, type II, alpha 1	1309	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				axon guidance (GO:0007411)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to BMP stimulus (GO:0071773)|central nervous system development (GO:0007417)|chondrocyte differentiation (GO:0002062)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal joint morphogenesis (GO:0060272)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|limb bud formation (GO:0060174)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|notochord development (GO:0030903)|otic vesicle development (GO:0071599)|palate development (GO:0060021)|proteoglycan metabolic process (GO:0006029)|regulation of gene expression (GO:0010468)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen type II trimer (GO:0005585)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)	p.D1240D(1)|p.D1309D(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(3)	64		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	CCTTCATGGCGTCCAAGGTGC	0.557																																					p.D1240D												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C3720T	12						.						109.0	104.0	105.0					12																	48368605		2203	4300	6503	46654872	SO:0001819	synonymous_variant	1280	exon51			X16468	CCDS8759.1, CCDS41778.1	12q12-q13.2	2013-11-14	2008-02-04		ENSG00000139219	ENSG00000139219		"""Collagens"""	2200	protein-coding gene	gene with protein product		120140	"""collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)"", ""arthroophthalmopathy, progressive (Stickler syndrome)"""	SEDC, AOM		1677770	Standard	NM_033150		Approved	STL1	uc001rqu.3	P02458	OTTHUMG00000149896	ENST00000380518.3:c.3927C>T	12.37:g.48368605G>A		Somatic		Capture	Illumina HiSeq	Phase_I	46654872	NM_033150	A6NGA0|Q12985|Q14009|Q14044|Q14045|Q14046|Q14047|Q14056|Q14058|Q16672|Q1JQ82|Q2V4X7|Q6LBY1|Q6LBY2|Q6LBY3|Q96IT5|Q99227|Q9UE38|Q9UE39|Q9UE40|Q9UE41|Q9UE42|Q9UE43	Silent	SNP	ENST00000380518.3	37	CCDS41778.1																																																																																				COL2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313810.2	NM_001844	
MYO1H	283446	broad.mit.edu	37	12	109870782	109870782	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr12:109870782T>C	ENST00000431443.2	+	19	2012	c.2012T>C	c.(2011-2013)aTc>aCc	p.I671T	MYO1H_ENST00000310903.5_Missense_Mutation_p.I661T	NM_001101421.3	NP_001094891.3	Q8N1T3	MYO1H_HUMAN	myosin IH	671	Myosin motor.					myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(17)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	47						ATCAAGTACATCGGCTACAAA	0.527											OREG0022105	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I661T												.	.	0			c.T1982C	12						.						128.0	136.0	133.0					12																	109870782		2084	4204	6288	108355165	SO:0001583	missense	283446	exon19				CCDS53826.1	12q24.11	2011-09-27			ENSG00000174527	ENSG00000174527		"""Myosins / Myosin superfamily : Class I"""	13879	protein-coding gene	gene with protein product		614636					Standard	NM_001101421		Approved	FLJ37587	uc010sxn.1	Q8N1T3	OTTHUMG00000169252	ENST00000431443.2:c.2012T>C	12.37:g.109870782T>C	ENSP00000444076:p.Ile671Thr	None	1423	Capture	Illumina HiSeq	Phase_I	108355165	NM_001101421	F5H3C6	Missense_Mutation	SNP	ENST00000431443.2	37		.	.	.	.	.	.	.	.	.	.	T	22.4	4.288046	0.80803	.	.	ENSG00000174527	ENST00000310903;ENST00000431443	T;T	0.71341	-0.56;-0.56	5.48	5.48	0.80851	.	.	.	.	.	T	0.64080	0.2566	N	0.25825	0.765	0.43214	D	0.995082	P	0.51791	0.948	P	0.48227	0.571	T	0.63567	-0.6608	9	0.32370	T	0.25	.	13.5107	0.61511	0.0:0.0:0.0:1.0	.	661	F5H3C6	.	T	661;671	ENSP00000439182:I661T;ENSP00000444076:I671T	ENSP00000439182:I661T	I	+	2	0	MYO1H	108355165	1.000000	0.71417	0.982000	0.44146	0.842000	0.47809	7.215000	0.77966	2.075000	0.62263	0.402000	0.26972	ATC		MYO1H-201	KNOWN	basic	protein_coding	protein_coding		NM_173597	
GJB2	2706	broad.mit.edu	37	13	20763364	20763364	+	Silent	SNP	C	C	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr13:20763364C>T	ENST00000382844.1	-	1	555	c.357G>A	c.(355-357)gaG>gaA	p.E119E	GJB2_ENST00000382848.4_Silent_p.E119E			P29033	CXB2_HUMAN	gap junction protein, beta 2, 26kDa	119					cell-cell signaling (GO:0007267)|gap junction assembly (GO:0016264)|male genitalia development (GO:0030539)|membrane organization (GO:0061024)|sensory perception of sound (GO:0007605)|transport (GO:0006810)	connexon complex (GO:0005922)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)	p.E119E(1)		breast(1)|endometrium(2)|large_intestine(1)|lung(2)|skin(1)	7		all_cancers(29;3.95e-22)|all_epithelial(30;2.36e-19)|all_lung(29;2.27e-18)|Lung SC(185;0.0257)|Ovarian(182;0.0822)		all cancers(112;0.000435)|Epithelial(112;0.000722)|OV - Ovarian serous cystadenocarcinoma(117;0.0096)|Lung(94;0.0236)|LUSC - Lung squamous cell carcinoma(192;0.0738)		TTTTGATCTCCTCGATGTCCT	0.537									Keratitis, Ichthyosis and Deafness syndrome		OREG0022282	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E119E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G357A	13						.						118.0	111.0	113.0					13																	20763364		2203	4300	6503	19661364	SO:0001819	synonymous_variant	2706	exon2	Familial Cancer Database	KID syndrome	M86849	CCDS9290.1	13q11-q12	2010-01-06	2007-01-16		ENSG00000165474	ENSG00000165474		"""Ion channels / Gap junction proteins (connexins)"""	4284	protein-coding gene	gene with protein product	"""connexin 26"""	121011	"""gap junction protein, beta 2, 26kD (connexin 26)"", ""gap junction protein, beta 2, 26kDa (connexin 26)"""	DFNB1, DFNA3		9139825	Standard	NM_004004		Approved	CX26, NSRD1	uc001umy.3	P29033	OTTHUMG00000016513	ENST00000382844.1:c.357G>A	13.37:g.20763364C>T		Somatic	743	Capture	Illumina HiSeq	Phase_I	19661364	NM_004004	Q508A5|Q508A6|Q5YLL0|Q5YLL1|Q5YLL4|Q6IPV5|Q86U88|Q96AK0|Q9H536|Q9NNY4	Silent	SNP	ENST00000382844.1	37	CCDS9290.1																																																																																				GJB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044064.1		
DCLK1	9201	broad.mit.edu	37	13	36382434	36382434	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr13:36382434A>G	ENST00000360631.3	-	14	2001	c.1790T>C	c.(1789-1791)cTt>cCt	p.L597P	DCLK1_ENST00000379893.1_Missense_Mutation_p.L290P|DCLK1_ENST00000255448.4_Missense_Mutation_p.L597P			O15075	DCLK1_HUMAN	doublecortin-like kinase 1	597	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)	p.L597P(2)		breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		CTGATCAAAAAGCACCTCCTG	0.448																																					p.L290P												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T869C	13						.						225.0	210.0	215.0					13																	36382434		2203	4300	6503	35280434	SO:0001583	missense	9201	exon10			AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.1790T>C	13.37:g.36382434A>G	ENSP00000353846:p.Leu597Pro	Somatic		Capture	Illumina HiSeq	Phase_I	35280434	NM_001195416	B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Missense_Mutation	SNP	ENST00000360631.3	37		.	.	.	.	.	.	.	.	.	.	A	25.4	4.634817	0.87760	.	.	ENSG00000133083	ENST00000399319;ENST00000255448;ENST00000360631;ENST00000379893;ENST00000539451	T;T;T	0.68624	-0.34;-0.34;-0.34	5.65	5.65	0.86999	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.82678	0.5089	M	0.80847	2.515	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.85301	0.1073	10	0.87932	D	0	.	15.8801	0.79197	1.0:0.0:0.0:0.0	.	290;597;597;290	O15075-4;O15075;O15075-2;O15075-3	.;DCLK1_HUMAN;.;.	P	289;597;597;290;579	ENSP00000255448:L597P;ENSP00000353846:L597P;ENSP00000369223:L290P	ENSP00000255448:L597P	L	-	2	0	DCLK1	35280434	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.233000	0.95337	2.166000	0.68216	0.460000	0.39030	CTT		DCLK1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000044487.1	NM_004734	
SOHLH2	54937	broad.mit.edu	37	13	36776025	36776025	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr13:36776025T>G	ENST00000379881.3	-	2	342	c.254A>C	c.(253-255)aAg>aCg	p.K85T	CCDC169-SOHLH2_ENST00000511166.1_Missense_Mutation_p.K162T|SOHLH2_ENST00000554962.1_Missense_Mutation_p.K162T|SOHLH2_ENST00000317764.6_Missense_Mutation_p.K85T	NM_017826.2	NP_060296.2	Q9NX45	SOLH2_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 2	85					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.K85T(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;4.63e-08)|Epithelial(112;2.67e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00272)|BRCA - Breast invasive adenocarcinoma(63;0.00685)|GBM - Glioblastoma multiforme(144;0.0273)		CCTAATTAACTTGATGGCTTC	0.368																																					p.K85T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A254C	13						.						78.0	72.0	74.0					13																	36776025		2203	4300	6503	35674025	SO:0001583	missense	54937	exon2			AK000456	CCDS9355.1, CCDS61309.1	13q13.3	2013-05-21			ENSG00000120669	ENSG00000120669		"""Basic helix-loop-helix proteins"""	26026	protein-coding gene	gene with protein product	"""spermatogenesis associated 28"""					12477932	Standard	NM_017826		Approved	FLJ20449, TEB1, bHLHe81, SPATA28		Q9NX45	OTTHUMG00000016728	ENST00000379881.3:c.254A>C	13.37:g.36776025T>G	ENSP00000369210:p.Lys85Thr	Somatic		Capture	Illumina HiSeq	Phase_I	35674025	NM_017826	B4DX90|Q5EGC3|Q8TC74|Q96QX4	Missense_Mutation	SNP	ENST00000379881.3	37	CCDS9355.1	.	.	.	.	.	.	.	.	.	.	t	8.503	0.864652	0.17250	.	.	ENSG00000120669;ENSG00000120669;ENSG00000120669;ENSG00000250709	ENST00000379881;ENST00000554962;ENST00000317764;ENST00000511166	T;T;T;T	0.55760	1.07;1.07;0.5;1.07	5.54	-3.24	0.05094	.	0.768760	0.12062	N	0.503020	T	0.34454	0.0898	N	0.24115	0.695	0.09310	N	1	P;P	0.38195	0.622;0.622	B;B	0.36418	0.224;0.224	T	0.23726	-1.0180	10	0.87932	D	0	-1.4129	10.688	0.45854	0.0:0.4685:0.0:0.5315	.	162;85	B4DX90;Q9NX45	.;SOLH2_HUMAN	T	85;162;85;162	ENSP00000369210:K85T;ENSP00000451542:K162T;ENSP00000326838:K85T;ENSP00000421868:K162T	ENSP00000421868:K162T	K	-	2	0	CCDC169-SOHLH2;SOHLH2	35674025	0.000000	0.05858	0.000000	0.03702	0.185000	0.23345	-0.494000	0.06451	-0.792000	0.04480	-0.971000	0.02607	AAG		SOHLH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044477.2	NM_017826	
CSNK1A1L	122011	broad.mit.edu	37	13	37679386	37679386	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr13:37679386T>G	ENST00000379800.3	-	1	417	c.8A>C	c.(7-9)aAc>aCc	p.N3T		NM_145203.5	NP_660204.2	Q8N752	KC1AL_HUMAN	casein kinase 1, alpha 1-like	3					cell morphogenesis (GO:0000902)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.N3T(1)		NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	37		Lung NSC(96;7.97e-05)|Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.109)		all cancers(112;3.58e-07)|Epithelial(112;1.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00695)|BRCA - Breast invasive adenocarcinoma(63;0.0117)|GBM - Glioblastoma multiforme(144;0.0407)		GCCGCTGTTGTTTGTCATCCT	0.602																																					p.N3T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A8C	13						.						73.0	71.0	72.0					13																	37679386		2203	4300	6503	36577386	SO:0001583	missense	122011	exon1			BC028723	CCDS9363.1	13q13.2	2008-02-05			ENSG00000180138	ENSG00000180138			20289	protein-coding gene	gene with protein product							Standard	NM_145203		Approved	MGC33182	uc001uwm.1	Q8N752	OTTHUMG00000016748	ENST00000379800.3:c.8A>C	13.37:g.37679386T>G	ENSP00000369126:p.Asn3Thr	Somatic		Capture	Illumina HiSeq	Phase_I	36577386	NM_145203	Q5T2N2	Missense_Mutation	SNP	ENST00000379800.3	37	CCDS9363.1	.	.	.	.	.	.	.	.	.	.	T	7.073	0.568703	0.13560	.	.	ENSG00000180138	ENST00000379800	T	0.49720	0.77	1.01	0.0113	0.14086	.	0.322570	0.40144	N	0.001163	T	0.18341	0.0440	N	0.03608	-0.345	0.24571	N	0.993927	B	0.02656	0.0	B	0.04013	0.001	T	0.11665	-1.0578	10	0.29301	T	0.29	.	4.8871	0.13708	0.0:0.7314:0.0:0.2686	.	3	Q8N752	KC1AL_HUMAN	T	3	ENSP00000369126:N3T	ENSP00000369126:N3T	N	-	2	0	CSNK1A1L	36577386	1.000000	0.71417	0.001000	0.08648	0.001000	0.01503	1.225000	0.32551	-0.044000	0.13491	-0.366000	0.07423	AAC		CSNK1A1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044563.1	NM_145203	
FAM124A	220108	broad.mit.edu	37	13	51854660	51854660	+	Silent	SNP	T	T	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr13:51854660T>A	ENST00000322475.8	+	4	1044	c.909T>A	c.(907-909)acT>acA	p.T303T	FAM124A_ENST00000280057.6_Silent_p.T339T	NM_001242312.1	NP_001229241.1	Q86V42	F124A_HUMAN	family with sequence similarity 124A	303								p.T339T(1)		breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|skin(1)	26		Acute lymphoblastic leukemia(7;0.000334)|Breast(56;0.00156)|Prostate(109;0.00538)|Lung NSC(96;0.0216)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;4.25e-07)		GTCATTCCACTCCTTTGCCGA	0.577																																					p.T339T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1017A	13						.						88.0	82.0	84.0					13																	51854660		2203	4300	6503	50752661	SO:0001819	synonymous_variant	220108	exon5			AK096364	CCDS9427.1, CCDS55900.1	13q14.3	2006-08-11			ENSG00000150510	ENSG00000150510			26413	protein-coding gene	gene with protein product						12975309	Standard	NM_145019		Approved	FLJ30707	uc001vff.2	Q86V42	OTTHUMG00000016942	ENST00000322475.8:c.909T>A	13.37:g.51854660T>A		Somatic		Capture	Illumina HiSeq	Phase_I	50752661	NM_145019	A2A324|Q8N8P9|Q8NE66|Q96NJ9	Silent	SNP	ENST00000322475.8	37	CCDS55900.1																																																																																				FAM124A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045019.3	NM_145019	
EDNRB	1910	broad.mit.edu	37	13	78492520	78492520	+	Silent	SNP	C	C	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr13:78492520C>T	ENST00000334286.5	-	1	425	c.189G>A	c.(187-189)gcG>gcA	p.A63A	EDNRB_ENST00000446573.1_Silent_p.A63A|EDNRB_ENST00000475537.1_5'UTR|EDNRB_ENST00000377211.4_Silent_p.A153A|RNF219-AS1_ENST00000607862.1_RNA	NM_000115.3|NM_001122659.2	NP_000106.1|NP_001116131.1	P24530	EDNRB_HUMAN	endothelin receptor type B	63					aging (GO:0007568)|cell surface receptor signaling pathway (GO:0007166)|cellular response to lipopolysaccharide (GO:0071222)|cGMP-mediated signaling (GO:0019934)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|enteric smooth muscle cell differentiation (GO:0035645)|epithelial fluid transport (GO:0042045)|macrophage chemotaxis (GO:0048246)|melanocyte differentiation (GO:0030318)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of neuron maturation (GO:0014043)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|peripheral nervous system development (GO:0007422)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|posterior midgut development (GO:0007497)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|regulation of fever generation (GO:0031620)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|response to organic cyclic compound (GO:0014070)|response to pain (GO:0048265)|sensory perception of pain (GO:0019233)|vasoconstriction (GO:0042310)|vasodilation (GO:0042311)|vein smooth muscle contraction (GO:0014826)	integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)	endothelin receptor activity (GO:0004962)|peptide hormone binding (GO:0017046)	p.A63A(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(18)|lung(16)|skin(3)	42		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0933)	Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	CCAACGACCGCGCCAGACTGG	0.622																																					p.A63A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G189A	13						.						71.0	74.0	73.0					13																	78492520		2203	4300	6503	77390521	SO:0001819	synonymous_variant	1910	exon1			L06623	CCDS9461.1, CCDS55902.1	13q22	2012-08-08			ENSG00000136160	ENSG00000136160		"""GPCR / Class A : Endothelin receptors"""	3180	protein-coding gene	gene with protein product		131244		HSCR2, HSCR		1659806, 9556633	Standard	NM_000115		Approved	ETB	uc001vkp.1	P24530	OTTHUMG00000017111	ENST00000334286.5:c.189G>A	13.37:g.78492520C>T		Somatic		Capture	Illumina HiSeq	Phase_I	77390521	NM_001122659	A2A2Z8|A8K3T4|O15343|Q59GB1|Q5W0G9|Q8NHM6|Q8NHM7|Q8NHM8|Q8NHM9|Q9UD23|Q9UQK3	Silent	SNP	ENST00000334286.5	37	CCDS9461.1																																																																																				EDNRB-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276505.1		
OR4K5	79317	broad.mit.edu	37	14	20389465	20389465	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr14:20389465G>C	ENST00000315915.4	+	1	725	c.700G>C	c.(700-702)Gca>Cca	p.A234P		NM_001005483.1	NP_001005483.1	Q8NGD3	OR4K5_HUMAN	olfactory receptor, family 4, subfamily K, member 5	234						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A234P(1)		central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|liver(1)|lung(27)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		AGCTGCAATGGCAAAGGCATT	0.418																																					p.A234P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G700C	14						.						259.0	271.0	267.0					14																	20389465		2203	4300	6503	19459305	SO:0001583	missense	79317	exon1			BK004355	CCDS32024.1	14q11.22	2012-08-09				ENSG00000176281		"""GPCR / Class A : Olfactory receptors"""	14745	protein-coding gene	gene with protein product						14983052	Standard	NM_001005483		Approved		uc010tkw.2	Q8NGD3		ENST00000315915.4:c.700G>C	14.37:g.20389465G>C	ENSP00000319511:p.Ala234Pro	Somatic		Capture	Illumina HiSeq	Phase_I	19459305	NM_001005483	Q6IFA7	Missense_Mutation	SNP	ENST00000315915.4	37	CCDS32024.1	.	.	.	.	.	.	.	.	.	.	.	3.056	-0.194285	0.06259	.	.	ENSG00000176281	ENST00000315915	T	0.00174	8.62	4.38	1.23	0.21249	GPCR, rhodopsin-like superfamily (1);	0.135801	0.33631	N	0.004709	T	0.00178	0.0005	L	0.49778	1.585	0.09310	N	1	B	0.10296	0.003	B	0.20577	0.03	T	0.40720	-0.9548	10	0.66056	D	0.02	.	5.7868	0.18338	0.0937:0.0:0.4044:0.5019	.	234	Q8NGD3	OR4K5_HUMAN	P	234	ENSP00000319511:A234P	ENSP00000319511:A234P	A	+	1	0	OR4K5	19459305	0.000000	0.05858	0.031000	0.17742	0.003000	0.03518	-0.049000	0.11924	0.435000	0.26365	-0.310000	0.09108	GCA		OR4K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409867.1	NM_001005483	
AKAP6	9472	broad.mit.edu	37	14	33292582	33292582	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr14:33292582C>T	ENST00000280979.4	+	13	5733	c.5563C>T	c.(5563-5565)Cgt>Tgt	p.R1855C	AKAP6_ENST00000557272.1_Intron	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	1855					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)	p.R1855C(1)		NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		CTCTGTAAAACGTGTCTCTGA	0.358																																					p.R1855C	Melanoma(49;821 1200 7288 13647 42351)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5563T	14						.						74.0	75.0	75.0					14																	33292582		2203	4300	6503	32362333	SO:0001583	missense	9472	exon13			AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.5563C>T	14.37:g.33292582C>T	ENSP00000280979:p.Arg1855Cys	Somatic		Capture	Illumina HiSeq	Phase_I	32362333	NM_004274	A7E242|A7E2D4|O15028	Missense_Mutation	SNP	ENST00000280979.4	37	CCDS9644.1	.	.	.	.	.	.	.	.	.	.	C	0.012	-1.673755	0.00758	.	.	ENSG00000151320	ENST00000280979	T	0.05513	3.43	5.37	-2.22	0.06952	.	1.558820	0.03167	N	0.170167	T	0.04861	0.0131	N	0.21448	0.665	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.40403	-0.9565	10	0.34782	T	0.22	3.1362	5.1401	0.14954	0.3002:0.3511:0.0:0.3486	.	1855	Q13023	AKAP6_HUMAN	C	1855	ENSP00000280979:R1855C	ENSP00000280979:R1855C	R	+	1	0	AKAP6	32362333	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	-0.301000	0.08232	-0.841000	0.04200	-0.802000	0.03209	CGT		AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2	NM_004274	
SRSF5	6430	broad.mit.edu	37	14	70237227	70237227	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr14:70237227C>T	ENST00000553521.1	+	7	1863	c.410C>T	c.(409-411)gCg>gTg	p.A137V	SRSF5_ENST00000553635.1_Missense_Mutation_p.A134V|SRSF5_ENST00000557154.1_Missense_Mutation_p.A137V|SRSF5_ENST00000394366.2_Missense_Mutation_p.A137V|SRSF5_ENST00000556587.1_3'UTR			Q13243	SRSF5_HUMAN	serine/arginine-rich splicing factor 5	137	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|mRNA splicing, via spliceosome (GO:0000398)|regulation of cell cycle (GO:0051726)|response to wounding (GO:0009611)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			large_intestine(1)|liver(1)	2						GTAACGTTTGCGGATGCACAC	0.373																																					p.A137V												.	.	0			c.C410T	14						.						91.0	84.0	86.0					14																	70237227		2203	4300	6503	69306980	SO:0001583	missense	6430	exon6			AF020307	CCDS32109.1	14q24	2013-02-12	2010-06-22	2010-06-22	ENSG00000100650	ENSG00000100650		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10787	protein-coding gene	gene with protein product	"""SR splicing factor 5"""	600914	"""splicing factor, arginine/serine-rich 5"""	SFRS5		7686911, 20516191	Standard	XM_005267998		Approved	SRP40, HRS	uc001xlp.3	Q13243		ENST00000553521.1:c.410C>T	14.37:g.70237227C>T	ENSP00000452123:p.Ala137Val	Somatic		Capture	Illumina HiSeq	Phase_I	69306980	NM_001039465	O14797|Q16662|Q49AD6|Q6FGE0	Missense_Mutation	SNP	ENST00000553521.1	37	CCDS32109.1	.	.	.	.	.	.	.	.	.	.	C	8.521	0.868801	0.17322	.	.	ENSG00000100650	ENST00000553521;ENST00000394366;ENST00000557154;ENST00000553635	T;T;T;T	0.14766	2.48;2.48;2.48;2.48	5.93	5.04	0.67666	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.147825	0.64402	D	0.000010	T	0.12732	0.0309	L	0.43701	1.375	0.80722	D	1	P;P	0.39665	0.633;0.682	B;B	0.32805	0.138;0.153	T	0.03060	-1.1077	10	0.44086	T	0.13	.	15.2917	0.73870	0.0:0.9328:0.0:0.0672	.	134;137	Q13243-3;Q13243	.;SRSF5_HUMAN	V	137;137;137;134	ENSP00000452123:A137V;ENSP00000377892:A137V;ENSP00000451088:A137V;ENSP00000451391:A134V	ENSP00000377892:A137V	A	+	2	0	SRSF5	69306980	1.000000	0.71417	1.000000	0.80357	0.014000	0.08584	5.765000	0.68834	1.519000	0.48950	-0.150000	0.13652	GCG		SRSF5-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412456.1	NM_001039465	
INF2	64423	broad.mit.edu	37	14	105169688	105169688	+	Silent	SNP	C	C	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr14:105169688C>T	ENST00000392634.4	+	4	676	c.564C>T	c.(562-564)agC>agT	p.S188S	INF2_ENST00000398337.4_Silent_p.S188S|INF2_ENST00000330634.7_Silent_p.S188S	NM_022489.3	NP_071934.3	Q27J81	INF2_HUMAN	inverted formin, FH2 and WH2 domain containing	188	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin cytoskeleton organization (GO:0030036)|cell death (GO:0008219)|regulation of cellular component size (GO:0032535)|regulation of mitochondrial fission (GO:0090140)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)		p.S188S(2)		large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00188)|OV - Ovarian serous cystadenocarcinoma(23;0.0191)|Epithelial(46;0.047)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.176)		TCTCCGGCAGCGACAACGTGC	0.657																																					p.S188S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C564T	14						.						89.0	96.0	93.0					14																	105169688		2177	4279	6456	104240733	SO:0001819	synonymous_variant	64423	exon4			AK025709	CCDS9989.2, CCDS45173.1	14q32.33	2009-09-07	2007-11-29	2007-11-29	ENSG00000203485	ENSG00000203485			23791	protein-coding gene	gene with protein product	"""inverted formin 2"""	610982	"""chromosome 14 open reading frame 151"", ""chromosome 14 open reading frame 173"""	C14orf151, C14orf173		16818491	Standard	NM_001031714		Approved	MGC13251	uc001ypb.2	Q27J81	OTTHUMG00000029811	ENST00000392634.4:c.564C>T	14.37:g.105169688C>T		Somatic		Capture	Illumina HiSeq	Phase_I	104240733	NM_032714	Q27J83|Q69YL8|Q6P1X7|Q6PK22|Q86TR7|Q9BRM1|Q9H6N1	Silent	SNP	ENST00000392634.4	37	CCDS9989.2																																																																																				INF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000074371.4	NM_022489	
PIGB	9488	broad.mit.edu	37	15	55611483	55611484	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr15:55611483_55611484insG	ENST00000164305.5	+	1	326_327	c.35_36insG	c.(34-39)ccggggfs	p.PG12fs	PIGB_ENST00000569909.1_3'UTR|RP11-139H15.1_ENST00000567948.1_RNA|RP11-139H15.1_ENST00000436697.2_RNA|RAB27A_ENST00000561545.1_5'Flank|RP11-139H15.1_ENST00000565225.1_RNA|PIGB_ENST00000539642.1_5'UTR	NM_004855.4	NP_004846.4	Q92521	PIGB_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class B	12					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	mannosyltransferase activity (GO:0000030)			endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	11				all cancers(107;0.0255)		GGAATGGAGCCGGGGGGCGGAG	0.579																																					p.P12fs												.	.	0			c.35_36insG	15						.			11,3667		0,11,1828						-2.4	0.0			23	4,7886		0,4,3941	no	frameshift	PIGB	NM_004855.4		0,15,5769	A1A1,A1R,RR		0.0507,0.2991,0.1297				15,11553				53398776	SO:0001589	frameshift_variant	9488	exon1			D42138	CCDS61641.1	15q21.3	2013-02-26	2006-06-28		ENSG00000069943	ENSG00000069943		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	8959	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 3"", ""dol-P-Man dependent GPI mannosyltransferase"""	604122	"""phosphatidylinositol glycan, class B"""			8861954	Standard	NM_004855		Approved		uc002act.3	Q92521	OTTHUMG00000172654	ENST00000164305.5:c.41dupG	15.37:g.55611489_55611489dupG	ENSP00000164305:p.Pro12fs	None		Capture	Illumina HiSeq	Phase_I	53398775	NM_004855	Q53FF9|Q8WVN7	Frame_Shift_Ins	INS	ENST00000164305.5	37																																																																																					PIGB-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000419687.1	NM_004855	
C15orf41	84529	broad.mit.edu	37	15	36950079	36950079	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr15:36950079T>G	ENST00000566621.1	+	5	569	c.319T>G	c.(319-321)Ttt>Gtt	p.F107V	C15orf41_ENST00000437989.2_Missense_Mutation_p.F107V|C15orf41_ENST00000569302.1_Missense_Mutation_p.F107V|C15orf41_ENST00000338183.4_Missense_Mutation_p.F9V|RP11-16L14.2_ENST00000565366.1_RNA|C15orf41_ENST00000567389.1_Missense_Mutation_p.F9V|C15orf41_ENST00000562877.1_Missense_Mutation_p.F9V	NM_001130010.1	NP_001123482.1	Q9Y2V0	CO041_HUMAN	chromosome 15 open reading frame 41	107								p.F107V(1)		kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)	12		all_epithelial(112;3.06e-10)|Lung NSC(122;6.48e-08)|all_lung(180;8.31e-07)|Melanoma(134;0.222)		all cancers(64;1.76e-19)|GBM - Glioblastoma multiforme(113;5.03e-07)|BRCA - Breast invasive adenocarcinoma(123;0.11)		ACTGGAGAGGTTTCTACAGGA	0.388																																					p.F107V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T319G	15						.						71.0	66.0	67.0					15																	36950079		1831	4077	5908	34737371	SO:0001583	missense	84529	exon5			BC006254	CCDS45215.1, CCDS45216.1	15q14	2012-05-31			ENSG00000186073	ENSG00000186073			26929	protein-coding gene	gene with protein product		615626					Standard	XM_005254719		Approved	HH114, MGC11326, FLJ22851	uc001zje.4	Q9Y2V0	OTTHUMG00000172659	ENST00000566621.1:c.319T>G	15.37:g.36950079T>G	ENSP00000455397:p.Phe107Val	Somatic		Capture	Illumina HiSeq	Phase_I	34737371	NM_001130010	B2RD87	Missense_Mutation	SNP	ENST00000566621.1	37	CCDS45215.1	.	.	.	.	.	.	.	.	.	.	T	15.62	2.886906	0.52014	.	.	ENSG00000186073	ENST00000437989;ENST00000338183	T	0.41065	1.01	5.32	5.32	0.75619	.	.	.	.	.	T	0.51346	0.1669	L	0.56769	1.78	0.58432	D	0.999994	D	0.56287	0.975	P	0.51516	0.672	T	0.52697	-0.8541	9	0.48119	T	0.1	-1.8607	15.6383	0.76973	0.0:0.0:0.0:1.0	.	107	Q9Y2V0	CO041_HUMAN	V	107;9	ENSP00000401362:F107V	ENSP00000342433:F9V	F	+	1	0	C15orf41	34737371	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.899000	0.69846	2.163000	0.67991	0.529000	0.55759	TTT		C15orf41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419741.1	NM_032499	
STRC	161497	broad.mit.edu	37	15	43892272	43892272	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr15:43892272T>C	ENST00000450892.2	-	28	5202	c.5125A>G	c.(5125-5127)Acc>Gcc	p.T1709A	RNU6-554P_ENST00000410466.1_RNA|STRC_ENST00000541030.1_Missense_Mutation_p.T936A	NM_153700.2	NP_714544.1	Q7RTU9	STRC_HUMAN	stereocilin	1709					auditory receptor cell stereocilium organization (GO:0060088)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)	kinocilium (GO:0060091)|stereocilium bundle tip (GO:0032426)		p.T1709A(1)		skin(4)	4		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)		TGAGCACTGGTGAGACTAGAT	0.562																																					p.T1709A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A5125G	15						.						105.0	89.0	94.0					15																	43892272		2199	4295	6494	41679564	SO:0001583	missense	161497	exon28			BK000138	CCDS10098.1	15q15.3	2010-02-26			ENSG00000242866	ENSG00000242866			16035	protein-coding gene	gene with protein product		606440		DFNB16		11687802, 9429146	Standard	NM_153700		Approved		uc001zsf.3	Q7RTU9	OTTHUMG00000059899	ENST00000450892.2:c.5125A>G	15.37:g.43892272T>C	ENSP00000401513:p.Thr1709Ala	Somatic		Capture	Illumina HiSeq	Phase_I	41679564	NM_153700		Missense_Mutation	SNP	ENST00000450892.2	37	CCDS10098.1	.	.	.	.	.	.	.	.	.	.	t	14.70	2.613955	0.46631	.	.	ENSG00000242866	ENST00000450892;ENST00000299992;ENST00000541030	T;T	0.77750	-1.12;-1.09	4.81	4.81	0.61882	.	0.141794	0.47455	D	0.000221	D	0.84197	0.5419	.	.	.	0.36280	D	0.855741	P;D	0.64830	0.86;0.994	P;D	0.63877	0.561;0.919	D	0.86314	0.1688	9	0.35671	T	0.21	-13.9719	12.6303	0.56653	0.0:0.0:0.0:1.0	.	936;1709	F5GXA4;Q7RTU9	.;STRC_HUMAN	A	1709;1709;936	ENSP00000401513:T1709A;ENSP00000440413:T936A	ENSP00000299992:T1709A	T	-	1	0	STRC	41679564	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.236000	0.58675	2.148000	0.66965	0.402000	0.26972	ACC		STRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133140.1	NM_153700	
RPL4	6124	broad.mit.edu	37	15	66793328	66793328	+	Silent	SNP	G	G	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr15:66793328G>A	ENST00000307961.6	-	7	884	c.792C>T	c.(790-792)taC>taT	p.Y264Y	SNORD18A_ENST00000363753.1_RNA|SNORD18C_ENST00000362704.1_RNA|SNORD18B_ENST00000365659.1_RNA|SNORD16_ENST00000362803.1_RNA|RPL4_ENST00000568588.1_Silent_p.Y170Y	NM_000968.3	NP_000959.2	P36578	RL4_HUMAN	ribosomal protein L4	264					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)	p.Y264Y(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|stomach(1)|urinary_tract(1)	17						GCCAAGTGCCGTACAATTCAT	0.408																																					p.Y264Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C792T	15						.						88.0	86.0	86.0					15																	66793328		2201	4299	6500	64580382	SO:0001819	synonymous_variant	6124	exon7			AB007167	CCDS10218.1	15q22	2011-04-06			ENSG00000174444	ENSG00000174444		"""L ribosomal proteins"""	10353	protein-coding gene	gene with protein product	"""60S ribosomal protein L4"""	180479				9582194, 8268230	Standard	NM_000968		Approved	L4	uc002apv.3	P36578	OTTHUMG00000133193	ENST00000307961.6:c.792C>T	15.37:g.66793328G>A		Somatic		Capture	Illumina HiSeq	Phase_I	64580382	NM_000968	A8K502|P39029|Q4VBR0|Q969Z9	Silent	SNP	ENST00000307961.6	37	CCDS10218.1																																																																																				RPL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256903.2	NM_000968	
TLE3	7090	broad.mit.edu	37	15	70358528	70358528	+	Silent	SNP	G	G	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr15:70358528G>A	ENST00000558939.1	-	7	1779	c.402C>T	c.(400-402)tcC>tcT	p.S134S	TLE3_ENST00000559929.1_Silent_p.S144S|TLE3_ENST00000559191.1_Intron|TLE3_ENST00000317509.8_Silent_p.S134S|TLE3_ENST00000557997.1_Silent_p.S134S|TLE3_ENST00000560939.1_Silent_p.S139S|TLE3_ENST00000557907.1_Silent_p.S134S|TLE3_ENST00000558379.1_Silent_p.S134S|TLE3_ENST00000440567.3_Silent_p.S127S|TLE3_ENST00000451782.2_Silent_p.S134S|TLE3_ENST00000539550.1_Silent_p.S78S|TLE3_ENST00000560589.1_Silent_p.S78S|TLE3_ENST00000442299.2_Silent_p.S134S|TLE3_ENST00000558201.1_Silent_p.S140S|TLE3_ENST00000559048.1_Silent_p.S139S	NM_001282979.1|NM_001282980.1|NM_001282981.1	NP_001269908.1|NP_001269909.1|NP_001269910.1	Q04726	TLE3_HUMAN	transducin-like enhancer of split 3	134	Gly/Pro-rich.				Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.S134S(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						GTGTGGCATGGGAGAGGTGCT	0.677																																					p.S134S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C402T	15						.						14.0	20.0	18.0					15																	70358528		2179	4278	6457	68145582	SO:0001819	synonymous_variant	7090	exon7			M99438	CCDS45293.1, CCDS45294.1, CCDS58375.1, CCDS61689.1, CCDS61691.1, CCDS61692.1, CCDS73747.1	15q22	2014-03-07	2014-03-07			ENSG00000140332		"""WD repeat domain containing"""	11839	protein-coding gene	gene with protein product		600190	"""transducin-like enhancer of split 3, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005254623		Approved	ESG, ESG3, KIAA1547, HsT18976, GRG3	uc002asm.2	Q04726		ENST00000558939.1:c.402C>T	15.37:g.70358528G>A		Somatic		Capture	Illumina HiSeq	Phase_I	68145582	NM_020908	B4DPT0|E9PD64|F8W964|Q6PI57|Q8IVV6|Q8WVR2|Q9HCM5	Silent	SNP	ENST00000558939.1	37	CCDS45293.1																																																																																				TLE3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000416913.1	NM_005078	
HCN4	10021	broad.mit.edu	37	15	73624615	73624615	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr15:73624615C>T	ENST00000261917.3	-	3	2221	c.1228G>A	c.(1228-1230)Gac>Aac	p.D410N	RP11-272D12.1_ENST00000558742.1_RNA	NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	410					blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)	p.D410N(1)		NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		CTGGCCAGGTCGTAGGTCATG	0.622																																					p.D410N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1228A	15						.						74.0	64.0	67.0					15																	73624615		2198	4297	6495	71411668	SO:0001583	missense	10021	exon3			AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.1228G>A	15.37:g.73624615C>T	ENSP00000261917:p.Asp410Asn	Somatic		Capture	Illumina HiSeq	Phase_I	71411668	NM_005477	Q9UMQ7	Missense_Mutation	SNP	ENST00000261917.3	37	CCDS10248.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.960332	0.74016	.	.	ENSG00000138622	ENST00000261917	D	0.98381	-4.9	4.36	4.36	0.52297	Ion transport (1);	.	.	.	.	D	0.98002	0.9342	L	0.39020	1.185	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97787	1.0236	9	0.30078	T	0.28	.	17.2725	0.87106	0.0:1.0:0.0:0.0	.	410	Q9Y3Q4	HCN4_HUMAN	N	410	ENSP00000261917:D410N	ENSP00000261917:D410N	D	-	1	0	HCN4	71411668	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.684000	0.84104	2.122000	0.65172	0.561000	0.74099	GAC		HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268900.2	NM_005477	
BAIAP3	8938	broad.mit.edu	37	16	1395284	1395284	+	Missense_Mutation	SNP	G	G	A	rs116719702	byFrequency	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr16:1395284G>A	ENST00000324385.5	+	22	2238	c.2080G>A	c.(2080-2082)Gcc>Acc	p.A694T	BAIAP3_ENST00000568887.1_Missense_Mutation_p.A631T|BAIAP3_ENST00000397489.1_Missense_Mutation_p.A676T|BAIAP3_ENST00000562208.1_Missense_Mutation_p.A636T|BAIAP3_ENST00000421665.2_Missense_Mutation_p.A623T|BAIAP3_ENST00000426824.3_Missense_Mutation_p.A659T|BAIAP3_ENST00000397488.2_Missense_Mutation_p.A676T	NM_003933.4	NP_003924.2	O94812	BAIP3_HUMAN	BAI1-associated protein 3	694	MHD1. {ECO:0000255|PROSITE- ProRule:PRU00587}.				G-protein coupled receptor signaling pathway (GO:0007186)|neurotransmitter secretion (GO:0007269)		protein C-terminus binding (GO:0008022)	p.A694T(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(25)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42		Hepatocellular(780;0.0893)				TGGCATCCACGCCCCCTTCCT	0.642													G|||	6	0.00119808	0.0045	0.0	5008	,	,		12728	0.0		0.0	False		,,,				2504	0.0				p.A631T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1891A	16						.	G	THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA	10,4388	16.8+/-37.8	0,10,2189	70.0	65.0	66.0		1867,1975,1906,1891,2080	-7.7	0.0	16	dbSNP_132	66	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense,missense,missense,missense	BAIAP3	NM_001199096.1,NM_001199097.1,NM_001199098.1,NM_001199099.1,NM_003933.4	58,58,58,58,58	0,12,6487	AA,AG,GG		0.0233,0.2274,0.0923	benign,benign,benign,benign,benign	623/1117,659/1153,636/1130,631/1125,694/1188	1395284	12,12986	2199	4300	6499	1335285	SO:0001583	missense	8938	exon22			AB017111	CCDS10434.1, CCDS55978.1, CCDS55979.1, CCDS58402.1, CCDS58403.1, CCDS66894.1	16p13.3	2008-07-04			ENSG00000007516	ENSG00000007516			948	protein-coding gene	gene with protein product		604009				9790924	Standard	NM_003933		Approved	BAP3, KIAA0734	uc002clk.2	O94812	OTTHUMG00000047833	ENST00000324385.5:c.2080G>A	16.37:g.1395284G>A	ENSP00000324510:p.Ala694Thr	Somatic		Capture	Illumina HiSeq	Phase_I	1335285	NM_001199099	A2A2B2|B2RCD7|B4DGS5|B4DIK3|B4DRK9|B4DRP1|E7EUB9|H3BUH8|H3BVI3|H7C2Q1|O94839|Q2M226|Q658J2|Q76N05|Q96RZ3|Q9UJK1	Missense_Mutation	SNP	ENST00000324385.5	37	CCDS10434.1	5	0.0022893772893772895	5	0.01016260162601626	0	0.0	0	0.0	0	0.0	G	4.673	0.125058	0.08931	0.002274	2.33E-4	ENSG00000007516	ENST00000426824;ENST00000397488;ENST00000324385;ENST00000397489;ENST00000421665	T;T;T;T;T	0.71222	-0.53;-0.54;-0.54;-0.54;-0.55	4.6	-7.7	0.01259	Munc13 homology 1 (1);	1.026490	0.07676	N	0.936301	T	0.18173	0.0436	N	0.00436	-1.5	0.09310	N	1	B;B;B;B	0.06786	0.001;0.001;0.001;0.001	B;B;B;B	0.06405	0.002;0.0;0.0;0.0	T	0.25813	-1.0121	10	0.14656	T	0.56	-3.3579	2.9734	0.05929	0.4416:0.1109:0.3361:0.1114	.	623;636;694;676	E7EUB9;B4DIK3;O94812;A2A2B2	.;.;BAIP3_HUMAN;.	T	659;676;694;676;623	ENSP00000407242:A659T;ENSP00000380625:A676T;ENSP00000324510:A694T;ENSP00000380626:A676T;ENSP00000409533:A623T	ENSP00000324510:A694T	A	+	1	0	BAIAP3	1335285	0.000000	0.05858	0.014000	0.15608	0.201000	0.24016	-0.246000	0.08878	-0.687000	0.05162	-1.976000	0.00459	GCC		BAIAP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109056.3		
HYDIN	54768	broad.mit.edu	37	16	70952155	70952155	+	Missense_Mutation	SNP	C	C	G	rs267604618		TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr16:70952155C>G	ENST00000393567.2	-	47	8113	c.7963G>C	c.(7963-7965)Gaa>Caa	p.E2655Q		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	2655					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.E2654Q(1)|p.E2606Q(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GATTCTATTTCCATTTCTTTT	0.443																																					p.E2654Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G7960C	16						.						5.0	4.0	4.0					16																	70952155		1557	3408	4965	69509656	SO:0001583	missense	54768	exon47			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.7963G>C	16.37:g.70952155C>G	ENSP00000377197:p.Glu2655Gln	Somatic		Capture	Illumina HiSeq	Phase_I	69509656	NM_032821	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	C	19.94	3.919246	0.73098	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.01051	5.4	5.89	5.89	0.94794	.	0.000000	0.33813	U	0.004539	T	0.04497	0.0123	L	0.60455	1.87	0.80722	D	1	D	0.61080	0.989	P	0.55923	0.787	T	0.46247	-0.9205	10	0.48119	T	0.1	.	18.8085	0.92048	0.0:1.0:0.0:0.0	.	2654	F8WD23	.	Q	2655;2654	ENSP00000377197:E2655Q	ENSP00000313052:E2654Q	E	-	1	0	HYDIN	69509656	0.981000	0.34729	0.097000	0.21041	0.006000	0.05464	4.904000	0.63279	2.790000	0.95986	0.609000	0.83330	GAA		HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
TP53	7157	broad.mit.edu	37	17	7579361	7579361	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr17:7579361A>C	ENST00000269305.4	-	4	515	c.326T>G	c.(325-327)tTc>tGc	p.F109C	TP53_ENST00000359597.4_Missense_Mutation_p.F109C|TP53_ENST00000420246.2_Missense_Mutation_p.F109C|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.F109C|TP53_ENST00000445888.2_Missense_Mutation_p.F109C|TP53_ENST00000455263.2_Missense_Mutation_p.F109C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	109	Interaction with HIPK1. {ECO:0000250}.|Interaction with WWOX.|Required for interaction with ZNF385A.		F -> C (in sporadic cancers; somatic mutation).|F -> L (in a sporadic cancer; somatic mutation).|F -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.F109C(4)|p.F109S(4)|p.G59fs*23(3)|p.G108_F109delGF(2)|p.F109_R110delFR(2)|p.V73fs*9(1)|p.G105_T125del21(1)|p.Y107fs*44(1)|p.Y103_G112>C(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.Y107fs*38(1)|p.Y103_L111>L(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCCCAGACGGAAACCGTAGCT	0.612		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.F109C	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	.	.	31	Substitution - Missense(8)|Whole gene deletion(8)|Deletion - Frameshift(8)|Deletion - In frame(5)|Complex - deletion inframe(2)	upper_aerodigestive_tract(5)|large_intestine(5)|stomach(4)|bone(4)|breast(4)|central_nervous_system(2)|lung(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|liver(1)|ovary(1)	c.T326G	17						.						62.0	59.0	60.0					17																	7579361		2203	4300	6503	7520086	SO:0001583	missense	7157	exon4	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.326T>G	17.37:g.7579361A>C	ENSP00000269305:p.Phe109Cys	Somatic		Capture	Illumina HiSeq	Phase_I	7520086	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.104070	0.76983	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	D;D;D;D;D;D;D;D	0.99853	-7.18;-7.18;-7.18;-7.18;-7.18;-7.18;-7.18;-7.18	4.75	4.75	0.60458	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.104685	0.64402	D	0.000004	D	0.99866	0.9937	M	0.90977	3.165	0.47862	D	0.999536	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.997;0.999;0.999;1.0;0.999;0.998	D	0.96432	0.9320	10	0.87932	D	0	-31.6488	12.5363	0.56144	1.0:0.0:0.0:0.0	.	70;109;109;109;109;109;109	B4E095;E7EMR6;P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	C	109	ENSP00000410739:F109C;ENSP00000352610:F109C;ENSP00000269305:F109C;ENSP00000398846:F109C;ENSP00000391127:F109C;ENSP00000391478:F109C;ENSP00000424104:F109C;ENSP00000426252:F109C	ENSP00000269305:F109C	F	-	2	0	TP53	7520086	1.000000	0.71417	0.868000	0.34077	0.936000	0.57629	7.389000	0.79806	2.125000	0.65367	0.533000	0.62120	TTC		TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
NGFR	4804	broad.mit.edu	37	17	47590285	47590285	+	Missense_Mutation	SNP	G	G	A	rs534528579		TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr17:47590285G>A	ENST00000172229.3	+	6	1323	c.1198G>A	c.(1198-1200)Gcc>Acc	p.A400T	RP5-1029K10.2_ENST00000514506.1_RNA|NGFR_ENST00000504201.1_Missense_Mutation_p.A306T	NM_002507.3	NP_002498.1	P08138	TNR16_HUMAN	nerve growth factor receptor	400	Death. {ECO:0000255|PROSITE- ProRule:PRU00064}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|detection of temperature stimulus (GO:0016048)|glucose homeostasis (GO:0042593)|hair follicle morphogenesis (GO:0031069)|intracellular protein transport (GO:0006886)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell cycle (GO:0045786)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of hair follicle development (GO:0051799)|nerve development (GO:0021675)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of axonogenesis (GO:0050772)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of odontogenesis of dentin-containing tooth (GO:0042488)|regulation of axonogenesis (GO:0050770)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cell surface (GO:0009986)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	death receptor activity (GO:0005035)|Rab GTPase binding (GO:0017137)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.A400T(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)	17	all_cancers(4;1.45e-13)|Breast(4;6.34e-28)|all_epithelial(4;4.95e-17)					CACACTGGACGCCCTCCTGGC	0.682													G|||	1	0.000199681	0.0	0.0014	5008	,	,		12743	0.0		0.0	False		,,,				2504	0.0				p.A400T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1198A	17						.						20.0	21.0	21.0					17																	47590285		2201	4297	6498	44945284	SO:0001583	missense	4804	exon6			M14764	CCDS11549.1	17q21-q22	2013-05-22	2010-04-28		ENSG00000064300	ENSG00000064300		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	7809	protein-coding gene	gene with protein product	"""low affinity nerve growth factor receptor"", ""TNFR superfamily, member 16"""	162010	"""nerve growth factor receptor (TNFR superfamily, member 16)"""			3022937, 3006050	Standard	NM_002507		Approved	TNFRSF16, CD271, p75NTR	uc002ioz.4	P08138	OTTHUMG00000161495	ENST00000172229.3:c.1198G>A	17.37:g.47590285G>A	ENSP00000172229:p.Ala400Thr	Somatic		Capture	Illumina HiSeq	Phase_I	44945284	NM_002507	B2R961|B4E096	Missense_Mutation	SNP	ENST00000172229.3	37	CCDS11549.1	.	.	.	.	.	.	.	.	.	.	G	14.76	2.630411	0.46944	.	.	ENSG00000064300	ENST00000172229;ENST00000504201	D;D	0.85339	-1.97;-1.97	4.55	3.56	0.40772	Death (3);DEATH-like (2);	0.684942	0.13412	N	0.389821	T	0.75206	0.3818	L	0.44542	1.39	0.35899	D	0.830258	P	0.43662	0.814	B	0.32022	0.139	T	0.73748	-0.3885	10	0.21540	T	0.41	-17.3422	11.0572	0.47925	0.097:0.0:0.903:0.0	.	400	P08138	TNR16_HUMAN	T	400;306	ENSP00000172229:A400T;ENSP00000421731:A306T	ENSP00000172229:A400T	A	+	1	0	NGFR	44945284	0.997000	0.39634	0.974000	0.42286	0.979000	0.70002	2.515000	0.45512	0.991000	0.38814	0.561000	0.74099	GCC		NGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365150.1		
ROCK1	6093	broad.mit.edu	37	18	18533685	18533685	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr18:18533685T>G	ENST00000399799.2	-	32	4855	c.3915A>C	c.(3913-3915)caA>caC	p.Q1305H		NM_005406.2	NP_005397.1	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein kinase 1	1305	Auto-inhibitory.|PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|apical constriction (GO:0003383)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|bleb assembly (GO:0032060)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of focal adhesion assembly (GO:0051894)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.Q1305H(1)		NS(1)|breast(4)|central_nervous_system(1)|large_intestine(8)|lung(2)	16	Melanoma(1;0.165)					CCCATTTTTTTTGTTCATCCT	0.368																																					p.Q1305H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3915C	18						.						35.0	37.0	36.0					18																	18533685		2201	4295	6496	16787683	SO:0001583	missense	6093	exon32				CCDS11870.2	18q11.2	2013-01-10			ENSG00000067900	ENSG00000067900	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10251	protein-coding gene	gene with protein product		601702				8617235	Standard	NM_005406		Approved	p160ROCK	uc002kte.3	Q13464	OTTHUMG00000131723	ENST00000399799.2:c.3915A>C	18.37:g.18533685T>G	ENSP00000382697:p.Gln1305His	Somatic		Capture	Illumina HiSeq	Phase_I	16787683	NM_005406	B0YJ91|Q2KHM4|Q59GZ4	Missense_Mutation	SNP	ENST00000399799.2	37	CCDS11870.2	.	.	.	.	.	.	.	.	.	.	T	11.35	1.611586	0.28712	.	.	ENSG00000067900	ENST00000399799	T	0.75367	-0.93	4.78	1.0	0.19881	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	D	0.83110	0.5183	M	0.80982	2.52	0.54753	D	0.999983	D	0.89917	1.0	D	0.91635	0.999	T	0.81075	-0.1097	10	0.87932	D	0	.	7.5269	0.27660	0.0:0.5255:0.0:0.4745	.	1305	Q13464	ROCK1_HUMAN	H	1305	ENSP00000382697:Q1305H	ENSP00000382697:Q1305H	Q	-	3	2	ROCK1	16787683	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.698000	0.47068	0.204000	0.20548	0.332000	0.21555	CAA		ROCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254641.2	NM_005406	
PTPRM	5797	broad.mit.edu	37	18	8253317	8253317	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr18:8253317G>A	ENST00000332175.8	+	17	3657	c.2620G>A	c.(2620-2622)Ggg>Agg	p.G874R	PTPRM_ENST00000444013.1_Missense_Mutation_p.G661R|PTPRM_ENST00000400060.4_Missense_Mutation_p.G888R|PTPRM_ENST00000580170.1_Missense_Mutation_p.G887R|PTPRM_ENST00000400053.4_Missense_Mutation_p.G812R	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	874					homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.G874R(1)		breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				CTATCAGACTGGGCAGCTCCA	0.582																																					p.G874R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2620A	18						.						41.0	32.0	35.0					18																	8253317		2203	4300	6503	8243317	SO:0001583	missense	5797	exon17			X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.2620G>A	18.37:g.8253317G>A	ENSP00000331418:p.Gly874Arg	Somatic		Capture	Illumina HiSeq	Phase_I	8243317	NM_002845	A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	ENST00000332175.8	37	CCDS11840.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.347838	0.82022	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	T;T;T;T	0.50001	1.08;1.13;0.91;0.76	6.04	5.17	0.71159	.	0.000000	0.85682	D	0.000000	T	0.69178	0.3082	M	0.79693	2.465	0.80722	D	1	D;B;B	0.69078	0.997;0.005;0.017	D;B;B	0.71414	0.973;0.014;0.014	T	0.71748	-0.4499	10	0.42905	T	0.14	.	15.4311	0.75099	0.0663:0.0:0.9337:0.0	.	661;887;874	E7EVX9;A7MBN1;P28827	.;.;PTPRM_HUMAN	R	874;888;812;661	ENSP00000331418:G874R;ENSP00000382933:G888R;ENSP00000382927:G812R;ENSP00000387608:G661R	ENSP00000331418:G874R	G	+	1	0	PTPRM	8243317	1.000000	0.71417	0.898000	0.35279	0.981000	0.71138	9.860000	0.99555	1.566000	0.49654	0.561000	0.74099	GGG		PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		
SMAD4	4089	broad.mit.edu	37	18	48603009	48603009	+	Splice_Site	SNP	T	T	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr18:48603009T>A	ENST00000342988.3	+	11	1848	c.1310T>A	c.(1309-1311)gTc>gAc	p.V437D	SMAD4_ENST00000398417.2_Splice_Site_p.V437D|SMAD4_ENST00000588745.1_Splice_Site_p.V341D	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	437	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(2)|p.V437D(1)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		TCTTAAAAGGTCTTTGATTTG	0.423																																					p.V437D												.	.	39	Whole gene deletion(36)|Unknown(2)|Substitution - Missense(1)	pancreas(26)|large_intestine(4)|breast(3)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)	c.T1310A	18						.						36.0	37.0	36.0					18																	48603009		2203	4300	6503	46857007	SO:0001630	splice_region_variant	4089	exon11			U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1309-1T>A	18.37:g.48603009T>A		Somatic		Capture	Illumina HiSeq	Phase_I	46857007	NM_005359	A8K405	Missense_Mutation	SNP	ENST00000342988.3	37	CCDS11950.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.363617	0.82353	.	.	ENSG00000141646	ENST00000342988;ENST00000398417	D;D	0.98207	-4.79;-4.79	6.03	6.03	0.97812	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.99143	0.9704	M	0.91510	3.215	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99425	1.0934	10	0.87932	D	0	.	15.5408	0.76043	0.0:0.0:0.0:1.0	.	437	Q13485	SMAD4_HUMAN	D	437	ENSP00000341551:V437D;ENSP00000381452:V437D	ENSP00000341551:V437D	V	+	2	0	SMAD4	46857007	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	7.883000	0.87264	2.308000	0.77769	0.533000	0.62120	GTC		SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	NM_005359	Missense_Mutation
EMC10	284361	broad.mit.edu	37	19	50985131	50985132	+	Intron	INS	-	-	G	rs200206091	byFrequency	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr19:50985131_50985132insG	ENST00000334976.6	+	7	724				EMC10_ENST00000376918.3_Frame_Shift_Ins_p.LG231fs|CTD-2545M3.2_ENST00000598194.1_RNA|EMC10_ENST00000598585.1_Intron	NM_206538.2	NP_996261.1	Q5UCC4	EMC10_HUMAN	ER membrane protein complex subunit 10							ER membrane protein complex (GO:0072546)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)		p.A234fs*56(1)									CACATCATCCTGGGGGGGGCCG	0.738													GGGGGGGG|GGGGGGGG|GGGGGGGGG|insertion	55	0.0109824	0.003	0.0231	5008	,	,		12717	0.001		0.0159	False		,,,				2504	0.0184				p.L231fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.692_693insG	19						.																																			55676944	SO:0001627	intron_variant	284361	exon7			BC062607	CCDS12796.1, CCDS42594.1	19q13.33	2012-05-30	2012-05-30	2012-05-30	ENSG00000161671	ENSG00000161671			27609	protein-coding gene	gene with protein product	"""hematopoietic signal peptide-containing secreted 1"", ""hematopoietic signal peptide-containing membrane domain-containing 1"""	614545	"""chromosome 19 open reading frame 63"""	C19orf63		12975309, 22119785	Standard	NM_175063		Approved	INM02, HSS1, HSM1	uc002psl.3	Q5UCC4		ENST00000334976.6:c.679-274->G	19.37:g.50985139_50985139dupG		Somatic		Capture	Illumina HiSeq	Phase_I	55676943	NM_175063	Q5UCC6|Q69YT5|Q6UWP3|Q86YL4|Q8N541	Frame_Shift_Ins	INS	ENST00000334976.6	37	CCDS12796.1																																																																																				EMC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464760.2	NM_175063	
OR10H2	26538	broad.mit.edu	37	19	15839673	15839673	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr19:15839673C>A	ENST00000305899.3	+	1	840	c.820C>A	c.(820-822)Ctg>Atg	p.L274M		NM_013939.2	NP_039227.1	O60403	O10H2_HUMAN	olfactory receptor, family 10, subfamily H, member 2	274						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L274M(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(1)	27	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)					GGGTGACACCCTGATGGCCAC	0.547																																					p.L274M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C820A	19						.						147.0	119.0	128.0					19																	15839673		2203	4300	6503	15700673	SO:0001583	missense	26538	exon1			AC004597	CCDS12333.1	19p13.1	2012-08-09				ENSG00000171942		"""GPCR / Class A : Olfactory receptors"""	8173	protein-coding gene	gene with protein product							Standard	NM_013939		Approved		uc002nbm.2	O60403		ENST00000305899.3:c.820C>A	19.37:g.15839673C>A	ENSP00000306095:p.Leu274Met	Somatic		Capture	Illumina HiSeq	Phase_I	15700673	NM_013939	Q6IFQ1|Q96R58	Missense_Mutation	SNP	ENST00000305899.3	37	CCDS12333.1	.	.	.	.	.	.	.	.	.	.	.	6.237	0.411772	0.11812	.	.	ENSG00000171942	ENST00000305899	T	0.00123	8.7	3.39	-0.3	0.12804	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38548	N	0.001658	T	0.00271	0.0008	L	0.46819	1.47	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.51779	-0.8662	10	0.66056	D	0.02	.	5.9046	0.18986	0.0:0.6236:0.1566:0.2198	.	274	O60403	O10H2_HUMAN	M	274	ENSP00000306095:L274M	ENSP00000306095:L274M	L	+	1	2	OR10H2	15700673	0.000000	0.05858	0.030000	0.17652	0.058000	0.15608	-4.940000	0.00168	-0.342000	0.08363	-1.510000	0.00946	CTG		OR10H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460917.1		
CEP89	84902	broad.mit.edu	37	19	33444706	33444706	+	Splice_Site	SNP	G	G	C			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr19:33444706G>C	ENST00000305768.5	-	4	395	c.307C>G	c.(307-309)Cca>Gca	p.P103A	CEP89_ENST00000590597.2_Splice_Site_p.P103A	NM_032816.3	NP_116205.3	Q96ST8	CEP89_HUMAN	centrosomal protein 89kDa	103					cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)		p.P103A(1)		breast(2)|cervix(1)|endometrium(4)|large_intestine(4)|lung(15)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	35						TGCCAATTTGGCCTGTATTAG	0.373																																					p.P103A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C307G	19						.						101.0	83.0	89.0					19																	33444706		2203	4300	6503	38136546	SO:0001630	splice_region_variant	84902	exon4			AL832158	CCDS32987.1	19q13.11	2014-02-20	2011-05-06	2011-05-06		ENSG00000121289			25907	protein-coding gene	gene with protein product		615470	"""coiled-coil domain containing 123"""	CCDC123		16395595	Standard	NM_032816		Approved	FLJ14640	uc002nty.3	Q96ST8		ENST00000305768.5:c.306-1C>G	19.37:g.33444706G>C		Somatic		Capture	Illumina HiSeq	Phase_I	38136546	NM_032816	B9EGA6|Q8N5J8	Missense_Mutation	SNP	ENST00000305768.5	37	CCDS32987.1	.	.	.	.	.	.	.	.	.	.	G	10.57	1.388263	0.25118	.	.	ENSG00000121289	ENST00000305768	T	0.29917	1.55	5.08	-0.616	0.11583	.	0.729129	0.13023	N	0.419910	T	0.27731	0.0682	L	0.55103	1.725	0.09310	N	1	P;B	0.49961	0.93;0.105	P;B	0.47915	0.561;0.05	T	0.12760	-1.0535	10	0.38643	T	0.18	1.6007	2.3566	0.04297	0.0969:0.2105:0.4077:0.2849	.	103;103	Q96ST8-3;Q96ST8	.;CEP89_HUMAN	A	103	ENSP00000306105:P103A	ENSP00000306105:P103A	P	-	1	0	CEP89	38136546	0.012000	0.17670	0.013000	0.15412	0.412000	0.31113	0.189000	0.17037	0.219000	0.20840	0.585000	0.79938	CCA		CEP89-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451300.2	NM_032816	Missense_Mutation
MYH14	79784	broad.mit.edu	37	19	50785053	50785053	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr19:50785053G>A	ENST00000596571.1	+	30	4370	c.4370G>A	c.(4369-4371)cGg>cAg	p.R1457Q	MYH14_ENST00000601313.1_Missense_Mutation_p.R1498Q|MYH14_ENST00000440075.2_Missense_Mutation_p.R1498Q|MYH14_ENST00000376970.2_Missense_Mutation_p.R1490Q|MYH14_ENST00000598205.1_Missense_Mutation_p.R1465Q|MYH14_ENST00000262269.8_Missense_Mutation_p.R1498Q|MYH14_ENST00000425460.1_Missense_Mutation_p.R1465Q			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	1457					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.R1498Q(1)		central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		GAGCAGCAGCGGCAGCTTGTG	0.647																																					p.R1465Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4394A	19						.						15.0	19.0	17.0					19																	50785053		2103	4208	6311	55476865	SO:0001583	missense	79784	exon32			AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.4370G>A	19.37:g.50785053G>A	ENSP00000472819:p.Arg1457Gln	Somatic		Capture	Illumina HiSeq	Phase_I	55476865	NM_001077186	B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Missense_Mutation	SNP	ENST00000596571.1	37	CCDS59411.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.681669	0.88542	.	.	ENSG00000105357	ENST00000440075;ENST00000376970;ENST00000425460;ENST00000262269	D;D;D;D	0.82984	-1.67;-1.67;-1.67;-1.67	4.0	2.95	0.34219	Myosin tail (1);	.	.	.	.	D	0.84014	0.5379	L	0.46157	1.445	0.41971	D	0.99075	D;D;D	0.59357	0.985;0.974;0.985	P;P;P	0.60117	0.793;0.869;0.84	T	0.81506	-0.0902	8	.	.	.	.	8.8709	0.35316	0.1155:0.0:0.8845:0.0	.	1498;1457;1465	Q7Z406-2;Q7Z406;Q7Z406-6	.;MYH14_HUMAN;.	Q	1498;1490;1465;1498	ENSP00000406273:R1498Q;ENSP00000366169:R1490Q;ENSP00000407879:R1465Q;ENSP00000262269:R1498Q	.	R	+	2	0	MYH14	55476865	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.974000	0.70465	1.009000	0.39289	0.561000	0.74099	CGG		MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464710.2	NM_024729	
ZNF880	400713	broad.mit.edu	37	19	52888008	52888008	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr19:52888008A>C	ENST00000422689.2	+	4	1190	c.1175A>C	c.(1174-1176)aAg>aCg	p.K392T		NM_001145434.1	NP_001138906.1	Q6PDB4	ZN880_HUMAN	zinc finger protein 880	392					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K392T(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	10						TTCAGGCACAAGTTTTGTCTA	0.413																																					p.K392T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1175C	19						.						58.0	53.0	55.0					19																	52888008		1568	3582	5150	57579820	SO:0001583	missense	400713	exon4			BC058819	CCDS46164.1	19q13.41	2013-01-08			ENSG00000221923	ENSG00000221923		"""Zinc fingers, C2H2-type"", ""-"""	37249	protein-coding gene	gene with protein product							Standard	NM_001145434		Approved		uc002pzc.3	Q6PDB4	OTTHUMG00000167972	ENST00000422689.2:c.1175A>C	19.37:g.52888008A>C	ENSP00000406318:p.Lys392Thr	Somatic		Capture	Illumina HiSeq	Phase_I	57579820	NM_001145434	B4DNA6	Missense_Mutation	SNP	ENST00000422689.2	37	CCDS46164.1	.	.	.	.	.	.	.	.	.	.	A	0.102	-1.150724	0.01700	.	.	ENSG00000221923	ENST00000422689	T	0.08458	3.09	1.84	-3.68	0.04463	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06735	0.0172	L	0.50993	1.605	0.09310	N	1	B	0.22604	0.072	B	0.21546	0.035	T	0.38929	-0.9638	8	.	.	.	.	4.1118	0.10062	0.3642:0.0:0.4643:0.1715	.	392	Q6PDB4	ZN880_HUMAN	T	392	ENSP00000406318:K392T	.	K	+	2	0	ZNF880	57579820	0.000000	0.05858	0.000000	0.03702	0.032000	0.12392	-2.998000	0.00654	-1.142000	0.02869	0.450000	0.29827	AAG		ZNF880-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397374.1	NM_001145434	
NLRP2	55655	broad.mit.edu	37	19	55494413	55494413	+	Silent	SNP	G	G	A	rs375208908		TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr19:55494413G>A	ENST00000543010.1	+	6	1490	c.1347G>A	c.(1345-1347)acG>acA	p.T449T	NLRP2_ENST00000339757.7_Silent_p.T427T|NLRP2_ENST00000448584.2_Silent_p.T449T|NLRP2_ENST00000263437.6_Silent_p.T446T|NLRP2_ENST00000391721.4_Silent_p.T425T|NLRP2_ENST00000538819.1_Silent_p.T425T|NLRP2_ENST00000427260.2_Silent_p.T426T|NLRP2_ENST00000537859.1_Silent_p.T427T	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	449	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)	p.T449T(1)		large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		CGCTGCGGACGCTGAGCCTCC	0.711													G|||	1	0.000199681	0.0	0.0014	5008	,	,		14977	0.0		0.0	False		,,,				2504	0.0				p.T426T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1278A	19						.	G	,,,	1,4361		0,1,2180	15.0	15.0	15.0		1347,1281,1278,1347	-3.8	0.0	19		15	0,8518		0,0,4259	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	NLRP2	NM_001174081.1,NM_001174082.1,NM_001174083.1,NM_017852.3	,,,	0,1,6439	AA,AG,GG		0.0,0.0229,0.0078	,,,	449/1063,427/1041,426/1040,449/1063	55494413	1,12879	2181	4259	6440	60186225	SO:0001819	synonymous_variant	55655	exon7			AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.1347G>A	19.37:g.55494413G>A		Somatic		Capture	Illumina HiSeq	Phase_I	60186225	NM_001174083	B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Silent	SNP	ENST00000543010.1	37	CCDS12913.1																																																																																				NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396152.1	NM_017852	
TMEM150B	284417	broad.mit.edu	37	19	55824238	55824238	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr19:55824238C>A	ENST00000326652.4	-	8	873	c.691G>T	c.(691-693)Gtc>Ttc	p.V231F	TMEM150B_ENST00000438693.1_Missense_Mutation_p.V231F|CTD-2105E13.14_ENST00000596786.1_RNA	NM_001282011.1	NP_001268940.1	A6NC51	T150B_HUMAN	transmembrane protein 150B	231						integral component of membrane (GO:0016021)		p.V231F(1)		endometrium(1)|large_intestine(1)|lung(1)	3						TACAGCTGGACCGGCAGGGAG	0.667																																					p.V231F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G691T	19						.																																			60516050	SO:0001583	missense	284417	exon8			BC020862	CCDS42629.1	19q13.42	2009-06-12	2009-06-12	2009-06-12		ENSG00000180061			34415	protein-coding gene	gene with protein product			"""transmembrane protein 224"""	TMEM224			Standard	XM_005258812		Approved		uc010esw.1	A6NC51		ENST00000326652.4:c.691G>T	19.37:g.55824238C>A	ENSP00000320757:p.Val231Phe	Somatic		Capture	Illumina HiSeq	Phase_I	60516050	NM_001085488	B7ZW71	Missense_Mutation	SNP	ENST00000326652.4	37	CCDS42629.1	.	.	.	.	.	.	.	.	.	.	.	12.94	2.088091	0.36855	.	.	ENSG00000180061	ENST00000326652;ENST00000438693	T;T	0.48201	0.82;0.82	4.44	-4.51	0.03483	.	1.040280	0.07596	N	0.922911	T	0.23370	0.0565	N	0.19112	0.55	0.09310	N	1	P	0.40476	0.718	B	0.30646	0.118	T	0.19976	-1.0289	10	0.52906	T	0.07	-5.4034	5.9583	0.19286	0.0:0.2575:0.1543:0.5882	.	231	A6NC51	T150B_HUMAN	F	231	ENSP00000320757:V231F;ENSP00000412658:V231F	ENSP00000320757:V231F	V	-	1	0	TMEM150B	60516050	0.000000	0.05858	0.000000	0.03702	0.048000	0.14542	-4.029000	0.00310	-0.559000	0.06110	0.511000	0.50034	GTC		TMEM150B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452685.1	NM_001085488	
MTOR	2475	broad.mit.edu	37	1	11177078	11177078	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr1:11177078A>C	ENST00000361445.4	-	50	7075	c.6999T>G	c.(6997-6999)atT>atG	p.I2333M	MTOR_ENST00000376838.1_Missense_Mutation_p.I538M	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	2333	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.I2333M(1)		breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	CCAGGCCTAAAATATACCCAA	0.383																																					p.I2333M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T6999G	1						.						151.0	145.0	147.0					1																	11177078		2203	4300	6503	11099665	SO:0001583	missense	2475	exon50			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.6999T>G	1.37:g.11177078A>C	ENSP00000354558:p.Ile2333Met	Somatic		Capture	Illumina HiSeq	Phase_I	11099665	NM_004958	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	37	CCDS127.1	.	.	.	.	.	.	.	.	.	.	A	18.48	3.633171	0.67015	.	.	ENSG00000198793	ENST00000361445;ENST00000376838	T;T	0.80480	-1.38;-1.38	5.69	4.57	0.56435	Protein kinase-like domain (1);Phosphatidylinositol 3/4-kinase, conserved site (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.000000	0.85682	D	0.000000	D	0.91175	0.7220	H	0.95260	3.645	0.80722	D	1	D	0.64830	0.994	D	0.69824	0.966	D	0.91080	0.4899	10	0.87932	D	0	-22.9158	8.0314	0.30467	0.8451:0.0:0.1549:0.0	.	2333	P42345	MTOR_HUMAN	M	2333;538	ENSP00000354558:I2333M;ENSP00000366034:I538M	ENSP00000354558:I2333M	I	-	3	3	MTOR	11099665	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.026000	0.49689	1.000000	0.39049	0.379000	0.24179	ATT		MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	NM_004958	
NRAS	4893	broad.mit.edu	37	1	115256530	115256530	+	Missense_Mutation	SNP	G	G	T	rs121913254		TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr1:115256530G>T	ENST00000369535.4	-	3	434	c.181C>A	c.(181-183)Caa>Aaa	p.Q61K		NM_002524.4	NP_002515.1	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog	61			Q -> K (in CMNS and NCMS; somatic mutation). {ECO:0000269|PubMed:23392294}.|Q -> R (in CMNS, NCMS and KNEN; also found in lung carcinoma cell and melanoma; dbSNP:rs11554290). {ECO:0000269|PubMed:18633438, ECO:0000269|PubMed:22499344, ECO:0000269|PubMed:23392294, ECO:0000269|PubMed:3276402}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of skeletal muscle tissue development (GO:0048642)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|small GTPase mediated signal transduction (GO:0007264)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.Q61K(595)|p.Q61E(9)|p.Q61L(3)|p.Q61R(2)|p.G60>?(1)		NS(134)|adrenal_gland(9)|autonomic_ganglia(9)|biliary_tract(6)|bone(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(11)|eye(3)|haematopoietic_and_lymphoid_tissue(1115)|kidney(3)|large_intestine(105)|liver(10)|lung(42)|meninges(2)|ovary(7)|pancreas(5)|prostate(8)|skin(1144)|soft_tissue(37)|stomach(5)|testis(8)|thyroid(359)|upper_aerodigestive_tract(28)|urinary_tract(13)	3085	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TACTCTTCTTGTCCAGCTGTA	0.458	Q61K(CHP212_AUTONOMIC_GANGLIA)|Q61K(HCC15_LUNG)|Q61K(HS936T_SKIN)|Q61K(HS944T_SKIN)|Q61K(HT1080_SOFT_TISSUE)|Q61K(HUT78_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61K(M07E_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61K(NCIH1299_LUNG)|Q61K(NCIH2087_LUNG)|Q61K(OCILY19_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61K(SKNAS_AUTONOMIC_GANGLIA)|Q61K(SKNSH_AUTONOMIC_GANGLIA)|Q61K(TYKNU_OVARY)	50	Mis		"""melanoma, MM, AML, thyroid"""				Noonan syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)																											p.Q61K			Dom	yes		1	1p13.2	4893	neuroblastoma RAS viral (v-ras) oncogene homolog		"""L, E"""	NRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0 	.	610	Substitution - Missense(609)|Complex(1)	skin(372)|haematopoietic_and_lymphoid_tissue(73)|thyroid(55)|NS(29)|large_intestine(28)|soft_tissue(16)|lung(12)|autonomic_ganglia(6)|liver(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|cervix(2)|endometrium(2)|pancreas(2)|meninges(1)|kidney(1)|biliary_tract(1)|stomach(1)|ovary(1)|bone(1)	c.C181A	1						.						180.0	156.0	164.0					1																	115256530		2203	4300	6503	115058053	SO:0001583	missense	4893	exon3	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	BC005219	CCDS877.1	1p13.2	2014-09-17			ENSG00000213281	ENSG00000213281			7989	protein-coding gene	gene with protein product		164790					Standard	NM_002524		Approved	N-ras	uc009wgu.3	P01111	OTTHUMG00000012059	ENST00000369535.4:c.181C>A	1.37:g.115256530G>T	ENSP00000358548:p.Gln61Lys	Somatic		Capture	Illumina HiSeq	Phase_I	115058053	NM_002524	Q14971|Q15104|Q15282	Missense_Mutation	SNP	ENST00000369535.4	37	CCDS877.1	.	.	.	.	.	.	.	.	.	.	G	33	5.255564	0.95336	.	.	ENSG00000213281	ENST00000369535	D	0.83506	-1.73	5.08	5.08	0.68730	Small GTP-binding protein domain (1);	0.000000	0.53938	U	0.000043	D	0.91845	0.7419	H	0.95850	3.73	0.80722	D	1	P	0.51791	0.948	P	0.54759	0.76	D	0.93711	0.7024	10	0.62326	D	0.03	.	18.6626	0.91477	0.0:0.0:1.0:0.0	.	61	P01111	RASN_HUMAN	K	61	ENSP00000358548:Q61K	ENSP00000358548:Q61K	Q	-	1	0	NRAS	115058053	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.520000	0.98027	2.624000	0.88883	0.655000	0.94253	CAA		NRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033395.2	NM_002524	
HRNR	388697	broad.mit.edu	37	1	152191074	152191074	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr1:152191074G>A	ENST00000368801.2	-	3	3106	c.3031C>T	c.(3031-3033)Cgt>Tgt	p.R1011C	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	1011					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.R1011C(1)		autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGTCGGCCACGGCTAGGGCTA	0.602																																					p.R1011C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3031T	1						.						117.0	128.0	124.0					1																	152191074		2203	4300	6503	150457698	SO:0001583	missense	388697	exon3			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.3031C>T	1.37:g.152191074G>A	ENSP00000357791:p.Arg1011Cys	Somatic		Capture	Illumina HiSeq	Phase_I	150457698	NM_001009931	Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	37	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	G	1.319	-0.599997	0.03744	.	.	ENSG00000197915	ENST00000368801	T	0.01685	4.69	0.0465	0.0465	0.14256	.	.	.	.	.	T	0.00356	0.0011	N	0.19112	0.55	0.09310	N	1	D	0.63880	0.993	B	0.32928	0.155	T	0.51204	-0.8735	8	0.38643	T	0.18	.	.	.	.	.	1011	Q86YZ3	HORN_HUMAN	C	1011	ENSP00000357791:R1011C	ENSP00000357791:R1011C	R	-	1	0	HRNR	150457698	0.000000	0.05858	0.004000	0.12327	0.074000	0.17049	-3.822000	0.00357	0.132000	0.18615	0.134000	0.15878	CGT		HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868	
INSRR	3645	broad.mit.edu	37	1	156814570	156814570	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr1:156814570G>A	ENST00000368195.3	-	13	2899	c.2503C>T	c.(2503-2505)Cgc>Tgc	p.R835C	NTRK1_ENST00000392302.2_Intron	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	835	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.R835C(2)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TCGAGCCAGCGCAGAAGGACA	0.627																																					p.R835C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2503T	1						.						66.0	66.0	66.0					1																	156814570		2203	4300	6503	155081194	SO:0001583	missense	3645	exon13			J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.2503C>T	1.37:g.156814570G>A	ENSP00000357178:p.Arg835Cys	Somatic		Capture	Illumina HiSeq	Phase_I	155081194	NM_014215	O60724|Q5VZS3	Missense_Mutation	SNP	ENST00000368195.3	37	CCDS1160.1	.	.	.	.	.	.	.	.	.	.	G	16.17	3.047765	0.55110	.	.	ENSG00000027644	ENST00000368195	T	0.58797	0.31	4.73	4.73	0.59995	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.492239	0.17280	N	0.180036	T	0.49081	0.1536	.	.	.	0.41269	D	0.986836	D	0.56035	0.974	P	0.48114	0.567	T	0.55140	-0.8187	9	0.54805	T	0.06	.	11.5179	0.50534	0.0:0.0:0.8206:0.1794	.	835	P14616	INSRR_HUMAN	C	835	ENSP00000357178:R835C	ENSP00000357178:R835C	R	-	1	0	INSRR	155081194	0.572000	0.26668	1.000000	0.80357	0.446000	0.32137	0.991000	0.29654	2.181000	0.69327	0.467000	0.42956	CGC		INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098929.1	NM_014215	
SPTA1	6708	broad.mit.edu	37	1	158617395	158617395	+	Missense_Mutation	SNP	C	C	T	rs201407861		TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr1:158617395C>T	ENST00000368147.4	-	27	4010	c.3830G>A	c.(3829-3831)cGt>cAt	p.R1277H		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1277					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.R1277L(2)|p.R1277H(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					ATCCTTTGTACGCCCCTGCAG	0.557																																					p.R1277H												.	.	3	Substitution - Missense(3)	lung(2)|large_intestine(1)	c.G3830A	1						.	C	HIS/ARG	1,3951		0,1,1975	115.0	116.0	115.0		3830	-5.2	0.0	1		115	0,8294		0,0,4147	yes	missense	SPTA1	NM_003126.2	29	0,1,6122	TT,TC,CC		0.0,0.0253,0.0082	benign	1277/2420	158617395	1,12245	1976	4147	6123	156884019	SO:0001583	missense	6708	exon27			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.3830G>A	1.37:g.158617395C>T	ENSP00000357129:p.Arg1277His	Somatic		Capture	Illumina HiSeq	Phase_I	156884019	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	C	7.837	0.721030	0.15372	2.53E-4	0.0	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.52295	0.67;0.67	4.43	-5.2	0.02823	.	.	.	.	.	T	0.14141	0.0342	L	0.39397	1.21	0.09310	N	1	B	0.16396	0.017	B	0.18561	0.022	T	0.32929	-0.9888	9	0.49607	T	0.09	.	6.0835	0.19954	0.5503:0.2286:0.0:0.221	.	1277	P02549	SPTA1_HUMAN	H	1277	ENSP00000357130:R1277H;ENSP00000357129:R1277H	ENSP00000357129:R1277H	R	-	2	0	SPTA1	156884019	0.001000	0.12720	0.000000	0.03702	0.013000	0.08279	0.152000	0.16302	-1.269000	0.02436	0.563000	0.77884	CGT		SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
KLHL20	27252	broad.mit.edu	37	1	173726125	173726125	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr1:173726125G>C	ENST00000209884.4	+	7	1114	c.978G>C	c.(976-978)tgG>tgC	p.W326C	KLHL20_ENST00000546011.1_Missense_Mutation_p.W137C	NM_014458.3	NP_055273.2	Q9Y2M5	KLH20_HUMAN	kelch-like family member 20	326					cytoskeleton organization (GO:0007010)|Golgi to endosome transport (GO:0006895)|negative regulation of apoptotic process (GO:0043066)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K33-linked ubiquitination (GO:1990390)|protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|response to interferon-alpha (GO:0035455)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|PML body (GO:0016605)|trans-Golgi network (GO:0005802)	interferon-gamma binding (GO:0019964)|ubiquitin-protein transferase activity (GO:0004842)	p.W326C(1)		breast(3)|endometrium(6)|kidney(1)|large_intestine(8)|lung(14)|ovary(1)|upper_aerodigestive_tract(1)	34						TTGGTGGTTGGTGCAGTGGAG	0.443																																					p.W326C	GBM(159;862 2695 6559 23041)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G978C	1						.						197.0	166.0	177.0					1																	173726125		2203	4300	6503	171992748	SO:0001583	missense	27252	exon7			AB026190	CCDS1310.1	1q25.1	2013-01-30	2013-01-30		ENSG00000076321	ENSG00000076321		"""Kelch-like"", ""BTB/POZ domain containing"""	25056	protein-coding gene	gene with protein product			"""kelch-like 20 (Drosophila)"""			14668487, 20389280	Standard	NM_014458		Approved	KLEIP, KHLHX	uc001gjc.3	Q9Y2M5	OTTHUMG00000040548	ENST00000209884.4:c.978G>C	1.37:g.173726125G>C	ENSP00000209884:p.Trp326Cys	Somatic		Capture	Illumina HiSeq	Phase_I	171992748	NM_014458	B3KMA0|B4DUR0|Q5TZF2|Q5ZF45|Q9H457	Missense_Mutation	SNP	ENST00000209884.4	37	CCDS1310.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.159137	0.78226	.	.	ENSG00000076321	ENST00000546011;ENST00000209884	T;T	0.76186	-1.0;-1.0	5.43	5.43	0.79202	Galactose oxidase, beta-propeller (1);	0.113544	0.64402	D	0.000004	T	0.79143	0.4396	L	0.48877	1.53	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.99	T	0.77205	-0.2673	10	0.38643	T	0.18	.	18.0216	0.89257	0.0:0.0:1.0:0.0	.	137;326	B4DUR0;Q9Y2M5	.;KLH20_HUMAN	C	137;326	ENSP00000443121:W137C;ENSP00000209884:W326C	ENSP00000209884:W326C	W	+	3	0	KLHL20	171992748	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.618000	0.98365	2.532000	0.85374	0.650000	0.86243	TGG		KLHL20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097582.1	NM_014458	
ASTN1	460	broad.mit.edu	37	1	176926855	176926855	+	Missense_Mutation	SNP	G	G	A	rs375497555		TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr1:176926855G>A	ENST00000367654.3	-	11	2081	c.1870C>T	c.(1870-1872)Cgc>Tgc	p.R624C	ASTN1_ENST00000281881.3_5'UTR|ASTN1_ENST00000361833.2_Missense_Mutation_p.R616C|ASTN1_ENST00000367657.3_Missense_Mutation_p.R616C|ASTN1_ENST00000424564.2_Missense_Mutation_p.R616C	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	624	EGF-like 2.				locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.R616C(1)		NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						GAAATACAGCGGAAATTCTTA	0.542																																					p.R616C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1846T	1						.	G	CYS/ARG,CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	86.0	81.0	83.0		1846,1846	5.6	1.0	1		83	0,8600		0,0,4300	no	missense,missense	ASTN1	NM_004319.1,NM_207108.1	180,180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	616/1295,616/1217	176926855	1,13005	2203	4300	6503	175193478	SO:0001583	missense	460	exon11			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.1870C>T	1.37:g.176926855G>A	ENSP00000356626:p.Arg624Cys	Somatic		Capture	Illumina HiSeq	Phase_I	175193478	NM_004319	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	ENST00000367654.3	37		.	.	.	.	.	.	.	.	.	.	G	32	5.182590	0.94885	2.27E-4	0.0	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	D;D;T;D	0.87809	-2.3;-2.3;2.73;-2.3	5.58	5.58	0.84498	Epidermal growth factor-like (1);	0.048091	0.85682	N	0.000000	D	0.89424	0.6711	N	0.19112	0.55	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.992;0.992	D	0.91099	0.4913	10	0.87932	D	0	-28.3011	19.1684	0.93567	0.0:0.0:1.0:0.0	.	624;616;616	O14525;O14525-2;B1AJS1	ASTN1_HUMAN;.;.	C	616;616;624;616;616	ENSP00000356629:R616C;ENSP00000354536:R616C;ENSP00000356626:R624C;ENSP00000395041:R616C	ENSP00000354536:R616C	R	-	1	0	ASTN1	175193478	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.454000	0.80714	2.618000	0.88619	0.563000	0.77884	CGC		ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319	
CFH	3075	broad.mit.edu	37	1	196695922	196695922	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr1:196695922A>C	ENST00000367429.4	+	14	2328	c.2088A>C	c.(2086-2088)gaA>gaC	p.E696D		NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	696	Sushi 12. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)	p.E696D(1)		NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						ATATACCTGAACTTGAACATG	0.353																																					p.E696D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2088C	1						.						119.0	119.0	119.0					1																	196695922		2203	4300	6503	194962545	SO:0001583	missense	3075	exon14			Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.2088A>C	1.37:g.196695922A>C	ENSP00000356399:p.Glu696Asp	Somatic		Capture	Illumina HiSeq	Phase_I	194962545	NM_000186	A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	ENST00000367429.4	37	CCDS1385.1	.	.	.	.	.	.	.	.	.	.	A	17.58	3.423856	0.62733	.	.	ENSG00000000971	ENST00000367429	T	0.63096	-0.02	5.8	-2.48	0.06423	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.35537	0.0935	N	0.20610	0.595	0.09310	N	1	B	0.28971	0.229	B	0.20384	0.029	T	0.20438	-1.0275	9	0.12103	T	0.63	.	5.7664	0.18229	0.3801:0.3976:0.2223:0.0	.	696	P08603	CFAH_HUMAN	D	696	ENSP00000356399:E696D	ENSP00000356399:E696D	E	+	3	2	CFH	194962545	0.000000	0.05858	0.000000	0.03702	0.831000	0.47069	-0.183000	0.09712	-0.733000	0.04850	-0.250000	0.11733	GAA		CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086412.2	NM_000186	
CR1	1378	broad.mit.edu	37	1	207718757	207718757	+	Missense_Mutation	SNP	G	G	A	rs372379497	byFrequency	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr1:207718757G>A	ENST00000367049.4	+	14	2341	c.2341G>A	c.(2341-2343)Gac>Aac	p.D781N	CR1_ENST00000400960.2_Intron|CR1_ENST00000367051.1_Missense_Mutation_p.D331N|CR1_ENST00000367052.1_Missense_Mutation_p.D781N|CR1_ENST00000367050.4_3'UTR|CR1_ENST00000367053.1_Intron	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	331	Sushi 12. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)	p.D781N(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						GCCCGGCTACGACCTCAGAGG	0.577													G|||	3	0.000599042	0.0023	0.0	5008	,	,		14128	0.0		0.0	False		,,,				2504	0.0				p.D781N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2341A	1						.	G	,ASN/ASP	2,3486		0,2,1742	68.0	40.0	51.0		,2341	-2.4	0.0	1		51	0,5198		0,0,2599	no	intron,missense	CR1	NM_000573.3,NM_000651.4	,23	0,2,4341	AA,AG,GG		0.0,0.0573,0.023	,benign	,781/2490	207718757	2,8684	1744	2599	4343	205785380	SO:0001583	missense	1378	exon14			Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.2341G>A	1.37:g.207718757G>A	ENSP00000356016:p.Asp781Asn	Somatic		Capture	Illumina HiSeq	Phase_I	205785380	NM_000651	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Missense_Mutation	SNP	ENST00000367049.4	37	CCDS44308.1	.	.	.	.	.	.	.	.	.	.	g	7.162	0.585925	0.13749	5.73E-4	0.0	ENSG00000203710	ENST00000367052;ENST00000367051;ENST00000534202;ENST00000367049;ENST00000400961	T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08	2.63	-2.41	0.06562	.	.	.	.	.	T	0.58323	0.2114	L	0.39020	1.185	0.09310	N	1	P;D;P	0.63046	0.522;0.992;0.94	B;P;P	0.62740	0.152;0.906;0.483	T	0.50030	-0.8875	9	0.29301	T	0.29	.	2.4144	0.04432	0.4524:0.0:0.3184:0.2292	.	781;306;781	Q5SR44;Q5SR42;E9PDY4	.;.;.	N	781;331;331;781;291	ENSP00000356019:D781N;ENSP00000356018:D331N;ENSP00000436139:D331N;ENSP00000356016:D781N	ENSP00000356016:D781N	D	+	1	0	CR1	205785380	0.000000	0.05858	0.000000	0.03702	0.227000	0.25037	-0.614000	0.05604	-0.215000	0.10063	0.298000	0.19748	GAC		CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1	NM_000573	
TGFB2	7042	broad.mit.edu	37	1	218607443	218607443	+	Nonsense_Mutation	SNP	T	T	G			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr1:218607443T>G	ENST00000366930.4	+	3	997	c.530T>G	c.(529-531)tTa>tGa	p.L177*	TGFB2_ENST00000366929.4_Nonsense_Mutation_p.L205*	NM_003238.3	NP_003229.1	P61812	TGFB2_HUMAN	transforming growth factor, beta 2	177					activation of protein kinase activity (GO:0032147)|angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell proliferation (GO:0060038)|cardioblast differentiation (GO:0010002)|cartilage condensation (GO:0001502)|catagen (GO:0042637)|cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|collagen fibril organization (GO:0030199)|dopamine biosynthetic process (GO:0042416)|embryo development (GO:0009790)|embryonic digestive tract development (GO:0048566)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|face morphogenesis (GO:0060325)|generation of neurons (GO:0048699)|glial cell migration (GO:0008347)|hair follicle development (GO:0001942)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|hemopoiesis (GO:0030097)|menstrual cycle phase (GO:0022601)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of immune response (GO:0050777)|negative regulation of macrophage cytokine production (GO:0010936)|neuron development (GO:0048666)|neuron fate commitment (GO:0048663)|neutrophil chemotaxis (GO:0030593)|odontogenesis (GO:0042476)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of activation-induced cell death of T cells (GO:0070237)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of catagen (GO:0051795)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of gene expression (GO:0010628)|positive regulation of heart contraction (GO:0045823)|positive regulation of immune response (GO:0050778)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of ossification (GO:0045778)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein secretion (GO:0050714)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of transforming growth factor beta2 production (GO:0032909)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to progesterone (GO:0032570)|response to wounding (GO:0009611)|salivary gland morphogenesis (GO:0007435)|signal transduction by phosphorylation (GO:0023014)|SMAD protein import into nucleus (GO:0007184)|somatic stem cell division (GO:0048103)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	axon (GO:0030424)|endosome (GO:0005768)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|platelet alpha granule lumen (GO:0031093)	beta-amyloid binding (GO:0001540)|cytokine activity (GO:0005125)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta receptor binding (GO:0005160)|type II transforming growth factor beta receptor binding (GO:0005114)	p.L177*(1)|p.L205*(1)		breast(1)|endometrium(1)|large_intestine(11)|lung(15)|upper_aerodigestive_tract(2)|urinary_tract(1)	31				all cancers(67;0.0459)|OV - Ovarian serous cystadenocarcinoma(81;0.049)|GBM - Glioblastoma multiforme(131;0.0776)		TCCAAAGATTTAACATCTCCA	0.433																																					p.L177X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.T530G	1						.						200.0	210.0	207.0					1																	218607443		2203	4300	6503	216674066	SO:0001587	stop_gained	7042	exon3			M19154	CCDS1521.1, CCDS44318.1	1q41	2014-01-30			ENSG00000092969	ENSG00000092969		"""Endogenous ligands"""	11768	protein-coding gene	gene with protein product	"""prepro-transforming growth factor beta-2"""	190220					Standard	NM_003238		Approved		uc001hln.3	P61812	OTTHUMG00000039521	ENST00000366930.4:c.530T>G	1.37:g.218607443T>G	ENSP00000355897:p.Leu177*	Somatic		Capture	Illumina HiSeq	Phase_I	216674066	NM_003238	B4DKC5|P08112|Q15579|Q15581|Q4VAV9	Nonsense_Mutation	SNP	ENST00000366930.4	37	CCDS1521.1	.	.	.	.	.	.	.	.	.	.	T	42	9.344596	0.99143	.	.	ENSG00000092969	ENST00000366930;ENST00000366929	.	.	.	5.91	5.91	0.95273	.	0.236227	0.38217	N	0.001770	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	.	11.396	0.49843	0.0:0.0699:0.0:0.9301	.	.	.	.	X	177;205	.	ENSP00000355896:L205X	L	+	2	0	TGFB2	216674066	0.985000	0.35326	0.830000	0.32933	0.949000	0.60115	3.702000	0.54800	2.266000	0.75297	0.533000	0.62120	TTA		TGFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095359.2	NM_003238	
RYR2	6262	broad.mit.edu	37	1	237947221	237947221	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr1:237947221C>T	ENST00000366574.2	+	90	12526	c.12209C>T	c.(12208-12210)gCg>gTg	p.A4070V	RYR2_ENST00000542537.1_Missense_Mutation_p.A4054V|RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000360064.6_Missense_Mutation_p.A4076V	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4070					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.A4068V(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TTGTCTTGTGCGGAGACGGAT	0.517																																					p.A4070V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C12209T	1						.						37.0	36.0	37.0					1																	237947221		1994	4173	6167	236013844	SO:0001583	missense	6262	exon90			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.12209C>T	1.37:g.237947221C>T	ENSP00000355533:p.Ala4070Val	Somatic		Capture	Illumina HiSeq	Phase_I	236013844	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	C	13.63	2.294821	0.40594	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	T;D;T	0.82167	-0.25;-1.58;-0.25	5.85	5.85	0.93711	EF-hand-like domain (1);	0.081583	0.46758	D	0.000264	D	0.83519	0.5272	L	0.35487	1.065	0.80722	D	1	D;P	0.59357	0.985;0.883	P;B	0.55011	0.766;0.218	T	0.78209	-0.2293	10	0.14252	T	0.57	.	20.1577	0.98120	0.0:1.0:0.0:0.0	.	1044;4070	B4DGV4;Q92736	.;RYR2_HUMAN	V	4070;4076;4054;1044	ENSP00000355533:A4070V;ENSP00000353174:A4076V;ENSP00000443798:A4054V	ENSP00000353174:A4076V	A	+	2	0	RYR2	236013844	1.000000	0.71417	0.602000	0.28890	0.126000	0.20510	7.776000	0.85560	2.767000	0.95098	0.655000	0.94253	GCG		RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
SPOCD1	90853	broad.mit.edu	37	1	32259832	32259832	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr1:32259832G>A	ENST00000360482.2	-	11	2405	c.2276C>T	c.(2275-2277)cCg>cTg	p.P759L	SPOCD1_ENST00000533231.1_Missense_Mutation_p.P759L|RP11-84A19.3_ENST00000527035.1_RNA|SPOCD1_ENST00000257100.3_Missense_Mutation_p.P252L|SPOCD1_ENST00000373648.2_3'UTR	NM_144569.4	NP_653170.3	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1	759					negative regulation of phosphatase activity (GO:0010923)|transcription, DNA-templated (GO:0006351)			p.P759L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(1)|lung(7)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	37		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		GAACATCTGCGGTCCCTGGGA	0.617																																					p.P759L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2276T	1						.						44.0	36.0	39.0					1																	32259832		2203	4300	6503	32032419	SO:0001583	missense	90853	exon11			AK058077	CCDS347.1, CCDS60066.1, CCDS72748.1	1p35.1	2014-06-13			ENSG00000134668	ENSG00000134668			26338	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 146"""					12477932	Standard	NM_144569		Approved	FLJ25348, PPP1R146	uc001bts.1	Q6ZMY3	OTTHUMG00000003879	ENST00000360482.2:c.2276C>T	1.37:g.32259832G>A	ENSP00000353670:p.Pro759Leu	Somatic		Capture	Illumina HiSeq	Phase_I	32032419	NM_144569	Q24JU3|Q6PI90|Q8N869|Q8N8U0|Q8NBC6|Q96LN6	Missense_Mutation	SNP	ENST00000360482.2	37	CCDS347.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.71|16.71	3.199316|3.199316	0.58126|0.58126	.|.	.|.	ENSG00000134668|ENSG00000134668	ENST00000257100;ENST00000360482;ENST00000294514;ENST00000452755;ENST00000533231;ENST00000449266|ENST00000528579	T;T;T;T|.	0.52754|.	0.71;1.72;0.65;1.72|.	5.07|5.07	4.16|4.16	0.48862|0.48862	.|.	.|.	.|.	.|.	.|.	T|T	0.47801|0.47801	0.1465|0.1465	M|M	0.62723|0.62723	1.935|1.935	0.23095|0.23095	N|N	0.998301|0.998301	D;D;D|.	0.69078|.	0.997;0.987;0.985|.	P;P;P|.	0.57502|.	0.822;0.46;0.493|.	T|T	0.36163|0.36163	-0.9759|-0.9759	9|5	0.62326|.	D|.	0.03|.	-3.854|-3.854	9.7483|9.7483	0.40459|0.40459	0.0968:0.0:0.9032:0.0|0.0968:0.0:0.9032:0.0	.|.	759;195;759|.	Q6ZMY3-2;E9PPM7;Q6ZMY3|.	.;.;SPOC1_HUMAN|.	L|C	252;759;156;195;759;102|133	ENSP00000257100:P252L;ENSP00000353670:P759L;ENSP00000399778:P195L;ENSP00000435851:P759L|.	ENSP00000257100:P252L|.	P|R	-|-	2|1	0|0	SPOCD1|SPOCD1	32032419|32032419	0.026000|0.026000	0.19158|0.19158	0.003000|0.003000	0.11579|0.11579	0.035000|0.035000	0.12851|0.12851	1.963000|1.963000	0.40452|0.40452	1.273000|1.273000	0.44346|0.44346	0.557000|0.557000	0.71058|0.71058	CCG|CGC		SPOCD1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000381912.1	NM_144569	
PHC2	1912	broad.mit.edu	37	1	33794735	33794735	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr1:33794735C>T	ENST00000257118.5	-	13	2211	c.2158G>A	c.(2158-2160)Gtg>Atg	p.V720M	PHC2_ENST00000431992.1_Missense_Mutation_p.V691M|PHC2_ENST00000373422.3_Missense_Mutation_p.V326M|PHC2_ENST00000373416.1_Missense_Mutation_p.V185M|PHC2_ENST00000419414.2_Missense_Mutation_p.V721M|PHC2_ENST00000373418.3_Missense_Mutation_p.V185M|PHC2_ENST00000485928.1_5'UTR	NM_198040.2	NP_932157.1	Q8IXK0	PHC2_HUMAN	polyhomeotic homolog 2 (Drosophila)	720					multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.V720M(1)		autonomic_ganglia(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				GAAAGGGGCACAGTGCCTGTT	0.498																																					p.V720M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2158A	1						.						62.0	56.0	58.0					1																	33794735		2203	4300	6503	33567322	SO:0001583	missense	1912	exon13			AJ419231	CCDS378.1, CCDS379.1	1p34.3	2013-01-10	2006-09-12	2002-11-15	ENSG00000134686	ENSG00000134686		"""Sterile alpha motif (SAM) domain containing"""	3183	protein-coding gene	gene with protein product		602979	"""early development regulator 2 (homolog of polyhomeotic 2)"", ""polyhomeotic-like 2 (Drosophila)"""	EDR2		9121482, 12384788	Standard	NM_198040		Approved	HPH2	uc001bxg.1	Q8IXK0	OTTHUMG00000004133	ENST00000257118.5:c.2158G>A	1.37:g.33794735C>T	ENSP00000257118:p.Val720Met	Somatic		Capture	Illumina HiSeq	Phase_I	33567322	NM_198040	A1L4Q1|A8KA40|D3DPR2|Q2TAL3|Q5T0C1|Q6NUJ6|Q6ZQR1|Q8N306|Q8TAG8|Q96BL4|Q9Y4Y7	Missense_Mutation	SNP	ENST00000257118.5	37	CCDS378.1	.	.	.	.	.	.	.	.	.	.	C	14.35	2.508014	0.44558	.	.	ENSG00000134686	ENST00000431992;ENST00000257118;ENST00000373422;ENST00000373418;ENST00000419414;ENST00000373416	T;T;T;T	0.46063	1.88;1.46;0.88;1.89	5.85	4.94	0.65067	.	0.315714	0.34245	N	0.004133	T	0.37598	0.1009	L	0.40543	1.245	0.38019	D	0.93477	B;B;B;B	0.25563	0.014;0.014;0.014;0.129	B;B;B;B	0.31290	0.018;0.018;0.018;0.127	T	0.34650	-0.9820	10	0.41790	T	0.15	-6.2735	12.9097	0.58173	0.0:0.9216:0.0:0.0784	.	721;692;720;135	A8KA40;B7ZLY0;Q8IXK0;Q8IXK0-3	.;.;PHC2_HUMAN;.	M	691;720;326;185;721;185	ENSP00000389436:V691M;ENSP00000257118:V720M;ENSP00000362521:V326M;ENSP00000391440:V721M	ENSP00000257118:V720M	V	-	1	0	PHC2	33567322	0.986000	0.35501	0.989000	0.46669	0.985000	0.73830	2.881000	0.48538	1.481000	0.48307	0.561000	0.74099	GTG		PHC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000011895.1	NM_198040	
C8B	732	broad.mit.edu	37	1	57425735	57425735	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr1:57425735A>C	ENST00000371237.4	-	2	273	c.207T>G	c.(205-207)agT>agG	p.S69R	C8B_ENST00000494324.1_Intron|C8B_ENST00000543257.1_Missense_Mutation_p.S17R|C8B_ENST00000535057.1_5'UTR	NM_000066.2	NP_000057	P07358	CO8B_HUMAN	complement component 8, beta polypeptide	69	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)|vesicle (GO:0031982)		p.S69R(1)		breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	52						AAGAGGACCAACTAGACAGCT	0.507																																					p.S69R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T207G	1						.						146.0	119.0	128.0					1																	57425735		2203	4300	6503	57198323	SO:0001583	missense	732	exon2			M16973	CCDS30730.1, CCDS60151.1, CCDS60152.1	1p32.2	2014-09-17			ENSG00000021852	ENSG00000021852		"""Complement system"""	1353	protein-coding gene	gene with protein product		120960					Standard	NM_000066		Approved		uc001cyp.3	P07358	OTTHUMG00000008305	ENST00000371237.4:c.207T>G	1.37:g.57425735A>C	ENSP00000360281:p.Ser69Arg	Somatic		Capture	Illumina HiSeq	Phase_I	57198323	NM_000066	A1L4K7	Missense_Mutation	SNP	ENST00000371237.4	37	CCDS30730.1	.	.	.	.	.	.	.	.	.	.	A	13.69	2.311976	0.40895	.	.	ENSG00000021852	ENST00000371237;ENST00000543257	T;T	0.18174	2.23;2.23	4.92	3.97	0.46021	.	0.419369	0.31210	N	0.008054	T	0.14485	0.0350	L	0.41961	1.31	0.80722	D	1	B;B	0.13145	0.006;0.007	B;B	0.12156	0.007;0.003	T	0.05386	-1.0888	10	0.30854	T	0.27	-17.7798	9.9879	0.41852	0.172:0.0:0.828:0.0	.	17;69	F5H7G1;P07358	.;CO8B_HUMAN	R	69;17	ENSP00000360281:S69R;ENSP00000442548:S17R	ENSP00000360281:S69R	S	-	3	2	C8B	57198323	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	1.872000	0.39549	1.391000	0.46566	-0.313000	0.08912	AGT		C8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022886.2		
SLC44A5	204962	broad.mit.edu	37	1	75677227	75677227	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr1:75677227A>T	ENST00000370855.5	-	23	2086	c.1973T>A	c.(1972-1974)tTt>tAt	p.F658Y	SLC44A5_ENST00000535611.1_Missense_Mutation_p.F528Y|SLC44A5_ENST00000370859.3_Missense_Mutation_p.F658Y	NM_152697.4	NP_689910.2	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5	658					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.F658Y(1)		kidney(1)|large_intestine(13)|lung(35)|ovary(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61						GTAAGACCCAAAAATGACTGT	0.373																																					p.F658Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1973A	1						.						127.0	112.0	117.0					1																	75677227		2203	4300	6503	75449815	SO:0001583	missense	204962	exon23			BC034580	CCDS667.1, CCDS44164.1	1p31.1	2013-05-22			ENSG00000137968	ENSG00000137968		"""Solute carriers"""	28524	protein-coding gene	gene with protein product						15715662	Standard	NM_152697		Approved	MGC34032, CTL5	uc001dgu.3	Q8NCS7	OTTHUMG00000009721	ENST00000370855.5:c.1973T>A	1.37:g.75677227A>T	ENSP00000359892:p.Phe658Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	75449815	NM_152697	B5MCU3|Q4G0K0|Q8NA44|Q8NB86	Missense_Mutation	SNP	ENST00000370855.5	37	CCDS667.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.205574	0.79127	.	.	ENSG00000137968	ENST00000370859;ENST00000536707;ENST00000370855;ENST00000535611;ENST00000535790	T;T;T	0.23950	1.88;1.88;1.88	5.47	3.14	0.36123	.	0.853808	0.11042	N	0.605946	T	0.22399	0.0540	M	0.67700	2.07	0.09310	N	0.999997	B;P;B;B;P	0.41366	0.162;0.747;0.33;0.068;0.702	B;P;B;B;P	0.50162	0.279;0.633;0.393;0.265;0.5	T	0.13683	-1.0500	10	0.49607	T	0.09	1.0186	9.9925	0.41879	0.8613:0.0:0.1387:0.0	.	652;697;658;658;697	B7Z5Y4;B7Z470;Q8NCS7;Q8NCS7-2;F5GYS0	.;.;CTL5_HUMAN;.;.	Y	658;697;658;528;651	ENSP00000359896:F658Y;ENSP00000359892:F658Y;ENSP00000443090:F528Y	ENSP00000359892:F658Y	F	-	2	0	SLC44A5	75449815	0.986000	0.35501	0.004000	0.12327	0.466000	0.32739	5.995000	0.70631	0.453000	0.26858	0.482000	0.46254	TTT		SLC44A5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026921.1	NM_152697	
ZNF644	84146	broad.mit.edu	37	1	91406698	91406698	+	Silent	SNP	C	C	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr1:91406698C>T	ENST00000370440.1	-	3	430	c.213G>A	c.(211-213)acG>acA	p.T71T	ZNF644_ENST00000347275.5_Intron|ZNF644_ENST00000337393.5_Silent_p.T71T|ZNF644_ENST00000361321.5_Intron|ZNF644_ENST00000467231.1_Intron			Q9H582	ZN644_HUMAN	zinc finger protein 644	71					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T71T(1)		breast(4)|endometrium(2)|large_intestine(10)|lung(21)|ovary(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	47		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		GCAGAGTCAACGTATTATTTT	0.383																																					p.T71T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G213A	1						.						156.0	150.0	152.0					1																	91406698		2203	4300	6503	91179286	SO:0001819	synonymous_variant	84146	exon3			AB033047	CCDS731.1, CCDS732.1	1p22.2	2008-02-05			ENSG00000122482	ENSG00000122482			29222	protein-coding gene	gene with protein product		614159				10574462	Standard	NM_032186		Approved	KIAA1221, BM-005, MGC60165, MGC70410	uc001dnw.3	Q9H582	OTTHUMG00000010078	ENST00000370440.1:c.213G>A	1.37:g.91406698C>T		Somatic		Capture	Illumina HiSeq	Phase_I	91179286	NM_201269	A2RU71|Q2TAM0|Q5TCC0|Q6BEP7|Q6P446|Q6PI06|Q7LG67|Q9ULJ9	Silent	SNP	ENST00000370440.1	37	CCDS731.1																																																																																				ZNF644-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027846.2	NM_032186	
OR6F1	343169	broad.mit.edu	37	1	247875703	247875703	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr1:247875703C>A	ENST00000302084.2	-	1	402	c.355G>T	c.(355-357)Gct>Tct	p.A119S	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005286.1	NP_001005286.1	Q8NGZ6	OR6F1_HUMAN	olfactory receptor, family 6, subfamily F, member 1	119						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A119S(1)		breast(1)|kidney(1)|large_intestine(5)|lung(34)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)	47	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0168)			CGGTCATAAGCCATGGCTGCC	0.517																																					p.A119S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G355T	1						.						84.0	81.0	82.0					1																	247875703		2203	4300	6503	245942326	SO:0001583	missense	343169	exon1			BK004460	CCDS31095.1	1q44	2012-08-09			ENSG00000169214	ENSG00000169214		"""GPCR / Class A : Olfactory receptors"""	15027	protein-coding gene	gene with protein product							Standard	NM_001005286		Approved	OST731	uc001idj.1	Q8NGZ6	OTTHUMG00000040213	ENST00000302084.2:c.355G>T	1.37:g.247875703C>A	ENSP00000305640:p.Ala119Ser	Somatic		Capture	Illumina HiSeq	Phase_I	245942326	NM_001005286	B2RNV6|Q6IF02|Q96R39	Missense_Mutation	SNP	ENST00000302084.2	37	CCDS31095.1	.	.	.	.	.	.	.	.	.	.	C	13.95	2.389199	0.42410	.	.	ENSG00000169214	ENST00000302084	T	0.13196	2.61	3.99	3.07	0.35406	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43579	D	0.000556	T	0.05777	0.0151	N	0.16130	0.375	0.39280	D	0.964548	P	0.45348	0.856	B	0.41510	0.359	T	0.34403	-0.9830	10	0.05721	T	0.95	-18.1156	5.0419	0.14463	0.3126:0.582:0.0:0.1054	.	119	Q8NGZ6	OR6F1_HUMAN	S	119	ENSP00000305640:A119S	ENSP00000305640:A119S	A	-	1	0	OR6F1	245942326	0.999000	0.42202	0.985000	0.45067	0.786000	0.44442	0.584000	0.23864	1.011000	0.39340	0.591000	0.81541	GCT		OR6F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096870.1	NM_001005286	
CSRP2BP	57325	broad.mit.edu	37	20	18165356	18165356	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr20:18165356G>C	ENST00000435364.3	+	9	2436	c.2095G>C	c.(2095-2097)Gct>Cct	p.A699P	CSRP2BP_ENST00000489634.2_Missense_Mutation_p.A571P|CSRP2BP_ENST00000377681.3_Missense_Mutation_p.A698P	NM_020536.4	NP_065397	Q9H8E8	CSR2B_HUMAN	CSRP2 binding protein	699	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				chromatin organization (GO:0006325)|G2/M transition of mitotic cell cycle (GO:0000086)|histone H3 acetylation (GO:0043966)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|LIM domain binding (GO:0030274)	p.A699P(1)		NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|stomach(1)	34						ATACAATGAAGCTTACATTTC	0.393																																					p.A699P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2095C	20						.						227.0	190.0	202.0					20																	18165356		2203	4300	6503	18113356	SO:0001583	missense	57325	exon9			AF252257	CCDS13133.1	20p11.23	2012-06-06			ENSG00000149474	ENSG00000149474			15904	protein-coding gene	gene with protein product	"""cysteine rich protein 2 binding protein"", ""ATAC component 2 homolog (Drosophila)"""					9286703, 10924333, 19103755	Standard	NR_028402		Approved	CRP2BP, dJ717M23.1, PRO1194, ATAC2, KAT14	uc021wbb.1	Q9H8E8	OTTHUMG00000031962	ENST00000435364.3:c.2095G>C	20.37:g.18165356G>C	ENSP00000392318:p.Ala699Pro	Somatic		Capture	Illumina HiSeq	Phase_I	18113356	NM_020536	A2A2I5|Q96GW6|Q96IH3|Q9HBF0|Q9UIY5	Missense_Mutation	SNP	ENST00000435364.3	37	CCDS13133.1	.	.	.	.	.	.	.	.	.	.	G	34	5.316320	0.95655	.	.	ENSG00000149474	ENST00000278816;ENST00000377681;ENST00000435364;ENST00000489634	T;T;T;T	0.26067	1.76;1.76;1.76;1.76	5.99	5.99	0.97316	GCN5-related N-acetyltransferase (GNAT) domain (2);Acyl-CoA N-acyltransferase (2);	0.000000	0.85682	D	0.000000	T	0.48295	0.1492	L	0.48174	1.505	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.78314	0.984;0.991	T	0.34850	-0.9812	10	0.87932	D	0	-15.1317	20.4777	0.99188	0.0:0.0:1.0:0.0	.	571;699	Q9H8E8-2;Q9H8E8	.;CSR2B_HUMAN	P	699;698;699;571	ENSP00000278816:A699P;ENSP00000366909:A698P;ENSP00000392318:A699P;ENSP00000425909:A571P	ENSP00000278816:A699P	A	+	1	0	CSRP2BP	18113356	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.750000	0.98875	2.840000	0.97914	0.655000	0.94253	GCT		CSRP2BP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078152.5	NM_020536	
TSHZ2	128553	broad.mit.edu	37	20	51872311	51872311	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr20:51872311A>G	ENST00000371497.5	+	2	3201	c.2314A>G	c.(2314-2316)Agc>Ggc	p.S772G	TSHZ2_ENST00000329613.6_Missense_Mutation_p.S769G|TSHZ2_ENST00000603338.2_Missense_Mutation_p.S769G|RP4-678D15.1_ENST00000606932.1_RNA	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	772					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S772G(1)		NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			CAAGTCCAAAAGCAAGAAAGC	0.557																																					p.S772G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2314G	20						.						104.0	100.0	102.0					20																	51872311		2203	4300	6503	51305718	SO:0001583	missense	128553	exon2			AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.2314A>G	20.37:g.51872311A>G	ENSP00000360552:p.Ser772Gly	Somatic		Capture	Illumina HiSeq	Phase_I	51305718	NM_173485	B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	SNP	ENST00000371497.5	37	CCDS33490.1	.	.	.	.	.	.	.	.	.	.	A	10.99	1.507919	0.27036	.	.	ENSG00000182463	ENST00000371497;ENST00000329613;ENST00000450262	T;T	0.15372	2.43;2.44	5.09	2.84	0.33178	.	0.227351	0.49916	N	0.000124	T	0.13543	0.0328	L	0.41236	1.265	0.30331	N	0.786677	B	0.02656	0.0	B	0.04013	0.001	T	0.08146	-1.0736	10	0.49607	T	0.09	-1.1308	8.4848	0.33065	0.7538:0.0:0.2462:0.0	.	772	Q9NRE2	TSH2_HUMAN	G	772;769;298	ENSP00000360552:S772G;ENSP00000333114:S769G	ENSP00000333114:S769G	S	+	1	0	TSHZ2	51305718	1.000000	0.71417	0.960000	0.40013	0.993000	0.82548	3.657000	0.54474	0.285000	0.22329	0.472000	0.43445	AGC		TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	NM_173485	
COL18A1	80781	broad.mit.edu	37	21	46888356	46888356	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr21:46888356G>T	ENST00000359759.4	+	2	1573	c.1552G>T	c.(1552-1554)Gag>Tag	p.E518*	COL18A1_ENST00000355480.5_Nonsense_Mutation_p.E283*|COL18A1_ENST00000400337.2_Nonsense_Mutation_p.E103*			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	518	Laminin G-like.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)	p.E283*(1)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		GCCAGCCACAGAGGGCCCAGG	0.637																																					p.E283X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G847T	21						.						70.0	83.0	78.0					21																	46888356		2108	4229	6337	45712784	SO:0001587	stop_gained	80781	exon2				CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.1552G>T	21.37:g.46888356G>T	ENSP00000352798:p.Glu518*	Somatic		Capture	Illumina HiSeq	Phase_I	45712784	NM_030582	A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Nonsense_Mutation	SNP	ENST00000359759.4	37		.	.	.	.	.	.	.	.	.	.	G	19.73	3.881977	0.72294	.	.	ENSG00000182871	ENST00000400337;ENST00000400347;ENST00000355480;ENST00000359759;ENST00000539645	.	.	.	4.65	1.77	0.24775	.	1.289780	0.05135	N	0.493208	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	.	6.3238	0.21232	0.1675:0.2841:0.5484:0.0	.	.	.	.	X	103;103;283;518;518	.	ENSP00000347665:E283X	E	+	1	0	COL18A1	45712784	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.156000	0.10100	0.132000	0.18615	0.655000	0.94253	GAG		COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206827.1		
SLC25A18	83733	broad.mit.edu	37	22	18072368	18072368	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr22:18072368G>T	ENST00000327451.6	+	10	1281	c.743G>T	c.(742-744)cGa>cTa	p.R248L	AC004019.13_ENST00000443935.1_RNA|SLC25A18_ENST00000399813.1_Missense_Mutation_p.R248L	NM_031481.1	NP_113669.1	Q9H1K4	GHC2_HUMAN	solute carrier family 25 (glutamate carrier), member 18	248						integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	symporter activity (GO:0015293)	p.R248L(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)	18				Lung(27;0.124)		CTGAAAACTCGAATCCAAACC	0.507																																					p.R248L	Colon(118;1560 1625 18964 29606 50093)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G743T	22						.						81.0	76.0	78.0					22																	18072368		2203	4300	6503	16452368	SO:0001583	missense	83733	exon10			AY008285	CCDS13744.1	22q11.2	2013-05-22	2012-03-29		ENSG00000182902	ENSG00000182902		"""Solute carriers"""	10988	protein-coding gene	gene with protein product		609303	"""solute carrier family 25 (mitochondrial carrier), member 18"""			11381032, 11897791	Standard	NM_031481		Approved		uc002zmp.1	Q9H1K4	OTTHUMG00000150089	ENST00000327451.6:c.743G>T	22.37:g.18072368G>T	ENSP00000329033:p.Arg248Leu	Somatic		Capture	Illumina HiSeq	Phase_I	16452368	NM_031481		Missense_Mutation	SNP	ENST00000327451.6	37	CCDS13744.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.711278	0.89112	.	.	ENSG00000182902	ENST00000327451;ENST00000399813	D;D	0.83419	-1.72;-1.72	4.08	4.08	0.47627	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.91774	0.7398	M	0.89414	3.03	0.80722	D	1	D	0.71674	0.998	D	0.70016	0.967	D	0.93518	0.6859	10	0.87932	D	0	.	15.5415	0.76052	0.0:0.0:1.0:0.0	.	248	Q9H1K4	GHC2_HUMAN	L	248	ENSP00000329033:R248L;ENSP00000382710:R248L	ENSP00000329033:R248L	R	+	2	0	SLC25A18	16452368	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.917000	0.75782	2.287000	0.76781	0.655000	0.94253	CGA		SLC25A18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316214.3	NM_031481	
APOBEC3D	140564	broad.mit.edu	37	22	39425414	39425414	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr22:39425414A>G	ENST00000216099.8	+	5	1059	c.652A>G	c.(652-654)Aaa>Gaa	p.K218E	APOBEC3D_ENST00000381568.4_Missense_Mutation_p.K218E|APOBEC3D_ENST00000427494.2_Intron	NM_152426.3	NP_689639.2	Q96AK3	ABC3D_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D	218					defense response to virus (GO:0051607)|DNA cytosine deamination (GO:0070383)|innate immune response (GO:0045087)|negative regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045869)|negative regulation of transposition (GO:0010529)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines (GO:0016814)|zinc ion binding (GO:0008270)	p.K218E(1)		breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(2)	11	Melanoma(58;0.04)					CTTCCACTTTAAAAACCTACT	0.512																																					p.K218E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A652G	22						.						122.0	108.0	113.0					22																	39425414		1568	3582	5150	37755360	SO:0001583	missense	140564	exon5			BF832090	CCDS46709.1	22q13.1	2012-10-19	2008-05-01		ENSG00000243811	ENSG00000243811		"""Apolipoprotein B mRNA editing enzymes"""	17354	protein-coding gene	gene with protein product		609900	"""apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D (putative)"", ""apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3E pseudogene"""	APOBEC3E		11863358	Standard	NM_152426		Approved	ARP6, APOBEC3DE	uc003awt.4	Q96AK3	OTTHUMG00000151084	ENST00000216099.8:c.652A>G	22.37:g.39425414A>G	ENSP00000216099:p.Lys218Glu	Somatic		Capture	Illumina HiSeq	Phase_I	37755360	NM_152426	Q5JZ91|Q7Z2N2|Q7Z2N5|Q7Z2N6	Missense_Mutation	SNP	ENST00000216099.8	37	CCDS46709.1	.	.	.	.	.	.	.	.	.	.	.	0.448	-0.895091	0.02491	.	.	ENSG00000243811	ENST00000381568;ENST00000216099	T;T	0.63913	-0.07;-0.07	1.87	-3.74	0.04385	APOBEC-like, N-terminal (1);	.	.	.	.	T	0.39809	0.1092	L	0.29908	0.895	0.09310	N	1	B	0.11235	0.004	B	0.11329	0.006	T	0.05451	-1.0884	9	0.22706	T	0.39	.	1.9159	0.03297	0.1905:0.2944:0.3685:0.1466	.	218	Q96AK3	ABC3D_HUMAN	E	218	ENSP00000370980:K218E;ENSP00000216099:K218E	ENSP00000216099:K218E	K	+	1	0	APOBEC3D	37755360	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-4.478000	0.00227	-3.847000	0.00099	-0.862000	0.03010	AAA		APOBEC3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321232.2	NM_152426	
SPOPL	339745	broad.mit.edu	37	2	139308058	139308058	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr2:139308058A>C	ENST00000280098.4	+	3	463	c.84A>C	c.(82-84)aaA>aaC	p.K28N		NM_001001664.2	NP_001001664.1	Q6IQ16	SPOPL_HUMAN	speckle-type POZ protein-like	28					negative regulation of protein ubiquitination (GO:0031397)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nucleus (GO:0005634)		p.K28N(1)		breast(2)|cervix(2)|endometrium(2)|large_intestine(2)|lung(11)|skin(2)	21				BRCA - Breast invasive adenocarcinoma(221;0.0296)		CTTAGGTTAAAGTAGTAAAAT	0.333																																					p.K28N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A84C	2						.						65.0	70.0	68.0					2																	139308058		2202	4290	6492	139024528	SO:0001583	missense	339745	exon3				CCDS33298.1	2q22.1	2013-01-09			ENSG00000144228	ENSG00000144228		"""BTB/POZ domain containing"""	27934	protein-coding gene	gene with protein product	"""HIB homolog 2"", ""roadkill homolog 2"""						Standard	NM_001001664		Approved	BTBD33	uc002tvh.3	Q6IQ16	OTTHUMG00000153635	ENST00000280098.4:c.84A>C	2.37:g.139308058A>C	ENSP00000280098:p.Lys28Asn	Somatic		Capture	Illumina HiSeq	Phase_I	139024528	NM_001001664		Missense_Mutation	SNP	ENST00000280098.4	37	CCDS33298.1	.	.	.	.	.	.	.	.	.	.	A	16.12	3.032426	0.54790	.	.	ENSG00000144228	ENST00000280098	T	0.48201	0.82	4.34	4.34	0.51931	TRAF-like (1);	0.092514	0.64402	D	0.000001	T	0.60431	0.2268	M	0.74881	2.28	0.80722	D	1	D	0.63046	0.992	P	0.58970	0.849	T	0.61148	-0.7121	10	0.38643	T	0.18	-2.4	9.9632	0.41708	0.9169:0.0:0.0831:0.0	.	28	Q6IQ16	SPOPL_HUMAN	N	28	ENSP00000280098:K28N	ENSP00000280098:K28N	K	+	3	2	SPOPL	139024528	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	3.046000	0.49846	1.811000	0.52892	0.455000	0.32223	AAA		SPOPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331897.1		
SDC1	6382	broad.mit.edu	37	2	20403631	20403631	+	Silent	SNP	C	C	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr2:20403631C>T	ENST00000254351.4	-	3	814	c.570G>A	c.(568-570)agG>agA	p.R190R	SDC1_ENST00000403076.1_Intron|SDC1_ENST00000381150.1_Silent_p.R190R|SDC1_ENST00000482879.1_Intron	NM_002997.4	NP_002988	P18827	SDC1_HUMAN	syndecan 1	190					canonical Wnt signaling pathway (GO:0060070)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|lipoprotein metabolic process (GO:0042157)|myoblast development (GO:0048627)|odontogenesis (GO:0042476)|phototransduction, visible light (GO:0007603)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to toxic substance (GO:0009636)|retinoid metabolic process (GO:0001523)|Sertoli cell development (GO:0060009)|small molecule metabolic process (GO:0044281)|striated muscle cell development (GO:0055002)|ureteric bud development (GO:0001657)|wound healing (GO:0042060)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	protein C-terminus binding (GO:0008022)	p.R190R(1)		NS(1)|breast(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(4)|skin(2)	21	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)			OV - Ovarian serous cystadenocarcinoma(76;0.221)		CCTCAGCAGCCCTCTCGGTGG	0.617																																					p.R190R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G570A	2						.						75.0	75.0	75.0					2																	20403631		2203	4300	6503	20267112	SO:0001819	synonymous_variant	6382	exon3			AJ551176	CCDS1697.1	2p24.1	2008-02-05			ENSG00000115884	ENSG00000115884		"""CD molecules"", ""Proteoglycans / Cell Surface : Syndecans"""	10658	protein-coding gene	gene with protein product	"""syndecan proteoglycan 1"""	186355		SDC			Standard	XM_005262621		Approved	CD138, syndecan, SYND1	uc002rdo.1	P18827	OTTHUMG00000090751	ENST00000254351.4:c.570G>A	2.37:g.20403631C>T		Somatic		Capture	Illumina HiSeq	Phase_I	20267112	NM_002997	D6W523|Q53QV0|Q546D3|Q96HB7	Silent	SNP	ENST00000254351.4	37	CCDS1697.1																																																																																				SDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207495.1	NM_001006946	
SCN9A	6335	broad.mit.edu	37	2	167055633	167055633	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr2:167055633A>C	ENST00000409435.1	-	26	5515	c.5516T>G	c.(5515-5517)cTt>cGt	p.L1839R	AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000303354.6_Missense_Mutation_p.L1840R|SCN9A_ENST00000409672.1_Missense_Mutation_p.L1828R|SCN9A_ENST00000375387.4_Missense_Mutation_p.L1840R			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	1839					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)	p.L1828R(1)		NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TAAGATGTCAAGACAATGGAT	0.473																																					p.L1828R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T5483G	2						.						126.0	127.0	127.0					2																	167055633		2203	4300	6503	166763879	SO:0001583	missense	6335	exon27			X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.5516T>G	2.37:g.167055633A>C	ENSP00000386330:p.Leu1839Arg	Somatic		Capture	Illumina HiSeq	Phase_I	166763879	NM_002977	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	ENST00000409435.1	37	CCDS46441.1	.	.	.	.	.	.	.	.	.	.	A	16.09	3.024210	0.54683	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435	D;D;D;D	0.96745	-4.09;-4.11;-4.11;-4.11	6.07	4.92	0.64577	.	0.109676	0.41294	D	0.000918	D	0.97945	0.9324	M	0.86805	2.84	0.58432	D	0.99999	D	0.57257	0.979	D	0.66497	0.944	D	0.98121	1.0425	10	0.87932	D	0	.	12.0897	0.53719	0.9332:0.0:0.0668:0.0	.	1828	E7EUN6	.	R	1828;1840;1840;1839	ENSP00000386306:L1828R;ENSP00000364536:L1840R;ENSP00000304748:L1840R;ENSP00000386330:L1839R	ENSP00000304748:L1840R	L	-	2	0	SCN9A	166763879	1.000000	0.71417	0.203000	0.23512	0.821000	0.46438	9.287000	0.95975	1.114000	0.41781	0.533000	0.62120	CTT		SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333639.1	NM_002977	
CPO	130749	broad.mit.edu	37	2	207804352	207804352	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr2:207804352T>A	ENST00000272852.3	+	1	75	c.29T>A	c.(28-30)cTt>cAt	p.L10H		NM_173077.2	NP_775100.1	Q8IVL8	CBPO_HUMAN	carboxypeptidase O	10						extracellular region (GO:0005576)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.L10H(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	14				LUSC - Lung squamous cell carcinoma(261;0.0744)|Epithelial(149;0.0807)|Lung(261;0.142)		ACCCTTTATCTTTTGGGGATG	0.423																																					p.L10H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T29A	2						.						167.0	166.0	166.0					2																	207804352		2203	4300	6503	207512597	SO:0001583	missense	130749	exon1				CCDS2372.1	2q34	2012-02-10			ENSG00000144410	ENSG00000144410			21011	protein-coding gene	gene with protein product	"""metallocarboxypeptidase O"", ""metallocarboxypeptidase C"""	609563				11836249	Standard	NM_173077		Approved		uc002vby.2	Q8IVL8	OTTHUMG00000088987	ENST00000272852.3:c.29T>A	2.37:g.207804352T>A	ENSP00000272852:p.Leu10His	Somatic		Capture	Illumina HiSeq	Phase_I	207512597	NM_173077	Q2M277|Q7RTW7	Missense_Mutation	SNP	ENST00000272852.3	37	CCDS2372.1	.	.	.	.	.	.	.	.	.	.	T	12.12	1.841369	0.32513	.	.	ENSG00000144410	ENST00000272852	T	0.17691	2.26	4.59	3.43	0.39272	.	1.629350	0.04318	N	0.350297	T	0.24275	0.0588	N	0.24115	0.695	0.09310	N	1	D	0.67145	0.996	P	0.57371	0.819	T	0.20405	-1.0276	10	0.87932	D	0	.	6.9251	0.24410	0.0:0.1043:0.0:0.8957	.	10	Q8IVL8	CBPO_HUMAN	H	10	ENSP00000272852:L10H	ENSP00000272852:L10H	L	+	2	0	CPO	207512597	0.827000	0.29292	0.002000	0.10522	0.454000	0.32378	3.387000	0.52501	0.891000	0.36235	0.397000	0.26171	CTT		CPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000202040.2	NM_173077	
SLC30A3	7781	broad.mit.edu	37	2	27481654	27481654	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr2:27481654C>T	ENST00000233535.4	-	2	596	c.244G>A	c.(244-246)Gtt>Att	p.V82I	SLC30A3_ENST00000447008.2_Missense_Mutation_p.V77I	NM_003459.4	NP_003450.2	Q99726	ZNT3_HUMAN	solute carrier family 30 (zinc transporter), member 3	82					positive regulation of transport (GO:0051050)|regulation of sequestering of zinc ion (GO:0061088)|transmembrane transport (GO:0055085)|transport (GO:0006810)|zinc ion transmembrane transport (GO:0071577)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	zinc transporting ATPase activity (GO:0015633)	p.V82I(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(11)|pancreas(1)	20	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACAAAGCAAACGGCACAGGCA	0.612																																					p.V82I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G244A	2						.						60.0	64.0	63.0					2																	27481654		2203	4300	6503	27335158	SO:0001583	missense	7781	exon2			U76010	CCDS1743.1	2p23.3	2013-05-22			ENSG00000115194	ENSG00000115194		"""Solute carriers"""	11014	protein-coding gene	gene with protein product		602878		ZNT3		8962159	Standard	NM_003459		Approved		uc002rjj.3	Q99726	OTTHUMG00000128409	ENST00000233535.4:c.244G>A	2.37:g.27481654C>T	ENSP00000233535:p.Val82Ile	Somatic		Capture	Illumina HiSeq	Phase_I	27335158	NM_003459	Q8TC03	Missense_Mutation	SNP	ENST00000233535.4	37	CCDS1743.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.282|9.282	1.048436|1.048436	0.19827|0.19827	.|.	.|.	ENSG00000115194|ENSG00000115194	ENST00000445870|ENST00000233535;ENST00000447008;ENST00000432351;ENST00000426924;ENST00000424577;ENST00000450118;ENST00000426569	.|T;T;T;T;T;T;T	.|0.62639	.|0.01;0.01;0.01;0.01;0.01;0.01;0.01	5.32|5.32	5.32|5.32	0.75619|0.75619	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.33789|0.33789	0.0875|0.0875	N|N	0.04373|0.04373	-0.215|-0.215	0.51482|0.51482	D|D	0.999924|0.999924	.|B;P	.|0.38195	.|0.369;0.622	.|B;B	.|0.31495	.|0.08;0.131	T|T	0.48234|0.48234	-0.9053|-0.9053	5|10	.|0.02654	.|T	.|1	-26.0994|-26.0994	16.4981|16.4981	0.84250|0.84250	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|77;82	.|F5H3B7;Q99726	.|.;ZNT3_HUMAN	H|I	70|82;77;33;69;60;33;33	.|ENSP00000233535:V82I;ENSP00000415226:V77I;ENSP00000414320:V33I;ENSP00000393545:V69I;ENSP00000403959:V60I;ENSP00000403912:V33I;ENSP00000392673:V33I	.|ENSP00000233535:V82I	R|V	-|-	2|1	0|0	SLC30A3|SLC30A3	27335158|27335158	0.613000|0.613000	0.27009|0.27009	0.974000|0.974000	0.42286|0.42286	0.863000|0.863000	0.49368|0.49368	1.237000|1.237000	0.32695|0.32695	2.482000|2.482000	0.83794|0.83794	0.561000|0.561000	0.74099|0.74099	CGT|GTT		SLC30A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250189.2		
WDR92	116143	broad.mit.edu	37	2	68358539	68358539	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr2:68358539C>T	ENST00000295121.6	-	8	1021	c.905G>A	c.(904-906)gGa>gAa	p.G302E	RP11-474G23.1_ENST00000406334.3_3'UTR|WDR92_ENST00000492039.2_5'UTR	NM_138458.3	NP_612467.1	Q96MX6	WDR92_HUMAN	WD repeat domain 92	302					apoptotic process (GO:0006915)|histone lysine methylation (GO:0034968)		methylated histone binding (GO:0035064)	p.G302E(1)		endometrium(1)|kidney(3)|large_intestine(4)|lung(3)|stomach(1)	12						CATTTCTATTCCCTCAGAATC	0.403																																					p.G302E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G905A	2						.						96.0	92.0	93.0					2																	68358539		2203	4300	6503	68212043	SO:0001583	missense	116143	exon8			AK056303	CCDS1884.1, CCDS58712.1	2p14	2013-01-09			ENSG00000243667	ENSG00000243667		"""WD repeat domain containing"""	25176	protein-coding gene	gene with protein product		610729				16487927	Standard	NM_138458		Approved	FLJ31741, Monad	uc002see.2	Q96MX6	OTTHUMG00000152561	ENST00000295121.6:c.905G>A	2.37:g.68358539C>T	ENSP00000295121:p.Gly302Glu	Somatic		Capture	Illumina HiSeq	Phase_I	68212043	NM_138458	Q96CR6	Missense_Mutation	SNP	ENST00000295121.6	37	CCDS1884.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.583924	0.86748	.	.	ENSG00000243667	ENST00000295121	D	0.89746	-2.56	5.77	5.77	0.91146	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.177837	0.32802	N	0.005637	D	0.92107	0.7498	M	0.90814	3.15	0.80722	D	1	D	0.56287	0.975	B	0.43867	0.434	D	0.93543	0.6879	10	0.72032	D	0.01	.	18.536	0.91010	0.0:1.0:0.0:0.0	.	302	Q96MX6	WDR92_HUMAN	E	302	ENSP00000295121:G302E	ENSP00000295121:G302E	G	-	2	0	WDR92	68212043	0.992000	0.36948	0.974000	0.42286	0.964000	0.63967	3.004000	0.49513	2.890000	0.99128	0.585000	0.79938	GGA		WDR92-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251754.2	NM_138458	
ZNF638	27332	broad.mit.edu	37	2	71577168	71577168	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr2:71577168G>A	ENST00000409544.1	+	2	1714	c.1084G>A	c.(1084-1086)Gta>Ata	p.V362I	ZNF638_ENST00000355812.3_Missense_Mutation_p.V362I|ZNF638_ENST00000410075.1_3'UTR|ZNF638_ENST00000264447.4_Missense_Mutation_p.V362I|ZNF638_ENST00000377802.2_Missense_Mutation_p.V362I	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	362					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.V362I(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						TTCATCTAACGTACATGTTGG	0.428																																					p.V362I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1084A	2						.						121.0	118.0	119.0					2																	71577168		2203	4300	6503	71430676	SO:0001583	missense	27332	exon2			D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.1084G>A	2.37:g.71577168G>A	ENSP00000386433:p.Val362Ile	Somatic		Capture	Illumina HiSeq	Phase_I	71430676	NM_014497	B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Missense_Mutation	SNP	ENST00000409544.1	37	CCDS1917.1	.	.	.	.	.	.	.	.	.	.	G	8.079	0.772012	0.16051	.	.	ENSG00000075292	ENST00000410075;ENST00000544512;ENST00000355812;ENST00000377802;ENST00000264447;ENST00000409544	T;T;T;T;T;T	0.73047	-0.11;-0.71;0.48;-0.09;1.5;1.5	5.42	3.25	0.37280	.	0.792020	0.11578	N	0.549997	T	0.39545	0.1082	N	0.03608	-0.345	0.21933	N	0.99947	P;P;P;P;P	0.52692	0.955;0.882;0.882;0.685;0.801	B;B;B;B;B	0.33890	0.172;0.09;0.128;0.06;0.09	T	0.08027	-1.0742	10	0.28530	T	0.3	-5.6922	8.7715	0.34735	0.2033:0.0:0.7967:0.0	.	468;362;362;362;362	F5H330;Q14966-4;Q14966-3;Q14966;Q14966-2	.;.;.;ZN638_HUMAN;.	I	362;468;362;362;362;362	ENSP00000386669:V362I;ENSP00000438189:V468I;ENSP00000348066:V362I;ENSP00000367033:V362I;ENSP00000264447:V362I;ENSP00000386433:V362I	ENSP00000264447:V362I	V	+	1	0	ZNF638	71430676	0.995000	0.38212	0.981000	0.43875	0.984000	0.73092	0.925000	0.28791	1.275000	0.44379	0.655000	0.94253	GTA		ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327431.1	NM_014497	
OBSL1	23363	broad.mit.edu	37	2	220419340	220419340	+	Nonsense_Mutation	SNP	G	G	A	rs116131367	byFrequency	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr2:220419340G>A	ENST00000404537.1	-	15	4788	c.4732C>T	c.(4732-4734)Cag>Tag	p.Q1578*	OBSL1_ENST00000265318.4_3'UTR|OBSL1_ENST00000373876.1_Nonsense_Mutation_p.Q1486*	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1	1578					cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)	p.Q1578*(1)					Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		GGATACAGCTGTACTCCACCC	0.642													G|||	18	0.00359425	0.0106	0.0058	5008	,	,		17720	0.0		0.0	False		,,,				2504	0.0				p.Q1578X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C4732T	2						.	G	stop/GLN	26,4136		0,26,2055	31.0	39.0	37.0		4732	4.4	1.0	2	dbSNP_132	37	7,8375		0,7,4184	yes	stop-gained	OBSL1	NM_015311.2		0,33,6239	AA,AG,GG		0.0835,0.6247,0.2631		1578/1897	220419340	33,12511	2081	4191	6272	220127584	SO:0001587	stop_gained	23363	exon15			BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	protein-coding gene	gene with protein product		610991				9734811	Standard	NM_015311		Approved	KIAA0657	uc010fwk.3	O75147	OTTHUMG00000059157	ENST00000404537.1:c.4732C>T	2.37:g.220419340G>A	ENSP00000385636:p.Gln1578*	Somatic		Capture	Illumina HiSeq	Phase_I	220127584	NM_015311	A4KVA4|A4KVA5|Q96IW3|S4R3M6	Nonsense_Mutation	SNP	ENST00000404537.1	37	CCDS46520.1	8	0.003663003663003663	3	0.006097560975609756	3	0.008287292817679558	2	0.0034965034965034965	0	0.0	g	42	9.335584	0.99140	0.006247	8.35E-4	ENSG00000124006	ENST00000404537;ENST00000373876	.	.	.	4.37	4.37	0.52481	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06757	T	0.87	.	17.1308	0.86726	0.0:0.0:1.0:0.0	.	.	.	.	X	1578;1486	.	ENSP00000362983:Q1486X	Q	-	1	0	OBSL1	220127584	0.518000	0.26234	1.000000	0.80357	0.709000	0.40893	3.334000	0.52097	2.267000	0.75376	0.651000	0.88453	CAG		OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322012.1		
MAPKAPK3	7867	broad.mit.edu	37	3	50655079	50655080	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr3:50655079_50655080insG	ENST00000446044.1	+	4	679_680	c.83_84insG	c.(82-87)ccggggfs	p.PG28fs	MAPKAPK3_ENST00000357955.2_Frame_Shift_Ins_p.PG28fs	NM_001243926.1	NP_001230855.1	Q16644	MAPK3_HUMAN	mitogen-activated protein kinase-activated protein kinase 3	28			P -> S (in a glioblastoma multiforme sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		activation of MAPK activity (GO:0000187)|innate immune response (GO:0045087)|macropinocytosis (GO:0044351)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|Ras protein signal transduction (GO:0007265)|response to cytokine (GO:0034097)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein serine/threonine kinase activity (GO:0004674)	p.R31fs*47(1)		central_nervous_system(1)|ovary(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.0188)|Kidney(197;0.0223)		GGCGGTGCTCCGGGGGGGCGGC	0.698																																					p.P28fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.83_84insG	3						.			14,4250		0,14,2118						0.6	0.0			46	10,8244		0,10,4117	no	frameshift	MAPKAPK3	NM_004635.4		0,24,6235	A1A1,A1R,RR		0.1212,0.3283,0.1917				24,12494				50630084	SO:0001589	frameshift_variant	7867	exon2			U43784	CCDS2832.1	3p21.3	2004-03-10			ENSG00000114738	ENSG00000114738			6888	protein-coding gene	gene with protein product		602130				8626550, 8622688	Standard	NM_004635		Approved	3pK, MAPKAP3, 3PK	uc003dba.2	Q16644	OTTHUMG00000156850	ENST00000446044.1:c.90dupG	3.37:g.50655086_50655086dupG	ENSP00000396467:p.Pro28fs	Somatic		Capture	Illumina HiSeq	Phase_I	50630083	NM_004635	B5BU67	Frame_Shift_Ins	INS	ENST00000446044.1	37	CCDS2832.1																																																																																				MAPKAPK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346237.1	NM_004635	
C3orf30	152405	broad.mit.edu	37	3	118865587	118865587	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr3:118865587G>A	ENST00000295622.1	+	1	591	c.551G>A	c.(550-552)gGc>gAc	p.G184D	IGSF11_ENST00000425327.2_5'Flank|IGSF11_ENST00000354673.2_5'Flank|RP11-484M3.5_ENST00000490594.1_5'Flank|IGSF11_ENST00000441144.2_5'Flank	NM_152539.2	NP_689752.2	Q96M34	CC030_HUMAN	chromosome 3 open reading frame 30	184								p.G184D(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(20)|ovary(2)|prostate(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(114;0.222)		AGAATGGCAGGCCAGTCTGAG	0.522																																					p.G184D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G551A	3						.						80.0	84.0	82.0					3																	118865587		2203	4300	6503	120348277	SO:0001583	missense	152405	exon1			AK057421	CCDS2984.1	3q13.32	2011-08-09			ENSG00000163424	ENSG00000163424			26553	protein-coding gene	gene with protein product							Standard	NM_152539		Approved	FLJ32859	uc003ecb.1	Q96M34	OTTHUMG00000159349	ENST00000295622.1:c.551G>A	3.37:g.118865587G>A	ENSP00000295622:p.Gly184Asp	Somatic		Capture	Illumina HiSeq	Phase_I	120348277	NM_152539	A1L4B7	Missense_Mutation	SNP	ENST00000295622.1	37	CCDS2984.1	.	.	.	.	.	.	.	.	.	.	G	0.430	-0.903806	0.02453	.	.	ENSG00000163424	ENST00000295622;ENST00000470341	T	0.26373	1.74	3.39	-0.834	0.10779	.	2.134890	0.01698	N	0.027014	T	0.15955	0.0384	N	0.22421	0.69	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.13176	-1.0519	10	0.33141	T	0.24	5.1317	1.7986	0.03066	0.1982:0.1407:0.4714:0.1896	.	184;184	E9PFE5;Q96M34	.;CC030_HUMAN	D	184	ENSP00000295622:G184D	ENSP00000295622:G184D	G	+	2	0	C3orf30	120348277	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-1.722000	0.01868	-0.207000	0.10187	-0.299000	0.09455	GGC		C3orf30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354838.1	NM_152539	
ZNF148	7707	broad.mit.edu	37	3	124998008	124998008	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr3:124998008T>A	ENST00000360647.4	-	6	1028	c.543A>T	c.(541-543)agA>agT	p.R181S	ZNF148_ENST00000544464.1_Intron|SLC12A8_ENST00000423114.2_Missense_Mutation_p.E5V|ZNF148_ENST00000484491.1_Missense_Mutation_p.R181S|ZNF148_ENST00000497929.1_5'UTR|ZNF148_ENST00000485866.1_Missense_Mutation_p.R181S|ZNF148_ENST00000492394.1_Missense_Mutation_p.R181S|ZNF148_ENST00000468369.1_Intron	NM_021964.2	NP_068799.2	Q9UQR1	ZN148_HUMAN	zinc finger protein 148	181					cellular defense response (GO:0006968)|gamete generation (GO:0007276)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein complex assembly (GO:0006461)|substantia nigra development (GO:0021762)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.R181S(1)		breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(3)|liver(1)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)	28						GATAGTTCGTTCTAAAGGCAG	0.338																																					p.R181S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A543T	3						.						153.0	158.0	156.0					3																	124998008		2203	4300	6503	126480698	SO:0001583	missense	7707	exon6			U09851	CCDS3031.1	3q21.2	2013-01-08	2006-06-13		ENSG00000163848	ENSG00000163848		"""Zinc fingers, C2H2-type"""	12933	protein-coding gene	gene with protein product		601897	"""zinc finger protein 148 (pHZ-52)"""			7557990, 9925940	Standard	NM_021964		Approved	BERF-1, ZBP-89, BFCOL1, HT-BETA, ZFP148, pHZ-52	uc003ehx.4	Q9UQR1	OTTHUMG00000159448	ENST00000360647.4:c.543A>T	3.37:g.124998008T>A	ENSP00000353863:p.Arg181Ser	Somatic		Capture	Illumina HiSeq	Phase_I	126480698	NM_021964	D3DN27|O00389|O43591|Q58EY5|Q6PJ98	Missense_Mutation	SNP	ENST00000360647.4	37	CCDS3031.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.3|20.3	3.969589|3.969589	0.74246|0.74246	.|.	.|.	ENSG00000221955|ENSG00000163848	ENST00000423114|ENST00000360647;ENST00000484491;ENST00000492394;ENST00000485866;ENST00000543574	D|T;T;T;T	0.88664|0.07567	-2.41|3.18;3.18;3.18;3.18	5.03|5.03	5.03|5.03	0.67393|0.67393	.|Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.21962|0.21962	0.0529|0.0529	M|M	0.61703|0.61703	1.905|1.905	0.80722|0.80722	D|D	1|1	D|D	0.76494|0.71674	0.999|0.998	D|D	0.64877|0.73708	0.93|0.981	T|T	0.00595|0.00595	-1.1653|-1.1653	9|10	0.27785|0.37606	T|T	0.31|0.19	-19.067|-19.067	9.425|9.425	0.38574|0.38574	0.0:0.0792:0.0:0.9208|0.0:0.0792:0.0:0.9208	.|.	5|181	A0AV02-2|Q9UQR1	.|ZN148_HUMAN	V|S	5|181	ENSP00000404243:E5V|ENSP00000353863:R181S;ENSP00000420335:R181S;ENSP00000419322:R181S;ENSP00000420448:R181S	ENSP00000404243:E5V|ENSP00000353863:R181S	E|R	-|-	2|3	0|2	SLC12A8|ZNF148	126480698|126480698	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.005000|3.005000	0.49521|0.49521	2.114000|2.114000	0.64651|0.64651	0.477000|0.477000	0.44152|0.44152	GAA|AGA		ZNF148-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355452.4	NM_021964	
CCDC39	339829	broad.mit.edu	37	3	180361933	180361933	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr3:180361933A>C	ENST00000442201.2	-	12	1759	c.1640T>G	c.(1639-1641)cTt>cGt	p.L547R	CCDC39_ENST00000273654.4_Missense_Mutation_p.L631R	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	547					axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)		p.L631R(1)|p.L547R(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			GGCTTTATCAAGTTCTTTCTC	0.308																																					p.L547R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T1640G	3						.						160.0	145.0	150.0					3																	180361933		1488	3303	4791	181844627	SO:0001583	missense	339829	exon12			BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000442201.2:c.1640T>G	3.37:g.180361933A>C	ENSP00000405708:p.Leu547Arg	Somatic		Capture	Illumina HiSeq	Phase_I	181844627	NM_181426	B4E2H1	Missense_Mutation	SNP	ENST00000442201.2	37	CCDS46964.1	.	.	.	.	.	.	.	.	.	.	A	13.98	2.398410	0.42512	.	.	ENSG00000145075	ENST00000273654;ENST00000442201	T;T	0.22945	1.93;1.93	5.56	5.56	0.83823	.	0.162313	0.41396	D	0.000899	T	0.44222	0.1283	L	0.59436	1.845	0.42547	D	0.993096	D	0.71674	0.998	P	0.60541	0.876	T	0.36768	-0.9734	10	0.56958	D	0.05	-5.8948	15.0019	0.71479	1.0:0.0:0.0:0.0	.	547	Q9UFE4	CCD39_HUMAN	R	631;547	ENSP00000273654:L631R;ENSP00000405708:L547R	ENSP00000273654:L631R	L	-	2	0	CCDC39	181844627	0.999000	0.42202	0.926000	0.36857	0.128000	0.20619	5.752000	0.68728	2.240000	0.73641	0.533000	0.62120	CTT		CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349783.3	XM_291028	
KLHL24	54800	broad.mit.edu	37	3	183388920	183388920	+	Silent	SNP	G	G	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr3:183388920G>A	ENST00000454652.2	+	7	1709	c.1323G>A	c.(1321-1323)aaG>aaA	p.K441K	KLHL24_ENST00000242810.6_Silent_p.K441K|KLHL24_ENST00000476808.1_Silent_p.K441K	NM_017644.3	NP_060114.2	Q6TFL4	KLH24_HUMAN	kelch-like family member 24	441						cell projection (GO:0042995)|cytoplasm (GO:0005737)		p.K441K(1)		NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(10)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;2.88e-10)|Ovarian(172;0.0303)		all cancers(12;1.43e-42)|Epithelial(37;1.73e-36)|OV - Ovarian serous cystadenocarcinoma(80;8.75e-22)			CTCCCCTTAAGGAAGCCGTGA	0.443																																					p.K441K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1323A	3						.						225.0	207.0	213.0					3																	183388920		2203	4300	6503	184871614	SO:0001819	synonymous_variant	54800	exon6				CCDS3246.1	3q27.1	2013-02-22	2013-02-22		ENSG00000114796	ENSG00000114796		"""Kelch-like"", ""BTB/POZ domain containing"""	25947	protein-coding gene	gene with protein product		611295	"""kelch-like 24 (Drosophila)"""				Standard	XM_005247552		Approved	DRE1, FLJ20059	uc003flv.3	Q6TFL4	OTTHUMG00000156911	ENST00000454652.2:c.1323G>A	3.37:g.183388920G>A		Somatic		Capture	Illumina HiSeq	Phase_I	184871614	NM_017644	A5PLN8|Q9H620|Q9NXT9	Silent	SNP	ENST00000454652.2	37	CCDS3246.1																																																																																				KLHL24-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346586.2	NM_017644	
MASP1	5648	broad.mit.edu	37	3	186971028	186971028	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr3:186971028T>A	ENST00000337774.5	-	6	1209	c.820A>T	c.(820-822)Agt>Tgt	p.S274C	MASP1_ENST00000296280.6_Missense_Mutation_p.S274C|MASP1_ENST00000392470.2_Missense_Mutation_p.S248C|MASP1_ENST00000392472.2_Missense_Mutation_p.S161C|MASP1_ENST00000495249.1_Intron|MASP1_ENST00000169293.6_Missense_Mutation_p.S274C	NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)	274	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.|Interaction with FCN2.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)	p.S274C(2)		NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		ATCAGGACACTGTGGCTCTGG	0.537																																					p.S274C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A820T	3						.						210.0	216.0	214.0					3																	186971028		2203	4300	6503	188453722	SO:0001583	missense	5648	exon6			D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.820A>T	3.37:g.186971028T>A	ENSP00000336792:p.Ser274Cys	Somatic		Capture	Illumina HiSeq	Phase_I	188453722	NM_001031849	A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Missense_Mutation	SNP	ENST00000337774.5	37	CCDS33907.1	.	.	.	.	.	.	.	.	.	.	T	17.92	3.505675	0.64410	.	.	ENSG00000127241	ENST00000337774;ENST00000296280;ENST00000392472;ENST00000541896;ENST00000169293;ENST00000392470	T;T;T;T;T	0.19532	2.14;2.14;2.14;2.14;2.14	5.63	4.47	0.54385	CUB (5);	0.190571	0.56097	D	0.000028	T	0.41604	0.1166	M	0.75264	2.295	0.47183	D	0.999347	P;P;D;D;P	0.69078	0.791;0.933;0.997;0.995;0.865	B;B;P;P;P	0.60173	0.367;0.367;0.87;0.792;0.626	T	0.36016	-0.9765	10	0.62326	D	0.03	.	12.5186	0.56046	0.0:0.0:0.1395:0.8605	.	248;274;161;274;274	F8W876;P48740-3;P48740-4;P48740-2;P48740	.;.;.;.;MASP1_HUMAN	C	274;274;161;161;274;248	ENSP00000336792:S274C;ENSP00000296280:S274C;ENSP00000376264:S161C;ENSP00000169293:S274C;ENSP00000376262:S248C	ENSP00000169293:S274C	S	-	1	0	MASP1	188453722	0.997000	0.39634	0.863000	0.33907	0.977000	0.68977	2.742000	0.47434	1.054000	0.40438	-0.291000	0.09656	AGT		MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344262.1	NM_001879	
CHL1	10752	broad.mit.edu	37	3	424221	424221	+	Silent	SNP	C	C	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr3:424221C>A	ENST00000256509.2	+	18	2685	c.2043C>A	c.(2041-2043)gtC>gtA	p.V681V	CHL1-AS1_ENST00000417612.1_RNA|CHL1_ENST00000397491.2_Silent_p.V665V	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.V681V(1)		NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		TGACCAGAGTCCAAGGAAAGA	0.423																																					p.V681V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2043A	3						.						97.0	112.0	107.0					3																	424221		2203	4300	6503	399221	SO:0001819	synonymous_variant	10752	exon18			AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.2043C>A	3.37:g.424221C>A		Somatic		Capture	Illumina HiSeq	Phase_I	399221	NM_006614	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Silent	SNP	ENST00000256509.2	37	CCDS2556.1																																																																																				CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207155.2	NM_006614	
SRGAP3	9901	broad.mit.edu	37	3	9068649	9068649	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr3:9068649C>T	ENST00000383836.3	-	13	1997	c.1570G>A	c.(1570-1572)Gag>Aag	p.E524K	SRGAP3_ENST00000433332.3_5'UTR|SRGAP3_ENST00000360413.3_Missense_Mutation_p.E500K	NM_014850.3	NP_055665.1	O43295	SRGP3_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	524	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.E524K(1)	SRGAP3/RAF1(6)	breast(1)|endometrium(2)|kidney(21)|large_intestine(7)|lung(13)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	54				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		ATGCAGCTCTCGACTACAAGC	0.428			T	RAF1	pilocytic astrocytoma																																p.E524K			Dom	yes		3	3p25.3	9901	SLIT-ROBO Rho GTPase activating protein 3		M	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1570A	3						.						132.0	128.0	129.0					3																	9068649		2203	4300	6503	9043649	SO:0001583	missense	9901	exon13			AB007871	CCDS2572.1, CCDS33689.1	3p25.3	2011-07-04	2004-11-12	2004-11-12	ENSG00000196220	ENSG00000196220		"""Rho GTPase activating proteins"""	19744	protein-coding gene	gene with protein product		606525	"""SLIT-ROBO Rho GTPase activating protein 2"""	SRGAP2		12195014	Standard	NM_014850		Approved	KIAA0411, MEGAP, WRP, ARHGAP14	uc003brf.2	O43295	OTTHUMG00000090589	ENST00000383836.3:c.1570G>A	3.37:g.9068649C>T	ENSP00000373347:p.Glu524Lys	Somatic		Capture	Illumina HiSeq	Phase_I	9043649	NM_014850	Q8IX13|Q8IZV8	Missense_Mutation	SNP	ENST00000383836.3	37	CCDS2572.1	.	.	.	.	.	.	.	.	.	.	C	33	5.238440	0.95240	.	.	ENSG00000196220	ENST00000383836;ENST00000360413	T;T	0.19105	2.17;2.17	5.17	5.17	0.71159	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.36663	0.0975	L	0.55834	1.745	0.80722	D	1	P;P	0.44690	0.825;0.841	B;P	0.53689	0.414;0.732	T	0.02081	-1.1217	10	0.37606	T	0.19	.	18.2773	0.90087	0.0:1.0:0.0:0.0	.	500;524	O43295-2;O43295	.;SRGP2_HUMAN	K	524;500	ENSP00000373347:E524K;ENSP00000353587:E500K	ENSP00000353587:E500K	E	-	1	0	SRGAP3	9043649	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	7.576000	0.82467	2.413000	0.81919	0.655000	0.94253	GAG		SRGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207137.3		
BRPF1	7862	broad.mit.edu	37	3	9782555	9782555	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr3:9782555G>A	ENST00000457855.1	+	3	1663	c.1652G>A	c.(1651-1653)cGg>cAg	p.R551Q	BRPF1_ENST00000424362.1_Missense_Mutation_p.R551Q|BRPF1_ENST00000433861.2_Missense_Mutation_p.R551Q|BRPF1_ENST00000383829.2_Missense_Mutation_p.R551Q|BRPF1_ENST00000302054.3_Missense_Mutation_p.R551Q			P55201	BRPF1_HUMAN	bromodomain and PHD finger containing, 1	551	Interaction with MEAF6 and ING5.|Required for RUNX1 and RUNX2 transcriptional activation.				chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.R551Q(1)		central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	49	Medulloblastoma(99;0.227)					CGGCAGTCACGGAATGGGGTC	0.562																																					p.R551Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1652A	3						.						79.0	65.0	70.0					3																	9782555		2203	4300	6503	9757555	SO:0001583	missense	7862	exon4			M91585	CCDS2575.1, CCDS33692.1	3p26-p25	2008-07-18			ENSG00000156983	ENSG00000156983			14255	protein-coding gene	gene with protein product	"""peregrin"", ""bromodomain-containing protein, 140kD"""	602410				8946209, 7906940	Standard	NM_001003694		Approved	BR140	uc003bsf.3	P55201	OTTHUMG00000097033	ENST00000457855.1:c.1652G>A	3.37:g.9782555G>A	ENSP00000410210:p.Arg551Gln	Somatic		Capture	Illumina HiSeq	Phase_I	9757555	NM_004634	B4DEZ6|Q7Z6E0|Q8TCM6|Q9UHI0	Missense_Mutation	SNP	ENST00000457855.1	37	CCDS2575.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.881770	0.91740	.	.	ENSG00000156983	ENST00000433861;ENST00000424362;ENST00000383829;ENST00000302054;ENST00000457855	T;T;T;T;T	0.26067	1.79;1.76;3.06;1.76;1.76	5.74	5.74	0.90152	.	0.055944	0.64402	D	0.000001	T	0.61022	0.2314	M	0.88906	2.99	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.996;0.995	T	0.67237	-0.5721	10	0.87932	D	0	.	19.9403	0.97159	0.0:0.0:1.0:0.0	.	551;551;551;551	P55201-4;P55201-3;P55201-2;P55201	.;.;.;BRPF1_HUMAN	Q	551	ENSP00000402485:R551Q;ENSP00000398863:R551Q;ENSP00000373340:R551Q;ENSP00000306297:R551Q;ENSP00000410210:R551Q	ENSP00000306297:R551Q	R	+	2	0	BRPF1	9757555	1.000000	0.71417	0.989000	0.46669	0.992000	0.81027	9.869000	0.99810	2.712000	0.92718	0.650000	0.86243	CGG		BRPF1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338485.1	NM_001003694	
XIRP1	165904	broad.mit.edu	37	3	39226544	39226544	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr3:39226544G>A	ENST00000340369.3	-	2	4621	c.4393C>T	c.(4393-4395)Caa>Taa	p.Q1465*	XIRP1_ENST00000421646.1_Nonsense_Mutation_p.Q148*|XIRP1_ENST00000396251.1_3'UTR	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	1465					cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)	p.Q1465*(1)		breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		TGGTTTCTTTGCAGACTGTCA	0.637																																					p.Q1465X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C4393T	3						.						44.0	53.0	50.0					3																	39226544		2189	4287	6476	39201548	SO:0001587	stop_gained	165904	exon2			AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.4393C>T	3.37:g.39226544G>A	ENSP00000343140:p.Gln1465*	Somatic		Capture	Illumina HiSeq	Phase_I	39201548	NM_194293	A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Nonsense_Mutation	SNP	ENST00000340369.3	37	CCDS2683.1	.	.	.	.	.	.	.	.	.	.	G	18.70	3.681119	0.68042	.	.	ENSG00000168334	ENST00000340369;ENST00000421646	.	.	.	4.42	3.45	0.39498	.	0.335742	0.24539	U	0.037644	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	.	10.2745	0.43501	0.0:0.3268:0.6732:0.0	.	.	.	.	X	1465;148	.	ENSP00000343140:Q1465X	Q	-	1	0	XIRP1	39201548	0.385000	0.25172	0.483000	0.27378	0.023000	0.10783	1.453000	0.35167	2.404000	0.81709	0.655000	0.94253	CAA		XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254065.1	XM_093522	
CRYBG3	131544	broad.mit.edu	37	3	97618040	97618040	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr3:97618040A>C	ENST00000182096.4	+	11	2124	c.2060A>C	c.(2059-2061)aAa>aCa	p.K687T		NM_153605.3	NP_705833.3	Q68DQ2	CRBG3_HUMAN	beta-gamma crystallin domain containing 3	2635							carbohydrate binding (GO:0030246)	p.K687T(1)		breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(10)|stomach(1)|upper_aerodigestive_tract(2)	32						GAAAAAGGGAAATACAAATGC	0.358																																					.												.	.	1	Substitution - Missense(1)	large_intestine(1)	.	3						.						83.0	80.0	81.0					3																	97618040		1810	4081	5891	99100730	SO:0001583	missense	131544	.					3q11.2	2008-09-30			ENSG00000080200	ENSG00000080200			34427	protein-coding gene	gene with protein product							Standard	NM_153605		Approved	DKFZp667G2110	uc021xbn.2	Q68DQ2	OTTHUMG00000159187	ENST00000182096.4:c.2060A>C	3.37:g.97618040A>C	ENSP00000182096:p.Lys687Thr	Somatic		Capture	Illumina HiSeq	Phase_I	99100730	.	B4DLE8|F6VHI2|Q4G0V8|Q7Z4R9|Q86VD0|Q8N262|Q8N7F1|Q8NDQ8	Missense_Mutation	SNP	ENST00000182096.4	37		.	.	.	.	.	.	.	.	.	.	A	18.55	3.648870	0.67358	.	.	ENSG00000080200	ENST00000182096	T	0.76316	-1.01	5.86	5.86	0.93980	Beta/gamma crystallin (5);Gamma-crystallin-related (1);	0.000000	0.56097	D	0.000029	T	0.79335	0.4428	L	0.55481	1.735	0.80722	D	1	D	0.56968	0.978	P	0.53360	0.724	T	0.79475	-0.1788	10	0.45353	T	0.12	.	9.6953	0.40154	0.9216:0.0:0.0784:0.0	.	687	Q68DQ2	CRBG3_HUMAN	T	687	ENSP00000182096:K687T	ENSP00000182096:K687T	K	+	2	0	CRYBG3	99100730	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.944000	0.49034	2.238000	0.73509	0.477000	0.44152	AAA		CRYBG3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000353751.1	NM_153605	
DLG1	1739	broad.mit.edu	37	3	196831800	196831800	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr3:196831800G>T	ENST00000419354.1	-	15	1905	c.1619C>A	c.(1618-1620)aCa>aAa	p.T540K	DLG1_ENST00000314062.3_Missense_Mutation_p.T489K|DLG1_ENST00000443183.1_Missense_Mutation_p.T424K|DLG1_ENST00000422288.1_Missense_Mutation_p.T489K|DLG1_ENST00000357674.4_Missense_Mutation_p.T507K|DLG1_ENST00000392382.2_Missense_Mutation_p.T507K|DLG1_ENST00000346964.2_Missense_Mutation_p.T540K|DLG1_ENST00000452595.1_Missense_Mutation_p.T424K|DLG1_ENST00000450955.1_Missense_Mutation_p.T507K|DLG1_ENST00000448528.2_Missense_Mutation_p.T540K			Q12959	DLG1_HUMAN	discs, large homolog 1 (Drosophila)	540	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				actin filament organization (GO:0007015)|activation of protein kinase activity (GO:0032147)|amyloid precursor protein metabolic process (GO:0042982)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|cortical actin cytoskeleton organization (GO:0030866)|dephosphorylation (GO:0016311)|embryonic skeletal system morphogenesis (GO:0048704)|endothelial cell proliferation (GO:0001935)|establishment or maintenance of cell polarity (GO:0007163)|hard palate development (GO:0060022)|immunological synapse formation (GO:0001771)|lens development in camera-type eye (GO:0002088)|membrane raft organization (GO:0031579)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell proliferation (GO:0042130)|nucleotide phosphorylation (GO:0046939)|peristalsis (GO:0030432)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell proliferation (GO:0008284)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|protein localization to plasma membrane (GO:0072659)|regulation of membrane potential (GO:0042391)|regulation of myelination (GO:0031641)|regulation of sodium ion transmembrane transport (GO:1902305)|reproductive structure development (GO:0048608)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|synaptic transmission (GO:0007268)|T cell activation (GO:0042110)|T cell cytokine production (GO:0002369)|tight junction assembly (GO:0070830)|viral process (GO:0016032)	basal lamina (GO:0005605)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell projection membrane (GO:0031253)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|immunological synapse (GO:0001772)|intercalated disc (GO:0014704)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|membrane raft (GO:0045121)|microtubule (GO:0005874)|MPP7-DLG1-LIN7 complex (GO:0097025)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	cytoskeletal protein binding (GO:0008092)|guanylate kinase activity (GO:0004385)|ion channel binding (GO:0044325)|L27 domain binding (GO:0097016)|mitogen-activated protein kinase kinase binding (GO:0031434)|phosphatase binding (GO:0019902)|phosphoprotein phosphatase activity (GO:0004721)|potassium channel regulator activity (GO:0015459)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)	p.T540K(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	26	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		TGCAACAATTGTGACAGCCTG	0.343																																					p.T540K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1619A	3						.						104.0	109.0	107.0					3																	196831800		2203	4300	6503	198316197	SO:0001583	missense	1739	exon15			U13897	CCDS3327.1, CCDS43194.1, CCDS56300.1, CCDS56301.1, CCDS75072.1	3q29	2008-12-15	2001-11-28		ENSG00000075711	ENSG00000075711			2900	protein-coding gene	gene with protein product	"""discs large homolog 1"", ""presynaptic protein SAP97"", ""synapse-associated protein 97"""	601014	"""discs, large (Drosophila) homolog 1"""			7937897, 8825652	Standard	NM_004087		Approved	SAP97, SAP-97, hdlg, DLGH1, dJ1061C18.1.1	uc003fxn.4	Q12959	OTTHUMG00000047972	ENST00000419354.1:c.1619C>A	3.37:g.196831800G>T	ENSP00000407531:p.Thr540Lys	Somatic		Capture	Illumina HiSeq	Phase_I	198316197	NM_004087	A5YKK7|B4DGU1|B4DGZ8|B7ZMM0|B9EIQ5|D3DXB8|D3DXB9|E7EWL7|E9PG21|Q12958	Missense_Mutation	SNP	ENST00000419354.1	37	CCDS43194.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.587767	0.86851	.	.	ENSG00000075711	ENST00000346964;ENST00000359922;ENST00000357674;ENST00000381807;ENST00000314062;ENST00000419354;ENST00000452595;ENST00000422288;ENST00000448528;ENST00000443183;ENST00000392382;ENST00000450955	T;T;T;T;T;T;T;T;T;T	0.27720	1.65;1.65;1.65;1.65;1.65;1.65;1.65;1.65;1.65;1.65	5.38	5.38	0.77491	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.48370	0.1496	L	0.39692	1.235	0.80722	D	1	D;P;D;D;D;D	0.76494	0.991;0.784;0.996;0.999;0.957;0.999	P;P;D;D;P;D	0.72075	0.904;0.763;0.943;0.966;0.596;0.976	T	0.47699	-0.9097	10	0.87932	D	0	.	17.6813	0.88243	0.0:0.0:1.0:0.0	.	507;424;424;507;540;540	Q12959-4;E9PG21;E7EWL7;Q12959-3;Q12959;Q12959-2	.;.;.;.;DLG1_HUMAN;.	K	540;540;507;540;489;540;424;489;540;424;507;507	ENSP00000345731:T540K;ENSP00000350303:T507K;ENSP00000321087:T489K;ENSP00000407531:T540K;ENSP00000398939:T424K;ENSP00000413238:T489K;ENSP00000391732:T540K;ENSP00000396658:T424K;ENSP00000376187:T507K;ENSP00000411278:T507K	ENSP00000321087:T489K	T	-	2	0	DLG1	198316197	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	8.935000	0.92923	2.505000	0.84491	0.591000	0.81541	ACA		DLG1-008	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000258170.2	NM_004087	
CRIPAK	285464	broad.mit.edu	37	4	1388923	1388923	+	Silent	SNP	T	T	C	rs553511535|rs76549100	byFrequency	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr4:1388923T>C	ENST00000324803.4	+	1	3584	c.624T>C	c.(622-624)ccT>ccC	p.P208P		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	208					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.P208P(1)		NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			GTGGAGTGCCTGCCTGCTCAC	0.667													N|||	103	0.0205671	0.0416	0.0187	5008	,	,		13340	0.003		0.0249	False		,,,				2504	0.0072				p.P208P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T624C	4						.	C		111,4211		17,77,2067	246.0	168.0	196.0		624	-1.0	0.0	4	dbSNP_131	196	36,7546		1,34,3756	no	coding-synonymous	CRIPAK	NM_175918.3		18,111,5823	CC,CT,TT		0.4748,2.5683,1.2349		208/447	1388923	147,11757	2161	3791	5952	1378923	SO:0001819	synonymous_variant	285464	exon1			AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.624T>C	4.37:g.1388923T>C		Somatic		Capture	Illumina HiSeq	Phase_I	1378923	NM_175918	Q8NB03	Silent	SNP	ENST00000324803.4	37	CCDS3349.1																																																																																				CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
FGA	2243	broad.mit.edu	37	4	155505788	155505788	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr4:155505788C>T	ENST00000302053.3	-	6	2167	c.2089G>A	c.(2089-2091)Ggc>Agc	p.G697S		NM_000508.3	NP_000499.1	P02671	FIBA_HUMAN	fibrinogen alpha chain	697	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				blood coagulation (GO:0007596)|blood coagulation, common pathway (GO:0072377)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of blood coagulation, common pathway (GO:2000261)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	structural molecule activity (GO:0005198)	p.G697S(1)		NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	73	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	TTCAGGCTGCCGAAACCTCTC	0.483																																					p.G697S	NSCLC(143;340 1922 20892 22370 48145)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2089A	4						.						101.0	96.0	98.0					4																	155505788		2203	4300	6503	155725238	SO:0001583	missense	2243	exon6				CCDS3787.1, CCDS47152.1	4q28	2014-09-17			ENSG00000171560	ENSG00000171560		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3661	protein-coding gene	gene with protein product		134820	"""fibrinogen, A alpha polypeptide"""				Standard	NM_000508		Approved		uc003iod.1	P02671	OTTHUMG00000150330	ENST00000302053.3:c.2089G>A	4.37:g.155505788C>T	ENSP00000306361:p.Gly697Ser	Somatic		Capture	Illumina HiSeq	Phase_I	155725238	NM_000508	A8K3E4|D3DP14|D3DP15|Q4QQH7|Q9BX62|Q9UCH2	Missense_Mutation	SNP	ENST00000302053.3	37	CCDS3787.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.647526	0.87958	.	.	ENSG00000171560	ENST00000302053	D	0.99839	-7.07	5.81	4.98	0.66077	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.000000	0.85682	D	0.000000	D	0.99883	0.9944	H	0.96365	3.81	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96256	0.9187	10	0.87932	D	0	.	15.1214	0.72447	0.0:0.932:0.0:0.068	.	697	P02671	FIBA_HUMAN	S	697	ENSP00000306361:G697S	ENSP00000306361:G697S	G	-	1	0	FGA	155725238	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.090000	0.71397	1.471000	0.48121	-0.143000	0.13931	GGC		FGA-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317593.1	NM_000508	
KCTD8	386617	broad.mit.edu	37	4	44177057	44177057	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr4:44177057C>T	ENST00000360029.3	-	2	1455	c.1172G>A	c.(1171-1173)cGc>cAc	p.R391H		NM_198353.2	NP_938167.1	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerization domain containing 8	391					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)		p.R391H(1)		central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(3)|upper_aerodigestive_tract(4)	41						TTTAGAGGGGCGATCCAATGT	0.507										HNSCC(17;0.042)																											p.R391H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1172A	4						.						165.0	165.0	165.0					4																	44177057		2203	4300	6503	43871814	SO:0001583	missense	386617	exon2			AK123347	CCDS3467.1	4p13	2013-06-20	2013-06-20		ENSG00000183783	ENSG00000183783			22394	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 8"""				Standard	NM_198353		Approved		uc003gwu.3	Q6ZWB6	OTTHUMG00000099409	ENST00000360029.3:c.1172G>A	4.37:g.44177057C>T	ENSP00000353129:p.Arg391His	Somatic		Capture	Illumina HiSeq	Phase_I	43871814	NM_198353	A2RU39	Missense_Mutation	SNP	ENST00000360029.3	37	CCDS3467.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.67|15.67	2.901921|2.901921	0.52227|0.52227	.|.	.|.	ENSG00000183783|ENSG00000183783	ENST00000515268|ENST00000360029	.|T	.|0.43294	.|0.95	4.56|4.56	4.56|4.56	0.56223|0.56223	.|.	.|0.000000	.|0.46758	.|D	.|0.000275	T|T	0.52597|0.52597	0.1744|0.1744	L|L	0.36672|0.36672	1.1|1.1	0.43271|0.43271	D|D	0.995228|0.995228	.|D	.|0.76494	.|0.999	.|P	.|0.62560	.|0.904	T|T	0.56860|0.56860	-0.7909|-0.7909	5|10	.|0.87932	.|D	.|0	.|.	16.846|16.846	0.85981|0.85981	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|391	.|Q6ZWB6	.|KCTD8_HUMAN	T|H	127|391	.|ENSP00000353129:R391H	.|ENSP00000353129:R391H	A|R	-|-	1|2	0|0	KCTD8|KCTD8	43871814|43871814	1.000000|1.000000	0.71417|0.71417	0.969000|0.969000	0.41365|0.41365	0.187000|0.187000	0.23431|0.23431	7.189000|7.189000	0.77747|0.77747	2.516000|2.516000	0.84829|0.84829	0.650000|0.650000	0.86243|0.86243	GCC|CGC		KCTD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216868.1		
PDGFRA	5156	broad.mit.edu	37	4	55133541	55133541	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr4:55133541T>A	ENST00000257290.5	+	6	1176	c.845T>A	c.(844-846)gTg>gAg	p.V282E	FIP1L1_ENST00000507166.1_Intron	NM_006206.4	NP_006197.1	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor, alpha polypeptide	282	Ig-like C2-type 3.				adrenal gland development (GO:0030325)|cardiac myofibril assembly (GO:0055003)|cell activation (GO:0001775)|cell chemotaxis (GO:0060326)|cellular response to amino acid stimulus (GO:0071230)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|epidermal growth factor receptor signaling pathway (GO:0007173)|estrogen metabolic process (GO:0008210)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hematopoietic progenitor cell differentiation (GO:0002244)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|Leydig cell differentiation (GO:0033327)|lung development (GO:0030324)|luteinization (GO:0001553)|male genitalia development (GO:0030539)|metanephric glomerular capillary formation (GO:0072277)|negative regulation of platelet activation (GO:0010544)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet aggregation (GO:0070527)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-alpha signaling pathway (GO:0035790)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA replication (GO:0045740)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of chemotaxis (GO:0050920)|regulation of mesenchymal stem cell differentiation (GO:2000739)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction involved in regulation of gene expression (GO:0023019)|viral process (GO:0016032)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane (GO:0016020)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet-derived growth factor alpha-receptor activity (GO:0005018)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.V282E(1)		NS(1)|autonomic_ganglia(1)|bone(1)|breast(4)|central_nervous_system(17)|cervix(1)|endometrium(4)|eye(1)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(22)|kidney(6)|large_intestine(26)|liver(4)|lung(48)|ovary(4)|prostate(6)|skin(11)|small_intestine(49)|soft_tissue(727)|stomach(32)|urinary_tract(1)	967	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sunitinib(DB01268)	GAGGCCACGGTGAAAGACAGT	0.483			"""Mis, O, T"""	FIP1L1	"""GIST, idiopathic hypereosinophilic syndrome, paediatric GBM"""				Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Intestinal Neurofibromatosis	TSP Lung(21;0.16)																											p.V282E	Pancreas(151;208 1913 7310 23853 37092)		Dom	yes		4	4q11-q13	5156	"""platelet-derived growth factor, alpha-receptor"""		"""L, M, O"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T845A	4						.						92.0	93.0	92.0					4																	55133541		2203	4300	6503	54828298	SO:0001583	missense	5156	exon6	Familial Cancer Database	Sporadic Multiple GIST;Familial Intestinal Stromal Tumors, NF3B, subset of Familial GIST,	D50001	CCDS3495.1	4q12	2014-09-17			ENSG00000134853	ENSG00000134853		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	8803	protein-coding gene	gene with protein product		173490					Standard	NM_006206		Approved	CD140a, PDGFR2	uc003han.4	P16234	OTTHUMG00000128699	ENST00000257290.5:c.845T>A	4.37:g.55133541T>A	ENSP00000257290:p.Val282Glu	Somatic		Capture	Illumina HiSeq	Phase_I	54828298	NM_006206	B2RE69|E9PBH0|Q6P4H5|Q96KZ7|Q9UD28	Missense_Mutation	SNP	ENST00000257290.5	37	CCDS3495.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.338804	0.81911	.	.	ENSG00000134853	ENST00000257290	T	0.67345	-0.26	5.67	4.5	0.54988	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.29522	U	0.011903	T	0.73976	0.3656	M	0.68952	2.095	0.80722	D	1	D;P	0.56287	0.975;0.918	P;P	0.58928	0.848;0.762	T	0.75645	-0.3246	10	0.59425	D	0.04	.	8.3901	0.32522	0.0:0.1468:0.0:0.8532	.	282;282	P16234-3;P16234	.;PGFRA_HUMAN	E	282	ENSP00000257290:V282E	ENSP00000257290:V282E	V	+	2	0	PDGFRA	54828298	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.312000	0.43726	2.165000	0.68154	0.260000	0.18958	GTG		PDGFRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250598.2	NM_006206	
EPHA5	2044	broad.mit.edu	37	4	66233084	66233084	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr4:66233084T>A	ENST00000273854.3	-	10	2515	c.1915A>T	c.(1915-1917)Aat>Tat	p.N639Y	EPHA5_ENST00000511294.1_Missense_Mutation_p.N640Y|EPHA5_ENST00000432638.2_Missense_Mutation_p.N476Y|EPHA5_ENST00000354839.4_Missense_Mutation_p.N617Y	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	639					axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)	p.N639Y(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						CTGTGCCCATTATGAAAATGC	0.333										TSP Lung(17;0.13)																											p.N639Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1915T	4						.						112.0	97.0	102.0					4																	66233084		2203	4300	6503	65915679	SO:0001583	missense	2044	exon10			L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.1915A>T	4.37:g.66233084T>A	ENSP00000273854:p.Asn639Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	65915679	NM_004439	Q7Z3F2	Missense_Mutation	SNP	ENST00000273854.3	37	CCDS3513.1	.	.	.	.	.	.	.	.	.	.	T	24.4	4.528867	0.85706	.	.	ENSG00000145242	ENST00000273854;ENST00000432638;ENST00000354839;ENST00000511294	T;T;T;T	0.12672	2.66;2.66;2.66;2.66	5.28	5.28	0.74379	.	0.000000	0.56097	D	0.000027	T	0.34890	0.0913	M	0.66297	2.02	0.58432	D	0.999991	D;P;D;D	0.65815	0.995;0.949;0.994;0.976	D;B;D;P	0.68192	0.947;0.443;0.956;0.524	T	0.05750	-1.0866	10	0.56958	D	0.05	.	14.8744	0.70483	0.0:0.0:0.0:1.0	.	618;640;617;639	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	Y	639;476;617;640	ENSP00000273854:N639Y;ENSP00000389208:N476Y;ENSP00000346899:N617Y;ENSP00000427638:N640Y	ENSP00000273854:N639Y	N	-	1	0	EPHA5	65915679	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.448000	0.52943	1.995000	0.58328	0.377000	0.23210	AAT		EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439	
GUCY1A3	2982	broad.mit.edu	37	4	156638359	156638359	+	Missense_Mutation	SNP	G	G	C	rs376656213		TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr4:156638359G>C	ENST00000296518.7	+	8	1830	c.1621G>C	c.(1621-1623)Gag>Cag	p.E541Q	GUCY1A3_ENST00000393832.3_Missense_Mutation_p.E283Q|GUCY1A3_ENST00000506455.1_Missense_Mutation_p.E541Q|GUCY1A3_ENST00000455639.2_Missense_Mutation_p.E541Q|GUCY1A3_ENST00000511507.1_Missense_Mutation_p.E541Q|GUCY1A3_ENST00000513574.1_Missense_Mutation_p.E541Q|GUCY1A3_ENST00000511108.1_Missense_Mutation_p.E541Q			Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3	541	Guanylate cyclase. {ECO:0000255|PROSITE- ProRule:PRU00099}.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of cGMP biosynthetic process (GO:0030828)|regulation of blood pressure (GO:0008217)|relaxation of vascular smooth muscle (GO:0060087)|response to defense-related host nitric oxide production (GO:0052565)	guanylate cyclase complex, soluble (GO:0008074)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)|receptor activity (GO:0004872)	p.E541Q(1)		central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|liver(2)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)		ATTACACAAAGAGAGTGATAC	0.428																																					p.E541Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1621C	4						.						156.0	147.0	150.0					4																	156638359		2203	4300	6503	156857809	SO:0001583	missense	2982	exon8				CCDS34085.1, CCDS54812.1	4q31.3-q33	2008-03-18				ENSG00000164116	4.6.1.2		4685	protein-coding gene	gene with protein product		139396		GUC1A3		1352257	Standard	NM_001130687		Approved	GC-SA3	uc003iow.3	Q02108		ENST00000296518.7:c.1621G>C	4.37:g.156638359G>C	ENSP00000296518:p.Glu541Gln	Somatic		Capture	Illumina HiSeq	Phase_I	156857809	NM_001130682	D3DP19|D6RDW3|O43843|Q8TAH3	Missense_Mutation	SNP	ENST00000296518.7	37	CCDS34085.1	.	.	.	.	.	.	.	.	.	.	G	17.63	3.436508	0.62955	.	.	ENSG00000164116	ENST00000506455;ENST00000511108;ENST00000511507;ENST00000455639;ENST00000393832;ENST00000296518;ENST00000513574	D;D;D;D;D;D;D	0.84873	-1.91;-1.91;-1.91;-1.91;-1.91;-1.91;-1.91	5.64	5.64	0.86602	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.64402	D	0.000004	D	0.82930	0.5144	L	0.55213	1.73	0.54753	D	0.999982	B;B	0.32876	0.388;0.388	B;B	0.32583	0.148;0.148	T	0.79315	-0.1854	10	0.19590	T	0.45	.	19.6996	0.96048	0.0:0.0:1.0:0.0	.	541;541	B3KU69;Q02108	.;GCYA3_HUMAN	Q	541;541;541;541;283;541;541	ENSP00000424361:E541Q;ENSP00000421493:E541Q;ENSP00000426968:E541Q;ENSP00000412201:E541Q;ENSP00000377418:E283Q;ENSP00000296518:E541Q;ENSP00000426040:E541Q	ENSP00000296518:E541Q	E	+	1	0	GUCY1A3	156857809	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.587000	0.74071	2.646000	0.89796	0.655000	0.94253	GAG		GUCY1A3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365786.2		
MCC	4163	broad.mit.edu	37	5	112458452	112458452	+	Missense_Mutation	SNP	C	C	T	rs371091745		TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr5:112458452C>T	ENST00000302475.4	-	4	949	c.386G>A	c.(385-387)cGa>cAa	p.R129Q	MCC_ENST00000408903.3_Missense_Mutation_p.R319Q|MCC_ENST00000515367.2_Missense_Mutation_p.R66Q|MCC_ENST00000514701.3_5'UTR	NM_002387.2	NP_002378	P23508	CRCM_HUMAN	mutated in colorectal cancers	129					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.R129Q(1)|p.R319Q(1)		endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		GTCCATGCTTCGAGAGTCCTC	0.527																																					p.R319Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G956A	5						.						173.0	139.0	150.0					5																	112458452		2202	4300	6502	112486351	SO:0001583	missense	4163	exon6				CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000302475.4:c.386G>A	5.37:g.112458452C>T	ENSP00000305617:p.Arg129Gln	Somatic		Capture	Illumina HiSeq	Phase_I	112486351	NM_001085377	D3DT05|Q6ZR04	Missense_Mutation	SNP	ENST00000302475.4	37	CCDS4111.1	.	.	.	.	.	.	.	.	.	.	C	17.58	3.424566	0.62733	.	.	ENSG00000171444	ENST00000302475;ENST00000515367;ENST00000408903	T;T;T	0.80033	-1.33;2.46;1.29	5.76	3.93	0.45458	.	0.139891	0.48286	D	0.000185	T	0.60274	0.2256	N	0.08118	0	0.45515	D	0.99847	B;D;B;D	0.63880	0.056;0.993;0.272;0.98	B;B;B;B	0.41860	0.015;0.368;0.034;0.368	T	0.60954	-0.7160	10	0.33940	T	0.23	-1.3534	8.5859	0.33657	0.0:0.7329:0.1271:0.14	.	129;91;319;129	B7Z6G0;B3KTX0;P23508-2;P23508	.;.;.;CRCM_HUMAN	Q	129;66;319	ENSP00000305617:R129Q;ENSP00000421615:R66Q;ENSP00000386227:R319Q	ENSP00000305617:R129Q	R	-	2	0	MCC	112486351	1.000000	0.71417	0.908000	0.35775	0.984000	0.73092	2.123000	0.41996	1.448000	0.47680	0.563000	0.77884	CGA		MCC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250736.3	NM_001085377	
DMXL1	1657	broad.mit.edu	37	5	118469726	118469726	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr5:118469726A>G	ENST00000311085.8	+	12	2187	c.2107A>G	c.(2107-2109)Agt>Ggt	p.S703G	DMXL1_ENST00000539542.1_Missense_Mutation_p.S703G	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	703								p.S703G(1)		breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		TGCAGTTTACAGTGAGCTTAT	0.428																																					p.S703G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2107G	5						.						123.0	119.0	120.0					5																	118469726		2202	4300	6502	118497625	SO:0001583	missense	1657	exon12			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.2107A>G	5.37:g.118469726A>G	ENSP00000309690:p.Ser703Gly	Somatic		Capture	Illumina HiSeq	Phase_I	118497625	NM_005509		Missense_Mutation	SNP	ENST00000311085.8	37	CCDS4125.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.218897	0.79464	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	T;T	0.47177	0.85;0.85	5.53	5.53	0.82687	WD40/YVTN repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.70378	0.3217	M	0.81112	2.525	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.73471	-0.3972	9	.	.	.	-14.2179	15.6458	0.77049	1.0:0.0:0.0:0.0	.	703;703	F5H269;Q9Y485	.;DMXL1_HUMAN	G	703	ENSP00000309690:S703G;ENSP00000439479:S703G	.	S	+	1	0	DMXL1	118497625	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.957000	0.93082	2.099000	0.63709	0.377000	0.23210	AGT		DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250862.1	NM_005509	
PCDHA2	56146	broad.mit.edu	37	5	140174733	140174733	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr5:140174733C>T	ENST00000526136.1	+	1	184	c.184C>T	c.(184-186)Cgc>Tgc	p.R62C	PCDHA2_ENST00000520672.2_Missense_Mutation_p.R62C|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000378132.1_Missense_Mutation_p.R62C	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	62	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.R62C(2)		NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTGGTGCCGCGCCTGTTCCG	0.632																																					p.R62C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C184T	5						.						49.0	59.0	56.0					5																	140174733		2200	4293	6493	140154917	SO:0001583	missense	56146	exon1			AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.184C>T	5.37:g.140174733C>T	ENSP00000431748:p.Arg62Cys	Somatic		Capture	Illumina HiSeq	Phase_I	140154917	NM_018905	O75287|Q9BTV3	Missense_Mutation	SNP	ENST00000526136.1	37	CCDS54914.1	.	.	.	.	.	.	.	.	.	.	c	16.81	3.225169	0.58668	.	.	ENSG00000204969	ENST00000520672;ENST00000378132;ENST00000526136	T;T;T	0.42131	0.98;0.98;0.98	3.94	2.98	0.34508	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.000000	0.37577	U	0.002024	T	0.67439	0.2893	H	0.99415	4.555	0.18873	N	0.999981	D;D;D	0.63046	0.989;0.992;0.989	B;P;B	0.49477	0.4;0.612;0.4	T	0.69386	-0.5159	10	0.87932	D	0	.	9.5098	0.39069	0.1564:0.6914:0.1522:0.0	.	62;62;62	Q9Y5H9-3;Q9Y5H9;Q9Y5H9-2	.;PCDA2_HUMAN;.	C	62	ENSP00000430584:R62C;ENSP00000367372:R62C;ENSP00000431748:R62C	ENSP00000367372:R62C	R	+	1	0	PCDHA2	140154917	0.990000	0.36364	1.000000	0.80357	0.993000	0.82548	2.746000	0.47467	2.201000	0.70794	0.644000	0.83932	CGC		PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372877.3	NM_018905	
PCDHAC2	56134	broad.mit.edu	37	5	140346788	140346788	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr5:140346788C>T	ENST00000289269.5	+	1	969	c.437C>T	c.(436-438)cCg>cTg	p.P146L	PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHAC1_ENST00000253807.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA10_ENST00000506939.2_Intron	NM_018899.5|NM_031883.2	NP_061722.1|NP_114089.1	Q9Y5I4	PCDC2_HUMAN	protocadherin alpha subfamily C, 2	146	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.P146L(1)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|liver(2)|lung(9)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	45			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACAACTCACCGCGTTTCCCG	0.637																																					p.P146L	Melanoma(190;638 2083 3390 11909 52360)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C437T	5						.						36.0	39.0	38.0					5																	140346788		2203	4300	6503	140326972	SO:0001583	missense	56134	exon1			AF152474	CCDS4242.1	5q31	2010-11-26			ENSG00000243232	ENSG00000243232		"""Cadherins / Protocadherins : Clustered"""	8677	other	complex locus constituent		606321				10380929	Standard	NM_031883		Approved	PCDH-ALPHA-C2		Q9Y5I4	OTTHUMG00000129607	ENST00000289269.5:c.437C>T	5.37:g.140346788C>T	ENSP00000289269:p.Pro146Leu	Somatic		Capture	Illumina HiSeq	Phase_I	140326972	NM_018899	Q2M3V1|Q9Y5F4	Missense_Mutation	SNP	ENST00000289269.5	37	CCDS4242.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.900362	0.92035	.	.	ENSG00000243232	ENST00000289269	T	0.72394	-0.65	5.43	5.43	0.79202	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.41712	D	0.000835	D	0.91012	0.7173	H	0.98542	4.26	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.94338	0.7568	10	0.87932	D	0	.	19.2427	0.93889	0.0:1.0:0.0:0.0	.	146;146	Q9Y5I4-2;Q9Y5I4	.;PCDC2_HUMAN	L	146	ENSP00000289269:P146L	ENSP00000289269:P146L	P	+	2	0	PCDHAC2	140326972	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.769000	0.85360	2.555000	0.86185	0.555000	0.69702	CCG		PCDHAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251802.2	NM_018899	
PCDHB4	56131	broad.mit.edu	37	5	140503791	140503791	+	Silent	SNP	C	C	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr5:140503791C>T	ENST00000194152.1	+	1	2211	c.2211C>T	c.(2209-2211)gaC>gaT	p.D737D		NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	737					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D737D(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ATCTGGTGGACGTAAGCGGCA	0.632																																					p.D737D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2211T	5						.						84.0	96.0	92.0					5																	140503791		2203	4300	6503	140483975	SO:0001819	synonymous_variant	56131	exon1			AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.2211C>T	5.37:g.140503791C>T		Somatic		Capture	Illumina HiSeq	Phase_I	140483975	NM_018938	Q4V761	Silent	SNP	ENST00000194152.1	37	CCDS4246.1																																																																																				PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251812.2	NM_018938	
PCDHB8	56128	broad.mit.edu	37	5	140558540	140558540	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr5:140558540G>A	ENST00000239444.2	+	1	1170	c.925G>A	c.(925-927)Gat>Aat	p.D309N	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	309	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GAAACAACTTGATTTCGAAAA	0.383																																					p.D309N												.	.	0			c.G925A	5						.						124.0	184.0	164.0					5																	140558540		2203	4300	6503	140538724	SO:0001583	missense	56128	exon1			AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.925G>A	5.37:g.140558540G>A	ENSP00000239444:p.Asp309Asn	None		Capture	Illumina HiSeq	Phase_I	140538724	NM_019120	B9EGV1	Missense_Mutation	SNP	ENST00000239444.2	37	CCDS4250.1	.	.	.	.	.	.	.	.	.	.	G	13.57	2.275609	0.40294	.	.	ENSG00000120322	ENST00000239444	T	0.63417	-0.04	4.25	4.25	0.50352	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.70979	0.3286	M	0.84846	2.72	0.35307	D	0.783562	P	0.40180	0.705	P	0.46975	0.533	T	0.80679	-0.1275	9	0.56958	D	0.05	.	10.0596	0.42266	0.095:0.0:0.905:0.0	.	309	Q9UN66	PCDB8_HUMAN	N	309	ENSP00000239444:D309N	ENSP00000239444:D309N	D	+	1	0	PCDHB8	140538724	1.000000	0.71417	0.897000	0.35233	0.039000	0.13416	6.421000	0.73353	1.911000	0.55334	0.585000	0.79938	GAT		PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251816.2	NM_019120	
PCDHB14	56122	broad.mit.edu	37	5	140604527	140604527	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr5:140604527G>A	ENST00000239449.4	+	1	1450	c.1450G>A	c.(1450-1452)Gcc>Acc	p.A484T	PCDHB14_ENST00000515856.2_Missense_Mutation_p.A331T	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	484	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A484T(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGGCACCAACGCCCAGGTCAA	0.642																																					p.A484T	Ovarian(141;50 1831 27899 33809 37648)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1450A	5						.						102.0	109.0	106.0					5																	140604527		2203	4300	6503	140584711	SO:0001583	missense	56122	exon1			AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.1450G>A	5.37:g.140604527G>A	ENSP00000239449:p.Ala484Thr	Somatic		Capture	Illumina HiSeq	Phase_I	140584711	NM_018934	B4DPE2|Q4FZA4|Q4KN11	Missense_Mutation	SNP	ENST00000239449.4	37	CCDS4256.1	.	.	.	.	.	.	.	.	.	.	-	21.9	4.209484	0.79240	.	.	ENSG00000120327	ENST00000515856;ENST00000239449	T;T	0.52295	0.67;0.67	4.34	3.46	0.39613	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.75889	0.3911	H	0.95114	3.625	0.35709	D	0.816222	D	0.89917	1.0	D	0.71870	0.975	D	0.86699	0.1928	9	0.87932	D	0	.	13.6049	0.62041	0.0:0.0:0.8438:0.1562	.	484	Q9Y5E9	PCDBE_HUMAN	T	331;484	ENSP00000444518:A331T;ENSP00000239449:A484T	ENSP00000239449:A484T	A	+	1	0	PCDHB14	140584711	0.898000	0.30612	0.997000	0.53966	0.860000	0.49131	4.643000	0.61390	0.943000	0.37553	0.556000	0.70494	GCC		PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251814.2	NM_018934	
PCDHGA2	56113	broad.mit.edu	37	5	140718828	140718828	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr5:140718828C>A	ENST00000394576.2	+	1	290	c.290C>A	c.(289-291)gCt>gAt	p.A97D	PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	97	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A97D(2)		breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGCTCTGCGCTCAGAGCGCA	0.498																																					p.A97D												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C290A	5						.						60.0	64.0	63.0					5																	140718828		2203	4300	6503	140699012	SO:0001583	missense	56113	exon1			AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.290C>A	5.37:g.140718828C>A	ENSP00000378077:p.Ala97Asp	Somatic		Capture	Illumina HiSeq	Phase_I	140699012	NM_032009	Q52LL6|Q9Y5D5	Missense_Mutation	SNP	ENST00000394576.2	37	CCDS47289.1	.	.	.	.	.	.	.	.	.	.	.	6.359	0.434305	0.12045	.	.	ENSG00000081853	ENST00000394576	T	0.27720	1.65	5.04	2.03	0.26663	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.184695	0.25503	U	0.030237	T	0.26122	0.0637	L	0.45137	1.4	0.22199	N	0.9993	B;B	0.20368	0.002;0.044	B;B	0.23852	0.027;0.049	T	0.21449	-1.0245	10	0.39692	T	0.17	.	11.9745	0.53083	0.1206:0.3133:0.5661:0.0	.	97;97	Q9Y5H1-2;Q9Y5H1	.;PCDG2_HUMAN	D	97	ENSP00000378077:A97D	ENSP00000378077:A97D	A	+	2	0	PCDHGA2	140699012	0.027000	0.19231	0.746000	0.31095	0.049000	0.14656	0.745000	0.26259	0.623000	0.30267	-0.257000	0.10917	GCT		PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374738.1	NM_018915	
FBXO38	81545	broad.mit.edu	37	5	147820024	147820024	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr5:147820024C>G	ENST00000340253.5	+	20	3376	c.3208C>G	c.(3208-3210)Cga>Gga	p.R1070G	FBXO38_ENST00000513826.1_Missense_Mutation_p.R825G|FBXO38_ENST00000394370.3_Missense_Mutation_p.R995G|FBXO38_ENST00000296701.6_Missense_Mutation_p.R825G			Q6PIJ6	FBX38_HUMAN	F-box protein 38	1070					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.R1070G(1)	ATG4C/FBXO38(2)	NS(1)|breast(2)|endometrium(7)|kidney(5)|large_intestine(9)|lung(15)|ovary(5)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGAAGCCACTCGAAGTGAAGA	0.353																																					p.R1070G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3208G	5						.						43.0	48.0	46.0					5																	147820024		2202	4300	6502	147800217	SO:0001583	missense	81545	exon20			BC005873	CCDS43384.1, CCDS64285.1	5q33.1	2008-02-05			ENSG00000145868	ENSG00000145868		"""F-boxes /  ""other"""""	28844	protein-coding gene	gene with protein product		608533				12477932	Standard	NM_030793		Approved	MOKA, SP329, FLJ13962, Fbx38	uc003lpg.2	Q6PIJ6	OTTHUMG00000129929	ENST00000340253.5:c.3208C>G	5.37:g.147820024C>G	ENSP00000342023:p.Arg1070Gly	Somatic		Capture	Illumina HiSeq	Phase_I	147800217	NM_205836	Q6PK72|Q7Z2U0|Q86VN3|Q9BXY6|Q9H837|Q9HC40	Missense_Mutation	SNP	ENST00000340253.5	37		.	.	.	.	.	.	.	.	.	.	C	17.33	3.363209	0.61513	.	.	ENSG00000145868	ENST00000340253;ENST00000296701;ENST00000394370;ENST00000513826	T;T;T;T	0.40476	1.03;1.12;1.1;1.12	5.65	3.81	0.43845	.	0.000000	0.85682	D	0.000000	T	0.51975	0.1706	L	0.32530	0.975	0.28517	N	0.913236	D;D;D	0.89917	0.992;0.999;1.0	D;D;D	0.87578	0.969;0.988;0.998	T	0.50508	-0.8820	10	0.46703	T	0.11	-7.3358	13.5579	0.61770	0.2833:0.7167:0.0:0.0	.	825;995;1070	Q6PIJ6-3;Q6PIJ6-2;Q6PIJ6	.;.;FBX38_HUMAN	G	1070;825;995;825	ENSP00000342023:R1070G;ENSP00000296701:R825G;ENSP00000377895:R995G;ENSP00000426410:R825G	ENSP00000296701:R825G	R	+	1	2	FBXO38	147800217	0.937000	0.31787	0.993000	0.49108	0.991000	0.79684	1.828000	0.39111	0.681000	0.31386	0.467000	0.42956	CGA		FBXO38-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000252185.2	NM_030793	
NMUR2	56923	broad.mit.edu	37	5	151784441	151784441	+	Silent	SNP	C	C	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr5:151784441C>T	ENST00000255262.3	-	1	399	c.234G>A	c.(232-234)acG>acA	p.T78T	NMUR2_ENST00000518933.1_Intron	NM_020167.4	NP_064552.3	Q9GZQ4	NMUR2_HUMAN	neuromedin U receptor 2	78					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|arachidonic acid secretion (GO:0050482)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|cell-cell signaling (GO:0007267)|central nervous system development (GO:0007417)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|feeding behavior (GO:0007631)|grooming behavior (GO:0007625)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|reduction of food intake in response to dietary excess (GO:0002023)|regulation of smooth muscle contraction (GO:0006940)|response to pain (GO:0048265)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|GTP binding (GO:0005525)|intracellular calcium activated chloride channel activity (GO:0005229)|neuromedin U binding (GO:0042924)|neuromedin U receptor activity (GO:0001607)	p.T78T(2)		breast(1)|endometrium(1)|kidney(2)|large_intestine(12)|liver(1)|lung(15)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	44		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)			AGTTGGTGGGCGTCTTCATAG	0.562																																					p.T78T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G234A	5						.						105.0	102.0	103.0					5																	151784441		2203	4300	6503	151764634	SO:0001819	synonymous_variant	56923	exon1			AF242874	CCDS4321.1	5q33.1	2012-08-08		2004-05-28	ENSG00000132911	ENSG00000132911		"""GPCR / Class A : Neuromedin U receptors"""	16454	protein-coding gene	gene with protein product		605108		NMU2R		8940772, 10894543	Standard	NM_020167		Approved		uc003luv.2	Q9GZQ4	OTTHUMG00000130131	ENST00000255262.3:c.234G>A	5.37:g.151784441C>T		Somatic		Capture	Illumina HiSeq	Phase_I	151764634	NM_020167	Q7LC54|Q96AM5|Q9NRA6	Silent	SNP	ENST00000255262.3	37	CCDS4321.1																																																																																				NMUR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252439.1	NM_020167	
ZNF354A	6940	broad.mit.edu	37	5	178139508	178139508	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr5:178139508C>G	ENST00000335815.2	-	5	1568	c.1371G>C	c.(1369-1371)gaG>gaC	p.E457D		NM_005649.2	NP_005640.2	O60765	Z354A_HUMAN	zinc finger protein 354A	457					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E457D(1)		breast(1)|endometrium(2)|large_intestine(7)|lung(3)|ovary(2)|skin(2)|stomach(2)	19	all_cancers(89;0.000536)|Renal(175;0.000159)|all_epithelial(37;0.000221)|Lung NSC(126;0.00308)|all_lung(126;0.00536)	all_cancers(40;0.0452)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.185)		TATGAATTCGCTCGTGAATAA	0.373																																					p.E457D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1371C	5						.						88.0	88.0	88.0					5																	178139508		2203	4300	6503	178072114	SO:0001583	missense	6940	exon5			AF116030	CCDS4438.1	5q35.3	2013-01-08		2001-11-23	ENSG00000169131	ENSG00000169131		"""Zinc fingers, C2H2-type"", ""-"""	11628	protein-coding gene	gene with protein product		602444		TCF17		9465904	Standard	NM_005649		Approved	KID-1, EZNF, HKL1, KID1	uc003mjj.3	O60765	OTTHUMG00000130895	ENST00000335815.2:c.1371G>C	5.37:g.178139508C>G	ENSP00000337122:p.Glu457Asp	Somatic		Capture	Illumina HiSeq	Phase_I	178072114	NM_005649	Q9UNJ8	Missense_Mutation	SNP	ENST00000335815.2	37	CCDS4438.1	.	.	.	.	.	.	.	.	.	.	C	15.48	2.847058	0.51164	.	.	ENSG00000169131	ENST00000335815	T	0.18502	2.21	4.71	-1.98	0.07480	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.33515	N	0.004832	T	0.16214	0.0390	M	0.64630	1.985	0.23787	N	0.996843	P	0.42203	0.773	B	0.42495	0.389	T	0.10291	-1.0636	10	0.72032	D	0.01	-16.6882	5.7036	0.17895	0.1338:0.3412:0.0:0.525	.	457	O60765	Z354A_HUMAN	D	457	ENSP00000337122:E457D	ENSP00000337122:E457D	E	-	3	2	ZNF354A	178072114	0.000000	0.05858	0.888000	0.34837	0.928000	0.56348	0.052000	0.14163	-0.539000	0.06273	0.555000	0.69702	GAG		ZNF354A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253481.1	NM_005649	
ADCY2	108	broad.mit.edu	37	5	7802411	7802411	+	Silent	SNP	C	C	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr5:7802411C>T	ENST00000338316.4	+	21	2798	c.2709C>T	c.(2707-2709)tcC>tcT	p.S903S	ADCY2_ENST00000537121.1_Silent_p.S723S	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	903					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)	p.S903S(1)		NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						ATACAGAATCCGACGTGAACA	0.498																																					p.S903S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2709T	5						.						86.0	86.0	86.0					5																	7802411		2203	4300	6503	7855411	SO:0001819	synonymous_variant	108	exon21			AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.2709C>T	5.37:g.7802411C>T		Somatic		Capture	Illumina HiSeq	Phase_I	7855411	NM_020546	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Silent	SNP	ENST00000338316.4	37	CCDS3872.2																																																																																				ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546	
SLC45A2	51151	broad.mit.edu	37	5	33963828	33963828	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr5:33963828G>A	ENST00000296589.4	-	3	1002	c.856C>T	c.(856-858)Cag>Tag	p.Q286*	SLC45A2_ENST00000345083.5_Intron|SLC45A2_ENST00000382102.3_Nonsense_Mutation_p.Q286*|SLC45A2_ENST00000342059.3_Nonsense_Mutation_p.Q227*|SLC45A2_ENST00000509381.1_Intron	NM_016180.3	NP_057264	Q9UMX9	S45A2_HUMAN	solute carrier family 45, member 2	286					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)		p.Q286*(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(25)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48						TTTGCTCCCTGCATTGCCAGC	0.378																																					p.Q286X	Ovarian(31;380 859 8490 22203 49048)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C856T	5						.						157.0	163.0	161.0					5																	33963828		2203	4300	6503	33999585	SO:0001587	stop_gained	51151	exon3			AF172849	CCDS3901.1, CCDS43308.1, CCDS75232.1	5p13.3	2013-08-06	2005-10-06	2005-10-06	ENSG00000164175	ENSG00000164175		"""Solute carriers"""	16472	protein-coding gene	gene with protein product		606202	"""membrane associated transporter"""	MATP		11916009, 11574907	Standard	NM_001012509		Approved	AIM-1, OCA4	uc003jid.3	Q9UMX9	OTTHUMG00000090719	ENST00000296589.4:c.856C>T	5.37:g.33963828G>A	ENSP00000296589:p.Gln286*	Somatic		Capture	Illumina HiSeq	Phase_I	33999585	NM_001012509	Q6P2P0|Q9BTM3	Nonsense_Mutation	SNP	ENST00000296589.4	37	CCDS3901.1	.	.	.	.	.	.	.	.	.	.	G	34	5.386993	0.95988	.	.	ENSG00000164175	ENST00000296589;ENST00000342059;ENST00000382102;ENST00000510600	.	.	.	5.83	4.02	0.46733	.	1.293660	0.05336	N	0.529337	.	.	.	.	.	.	0.20196	N	0.999921	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	-19.6809	8.9943	0.36043	0.0794:0.1487:0.7719:0.0	.	.	.	.	X	286;227;286;111	.	ENSP00000296589:Q286X	Q	-	1	0	SLC45A2	33999585	0.000000	0.05858	0.006000	0.13384	0.893000	0.52053	0.459000	0.21908	0.779000	0.33543	0.563000	0.77884	CAG		SLC45A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207443.2	NM_016180	
SPEF2	79925	broad.mit.edu	37	5	35670225	35670225	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr5:35670225G>T	ENST00000356031.3	+	10	1574	c.1420G>T	c.(1420-1422)Gaa>Taa	p.E474*	SPEF2_ENST00000440995.2_Nonsense_Mutation_p.E474*|SPEF2_ENST00000282469.6_Nonsense_Mutation_p.E474*|SPEF2_ENST00000509059.1_Nonsense_Mutation_p.E474*	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	474					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)		p.E474*(2)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ACCCATATATGAACAAGCCTC	0.368																																					p.E474X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.G1420T	5						.						123.0	129.0	127.0					5																	35670225		2203	4299	6502	35705982	SO:0001587	stop_gained	79925	exon10			AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.1420G>T	5.37:g.35670225G>T	ENSP00000348314:p.Glu474*	Somatic		Capture	Illumina HiSeq	Phase_I	35705982	NM_024867	Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Nonsense_Mutation	SNP	ENST00000356031.3	37	CCDS43309.1	.	.	.	.	.	.	.	.	.	.	G	32	5.119104	0.94385	.	.	ENSG00000152582	ENST00000282469;ENST00000356031;ENST00000509059;ENST00000440995	.	.	.	5.1	3.18	0.36537	.	0.408748	0.25230	N	0.032164	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	10.2823	0.43548	0.0746:0.1359:0.7895:0.0	.	.	.	.	X	474	.	ENSP00000282469:E474X	E	+	1	0	SPEF2	35705982	1.000000	0.71417	0.999000	0.59377	0.654000	0.38779	2.855000	0.48333	1.270000	0.44297	0.655000	0.94253	GAA		SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	NM_144722	
LMBRD2	92255	broad.mit.edu	37	5	36115188	36115188	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr5:36115188T>G	ENST00000296603.4	-	12	1933	c.1471A>C	c.(1471-1473)Aat>Cat	p.N491H		NM_001007527.1	NP_001007528.1	Q68DH5	LMBD2_HUMAN	LMBR1 domain containing 2	491						integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.N491H(1)		breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(12)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_lung(31;0.000146)		Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CCCAAGAAATTAAGACATAAA	0.318																																					p.N491H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1471C	5						.						82.0	80.0	80.0					5																	36115188		2203	4300	6503	36150945	SO:0001583	missense	92255	exon12				CCDS34145.1	5p13.2	2008-02-05			ENSG00000164187	ENSG00000164187			25287	protein-coding gene	gene with protein product							Standard	NM_001007527		Approved	DKFZp434H2226	uc003jkb.1	Q68DH5	OTTHUMG00000162150	ENST00000296603.4:c.1471A>C	5.37:g.36115188T>G	ENSP00000296603:p.Asn491His	Somatic		Capture	Illumina HiSeq	Phase_I	36150945	NM_001007527	B3KRB6|Q9NTC7	Missense_Mutation	SNP	ENST00000296603.4	37	CCDS34145.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.475045	0.84640	.	.	ENSG00000164187	ENST00000296603;ENST00000546130	T	0.37584	1.19	5.46	5.46	0.80206	LMBR1-like membrane protein (1);	0.000000	0.85682	D	0.000000	T	0.64583	0.2611	M	0.86028	2.79	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.69514	-0.5125	10	0.52906	T	0.07	-20.4819	15.5397	0.76031	0.0:0.0:0.0:1.0	.	491	Q68DH5	LMBD2_HUMAN	H	491;385	ENSP00000296603:N491H	ENSP00000296603:N491H	N	-	1	0	LMBRD2	36150945	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.226000	0.78060	2.074000	0.62210	0.528000	0.53228	AAT		LMBRD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367552.1	NM_001007527	
LIFR	3977	broad.mit.edu	37	5	38506150	38506150	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr5:38506150T>C	ENST00000263409.4	-	9	1310	c.1148A>G	c.(1147-1149)aAa>aGa	p.K383R	LIFR_ENST00000453190.2_Missense_Mutation_p.K383R|LIFR_ENST00000503088.1_5'UTR	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha	383	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)	p.K383R(2)		NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					TTCAGCTCTTTTAAGTCTAAC	0.294			T	PLAG1	salivary adenoma																																p.K383R	Melanoma(13;4 730 6426 9861 34751)		Dom	yes		5	5p13-p12	3977	leukemia inhibitory factor receptor		E	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A1148G	5						.						49.0	51.0	50.0					5																	38506150		2202	4291	6493	38541907	SO:0001583	missense	3977	exon9			X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.1148A>G	5.37:g.38506150T>C	ENSP00000263409:p.Lys383Arg	Somatic		Capture	Illumina HiSeq	Phase_I	38541907	NM_001127671	Q6LCD9	Missense_Mutation	SNP	ENST00000263409.4	37	CCDS3927.1	.	.	.	.	.	.	.	.	.	.	T	2.659	-0.280148	0.05642	.	.	ENSG00000113594	ENST00000263409;ENST00000453190	T;T	0.36520	1.25;1.25	5.45	3.01	0.34805	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.923530	0.09418	N	0.804890	T	0.33352	0.0860	M	0.64404	1.975	0.09310	N	1	B	0.28900	0.227	B	0.23716	0.048	T	0.21280	-1.0250	10	0.28530	T	0.3	-13.5352	8.1316	0.31031	0.0:0.1664:0.0:0.8336	.	383	P42702	LIFR_HUMAN	R	383	ENSP00000263409:K383R;ENSP00000398368:K383R	ENSP00000263409:K383R	K	-	2	0	LIFR	38541907	0.324000	0.24652	0.058000	0.19502	0.010000	0.07245	0.901000	0.28445	0.901000	0.36495	-0.256000	0.11100	AAA		LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253823.1	NM_002310	
EMB	133418	broad.mit.edu	37	5	49699248	49699248	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr5:49699248C>A	ENST00000303221.5	-	6	856	c.641G>T	c.(640-642)gGa>gTa	p.G214V	EMB_ENST00000506190.1_5'UTR|EMB_ENST00000514111.1_Missense_Mutation_p.G164V|EMB_ENST00000508934.1_Missense_Mutation_p.G160V	NM_198449.2	NP_940851.1	Q6PCB8	EMB_HUMAN	embigin	214	Ig-like V-type 2.				cell adhesion (GO:0007155)|plasma membrane lactate transport (GO:0035879)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	organic cyclic compound binding (GO:0097159)	p.G214V(1)		breast(2)|endometrium(3)|large_intestine(4)|lung(4)|skin(2)	15	Lung SC(58;0.218)	Lung NSC(810;0.0795)				AGCATATGTTCCATTGATCAC	0.368																																					p.G214V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G641T	5						.						98.0	90.0	93.0					5																	49699248		2203	4299	6502	49735005	SO:0001583	missense	133418	exon6			BC059398	CCDS3953.1	5q11.1	2013-01-29	2010-06-24		ENSG00000170571	ENSG00000170571		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30465	protein-coding gene	gene with protein product		615669	"""embigin homolog (mouse)"""			9438341	Standard	NM_198449		Approved	MGC71745	uc003jom.3	Q6PCB8	OTTHUMG00000131161	ENST00000303221.5:c.641G>T	5.37:g.49699248C>A	ENSP00000302289:p.Gly214Val	Somatic		Capture	Illumina HiSeq	Phase_I	49735005	NM_198449	B7Z6S3|B7Z902	Missense_Mutation	SNP	ENST00000303221.5	37	CCDS3953.1	.	.	.	.	.	.	.	.	.	.	C	11.43	1.637056	0.29157	.	.	ENSG00000170571	ENST00000303221;ENST00000510295;ENST00000508934;ENST00000514111	T;T;T	0.64438	-0.1;2.86;-0.1	4.71	1.59	0.23543	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.793847	0.11347	N	0.573463	T	0.62913	0.2467	L	0.57536	1.79	0.20307	N	0.999911	P;B	0.43542	0.81;0.213	P;B	0.49887	0.625;0.358	T	0.51639	-0.8680	9	.	.	.	-5.0919	5.595	0.17321	0.0:0.5078:0.3078:0.1844	.	160;214	D6RDX7;Q6PCB8	.;EMB_HUMAN	V	214;186;160;164	ENSP00000302289:G214V;ENSP00000425215:G160V;ENSP00000426404:G164V	.	G	-	2	0	EMB	49735005	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.242000	0.18087	0.485000	0.27652	-0.459000	0.05422	GGA		EMB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253853.1	NM_198449	
VCAN	1462	broad.mit.edu	37	5	82816035	82816035	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr5:82816035G>C	ENST00000265077.3	+	7	2475	c.1910G>C	c.(1909-1911)gGc>gCc	p.G637A	VCAN_ENST00000512590.2_Missense_Mutation_p.G589A|VCAN_ENST00000343200.5_Intron|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000342785.4_Missense_Mutation_p.G637A	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	637	GAG-alpha (glucosaminoglycan attachment domain).				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)	p.G637A(1)		NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	GAGTTTCTTGGCAAATATCTG	0.373																																					p.G637A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1910C	5						.						143.0	139.0	140.0					5																	82816035		2203	4300	6503	82851791	SO:0001583	missense	1462	exon7			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.1910G>C	5.37:g.82816035G>C	ENSP00000265077:p.Gly637Ala	Somatic		Capture	Illumina HiSeq	Phase_I	82851791	NM_001164098	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	G	12.98	2.101819	0.37048	.	.	ENSG00000038427	ENST00000265077;ENST00000342785;ENST00000512590	T;T;T	0.57595	0.39;0.39;0.39	5.73	0.434	0.16539	.	0.342605	0.25575	N	0.029735	T	0.64227	0.2579	M	0.69823	2.125	0.09310	N	1	D;D	0.76494	0.999;0.999	D;D	0.71870	0.975;0.943	T	0.54794	-0.8240	10	0.45353	T	0.12	.	8.3706	0.32412	0.4403:0.0:0.5597:0.0	.	637;637	P13611-3;P13611	.;CSPG2_HUMAN	A	637;637;589	ENSP00000265077:G637A;ENSP00000342768:G637A;ENSP00000425959:G589A	ENSP00000265077:G637A	G	+	2	0	VCAN	82851791	0.004000	0.15560	0.060000	0.19600	0.658000	0.38924	0.106000	0.15354	-0.011000	0.14247	0.655000	0.94253	GGC		VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
APC	324	broad.mit.edu	37	5	112175351	112175351	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr5:112175351delT	ENST00000457016.1	+	16	4440	c.4060delT	c.(4060-4062)tttfs	p.F1354fs	APC_ENST00000508376.2_Frame_Shift_Del_p.F1354fs|APC_ENST00000257430.4_Frame_Shift_Del_p.F1354fs|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	1354	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.S1355fs*18(3)|p.S1355fs*60(2)|p.E1353fs*19(1)|p.?(1)|p.K1192fs*3(1)|p.S1355fs*19(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AGCTGTTGAATTTTCTTCAGG	0.483		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.F1336fs	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,NS,Substitution - Missense,-2 	.	9	Deletion - Frameshift(8)|Unknown(1)	large_intestine(7)|soft_tissue(1)|skin(1)	c.4006delT	5						.						63.0	66.0	65.0					5																	112175351		2202	4300	6502	112203250	SO:0001589	frameshift_variant	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4060delT	5.37:g.112175351delT	ENSP00000413133:p.Phe1354fs	Somatic		Capture	Illumina HiSeq	Phase_I	112203250	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Del	DEL	ENST00000457016.1	37	CCDS4107.1																																																																																				APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
ZFP2	80108	broad.mit.edu	37	5	178358535	178358535	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr5:178358535A>G	ENST00000361362.2	+	5	751	c.221A>G	c.(220-222)cAt>cGt	p.H74R	ZFP2_ENST00000523286.1_Missense_Mutation_p.H74R|ZFP2_ENST00000520301.1_Missense_Mutation_p.H74R|ZFP2_ENST00000503510.2_Missense_Mutation_p.H74R	NM_030613.2	NP_085116.2	Q6ZN57	ZFP2_HUMAN	ZFP2 zinc finger protein	74					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H74R(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	20	all_cancers(89;0.000639)|all_epithelial(37;0.000109)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.00655)|GBM - Glioblastoma multiforme(465;0.0302)|OV - Ovarian serous cystadenocarcinoma(192;0.0615)|Epithelial(171;0.111)		AAAAGGCCCCATAACTGTAAT	0.363																																					p.H74R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A221G	5						.						70.0	71.0	70.0					5																	178358535		2203	4300	6503	178291141	SO:0001583	missense	80108	exon5			AK025281	CCDS4440.1	5q35.3	2013-01-08	2012-11-27		ENSG00000198939	ENSG00000198939		"""Zinc fingers, C2H2-type"""	26138	protein-coding gene	gene with protein product			"""zinc finger protein 2 homolog (mouse)"""				Standard	NM_030613		Approved	FLJ21628, ZNF751	uc003mjn.1	Q6ZN57	OTTHUMG00000130885	ENST00000361362.2:c.221A>G	5.37:g.178358535A>G	ENSP00000354453:p.His74Arg	Somatic		Capture	Illumina HiSeq	Phase_I	178291141	NM_030613	A5PLN5|B7ZM23|Q9H6Z6	Missense_Mutation	SNP	ENST00000361362.2	37	CCDS4440.1	.	.	.	.	.	.	.	.	.	.	a	3.077	-0.189770	0.06299	.	.	ENSG00000198939	ENST00000361362;ENST00000520301;ENST00000523286;ENST00000503510	T;T;T;T	0.07216	3.21;3.21;3.21;3.21	4.61	-2.25	0.06888	.	1.512070	0.04717	N	0.418578	T	0.08358	0.0208	L	0.55103	1.725	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46470	-0.9189	10	0.87932	D	0	0.6611	1.2337	0.01949	0.2583:0.3033:0.2907:0.1477	.	74	Q6ZN57	ZFP2_HUMAN	R	74	ENSP00000354453:H74R;ENSP00000430980:H74R;ENSP00000430531:H74R;ENSP00000438114:H74R	ENSP00000354453:H74R	H	+	2	0	ZFP2	178291141	0.000000	0.05858	0.000000	0.03702	0.239000	0.25481	-0.058000	0.11750	-0.006000	0.14370	0.482000	0.46254	CAT		ZFP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253470.2	NM_030613	
SYCP2L	221711	broad.mit.edu	37	6	10912909	10912909	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr6:10912909A>G	ENST00000283141.6	+	13	1218	c.922A>G	c.(922-924)Aga>Gga	p.R308G	SYCP2L_ENST00000543878.1_Missense_Mutation_p.R149G|RP11-637O19.3_ENST00000480294.1_3'UTR	NM_001040274.2	NP_001035364.2	Q5T4T6	SYC2L_HUMAN	synaptonemal complex protein 2-like	308						nucleus (GO:0005634)		p.R308G(1)		breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	36	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	Epithelial(50;0.239)			CTTACAGATGAGAAAACCAGC	0.343																																					p.R308G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A922G	6						.						78.0	71.0	73.0					6																	10912909		1833	4077	5910	11020895	SO:0001583	missense	221711	exon13			AK128130	CCDS43423.1	6p24.2	2008-11-06	2007-07-02	2007-07-02	ENSG00000153157	ENSG00000153157			21537	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 177"""	C6orf177			Standard	NM_001040274		Approved	dJ62D2.1, NO145	uc003mzo.3	Q5T4T6	OTTHUMG00000014250	ENST00000283141.6:c.922A>G	6.37:g.10912909A>G	ENSP00000283141:p.Arg308Gly	Somatic		Capture	Illumina HiSeq	Phase_I	11020895	NM_001040274	A6NDS5|Q08GK5|Q6ZRM2|Q96EJ2	Missense_Mutation	SNP	ENST00000283141.6	37	CCDS43423.1	.	.	.	.	.	.	.	.	.	.	A	13.36	2.213958	0.39102	.	.	ENSG00000153157	ENST00000543878;ENST00000283141	T;T	0.46063	0.88;2.17	5.42	5.42	0.78866	.	0.531809	0.20194	N	0.097243	T	0.35364	0.0929	L	0.57536	1.79	0.80722	D	1	P;P	0.46142	0.873;0.763	P;P	0.44990	0.466;0.463	T	0.31833	-0.9929	10	0.59425	D	0.04	-1.8442	15.1362	0.72569	1.0:0.0:0.0:0.0	.	149;308	B4DFB8;Q5T4T6	.;SYC2L_HUMAN	G	149;308	ENSP00000440676:R149G;ENSP00000283141:R308G	ENSP00000283141:R308G	R	+	1	2	SYCP2L	11020895	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.979000	0.49313	2.055000	0.61198	0.533000	0.62120	AGA		SYCP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039845.3	NM_194299	
PKIB	5570	broad.mit.edu	37	6	123038957	123038957	+	Silent	SNP	A	A	C			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr6:123038957A>C	ENST00000368448.1	+	5	645	c.18A>C	c.(16-18)tcA>tcC	p.S6S	PKIB_ENST00000354275.2_Silent_p.S6S|PKIB_ENST00000368452.2_Silent_p.S6S|PKIB_ENST00000368446.1_Silent_p.S15S|PKIB_ENST00000258014.3_Silent_p.S13S|PKIB_ENST00000392490.1_Silent_p.S6S|PKIB_ENST00000392491.2_Silent_p.S6S			Q9C010	IPKB_HUMAN	protein kinase (cAMP-dependent, catalytic) inhibitor beta	6							cAMP-dependent protein kinase inhibitor activity (GO:0004862)	p.S6S(1)		large_intestine(3)|lung(1)	4				GBM - Glioblastoma multiforme(226;0.164)		CAGATTCATCAAAAATGACTG	0.463																																					p.S6S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A18C	6						.						119.0	115.0	116.0					6																	123038957		2203	4300	6503	123080656	SO:0001819	synonymous_variant	5570	exon3				CCDS5126.1, CCDS59033.1	6q21-q22.1	2008-05-27			ENSG00000135549	ENSG00000135549			9018	protein-coding gene	gene with protein product		606914		PRKACN2		10880337	Standard	NM_181795		Approved		uc003pzc.4	Q9C010	OTTHUMG00000015488	ENST00000368448.1:c.18A>C	6.37:g.123038957A>C		Somatic		Capture	Illumina HiSeq	Phase_I	123080656	NM_032471	B2RCK2|Q567T9|Q5T0Z7	Silent	SNP	ENST00000368448.1	37	CCDS5126.1																																																																																				PKIB-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042035.1		
SYNE1	23345	broad.mit.edu	37	6	152640060	152640060	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr6:152640060T>C	ENST00000367255.5	-	85	16928	c.16327A>G	c.(16327-16329)Act>Gct	p.T5443A	SYNE1_ENST00000265368.4_Missense_Mutation_p.T5443A|SYNE1_ENST00000423061.1_Missense_Mutation_p.T5372A|SYNE1_ENST00000448038.1_Missense_Mutation_p.T5372A|SYNE1_ENST00000356820.4_5'Flank|SYNE1_ENST00000341594.5_Missense_Mutation_p.T5116A	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5443					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.T5443A(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GTTAGAATAGTTGTGAGGTCT	0.373										HNSCC(10;0.0054)																											p.T5372A												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A16114G	6						.						116.0	108.0	111.0					6																	152640060		2203	4300	6503	152681753	SO:0001583	missense	23345	exon84			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.16327A>G	6.37:g.152640060T>C	ENSP00000356224:p.Thr5443Ala	Somatic		Capture	Illumina HiSeq	Phase_I	152681753	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	T	9.463	1.093670	0.20471	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.51325	0.8;0.8;0.71;0.8;0.95	5.23	4.07	0.47477	.	0.106709	0.41605	D	0.000846	T	0.12092	0.0294	L	0.35487	1.065	0.45415	D	0.998392	B;B;B;B	0.06786	0.001;0.0;0.0;0.001	B;B;B;B	0.09377	0.004;0.0;0.0;0.002	T	0.15435	-1.0437	10	0.08837	T	0.75	.	4.2887	0.10867	0.1396:0.2253:0.0:0.6352	.	5443;5443;5443;5372	Q8NF91-7;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	A	5443;5372;5443;5372;5116	ENSP00000356224:T5443A;ENSP00000396024:T5372A;ENSP00000265368:T5443A;ENSP00000390975:T5372A;ENSP00000341887:T5116A	ENSP00000265368:T5443A	T	-	1	0	SYNE1	152681753	0.056000	0.20664	0.247000	0.24249	0.990000	0.78478	0.451000	0.21779	0.822000	0.34565	0.482000	0.46254	ACT		SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
TXNDC5	81567	broad.mit.edu	37	6	7904929	7904929	+	Silent	SNP	C	C	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr6:7904929C>A	ENST00000379757.4	-	2	328	c.291G>T	c.(289-291)ccG>ccT	p.P97P	BLOC1S5-TXNDC5_ENST00000439343.2_Missense_Mutation_p.D134Y|TXNDC5_ENST00000473453.1_5'UTR|TXNDC5_ENST00000539054.1_Silent_p.P25P	NM_030810.3	NP_110437.2	Q8NBS9	TXND5_HUMAN	thioredoxin domain containing 5 (endoplasmic reticulum)	97	Thioredoxin 1. {ECO:0000255|PROSITE- ProRule:PRU00691}.				apoptotic cell clearance (GO:0043277)|cell redox homeostasis (GO:0045454)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	protein disulfide isomerase activity (GO:0003756)	p.P97P(2)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|skin(2)	22	Ovarian(93;0.0398)					CATTCCAAGTCGGCTGCAGCC	0.557																																					p.P97P	Ovarian(119;1430 1625 3928 26125 34589)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G291T	6						.						120.0	92.0	101.0					6																	7904929		2203	4300	6503	7849928	SO:0001819	synonymous_variant	81567	exon2			AK025006	CCDS4505.1, CCDS47369.1	6p24.3	2011-10-19	2009-02-23		ENSG00000239264	ENSG00000239264		"""Protein disulfide isomerases"""	21073	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 15"""		"""thioredoxin domain containing 5"""				Standard	NM_001145549		Approved	MGC3178, FLJ21353, FLJ90810, EndoPDI, Hcc-2, ERp46, PDIA15	uc003mxv.3	Q8NBS9	OTTHUMG00000014216	ENST00000379757.4:c.291G>T	6.37:g.7904929C>A		Somatic		Capture	Illumina HiSeq	Phase_I	7849928	NM_030810	B2RDM2|Q5TCQ0|Q8ND33|Q8TCT2|Q9BVH9	Silent	SNP	ENST00000379757.4	37	CCDS4505.1																																																																																				TXNDC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039792.1	NM_030810	
TNXB	7148	broad.mit.edu	37	6	32024494	32024494	+	Missense_Mutation	SNP	G	G	A	rs201037895		TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr6:32024494G>A	ENST00000375244.3	-	23	8213	c.8012C>T	c.(8011-8013)gCg>gTg	p.A2671V	TNXB_ENST00000375247.2_Missense_Mutation_p.A2671V			P22105	TENX_HUMAN	tenascin XB	2731	Fibronectin type-III 18. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)	p.A2758V(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						CACCCGCACCGCCTTGGGCTG	0.637																																					p.A2671V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C8012T	6						.	G	VAL/ALA	1,2419		0,1,1209	42.0	45.0	44.0		8012	-4.5	0.4	6		44	6,5006		0,6,2500	no	missense	TNXB	NM_019105.6	64	0,7,3709	AA,AG,GG		0.1197,0.0413,0.0942	benign	2671/4243	32024494	7,7425	1210	2506	3716	32132472	SO:0001583	missense	7148	exon23			X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.8012C>T	6.37:g.32024494G>A	ENSP00000364393:p.Ala2671Val	Somatic		Capture	Illumina HiSeq	Phase_I	32132472	NM_019105	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000375244.3	37		.	.	.	.	.	.	.	.	.	.	G	0.024	-1.388736	0.01185	4.13E-4	0.001197	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.56611	0.45;0.45	4.37	-4.53	0.03462	.	1.278090	0.05546	N	0.566714	T	0.09949	0.0244	N	0.04705	-0.18	0.09310	N	1	B	0.14805	0.011	B	0.11329	0.006	T	0.19289	-1.0310	10	0.11485	T	0.65	.	11.8751	0.52541	0.6004:0.0:0.3996:0.0	.	2671	P22105-3	.	V	2671	ENSP00000364393:A2671V;ENSP00000364396:A2671V	ENSP00000364393:A2671V	A	-	2	0	TNXB	32132472	0.000000	0.05858	0.354000	0.25760	0.271000	0.26615	-1.592000	0.02098	-0.952000	0.03649	-0.683000	0.03753	GCG		TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105	
PGK2	5232	broad.mit.edu	37	6	49754502	49754502	+	Silent	SNP	T	T	C	rs557577912		TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr6:49754502T>C	ENST00000304801.3	-	1	551	c.399A>G	c.(397-399)caA>caG	p.Q133Q		NM_138733.4	NP_620061.2	P07205	PGK2_HUMAN	phosphoglycerate kinase 2	133					glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)	p.Q133Q(1)		autonomic_ganglia(1)|endometrium(3)|large_intestine(12)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	47	Lung NSC(77;0.0402)					CAGAGGGATCTTGGCCCTTCC	0.502																																					p.Q133Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A399G	6						.						110.0	107.0	108.0					6																	49754502		2203	4300	6503	49862461	SO:0001819	synonymous_variant	5232	exon1			K03019	CCDS4930.1	6p12.3	2012-09-20		2002-04-19	ENSG00000170950	ENSG00000170950			8898	protein-coding gene	gene with protein product		172270				3839763, 3453121	Standard	NM_138733		Approved	PGKPS, PGK-2	uc003ozu.3	P07205	OTTHUMG00000014824	ENST00000304801.3:c.399A>G	6.37:g.49754502T>C		Somatic		Capture	Illumina HiSeq	Phase_I	49862461	NM_138733	B2R6Y8|Q9H107	Silent	SNP	ENST00000304801.3	37	CCDS4930.1																																																																																				PGK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040872.1		
BMP5	653	broad.mit.edu	37	6	55625272	55625272	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr6:55625272G>A	ENST00000370830.3	-	5	1785	c.1087C>T	c.(1087-1089)Cgg>Tgg	p.R363W	BMP5_ENST00000446683.2_Missense_Mutation_p.R363W	NM_021073.2	NP_066551.1	P22003	BMP5_HUMAN	bone morphogenetic protein 5	363					cartilage development (GO:0051216)|growth (GO:0040007)|male genitalia development (GO:0030539)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of steroid biosynthetic process (GO:0010894)|ossification (GO:0001503)|pattern specification process (GO:0007389)|positive regulation of dendrite development (GO:1900006)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system development (GO:0001501)|type B pancreatic cell development (GO:0003323)	extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)	p.R363W(1)		cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	45	Lung NSC(77;0.0462)		LUSC - Lung squamous cell carcinoma(124;0.181)			CCCAGATCCCGGAAGCTCACA	0.358																																					p.R363W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1087T	6						.						122.0	113.0	116.0					6																	55625272		2203	4300	6503	55733231	SO:0001583	missense	653	exon5				CCDS4958.1	6p12.1	2014-01-30			ENSG00000112175	ENSG00000112175		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1072	protein-coding gene	gene with protein product		112265				1427904, 11580864	Standard	NM_021073		Approved		uc003pcq.3	P22003	OTTHUMG00000014903	ENST00000370830.3:c.1087C>T	6.37:g.55625272G>A	ENSP00000359866:p.Arg363Trp	Somatic		Capture	Illumina HiSeq	Phase_I	55733231	NM_021073	B4E0Y4|Q9H547|Q9NTM5	Missense_Mutation	SNP	ENST00000370830.3	37	CCDS4958.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.657104	0.88154	.	.	ENSG00000112175	ENST00000370830;ENST00000446683	D;D	0.89939	-2.59;-2.59	5.73	5.73	0.89815	Transforming growth factor-beta, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.95859	0.8652	M	0.92169	3.28	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.976;0.991	D	0.96183	0.9132	10	0.87932	D	0	.	19.9059	0.97007	0.0:0.0:1.0:0.0	.	363;363	B4E0Y4;P22003	.;BMP5_HUMAN	W	363	ENSP00000359866:R363W;ENSP00000391818:R363W	ENSP00000359866:R363W	R	-	1	2	BMP5	55733231	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.944000	0.87722	2.693000	0.91896	0.655000	0.94253	CGG		BMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041000.1		
SYNCRIP	10492	broad.mit.edu	37	6	86350247	86350247	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr6:86350247T>G	ENST00000369622.3	-	3	684	c.184A>C	c.(184-186)Att>Ctt	p.I62L	SYNCRIP_ENST00000355238.6_Missense_Mutation_p.I62L	NM_001159675.1|NM_006372.4	NP_001153147.1|NP_006363.4	O60506	HNRPQ_HUMAN	synaptotagmin binding, cytoplasmic RNA interacting protein	62					cellular response to interferon-gamma (GO:0071346)|CRD-mediated mRNA stabilization (GO:0070934)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of translation (GO:0017148)|osteoblast differentiation (GO:0001649)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|CRD-mediated mRNA stability complex (GO:0070937)|endoplasmic reticulum (GO:0005783)|GAIT complex (GO:0097452)|histone pre-mRNA 3'end processing complex (GO:0071204)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	33		all_cancers(76;0.000137)|Acute lymphoblastic leukemia(125;3.66e-08)|Prostate(29;8.2e-07)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0297)		BRCA - Breast invasive adenocarcinoma(108;0.0389)		AAAGCTTCAATAGCTCTTTCA	0.308																																					p.I62L												.	.	0			c.A184C	6						.						66.0	65.0	66.0					6																	86350247		2203	4297	6500	86406966	SO:0001583	missense	10492	exon3			AF037448	CCDS5005.1, CCDS55041.1, CCDS75491.1	6q14-q15	2013-05-23			ENSG00000135316	ENSG00000135316		"""RNA binding motif (RRM) containing"""	16918	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein Q"""					9847309, 11352648	Standard	NM_006372		Approved	NSAP1, GRY-RBP, dJ3J17.2, HNRPQ1, hnRNP-Q, HNRNPQ	uc003pla.2	O60506	OTTHUMG00000015141	ENST00000369622.3:c.184A>C	6.37:g.86350247T>G	ENSP00000358635:p.Ile62Leu	None		Capture	Illumina HiSeq	Phase_I	86406966	NM_001159677	E1P501|E1P502|Q53H05|Q5TCG2|Q5TCG3|Q8IW78|Q8N599|Q96LC1|Q96LC2|Q9Y583	Missense_Mutation	SNP	ENST00000369622.3	37	CCDS5005.1	.	.	.	.	.	.	.	.	.	.	T	11.06	1.528407	0.27299	.	.	ENSG00000135316	ENST00000355238;ENST00000369622;ENST00000444272	T;T	0.24538	1.86;1.85	5.07	5.07	0.68467	.	0.046491	0.85682	D	0.000000	T	0.06690	0.0171	N	0.25890	0.77	0.80722	D	1	B;B;B;B;B	0.12630	0.004;0.006;0.001;0.002;0.004	B;B;B;B;B	0.17979	0.009;0.02;0.012;0.008;0.009	T	0.09335	-1.0679	10	0.02654	T	1	.	14.8468	0.70267	0.0:0.0:0.0:1.0	.	62;62;62;62;62	O60506;O60506-2;O60506-4;O60506-3;B2R8Z8	HNRPQ_HUMAN;.;.;.;.	L	62	ENSP00000347380:I62L;ENSP00000358635:I62L	ENSP00000347380:I62L	I	-	1	0	SYNCRIP	86406966	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.628000	0.83189	1.888000	0.54679	0.533000	0.62120	ATT		SYNCRIP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041396.1	NM_006372	
SYNE1	23345	broad.mit.edu	37	6	152831385	152831385	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr6:152831385T>A	ENST00000367255.5	-	8	1125	c.524A>T	c.(523-525)aAg>aTg	p.K175M	SYNE1_ENST00000265368.4_Missense_Mutation_p.K175M|SYNE1_ENST00000423061.1_Missense_Mutation_p.K182M|SYNE1_ENST00000448038.1_Missense_Mutation_p.K182M|SYNE1_ENST00000367253.4_Missense_Mutation_p.K175M|SYNE1_ENST00000466159.2_Missense_Mutation_p.K175M|SYNE1_ENST00000367248.3_Missense_Mutation_p.K182M|SYNE1_ENST00000413186.2_Missense_Mutation_p.K175M|SYNE1_ENST00000341594.5_Missense_Mutation_p.K175M	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	175	Actin-binding.				cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.K175M(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCCTTGGATCTTGGTGGTCAC	0.468										HNSCC(10;0.0054)																											p.K182M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A545T	6						.						209.0	191.0	197.0					6																	152831385		2203	4300	6503	152873078	SO:0001583	missense	23345	exon8			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.524A>T	6.37:g.152831385T>A	ENSP00000356224:p.Lys175Met	Somatic		Capture	Illumina HiSeq	Phase_I	152873078	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	T	20.7	4.037324	0.75617	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253;ENST00000367248;ENST00000413186;ENST00000466159;ENST00000537750	D;D;D;D;D;D;D;D;D;D	0.95690	-3.78;-3.78;-3.78;-3.78;-3.78;-3.78;-3.78;-3.78;-3.78;-3.78	5.66	4.5	0.54988	Calponin homology domain (1);	0.000000	0.64402	D	0.000005	D	0.96436	0.8837	M	0.74467	2.265	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.999;0.989;1.0	D;D;D;P;D	0.78314	0.991;0.979;0.957;0.815;0.991	D	0.96541	0.9400	10	0.72032	D	0.01	.	11.4033	0.49883	0.0:0.0706:0.0:0.9294	.	175;175;175;175;182	B3W695;Q8NF91;F5H4Q0;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.	M	175;182;175;182;175;175;182;175;175;175	ENSP00000356224:K175M;ENSP00000396024:K182M;ENSP00000265368:K175M;ENSP00000390975:K182M;ENSP00000341887:K175M;ENSP00000356222:K175M;ENSP00000356217:K182M;ENSP00000414510:K175M;ENSP00000446021:K175M;ENSP00000441264:K175M	ENSP00000265368:K175M	K	-	2	0	SYNE1	152873078	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.822000	0.55708	0.990000	0.38787	0.519000	0.50382	AAG		SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
OR2A12	346525	broad.mit.edu	37	7	143792500	143792500	+	Silent	SNP	T	T	G	rs368735311	byFrequency	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr7:143792500T>G	ENST00000408949.2	+	1	360	c.300T>G	c.(298-300)acT>acG	p.T100T		NM_001004135.1	NP_001004135.1	Q8NGT7	O2A12_HUMAN	olfactory receptor, family 2, subfamily A, member 12	100						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T100T(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)	25	Melanoma(164;0.0783)					TACTTCAGACTTTTTTGTATT	0.428																																					p.T100T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T300G	7						.						121.0	111.0	114.0					7																	143792500		1977	4182	6159	143423433	SO:0001819	synonymous_variant	346525	exon1				CCDS43670.1	7q35	2013-09-20	2002-11-13	2002-11-13	ENSG00000221858	ENSG00000221858		"""GPCR / Class A : Olfactory receptors"""	15082	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily A, member 12 pseudogene"""	OR2A12P			Standard	NM_001004135		Approved		uc011kty.2	Q8NGT7	OTTHUMG00000157996	ENST00000408949.2:c.300T>G	7.37:g.143792500T>G		Somatic		Capture	Illumina HiSeq	Phase_I	143423433	NM_001004135	Q6IF43	Silent	SNP	ENST00000408949.2	37	CCDS43670.1																																																																																				OR2A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349969.1		
STK31	56164	broad.mit.edu	37	7	23808721	23808721	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr7:23808721G>C	ENST00000355870.3	+	12	1643	c.1524G>C	c.(1522-1524)gaG>gaC	p.E508D	STK31_ENST00000433467.2_Missense_Mutation_p.E508D|STK31_ENST00000405627.3_3'UTR|STK31_ENST00000354639.3_Missense_Mutation_p.E485D|STK31_ENST00000428484.1_Missense_Mutation_p.E485D	NM_031414.4	NP_113602.2	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31	508						acrosomal vesicle (GO:0001669)	ATP binding (GO:0005524)|hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|protein serine/threonine kinase activity (GO:0004674)	p.E508D(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(31)|ovary(2)|prostate(1)|skin(7)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						AAAGAGAGGAGTTCACCAGTG	0.403																																					p.E485D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1455C	7						.						96.0	99.0	98.0					7																	23808721		2202	4299	6501	23775246	SO:0001583	missense	56164	exon12			AF285599	CCDS5386.1, CCDS43556.1, CCDS59049.1	7p15.3	2014-04-23			ENSG00000196335	ENSG00000196335		"""Tudor domain containing"""	11407	protein-coding gene	gene with protein product		605790				11279525	Standard	NM_031414		Approved	TDRD8, SgK396	uc003sws.5	Q9BXU1	OTTHUMG00000023053	ENST00000355870.3:c.1524G>C	7.37:g.23808721G>C	ENSP00000348132:p.Glu508Asp	Somatic		Capture	Illumina HiSeq	Phase_I	23775246	NM_001122833	B4DZ06|B7WPP5|C9J4F9|Q6PCD3|Q9BXH8	Missense_Mutation	SNP	ENST00000355870.3	37	CCDS5386.1	.	.	.	.	.	.	.	.	.	.	G	17.42	3.384055	0.61845	.	.	ENSG00000196335	ENST00000355870;ENST00000433467;ENST00000354639;ENST00000428484	T;T;T;T	0.72051	-0.62;1.12;-0.61;-0.61	5.3	-0.348	0.12613	.	0.180330	0.45867	D	0.000325	T	0.65037	0.2653	M	0.64997	1.995	0.31055	N	0.714754	P;P	0.49090	0.919;0.919	P;P	0.44447	0.45;0.45	T	0.67023	-0.5775	10	0.44086	T	0.13	-4.8816	9.3554	0.38164	0.5567:0.0:0.4433:0.0	.	508;508	B4DZ06;Q9BXU1	.;STK31_HUMAN	D	508;508;485;485	ENSP00000348132:E508D;ENSP00000411852:E508D;ENSP00000346660:E485D;ENSP00000406146:E485D	ENSP00000346660:E485D	E	+	3	2	STK31	23775246	0.987000	0.35691	0.979000	0.43373	0.834000	0.47266	0.050000	0.14120	0.004000	0.14682	0.655000	0.94253	GAG		STK31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214036.2	NM_031414	
PKD1L1	168507	broad.mit.edu	37	7	47969094	47969094	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr7:47969094C>T	ENST00000289672.2	-	7	817	c.767G>A	c.(766-768)cGc>cAc	p.R256H		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	256					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.R256H(1)	BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						GCTGGGGGTGCGAGGAATGCC	0.582																																					p.R256H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G767A	7						.						54.0	57.0	56.0					7																	47969094		2203	4300	6503	47935619	SO:0001583	missense	168507	exon7			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.767G>A	7.37:g.47969094C>T	ENSP00000289672:p.Arg256His	Somatic		Capture	Illumina HiSeq	Phase_I	47935619	NM_138295	Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	37	CCDS34633.1	.	.	.	.	.	.	.	.	.	.	C	2.620	-0.288889	0.05605	.	.	ENSG00000158683	ENST00000289672	T	0.27402	1.67	3.73	-7.45	0.01374	.	8.806170	0.00397	N	0.000041	T	0.13286	0.0322	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16394	-1.0404	10	0.14656	T	0.56	-0.0011	7.5076	0.27553	0.123:0.5038:0.0:0.3732	.	256	Q8TDX9	PK1L1_HUMAN	H	256	ENSP00000289672:R256H	ENSP00000289672:R256H	R	-	2	0	PKD1L1	47935619	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.036000	0.01421	-1.871000	0.01138	-2.767000	0.00120	CGC		PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295	
ABCA13	154664	broad.mit.edu	37	7	48428740	48428740	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr7:48428740A>C	ENST00000435803.1	+	37	11601	c.11577A>C	c.(11575-11577)caA>caC	p.Q3859H		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3859	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.Q3859H(1)|p.Q3804H(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						CTGTGGTCCAAGACCTCAGCC	0.547																																					p.K3805T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A11414C	7						.						66.0	68.0	67.0					7																	48428740		1924	4147	6071	48399286	SO:0001583	missense	154664	exon35			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.11577A>C	7.37:g.48428740A>C	ENSP00000411096:p.Gln3859His	Somatic		Capture	Illumina HiSeq	Phase_I	48399286	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	A	14.12	2.440487	0.43326	.	.	ENSG00000179869	ENST00000435803	D	0.93366	-3.21	4.59	-7.48	0.01360	ABC transporter-like (1);	1.137970	0.06901	N	0.805884	D	0.89336	0.6686	N	0.17631	0.505	0.20638	N	0.999877	P;P	0.49783	0.928;0.883	P;B	0.50440	0.641;0.438	D	0.85360	0.1107	10	0.66056	D	0.02	.	12.7259	0.57170	0.4171:0.0:0.5829:0.0	.	1561;3859	Q86UQ4-3;Q86UQ4	.;ABCAD_HUMAN	H	3859	ENSP00000411096:Q3859H	ENSP00000411096:Q3859H	Q	+	3	2	ABCA13	48399286	0.035000	0.19736	0.001000	0.08648	0.569000	0.35902	-0.514000	0.06298	-1.735000	0.01353	-0.290000	0.09829	CAA		ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
MAGI2	9863	broad.mit.edu	37	7	78636484	78636484	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr7:78636484A>C	ENST00000354212.4	-	2	593	c.340T>G	c.(340-342)Tta>Gta	p.L114V	MAGI2_ENST00000522391.1_Missense_Mutation_p.L114V|MAGI2_ENST00000419488.1_Missense_Mutation_p.L114V|MAGI2-AS2_ENST00000411616.1_RNA	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	114	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)	p.L114V(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				TGAAATCGTAAGTTGAGGTAG	0.388																																					p.L114V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T340G	7						.						147.0	126.0	133.0					7																	78636484		2203	4300	6503	78474420	SO:0001583	missense	9863	exon2			AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.340T>G	7.37:g.78636484A>C	ENSP00000346151:p.Leu114Val	Somatic		Capture	Illumina HiSeq	Phase_I	78474420	NM_012301	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	ENST00000354212.4	37	CCDS5594.1	.	.	.	.	.	.	.	.	.	.	A	20.5	3.994850	0.74703	.	.	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391	T;T;T	0.11277	2.89;2.89;2.79	5.29	4.1	0.47936	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (1);	.	.	.	.	T	0.23492	0.0568	L	0.52573	1.65	0.80722	D	1	D;D	0.89917	1.0;0.996	D;P	0.91635	0.999;0.82	T	0.00647	-1.1628	9	0.35671	T	0.21	.	9.4432	0.38681	0.8477:0.0:0.1523:0.0	.	114;114	Q86UL8-2;Q86UL8	.;MAGI2_HUMAN	V	114	ENSP00000405766:L114V;ENSP00000346151:L114V;ENSP00000428389:L114V	ENSP00000346151:L114V	L	-	1	2	MAGI2	78474420	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.746000	0.55127	0.802000	0.34089	0.519000	0.50382	TTA		MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	NM_012301	
ZBED6CL	113763	broad.mit.edu	37	7	150027504	150027504	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr7:150027504G>A	ENST00000343855.4	+	1	567	c.11G>A	c.(10-12)cGc>cAc	p.R4H	LRRC61_ENST00000323078.7_Intron|LRRC61_ENST00000359623.4_Intron|LRRC61_ENST00000493307.1_Intron	NM_138434.2	NP_612443.1	Q96FA7	ZB6CL_HUMAN	ZBED6 C-terminal like	4								p.R4H(1)									ATGGTGGTCCGCGAGGCGAGT	0.632																																					p.R4H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G11A	7						.						59.0	64.0	63.0					7																	150027504		2202	4299	6501	149658437	SO:0001583	missense	113763	exon1			BC011406	CCDS5900.1	7q35	2013-05-03	2013-05-03	2013-05-03	ENSG00000188707	ENSG00000188707			21720	protein-coding gene	gene with protein product		615252	"""chromosome 7 open reading frame 29"""	C7orf29		23533661	Standard	NM_138434		Approved			Q96FA7	OTTHUMG00000158328	ENST00000343855.4:c.11G>A	7.37:g.150027504G>A	ENSP00000343242:p.Arg4His	Somatic		Capture	Illumina HiSeq	Phase_I	149658437	NM_138434		Missense_Mutation	SNP	ENST00000343855.4	37	CCDS5900.1	.	.	.	.	.	.	.	.	.	.	G	6.847	0.525472	0.13066	.	.	ENSG00000188707	ENST00000343855	.	.	.	4.25	-8.5	0.00927	.	1.184760	0.07021	U	0.826805	T	0.24084	0.0583	L	0.27053	0.805	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.33394	-0.9870	9	0.66056	D	0.02	.	6.4369	0.21829	0.5239:0.0:0.2812:0.195	.	4	Q96FA7	CG029_HUMAN	H	4	.	ENSP00000343242:R4H	R	+	2	0	C7orf29	149658437	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.695000	0.01913	-2.398000	0.00580	-1.337000	0.01257	CGC		ZBED6CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350702.1	NM_138434	
EXT1	2131	broad.mit.edu	37	8	119122744	119122744	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr8:119122744A>G	ENST00000378204.2	-	1	1348	c.542T>C	c.(541-543)cTc>cCc	p.L181P		NM_000127.2	NP_000118.2	Q16394	EXT1_HUMAN	exostosin glycosyltransferase 1	181					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular polysaccharide biosynthetic process (GO:0033692)|embryonic skeletal joint development (GO:0072498)|endoderm development (GO:0007492)|gastrulation (GO:0007369)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|mesoderm development (GO:0007498)|olfactory bulb development (GO:0021772)|ossification (GO:0001503)|protein glycosylation (GO:0006486)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)|glucuronosyltransferase activity (GO:0015020)|heparan sulfate N-acetylglucosaminyltransferase activity (GO:0042328)|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity (GO:0050509)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|transferase activity, transferring glycosyl groups (GO:0016757)	p.L181P(1)		breast(1)|endometrium(7)|kidney(1)|large_intestine(12)|lung(10)|ovary(3)|prostate(1)|stomach(1)|urinary_tract(2)	38	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)			CCACAAGTGGAGACTCTGCAC	0.483			"""Mis, N, F, S"""			"""exostoses, osteosarcoma"""			Langer-Giedion syndrome;Hereditary Multiple Exostoses																												p.L181P		yes	Rec		Multiple Exostoses Type 1	8	8q24.11-q24.13	2131	multiple exostoses type 1 gene		M	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T542C	8						.						123.0	140.0	134.0					8																	119122744		2203	4300	6503	119191925	SO:0001583	missense	2131	exon1	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II;HME, Hereditary Exostoses, Multiple Osteochondromatosis, Multiple Cartilaginous Exostoses	S79639	CCDS6324.1	8q24.11	2014-09-17	2013-03-01		ENSG00000182197	ENSG00000182197	2.4.1.224, 2.4.1.225	"""Exostosin glycosyltransferase family"""	3512	protein-coding gene	gene with protein product	"""Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase"""	608177	"""Langer-Giedion syndrome chromosome region"", ""exostoses (multiple) 1"", ""exostosin 1"""	LGCR, LGS			Standard	NM_000127		Approved	ttv	uc003yok.1	Q16394	OTTHUMG00000059718	ENST00000378204.2:c.542T>C	8.37:g.119122744A>G	ENSP00000367446:p.Leu181Pro	Somatic		Capture	Illumina HiSeq	Phase_I	119191925	NM_000127	B2R7V2|Q9BVI9	Missense_Mutation	SNP	ENST00000378204.2	37	CCDS6324.1	.	.	.	.	.	.	.	.	.	.	A	15.66	2.900494	0.52227	.	.	ENSG00000182197	ENST00000378204	D	0.97831	-4.56	5.58	5.58	0.84498	.	0.000000	0.64402	D	0.000007	D	0.99013	0.9663	M	0.93939	3.475	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.99501	1.0953	10	0.59425	D	0.04	-0.7685	15.7372	0.77853	1.0:0.0:0.0:0.0	.	181	Q16394	EXT1_HUMAN	P	181	ENSP00000367446:L181P	ENSP00000367446:L181P	L	-	2	0	EXT1	119191925	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.206000	0.95056	2.114000	0.64651	0.379000	0.24179	CTC		EXT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132768.3	NM_000127	
GSDMC	56169	broad.mit.edu	37	8	130760927	130760927	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr8:130760927T>A	ENST00000276708.4	-	14	2228	c.1347A>T	c.(1345-1347)aaA>aaT	p.K449N		NM_031415.2	NP_113603.1	Q9BYG8	GSDMC_HUMAN	gasdermin C	449						cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)		p.K449N(1)		autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|pancreas(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	26						GGAGCTCAGGTTTGAGGGTGA	0.537																																					p.K449N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1347T	8						.						83.0	83.0	83.0					8																	130760927		2203	4300	6503	130830109	SO:0001583	missense	56169	exon14			AB042405	CCDS6360.1	8q24.21	2014-05-14	2008-07-31	2008-07-31	ENSG00000147697	ENSG00000147697			7151	protein-coding gene	gene with protein product		608384	"""melanoma-derived leucine zipper, extra-nuclear factor"""	MLZE		17350798	Standard	NM_031415		Approved		uc003ysr.3	Q9BYG8	OTTHUMG00000164851	ENST00000276708.4:c.1347A>T	8.37:g.130760927T>A	ENSP00000276708:p.Lys449Asn	Somatic		Capture	Illumina HiSeq	Phase_I	130830109	NM_031415	Q5XKF3|Q6P494	Missense_Mutation	SNP	ENST00000276708.4	37	CCDS6360.1	.	.	.	.	.	.	.	.	.	.	T	13.41	2.230110	0.39399	.	.	ENSG00000147697	ENST00000276708	T	0.24151	1.87	4.87	-9.75	0.00506	.	1.754390	0.02675	N	0.108971	T	0.30386	0.0763	L	0.43923	1.385	0.09310	N	1	D	0.64830	0.994	P	0.61592	0.891	T	0.57370	-0.7823	10	0.39692	T	0.17	.	3.6663	0.08257	0.2303:0.507:0.1548:0.1078	.	449	Q9BYG8	GSDMC_HUMAN	N	449	ENSP00000276708:K449N	ENSP00000276708:K449N	K	-	3	2	GSDMC	130830109	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.712000	0.00386	-3.635000	0.00129	-1.559000	0.00887	AAA		GSDMC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380586.1		
ADCY8	114	broad.mit.edu	37	8	131921985	131921985	+	Missense_Mutation	SNP	C	C	T	rs75890340		TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr8:131921985C>T	ENST00000286355.5	-	6	3701	c.1609G>A	c.(1609-1611)Gca>Aca	p.A537T	ADCY8_ENST00000377928.3_Missense_Mutation_p.A537T	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	537					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)	p.A537T(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			AGTTTGTTTGCAATATCCACA	0.468										HNSCC(32;0.087)																											p.A537T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1609A	8						.						262.0	228.0	240.0					8																	131921985		2203	4300	6503	131991167	SO:0001583	missense	114	exon6			Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.1609G>A	8.37:g.131921985C>T	ENSP00000286355:p.Ala537Thr	Somatic		Capture	Illumina HiSeq	Phase_I	131991167	NM_001115		Missense_Mutation	SNP	ENST00000286355.5	37	CCDS6363.1	.	.	.	.	.	.	.	.	.	.	C	37	6.087006	0.97271	.	.	ENSG00000155897	ENST00000286355;ENST00000377928;ENST00000522949	D;D;D	0.94897	-3.55;-3.55;-3.55	5.93	5.93	0.95920	Adenylyl cyclase class-3/4/guanylyl cyclase, conserved site (1);Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.85682	D	0.000000	D	0.97945	0.9324	M	0.91663	3.23	0.58432	D	0.999992	D;D	0.89917	0.998;1.0	D;D	0.81914	0.995;0.986	D	0.98346	1.0541	10	0.87932	D	0	.	19.3421	0.94347	0.0:1.0:0.0:0.0	.	537;537	E7EVL1;P40145	.;ADCY8_HUMAN	T	537;537;152	ENSP00000286355:A537T;ENSP00000367161:A537T;ENSP00000428010:A152T	ENSP00000286355:A537T	A	-	1	0	ADCY8	131991167	1.000000	0.71417	0.995000	0.50966	0.998000	0.95712	7.818000	0.86416	2.826000	0.97356	0.655000	0.94253	GCA		ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1		
CSMD1	64478	broad.mit.edu	37	8	3038716	3038716	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr8:3038716G>T	ENST00000520002.1	-	38	6199	c.5644C>A	c.(5644-5646)Ctg>Atg	p.L1882M	CSMD1_ENST00000523387.1_5'UTR|CSMD1_ENST00000602557.1_Missense_Mutation_p.L1882M|CSMD1_ENST00000542608.1_Missense_Mutation_p.L1881M|CSMD1_ENST00000400186.3_Missense_Mutation_p.L1882M|CSMD1_ENST00000539096.1_Missense_Mutation_p.L1881M|CSMD1_ENST00000602723.1_Missense_Mutation_p.L1882M|CSMD1_ENST00000537824.1_Missense_Mutation_p.L1881M			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1882	CUB 11. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)		p.L1610M(1)|p.L1881M(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GTACTGTTCAGCAGTGCCGGT	0.388																																					p.A1881D												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C5642A	8						.						87.0	86.0	87.0					8																	3038716		1907	4134	6041	3026123	SO:0001583	missense	64478	exon37					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.5644C>A	8.37:g.3038716G>T	ENSP00000430733:p.Leu1882Met	Somatic		Capture	Illumina HiSeq	Phase_I	3026123	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.52|13.52	2.260785|2.260785	0.39995|0.39995	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000335551|ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	.|T;T;T;T;T	.|0.19938	.|2.11;2.11;2.11;2.11;2.11	5.12|5.12	3.29|3.29	0.37713|0.37713	.|CUB (5);	.|0.000000	.|0.56097	.|D	.|0.000034	T|T	0.40222|0.40222	0.1108|0.1108	M|M	0.72118|0.72118	2.19|2.19	0.48696|0.48696	D|D	0.999691|0.999691	.|D;D;D	.|0.89917	.|1.0;1.0;0.999	.|D;D;D	.|0.97110	.|0.998;1.0;0.999	T|T	0.20571|0.20571	-1.0271|-1.0271	5|10	.|0.66056	.|D	.|0.02	.|.	7.7952|7.7952	0.29143|0.29143	0.2784:0.0:0.7216:0.0|0.2784:0.0:0.7216:0.0	.|.	.|1882;1882;1882	.|E5RIG2;Q96PZ7;Q96PZ7-4	.|.;CSMD1_HUMAN;.	D|M	1361|1882;1882;1743;1881;1881;1881	.|ENSP00000383047:L1882M;ENSP00000430733:L1882M;ENSP00000441462:L1881M;ENSP00000446243:L1881M;ENSP00000441675:L1881M	.|ENSP00000320445:L1743M	A|L	-|-	2|1	0|2	CSMD1|CSMD1	3026123|3026123	1.000000|1.000000	0.71417|0.71417	0.874000|0.874000	0.34290|0.34290	0.206000|0.206000	0.24218|0.24218	3.598000|3.598000	0.54038|0.54038	2.373000|2.373000	0.80994|0.80994	0.655000|0.655000	0.94253|0.94253	GCT|CTG		CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
SPIDR	23514	broad.mit.edu	37	8	48309138	48309138	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr8:48309138C>G	ENST00000297423.4	+	6	1112	c.728C>G	c.(727-729)gCt>gGt	p.A243G	SPIDR_ENST00000541342.1_Missense_Mutation_p.A173G|SPIDR_ENST00000518074.1_Missense_Mutation_p.A183G|SPIDR_ENST00000521214.1_3'UTR	NM_001080394.2|NM_001282916.1	NP_001073863.1|NP_001269845.1	Q14159	SPIDR_HUMAN	scaffolding protein involved in DNA repair	243	Necessary for interaction with RAD51.				cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of protein complex assembly (GO:0031334)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of establishment of protein localization to chromosome (GO:0070202)	nuclear chromosome (GO:0000228)		p.A243G(1)									AAACCCACAGCTAAGTTTCCC	0.358																																					p.A243G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C728G	8						.						151.0	150.0	150.0					8																	48309138		1827	4086	5913	48471691	SO:0001583	missense	23514	exon6			AK055680	CCDS43737.1, CCDS64890.1, CCDS64891.1	8q11.21	2013-07-02	2013-07-02	2013-07-02	ENSG00000164808	ENSG00000164808			28971	protein-coding gene	gene with protein product		615384	"""KIAA0146"""	KIAA0146		8590280, 23509288	Standard	XM_005251189		Approved		uc003xqd.3	Q14159	OTTHUMG00000164176	ENST00000297423.4:c.728C>G	8.37:g.48309138C>G	ENSP00000297423:p.Ala243Gly	Somatic		Capture	Illumina HiSeq	Phase_I	48471691	NM_001080394	B4DFV2|B4E0Y6|Q96BI5	Missense_Mutation	SNP	ENST00000297423.4	37	CCDS43737.1	.	.	.	.	.	.	.	.	.	.	C	2.114	-0.403137	0.04865	.	.	ENSG00000164808	ENST00000297423;ENST00000518074;ENST00000541342	.	.	.	4.21	2.08	0.27032	.	1.441810	0.04288	N	0.344913	T	0.23926	0.0579	N	0.22421	0.69	0.09310	N	1	B;B;B;B	0.24721	0.11;0.065;0.027;0.065	B;B;B;B	0.22152	0.038;0.027;0.017;0.038	T	0.23655	-1.0182	9	0.46703	T	0.11	.	1.3286	0.02130	0.3984:0.3286:0.139:0.134	.	183;173;243;243	B4E0Y6;B4DFV2;B4DEV5;Q14159	.;.;.;K0146_HUMAN	G	243;183;173	.	ENSP00000297423:A243G	A	+	2	0	KIAA0146	48471691	0.000000	0.05858	0.000000	0.03702	0.124000	0.20399	0.094000	0.15107	0.160000	0.19432	0.650000	0.86243	GCT		SPIDR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377611.1	NM_001080394	
ZFHX4	79776	broad.mit.edu	37	8	77768427	77768427	+	Silent	SNP	C	C	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr8:77768427C>T	ENST00000521891.2	+	10	9718	c.9270C>T	c.(9268-9270)caC>caT	p.H3090H	ZFHX4_ENST00000455469.2_Silent_p.H3045H|ZFHX4_ENST00000050961.6_Silent_p.H3045H|ZFHX4_ENST00000518282.1_Silent_p.H3064H	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	3045	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.H3074H(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GTTCTCTCCACGGCATCAGCC	0.567										HNSCC(33;0.089)																											p.H3090H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C9270T	8						.						75.0	78.0	77.0					8																	77768427		2062	4215	6277	77930982	SO:0001819	synonymous_variant	79776	exon10				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.9270C>T	8.37:g.77768427C>T		Somatic		Capture	Illumina HiSeq	Phase_I	77930982	NM_024721	G3V138|Q18PS0|Q6ZN20	Silent	SNP	ENST00000521891.2	37	CCDS47878.2																																																																																				ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
ZFHX4	79776	broad.mit.edu	37	8	77776346	77776346	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr8:77776346C>T	ENST00000521891.2	+	11	10844	c.10396C>T	c.(10396-10398)Ctc>Ttc	p.L3466F	ZFHX4_ENST00000455469.2_Missense_Mutation_p.L3421F|ZFHX4_ENST00000050961.6_Missense_Mutation_p.L3417F|ZFHX4_ENST00000518282.1_Missense_Mutation_p.L3440F	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	3417	Ser-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.L3450F(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TAGCCAACACCTCCAGTCAAG	0.453										HNSCC(33;0.089)																											p.L3466F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C10396T	8						.						103.0	97.0	99.0					8																	77776346		2042	4200	6242	77938901	SO:0001583	missense	79776	exon11				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.10396C>T	8.37:g.77776346C>T	ENSP00000430497:p.Leu3466Phe	Somatic		Capture	Illumina HiSeq	Phase_I	77938901	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	C	14.82	2.650522	0.47362	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.49139	0.79;0.79;0.79;0.79	4.75	4.75	0.60458	.	0.000000	0.40144	U	0.001178	T	0.69700	0.3140	M	0.76574	2.34	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.74269	-0.3720	10	0.87932	D	0	.	17.964	0.89094	0.0:1.0:0.0:0.0	.	3421	Q86UP3-4	.	F	3466;3450;3421;3417;3440	ENSP00000430497:L3466F;ENSP00000399605:L3421F;ENSP00000050961:L3417F;ENSP00000430848:L3440F	ENSP00000050961:L3417F	L	+	1	0	ZFHX4	77938901	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.563000	0.82314	2.482000	0.83794	0.650000	0.86243	CTC		ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
GML	2765	broad.mit.edu	37	8	143928033	143928033	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr8:143928033G>T	ENST00000220940.1	+	4	494	c.404G>T	c.(403-405)gGa>gTa	p.G135V		NM_002066.2	NP_002057.1	Q99445	GML_HUMAN	glycosylphosphatidylinositol anchored molecule like	135					apoptotic process (GO:0006915)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|negative regulation of cell proliferation (GO:0008285)	anchored component of membrane (GO:0031225)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)		p.G135V(1)		NS(1)|central_nervous_system(2)|endometrium(1)|large_intestine(6)|lung(8)	18	all_cancers(97;4.26e-11)|all_epithelial(106;1.85e-08)|Lung NSC(106;0.000274)|all_lung(105;0.000755)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					CTTCCAGAAGGAACTGTGAGG	0.463																																					p.G135V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G404T	8						.						111.0	107.0	109.0					8																	143928033		2203	4300	6503	143925035	SO:0001583	missense	2765	exon4			D84290	CCDS6391.1	8q24.3	2014-05-14	2012-11-02						4375	protein-coding gene	gene with protein product		602370	"""GPI anchored molecule like protein"", ""glycosylphosphatidylinositol anchored molecule like protein"""			8934543, 9169150	Standard	NM_002066		Approved	LY6DL	uc003yxg.3	Q99445		ENST00000220940.1:c.404G>T	8.37:g.143928033G>T	ENSP00000220940:p.Gly135Val	Somatic		Capture	Illumina HiSeq	Phase_I	143925035	NM_002066	A0AVF6|O00686|O00731	Missense_Mutation	SNP	ENST00000220940.1	37	CCDS6391.1	.	.	.	.	.	.	.	.	.	.	N	11.93	1.784703	0.31593	.	.	ENSG00000104499	ENST00000220940	T	0.50001	0.76	3.52	2.64	0.31445	.	0.891146	0.09267	N	0.825657	T	0.58779	0.2146	L	0.60455	1.87	0.09310	N	0.999995	D	0.67145	0.996	D	0.64877	0.93	T	0.40924	-0.9537	10	0.39692	T	0.17	-34.9126	6.5487	0.22420	0.1313:0.0:0.8687:0.0	.	135	Q99445	GML_HUMAN	V	135	ENSP00000220940:G135V	ENSP00000220940:G135V	G	+	2	0	GML	143925035	0.000000	0.05858	0.001000	0.08648	0.066000	0.16364	0.170000	0.16663	1.051000	0.40369	0.557000	0.71058	GGA		GML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379659.1	NM_002066	
DPP7	29952	broad.mit.edu	37	9	140006326	140006327	+	Splice_Site	INS	-	-	C			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr9:140006326_140006327insC	ENST00000371579.2	-	10	1209_1210	c.1205_1206insG	c.(1204-1206)ggt>ggGt	p.G402fs		NM_013379.2	NP_037511.2	Q9UHL4	DPP2_HUMAN	dipeptidyl-peptidase 7	402						cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)	p.D403fs*1(1)		endometrium(2)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	7	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;4.25e-05)|Epithelial(140;0.000633)		CAGCCTTACCACCCCCCCAGAA	0.703																																					p.G402fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1206_1207insG	9						.																																			139126148	SO:0001630	splice_region_variant	29952	exon10			AF154502	CCDS7030.1	9q34.3	2008-02-05	2006-01-12		ENSG00000176978	ENSG00000176978			14892	protein-coding gene	gene with protein product		610537	"""dipeptidylpeptidase 7"""			10477574, 11139392	Standard	XM_005266075		Approved	DPPII	uc004clh.3	Q9UHL4	OTTHUMG00000020977	ENST00000371579.2:c.1207+1->G	9.37:g.140006333_140006333dupC		Somatic		Capture	Illumina HiSeq	Phase_I	139126147	NM_013379	A8K7U7|Q5VSF1|Q969X4	Frame_Shift_Ins	INS	ENST00000371579.2	37	CCDS7030.1																																																																																				DPP7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055279.1	NM_013379	Frame_Shift_Ins
TRPM3	80036	broad.mit.edu	37	9	73240148	73240148	+	Missense_Mutation	SNP	G	G	A	rs367948487		TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr9:73240148G>A	ENST00000377111.2	-	13	1975	c.1732C>T	c.(1732-1734)Cgc>Tgc	p.R578C	TRPM3_ENST00000377106.1_Missense_Mutation_p.R450C|TRPM3_ENST00000396292.4_Missense_Mutation_p.R450C|TRPM3_ENST00000396280.5_Missense_Mutation_p.R437C|TRPM3_ENST00000423814.3_Missense_Mutation_p.R605C|TRPM3_ENST00000358082.3_Missense_Mutation_p.R450C|TRPM3_ENST00000357533.2_Missense_Mutation_p.R592C|TRPM3_ENST00000396285.1_Missense_Mutation_p.R425C|TRPM3_ENST00000360823.2_Missense_Mutation_p.R450C|TRPM3_ENST00000377105.1_Missense_Mutation_p.R437C|TRPM3_ENST00000408909.2_Missense_Mutation_p.R437C|TRPM3_ENST00000377110.3_Missense_Mutation_p.R578C	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	603					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)	p.R592C(1)|p.R450C(1)		NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						GTCCGGAAGCGCTTGCGCGTG	0.602																																					p.R578C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1732T	9						.						41.0	41.0	41.0					9																	73240148		2203	4300	6503	72429968	SO:0001583	missense	80036	exon13			AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.1732C>T	9.37:g.73240148G>A	ENSP00000366315:p.Arg578Cys	Somatic		Capture	Illumina HiSeq	Phase_I	72429968	NM_001007471	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	ENST00000377111.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.8|20.8	4.044627|4.044627	0.75732|0.75732	.|.	.|.	ENSG00000083067|ENSG00000083067	ENST00000396280|ENST00000377111;ENST00000377110;ENST00000377106;ENST00000360823;ENST00000377105;ENST00000357533;ENST00000408909;ENST00000396285;ENST00000396292;ENST00000358082;ENST00000423814	.|T;T;T;T;T;T;T;T;T;T;T	.|0.75260	.|-0.92;-0.92;-0.92;-0.92;-0.92;-0.92;-0.92;-0.92;-0.92;-0.92;-0.92	6.03|6.03	5.12|5.12	0.69794|0.69794	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.83266|0.83266	0.5217|0.5217	M|M	0.64997|0.64997	1.995|1.995	0.49915|0.49915	D|D	0.999831|0.999831	.|D;P;D;D;D;D;D;P	.|0.89917	.|0.999;0.605;1.0;0.999;0.999;0.999;1.0;0.721	.|D;B;D;D;D;P;D;B	.|0.67231	.|0.94;0.145;0.95;0.917;0.917;0.898;0.94;0.115	D|D	0.85187|0.85187	0.1007|0.1007	5|10	.|0.87932	.|D	.|0	-19.6504|-19.6504	14.2051|14.2051	0.65730|0.65730	0.0:0.0:0.7276:0.2724|0.0:0.0:0.7276:0.2724	.|.	.|578;578;578;592;450;437;560;425	.|Q9HCF6-2;Q9HCF6-10;Q9HCF6-4;A2A3F7;A2A3F4;G5E9G1;Q9HCF6-8;A2A3F3	.|.;.;.;.;.;.;.;.	V|C	436|578;578;450;450;437;592;437;425;450;450;605	.|ENSP00000366315:R578C;ENSP00000366314:R578C;ENSP00000366310:R450C;ENSP00000354066:R450C;ENSP00000366309:R437C;ENSP00000350140:R592C;ENSP00000386127:R437C;ENSP00000379581:R425C;ENSP00000379587:R450C;ENSP00000350791:R450C;ENSP00000389542:R605C	.|ENSP00000350140:R592C	A|R	-|-	2|1	0|0	TRPM3|TRPM3	72429968|72429968	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	2.090000|2.090000	0.41682|0.41682	1.527000|1.527000	0.49086|0.49086	0.555000|0.555000	0.69702|0.69702	GCG|CGC		TRPM3-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000214157.5	NM_206945	
GNAQ	2776	broad.mit.edu	37	9	80412499	80412499	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chr9:80412499C>G	ENST00000286548.4	-	4	764	c.542G>C	c.(541-543)aGa>aCa	p.R181T	GNAQ_ENST00000397476.3_5'UTR	NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	181					action potential (GO:0001508)|activation of phospholipase C activity (GO:0007202)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|developmental pigmentation (GO:0048066)|embryonic digit morphogenesis (GO:0042733)|forebrain neuron development (GO:0021884)|glutamate receptor signaling pathway (GO:0007215)|heart development (GO:0007507)|maternal behavior (GO:0042711)|negative regulation of protein kinase activity (GO:0006469)|neuron remodeling (GO:0016322)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|post-embryonic development (GO:0009791)|protein stabilization (GO:0050821)|regulation of catenin import into nucleus (GO:0035412)|regulation of melanocyte differentiation (GO:0045634)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 2A serotonin receptor binding (GO:0031826)	p.R181T(1)		NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302						GACTCGAACTCTAAGCACATC	0.468			Mis		uveal melanoma																																p.R181T			Dom	yes		9	9q21	2776	"""guanine nucleotide binding protein (G protein), q polypeptide"""		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G542C	9						.						160.0	122.0	135.0					9																	80412499		2203	4300	6503	79602319	SO:0001583	missense	2776	exon4				CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052			4390	protein-coding gene	gene with protein product		600998				8825633	Standard	NM_002072		Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.542G>C	9.37:g.80412499C>G	ENSP00000286548:p.Arg181Thr	Somatic		Capture	Illumina HiSeq	Phase_I	79602319	NM_002072	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	Missense_Mutation	SNP	ENST00000286548.4	37	CCDS6658.1	.	.	.	.	.	.	.	.	.	.	C	35	5.578723	0.96565	.	.	ENSG00000156052	ENST00000286548;ENST00000411677	D;D	0.89617	-2.54;-2.54	5.88	5.88	0.94601	G protein alpha subunit, helical insertion (1);	0.000000	0.85682	D	0.000000	D	0.97250	0.9101	H	0.98738	4.315	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	D	0.98249	1.0492	10	0.87932	D	0	.	20.2279	0.98344	0.0:1.0:0.0:0.0	.	181	P50148	GNAQ_HUMAN	T	181;152	ENSP00000286548:R181T;ENSP00000391501:R152T	ENSP00000286548:R181T	R	-	2	0	GNAQ	79602319	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.776000	0.85560	2.778000	0.95560	0.655000	0.94253	AGA		GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052761.1	NM_002072	
HTR2C	3358	broad.mit.edu	37	X	114082707	114082707	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chrX:114082707G>A	ENST00000276198.1	+	5	1219	c.491G>A	c.(490-492)cGt>cAt	p.R164H	HTR2C_ENST00000371950.3_Intron|HTR2C_ENST00000371951.1_Missense_Mutation_p.R164H	NM_000868.2	NP_000859.1	P28335	5HT2C_HUMAN	5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled	164					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|cGMP biosynthetic process (GO:0006182)|feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|regulation of appetite (GO:0032098)|regulation of corticotropin-releasing hormone secretion (GO:0043397)|regulation of neurological system process (GO:0031644)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|Gq/11-coupled serotonin receptor activity (GO:0001587)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.R164H(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50					Agomelatine(DB06594)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Doxepin(DB01142)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Lorcaserin(DB04871)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	GAGCATAGCCGTTTCAATTCG	0.398																																					p.R164H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G491A	X						.						131.0	111.0	118.0					X																	114082707		2203	4300	6503	113988963	SO:0001583	missense	3358	exon5				CCDS14564.1, CCDS59174.1	Xq23	2013-12-19	2012-02-03		ENSG00000147246	ENSG00000147246		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5295	protein-coding gene	gene with protein product		312861	"""5-hydroxytryptamine (serotonin) receptor 2C"""	HTR1C		7895773	Standard	NM_000868		Approved	5-HT2C, 5HTR2C	uc004epu.1	P28335	OTTHUMG00000022226	ENST00000276198.1:c.491G>A	X.37:g.114082707G>A	ENSP00000276198:p.Arg164His	Somatic		Capture	Illumina HiSeq	Phase_I	113988963	NM_000868	B1AMW4|Q5VUF8|Q9NP28	Missense_Mutation	SNP	ENST00000276198.1	37	CCDS14564.1	.	.	.	.	.	.	.	.	.	.	G	19.21	3.783801	0.70222	.	.	ENSG00000147246	ENST00000276198;ENST00000371951	T;T	0.19938	2.11;2.11	4.41	3.54	0.40534	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.32793	0.0841	M	0.64260	1.97	0.80722	D	1	D	0.58620	0.983	P	0.58820	0.846	T	0.07654	-1.0761	10	0.17832	T	0.49	.	9.4759	0.38871	0.1094:0.0:0.8906:0.0	.	164	P28335	5HT2C_HUMAN	H	164	ENSP00000276198:R164H;ENSP00000361019:R164H	ENSP00000276198:R164H	R	+	2	0	HTR2C	113988963	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.596000	0.74113	0.665000	0.31066	0.544000	0.68410	CGT		HTR2C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057962.1	NM_000868	
ARSD	414	broad.mit.edu	37	X	2836233	2836233	+	Missense_Mutation	SNP	C	C	T	rs139907025		TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chrX:2836233C>T	ENST00000381154.1	-	5	550	c.475G>A	c.(475-477)Ggg>Agg	p.G159R	ARSD_ENST00000217890.6_5'UTR	NM_001669.3	NP_001660.2	P51689	ARSD_HUMAN	arylsulfatase D	159					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)	p.G159R(1)		large_intestine(3)|lung(3)	6		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CAGTGATCCCCGCGGGATGCA	0.547													c|||	1	0.000264901	0.0008	0.0	3775	,	,		15891	0.0		0.0	False		,,,				2504	0.0				p.G159R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G475A	X						.	C	ARG/GLY	1,3821		0,1,1625,570	31.0	19.0	23.0		475	-4.3	0.0	X	dbSNP_134	23	0,6703		0,0,2418,1867	no	missense	ARSD	NM_001669.3	125	0,1,4043,2437	TT,TC,CC,C		0.0,0.0262,0.0095	benign	159/594	2836233	1,10524	2196	4285	6481	2846233	SO:0001583	missense	414	exon5			X83572	CCDS35196.1	Xp22.3	2013-02-14			ENSG00000006756	ENSG00000006756		"""Arylsulfatase family"""	717	protein-coding gene	gene with protein product		300002				7720070	Standard	NM_001669		Approved		uc004cqy.3	P51689	OTTHUMG00000021077	ENST00000381154.1:c.475G>A	X.37:g.2836233C>T	ENSP00000370546:p.Gly159Arg	Somatic		Capture	Illumina HiSeq	Phase_I	2846233	NM_009589	Q9UHJ8	Missense_Mutation	SNP	ENST00000381154.1	37	CCDS35196.1	.	.	.	.	.	.	.	.	.	.	c	1.992	-0.431463	0.04669	2.62E-4	0.0	ENSG00000006756	ENST00000381154;ENST00000217890	D	0.98666	-5.06	3.47	-4.35	0.03656	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	1.644960	0.03521	U	0.221055	D	0.95557	0.8556	L	0.27053	0.805	0.09310	N	1	B;B	0.24823	0.112;0.02	B;B	0.18561	0.022;0.013	D	0.91311	0.5074	10	0.27082	T	0.32	.	11.2132	0.48810	0.0:0.2417:0.0:0.7583	.	159;159	E9PAW5;P51689	.;ARSD_HUMAN	R	159	ENSP00000370546:G159R	ENSP00000217890:G159R	G	-	1	0	ARSD	2846233	0.000000	0.05858	0.000000	0.03702	0.041000	0.13682	-0.477000	0.06583	-1.075000	0.03129	0.420000	0.28162	GGG		ARSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055636.1		
GRPR	2925	broad.mit.edu	37	X	16168672	16168672	+	Missense_Mutation	SNP	G	G	A	rs143721353	byFrequency	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chrX:16168672G>A	ENST00000380289.2	+	2	1056	c.658G>A	c.(658-660)Gtc>Atc	p.V220I	RP11-431J24.2_ENST00000454712.2_RNA|RP11-431J24.2_ENST00000422438.1_RNA|RP11-431J24.2_ENST00000435789.1_RNA	NM_005314.2	NP_005305.1	P30550	GRPR_HUMAN	gastrin-releasing peptide receptor	220					cell proliferation (GO:0008283)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of cell proliferation (GO:0042127)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)|G-protein coupled peptide receptor activity (GO:0008528)	p.V220I(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(12)|ovary(3)|stomach(1)|upper_aerodigestive_tract(3)	25	Hepatocellular(33;0.183)					GGTCTTCTACGTCATTCCACT	0.438													G|||	10	0.00264901	0.0076	0.0	3775	,	,		14993	0.0		0.0	False		,,,				2504	0.0				p.V220I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G658A	X						.	G	ILE/VAL	13,3822		0,11,2,1621,569	198.0	148.0	165.0		658	-0.1	1.0	X	dbSNP_134	165	0,6728		0,0,0,2428,1872	yes	missense	GRPR	NM_005314.2	29	0,11,2,4049,2441	AA,AG,A,GG,G		0.0,0.339,0.1231	benign	220/385	16168672	13,10550	2203	4300	6503	16078593	SO:0001583	missense	2925	exon2				CCDS14174.1	Xp22.2	2014-02-21			ENSG00000126010	ENSG00000126010		"""GPCR / Class A : Bombesin receptors"""	4609	protein-coding gene	gene with protein product	"""bombesin receptor 2"""	305670					Standard	NM_005314		Approved	BB2	uc004cxj.3	P30550	OTTHUMG00000021189	ENST00000380289.2:c.658G>A	X.37:g.16168672G>A	ENSP00000369643:p.Val220Ile	Somatic		Capture	Illumina HiSeq	Phase_I	16078593	NM_005314	B2R910	Missense_Mutation	SNP	ENST00000380289.2	37	CCDS14174.1	.	.	.	.	.	.	.	.	.	.	G	2.283	-0.364219	0.05103	0.00339	0.0	ENSG00000126010	ENST00000380289;ENST00000535371	T	0.73152	-0.72	5.63	-0.0958	0.13639	GPCR, rhodopsin-like superfamily (1);	0.282926	0.38381	N	0.001714	T	0.44350	0.1289	N	0.12471	0.22	0.35251	D	0.778688	B	0.06786	0.001	B	0.09377	0.004	T	0.35943	-0.9768	10	0.10111	T	0.7	-11.2895	9.4593	0.38774	0.611:0.0:0.389:0.0	.	220	P30550	GRPR_HUMAN	I	220;9	ENSP00000369643:V220I	ENSP00000369643:V220I	V	+	1	0	GRPR	16078593	0.963000	0.33076	0.998000	0.56505	0.914000	0.54420	0.452000	0.21795	-0.039000	0.13602	-0.354000	0.07668	GTC		GRPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055901.1	NM_005314	
BEND2	139105	broad.mit.edu	37	X	18189245	18189245	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chrX:18189245G>T	ENST00000380033.4	-	13	2193	c.2061C>A	c.(2059-2061)agC>agA	p.S687R	BEND2_ENST00000380030.3_Missense_Mutation_p.S596R	NM_153346.4	NP_699177.2	Q8NDZ0	BEND2_HUMAN	BEN domain containing 2	687	BEN 2. {ECO:0000255|PROSITE- ProRule:PRU00784}.							p.S687R(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(11)|liver(1)|lung(21)|ovary(3)|prostate(1)	49						TAGCCGACAGGCTTGCGCAAG	0.433																																					p.S687R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2061A	X						.						163.0	141.0	148.0					X																	18189245		2203	4300	6503	18099166	SO:0001583	missense	139105	exon13			AK128155	CCDS14184.1, CCDS55375.1	Xp22.22	2012-11-22	2008-10-03	2008-10-03	ENSG00000177324	ENSG00000177324		"""BEN domain containing"""	28509	protein-coding gene	gene with protein product			"""chromosome X open reading frame 20"""	CXorf20		12477932	Standard	NM_153346		Approved	MGC33653	uc004cyj.4	Q8NDZ0	OTTHUMG00000021211	ENST00000380033.4:c.2061C>A	X.37:g.18189245G>T	ENSP00000369372:p.Ser687Arg	Somatic		Capture	Illumina HiSeq	Phase_I	18099166	NM_153346	E9PFY2|Q4V9S2|Q5JXE5	Missense_Mutation	SNP	ENST00000380033.4	37	CCDS14184.1	.	.	.	.	.	.	.	.	.	.	G	10.34	1.321843	0.23994	.	.	ENSG00000177324	ENST00000380033;ENST00000380030	T;T	0.24350	1.86;1.89	5.49	-1.01	0.10169	BEN domain (1);	0.590084	0.15021	N	0.285009	T	0.16599	0.0399	L	0.29908	0.895	0.09310	N	1	P;P	0.44429	0.835;0.835	P;B	0.44732	0.459;0.381	T	0.11421	-1.0588	10	0.56958	D	0.05	-1.2481	1.9061	0.03278	0.233:0.3808:0.2387:0.1476	.	596;687	E9PFY2;Q8NDZ0	.;BEND2_HUMAN	R	687;596	ENSP00000369372:S687R;ENSP00000369369:S596R	ENSP00000369369:S596R	S	-	3	2	BEND2	18099166	0.322000	0.24634	0.000000	0.03702	0.000000	0.00434	-0.227000	0.09126	-0.410000	0.07542	-0.281000	0.10026	AGC		BEND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055940.1	NM_153346	
CLCN5	1184	broad.mit.edu	37	X	49855022	49855022	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chrX:49855022T>G	ENST00000307367.2	+	10	2075	c.1784T>G	c.(1783-1785)tTg>tGg	p.L595W	CLCN5_ENST00000376091.3_Missense_Mutation_p.L665W|CLCN5_ENST00000376108.3_Missense_Mutation_p.L595W|CLCN5_ENST00000376088.3_Missense_Mutation_p.L665W			P51795	CLCN5_HUMAN	chloride channel, voltage-sensitive 5	595	CBS 1. {ECO:0000255|PROSITE- ProRule:PRU00703}.				chloride transmembrane transport (GO:1902476)|endocytosis (GO:0006897)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)	p.L595W(1)		central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)	30	Ovarian(276;0.236)					GATCCTTTGTTGACTGTCCTT	0.473																																					p.L665W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1994G	X						.						107.0	86.0	93.0					X																	49855022		2203	4300	6503	49741762	SO:0001583	missense	1184	exon13			X91906	CCDS14328.1, CCDS48115.1, CCDS69763.1	Xp11.23-p11.22	2012-09-26	2012-02-23		ENSG00000171365	ENSG00000171365		"""Ion channels / Chloride channels : Voltage-sensitive"""	2023	protein-coding gene	gene with protein product	"""Dent disease"""	300008	"""nephrolithiasis 2, X-linked"", ""nephrolithiasis 1 (X-linked)"", ""chloride channel 5"""	NPHL2, NPHL1		7874126, 8111383, 8099916, 8559248, 9602200	Standard	NM_001272102		Approved	DENTS, XLRH, hClC-K2, hCIC-K2, CLC5, XRN, ClC-5	uc004doq.1	P51795	OTTHUMG00000021514	ENST00000307367.2:c.1784T>G	X.37:g.49855022T>G	ENSP00000304257:p.Leu595Trp	Somatic		Capture	Illumina HiSeq	Phase_I	49741762	NM_001127899	A1L475|B3KPN6|Q5JQD5|Q7RTN8	Missense_Mutation	SNP	ENST00000307367.2	37	CCDS14328.1	.	.	.	.	.	.	.	.	.	.	T	20.1	3.936425	0.73442	.	.	ENSG00000171365	ENST00000376088;ENST00000450422;ENST00000376091;ENST00000376108;ENST00000307367	D;D;D;D	0.94000	-3.33;-3.33;-3.33;-3.33	5.78	5.78	0.91487	Cystathionine beta-synthase, core (3);	0.000000	0.85682	D	0.000000	D	0.96920	0.8994	M	0.86805	2.84	0.80722	D	1	D;D	0.89917	0.976;1.0	P;D	0.91635	0.876;0.999	D	0.97536	1.0083	10	0.87932	D	0	-10.7377	13.9947	0.64390	0.0:0.0:0.0:1.0	.	595;665	P51795;P51795-2	CLCN5_HUMAN;.	W	665;497;665;595;595	ENSP00000365256:L665W;ENSP00000365259:L665W;ENSP00000365276:L595W;ENSP00000304257:L595W	ENSP00000304257:L595W	L	+	2	0	CLCN5	49741762	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.910000	0.87451	1.950000	0.56595	0.481000	0.45027	TTG		CLCN5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056544.1		
AMER1	139285	broad.mit.edu	37	X	63411678	63411678	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chrX:63411678G>A	ENST00000330258.3	-	2	1761	c.1489C>T	c.(1489-1491)Cga>Tga	p.R497*	AMER1_ENST00000403336.1_Nonsense_Mutation_p.R497*|AMER1_ENST00000374869.3_Nonsense_Mutation_p.R497*	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	497					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)|p.R497*(5)|p.R497R(2)									TAGCTGTCTCGGGGTAGACAA	0.522																																					p.R497X												.	.	74	Whole gene deletion(67)|Substitution - Nonsense(5)|Substitution - coding silent(2)	kidney(65)|large_intestine(6)|lung(2)|ovary(1)	c.C1489T	X						.						56.0	47.0	50.0					X																	63411678		2203	4300	6503	63328403	SO:0001587	stop_gained	139285	exon2			AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.1489C>T	X.37:g.63411678G>A	ENSP00000329117:p.Arg497*	Somatic		Capture	Illumina HiSeq	Phase_I	63328403	NM_152424	A2IB86|Q8N885	Nonsense_Mutation	SNP	ENST00000330258.3	37	CCDS14377.2	.	.	.	.	.	.	.	.	.	.	G	39	7.315935	0.98207	.	.	ENSG00000184675	ENST00000374869;ENST00000330258;ENST00000403336	.	.	.	5.21	0.738	0.18319	.	0.076466	0.49916	D	0.000127	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.2202	14.7031	0.69168	0.0:0.0:0.2919:0.7081	.	.	.	.	X	497	.	ENSP00000329117:R497X	R	-	1	2	FAM123B	63328403	1.000000	0.71417	0.993000	0.49108	0.964000	0.63967	0.633000	0.24598	-0.084000	0.12595	-0.237000	0.12165	CGA		AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424	
AR	367	broad.mit.edu	37	X	66931382	66931382	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chrX:66931382T>C	ENST00000374690.3	+	4	2548	c.2024T>C	c.(2023-2025)cTg>cCg	p.L675P	AR_ENST00000396044.3_Missense_Mutation_p.L675P|AR_ENST00000396043.2_Missense_Mutation_p.L143P	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	674	Interaction with KAT7.|Interaction with LPXN.			N -> I (in Ref. 18; AAB21256/AAB21257). {ECO:0000305}.	androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.L675P(1)|p.L485P(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	CCCATCTTTCTGAATGTCCTG	0.537									Androgen Insensitivity Syndrome																												p.L143P												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T428C	X						.						123.0	84.0	97.0					X																	66931382		2203	4300	6503	66848107	SO:0001583	missense	367	exon4	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.2024T>C	X.37:g.66931382T>C	ENSP00000363822:p.Leu675Pro	Somatic		Capture	Illumina HiSeq	Phase_I	66848107	NM_001011645	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	ENST00000374690.3	37	CCDS14387.1	.	.	.	.	.	.	.	.	.	.	t	21.8	4.208036	0.79240	.	.	ENSG00000169083	ENST00000544984;ENST00000374690;ENST00000396044;ENST00000396043	D;D;D	0.99836	-7.05;-2.54;-7.05	5.42	5.42	0.78866	Nuclear hormone receptor, ligand-binding (1);	0.000000	0.85682	D	0.000000	D	0.99859	0.9934	H	0.94222	3.51	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	D	0.96672	0.9497	10	0.87932	D	0	.	12.1382	0.53982	0.0:0.0:0.0:1.0	.	143;674	F1D8N5;P10275	.;ANDR_HUMAN	P	485;675;675;143	ENSP00000363822:L675P;ENSP00000379359:L675P;ENSP00000379358:L143P	ENSP00000363822:L675P	L	+	2	0	AR	66848107	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.111000	0.71541	1.996000	0.58369	0.478000	0.44815	CTG		AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
IGSF1	3547	broad.mit.edu	37	X	130412673	130412674	+	Missense_Mutation	DNP	AG	AG	GA			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	AG	AG					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chrX:130412673_130412674AG>GA	ENST00000361420.3	-	12	1881_1882	c.1802_1803CT>TC	c.(1801-1803)cCT>cTC	p.P601L	IGSF1_ENST00000467244.1_5'Flank|IGSF1_ENST00000370910.1_Missense_Mutation_p.P592L|IGSF1_ENST00000370903.3_Missense_Mutation_p.P606L|IGSF1_ENST00000370904.1_Missense_Mutation_p.P592L			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	601	Ig-like C2-type 6.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)	p.P601>?(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						ACGGGGCCAGAGGAAAGTTGGT	0.545																																					.												.	.	1	Complex(1)	large_intestine(1)	c.1775_1776TC	X						.																																			130240355	SO:0001583	missense	3547	exon11			AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.1802_1803delinsGA	X.37:g.130412673_130412674delinsGA	ENSP00000355010:p.Pro601Leu	Somatic		Capture	Illumina HiSeq	Phase_I	130240354	NM_001170962	B5MEG2|H9KV64|O15070|Q9NTC8	Missense_Mutation	DNP	ENST00000361420.3	37	CCDS14629.1																																																																																				IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058288.1		
TBL1Y	90665	broad.mit.edu	37	Y	6938319	6938319	+	Silent	SNP	T	T	A			TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3666-01A-02W-0900-09	TCGA-AA-3666-10A-01W-0900-09	g.chrY:6938319T>A	ENST00000383032.1	+	9	1187	c.540T>A	c.(538-540)tcT>tcA	p.S180S	TBL1Y_ENST00000346432.3_Silent_p.S180S|TBL1Y_ENST00000355162.2_Silent_p.S180S	NM_033284.1	NP_150600.1	Q9BQ87	TBL1Y_HUMAN	transducin (beta)-like 1, Y-linked	180					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.S180S(1)		kidney(1)|large_intestine(4)|lung(2)|skin(1)	8						GCCACGAGTCTGAGGTGTTCA	0.517																																					p.S180S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T540A	Y						.						102.0	101.0	101.0					Y																	6938319		597	1971	2568	6998319	SO:0001819	synonymous_variant	90665	exon9			AF332220	CCDS14779.1	Yp11.2	2013-01-10	2009-12-17		ENSG00000092377	ENSG00000092377		"""WD repeat domain containing"""	18502	protein-coding gene	gene with protein product		400033					Standard	NM_033284		Approved	TBL1	uc004frd.3	Q9BQ87	OTTHUMG00000035299	ENST00000383032.1:c.540T>A	Y.37:g.6938319T>A		Somatic		Capture	Illumina HiSeq	Phase_I	6998319	NM_033284	A1L4B3	Silent	SNP	ENST00000383032.1	37	CCDS14779.1																																																																																				TBL1Y-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085360.1	NM_033284	
