#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ITIH2	3698	broad.mit.edu	37	10	7773949	7773949	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr10:7773949C>T	ENST00000358415.4	+	13	1803	c.1637C>T	c.(1636-1638)aCg>aTg	p.T546M	ITIH2_ENST00000379587.4_Missense_Mutation_p.T535M	NM_002216.2	NP_002207.2	P19823	ITIH2_HUMAN	inter-alpha-trypsin inhibitor heavy chain 2	546					hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.T546M(1)		NS(2)|breast(1)|endometrium(8)|kidney(1)|large_intestine(17)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64						AGCGTTATCACGGCGACTTCG	0.438																																					p.T546M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1637T	10						.						130.0	122.0	125.0					10																	7773949		2203	4300	6503	7813955	SO:0001583	missense	3698	exon13			X07173	CCDS31141.1	10p14	2011-10-26	2011-10-26		ENSG00000151655	ENSG00000151655			6167	protein-coding gene	gene with protein product		146640	"""inter-alpha (globulin) inhibitor, H2 polypeptide"""			1385302, 10100603	Standard	NM_002216		Approved	H2P	uc001ijs.3	P19823	OTTHUMG00000017633	ENST00000358415.4:c.1637C>T	10.37:g.7773949C>T	ENSP00000351190:p.Thr546Met	Somatic		Capture	Illumina HiSeq	Phase_I	7813955	NM_002216	Q14659|Q15484|Q5T986	Missense_Mutation	SNP	ENST00000358415.4	37	CCDS31141.1	.	.	.	.	.	.	.	.	.	.	C	12.61	1.989269	0.35131	.	.	ENSG00000151655	ENST00000358415;ENST00000379587	T;T	0.11712	2.75;2.75	5.44	5.44	0.79542	.	0.098092	0.64402	D	0.000001	T	0.24084	0.0583	M	0.87900	2.915	0.53005	D	0.999963	D	0.56035	0.974	P	0.45639	0.488	T	0.08493	-1.0719	10	0.62326	D	0.03	-20.1587	14.8331	0.70162	0.0:0.8566:0.1434:0.0	.	546	P19823	ITIH2_HUMAN	M	546;535	ENSP00000351190:T546M;ENSP00000368906:T535M	ENSP00000351190:T546M	T	+	2	0	ITIH2	7813955	0.984000	0.35163	0.797000	0.32132	0.008000	0.06430	2.615000	0.46368	2.558000	0.86282	0.643000	0.83706	ACG		ITIH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046678.2	NM_002216	
ARHGAP21	57584	broad.mit.edu	37	10	24910283	24910283	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr10:24910283C>A	ENST00000396432.2	-	9	1027	c.541G>T	c.(541-543)Gcc>Tcc	p.A181S	ARHGAP21_ENST00000320481.6_5'UTR	NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	180					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)	p.A180S(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						TTCAGGTAGGCATCTTGAGAA	0.418																																					p.A181S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G541T	10						.						25.0	24.0	25.0					10																	24910283		2203	4300	6503	24950289	SO:0001583	missense	57584	exon9			AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.541G>T	10.37:g.24910283C>A	ENSP00000379709:p.Ala181Ser	Somatic		Capture	Illumina HiSeq	Phase_I	24950289	NM_020824	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	ENST00000396432.2	37	CCDS7144.2	.	.	.	.	.	.	.	.	.	.	C	26.4	4.734844	0.89482	.	.	ENSG00000107863	ENST00000396432;ENST00000447364;ENST00000376410;ENST00000446003;ENST00000445703	T;T;T	0.54675	2.51;0.56;0.58	5.72	5.72	0.89469	PDZ/DHR/GLGF (1);	0.000000	0.85682	D	0.000000	T	0.76176	0.3951	M	0.80183	2.485	0.80722	D	1	D;D	0.89917	0.992;1.0	D;D	0.87578	0.973;0.998	T	0.77496	-0.2566	10	0.72032	D	0.01	.	20.2441	0.98394	0.0:1.0:0.0:0.0	.	171;180	F8W9U9;Q5T5U3	.;RHG21_HUMAN	S	181;170;171;181;16	ENSP00000379709:A181S;ENSP00000365592:A171S;ENSP00000405018:A181S	ENSP00000365592:A171S	A	-	1	0	ARHGAP21	24950289	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.445000	0.80570	2.865000	0.98341	0.655000	0.94253	GCC		ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047229.4	NM_020824	
SORCS3	22986	broad.mit.edu	37	10	106976754	106976754	+	Missense_Mutation	SNP	G	G	A	rs367942325		TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr10:106976754G>A	ENST00000369701.3	+	19	2835	c.2608G>A	c.(2608-2610)Gca>Aca	p.A870T	SORCS3_ENST00000369699.4_Missense_Mutation_p.A156T	NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	870	PKD. {ECO:0000255|PROSITE- ProRule:PRU00151}.				learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)	p.A870T(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		TGTGTCCTACGCAAACTTCAG	0.517																																					p.A870T	NSCLC(116;1497 1690 7108 13108 14106)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2608A	10						.	G	THR/ALA	0,4406		0,0,2203	163.0	123.0	137.0		2608	5.9	1.0	10		137	1,8599	1.2+/-3.3	0,1,4299	no	missense	SORCS3	NM_014978.1	58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	870/1223	106976754	1,13005	2203	4300	6503	106966744	SO:0001583	missense	22986	exon19			AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.2608G>A	10.37:g.106976754G>A	ENSP00000358715:p.Ala870Thr	Somatic		Capture	Illumina HiSeq	Phase_I	106966744	NM_014978	Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	ENST00000369701.3	37	CCDS7558.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.629689	0.87660	0.0	1.16E-4	ENSG00000156395	ENST00000369701;ENST00000369699	T;T	0.60299	0.2;0.2	5.87	5.87	0.94306	PKD domain (4);	0.059730	0.64402	D	0.000002	T	0.57519	0.2059	L	0.36672	1.1	0.49798	D	0.999828	D	0.57899	0.981	P	0.51079	0.658	T	0.52094	-0.8621	9	.	.	.	.	15.3178	0.74095	0.0:0.0:0.8602:0.1398	.	870	Q9UPU3	SORC3_HUMAN	T	870;156	ENSP00000358715:A870T;ENSP00000358713:A156T	.	A	+	1	0	SORCS3	106966744	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	5.695000	0.68279	2.941000	0.99782	0.655000	0.94253	GCA		SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978	
MAPK8IP1	9479	broad.mit.edu	37	11	45923969	45923970	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr11:45923969_45923970insC	ENST00000241014.2	+	5	821_822	c.651_652insC	c.(652-654)cccfs	p.P218fs	MAPK8IP1_ENST00000395629.2_Frame_Shift_Ins_p.P208fs	NM_005456.3	NP_005447.1	Q9UQF2	JIP1_HUMAN	mitogen-activated protein kinase 8 interacting protein 1	218	JNK-binding domain (JBD).				JUN phosphorylation (GO:0007258)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|positive regulation of signal transduction (GO:0009967)|regulation of JNK cascade (GO:0046328)|regulation of transcription, DNA-templated (GO:0006355)|vesicle-mediated transport (GO:0016192)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic growth cone (GO:0044294)|dentate gyrus mossy fiber (GO:0044302)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)|protein kinase inhibitor activity (GO:0004860)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(2)	24				GBM - Glioblastoma multiforme(35;0.231)		GCGATGAGCTGCCCCCCCAGAG	0.678																																					p.L217fs												.	.	0			c.651_652insC	11						.																																			45880546	SO:0001589	frameshift_variant	9479	exon5				CCDS7916.1	11p11.2	2009-07-24			ENSG00000121653	ENSG00000121653			6882	protein-coding gene	gene with protein product		604641		PRKM8IP		9235893, 9442013	Standard	NM_005456		Approved	IB1, JIP-1, JIP1	uc001nbr.3	Q9UQF2	OTTHUMG00000134324	ENST00000241014.2:c.658dupC	11.37:g.45923976_45923976dupC	ENSP00000241014:p.Pro218fs	None		Capture	Illumina HiSeq	Phase_I	45880545	NM_005456	D3DQP4|O43407	Frame_Shift_Ins	INS	ENST00000241014.2	37	CCDS7916.1																																																																																				MAPK8IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259405.1	NM_005456	
STIM1	6786	broad.mit.edu	37	11	4112814	4112814	+	Missense_Mutation	SNP	G	G	A	rs145197758	byFrequency	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr11:4112814G>A	ENST00000300737.4	+	12	2413	c.1844G>A	c.(1843-1845)cGt>cAt	p.R615H	STIM1_ENST00000533977.1_Missense_Mutation_p.R442H|STIM1_ENST00000527651.1_3'UTR	NM_003156.3	NP_003147.2	Q13586	STIM1_HUMAN	stromal interaction molecule 1	615	Pro/Ser-rich.				activation of store-operated calcium channel activity (GO:0032237)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|regulation of calcium ion transport (GO:0051924)|regulation of store-operated calcium entry (GO:2001256)|store-operated calcium entry (GO:0002115)	cortical endoplasmic reticulum (GO:0032541)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|growth cone (GO:0030426)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of plasma membrane (GO:0005887)|microtubule (GO:0005874)	calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|microtubule plus-end binding (GO:0051010)|store-operated calcium channel activity (GO:0015279)	p.R615H(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|liver(1)|lung(14)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30		Breast(177;0.00159)|Medulloblastoma(188;0.00258)|all_neural(188;0.0233)		BRCA - Breast invasive adenocarcinoma(625;0.114)|LUSC - Lung squamous cell carcinoma(625;0.141)		GATTCTTCCCGTTCTCACAGC	0.622																																					p.R615H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1844A	11						.	G	HIS/ARG	0,4402		0,0,2201	84.0	94.0	91.0		1844	0.5	1.0	11	dbSNP_134	91	3,8593	3.0+/-9.4	0,3,4295	yes	missense	STIM1	NM_003156.3	29	0,3,6496	AA,AG,GG		0.0349,0.0,0.0231	probably-damaging	615/686	4112814	3,12995	2201	4298	6499	4069390	SO:0001583	missense	6786	exon12			BC021300, U52426	CCDS7749.1, CCDS60706.1, CCDS73247.1	11p15.5	2014-09-17			ENSG00000167323	ENSG00000167323		"""Sterile alpha motif (SAM) domain containing"""	11386	protein-coding gene	gene with protein product		605921				8921403, 11463338, 11983428	Standard	NM_003156		Approved	GOK, D11S4896E	uc021qco.1	Q13586	OTTHUMG00000133360	ENST00000300737.4:c.1844G>A	11.37:g.4112814G>A	ENSP00000300737:p.Arg615His	Somatic		Capture	Illumina HiSeq	Phase_I	4069390	NM_003156	E9PQJ4|Q8N382	Missense_Mutation	SNP	ENST00000300737.4	37	CCDS7749.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.07|11.07	1.529990|1.529990	0.27387|0.27387	0.0|0.0	3.49E-4|3.49E-4	ENSG00000167323|ENSG00000167323	ENST00000300737;ENST00000533977|ENST00000526596	T;T|.	0.69926|.	-0.43;-0.44|.	4.71|4.71	0.488|0.488	0.16848|0.16848	.|.	0.235337|.	0.35708|.	N|.	0.003022|.	T|T	0.33731|0.33731	0.0873|0.0873	N|N	0.14661|0.14661	0.345|0.345	0.41517|0.41517	D|D	0.988374|0.988374	B|.	0.09022|.	0.002|.	B|.	0.06405|.	0.002|.	T|T	0.04946|0.04946	-1.0916|-1.0916	10|5	0.29301|.	T|.	0.29|.	-18.1661|-18.1661	7.6903|7.6903	0.28565|0.28565	0.4054:0.0:0.5946:0.0|0.4054:0.0:0.5946:0.0	.|.	615|.	Q13586|.	STIM1_HUMAN|.	H|I	615;442|377	ENSP00000300737:R615H;ENSP00000434767:R442H|.	ENSP00000300737:R615H|.	R|V	+|+	2|1	0|0	STIM1|STIM1	4069390|4069390	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.996000|0.996000	0.88848|0.88848	2.661000|2.661000	0.46758|0.46758	0.001000|0.001000	0.14605|0.14605	0.591000|0.591000	0.81541|0.81541	CGT|GTT		STIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257196.1	NM_003156	
SYVN1	84447	broad.mit.edu	37	11	64899033	64899033	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr11:64899033A>C	ENST00000377190.3	-	7	660	c.566T>G	c.(565-567)tTc>tGc	p.F189C	SYVN1_ENST00000307289.6_Missense_Mutation_p.F138C|SYVN1_ENST00000526060.1_Missense_Mutation_p.F189C|SYVN1_ENST00000526121.1_5'UTR|SYVN1_ENST00000294256.8_Missense_Mutation_p.F189C	NM_172230.2	NP_757385.1	Q86TM6	SYVN1_HUMAN	synovial apoptosis inhibitor 1, synoviolin	189					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|in utero embryonic development (GO:0001701)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|zinc ion binding (GO:0008270)	p.F189C(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						ATACTTGATGAAGATGGTGAG	0.542																																					p.F189C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T566G	11						.						100.0	82.0	88.0					11																	64899033		2201	4297	6498	64655609	SO:0001583	missense	84447	exon7			AB085847	CCDS8097.1, CCDS31605.1	11q13	2013-01-09			ENSG00000162298	ENSG00000162298		"""RING-type (C3HC4) zinc fingers"""	20738	protein-coding gene	gene with protein product	"""HMG-coA reductase degradation 1 homolog (S. cerevisiae)"""	608046				12975321	Standard	NM_032431		Approved	HRD1, DER3	uc001odb.3	Q86TM6		ENST00000377190.3:c.566T>G	11.37:g.64899033A>C	ENSP00000366395:p.Phe189Cys	Somatic		Capture	Illumina HiSeq	Phase_I	64655609	NM_032431	Q8N3K3|Q8N6E8|Q96JL5|Q96PK3	Missense_Mutation	SNP	ENST00000377190.3	37	CCDS31605.1	.	.	.	.	.	.	.	.	.	.	A	19.18	3.777687	0.70107	.	.	ENSG00000162298	ENST00000377190;ENST00000294256;ENST00000434219;ENST00000307289;ENST00000526060;ENST00000531018;ENST00000528487	T;T;T;T;T;T	0.51574	0.7;0.7;0.7;0.7;0.7;0.7	4.76	4.76	0.60689	.	0.000000	0.85682	D	0.000000	T	0.58380	0.2118	L	0.55481	1.735	0.58432	D	0.999999	D;D;D	0.64830	0.994;0.994;0.989	P;P;P	0.61658	0.892;0.892;0.829	T	0.57165	-0.7858	10	0.38643	T	0.18	-20.0758	12.2881	0.54803	1.0:0.0:0.0:0.0	.	138;189;189	Q86TM6-2;Q86TM6-3;Q86TM6	.;.;SYVN1_HUMAN	C	189;189;189;138;189;129;174	ENSP00000366395:F189C;ENSP00000294256:F189C;ENSP00000302035:F138C;ENSP00000436984:F189C;ENSP00000431215:F129C;ENSP00000431720:F174C	ENSP00000294256:F189C	F	-	2	0	SYVN1	64655609	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.362000	0.90100	1.994000	0.58287	0.460000	0.39030	TTC		SYVN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000385274.1	NM_032431	
TYR	7299	broad.mit.edu	37	11	88911358	88911358	+	Silent	SNP	G	G	A	rs376813190		TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr11:88911358G>A	ENST00000263321.5	+	1	739	c.237G>A	c.(235-237)tcG>tcA	p.S79S	TYR_ENST00000526139.1_3'UTR	NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	79			S -> L (in OCA1A). {ECO:0000269|PubMed:15146472}.		cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.S79S(4)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	ACCGGGAGTCGTGGCCTTCCG	0.517																																					p.S79S												TYR,central_nervous_system,brain,Substitution - coding silent,0 	.	4	Substitution - coding silent(4)	large_intestine(2)|urinary_tract(1)|central_nervous_system(1)	c.G237A	11						.	G		1,4401	2.1+/-5.4	0,1,2200	47.0	43.0	44.0		237	-5.7	1.0	11		44	0,8598		0,0,4299	no	coding-synonymous	TYR	NM_000372.4		0,1,6499	AA,AG,GG		0.0,0.0227,0.0077		79/530	88911358	1,12999	2201	4299	6500	88551006	SO:0001819	synonymous_variant	7299	exon1			M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.237G>A	11.37:g.88911358G>A		Somatic		Capture	Illumina HiSeq	Phase_I	88551006	NM_000372	Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Silent	SNP	ENST00000263321.5	37	CCDS8284.1																																																																																				TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394045.2	NM_000372	
GUCY2C	2984	broad.mit.edu	37	12	14840994	14840994	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr12:14840994A>G	ENST00000261170.3	-	2	357	c.221T>C	c.(220-222)cTa>cCa	p.L74P	RP11-174G6.1_ENST00000501178.2_RNA	NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	74					intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)	p.L74P(1)		breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	AGTCACATTTAGGCCTGTCGC	0.438																																					p.L74P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T221C	12						.						84.0	81.0	82.0					12																	14840994		2203	4300	6503	14732261	SO:0001583	missense	2984	exon2				CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.221T>C	12.37:g.14840994A>G	ENSP00000261170:p.Leu74Pro	Somatic		Capture	Illumina HiSeq	Phase_I	14732261	NM_004963	B2RMY6	Missense_Mutation	SNP	ENST00000261170.3	37	CCDS8664.1	.	.	.	.	.	.	.	.	.	.	A	12.32	1.902385	0.33628	.	.	ENSG00000070019	ENST00000261170	T	0.79749	-1.3	5.48	2.92	0.33932	Extracellular ligand-binding receptor (1);	1.154560	0.06326	N	0.705383	T	0.81365	0.4807	L	0.50333	1.59	0.22446	N	0.999098	P	0.50066	0.931	P	0.51866	0.682	T	0.65512	-0.6150	10	0.27082	T	0.32	.	7.8627	0.29520	0.6677:0.0:0.0:0.3323	.	74	P25092	GUC2C_HUMAN	P	74	ENSP00000261170:L74P	ENSP00000261170:L74P	L	-	2	0	GUCY2C	14732261	0.002000	0.14202	0.007000	0.13788	0.372000	0.29890	1.254000	0.32897	0.996000	0.38943	0.482000	0.46254	CTA		GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400835.1		
KRAS	3845	broad.mit.edu	37	12	25378562	25378562	+	Missense_Mutation	SNP	C	C	T	rs121913527		TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr12:25378562C>T	ENST00000256078.4	-	4	499	c.436G>A	c.(436-438)Gca>Aca	p.A146T	KRAS_ENST00000557334.1_Intron|KRAS_ENST00000311936.3_Missense_Mutation_p.A146T|AC087239.1_ENST00000594112.1_5'Flank	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	146			A -> T (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.A146T(75)|p.A146P(7)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CTTGTCTTTGCTGATGTTTCA	0.323	A146T(AMO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|A146T(LS1034_LARGE_INTESTINE)|A146T(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.A146T	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,large_intestine,NS,Substitution - Missense,0 	.	82	Substitution - Missense(82)	large_intestine(69)|haematopoietic_and_lymphoid_tissue(11)|lung(2)	c.G436A	12						.						207.0	188.0	195.0					12																	25378562		2203	4300	6503	25269829	SO:0001583	missense	3845	exon4	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.436G>A	12.37:g.25378562C>T	ENSP00000256078:p.Ala146Thr	Somatic		Capture	Illumina HiSeq	Phase_I	25269829	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	33	5.234460	0.95207	.	.	ENSG00000133703	ENST00000311936;ENST00000256078	D;D	0.88741	-2.42;-2.42	5.52	5.52	0.82312	Small GTP-binding protein domain (1);	0.045975	0.85682	D	0.000000	D	0.96639	0.8903	H	0.97131	3.945	0.80722	D	1	D;D	0.89917	1.0;0.963	D;P	0.76071	0.987;0.876	D	0.97524	1.0075	10	0.72032	D	0.01	.	18.7849	0.91951	0.0:1.0:0.0:0.0	.	146;146	P01116-2;P01116	.;RASK_HUMAN	T	146	ENSP00000308495:A146T;ENSP00000256078:A146T	ENSP00000256078:A146T	A	-	1	0	KRAS	25269829	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.762000	0.85270	2.757000	0.94681	0.585000	0.79938	GCA		KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
KMT2D	8085	broad.mit.edu	37	12	49432374	49432374	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr12:49432374C>T	ENST00000301067.7	-	34	8764	c.8765G>A	c.(8764-8766)cGg>cAg	p.R2922Q	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	2922	Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.R2922Q(1)|p.R2652Q(1)									CGCCAGGCCCCGAAGCCCTTC	0.617																																					p.R2922Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G8765A	12						.						31.0	36.0	35.0					12																	49432374		1858	4084	5942	47718641	SO:0001583	missense	8085	exon34			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.8765G>A	12.37:g.49432374C>T	ENSP00000301067:p.Arg2922Gln	Somatic		Capture	Illumina HiSeq	Phase_I	47718641	NM_003482	O14687	Missense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	C	10.03	1.239869	0.22711	.	.	ENSG00000167548	ENST00000301067	T	0.78707	-1.2	5.32	5.32	0.75619	.	0.000000	0.35436	N	0.003206	T	0.63224	0.2493	N	0.22421	0.69	0.22457	N	0.999089	P	0.35628	0.513	B	0.23716	0.048	T	0.64715	-0.6342	10	0.87932	D	0	.	14.899	0.70664	0.0:0.8554:0.1446:0.0	.	2922	O14686	MLL2_HUMAN	Q	2922	ENSP00000301067:R2922Q	ENSP00000301067:R2922Q	R	-	2	0	MLL2	47718641	0.935000	0.31712	0.990000	0.47175	0.806000	0.45545	1.733000	0.38156	2.878000	0.98634	0.650000	0.86243	CGG		KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
FAM186B	84070	broad.mit.edu	37	12	49982388	49982388	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr12:49982388C>T	ENST00000257894.2	-	6	2544	c.2383G>A	c.(2383-2385)Gtt>Att	p.V795I	FAM186B_ENST00000551047.1_Intron|FAM186B_ENST00000544141.1_Missense_Mutation_p.V705I	NM_032130.2	NP_115506.1	Q8IYM0	F186B_HUMAN	family with sequence similarity 186, member B	795						protein complex (GO:0043234)		p.V795I(1)		breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						TTCAGGTGAACGTTCCACTCC	0.557																																					p.V795I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2383A	12						.						133.0	122.0	126.0					12																	49982388		2203	4300	6503	48268655	SO:0001583	missense	84070	exon6			AL136748	CCDS8788.1	12q13.12	2008-09-17	2008-09-17	2008-09-17	ENSG00000135436	ENSG00000135436			25296	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 25"""	C12orf25		11230166	Standard	NM_032130		Approved	DKFZP434J0113	uc001ruo.3	Q8IYM0	OTTHUMG00000167427	ENST00000257894.2:c.2383G>A	12.37:g.49982388C>T	ENSP00000257894:p.Val795Ile	Somatic		Capture	Illumina HiSeq	Phase_I	48268655	NM_032130	B4DZ15|Q8TCP7|Q9H0L3	Missense_Mutation	SNP	ENST00000257894.2	37	CCDS8788.1	.	.	.	.	.	.	.	.	.	.	C	0.039	-1.294425	0.01375	.	.	ENSG00000135436	ENST00000544141;ENST00000532262;ENST00000257894	T;T;T	0.41400	1.0;1.0;1.0	4.29	-6.89	0.01660	.	0.866156	0.09608	N	0.779251	T	0.18800	0.0451	N	0.12471	0.22	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.06405	0.002;0.002	T	0.41070	-0.9529	10	0.09338	T	0.73	-0.23	12.2448	0.54563	0.0:0.6759:0.0:0.3241	.	705;795	B4DZ15;Q8IYM0	.;F186B_HUMAN	I	705;408;795	ENSP00000438569:V705I;ENSP00000436995:V408I;ENSP00000257894:V795I	ENSP00000257894:V795I	V	-	1	0	FAM186B	48268655	0.000000	0.05858	0.001000	0.08648	0.571000	0.35966	-2.728000	0.00807	-1.178000	0.02741	-0.982000	0.02568	GTT		FAM186B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394583.2	NM_032130	
C12orf56	115749	broad.mit.edu	37	12	64784245	64784245	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr12:64784245C>T	ENST00000543942.2	-	1	727	c.101G>A	c.(100-102)cGc>cAc	p.R34H	RPS11P6_ENST00000535684.1_RNA|C12orf56_ENST00000333722.5_Missense_Mutation_p.R34H	NM_001170633.1	NP_001164104.1	Q8IXR9	CL056_HUMAN	chromosome 12 open reading frame 56	34								p.R34H(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)	15			GBM - Glioblastoma multiforme(3;0.000582)	GBM - Glioblastoma multiforme(28;0.0259)		CTCGTAGGCGCGGACCGCGTC	0.652																																					p.R34H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G101A	12						.						42.0	46.0	45.0					12																	64784245		1970	4148	6118	63070512	SO:0001583	missense	115749	exon1				CCDS44935.1, CCDS61182.1	12q14.2	2012-08-15			ENSG00000185306	ENSG00000185306			26967	protein-coding gene	gene with protein product							Standard	NM_001099676		Approved		uc021qzu.1	Q8IXR9	OTTHUMG00000168782	ENST00000543942.2:c.101G>A	12.37:g.64784245C>T	ENSP00000446101:p.Arg34His	Somatic		Capture	Illumina HiSeq	Phase_I	63070512	NM_001170633		Missense_Mutation	SNP	ENST00000543942.2	37		.	.	.	.	.	.	.	.	.	.	C	16.60	3.168669	0.57584	.	.	ENSG00000185306	ENST00000333722;ENST00000543942;ENST00000433716;ENST00000543259	.	.	.	4.58	3.68	0.42216	.	0.184659	0.34628	N	0.003818	T	0.74898	0.3777	M	0.72894	2.215	0.40479	D	0.980422	D	0.89917	1.0	D	0.79784	0.993	T	0.76063	-0.3096	8	.	.	.	-1.0875	10.8136	0.46562	0.0:0.8086:0.1914:0.0	.	34	Q8IXR9-2	.	H	34;34;34;21	.	.	R	-	2	0	C12orf56	63070512	1.000000	0.71417	0.916000	0.36221	0.002000	0.02628	4.699000	0.61796	1.252000	0.44001	0.455000	0.32223	CGC		C12orf56-008	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000401058.2	NM_001099676	
CPSF6	11052	broad.mit.edu	37	12	69653949	69653949	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr12:69653949G>A	ENST00000435070.2	+	8	1551	c.1441G>A	c.(1441-1443)Gag>Aag	p.E481K	CPSF6_ENST00000551516.1_Intron|CPSF6_ENST00000456847.3_Missense_Mutation_p.E408K|CPSF6_ENST00000266679.8_Missense_Mutation_p.E518K	NM_007007.2	NP_008938.2	Q16630	CPSF6_HUMAN	cleavage and polyadenylation specific factor 6, 68kDa	481					mRNA polyadenylation (GO:0006378)|mRNA processing (GO:0006397)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|mRNA cleavage factor complex (GO:0005849)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.E481K(2)		endometrium(1)|large_intestine(7)|lung(8)	16	all_epithelial(5;2.47e-36)|Lung NSC(4;1.1e-32)|all_lung(4;6.26e-31)|Breast(13;1.59e-06)|Esophageal squamous(21;0.187)		Epithelial(6;4.89e-17)|BRCA - Breast invasive adenocarcinoma(5;8.5e-10)|Lung(24;6.04e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.171)|Kidney(9;0.241)			tcatggaattgagtccaagtc	0.328																																					p.E481K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1441A	12						.						111.0	103.0	106.0					12																	69653949		2203	4300	6503	67940216	SO:0001583	missense	11052	exon8			X67336	CCDS8988.1, CCDS73494.1	12q15	2013-06-18	2002-08-29			ENSG00000111605		"""RNA binding motif (RRM) containing"""	13871	protein-coding gene	gene with protein product	"""cleavage factor Im complex 68 kDa subunit"""	604979	"""cleavage and polyadenylation specific factor 6, 68kD subunit"""			9659921, 17267687	Standard	NM_007007		Approved	CFIM, HPBRII-4, HPBRII-7, CFIM68	uc001sut.4	Q16630		ENST00000435070.2:c.1441G>A	12.37:g.69653949G>A	ENSP00000391774:p.Glu481Lys	Somatic		Capture	Illumina HiSeq	Phase_I	67940216	NM_007007	A8K7K9|Q53ES1|Q9BSJ7|Q9BW18	Missense_Mutation	SNP	ENST00000435070.2	37	CCDS8988.1	.	.	.	.	.	.	.	.	.	.	G	35	5.472279	0.96274	.	.	ENSG00000111605	ENST00000435070;ENST00000456847;ENST00000266679	T;T;T	0.28895	1.59;1.59;1.59	5.72	5.72	0.89469	.	0.086169	0.85682	D	0.000000	T	0.55577	0.1929	M	0.68952	2.095	0.80722	D	1	D;D;D	0.69078	0.997;0.997;0.993	P;D;D	0.68192	0.899;0.93;0.956	T	0.47548	-0.9109	9	.	.	.	-13.1332	20.2626	0.98452	0.0:0.0:1.0:0.0	.	229;518;481	B4DSU9;Q16630-2;Q16630	.;.;CPSF6_HUMAN	K	481;408;518	ENSP00000391774:E481K;ENSP00000391437:E408K;ENSP00000266679:E518K	.	E	+	1	0	CPSF6	67940216	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.869000	0.99810	2.873000	0.98535	0.563000	0.77884	GAG		CPSF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403609.1	NM_007007	
BBS10	79738	broad.mit.edu	37	12	76739686	76739686	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr12:76739686C>A	ENST00000393262.3	-	2	2162	c.2079G>T	c.(2077-2079)caG>caT	p.Q693H		NM_024685.3	NP_078961.3	Q8TAM1	BBS10_HUMAN	Bardet-Biedl syndrome 10	693					cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|regulation of protein complex assembly (GO:0043254)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cell projection (GO:0042995)	ATP binding (GO:0005524)|RNA polymerase II repressing transcription factor binding (GO:0001103)	p.Q693H(1)		endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)	19						TTGTCAAACACTGAAGAACTG	0.388									Bardet-Biedl syndrome																												p.Q693H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2079T	12						.						107.0	104.0	105.0					12																	76739686		2203	4300	6503	75263817	SO:0001583	missense	79738	exon2	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	BC026355	CCDS9014.2	12q21.2	2014-06-17	2006-04-28	2006-04-28	ENSG00000179941	ENSG00000179941		"""Heat Shock Proteins / Chaperonins"""	26291	protein-coding gene	gene with protein product		610148	"""chromosome 12 open reading frame 58"""	C12orf58		16582908	Standard	NM_024685		Approved	FLJ23560	uc001syd.1	Q8TAM1	OTTHUMG00000147352	ENST00000393262.3:c.2079G>T	12.37:g.76739686C>A	ENSP00000376946:p.Gln693His	Somatic		Capture	Illumina HiSeq	Phase_I	75263817	NM_024685	Q96CW2|Q9H5D2	Missense_Mutation	SNP	ENST00000393262.3	37	CCDS9014.2	.	.	.	.	.	.	.	.	.	.	C	1.162	-0.643661	0.03531	.	.	ENSG00000179941	ENST00000393262	D	0.90324	-2.65	4.91	0.823	0.18812	.	0.159611	0.42420	D	0.000710	T	0.77624	0.4158	L	0.31294	0.92	0.33035	D	0.530657	B	0.15719	0.014	B	0.18871	0.023	T	0.61407	-0.7069	10	0.09843	T	0.71	-7.2126	0.7596	0.01004	0.2375:0.3819:0.1239:0.2566	.	693	Q8TAM1	BBS10_HUMAN	H	693	ENSP00000376946:Q693H	ENSP00000376946:Q693H	Q	-	3	2	BBS10	75263817	0.998000	0.40836	1.000000	0.80357	0.994000	0.84299	0.451000	0.21779	0.386000	0.24997	0.650000	0.86243	CAG		BBS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000303983.2	NM_024685	
HECTD4	283450	broad.mit.edu	37	12	112673415	112673415	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr12:112673415C>A	ENST00000430131.2	-	35	5497	c.4352G>T	c.(4351-4353)tGg>tTg	p.W1451L	HECTD4_ENST00000377560.5_Missense_Mutation_p.W1701L|HECTD4_ENST00000550722.1_Missense_Mutation_p.W1727L			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	1451					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.W1451L(1)|p.W1701L(1)									AGAGTAGCTCCAGGGTGGGAG	0.577																																					p.W1701L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G5102T	12						.						48.0	50.0	49.0					12																	112673415		1953	4153	6106	111157798	SO:0001583	missense	283450	exon35			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.4352G>T	12.37:g.112673415C>A	ENSP00000404379:p.Trp1451Leu	Somatic		Capture	Illumina HiSeq	Phase_I	111157798	NM_001109662	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	ENST00000430131.2	37		.	.	.	.	.	.	.	.	.	.	C	36	5.638105	0.96693	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.53640	0.62;0.63;0.61	6.03	6.03	0.97812	.	.	.	.	.	T	0.56702	0.2003	N	0.19112	0.55	0.80722	D	1	D	0.54601	0.967	D	0.65140	0.932	T	0.59904	-0.7366	9	0.87932	D	0	.	20.5666	0.99351	0.0:1.0:0.0:0.0	.	1451	Q9Y4D8	K0614_HUMAN	L	1701;1451;1727	ENSP00000366783:W1701L;ENSP00000404379:W1451L;ENSP00000449784:W1727L	ENSP00000366783:W1701L	W	-	2	0	C12orf51	111157798	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	7.400000	0.79949	2.854000	0.98071	0.655000	0.94253	TGG		HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
DOCK9	23348	broad.mit.edu	37	13	99502311	99502312	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr13:99502311_99502312insA	ENST00000376460.1	-	36	4082_4083	c.4002_4003insT	c.(4000-4005)tttacafs	p.T1335fs	DOCK9_ENST00000448493.2_Frame_Shift_Ins_p.T1347fs|DOCK9_ENST00000339416.2_Frame_Shift_Ins_p.T1336fs	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9	1336					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(18)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TCAGATATTGTAAAAAAATCCA	0.322																																					p.T1335fs												.	.	0			c.4003_4004insT	13						.																																			98300313	SO:0001589	frameshift_variant	23348	exon36			AF527605	CCDS45062.1	13q32.3	2013-01-10			ENSG00000088387	ENSG00000088387		"""Pleckstrin homology (PH) domain containing"""	14132	protein-coding gene	gene with protein product	"""zizimin1"""	607325				12172552, 12432077	Standard	NM_015296		Approved	KIAA1058, ZIZ1	uc001vnt.2	Q9BZ29	OTTHUMG00000017260	ENST00000376460.1:c.4003dupT	13.37:g.99502318_99502318dupA	ENSP00000365643:p.Thr1335fs	None		Capture	Illumina HiSeq	Phase_I	98300312	NM_001130048	B3KX25|E9PFM9|Q5JUD4|Q5JUD6|Q5T2Q1|Q5TAN8|Q9BZ25|Q9BZ26|Q9BZ27|Q9BZ28|Q9UPU4	Frame_Shift_Ins	INS	ENST00000376460.1	37	CCDS45062.1																																																																																				DOCK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045566.1	NM_015296	
ZMYM5	9205	broad.mit.edu	37	13	20399354	20399354	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr13:20399354T>C	ENST00000337963.4	-	8	1537	c.1273A>G	c.(1273-1275)Aaa>Gaa	p.K425E		NM_001142684.1	NP_001136156.1	Q9UJ78	ZMYM5_HUMAN	zinc finger, MYM-type 5	425						nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.K425E(1)		kidney(1)|large_intestine(5)|lung(9)	15		all_cancers(29;2.96e-22)|all_epithelial(30;3.76e-20)|all_lung(29;4.38e-20)|Lung NSC(5;5.8e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.61e-05)|Epithelial(112;4.89e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00171)|Lung(94;0.00942)|LUSC - Lung squamous cell carcinoma(192;0.0431)		gctgttaatttttttgatttt	0.259																																					p.K425E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1273G	13						.						9.0	8.0	8.0					13																	20399354		1464	3316	4780	19297354	SO:0001583	missense	9205	exon8			AF161535	CCDS31942.1, CCDS31943.1	13q12	2013-01-08	2005-09-12	2005-09-12	ENSG00000132950	ENSG00000132950		"""Zinc fingers, MYM type"""	13029	protein-coding gene	gene with protein product			"""zinc finger protein 237"""	ZNF237			Standard	NM_001039650		Approved	ZNF198L1, MYM	uc010tcn.1	Q9UJ78	OTTHUMG00000016504	ENST00000337963.4:c.1273A>G	13.37:g.20399354T>C	ENSP00000337034:p.Lys425Glu	Somatic		Capture	Illumina HiSeq	Phase_I	19297354	NM_001142684	B2R6V1|Q5T6E1|Q5T6E2|Q5T6E4|Q96IY6|Q9NZY5|Q9UBW0|Q9UJ77	Missense_Mutation	SNP	ENST00000337963.4	37		.	.	.	.	.	.	.	.	.	.	T	4.088	0.014317	0.07959	.	.	ENSG00000132950	ENST00000337963;ENST00000502168	T;T	0.18502	2.21;2.23	2.62	-0.222	0.13122	.	0.315912	0.32258	U	0.006345	T	0.09949	0.0244	L	0.36672	1.1	0.09310	N	1	P	0.35174	0.488	B	0.32211	0.142	T	0.25813	-1.0121	10	0.27082	T	0.32	.	6.5603	0.22483	0.0:0.0:0.4955:0.5045	.	425	Q9UJ78	ZMYM5_HUMAN	E	425;415	ENSP00000337034:K425E;ENSP00000445779:K415E	ENSP00000337034:K425E	K	-	1	0	ZMYM5	19297354	0.029000	0.19370	0.011000	0.14972	0.751000	0.42716	0.333000	0.19768	-0.034000	0.13713	0.254000	0.18369	AAA		ZMYM5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_014242	
SPATA13	221178	broad.mit.edu	37	13	24861026	24861026	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr13:24861026G>A	ENST00000382095.4	+	6	1137	c.730G>A	c.(730-732)Gtc>Atc	p.V244I	SPATA13_ENST00000424834.2_Missense_Mutation_p.V869I|SPATA13_ENST00000409126.1_Intron|SPATA13_ENST00000343003.6_Missense_Mutation_p.V188I|RP11-307N16.6_ENST00000382141.4_Missense_Mutation_p.V747I|SPATA13_ENST00000399949.2_Missense_Mutation_p.V166I|SPATA13_ENST00000382108.3_Missense_Mutation_p.V869I	NM_153023.2	NP_694568.1	Q96N96	SPT13_HUMAN	spermatogenesis associated 13	244	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				cell migration (GO:0016477)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell migration (GO:0030334)	cytoplasm (GO:0005737)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)	p.V244I(1)		breast(4)|endometrium(2)|large_intestine(9)|lung(4)|ovary(1)|prostate(1)|skin(2)	23		all_cancers(29;4.05e-15)|all_lung(29;2.77e-14)|all_epithelial(30;7.77e-13)|Lung SC(185;0.0279)		all cancers(112;0.00616)|Epithelial(112;0.0195)|OV - Ovarian serous cystadenocarcinoma(117;0.0705)|Lung(94;0.231)		GCGGACCAACGTCATCCGGGA	0.607																																					p.V869I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2605A	13						.						123.0	105.0	111.0					13																	24861026		2203	4300	6503	23759026	SO:0001583	missense	221178	exon7			AK055770	CCDS9305.1, CCDS53857.1, CCDS66517.1, CCDS66518.1, CCDS73553.1	13q12.13	2013-01-10			ENSG00000182957	ENSG00000182957		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	23222	protein-coding gene	gene with protein product		613324					Standard	NM_001286795		Approved	FLJ31208, ARHGEF29	uc021rhg.1	Q96N96	OTTHUMG00000016578	ENST00000382095.4:c.730G>A	13.37:g.24861026G>A	ENSP00000371527:p.Val244Ile	Somatic		Capture	Illumina HiSeq	Phase_I	23759026	NM_001166271	A2VEA9|A6NF85|B4DQB1|B4DSZ0|B4DVM8|J3KPJ7|J3KQH2|Q5VX68|Q6ZML1|Q8N873|Q8TEK6	Missense_Mutation	SNP	ENST00000382095.4	37	CCDS9305.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.1|22.1	4.249906|4.249906	0.80024|0.80024	.|.	.|.	ENSG00000182957|ENSG00000182957	ENST00000424834|ENST00000382108;ENST00000382095;ENST00000438694;ENST00000399949;ENST00000343003	.|T;T;T;T	.|0.65916	.|-0.18;-0.18;-0.18;-0.18	4.96|4.96	4.96|4.96	0.65561|0.65561	.|Src homology-3 domain (1);Dbl homology (DH) domain (5);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.71921|0.71921	0.3397|0.3397	M|M	0.62016|0.62016	1.91|1.91	0.58432|0.58432	D|D	0.999999|0.999999	.|P;P;B;P	.|0.50943	.|0.65;0.94;0.272;0.699	.|P;P;P;P	.|0.54460	.|0.638;0.744;0.507;0.753	T|T	0.73135|0.73135	-0.4078|-0.4078	5|10	.|0.46703	.|T	.|0.11	.|.	17.5605|17.5605	0.87905|0.87905	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|188;190;166;244	.|Q96N96-3;Q96N96-4;Q96N96-2;Q96N96	.|.;.;.;SPT13_HUMAN	H|I	906|869;244;190;166;188	.|ENSP00000371542:V869I;ENSP00000371527:V244I;ENSP00000382830:V166I;ENSP00000343631:V188I	.|ENSP00000343631:V188I	R|V	+|+	2|1	0|0	SPATA13|SPATA13	23759026|23759026	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.925000|0.925000	0.55904|0.55904	9.371000|9.371000	0.97162|0.97162	2.452000|2.452000	0.82932|0.82932	0.561000|0.561000	0.74099|0.74099	CGT|GTC		SPATA13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044180.2	NM_153023	
MTUS2	23281	broad.mit.edu	37	13	29600795	29600795	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr13:29600795G>A	ENST00000431530.3	+	1	2048	c.1990G>A	c.(1990-1992)Gcc>Acc	p.A664T		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	654	Mediates interaction with MAPRE1.					cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)	p.A664T(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						GAATCCCCAGGCCCTGGGCCA	0.572																																					p.A664T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1990A	13						.						36.0	42.0	40.0					13																	29600795		2002	4154	6156	28498795	SO:0001583	missense	23281	exon1			AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.1990G>A	13.37:g.29600795G>A	ENSP00000392057:p.Ala664Thr	Somatic		Capture	Illumina HiSeq	Phase_I	28498795	NM_001033602	A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	ENST00000431530.3	37	CCDS45022.1	.	.	.	.	.	.	.	.	.	.	g	14.12	2.439156	0.43326	.	.	ENSG00000132938	ENST00000431530	T	0.14144	2.53	6.17	4.44	0.53790	.	0.221665	0.31976	N	0.006765	T	0.11110	0.0271	L	0.60455	1.87	0.80722	D	1	P	0.41450	0.75	B	0.33690	0.168	T	0.07731	-1.0757	9	.	.	.	.	5.4205	0.16398	0.2188:0.0:0.6305:0.1507	.	654	Q5JR59	MTUS2_HUMAN	T	664	ENSP00000392057:A664T	.	A	+	1	0	MTUS2	28498795	0.999000	0.42202	0.954000	0.39281	0.586000	0.36452	1.882000	0.39648	1.630000	0.50440	0.655000	0.94253	GCC		MTUS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044336.3	XM_166270	
PCDH17	27253	broad.mit.edu	37	13	58207013	58207013	+	Silent	SNP	C	C	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr13:58207013C>T	ENST00000377918.3	+	1	359	c.333C>T	c.(331-333)aaC>aaT	p.N111N		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	111	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.N111N(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		TGTTCGCCAACGACAAGGAGA	0.587																																					p.N111N	Melanoma(72;952 1291 1619 12849 33676)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C333T	13						.						92.0	73.0	80.0					13																	58207013		2203	4300	6503	57105014	SO:0001819	synonymous_variant	27253	exon1			AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.333C>T	13.37:g.58207013C>T		Somatic		Capture	Illumina HiSeq	Phase_I	57105014	NM_001040429	A8K1R5|Q5VVW9|Q5VVX0	Silent	SNP	ENST00000377918.3	37	CCDS31986.1																																																																																				PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429	
EDNRB	1910	broad.mit.edu	37	13	78492519	78492519	+	Missense_Mutation	SNP	G	G	A	rs139147111		TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr13:78492519G>A	ENST00000334286.5	-	1	426	c.190C>T	c.(190-192)Cgg>Tgg	p.R64W	EDNRB_ENST00000475537.1_5'UTR|EDNRB_ENST00000377211.4_Missense_Mutation_p.R154W|RNF219-AS1_ENST00000607862.1_RNA|EDNRB_ENST00000446573.1_Missense_Mutation_p.R64W	NM_000115.3|NM_001122659.2	NP_000106.1|NP_001116131.1	P24530	EDNRB_HUMAN	endothelin receptor type B	64					aging (GO:0007568)|cell surface receptor signaling pathway (GO:0007166)|cellular response to lipopolysaccharide (GO:0071222)|cGMP-mediated signaling (GO:0019934)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|enteric smooth muscle cell differentiation (GO:0035645)|epithelial fluid transport (GO:0042045)|macrophage chemotaxis (GO:0048246)|melanocyte differentiation (GO:0030318)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of neuron maturation (GO:0014043)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|peripheral nervous system development (GO:0007422)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|posterior midgut development (GO:0007497)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|regulation of fever generation (GO:0031620)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|response to organic cyclic compound (GO:0014070)|response to pain (GO:0048265)|sensory perception of pain (GO:0019233)|vasoconstriction (GO:0042310)|vasodilation (GO:0042311)|vein smooth muscle contraction (GO:0014826)	integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)	endothelin receptor activity (GO:0004962)|peptide hormone binding (GO:0017046)	p.R64W(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(18)|lung(16)|skin(3)	42		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0933)	Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	GCCAACGACCGCGCCAGACTG	0.617																																					p.R64W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C190T	13						.	G	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	71.0	74.0	73.0		190,190,460,190	0.5	0.0	13	dbSNP_134	73	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	EDNRB	NM_000115.3,NM_001122659.2,NM_001201397.1,NM_003991.3	101,101,101,101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign,benign	64/443,64/443,154/533,64/437	78492519	1,13005	2203	4300	6503	77390520	SO:0001583	missense	1910	exon1			L06623	CCDS9461.1, CCDS55902.1	13q22	2012-08-08			ENSG00000136160	ENSG00000136160		"""GPCR / Class A : Endothelin receptors"""	3180	protein-coding gene	gene with protein product		131244		HSCR2, HSCR		1659806, 9556633	Standard	NM_000115		Approved	ETB	uc001vkp.1	P24530	OTTHUMG00000017111	ENST00000334286.5:c.190C>T	13.37:g.78492519G>A	ENSP00000335311:p.Arg64Trp	Somatic		Capture	Illumina HiSeq	Phase_I	77390520	NM_001122659	A2A2Z8|A8K3T4|O15343|Q59GB1|Q5W0G9|Q8NHM6|Q8NHM7|Q8NHM8|Q8NHM9|Q9UD23|Q9UQK3	Missense_Mutation	SNP	ENST00000334286.5	37	CCDS9461.1	.	.	.	.	.	.	.	.	.	.	G	9.291	1.050745	0.19827	0.0	1.16E-4	ENSG00000136160	ENST00000377211;ENST00000446573;ENST00000334286	T;T;T	0.72835	-0.69;-0.48;-0.62	4.57	0.523	0.17060	.	1.757240	0.02647	N	0.105982	T	0.56262	0.1973	N	0.22421	0.69	0.09310	N	1	B;B;B	0.14438	0.002;0.01;0.003	B;B;B	0.09377	0.001;0.004;0.001	T	0.37865	-0.9687	10	0.54805	T	0.06	2.4825	3.6334	0.08140	0.1549:0.2303:0.4956:0.1192	.	64;154;64	P24530-2;P24530-3;P24530	.;.;EDNRB_HUMAN	W	154;64;64	ENSP00000366416:R154W;ENSP00000403401:R64W;ENSP00000335311:R64W	ENSP00000335311:R64W	R	-	1	2	EDNRB	77390520	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.028000	0.13644	-0.463000	0.06973	-1.378000	0.01179	CGG		EDNRB-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276505.1		
SIX4	51804	broad.mit.edu	37	14	61180295	61180295	+	Silent	SNP	A	A	G			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr14:61180295A>G	ENST00000216513.4	-	3	2235	c.2176T>C	c.(2176-2178)Tta>Cta	p.L726L		NM_017420.4	NP_059116.3	Q9UIU6	SIX4_HUMAN	SIX homeobox 4	726					anatomical structure morphogenesis (GO:0009653)|embryonic cranial skeleton morphogenesis (GO:0048701)|generation of neurons (GO:0048699)|inner ear morphogenesis (GO:0042472)|metanephric mesenchyme development (GO:0072075)|myoblast migration (GO:0051451)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of ureteric bud formation (GO:0072107)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of protein localization (GO:0032880)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|skeletal muscle tissue development (GO:0007519)|thymus development (GO:0048538)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L726L(1)		breast(5)|endometrium(1)|large_intestine(11)|liver(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28				OV - Ovarian serous cystadenocarcinoma(108;0.0275)		GAATTTGATAAGAAATTCTCT	0.418																																					p.L726L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2176C	14						.						115.0	111.0	112.0					14																	61180295		2203	4300	6503	60250048	SO:0001819	synonymous_variant	51804	exon3			AB024687	CCDS9749.2	14q23.1	2012-10-02	2007-07-13		ENSG00000100625	ENSG00000100625		"""Homeoboxes / SINE class"""	10890	protein-coding gene	gene with protein product		606342	"""sine oculis homeobox (Drosophila) homolog 4"", ""sine oculis homeobox homolog 4 (Drosophila)"""			10512683, 10640827	Standard	NM_017420		Approved	AREC3	uc001xfc.3	Q9UIU6	OTTHUMG00000028996	ENST00000216513.4:c.2176T>C	14.37:g.61180295A>G		Somatic		Capture	Illumina HiSeq	Phase_I	60250048	NM_017420	Q4QQH5|Q4V764	Silent	SNP	ENST00000216513.4	37	CCDS9749.2																																																																																				SIX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072397.2		
ATG2B	55102	broad.mit.edu	37	14	96781571	96781571	+	Splice_Site	SNP	C	C	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr14:96781571C>A	ENST00000359933.4	-	23	4455	c.3562G>T	c.(3562-3564)Gaa>Taa	p.E1188*		NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	1188					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)		p.E1188*(1)		breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		ATGAGAAATTCCTATACAGAA	0.368																																					p.E1188X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G3562T	14						.						33.0	31.0	32.0					14																	96781571		2203	4300	6503	95851324	SO:0001630	splice_region_variant	55102	exon23			AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.3562-1G>T	14.37:g.96781571C>A		Somatic		Capture	Illumina HiSeq	Phase_I	95851324	NM_018036	Q6ZRE7|Q96DQ3|Q9NW80	Nonsense_Mutation	SNP	ENST00000359933.4	37	CCDS9944.2	.	.	.	.	.	.	.	.	.	.	C	49	15.509806	0.99836	.	.	ENSG00000066739	ENST00000359933	.	.	.	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	.	14.5097	0.67776	0.1467:0.8533:0.0:0.0	.	.	.	.	X	1188	.	ENSP00000353010:E1188X	E	-	1	0	ATG2B	95851324	1.000000	0.71417	0.998000	0.56505	0.816000	0.46133	6.915000	0.75770	2.730000	0.93505	0.591000	0.81541	GAA		ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314037.1	NM_018036	Nonsense_Mutation
EIF2AK4	440275	broad.mit.edu	37	15	40324401	40324401	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr15:40324401A>G	ENST00000263791.5	+	36	4734	c.4691A>G	c.(4690-4692)aAc>aGc	p.N1564S	EIF2AK4_ENST00000382727.2_Missense_Mutation_p.N1536S	NM_001013703.2	NP_001013725.2	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha kinase 4	1564					cellular response to starvation (GO:0009267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of translation (GO:0017148)|protein phosphorylation (GO:0006468)|regulation of translational initiation (GO:0006446)|regulation of translational initiation in response to stress (GO:0043558)	cytosolic ribosome (GO:0022626)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|protein serine/threonine kinase activity (GO:0004674)	p.N1564S(1)		NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)	40		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		TCCCTTGCCAACTTACATCAG	0.383																																					p.N1564S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4691G	15						.						192.0	178.0	182.0					15																	40324401		1849	4095	5944	38111693	SO:0001583	missense	440275	exon36			AB037759	CCDS42016.1	15q13.3	2008-08-18				ENSG00000128829			19687	protein-coding gene	gene with protein product		609280				10504407	Standard	XM_005254392		Approved	GCN2, KIAA1338	uc001zkm.1	Q9P2K8		ENST00000263791.5:c.4691A>G	15.37:g.40324401A>G	ENSP00000263791:p.Asn1564Ser	Somatic		Capture	Illumina HiSeq	Phase_I	38111693	NM_001013703	C9JEC4|Q69YL7|Q6DC97|Q96GN6|Q9H5K1|Q9NSQ3|Q9NSZ5|Q9UJ56	Missense_Mutation	SNP	ENST00000263791.5	37	CCDS42016.1	.	.	.	.	.	.	.	.	.	.	A	14.45	2.538261	0.45176	.	.	ENSG00000128829	ENST00000263791;ENST00000382727	T;T	0.40225	1.04;1.04	6.17	6.17	0.99709	Serine/threonine-protein kinase GCN2, anticodon binding domain (1);	0.095743	0.64402	D	0.000001	T	0.22513	0.0543	N	0.14661	0.345	0.38477	D	0.947615	B;B	0.17465	0.018;0.022	B;B	0.19946	0.016;0.027	T	0.21008	-1.0258	10	0.08381	T	0.77	-30.2781	8.0364	0.30495	0.7916:0.1381:0.0702:0.0	.	1536;1564	Q9P2K8-2;Q9P2K8	.;E2AK4_HUMAN	S	1564;1536	ENSP00000263791:N1564S;ENSP00000372174:N1536S	ENSP00000263791:N1564S	N	+	2	0	EIF2AK4	38111693	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.187000	0.42602	2.371000	0.80710	0.533000	0.62120	AAC		EIF2AK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418395.1		
DET1	55070	broad.mit.edu	37	15	89074044	89074044	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr15:89074044C>T	ENST00000268148.8	-	2	1038	c.893G>A	c.(892-894)cGg>cAg	p.R298Q	DET1_ENST00000444300.1_Missense_Mutation_p.R309Q|DET1_ENST00000558413.1_3'UTR|DET1_ENST00000564406.1_Missense_Mutation_p.R309Q|DET1_ENST00000559656.1_5'Flank	NM_001144074.1	NP_001137546.1	Q7L5Y6	DET1_HUMAN	de-etiolated homolog 1 (Arabidopsis)	298						nucleus (GO:0005634)		p.R309Q(1)|p.R309L(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(10)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	Lung NSC(78;0.105)|all_lung(78;0.182)		BRCA - Breast invasive adenocarcinoma(143;0.188)			TACCAGCAACCGGTGTTTGAG	0.532																																					p.R298Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G893A	15						.						43.0	44.0	43.0					15																	89074044		1944	4149	6093	86875048	SO:0001583	missense	55070	exon2			BC001242	CCDS45343.1, CCDS45344.1	15q25.3	2004-12-13				ENSG00000140543			25477	protein-coding gene	gene with protein product		608727				14739464	Standard	NM_001144074		Approved	FLJ10103	uc002bmq.2	Q7L5Y6		ENST00000268148.8:c.893G>A	15.37:g.89074044C>T	ENSP00000268148:p.Arg298Gln	Somatic		Capture	Illumina HiSeq	Phase_I	86875048	NM_001144074	B3KNN6|Q2VPC0|Q9NWD5	Missense_Mutation	SNP	ENST00000268148.8	37	CCDS45344.1	.	.	.	.	.	.	.	.	.	.	C	32	5.136153	0.94517	.	.	ENSG00000140543	ENST00000444300;ENST00000268148	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.84325	0.5447	M	0.86651	2.83	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.65323	0.934;0.934	D	0.85450	0.1160	9	0.72032	D	0.01	-37.6227	19.8676	0.96824	0.0:1.0:0.0:0.0	.	298;309	Q7L5Y6;B3KNN6	DET1_HUMAN;.	Q	309;298	.	ENSP00000268148:R298Q	R	-	2	0	DET1	86875048	1.000000	0.71417	1.000000	0.80357	0.795000	0.44927	7.097000	0.76967	2.941000	0.99782	0.655000	0.94253	CGG		DET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415442.2	NM_017996	
NGRN	51335	broad.mit.edu	37	15	90814447	90814447	+	Silent	SNP	C	C	G			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr15:90814447C>G	ENST00000379095.3	+	3	311	c.303C>G	c.(301-303)tcC>tcG	p.S101S	RP11-697E2.6_ENST00000561573.1_3'UTR|NGRN_ENST00000331497.3_3'UTR	NM_001033088.1	NP_001028260.2	Q9NPE2	NGRN_HUMAN	neugrin, neurite outgrowth associated	101					neuron differentiation (GO:0030182)	extracellular region (GO:0005576)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.S29S(1)|p.S101S(1)		kidney(2)|large_intestine(4)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	11	Melanoma(11;0.00551)|Lung NSC(78;0.0178)|all_lung(78;0.0378)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|BRCA - Breast invasive adenocarcinoma(143;0.0323)|Kidney(142;0.0514)			TTCCAGAGTCCTGGTCAGTTC	0.438																																					p.S101S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C303G	15						.						90.0	91.0	91.0					15																	90814447		2199	4298	6497	88615451	SO:0001819	synonymous_variant	51335	exon3			AB029315	CCDS32329.1	15q26.1	2008-02-05			ENSG00000182768	ENSG00000182768			18077	protein-coding gene	gene with protein product						11118320	Standard	NR_028052		Approved	DSC92	uc002bpf.1	Q9NPE2	OTTHUMG00000149807	ENST00000379095.3:c.303C>G	15.37:g.90814447C>G		Somatic		Capture	Illumina HiSeq	Phase_I	88615451	NM_001033088	B2R6M8|Q4V9L7|Q9HBL4	Silent	SNP	ENST00000379095.3	37	CCDS32329.1																																																																																				NGRN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313418.1		
TRAF7	84231	broad.mit.edu	37	16	2225555	2225555	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr16:2225555A>T	ENST00000326181.6	+	17	1690	c.1558A>T	c.(1558-1560)Aac>Tac	p.N520Y		NM_032271.2	NP_115647.2	Q6Q0C0	TRAF7_HUMAN	TNF receptor-associated factor 7, E3 ubiquitin protein ligase	520					activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of MAPK cascade (GO:0043410)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic vesicle (GO:0031410)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.N520Y(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	23						CACAGGCCTCAACCACTGGGT	0.637																																					p.N520Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1558T	16						.						78.0	77.0	77.0					16																	2225555		2198	4300	6498	2165556	SO:0001583	missense	84231	exon17			AL136921	CCDS10461.1	16p13.3	2013-01-10	2012-02-23	2004-06-04	ENSG00000131653	ENSG00000131653		"""RING-type (C3HC4) zinc fingers"", ""WD repeat domain containing"""	20456	protein-coding gene	gene with protein product		606692	"""ring finger and WD repeat domain 1"", ""TNF receptor-associated factor 7"""	RFWD1		11230166, 15001576	Standard	NM_032271		Approved	RNF119, DKFZp586I021, MGC7807	uc002cow.3	Q6Q0C0	OTTHUMG00000128826	ENST00000326181.6:c.1558A>T	16.37:g.2225555A>T	ENSP00000318944:p.Asn520Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	2165556	NM_032271	Q9H073	Missense_Mutation	SNP	ENST00000326181.6	37	CCDS10461.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.594793	0.86953	.	.	ENSG00000131653	ENST00000326181	T	0.60797	0.16	4.49	4.49	0.54785	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.74427	0.3715	M	0.75264	2.295	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.78280	-0.2265	10	0.87932	D	0	-55.8238	13.3899	0.60818	1.0:0.0:0.0:0.0	.	520	Q6Q0C0	TRAF7_HUMAN	Y	520	ENSP00000318944:N520Y	ENSP00000318944:N520Y	N	+	1	0	TRAF7	2165556	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.237000	0.89807	2.026000	0.59711	0.459000	0.35465	AAC		TRAF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250762.1	NM_032271	
SLFN12L	100506736	broad.mit.edu	37	17	33806619	33806620	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr17:33806619_33806620insA	ENST00000260908.7	-	2	726_727	c.609_610insT	c.(607-612)tttaacfs	p.N204fs	SLFN12L_ENST00000361112.4_Frame_Shift_Ins_p.N233fs|SLFN12L_ENST00000449046.1_Frame_Shift_Ins_p.N235fs|RP11-686D22.9_ENST00000587076.1_RNA	NM_001195790.1	NP_001182719.1	Q6IEE8	SN12L_HUMAN	schlafen family member 12-like	204						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)	p.N235fs*1(4)		breast(1)|endometrium(4)|kidney(5)|large_intestine(2)|lung(3)|ovary(1)	16						TCTGTTCTGTTAAAAAAATCAG	0.371																																					p.N204_R205delinsX												.	.	4	Insertion - Frameshift(4)	large_intestine(4)	c.610_611insT	17						.			0,3970		0,0,1985						2.6	0.7			64	3,8049		0,3,4023	no	frameshift	SLFN12L	NM_001195790.1		0,3,6008	A1A1,A1R,RR		0.0373,0.0,0.025				3,12019				30830733	SO:0001589	frameshift_variant	342615	exon2			AK172761	CCDS56026.1	17q12	2011-05-24				ENSG00000205045			33920	protein-coding gene	gene with protein product		614956				9846487	Standard	NM_001195790		Approved		uc021tuy.1	Q6IEE8		ENST00000260908.7:c.610dupT	17.37:g.33806626_33806626dupA	ENSP00000437635:p.Asn204fs	Somatic		Capture	Illumina HiSeq	Phase_I	30830732	NM_001195790	F5H6G3	Frame_Shift_Ins	INS	ENST00000260908.7	37	CCDS56026.1																																																																																				SLFN12L-004	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395748.2	XM_496206	
UTP6	55813	broad.mit.edu	37	17	30205291	30205291	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr17:30205291G>A	ENST00000261708.4	-	13	1240	c.1103C>T	c.(1102-1104)tCa>tTa	p.S368L	CTC-542B22.2_ENST00000583236.1_lincRNA	NM_018428.2	NP_060898.2	Q9NYH9	UTP6_HUMAN	UTP6, small subunit (SSU) processome component, homolog (yeast)	368					rRNA processing (GO:0006364)	nucleolus (GO:0005730)		p.S368L(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|skin(1)	21		all_hematologic(16;0.0149)|Ovarian(249;0.021)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|Breast(31;0.231)				TTGGCATTCTGACAGAAGCTT	0.388																																					p.S368L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1103T	17						.						162.0	156.0	158.0					17																	30205291		2203	4300	6503	27229404	SO:0001583	missense	55813	exon13			AF116631	CCDS11269.1	17q11.2	2010-06-24	2006-05-16	2006-05-16	ENSG00000108651	ENSG00000108651			18279	protein-coding gene	gene with protein product	"""hepatocellular carcinoma associated antigen 66"""		"""chromosome 17 open reading frame 40"""	C17orf40		10843809, 16138909	Standard	NM_018428		Approved	HCA66	uc002hgr.3	Q9NYH9	OTTHUMG00000132815	ENST00000261708.4:c.1103C>T	17.37:g.30205291G>A	ENSP00000261708:p.Ser368Leu	Somatic		Capture	Illumina HiSeq	Phase_I	27229404	NM_018428	Q8IX96|Q96BL2|Q9NQ91	Missense_Mutation	SNP	ENST00000261708.4	37	CCDS11269.1	.	.	.	.	.	.	.	.	.	.	G	5.394	0.257871	0.10239	.	.	ENSG00000108651	ENST00000261708	T	0.32272	1.46	5.03	1.88	0.25563	.	0.512696	0.22116	N	0.064420	T	0.20740	0.0499	L	0.40543	1.245	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.09377	0.004;0.004	T	0.17018	-1.0383	10	0.30854	T	0.27	0.087	6.1924	0.20532	0.0879:0.0:0.5834:0.3287	.	368;368	B3KQ21;Q9NYH9	.;UTP6_HUMAN	L	368	ENSP00000261708:S368L	ENSP00000261708:S368L	S	-	2	0	UTP6	27229404	0.054000	0.20591	0.003000	0.11579	0.061000	0.15899	2.435000	0.44811	0.237000	0.21200	-0.158000	0.13435	TCA		UTP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256265.2	NM_018428	
CCR7	1236	broad.mit.edu	37	17	38711595	38711595	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr17:38711595C>A	ENST00000246657.2	-	3	598	c.536G>T	c.(535-537)tGt>tTt	p.C179F	CCR7_ENST00000579344.1_Missense_Mutation_p.C173F	NM_001838.3	NP_001829.1	P32248	CCR7_HUMAN	chemokine (C-C motif) receptor 7	179					activation of Rho GTPase activity (GO:0032862)|cellular response to cytokine stimulus (GO:0071345)|chemokine (C-C motif) ligand 19 signaling pathway (GO:0038115)|chemokine (C-C motif) ligand 21 signaling pathway (GO:0038116)|chemokine-mediated signaling pathway (GO:0070098)|dendritic cell chemotaxis (GO:0002407)|establishment of T cell polarity (GO:0001768)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interleukin-12 secretion (GO:0072610)|lymphocyte migration into lymph node (GO:0097022)|mature dendritic cell differentiation (GO:0097029)|myeloid dendritic cell chemotaxis (GO:0002408)|negative regulation of leukocyte apoptotic process (GO:2000107)|negative thymic T cell selection (GO:0045060)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell motility (GO:2000147)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of glycoprotein biosynthetic process involved in immunological synapse formation (GO:2000526)|positive regulation of humoral immune response (GO:0002922)|positive regulation of hypersensitivity (GO:0002885)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of immunological synapse formation (GO:2000522)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of T cell costimulation (GO:2000525)|positive regulation of T cell receptor signaling pathway (GO:0050862)|regulation of dendritic cell dendrite assembly (GO:2000547)|regulation of interferon-gamma production (GO:0032649)|regulation of interleukin-1 beta secretion (GO:0050706)|release of sequestered calcium ion into cytosol (GO:0051209)|response to lipopolysaccharide (GO:0032496)|response to nitric oxide (GO:0071731)|response to prostaglandin E (GO:0034695)|ruffle organization (GO:0031529)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|C-C motif chemokine 19 receptor activity (GO:0038117)|C-C motif chemokine 21 receptor activity (GO:0038121)|chemokine (C-C motif) ligand 19 binding (GO:0035757)|chemokine (C-C motif) ligand 21 binding (GO:0035758)|G-protein coupled receptor activity (GO:0004930)	p.C179F(1)		breast(1)|large_intestine(4)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		Breast(137;0.000496)				GATGCCCACACAGGACAGCTT	0.582																																					p.C179F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G536T	17						.						71.0	61.0	65.0					17																	38711595		2203	4300	6503	35965121	SO:0001583	missense	1236	exon3				CCDS11369.1	17q12-q21.2	2012-08-08			ENSG00000126353	ENSG00000126353		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1608	protein-coding gene	gene with protein product		600242		CMKBR7, EBI1		8383238	Standard	NM_001838		Approved	BLR2, CDw197, CD197	uc002huw.3	P32248	OTTHUMG00000133375	ENST00000246657.2:c.536G>T	17.37:g.38711595C>A	ENSP00000246657:p.Cys179Phe	Somatic		Capture	Illumina HiSeq	Phase_I	35965121	NM_001838		Missense_Mutation	SNP	ENST00000246657.2	37	CCDS11369.1	.	.	.	.	.	.	.	.	.	.	C	15.63	2.890320	0.52014	.	.	ENSG00000126353	ENST00000246657	T	0.72505	-0.66	5.16	4.16	0.48862	GPCR, rhodopsin-like superfamily (1);	0.166936	0.53938	N	0.000046	T	0.82084	0.4960	M	0.67397	2.05	0.47476	D	0.999438	D	0.89917	1.0	D	0.79784	0.993	D	0.84586	0.0664	10	0.87932	D	0	.	15.0038	0.71495	0.1434:0.8566:0.0:0.0	.	179	P32248	CCR7_HUMAN	F	179	ENSP00000246657:C179F	ENSP00000246657:C179F	C	-	2	0	CCR7	35965121	1.000000	0.71417	0.920000	0.36463	0.610000	0.37248	4.843000	0.62838	1.362000	0.46000	0.561000	0.74099	TGT		CCR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257222.1		
KRTAP4-3	85290	broad.mit.edu	37	17	39324303	39324303	+	Missense_Mutation	SNP	C	C	T	rs369554170		TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr17:39324303C>T	ENST00000391356.2	-	1	121	c.122G>A	c.(121-123)cGc>cAc	p.R41H		NM_033187.1	NP_149443.1	Q9BYR4	KRA43_HUMAN	keratin associated protein 4-3	41	29 X 5 AA repeats of C-C-[GIKRQVH]-[SPT]- [STA].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.R41H(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	12		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			gcagctggggcggcagcagGT	0.652																																					p.R41H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G122A	17						.	C	HIS/ARG	0,4330		0,0,2165	19.0	21.0	20.0		122	0.2	0.0	17		20	1,8519		0,1,4259	no	missense	KRTAP4-3	NM_033187.1	29	0,1,6424	TT,TC,CC		0.0117,0.0,0.0078	probably-damaging	41/196	39324303	1,12849	2165	4260	6425	36577829	SO:0001583	missense	85290	exon1			AJ406935	CCDS42331.1	17q21.2	2013-06-25			ENSG00000196156	ENSG00000196156		"""Keratin associated proteins"""	18908	protein-coding gene	gene with protein product							Standard	NM_033187		Approved	KAP4.3	uc010cxl.3	Q9BYR4	OTTHUMG00000133639	ENST00000391356.2:c.122G>A	17.37:g.39324303C>T	ENSP00000375151:p.Arg41His	Somatic		Capture	Illumina HiSeq	Phase_I	36577829	NM_033187		Missense_Mutation	SNP	ENST00000391356.2	37	CCDS42331.1	.	.	.	.	.	.	.	.	.	.	.	12.45	1.940510	0.34283	0.0	1.17E-4	ENSG00000196156	ENST00000391356	T	0.01430	4.9	4.64	0.186	0.15105	.	31.832200	0.01201	U	0.007588	T	0.03305	0.0096	L	0.55834	1.745	0.09310	N	1	D	0.54207	0.965	P	0.49561	0.615	T	0.36890	-0.9729	10	0.46703	T	0.11	.	5.1247	0.14878	0.1567:0.5733:0.0:0.27	.	41	Q9BYR4	KRA43_HUMAN	H	41	ENSP00000375151:R41H	ENSP00000375151:R41H	R	-	2	0	KRTAP4-3	36577829	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.168000	0.16622	0.109000	0.17891	-0.218000	0.12543	CGC		KRTAP4-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257784.1		
TP53	7157	broad.mit.edu	37	17	7577550	7577550	+	Missense_Mutation	SNP	C	C	T	rs397516437		TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr17:7577550C>T	ENST00000269305.4	-	7	920	c.731G>A	c.(730-732)gGc>gAc	p.G244D	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.G244D|TP53_ENST00000445888.2_Missense_Mutation_p.G244D|TP53_ENST00000420246.2_Missense_Mutation_p.G244D|TP53_ENST00000455263.2_Missense_Mutation_p.G244D|TP53_ENST00000359597.4_Missense_Mutation_p.G244D	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	244	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> C (in sporadic cancers; somatic mutation).|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934572).|G -> E (in a sporadic cancer; somatic mutation).|G -> R (in sporadic cancers; somatic mutation).|G -> S (in sporadic cancers; somatic mutation).|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation).|MG -> IC (in a sporadic cancer; somatic mutation).|MG -> IS (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G244D(47)|p.G244V(14)|p.G244A(9)|p.0?(8)|p.?(5)|p.G151D(4)|p.G244fs*4(3)|p.G244_M246>V(3)|p.G244fs*19(1)|p.G151_M153>V(1)|p.G244fs*17(1)|p.M243fs*18(1)|p.G244E(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.C242_M246>L(1)|p.G244del(1)|p.G151fs*4(1)|p.C238_M246delCNSSCMGGM(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTTCATGCCGCCCATGCAGGA	0.577		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.G244D	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,central_nervous_system,brain,Substitution - Missense,+2 	.	104	Substitution - Missense(75)|Whole gene deletion(8)|Complex - deletion inframe(5)|Unknown(5)|Insertion - Frameshift(4)|Deletion - Frameshift(4)|Deletion - In frame(3)	large_intestine(21)|liver(16)|haematopoietic_and_lymphoid_tissue(9)|ovary(9)|stomach(7)|breast(7)|lung(7)|biliary_tract(6)|upper_aerodigestive_tract(4)|urinary_tract(4)|bone(4)|central_nervous_system(3)|oesophagus(2)|cervix(1)|vulva(1)|endometrium(1)|salivary_gland(1)|prostate(1)	c.G731A	17	GRCh37	CM056069|CM070298	TP53	M	rs28934572	.						148.0	111.0	124.0					17																	7577550		2203	4300	6503	7518275	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.731G>A	17.37:g.7577550C>T	ENSP00000269305:p.Gly244Asp	Somatic		Capture	Illumina HiSeq	Phase_I	7518275	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.842901	0.91197	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99900	-7.62;-7.62;-7.62;-7.62;-7.62;-7.62;-7.62;-7.62	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99894	0.9949	M	0.90759	3.145	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.997;1.0;1.0;1.0;1.0	D	0.96044	0.9026	10	0.87932	D	0	-29.0146	15.3618	0.74483	0.0:1.0:0.0:0.0	rs28934572	244;244;151;244;244;244	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	D	244;244;244;244;244;244;233;151;112;151	ENSP00000410739:G244D;ENSP00000352610:G244D;ENSP00000269305:G244D;ENSP00000398846:G244D;ENSP00000391127:G244D;ENSP00000391478:G244D;ENSP00000425104:G112D;ENSP00000423862:G151D	ENSP00000269305:G244D	G	-	2	0	TP53	7518275	1.000000	0.71417	0.965000	0.40720	0.979000	0.70002	7.609000	0.82925	2.564000	0.86499	0.462000	0.41574	GGC		TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
GH2	2689	broad.mit.edu	37	17	61958120	61958120	+	Intron	SNP	T	T	C			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr17:61958120T>C	ENST00000423893.2	-	4	518				GH2_ENST00000456543.2_Intron|GH2_ENST00000449787.2_Intron|GH2_ENST00000332800.7_Silent_p.A156A			P01242	SOM2_HUMAN	growth hormone 2						JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)	extracellular region (GO:0005576)	hormone activity (GO:0005179)	p.A156A(1)		breast(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	24						GGATCCCTGGTGCCACCCTCA	0.597																																					p.A156A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A468G	17						.						83.0	82.0	83.0					17																	61958120		2203	4300	6503	59311852	SO:0001627	intron_variant	2689	exon4			J03756	CCDS11647.1, CCDS11648.1, CCDS45757.1, CCDS45758.1	17q22-q24	2014-01-30						"""Endogenous ligands"""	4262	protein-coding gene	gene with protein product	"""placental-specific growth hormone"", ""placenta-specific growth hormone"""	139240				6306568	Standard	NM_002059		Approved	GH-V, GHV, GHL, hGH-V	uc002jcl.2	P01242		ENST00000423893.2:c.456+11A>G	17.37:g.61958120T>C		Somatic		Capture	Illumina HiSeq	Phase_I	59311852	NM_022557	B1A4H5|B1A4H7|O14643|O14644|P09587	Silent	SNP	ENST00000423893.2	37	CCDS11647.1																																																																																				GH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417665.1	NM_002059	
PIEZO2	63895	broad.mit.edu	37	18	10680294	10680294	+	Silent	SNP	A	A	C			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr18:10680294A>C	ENST00000503781.3	-	48	7514	c.7515T>G	c.(7513-7515)tcT>tcG	p.S2505S	PIEZO2_ENST00000538948.1_Silent_p.S462S|PIEZO2_ENST00000285141.4_Silent_p.S297S|PIEZO2_ENST00000302079.6_Silent_p.S2442S|PIEZO2_ENST00000580640.1_Silent_p.S2530S|PIEZO2_ENST00000581680.1_5'UTR	NM_022068.2	NP_071351.2	Q9H5I5	PIEZ2_HUMAN	piezo-type mechanosensitive ion channel component 2	2505					cation transport (GO:0006812)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|regulation of membrane potential (GO:0042391)|response to mechanical stimulus (GO:0009612)	integral component of membrane (GO:0016021)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)	p.S2505S(1)|p.S297S(1)									TGGTCCACAAAGAATTTGAGT	0.408																																					p.S2505S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T7515G	18						.						199.0	192.0	194.0					18																	10680294		2203	4300	6503	10670294	SO:0001819	synonymous_variant	63895	exon48			AK027056		18p11.21	2012-11-19	2011-08-31	2011-08-31	ENSG00000154864	ENSG00000154864			26270	protein-coding gene	gene with protein product		613629	"""chromosome 18 open reading frame 30"", ""chromosome 18 open reading frame 58"", ""family with sequence similarity 38, member B"""	FAM38B2, C18orf30, C18orf58, FAM38B		20813920, 21056836, 21299953	Standard	NM_022068		Approved	FLJ23403, FLJ23144, HsT748, HsT771, FLJ34907	uc002kos.2	Q9H5I5	OTTHUMG00000178507	ENST00000503781.3:c.7515T>G	18.37:g.10680294A>C		Somatic		Capture	Illumina HiSeq	Phase_I	10670294	NM_022068	B7Z812|M4GPJ9|Q6ZS91|Q8N787|Q8NAR6|Q9H5R4	Silent	SNP	ENST00000503781.3	37																																																																																					PIEZO2-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000442385.4	NM_022068	
CYP4F8	11283	broad.mit.edu	37	19	15730493	15730493	+	RNA	SNP	C	C	T	rs558107890	byFrequency	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr19:15730493C>T	ENST00000441682.2	+	0	509							P98187	CP4F8_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 8						icosanoid metabolic process (GO:0006690)|prostaglandin metabolic process (GO:0006693)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alkane 1-monooxygenase activity (GO:0018685)|aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.R149C(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|skin(1)	26						ACACCACCGTCGCTTGTGACG	0.512													C|||	3	0.000599042	0.0008	0.0014	5008	,	,		20575	0.0		0.0	False		,,,				2504	0.001				p.R149C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C445T	19						.						71.0	71.0	71.0					19																	15730493		2203	4300	6503	15591493			11283	exon5			AF133298	CCDS74303.1	19p13.12	2013-11-11	2003-01-14		ENSG00000186526	ENSG00000186526		"""Cytochrome P450s"""	2648	protein-coding gene	gene with protein product		611545	"""cytochrome P450, subfamily IVF, polypeptide 8"""			10405341	Standard	NM_007253		Approved		uc002nbi.3	P98187	OTTHUMG00000182386		19.37:g.15730493C>T		Somatic		Capture	Illumina HiSeq	Phase_I	15591493	NM_007253		Splice_Site	SNP	ENST00000441682.2	37		.	.	.	.	.	.	.	.	.	.	.	6.599	0.478848	0.12581	.	.	ENSG00000186526	ENST00000441682	.	.	.	2.98	1.91	0.25777	.	0.083137	0.49305	U	0.000160	T	0.54565	0.1866	.	.	.	.	.	.	.	.	.	.	.	.	T	0.65557	-0.6139	5	0.87932	D	0	.	7.723	0.28744	0.0:0.8657:0.0:0.1343	.	.	.	.	C	149	.	ENSP00000409702:R149C	R	+	1	0	CYP4F8	15591493	0.980000	0.34600	0.221000	0.23827	0.033000	0.12548	2.489000	0.45285	0.595000	0.29777	0.313000	0.20887	CGC		CYP4F8-201	KNOWN	basic	processed_transcript	processed_transcript		NM_007253	
AXL	558	broad.mit.edu	37	19	41727944	41727944	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr19:41727944G>A	ENST00000301178.4	+	4	759	c.569G>A	c.(568-570)cGc>cAc	p.R190H	AXL_ENST00000359092.3_Missense_Mutation_p.R190H|CTD-2195B23.3_ENST00000598541.1_RNA	NM_001278599.1|NM_021913.3	NP_001265528.1|NP_068713	P30530	UFO_HUMAN	AXL receptor tyrosine kinase	190	Ig-like C2-type 2.				apoptotic cell clearance (GO:0043277)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to extracellular stimulus (GO:0031668)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interferon-alpha (GO:0035457)|cellular response to lipopolysaccharide (GO:0071222)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte homeostasis (GO:0034101)|forebrain cell migration (GO:0021885)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|natural killer cell differentiation (GO:0001779)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of tumor necrosis factor production (GO:0032720)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of protein kinase B signaling (GO:0051897)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|phosphatidylserine binding (GO:0001786)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.R190H(1)		breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	48						GGCCCCCAGCGCAGCCTGCAT	0.657																																					p.R190H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G569A	19						.						17.0	19.0	18.0					19																	41727944		2201	4297	6498	46419784	SO:0001583	missense	558	exon4			M76125	CCDS12574.1, CCDS12575.1, CCDS62677.1	19q13.1	2013-02-11				ENSG00000167601	2.7.10.1	"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	905	protein-coding gene	gene with protein product		109135				1656220	Standard	NM_021913		Approved	UFO, JTK11	uc010ehj.3	P30530		ENST00000301178.4:c.569G>A	19.37:g.41727944G>A	ENSP00000301178:p.Arg190His	Somatic		Capture	Illumina HiSeq	Phase_I	46419784	NM_021913	Q8N5L2|Q9UD27	Missense_Mutation	SNP	ENST00000301178.4	37	CCDS12575.1	.	.	.	.	.	.	.	.	.	.	G	11.72	1.723121	0.30503	.	.	ENSG00000167601	ENST00000301178;ENST00000359092	T;T	0.12569	2.67;2.67	3.86	0.374	0.16183	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.803958	0.11330	N	0.575102	T	0.06872	0.0175	N	0.13098	0.295	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.37244	-0.9714	10	0.34782	T	0.22	-5.7306	4.6792	0.12727	0.2992:0.3248:0.376:0.0	.	190;190	P30530-2;P30530	.;UFO_HUMAN	H	190	ENSP00000301178:R190H;ENSP00000351995:R190H	ENSP00000301178:R190H	R	+	2	0	AXL	46419784	0.006000	0.16342	0.513000	0.27749	0.508000	0.34012	0.359000	0.20233	0.137000	0.18759	0.298000	0.19748	CGC		AXL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463323.2		
CEACAM20	125931	broad.mit.edu	37	19	45026933	45026933	+	RNA	SNP	C	C	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr19:45026933C>A	ENST00000454753.1	-	0	759							Q6UY09	CEA20_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 20							integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)	15		Prostate(69;0.0352)				TCAACAGGATCAGGACCATCT	0.453																																					p.D161Y												.	.	0			c.G481T	19						.						55.0	58.0	57.0					19																	45026933		2081	4223	6304	49718773			125931	exon4			AY358129	CCDS74390.1, CCDS74391.1, CCDS74392.1, CCDS74393.1	19q13.31	2013-01-30			ENSG00000176395	ENSG00000273777		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	24879	protein-coding gene	gene with protein product						12975309	Standard	NM_001102600		Approved	UNQ9366	uc010ejo.1	Q6UY09	OTTHUMG00000151532		19.37:g.45026933C>A		Somatic		Capture	Illumina HiSeq	Phase_I	49718773	NM_001102597		Missense_Mutation	SNP	ENST00000454753.1	37																																																																																					CEACAM20-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000323032.1	NM_198444	
BRSK1	84446	broad.mit.edu	37	19	55805597	55805597	+	Silent	SNP	G	G	A	rs374051558		TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr19:55805597G>A	ENST00000309383.1	+	6	868	c.591G>A	c.(589-591)gcG>gcA	p.A197A	BRSK1_ENST00000590333.1_Silent_p.A213A|BRSK1_ENST00000585418.1_Silent_p.A197A	NM_032430.1	NP_115806.1	Q8TDC3	BRSK1_HUMAN	BR serine/threonine kinase 1	197	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axonogenesis (GO:0007409)|cellular response to DNA damage stimulus (GO:0006974)|centrosome duplication (GO:0051298)|establishment of cell polarity (GO:0030010)|G2 DNA damage checkpoint (GO:0031572)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|protein phosphorylation (GO:0006468)|response to UV (GO:0009411)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)	p.A197A(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(15)|ovary(2)|prostate(2)|skin(6)|stomach(1)	48		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)		CCCATTATGCGTGTCCAGAGG	0.617																																					p.A197A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G591A	19						.	G		0,4406		0,0,2203	82.0	84.0	83.0		591	-6.8	0.9	19		83	1,8599		0,1,4299	no	coding-synonymous	BRSK1	NM_032430.1		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		197/779	55805597	1,13005	2203	4300	6503	60497409	SO:0001819	synonymous_variant	84446	exon6			AB058714	CCDS12921.1	19q13.4	2008-02-05				ENSG00000160469			18994	protein-coding gene	gene with protein product		609235				14976552	Standard	NM_032430		Approved	KIAA1811	uc002qkg.3	Q8TDC3		ENST00000309383.1:c.591G>A	19.37:g.55805597G>A		Somatic		Capture	Illumina HiSeq	Phase_I	60497409	NM_032430	F1DG44|Q5J5B5|Q8NDD0|Q8NDR4|Q8TDC2|Q96AV4|Q96JL4	Silent	SNP	ENST00000309383.1	37	CCDS12921.1																																																																																				BRSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452787.1	NM_032430	
DRAM2	128338	broad.mit.edu	37	1	111667439	111667439	+	Silent	SNP	G	G	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr1:111667439G>T	ENST00000286692.4	-	5	881	c.264C>A	c.(262-264)atC>atA	p.I88I	DRAM2_ENST00000539140.1_Silent_p.I88I|DRAM2_ENST00000484310.1_5'UTR			Q6UX65	DRAM2_HUMAN	DNA-damage regulated autophagy modulator 2	88					apoptotic process (GO:0006915)|regulation of autophagy (GO:0010506)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|microtubule cytoskeleton (GO:0015630)		p.I88I(1)		endometrium(1)|large_intestine(5)|lung(3)	9						TTAATTTGATGATAACGTTCT	0.378																																					p.I88I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C264A	1						.						103.0	94.0	97.0					1																	111667439		2203	4300	6503	111468962	SO:0001819	synonymous_variant	128338	exon5			AY336747	CCDS30801.1	1p13.3	2010-07-08	2009-06-12	2009-06-12	ENSG00000156171	ENSG00000156171			28769	protein-coding gene	gene with protein product		613360	"""transmembrane protein 77"""	TMEM77		12975309	Standard	NM_178454		Approved	MGC54289, PRO180, WWFQ154, RP5-1180E21.1	uc001ead.4	Q6UX65	OTTHUMG00000011911	ENST00000286692.4:c.264C>A	1.37:g.111667439G>T		Somatic		Capture	Illumina HiSeq	Phase_I	111468962	NM_178454	B3SUG9|Q4VWF6|Q86VD3|Q8NBQ4	Silent	SNP	ENST00000286692.4	37	CCDS30801.1																																																																																				DRAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032930.3	NM_178454	
CSDE1	7812	broad.mit.edu	37	1	115269666	115269666	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr1:115269666G>C	ENST00000358528.4	-	13	1828	c.1402C>G	c.(1402-1404)Ctg>Gtg	p.L468V	CSDE1_ENST00000530886.1_Missense_Mutation_p.L338V|CSDE1_ENST00000438362.2_Missense_Mutation_p.L514V|CSDE1_ENST00000534699.1_Missense_Mutation_p.L468V|CSDE1_ENST00000261443.5_Missense_Mutation_p.L437V|CSDE1_ENST00000369530.1_Missense_Mutation_p.L483V|Y_RNA_ENST00000365030.1_RNA|CSDE1_ENST00000339438.6_Missense_Mutation_p.L437V	NM_001007553.2	NP_001007554.1	O75534	CSDE1_HUMAN	cold shock domain containing E1, RNA-binding	468	CSD 6.				male gonad development (GO:0008584)|nuclear-transcribed mRNA catabolic process, no-go decay (GO:0070966)|regulation of transcription, DNA-templated (GO:0006355)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.L468V(1)		NS(1)|breast(4)|endometrium(11)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	51	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;2.21e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCAATAGTCAGTTTCACCCCA	0.393																																					p.L483V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1447G	1						.						158.0	136.0	143.0					1																	115269666		2203	4300	6503	115071189	SO:0001583	missense	7812	exon13				CCDS30811.1, CCDS30812.1, CCDS44197.1, CCDS55626.1	1p13.2	2011-11-02			ENSG00000009307	ENSG00000009307			29905	protein-coding gene	gene with protein product	"""upstream of NRAS"""	191510				2204029, 10048485	Standard	NM_007158		Approved	D1S155E, UNR	uc001efi.3	O75534	OTTHUMG00000012060	ENST00000358528.4:c.1402C>G	1.37:g.115269666G>C	ENSP00000351329:p.Leu468Val	Somatic		Capture	Illumina HiSeq	Phase_I	115071189	NM_001130523	A8K281|E9PGZ0|G5E9Q2|O94961|Q5TF04|Q5TF05|Q68DF1|Q68DI9|Q9Y2S4	Missense_Mutation	SNP	ENST00000358528.4	37	CCDS30812.1	.	.	.	.	.	.	.	.	.	.	G	9.495	1.101788	0.20632	.	.	ENSG00000009307	ENST00000339438;ENST00000438362;ENST00000358528;ENST00000261443;ENST00000530886;ENST00000369530;ENST00000534699	.	.	.	5.75	4.78	0.61160	.	0.300649	0.32416	N	0.006133	T	0.56077	0.1961	L	0.51422	1.61	0.41171	D	0.986163	B;B;D	0.56035	0.016;0.001;0.974	B;B;D	0.70487	0.014;0.003;0.969	T	0.56517	-0.7966	9	0.29301	T	0.29	-1.1878	10.2104	0.43136	0.1076:0.0:0.8924:0.0	.	483;468;514	E9PGZ0;O75534;G5E9Q2	.;CSDE1_HUMAN;.	V	437;514;468;437;338;483;468	.	ENSP00000261443:L437V	L	-	1	2	CSDE1	115071189	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.283000	0.43470	1.272000	0.44329	0.655000	0.94253	CTG		CSDE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033397.1	NM_007158	
FLG	2312	broad.mit.edu	37	1	152287066	152287066	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr1:152287066T>C	ENST00000368799.1	-	3	331	c.296A>G	c.(295-297)cAc>cGc	p.H99R	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	99					establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.H99R(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCTGTGCTTGTGTCCTGATAT	0.353									Ichthyosis																												p.H99R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A296G	1						.						160.0	155.0	156.0					1																	152287066		2203	4300	6503	150553690	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.296A>G	1.37:g.152287066T>C	ENSP00000357789:p.His99Arg	Somatic		Capture	Illumina HiSeq	Phase_I	150553690	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	T	10.56	1.383115	0.25031	.	.	ENSG00000143631	ENST00000368799	T	0.00642	6.02	5.09	-6.23	0.02052	.	.	.	.	.	T	0.00144	0.0004	L	0.29908	0.895	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.39121	-0.9629	9	0.09084	T	0.74	-0.0237	4.119	0.10095	0.0954:0.1685:0.5745:0.1615	.	99	P20930	FILA_HUMAN	R	99	ENSP00000357789:H99R	ENSP00000357789:H99R	H	-	2	0	FLG	150553690	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.317000	0.02707	-1.290000	0.02372	-0.468000	0.05107	CAC		FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
SLC27A3	11000	broad.mit.edu	37	1	153745735	153745735	+	5'Flank	SNP	G	G	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr1:153745735G>T	ENST00000368661.3	+	0	0				INTS3_ENST00000456435.1_Missense_Mutation_p.D900Y|SLC27A3_ENST00000271857.2_5'Flank|INTS3_ENST00000512605.1_Missense_Mutation_p.D900Y|INTS3_ENST00000318967.2_Missense_Mutation_p.D1040Y|INTS3_ENST00000476843.1_3'UTR|INTS3_ENST00000435409.2_Missense_Mutation_p.D1040Y	NM_024330.1	NP_077306.1	Q5K4L6	S27A3_HUMAN	solute carrier family 27 (fatty acid transporter), member 3						fatty acid metabolic process (GO:0006631)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	fatty-acyl-CoA synthase activity (GO:0004321)|ligase activity (GO:0016874)|nucleotide binding (GO:0000166)	p.D1040Y(1)		NS(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	14	all_lung(78;6.47e-32)|Lung NSC(65;2.52e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			AGTGGGCTCTGACAGTGACTG	0.552																																					p.D1040Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3118T	1						.						157.0	158.0	158.0					1																	153745735		2203	4300	6503	152012359	SO:0001631	upstream_gene_variant	65123	exon30			BC009916	CCDS1053.1	1q21.1	2013-05-22			ENSG00000143554	ENSG00000143554		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10997	protein-coding gene	gene with protein product		604193				9671728	Standard	NM_024330		Approved	FATP3, MGC4365, ACSVL3	uc001fcz.3	Q5K4L6	OTTHUMG00000037155		1.37:g.153745735G>T	Exception_encountered	Somatic		Capture	Illumina HiSeq	Phase_I	152012359	NM_023015	Q5VUQ7|Q5VUQ8|Q5VUR3|Q6ZV16|Q8N2X7|Q8TEJ0|Q96SW5|Q9BTJ5|Q9BTY5	Missense_Mutation	SNP	ENST00000368661.3	37	CCDS1053.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.364064	0.82353	.	.	ENSG00000143624	ENST00000318967;ENST00000456435;ENST00000435409;ENST00000512605	.	.	.	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	T	0.58779	0.2146	L	0.55481	1.735	0.31275	N	0.691331	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.83275	0.996;0.99;0.996	T	0.59736	-0.7398	9	0.87932	D	0	.	13.549	0.61721	0.0:0.0:1.0:0.0	.	900;1041;1040	Q68E01-3;Q68E01;Q68E01-2	.;INT3_HUMAN;.	Y	1040;900;1040;900	.	ENSP00000318641:D1040Y	D	+	1	0	INTS3	152012359	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.606000	0.82863	2.569000	0.86673	0.485000	0.47835	GAC		SLC27A3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_024330	
NUP210L	91181	broad.mit.edu	37	1	153995648	153995648	+	Silent	SNP	G	G	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr1:153995648G>A	ENST00000368559.3	-	31	4319	c.4248C>T	c.(4246-4248)atC>atT	p.I1416I	NUP210L_ENST00000271854.3_Silent_p.I1416I|NUP210L_ENST00000368553.1_Silent_p.I349I	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	1416					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)		p.I1416I(1)		NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			ATTTCTCTCCGATACTATTAT	0.438																																					p.I1416I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4248T	1						.						121.0	118.0	119.0					1																	153995648		1900	4117	6017	152262272	SO:0001819	synonymous_variant	91181	exon31			AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.4248C>T	1.37:g.153995648G>A		Somatic		Capture	Illumina HiSeq	Phase_I	152262272	NM_207308	E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Silent	SNP	ENST00000368559.3	37	CCDS41399.1																																																																																				NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087270.3	NM_207308	
CDC73	79577	broad.mit.edu	37	1	193094339	193094339	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr1:193094339C>T	ENST00000367435.3	+	2	413	c.229C>T	c.(229-231)Cgt>Tgt	p.R77C		NM_024529.4	NP_078805.3	Q6P1J9	CDC73_HUMAN	cell division cycle 73	77					cell cycle (GO:0007049)|cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein destabilization (GO:0031648)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|nucleus (GO:0005634)	RNA polymerase II core binding (GO:0000993)	p.R77C(1)		breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(14)|ovary(1)|pancreas(1)|parathyroid(51)|skin(1)|upper_aerodigestive_tract(1)	87						TTATGTCCGACGTGCAGCTGT	0.393																																					p.R77C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C229T	1						.						140.0	140.0	140.0					1																	193094339		2203	4300	6503	191360962	SO:0001583	missense	79577	exon2			AF312865	CCDS1382.1	1q25	2014-09-17	2013-01-17	2005-07-20	ENSG00000134371	ENSG00000134371			16783	protein-coding gene	gene with protein product	"""Paf1/RNA polymerase II complex component"""	607393	"""chromosome 1 open reading frame 28"", ""hyperparathyroidism 2 (with jaw tumor)"", ""cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"", ""hyperparathyroidism 1"""	C1orf28, HRPT2, HRPT1		11318611, 15632063, 18755853	Standard	NM_024529		Approved	parafibromin, FIHP	uc001gtb.3	Q6P1J9	OTTHUMG00000035676	ENST00000367435.3:c.229C>T	1.37:g.193094339C>T	ENSP00000356405:p.Arg77Cys	Somatic		Capture	Illumina HiSeq	Phase_I	191360962	NM_024529	A6NLZ8|B2RBR2|Q6PK51|Q96A07|Q9H245|Q9H5L7	Missense_Mutation	SNP	ENST00000367435.3	37	CCDS1382.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.203475	0.79127	.	.	ENSG00000134371	ENST00000367435;ENST00000445394	D	0.85013	-1.93	5.88	4.95	0.65309	.	0.000000	0.85682	D	0.000000	D	0.88994	0.6589	L	0.51422	1.61	0.80722	D	1	D	0.89917	1.0	P	0.60236	0.871	D	0.90048	0.4147	10	0.72032	D	0.01	-9.511	16.2736	0.82632	0.1335:0.8665:0.0:0.0	.	77	Q6P1J9	CDC73_HUMAN	C	77	ENSP00000356405:R77C	ENSP00000356405:R77C	R	+	1	0	CDC73	191360962	1.000000	0.71417	0.992000	0.48379	0.987000	0.75469	3.848000	0.55903	1.439000	0.47511	0.655000	0.94253	CGT		CDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086696.2	NM_024529	
CFH	3075	broad.mit.edu	37	1	196716301	196716301	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr1:196716301C>A	ENST00000367429.4	+	22	3794	c.3554C>A	c.(3553-3555)gCc>gAc	p.A1185D		NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	1185	Sushi 20. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)	p.A1185D(1)		NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						AGGTGGACAGCCAAACAGAAG	0.348																																					p.A1185D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3554A	1						.						186.0	176.0	179.0					1																	196716301		2203	4300	6503	194982924	SO:0001583	missense	3075	exon22			Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.3554C>A	1.37:g.196716301C>A	ENSP00000356399:p.Ala1185Asp	Somatic		Capture	Illumina HiSeq	Phase_I	194982924	NM_000186	A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	ENST00000367429.4	37	CCDS1385.1	.	.	.	.	.	.	.	.	.	.	.	10.70	1.423899	0.25639	.	.	ENSG00000000971	ENST00000367429	T	0.81415	-1.49	4.35	-5.01	0.02991	Complement control module (1);Sushi/SCR/CCP (1);	.	.	.	.	T	0.49287	0.1548	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.43147	-0.9409	9	0.15499	T	0.54	.	7.7427	0.28851	0.308:0.5343:0.1577:0.0	.	1185	P08603	CFAH_HUMAN	D	1185	ENSP00000356399:A1185D	ENSP00000356399:A1185D	A	+	2	0	CFH	194982924	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.905000	0.01591	-1.064000	0.03172	-0.538000	0.04264	GCC		CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086412.2	NM_000186	
PROX1	5629	broad.mit.edu	37	1	214171516	214171516	+	Silent	SNP	C	C	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr1:214171516C>T	ENST00000366958.4	+	2	2246	c.1638C>T	c.(1636-1638)acC>acT	p.T546T	PROX1_ENST00000435016.1_Silent_p.T546T|PROX1_ENST00000498508.2_Silent_p.T546T|PROX1_ENST00000261454.4_Silent_p.T546T	NM_001270616.1	NP_001257545.1	Q92786	PROX1_HUMAN	prospero homeobox 1	546					aorta smooth muscle tissue morphogenesis (GO:0060414)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|brain development (GO:0007420)|cell fate determination (GO:0001709)|cerebellar granule cell differentiation (GO:0021707)|dentate gyrus development (GO:0021542)|dorsal spinal cord development (GO:0021516)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocardium formation (GO:0060214)|hepatocyte cell migration (GO:0002194)|hepatocyte differentiation (GO:0070365)|hepatocyte proliferation (GO:0072574)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lens fiber cell morphogenesis (GO:0070309)|liver development (GO:0001889)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of cell proliferation (GO:0008285)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|olfactory placode formation (GO:0030910)|optic placode formation involved in camera-type eye formation (GO:0046619)|otic placode formation (GO:0043049)|pancreas development (GO:0031016)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell cycle checkpoint (GO:1901978)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of forebrain neuron differentiation (GO:2000979)|positive regulation of heart growth (GO:0060421)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of gene expression (GO:0010468)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to nutrient levels (GO:0031667)|retina morphogenesis in camera-type eye (GO:0060042)|skeletal muscle thin filament assembly (GO:0030240)|venous blood vessel morphogenesis (GO:0048845)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DBD domain binding (GO:0050692)|DNA binding (GO:0003677)|LBD domain binding (GO:0050693)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)	p.T546T(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|prostate(2)|skin(4)	47				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		CGCCCAGCACCGCCGAAGGGC	0.498																																					p.T546T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1638T	1						.						92.0	95.0	94.0					1																	214171516		2203	4300	6503	212238139	SO:0001819	synonymous_variant	5629	exon2			U44060	CCDS31021.1	1q41	2011-06-20	2007-06-01		ENSG00000117707	ENSG00000117707		"""Homeoboxes / PROS class"""	9459	protein-coding gene	gene with protein product		601546	"""prospero-related homeobox 1"""			8812486	Standard	NM_002763		Approved		uc001hkg.2	Q92786	OTTHUMG00000036946	ENST00000366958.4:c.1638C>T	1.37:g.214171516C>T		Somatic		Capture	Illumina HiSeq	Phase_I	212238139	NM_002763	A6NK29|A8K2B1|Q5SW76|Q8TB91	Silent	SNP	ENST00000366958.4	37	CCDS31021.1																																																																																				PROX1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089727.6	NM_002763	
USH2A	7399	broad.mit.edu	37	1	215901417	215901417	+	Silent	SNP	G	G	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr1:215901417G>A	ENST00000307340.3	-	61	12407	c.12021C>T	c.(12019-12021)gaC>gaT	p.D4007D	USH2A_ENST00000366943.2_Silent_p.D4007D	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4007	Fibronectin type-III 25. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.D4007D(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ATGTAGGATCGTCGGGTCTCT	0.453										HNSCC(13;0.011)																											p.D4007D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C12021T	1						.						135.0	127.0	130.0					1																	215901417		2203	4300	6503	213968040	SO:0001819	synonymous_variant	7399	exon61			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.12021C>T	1.37:g.215901417G>A		Somatic		Capture	Illumina HiSeq	Phase_I	213968040	NM_206933	Q5VVM9|Q6S362|Q9NS27	Silent	SNP	ENST00000307340.3	37	CCDS31025.1																																																																																				USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
EPHB2	2048	broad.mit.edu	37	1	23232533	23232533	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr1:23232533G>A	ENST00000400191.3	+	10	1837	c.1819G>A	c.(1819-1821)Gag>Aag	p.E607K	EPHB2_ENST00000374632.3_Missense_Mutation_p.E608K|EPHB2_ENST00000374627.1_Missense_Mutation_p.E602K|EPHB2_ENST00000374630.3_Missense_Mutation_p.E607K	NM_004442.6|NM_017449.3	NP_004433.2|NP_059145.2	P29323	EPHB2_HUMAN	EPH receptor B2	607					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|camera-type eye morphogenesis (GO:0048593)|central nervous system projection neuron axonogenesis (GO:0021952)|commissural neuron axon guidance (GO:0071679)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|ephrin receptor signaling pathway (GO:0048013)|inner ear morphogenesis (GO:0042472)|learning (GO:0007612)|negative regulation of axonogenesis (GO:0050771)|nervous system development (GO:0007399)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse assembly (GO:0051965)|regulation of body fluid levels (GO:0050878)|retinal ganglion cell axon guidance (GO:0031290)|urogenital system development (GO:0001655)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|protein tyrosine kinase activity (GO:0004713)|transmembrane-ephrin receptor activity (GO:0005005)	p.E607K(1)		NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(8)|stomach(1)|urinary_tract(1)	56		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		GGACCCCAACGAGGCAGTGCG	0.517																																					p.E607K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1819A	1						.						103.0	92.0	96.0					1																	23232533		2203	4300	6503	23105120	SO:0001583	missense	2048	exon10			AF025304	CCDS229.2, CCDS230.1	1p36.1-p35	2014-09-17	2004-10-28		ENSG00000133216	ENSG00000133216	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3393	protein-coding gene	gene with protein product		600997	"""EphB2"""	DRT, ERK, EPHT3		1648701	Standard	NM_017449		Approved	Hek5, Tyro5	uc001bge.3	P29323	OTTHUMG00000002881	ENST00000400191.3:c.1819G>A	1.37:g.23232533G>A	ENSP00000383053:p.Glu607Lys	Somatic		Capture	Illumina HiSeq	Phase_I	23105120	NM_017449	O43477|Q5T0U6|Q5T0U7|Q5T0U8	Missense_Mutation	SNP	ENST00000400191.3	37		.	.	.	.	.	.	.	.	.	.	G	25.6	4.652182	0.88056	.	.	ENSG00000133216	ENST00000374625;ENST00000374630;ENST00000400191;ENST00000374632;ENST00000374627	T;T;T;T	0.11063	2.81;2.81;2.81;2.81	5.01	5.01	0.66863	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.38480	0.1042	M	0.86502	2.82	0.80722	D	1	B;D;D;D	0.89917	0.063;1.0;1.0;0.995	B;D;D;P	0.70716	0.01;0.97;0.97;0.908	T	0.22591	-1.0212	10	0.46703	T	0.11	.	17.4757	0.87658	0.0:0.0:1.0:0.0	.	549;607;625;608	A6NJM0;P29323;Q4LE53;P29323-3	.;EPHB2_HUMAN;.;.	K	549;607;607;608;602	ENSP00000363761:E607K;ENSP00000383053:E607K;ENSP00000363763:E608K;ENSP00000363758:E602K	ENSP00000363755:E549K	E	+	1	0	EPHB2	23105120	1.000000	0.71417	0.992000	0.48379	0.626000	0.37791	9.601000	0.98297	2.774000	0.95407	0.644000	0.83932	GAG		EPHB2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000008060.2	NM_017449	
HHIPL2	79802	broad.mit.edu	37	1	222716915	222716915	+	Missense_Mutation	SNP	C	C	T	rs367983202		TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr1:222716915C>T	ENST00000343410.6	-	2	996	c.938G>A	c.(937-939)cGg>cAg	p.R313Q		NM_024746.3	NP_079022.2	Q6UWX4	HIPL2_HUMAN	HHIP-like 2	313					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)	p.R313Q(1)		NS(2)|endometrium(8)|kidney(4)|large_intestine(7)|lung(28)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59				GBM - Glioblastoma multiforme(131;0.0185)		AGGATCAGCCCGAGAAACCTT	0.453																																					p.R313Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G938A	1						.	C	GLN/ARG	0,4406		0,0,2203	290.0	317.0	308.0		938	-2.8	0.1	1		308	1,8599	1.2+/-3.3	0,1,4299	no	missense	HHIPL2	NM_024746.3	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	313/725	222716915	1,13005	2203	4300	6503	220783538	SO:0001583	missense	79802	exon2			BC007638	CCDS1530.2	1q41	2008-02-05	2008-01-16	2008-01-16	ENSG00000143512	ENSG00000143512			25842	protein-coding gene	gene with protein product			"""KIAA1822-like"""	KIAA1822L		12975309	Standard	NM_024746		Approved	FLJ13840	uc001hnh.1	Q6UWX4	OTTHUMG00000037545	ENST00000343410.6:c.938G>A	1.37:g.222716915C>T	ENSP00000342118:p.Arg313Gln	Somatic		Capture	Illumina HiSeq	Phase_I	220783538	NM_024746	Q6GU65|Q96BT4|Q96BU5|Q9H8A0	Missense_Mutation	SNP	ENST00000343410.6	37	CCDS1530.2	.	.	.	.	.	.	.	.	.	.	C	9.020	0.984568	0.18889	0.0	1.16E-4	ENSG00000143512	ENST00000343410	T	0.13089	2.62	5.57	-2.82	0.05787	Soluble quinoprotein glucose/sorbosone dehydrogenase (1);Six-bladed beta-propeller, TolB-like (1);	0.742361	0.12465	N	0.466567	T	0.07279	0.0184	L	0.41492	1.28	0.09310	N	1	B	0.18863	0.031	B	0.16289	0.015	T	0.40194	-0.9576	10	0.18276	T	0.48	-8.0492	0.5366	0.00638	0.1926:0.2605:0.2318:0.3152	.	313	Q6UWX4	HIPL2_HUMAN	Q	313	ENSP00000342118:R313Q	ENSP00000342118:R313Q	R	-	2	0	HHIPL2	220783538	0.000000	0.05858	0.055000	0.19348	0.990000	0.78478	0.010000	0.13242	-0.535000	0.06307	0.591000	0.81541	CGG		HHIPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091499.2	NM_024746	
CEP104	9731	broad.mit.edu	37	1	3740069	3740069	+	Missense_Mutation	SNP	C	C	T	rs151278058		TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr1:3740069C>T	ENST00000378230.3	-	19	2746	c.2422G>A	c.(2422-2424)Ggg>Agg	p.G808R		NM_014704.3	NP_055519.1	O60308	CE104_HUMAN	centrosomal protein 104kDa	808						centriole (GO:0005814)	glutamate binding (GO:0016595)|glycine binding (GO:0016594)|thienylcyclohexylpiperidine binding (GO:0016596)	p.G808R(1)		breast(2)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(14)|lung(8)|prostate(1)|skin(3)	39						TTTCCAAACCCGTCTTTTTTG	0.493																																					p.G808R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2422A	1						.	C	ARG/GLY	0,4406		0,0,2203	182.0	161.0	168.0		2422	-4.0	0.0	1	dbSNP_134	168	1,8599	1.2+/-3.3	0,1,4299	no	missense	CEP104	NM_014704.3	125	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	808/926	3740069	1,13005	2203	4300	6503	3729929	SO:0001583	missense	9731	exon19			AB011134	CCDS30571.1	1p36.32	2014-02-20	2011-05-06	2011-05-06	ENSG00000116198	ENSG00000116198			24866	protein-coding gene	gene with protein product	"""glycine, glutamate, thienylcyclohexylpiperidine binding protein"""		"""KIAA0562"""	KIAA0562		7488117, 21399614	Standard	NM_014704		Approved	GlyBP, RP1-286D6.4	uc001aky.2	O60308	OTTHUMG00000003507	ENST00000378230.3:c.2422G>A	1.37:g.3740069C>T	ENSP00000367476:p.Gly808Arg	Somatic		Capture	Illumina HiSeq	Phase_I	3729929	NM_014704	Q5JSQ3|Q5SR24|Q5SR25|Q6PKF5|Q86W32|Q86X14	Missense_Mutation	SNP	ENST00000378230.3	37	CCDS30571.1	.	.	.	.	.	.	.	.	.	.	C	0.120	-1.127017	0.01770	0.0	1.16E-4	ENSG00000116198	ENST00000378230	T	0.28895	1.59	5.68	-4.02	0.04034	.	0.719715	0.13898	N	0.355089	T	0.19248	0.0462	L	0.57536	1.79	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.31971	-0.9924	10	0.16896	T	0.51	.	2.2621	0.04069	0.1933:0.262:0.0951:0.4495	.	808	O60308	CE104_HUMAN	R	808	ENSP00000367476:G808R	ENSP00000367476:G808R	G	-	1	0	CEP104	3729929	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.080000	0.14802	-0.796000	0.04456	-2.139000	0.00339	GGG		CEP104-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009747.3	NM_014704	
CLSTN1	22883	broad.mit.edu	37	1	9809562	9809562	+	Silent	SNP	G	G	A	rs183348898		TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr1:9809562G>A	ENST00000377298.4	-	7	1734	c.942C>T	c.(940-942)tgC>tgT	p.C314C	CLSTN1_ENST00000361311.4_Silent_p.C304C|CLSTN1_ENST00000377288.3_Silent_p.C314C	NM_001009566.1	NP_001009566.1	O94985	CSTN1_HUMAN	calsyntenin 1	314					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)|calcium ion binding (GO:0005509)|kinesin binding (GO:0019894)|X11-like protein binding (GO:0042988)	p.C314C(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(9)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	36	all_lung(157;0.222)	all_lung(284;4.03e-05)|Lung NSC(185;6.93e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;8.36e-08)|COAD - Colon adenocarcinoma(227;1.93e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)		TGTCTCGGTCGCAGCCTTTCC	0.577													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17918	0.0		0.0	False		,,,				2504	0.0				p.C304C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C912T	1						.						121.0	122.0	122.0					1																	9809562		2203	4300	6503	9732149	SO:0001819	synonymous_variant	22883	exon6			AB020718	CCDS105.1, CCDS30580.1	1p36.22	2011-07-01			ENSG00000171603	ENSG00000171603		"""Cadherins / Cadherin-related"""	17447	protein-coding gene	gene with protein product	"""cadherin-related family member 12"""	611321				10048485	Standard	XM_005263432		Approved	CSTN1, KIAA0911, CDHR12	uc001aqh.3	O94985	OTTHUMG00000001451	ENST00000377298.4:c.942C>T	1.37:g.9809562G>A		Somatic		Capture	Illumina HiSeq	Phase_I	9732149	NM_014944	A8K183|Q5SR52|Q5UE58|Q71MN0|Q8N4K9	Silent	SNP	ENST00000377298.4	37	CCDS30580.1																																																																																				CLSTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000004239.1		
OR2B11	127623	broad.mit.edu	37	1	247614486	247614486	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr1:247614486G>A	ENST00000318749.6	-	1	822	c.799C>T	c.(799-801)Cct>Tct	p.P267S		NM_001004492.1	NP_001004492.1	Q5JQS5	OR2BB_HUMAN	olfactory receptor, family 2, subfamily B, member 11	267						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P267S(1)		endometrium(3)|kidney(13)|large_intestine(7)|lung(31)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	60	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			TAGCTGGAAGGGGGCTGCAGA	0.498																																					p.P267S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C799T	1						.						152.0	156.0	155.0					1																	247614486		2203	4300	6503	245681109	SO:0001583	missense	127623	exon1				CCDS31090.1	1q44	2012-08-09			ENSG00000177535	ENSG00000177535		"""GPCR / Class A : Olfactory receptors"""	31249	protein-coding gene	gene with protein product							Standard	NM_001004492		Approved		uc010pyx.2	Q5JQS5	OTTHUMG00000040572	ENST00000318749.6:c.799C>T	1.37:g.247614486G>A	ENSP00000325682:p.Pro267Ser	Somatic		Capture	Illumina HiSeq	Phase_I	245681109	NM_001004492	B2RP03	Missense_Mutation	SNP	ENST00000318749.6	37	CCDS31090.1	.	.	.	.	.	.	.	.	.	.	G	14.00	2.405125	0.42613	.	.	ENSG00000177535	ENST00000318749	T	0.00069	8.77	5.09	3.22	0.36961	GPCR, rhodopsin-like superfamily (1);	0.254543	0.28198	N	0.016223	T	0.00073	0.0002	N	0.10972	0.075	0.28152	N	0.929348	B	0.16603	0.018	B	0.19666	0.026	T	0.00839	-1.1545	10	0.22109	T	0.4	.	9.7485	0.40462	0.169:0.0:0.831:0.0	.	267	Q5JQS5	OR2BB_HUMAN	S	267	ENSP00000325682:P267S	ENSP00000325682:P267S	P	-	1	0	OR2B11	245681109	0.000000	0.05858	0.255000	0.24374	0.959000	0.62525	-0.362000	0.07602	0.854000	0.35336	0.643000	0.83706	CCT		OR2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097620.1	NM_001004492	
ADAM33	80332	broad.mit.edu	37	20	3652816	3652816	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr20:3652816G>A	ENST00000356518.2	-	14	1803	c.1562C>T	c.(1561-1563)aCg>aTg	p.T521M	ADAM33_ENST00000350009.2_Missense_Mutation_p.T521M|ADAM33_ENST00000379861.4_Missense_Mutation_p.T521M|ADAM33_ENST00000466620.1_5'UTR	NM_025220.2	NP_079496.1	Q9BZ11	ADA33_HUMAN	ADAM metallopeptidase domain 33	521	Cys-rich.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.T521M(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|skin(3)	29						CTGCTCCAGCGTGGGACATGC	0.652																																					p.T521M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1562T	20						.						37.0	36.0	36.0					20																	3652816		2203	4299	6502	3600816	SO:0001583	missense	80332	exon14			AL117415, AB055891	CCDS13058.1, CCDS63219.1	20p13	2010-04-06	2005-08-18		ENSG00000149451	ENSG00000149451		"""ADAM metallopeptidase domain containing"""	15478	protein-coding gene	gene with protein product		607114	"""a disintegrin and metalloproteinase domain 33"", ""chromosome 20 open reading frame 153"""	C20orf153		11814695	Standard	XM_005260843		Approved	DKFZp434K0521, dJ964F7.1	uc002wit.3	Q9BZ11	OTTHUMG00000031758	ENST00000356518.2:c.1562C>T	20.37:g.3652816G>A	ENSP00000348912:p.Thr521Met	Somatic		Capture	Illumina HiSeq	Phase_I	3600816	NM_025220	A0A1K6|Q5JT75|Q5JT76|Q8N0W6	Missense_Mutation	SNP	ENST00000356518.2	37	CCDS13058.1	.	.	.	.	.	.	.	.	.	.	g	23.2	4.381907	0.82792	.	.	ENSG00000149451	ENST00000356518;ENST00000379861;ENST00000350009;ENST00000439201	T;T;T	0.24723	1.84;1.84;1.84	4.47	4.47	0.54385	ADAM, cysteine-rich (2);	.	.	.	.	T	0.56572	0.1994	M	0.86651	2.83	0.53005	D	0.999965	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.65438	-0.6168	9	0.66056	D	0.02	.	15.8669	0.79071	0.0:0.0:1.0:0.0	.	521;521;521	Q9BZ11-2;Q9BZ11;A2A2L3	.;ADA33_HUMAN;.	M	521;521;521;401	ENSP00000348912:T521M;ENSP00000369190:T521M;ENSP00000322550:T521M	ENSP00000322550:T521M	T	-	2	0	ADAM33	3600816	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	5.352000	0.66028	2.321000	0.78463	0.457000	0.33378	ACG		ADAM33-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077763.2	NM_025220	
CDH22	64405	broad.mit.edu	37	20	44879689	44879689	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr20:44879689T>C	ENST00000372262.3	-	1	645	c.245A>G	c.(244-246)tAt>tGt	p.Y82C	CDH22_ENST00000537909.1_Missense_Mutation_p.Y82C	NM_021248.1	NP_067071.1	Q9UJ99	CAD22_HUMAN	cadherin 22, type 2	82	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Y82C(1)		endometrium(3)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	44		Myeloproliferative disorder(115;0.0122)				CTTGCCCACATACAGGGGCTC	0.627																																					p.Y82C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A245G	20						.						34.0	36.0	35.0					20																	44879689		2203	4300	6503	44313096	SO:0001583	missense	64405	exon1			AF035300	CCDS13395.1	20q13.1	2010-01-26	2009-11-20		ENSG00000149654	ENSG00000149654		"""Cadherins / Major cadherins"""	13251	protein-coding gene	gene with protein product		609920	"""cadherin-like 22"""	C20orf25		8626716	Standard	NM_021248		Approved	dJ998H6.1	uc010ghk.2	Q9UJ99	OTTHUMG00000033073	ENST00000372262.3:c.245A>G	20.37:g.44879689T>C	ENSP00000361336:p.Tyr82Cys	Somatic		Capture	Illumina HiSeq	Phase_I	44313096	NM_021248	B9EGK7|O43205	Missense_Mutation	SNP	ENST00000372262.3	37	CCDS13395.1	.	.	.	.	.	.	.	.	.	.	t	14.25	2.478519	0.44044	.	.	ENSG00000149654	ENST00000372262;ENST00000537909	T;T	0.00587	6.38;6.38	3.45	3.45	0.39498	Cadherin (1);Cadherin-like (1);	0.000000	0.64402	U	0.000002	T	0.02888	0.0086	M	0.88775	2.98	0.50813	D	0.99989	D	0.89917	1.0	D	0.74023	0.982	T	0.29731	-1.0002	10	0.66056	D	0.02	.	9.7972	0.40742	0.0:0.0:0.0:1.0	.	82	Q9UJ99	CAD22_HUMAN	C	82	ENSP00000361336:Y82C;ENSP00000437790:Y82C	ENSP00000361336:Y82C	Y	-	2	0	CDH22	44313096	1.000000	0.71417	1.000000	0.80357	0.571000	0.35966	2.602000	0.46257	1.439000	0.47511	0.157000	0.16456	TAT		CDH22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080491.1	NM_021248	
GNAS	2778	broad.mit.edu	37	20	57429243	57429243	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr20:57429243C>T	ENST00000371100.4	+	1	1475	c.923C>T	c.(922-924)cCg>cTg	p.P308L	GNAS_ENST00000371099.2_Missense_Mutation_p.P308L|GNAS_ENST00000371098.2_Intron|GNAS_ENST00000306120.3_Missense_Mutation_p.R245C|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000313949.7_Intron|GNAS_ENST00000371102.4_Missense_Mutation_p.P308L|GNAS_ENST00000371075.3_Intron	NM_001077490.1|NM_080425.2	NP_001070958.1|NP_536350.2	P63092	GNAS2_HUMAN	GNAS complex locus	0					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.P308L(1)		adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			TCCGGACCCCCGTTCGAGATT	0.662			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											p.R246C	Colon(117;935 1597 6045 8307 46442)		Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C736T	20						.						18.0	21.0	20.0					20																	57429243		1889	4095	5984	56862638	SO:0001583	missense	2778	exon1			M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371100.4:c.923C>T	20.37:g.57429243C>T	ENSP00000360141:p.Pro308Leu	Somatic		Capture	Illumina HiSeq	Phase_I	56862638	NM_001077490	A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	ENST00000371100.4	37	CCDS46622.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	4.166|4.166	0.029265|0.029265	0.08054|0.08054	.|.	.|.	ENSG00000087460|ENSG00000087460	ENST00000371099;ENST00000371100;ENST00000371102|ENST00000306120	D;D|.	0.87966|.	-2.32;-2.32|.	3.76|3.76	-3.88|-3.88	0.04205|0.04205	.|.	12.479100|.	0.00166|.	N|.	0.000001|.	T|T	0.20088|0.20088	0.0483|0.0483	N|N	0.04508|0.04508	-0.205|-0.205	0.42098|0.42098	D|D	0.99132|0.99132	B|.	0.15473|.	0.013|.	B|.	0.04013|.	0.001|.	T|T	0.10776|0.10776	-1.0615|-1.0615	10|6	0.09843|0.45353	T|T	0.71|0.12	.|.	1.4312|1.4312	0.02334|0.02334	0.3915:0.307:0.1283:0.1732|0.3915:0.307:0.1283:0.1732	.|.	308|.	Q5JWF2|.	GNAS1_HUMAN|.	L|C	308|245	ENSP00000360141:P308L;ENSP00000360143:P308L|.	ENSP00000360140:P308L|ENSP00000302237:R245C	P|R	+|+	2|1	0|0	GNAS|GNAS	56862638|56862638	0.006000|0.006000	0.16342|0.16342	0.090000|0.090000	0.20809|0.20809	0.602000|0.602000	0.36980|0.36980	-0.734000|-0.734000	0.04893|0.04893	-0.740000|-0.740000	0.04803|0.04803	0.462000|0.462000	0.41574|0.41574	CCG|CGT		GNAS-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080417.3	NM_000516	
USP16	10600	broad.mit.edu	37	21	30415812	30415812	+	Silent	SNP	G	G	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr21:30415812G>A	ENST00000334352.4	+	14	1479	c.1248G>A	c.(1246-1248)gaG>gaA	p.E416E	USP16_ENST00000399975.3_Silent_p.E415E|USP16_ENST00000535828.1_Silent_p.E45E|USP16_ENST00000399976.2_Silent_p.E416E	NM_001032410.1	NP_001027582.1			ubiquitin specific peptidase 16									p.E416E(1)		breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(2)	34						AAGATAGTGAGGAAGAAAAAG	0.318																																					p.E415E	Melanoma(92;625 1444 27493 34101 44971)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1245A	21						.						90.0	82.0	85.0					21																	30415812		2203	4299	6502	29337683	SO:0001819	synonymous_variant	10600	exon13			AF126736	CCDS13583.1, CCDS42912.1	21q21	2008-04-11	2005-08-08		ENSG00000156256	ENSG00000156256		"""Ubiquitin-specific peptidases"""	12614	protein-coding gene	gene with protein product		604735	"""ubiquitin specific protease 16"""			12838346	Standard	NM_006447		Approved	Ubp-M	uc002ymy.3	Q9Y5T5	OTTHUMG00000078802	ENST00000334352.4:c.1248G>A	21.37:g.30415812G>A		Somatic		Capture	Illumina HiSeq	Phase_I	29337683	NM_001001992		Silent	SNP	ENST00000334352.4	37	CCDS13583.1																																																																																				USP16-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171847.1		
DIP2A	23181	broad.mit.edu	37	21	47971755	47971755	+	Missense_Mutation	SNP	G	G	A	rs375730938		TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr21:47971755G>A	ENST00000417564.2	+	25	2989	c.2968G>A	c.(2968-2970)Gtg>Atg	p.V990M	DIP2A_ENST00000318711.7_Missense_Mutation_p.V991M|DIP2A_ENST00000400274.1_Missense_Mutation_p.V986M|DIP2A_ENST00000427143.2_Missense_Mutation_p.V926M			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	990					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.V991M(1)|p.V990M(1)		cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		CCTGGCTGACGTGCTGCAGTG	0.652																																					p.V926M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2776A	21						.	G	MET/VAL,MET/VAL,MET/VAL	0,4380		0,0,2190	38.0	41.0	40.0		2776,2956,2968	5.3	0.9	21		40	1,8555		0,1,4277	no	missense,missense,missense	DIP2A	NM_001146114.1,NM_001146116.1,NM_015151.3	21,21,21	0,1,6467	AA,AG,GG		0.0117,0.0,0.0077	benign,benign,benign	926/1111,986/1568,990/1572	47971755	1,12935	2190	4278	6468	46796183	SO:0001583	missense	23181	exon23			AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.2968G>A	21.37:g.47971755G>A	ENSP00000392066:p.Val990Met	Somatic		Capture	Illumina HiSeq	Phase_I	46796183	NM_001146114	A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Missense_Mutation	SNP	ENST00000417564.2	37	CCDS46655.1	.	.	.	.	.	.	.	.	.	.	G	18.86	3.713157	0.68730	0.0	1.17E-4	ENSG00000160305	ENST00000400274;ENST00000427143;ENST00000318711;ENST00000417564	T;T;T;T	0.11277	2.79;2.79;2.79;2.79	5.34	5.34	0.76211	.	0.000000	0.64402	D	0.000001	T	0.16642	0.0400	L	0.31926	0.97	0.80722	D	1	D;D;P	0.58620	0.983;0.964;0.624	P;B;B	0.50791	0.65;0.158;0.097	T	0.00514	-1.1695	10	0.59425	D	0.04	-22.411	18.0294	0.89278	0.0:0.0:1.0:0.0	.	991;926;990	E9PER1;E7EMA5;Q14689	.;.;DIP2A_HUMAN	M	986;926;991;990	ENSP00000383133:V986M;ENSP00000400528:V926M;ENSP00000323633:V991M;ENSP00000392066:V990M	ENSP00000323633:V991M	V	+	1	0	DIP2A	46796183	1.000000	0.71417	0.929000	0.37066	0.919000	0.55068	7.856000	0.86956	2.489000	0.83994	0.655000	0.94253	GTG		DIP2A-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376736.1	NM_015151	
EMID1	129080	broad.mit.edu	37	22	29628274	29628274	+	Missense_Mutation	SNP	C	C	T	rs555505087	byFrequency	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr22:29628274C>T	ENST00000404820.3	+	8	833	c.706C>T	c.(706-708)Cgg>Tgg	p.R236W	EMID1_ENST00000404755.3_Missense_Mutation_p.R236W|EMID1_ENST00000334018.6_Missense_Mutation_p.R236W|EMID1_ENST00000484039.1_3'UTR			Q96A84	EMID1_HUMAN	EMI domain containing 1	234	Collagen-like.					collagen trimer (GO:0005581)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|proteinaceous extracellular matrix (GO:0005578)		p.R236W(1)		NS(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(2)|skin(3)	12						GAGCCCTGGCCGGGCTGGAGC	0.701													C|||	2	0.000399361	0.0008	0.0	5008	,	,		16614	0.0		0.001	False		,,,				2504	0.0				p.R236W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C706T	22						.						22.0	27.0	25.0					22																	29628274		2163	4224	6387	27958274	SO:0001583	missense	129080	exon8			AJ416090	CCDS33630.1	22q12.2	2009-08-04			ENSG00000186998	ENSG00000186998		"""EMI domain containing"""	18036	protein-coding gene	gene with protein product	"""emilin and multimerin-domain containing protein 1"", ""putative emu1"""	608926				12221002	Standard	NM_001267895		Approved	EMU1, hEmu1, EMI5	uc003aem.4	Q96A84	OTTHUMG00000151013	ENST00000404820.3:c.706C>T	22.37:g.29628274C>T	ENSP00000384452:p.Arg236Trp	Somatic		Capture	Illumina HiSeq	Phase_I	27958274	NM_133455	B0QYK6|Q6ICG1|Q86SS7	Missense_Mutation	SNP	ENST00000404820.3	37		.	.	.	.	.	.	.	.	.	.	C	19.56	3.851256	0.71719	.	.	ENSG00000186998	ENST00000334018;ENST00000404755;ENST00000404820	D;D;D	0.93604	-3.25;-3.25;-3.25	4.85	3.78	0.43462	.	0.331818	0.21698	N	0.070470	D	0.90273	0.6958	L	0.46670	1.46	0.27871	N	0.94003	D;D;D;P	0.56035	0.964;0.974;0.964;0.956	B;B;B;B	0.43990	0.373;0.438;0.373;0.257	D	0.86076	0.1541	10	0.66056	D	0.02	-3.7531	10.5469	0.45066	0.1915:0.8085:0.0:0.0	.	236;236;234;236	B0QYK4;B0QYK5;Q96A84;Q96A84-3	.;.;EMID1_HUMAN;.	W	236	ENSP00000335481:R236W;ENSP00000385414:R236W;ENSP00000384452:R236W	ENSP00000335481:R236W	R	+	1	2	EMID1	27958274	0.411000	0.25384	0.985000	0.45067	0.960000	0.62799	1.857000	0.39399	2.249000	0.74217	0.555000	0.69702	CGG		EMID1-002	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000321075.1	NM_133455	
NCKAP5	344148	broad.mit.edu	37	2	133540521	133540521	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr2:133540521G>A	ENST00000409261.1	-	14	4236	c.3863C>T	c.(3862-3864)aCg>aTg	p.T1288M	NCKAP5_ENST00000317721.6_Missense_Mutation_p.T1288M|NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000473859.1_5'Flank|NCKAP5_ENST00000409213.1_Intron	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1288								p.T1288M(1)		NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						GATGGGGGGCGTAGAAGGCTT	0.547																																					p.T1288M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3863T	2						.						92.0	93.0	93.0					2																	133540521		1992	4180	6172	133256991	SO:0001583	missense	344148	exon14			AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.3863C>T	2.37:g.133540521G>A	ENSP00000387128:p.Thr1288Met	Somatic		Capture	Illumina HiSeq	Phase_I	133256991	NM_207363	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	G	10.40	1.340678	0.24339	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.10960	2.82;2.82	5.5	4.62	0.57501	.	0.222920	0.22055	U	0.065246	T	0.07728	0.0194	L	0.29908	0.895	0.09310	N	0.999991	D	0.53619	0.961	B	0.38803	0.282	T	0.24728	-1.0152	10	0.52906	T	0.07	.	9.2728	0.37681	0.0754:0.1467:0.7778:0.0	.	1288	O14513	NCKP5_HUMAN	M	1288	ENSP00000387128:T1288M;ENSP00000380603:T1288M	ENSP00000380603:T1288M	T	-	2	0	NCKAP5	133256991	0.021000	0.18746	0.024000	0.17045	0.232000	0.25224	1.014000	0.29950	1.541000	0.49316	0.655000	0.94253	ACG		NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481	
NBAS	51594	broad.mit.edu	37	2	15564502	15564502	+	Silent	SNP	C	C	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr2:15564502C>T	ENST00000281513.5	-	23	2539	c.2514G>A	c.(2512-2514)acG>acA	p.T838T	NBAS_ENST00000441750.1_Silent_p.T838T	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	838					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)		p.T838T(2)		NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						CCTTCTCCACCGTAAGCTGGG	0.478																																					p.T838T												.	.	2	Substitution - coding silent(2)	ovary(1)|large_intestine(1)	c.G2514A	2						.						198.0	151.0	167.0					2																	15564502		2203	4300	6503	15481953	SO:0001819	synonymous_variant	51594	exon23			BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.2514G>A	2.37:g.15564502C>T		Somatic		Capture	Illumina HiSeq	Phase_I	15481953	NM_015909	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Silent	SNP	ENST00000281513.5	37	CCDS1685.1	.	.	.	.	.	.	.	.	.	.	C	0.460	-0.889359	0.02511	.	.	ENSG00000151779	ENST00000442506	.	.	.	5.37	-10.7	0.00240	.	.	.	.	.	T	0.34019	0.0883	.	.	.	0.58432	D	0.999995	.	.	.	.	.	.	T	0.41538	-0.9503	4	.	.	.	.	3.2258	0.06731	0.1351:0.2405:0.3765:0.2479	.	.	.	.	Q	6	.	.	R	-	2	0	NBAS	15481953	0.000000	0.05858	0.000000	0.03702	0.108000	0.19459	-2.646000	0.00860	-1.959000	0.01018	-1.224000	0.01588	CGG		NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909	
UBXN4	23190	broad.mit.edu	37	2	136533901	136533901	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr2:136533901G>T	ENST00000272638.9	+	10	1344	c.1033G>T	c.(1033-1035)Gca>Tca	p.A345S	UBXN4_ENST00000490163.1_3'UTR	NM_014607.3	NP_055422.1	Q92575	UBXN4_HUMAN	UBX domain protein 4	345	UBX. {ECO:0000255|PROSITE- ProRule:PRU00215}.				response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)		p.A345S(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	24						TCTAGAAGAGGCAAGGCAGTT	0.363																																					p.A345S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1033T	2						.						115.0	102.0	106.0					2																	136533901		1844	4085	5929	136250371	SO:0001583	missense	23190	exon10			D87684	CCDS42761.1	2q21.3-q22.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000144224	ENSG00000144224		"""UBX domain containing"""	14860	protein-coding gene	gene with protein product	"""erasin"""	611216	"""UBX domain-containing 2"", ""UBX domain containing 2"""	UBXDC1, UBXD2		16968747	Standard	NM_014607		Approved	KIAA0242	uc002tur.3	Q92575	OTTHUMG00000153577	ENST00000272638.9:c.1033G>T	2.37:g.136533901G>T	ENSP00000272638:p.Ala345Ser	Somatic		Capture	Illumina HiSeq	Phase_I	136250371	NM_014607	A8K9W4|Q4ZG56|Q8IYM5	Missense_Mutation	SNP	ENST00000272638.9	37	CCDS42761.1	.	.	.	.	.	.	.	.	.	.	G	33	5.211846	0.95069	.	.	ENSG00000144224	ENST00000272638;ENST00000430594	T	0.14893	2.47	5.86	5.86	0.93980	UBX (3);	0.099318	0.64402	D	0.000002	T	0.45316	0.1336	M	0.69823	2.125	0.58432	D	0.999996	P	0.41420	0.749	P	0.62382	0.901	T	0.14504	-1.0470	10	0.87932	D	0	.	20.1858	0.98214	0.0:0.0:1.0:0.0	.	345	Q92575	UBXN4_HUMAN	S	345;327	ENSP00000272638:A345S	ENSP00000272638:A345S	A	+	1	0	UBXN4	136250371	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.926000	0.92839	2.777000	0.95525	0.591000	0.81541	GCA		UBXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331696.1	NM_014607	
XIRP2	129446	broad.mit.edu	37	2	167760305	167760305	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr2:167760305C>T	ENST00000409728.1	+	2	402	c.313C>T	c.(313-315)Cgc>Tgc	p.R105C	XIRP2_ENST00000409195.1_Missense_Mutation_p.R105C|XIRP2_ENST00000409756.2_Missense_Mutation_p.R105C|XIRP2_ENST00000295237.9_Missense_Mutation_p.R105C|XIRP2_ENST00000420519.1_Missense_Mutation_p.R105C|XIRP2_ENST00000409043.1_Missense_Mutation_p.R105C	NM_001199143.1	NP_001186072.1	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	0					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.R105C(2)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						GAGCAGTCGGCGCAGGATTGA	0.512																																					p.R105C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C313T	2						.						114.0	116.0	115.0					2																	167760305		2024	4159	6183	167468551	SO:0001583	missense	129446	exon2			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409728.1:c.313C>T	2.37:g.167760305C>T	ENSP00000386619:p.Arg105Cys	Somatic		Capture	Illumina HiSeq	Phase_I	167468551	NM_001199143	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409728.1	37	CCDS56143.1	.	.	.	.	.	.	.	.	.	.	C	11.00	1.511643	0.27036	.	.	ENSG00000163092	ENST00000409043;ENST00000409728;ENST00000409195;ENST00000409756;ENST00000420519;ENST00000295237	D;D;T;D;D;T	0.82344	-1.58;-1.6;3.79;-1.58;-1.6;3.79	5.12	4.23	0.50019	.	.	.	.	.	T	0.75102	0.3804	.	.	.	0.40273	D	0.978316	P;P	0.46395	0.877;0.877	B;B	0.38562	0.276;0.276	T	0.78661	-0.2117	8	0.87932	D	0	-2.224	8.5532	0.33465	0.0:0.8965:0.0:0.1035	.	105;105	A4UGR9-4;A4UGR9-6	.;.	C	105	ENSP00000386454:R105C;ENSP00000386619:R105C;ENSP00000386840:R105C;ENSP00000386724:R105C;ENSP00000415541:R105C;ENSP00000295237:R105C	ENSP00000295237:R105C	R	+	1	0	XIRP2	167468551	0.964000	0.33143	0.939000	0.37840	0.218000	0.24690	1.551000	0.36233	2.390000	0.81377	0.655000	0.94253	CGC		XIRP2-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333552.1	NM_152381	
CHRNG	1146	broad.mit.edu	37	2	233408081	233408081	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr2:233408081C>A	ENST00000389494.3	+	8	923	c.902C>A	c.(901-903)gCg>gAg	p.A301E	CHRNG_ENST00000389492.3_Missense_Mutation_p.A249E	NM_005199.4	NP_005190.4	P07510	ACHG_HUMAN	cholinergic receptor, nicotinic, gamma (muscle)	301					muscle contraction (GO:0006936)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|channel activity (GO:0015267)	p.A301E(1)		breast(2)|endometrium(3)|large_intestine(4)|lung(12)|upper_aerodigestive_tract(1)	22		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;6.39e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00079)|LUSC - Lung squamous cell carcinoma(224;0.00757)|Lung(119;0.0086)	Galantamine(DB00674)	ACCTCCCAGGCGGTGCCACTC	0.587																																					p.A301E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C902A	2						.						96.0	90.0	92.0					2																	233408081		2203	4300	6503	233116325	SO:0001583	missense	1146	exon8			X01715	CCDS33400.1	2q37.1	2012-10-02	2012-02-07		ENSG00000196811	ENSG00000196811		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1967	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, gamma (muscle)"""	100730	"""cholinergic receptor, nicotinic, gamma"""	ACHRG			Standard	NM_005199		Approved		uc002vsx.1	P07510	OTTHUMG00000153327	ENST00000389494.3:c.902C>A	2.37:g.233408081C>A	ENSP00000374145:p.Ala301Glu	Somatic		Capture	Illumina HiSeq	Phase_I	233116325	NM_005199	B3KWM8|Q14DU4|Q53RG2	Missense_Mutation	SNP	ENST00000389494.3	37	CCDS33400.1	.	.	.	.	.	.	.	.	.	.	C	17.98	3.520291	0.64747	.	.	ENSG00000196811	ENST00000389494;ENST00000541596;ENST00000389492	D;D	0.86694	-2.16;-2.16	4.96	4.07	0.47477	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.124807	0.53938	D	0.000059	D	0.92870	0.7732	M	0.85373	2.75	0.47441	D	0.999424	D;D	0.64830	0.994;0.991	D;D	0.68943	0.933;0.961	D	0.93224	0.6611	10	0.72032	D	0.01	.	11.134	0.48365	0.1443:0.7167:0.139:0.0	.	249;301	Q14DU4;P07510	.;ACHG_HUMAN	E	301;301;249	ENSP00000374145:A301E;ENSP00000374143:A249E	ENSP00000374143:A249E	A	+	2	0	CHRNG	233116325	0.968000	0.33430	0.946000	0.38457	0.931000	0.56810	2.328000	0.43867	1.300000	0.44818	0.313000	0.20887	GCG		CHRNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330743.1	NM_005199	
PUS10	150962	broad.mit.edu	37	2	61175309	61175309	+	Silent	SNP	G	G	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr2:61175309G>A	ENST00000316752.6	-	16	1581	c.1320C>T	c.(1318-1320)atC>atT	p.I440I	PUS10_ENST00000407787.1_Silent_p.I440I	NM_144709.2	NP_653310.2	Q3MIT2	PUS10_HUMAN	pseudouridylate synthase 10	440					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)	p.I440I(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)	22			LUSC - Lung squamous cell carcinoma(5;1.56e-06)|Lung(5;2.48e-05)|Epithelial(17;0.113)			TTTTCTGGTCGATTTTTAAGT	0.532																																					p.I440I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1320T	2						.						138.0	138.0	138.0					2																	61175309		2203	4300	6503	61028813	SO:0001819	synonymous_variant	150962	exon16			AK056874	CCDS1865.1	2p16.1	2008-02-05	2008-01-09	2008-01-09	ENSG00000162927	ENSG00000162927			26505	protein-coding gene	gene with protein product		612787	"""coiled-coil domain containing 139"""	CCDC139		17900615	Standard	NM_144709		Approved	FLJ32312	uc002sao.3	Q3MIT2	OTTHUMG00000129423	ENST00000316752.6:c.1320C>T	2.37:g.61175309G>A		Somatic		Capture	Illumina HiSeq	Phase_I	61028813	NM_144709	Q5JPJ5|Q96MI8	Silent	SNP	ENST00000316752.6	37	CCDS1865.1																																																																																				PUS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251582.2	NM_144709	
SFTPB	6439	broad.mit.edu	37	2	85892818	85892818	+	Missense_Mutation	SNP	G	G	A	rs370715446		TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr2:85892818G>A	ENST00000519937.2	-	5	512	c.493C>T	c.(493-495)Cgg>Tgg	p.R165W	SFTPB_ENST00000409383.1_Missense_Mutation_p.R177W|SFTPB_ENST00000342375.3_Missense_Mutation_p.R165W|SFTPB_ENST00000393822.3_Missense_Mutation_p.R177W			P07988	PSPB_HUMAN	surfactant protein B	165					organ morphogenesis (GO:0009887)|respiratory gaseous exchange (GO:0007585)|sphingolipid metabolic process (GO:0006665)	extracellular region (GO:0005576)|lysosome (GO:0005764)		p.R165W(1)		central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|skin(3)	16						AGAGGGTCCCGCAGAGGTTTG	0.667													g|||	1	0.000199681	0.0	0.0	5008	,	,		17225	0.001		0.0	False		,,,				2504	0.0				p.R177W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C529T	2						.		TRP/ARG,TRP/ARG	1,4405		0,1,2202	52.0	55.0	54.0		529,529	-1.9	0.0	2		54	0,8600		0,0,4300	no	missense,missense	SFTPB	NM_000542.3,NM_198843.2	101,101	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign	177/394,177/394	85892818	1,13005	2203	4300	6503	85746329	SO:0001583	missense	6439	exon6			J02761	CCDS1983.1, CCDS1983.2	2p12-p11.2	2008-08-26	2008-08-26		ENSG00000168878	ENSG00000168878			10801	protein-coding gene	gene with protein product		178640	"""surfactant, pulmonary-associated protein B"""	SFTP3		2924687, 1346779	Standard	NM_198843		Approved	SP-B	uc002sqh.3	P07988	OTTHUMG00000130181	ENST00000519937.2:c.493C>T	2.37:g.85892818G>A	ENSP00000428719:p.Arg165Trp	Somatic		Capture	Illumina HiSeq	Phase_I	85746329	NM_198843	Q96R04	Missense_Mutation	SNP	ENST00000519937.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	3.472|3.472	-0.107751|-0.107751	0.06924|0.06924	2.27E-4|2.27E-4	0.0|0.0	ENSG00000168878|ENSG00000168878	ENST00000428225|ENST00000519937;ENST00000393822;ENST00000342375;ENST00000409383;ENST00000441838	.|T;T;T;T	.|0.69806	.|0.61;-0.24;-0.43;-0.24	0.951|0.951	-1.9|-1.9	0.07665|0.07665	.|.	.|1.074710	.|0.07470	.|N	.|0.902121	T|T	0.42086|0.42086	0.1187|0.1187	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.01281	.|0.0;0.0	T|T	0.18745|0.18745	-1.0327|-1.0327	5|10	.|0.59425	.|D	.|0.04	.|.	4.7557|4.7557	0.13082|0.13082	0.3289:0.0:0.6711:0.0|0.3289:0.0:0.6711:0.0	.|.	.|177;165	.|D6W5L6;P07988	.|.;PSPB_HUMAN	V|W	161|167;177;165;177;133	.|ENSP00000428719:R167W;ENSP00000377409:R177W;ENSP00000345161:R165W;ENSP00000386346:R177W	.|ENSP00000345161:R165W	A|R	-|-	2|1	0|2	SFTPB|SFTPB	85746329|85746329	0.000000|0.000000	0.05858|0.05858	0.016000|0.016000	0.15963|0.15963	0.032000|0.032000	0.12392|0.12392	-0.502000|-0.502000	0.06390|0.06390	-1.071000|-1.071000	0.03145|0.03145	-1.063000|-1.063000	0.02288|0.02288	GCG|CGG		SFTPB-001	KNOWN	alternative_3_UTR|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000252499.3	NM_198843	
COL6A3	1293	broad.mit.edu	37	2	238243368	238243368	+	Missense_Mutation	SNP	C	C	T	rs374628435		TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr2:238243368C>T	ENST00000295550.4	-	41	9582	c.9130G>A	c.(9130-9132)Gtc>Atc	p.V3044I	COL6A3_ENST00000472056.1_Missense_Mutation_p.V2437I|COL6A3_ENST00000353578.4_Missense_Mutation_p.V2838I|COL6A3_ENST00000409809.1_Missense_Mutation_p.V2838I|COL6A3_ENST00000346358.4_Missense_Mutation_p.V2844I|COL6A3_ENST00000347401.3_Missense_Mutation_p.V2843I	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	3044	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.|Nonhelical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.V3044I(1)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CCTCCAATGACGCGGTCCGTG	0.577																																					p.V2437I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G7309A	2						.	C	ILE/VAL,ILE/VAL,ILE/VAL	0,4406		0,0,2203	72.0	66.0	68.0		8512,7309,9130	2.2	0.0	2		68	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	COL6A3	NM_057167.3,NM_057166.4,NM_004369.3	29,29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign	2838/2972,2437/2571,3044/3178	238243368	1,13005	2203	4300	6503	237908107	SO:0001583	missense	1293	exon38			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.9130G>A	2.37:g.238243368C>T	ENSP00000295550:p.Val3044Ile	Somatic		Capture	Illumina HiSeq	Phase_I	237908107	NM_057166	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	C	1.391	-0.580793	0.03854	0.0	1.16E-4	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	T;T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53;1.53	4.93	2.19	0.27852	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.409880	0.20308	N	0.094883	T	0.26629	0.0651	L	0.56769	1.78	0.09310	N	1	B;B;B	0.11235	0.001;0.002;0.004	B;B;B	0.09377	0.002;0.004;0.002	T	0.21518	-1.0243	10	0.49607	T	0.09	.	6.5545	0.22452	0.0:0.6654:0.1289:0.2057	.	2437;2838;3044	E9PFQ6;P12111-2;P12111	.;.;CO6A3_HUMAN	I	3044;2843;2838;2437;2838;2844	ENSP00000295550:V3044I;ENSP00000315609:V2843I;ENSP00000315873:V2838I;ENSP00000418285:V2437I;ENSP00000386844:V2838I;ENSP00000295546:V2844I	ENSP00000295550:V3044I	V	-	1	0	COL6A3	237908107	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.070000	0.11523	0.238000	0.21222	-1.987000	0.00451	GTC		COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
KIAA2018	205717	broad.mit.edu	37	3	113375929	113375929	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr3:113375929A>C	ENST00000478658.1	-	5	4617	c.4600T>G	c.(4600-4602)Tct>Gct	p.S1534A	KIAA2018_ENST00000316407.4_Missense_Mutation_p.S1534A|KIAA2018_ENST00000491165.1_Intron			Q68DE3	K2018_HUMAN	KIAA2018	1534	Gln-rich.					membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.S1534A(1)		NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						GAAAGCTGAGAGGTCTGGGTG	0.512																																					p.S1534A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T4600G	3						.						107.0	107.0	107.0					3																	113375929		2026	4188	6214	114858619	SO:0001583	missense	205717	exon7			AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.4600T>G	3.37:g.113375929A>C	ENSP00000420721:p.Ser1534Ala	Somatic		Capture	Illumina HiSeq	Phase_I	114858619	NM_001009899	Q7Z3L9|Q8IVF3|Q9H8T4	Missense_Mutation	SNP	ENST00000478658.1	37	CCDS43133.1	.	.	.	.	.	.	.	.	.	.	A	13.47	2.247241	0.39697	.	.	ENSG00000176542	ENST00000316407;ENST00000478658	T;T	0.31769	1.48;1.48	6.03	4.9	0.64082	.	0.139684	0.49916	D	0.000131	T	0.16471	0.0396	N	0.24115	0.695	0.30405	N	0.779624	B	0.30406	0.278	B	0.24974	0.057	T	0.09143	-1.0688	10	0.54805	T	0.06	-14.3272	3.1007	0.06325	0.3771:0.0:0.142:0.4808	.	1534	Q68DE3	K2018_HUMAN	A	1534	ENSP00000320794:S1534A;ENSP00000420721:S1534A	ENSP00000320794:S1534A	S	-	1	0	KIAA2018	114858619	1.000000	0.71417	0.994000	0.49952	0.987000	0.75469	1.869000	0.39519	2.308000	0.77769	0.533000	0.62120	TCT		KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899	
TMCC1	23023	broad.mit.edu	37	3	129389881	129389881	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr3:129389881C>T	ENST00000393238.3	-	4	1143	c.803G>A	c.(802-804)aGt>aAt	p.S268N	TMCC1_ENST00000426664.2_Missense_Mutation_p.S154N|TMCC1_ENST00000329333.5_Missense_Mutation_p.S89N|TMCC1_ENST00000432054.2_De_novo_Start_OutOfFrame	NM_001017395.3	NP_001017395.2	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	268						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.S268N(2)	PLXND1/TMCC1(4)	breast(1)|endometrium(3)|large_intestine(8)|lung(12)|skin(1)	25						TTTGTCTGCACTGTTGGCAAG	0.488																																					p.S268N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G803A	3						.						208.0	203.0	205.0					3																	129389881		2203	4300	6503	130872571	SO:0001583	missense	23023	exon4			AB018322	CCDS33855.1	3q21.3	2010-04-19	2005-07-13		ENSG00000172765	ENSG00000172765		"""Transmembrane and coiled-coil domain containing"""	29116	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 1"""			9872452	Standard	NR_033361		Approved	KIAA0779	uc021xdy.1	O94876	OTTHUMG00000159579	ENST00000393238.3:c.803G>A	3.37:g.129389881C>T	ENSP00000376930:p.Ser268Asn	Somatic		Capture	Illumina HiSeq	Phase_I	130872571	NM_001017395	A8K5Y3|B4DE04|Q68E06|Q8IXM8	De_novo_Start_OutOfFrame	SNP	ENST00000393238.3	37	CCDS33855.1	.	.	.	.	.	.	.	.	.	.	C	5.389	0.257078	0.10239	.	.	ENSG00000172765	ENST00000393238;ENST00000426664;ENST00000329333	T;T;T	0.44083	0.93;0.93;0.93	5.56	4.46	0.54185	.	0.037617	0.85682	D	0.000000	T	0.09774	0.0240	N	0.00471	-1.455	0.44500	D	0.997446	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.37798	-0.9690	10	0.06891	T	0.86	-0.4155	4.1224	0.10111	0.0:0.6833:0.0:0.3167	.	89;268	B4DE04;O94876	.;TMCC1_HUMAN	N	268;154;89	ENSP00000376930:S268N;ENSP00000389892:S154N;ENSP00000327349:S89N	ENSP00000327349:S89N	S	-	2	0	TMCC1	130872571	1.000000	0.71417	0.992000	0.48379	0.967000	0.64934	5.995000	0.70631	2.778000	0.95560	0.591000	0.81541	AGT		TMCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356418.2	NM_015008	
FBLN2	2199	broad.mit.edu	37	3	13679189	13679189	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr3:13679189G>A	ENST00000295760.7	+	17	3394	c.3325G>A	c.(3325-3327)Gcg>Acg	p.A1109T	FBLN2_ENST00000535798.1_Missense_Mutation_p.A1135T|FBLN2_ENST00000404922.3_Missense_Mutation_p.A1156T|FBLN2_ENST00000492059.1_Missense_Mutation_p.A1156T	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	1109	Domain III.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)	p.A1156T(2)|p.A575T(2)		haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			CATTGGCCCCGCGCCAGCCTT	0.622																																					p.R1109H												.	.	4	Substitution - Missense(4)	large_intestine(2)|prostate(2)	c.G3326A	3						.						43.0	48.0	46.0					3																	13679189		2154	4245	6399	13654190	SO:0001583	missense	2199	exon17			X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.3325G>A	3.37:g.13679189G>A	ENSP00000295760:p.Ala1109Thr	Somatic		Capture	Illumina HiSeq	Phase_I	13654190	NM_001998	B7Z9C5|Q8IUI0|Q8IUI1	Missense_Mutation	SNP	ENST00000295760.7	37	CCDS46762.1	.	.	.	.	.	.	.	.	.	.	G	12.47	1.946543	0.34377	.	.	ENSG00000163520	ENST00000535798;ENST00000404922;ENST00000295760;ENST00000492059	T;T;T;T	0.79554	-1.28;-1.24;-1.19;-1.24	4.6	2.63	0.31362	.	0.194173	0.46442	D	0.000286	T	0.44871	0.1314	N	0.01729	-0.75	0.35567	D	0.805155	B;P;P	0.48998	0.313;0.918;0.72	B;B;B	0.34138	0.058;0.176;0.131	T	0.54221	-0.8326	10	0.14656	T	0.56	.	5.867	0.18781	0.1026:0.0:0.5213:0.376	.	1109;1156;1135	P98095;P98095-2;F5H1F3	FBLN2_HUMAN;.;.	T	1135;1156;1109;1156	ENSP00000445705:A1135T;ENSP00000384169:A1156T;ENSP00000295760:A1109T;ENSP00000420042:A1156T	ENSP00000295760:A1109T	A	+	1	0	FBLN2	13654190	0.993000	0.37304	0.747000	0.31113	0.616000	0.37450	3.099000	0.50267	1.157000	0.42530	0.462000	0.41574	GCG		FBLN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000340083.3	NM_001004019	
LRRC3B	116135	broad.mit.edu	37	3	26751685	26751685	+	Silent	SNP	G	G	A	rs181467821		TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr3:26751685G>A	ENST00000396641.2	+	2	1114	c.522G>A	c.(520-522)acG>acA	p.T174T	AC114877.3_ENST00000446601.1_lincRNA|LRRC3B_ENST00000456208.2_Silent_p.T174T|LRRC3B_ENST00000417744.1_Silent_p.T174T	NM_052953.2	NP_443185.1	Q96PB8	LRC3B_HUMAN	leucine rich repeat containing 3B	174	LRRCT.					integral component of membrane (GO:0016021)		p.T174T(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|pancreas(2)|prostate(1)|skin(4)	21						TCTGTAAAACGTCCGTGTTGG	0.502													G|||	1	0.000199681	0.0	0.0	5008	,	,		21051	0.001		0.0	False		,,,				2504	0.0				p.T174T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G522A	3						.						75.0	63.0	67.0					3																	26751685		2203	4300	6503	26726689	SO:0001819	synonymous_variant	116135	exon2			AF396933	CCDS2644.1	3p24	2004-07-12			ENSG00000179796	ENSG00000179796			28105	protein-coding gene	gene with protein product							Standard	NM_052953		Approved	LRP15	uc003cdp.3	Q96PB8	OTTHUMG00000130572	ENST00000396641.2:c.522G>A	3.37:g.26751685G>A		Somatic		Capture	Illumina HiSeq	Phase_I	26726689	NM_052953	Q5M8T0	Silent	SNP	ENST00000396641.2	37	CCDS2644.1																																																																																				LRRC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252997.2	NM_052953	
MAGI1	9223	broad.mit.edu	37	3	65342500	65342500	+	Silent	SNP	G	G	A	rs141542625		TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr3:65342500G>A	ENST00000402939.2	-	23	3941	c.3942C>T	c.(3940-3942)gcC>gcT	p.A1314A	MAGI1_ENST00000330909.8_3'UTR|RP11-88H12.2_ENST00000602316.1_RNA	NM_001033057.1	NP_001028229.1	Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1	1343					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)	p.A1314A(1)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		GGCCGTTGGCGGCTGCCGCGC	0.701													G|||	1	0.000199681	0.0008	0.0	5008	,	,		11667	0.0		0.0	False		,,,				2504	0.0				p.A1314A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3942T	3						.	G	,	5,4401	9.9+/-24.2	0,5,2198	35.0	40.0	38.0		3942,	0.3	0.0	3	dbSNP_134	38	0,8588		0,0,4294	no	coding-synonymous,utr-3	MAGI1	NM_001033057.1,NM_015520.1	,	0,5,6492	AA,AG,GG		0.0,0.1135,0.0385	,	1314/1463,	65342500	5,12989	2203	4294	6497	65317540	SO:0001819	synonymous_variant	9223	exon23			AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000402939.2:c.3942C>T	3.37:g.65342500G>A		Somatic		Capture	Illumina HiSeq	Phase_I	65317540	NM_001033057	A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	Silent	SNP	ENST00000402939.2	37	CCDS33780.1																																																																																				MAGI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349126.1	NM_004742	
DNAJC13	23317	broad.mit.edu	37	3	132175237	132175237	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr3:132175237C>T	ENST00000260818.6	+	10	1339	c.1091C>T	c.(1090-1092)aCg>aTg	p.T364M	DNAJC13_ENST00000486798.1_3'UTR	NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	364					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)		p.T364M(1)		breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						TTCTTAGCTACGCCTCCAAGT	0.383																																					p.T364M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1091T	3						.						92.0	87.0	89.0					3																	132175237		2203	4300	6503	133657927	SO:0001583	missense	23317	exon10			AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.1091C>T	3.37:g.132175237C>T	ENSP00000260818:p.Thr364Met	Somatic		Capture	Illumina HiSeq	Phase_I	133657927	NM_015268	Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Missense_Mutation	SNP	ENST00000260818.6	37	CCDS33857.1	.	.	.	.	.	.	.	.	.	.	C	19.02	3.745826	0.69418	.	.	ENSG00000138246	ENST00000260818	T	0.42513	0.97	5.93	5.93	0.95920	.	0.414158	0.28958	N	0.013596	T	0.39600	0.1084	L	0.34521	1.04	0.44282	D	0.997143	P;P;P	0.46064	0.499;0.872;0.71	B;B;B	0.41571	0.163;0.36;0.23	T	0.21793	-1.0235	10	0.52906	T	0.07	.	20.3507	0.98813	0.0:1.0:0.0:0.0	.	364;31;364	A7E2Y5;Q8N7A5;O75165	.;.;DJC13_HUMAN	M	364	ENSP00000260818:T364M	ENSP00000260818:T364M	T	+	2	0	DNAJC13	133657927	0.964000	0.33143	0.490000	0.27465	0.974000	0.67602	7.625000	0.83145	2.808000	0.96608	0.655000	0.94253	ACG		DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356807.2	NM_015268	
ANK2	287	broad.mit.edu	37	4	114257178	114257178	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr4:114257178G>C	ENST00000357077.4	+	30	3609	c.3556G>C	c.(3556-3558)Ggg>Cgg	p.G1186R	ANK2_ENST00000506722.1_Missense_Mutation_p.G1177R|ANK2_ENST00000509550.1_Missense_Mutation_p.G362R|ANK2_ENST00000394537.3_Missense_Mutation_p.G1186R|ANK2_ENST00000264366.6_Missense_Mutation_p.G1153R	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1186	ZU5 2. {ECO:0000255|PROSITE- ProRule:PRU00485}.				atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.G1186R(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CTTCCCAGAGGGGGCACTCAC	0.507																																					p.G1186R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3556C	4						.						83.0	82.0	82.0					4																	114257178		2203	4300	6503	114476627	SO:0001583	missense	287	exon30			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.3556G>C	4.37:g.114257178G>C	ENSP00000349588:p.Gly1186Arg	Somatic		Capture	Illumina HiSeq	Phase_I	114476627	NM_020977	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	31|31	5.088575|5.088575	0.94100|0.94100	.|.	.|.	ENSG00000145362|ENSG00000145362	ENST00000514960|ENST00000503423;ENST00000506722;ENST00000431447;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056;ENST00000509550	.|T;T;T;T;T;T;T	.|0.73681	.|-0.77;-0.77;-0.77;-0.77;-0.67;-0.67;-0.77	5.27|5.27	5.27|5.27	0.74061|0.74061	.|.	0.000000|0.000000	0.50627|0.50627	D|D	0.000120|0.000120	D|D	0.88789|0.88789	0.6532|0.6532	M|M	0.89095|0.89095	3.005|3.005	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0;0.965;0.999	.|D;D;D;D;D;P;D	.|0.97110	.|1.0;1.0;1.0;1.0;1.0;0.885;0.997	D|D	0.90290|0.90290	0.4322|0.4322	6|9	.|.	.|.	.|.	.|.	18.9084|18.9084	0.92472|0.92472	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|362;1153;198;1186;1186;1177;1177	.|E9PCH6;Q01484;Q7Z344;Q01484-2;Q01484-4;Q01484-5;F8WEF9	.|.;ANK2_HUMAN;.;.;.;.;.	A|R	198|1099;1177;232;1201;1186;1186;1153;1177;362	.|ENSP00000421011:G1099R;ENSP00000421067:G1177R;ENSP00000424722:G1201R;ENSP00000378044:G1186R;ENSP00000349588:G1186R;ENSP00000264366:G1153R;ENSP00000426944:G362R	.|.	G|G	+|+	2|1	0|0	ANK2|ANK2	114476627|114476627	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.929000|0.929000	0.56500|0.56500	9.869000|9.869000	0.99810|0.99810	2.455000|2.455000	0.83008|0.83008	0.655000|0.655000	0.94253|0.94253	GGG|GGG		ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
PRSS12	8492	broad.mit.edu	37	4	119203354	119203354	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr4:119203354G>C	ENST00000296498.3	-	13	2647	c.2365C>G	c.(2365-2367)Ctt>Gtt	p.L789V	PRSS12_ENST00000510903.1_5'Flank|SNHG8_ENST00000384096.1_lincRNA	NM_003619.3	NP_003610.2	P56730	NETR_HUMAN	protease, serine, 12 (neurotrypsin, motopsin)	789	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				exocytosis (GO:0006887)|zymogen activation (GO:0031638)	axon (GO:0030424)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)|terminal bouton (GO:0043195)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.L789V(1)		endometrium(3)|kidney(1)|large_intestine(9)|lung(11)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	29						CTTTTAGGAAGTAAGGGAATG	0.443																																					p.L789V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2365G	4						.						134.0	130.0	132.0					4																	119203354		2203	4300	6503	119422802	SO:0001583	missense	8492	exon13			AJ001531	CCDS3709.1	4q25-q26	2010-05-07			ENSG00000164099	ENSG00000164099		"""Serine peptidases / Serine peptidases"""	9477	protein-coding gene	gene with protein product		606709				9540828, 9245503	Standard	NM_003619		Approved	BSSP-3, MRT1	uc003ica.2	P56730	OTTHUMG00000161166	ENST00000296498.3:c.2365C>G	4.37:g.119203354G>C	ENSP00000296498:p.Leu789Val	Somatic		Capture	Illumina HiSeq	Phase_I	119422802	NM_003619	Q9UP16	Missense_Mutation	SNP	ENST00000296498.3	37	CCDS3709.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.230074	0.79688	.	.	ENSG00000164099	ENST00000296498	D	0.87334	-2.24	6.08	5.23	0.72850	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.127686	0.48286	D	0.000189	D	0.85225	0.5648	N	0.04116	-0.275	0.51482	D	0.999925	D	0.69078	0.997	D	0.70227	0.968	D	0.89080	0.3475	10	0.72032	D	0.01	.	14.5091	0.67772	0.0708:0.0:0.9292:0.0	.	789	P56730	NETR_HUMAN	V	789	ENSP00000296498:L789V	ENSP00000296498:L789V	L	-	1	0	PRSS12	119422802	1.000000	0.71417	0.976000	0.42696	0.988000	0.76386	4.314000	0.59166	1.557000	0.49525	0.591000	0.81541	CTT		PRSS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256516.2		
PCDH10	57575	broad.mit.edu	37	4	134072677	134072677	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr4:134072677C>T	ENST00000264360.5	+	1	2208	c.1382C>T	c.(1381-1383)cCg>cTg	p.P461L	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	461	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P461L(1)		NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		GACAACGCGCCGCGTTTCAGC	0.622																																					p.P461L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1382T	4						.						89.0	91.0	90.0					4																	134072677		2203	4300	6503	134292127	SO:0001583	missense	57575	exon1			AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.1382C>T	4.37:g.134072677C>T	ENSP00000264360:p.Pro461Leu	Somatic		Capture	Illumina HiSeq	Phase_I	134292127	NM_032961	Q4W5F6|Q96SF0	Missense_Mutation	SNP	ENST00000264360.5	37	CCDS34063.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.546339	0.86022	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	D	0.84800	-1.9	4.71	4.71	0.59529	Cadherin (5);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.44902	D	0.000415	D	0.95896	0.8664	H	0.99379	4.54	0.80722	D	1	D;D	0.76494	0.989;0.999	P;D	0.70487	0.455;0.969	D	0.97971	1.0343	10	0.87932	D	0	.	16.6083	0.84837	0.0:1.0:0.0:0.0	.	461;461	Q9P2E7;Q96SF0	PCD10_HUMAN;.	L	461	ENSP00000264360:P461L	ENSP00000264360:P461L	P	+	2	0	PCDH10	134292127	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.620000	0.83070	2.436000	0.82500	0.655000	0.94253	CCG		PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	NM_032961	
FBXW7	55294	broad.mit.edu	37	4	153249384	153249384	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr4:153249384C>T	ENST00000281708.4	-	9	2623	c.1394G>A	c.(1393-1395)cGt>cAt	p.R465H	FBXW7_ENST00000296555.5_Missense_Mutation_p.R347H|FBXW7_ENST00000603841.1_Missense_Mutation_p.R465H|FBXW7_ENST00000263981.5_Missense_Mutation_p.R385H|FBXW7_ENST00000603548.1_Missense_Mutation_p.R465H|FBXW7_ENST00000393956.3_Missense_Mutation_p.R289H	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	465			R -> C (in a acute lymphoblastic leukemia cell line). {ECO:0000269|PubMed:11565033}.|R -> H (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.R465H(69)|p.R385H(16)|p.R226H(16)|p.R465L(4)|p.R347H(4)|p.R465Y(2)|p.?(1)|p.R385L(1)|p.R226L(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				ATGCATACAACGCACAGTGGA	0.408			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																p.R385H			Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	FBXW7,large_intestine,NS,Substitution - Missense,0 	.	114	Substitution - Missense(113)|Unknown(1)	haematopoietic_and_lymphoid_tissue(40)|large_intestine(39)|endometrium(24)|lung(5)|ovary(4)|cervix(1)|biliary_tract(1)	c.G1154A	4						.						253.0	218.0	230.0					4																	153249384		2203	4300	6503	153468834	SO:0001583	missense	55294	exon8			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1394G>A	4.37:g.153249384C>T	ENSP00000281708:p.Arg465His	Somatic		Capture	Illumina HiSeq	Phase_I	153468834	NM_018315	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	ENST00000281708.4	37	CCDS3777.1	.	.	.	.	.	.	.	.	.	.	C	32	5.178201	0.94846	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	6.05	6.05	0.98169	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.63827	0.2544	L	0.56124	1.755	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;1.0	T	0.62469	-0.6848	10	0.87932	D	0	-17.2313	20.6013	0.99457	0.0:1.0:0.0:0.0	.	289;465;347;385	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	H	465;347;385;289	ENSP00000281708:R465H;ENSP00000296555:R347H;ENSP00000263981:R385H;ENSP00000377528:R289H	ENSP00000263981:R385H	R	-	2	0	FBXW7	153468834	1.000000	0.71417	0.960000	0.40013	0.996000	0.88848	7.818000	0.86416	2.878000	0.98634	0.650000	0.86243	CGT		FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1		
ASIC5	51802	broad.mit.edu	37	4	156764843	156764843	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr4:156764843C>T	ENST00000537611.2	-	5	897	c.851G>A	c.(850-852)cGc>cAc	p.R284H		NM_017419.2	NP_059115.1	Q9NY37	ASIC5_HUMAN	acid-sensing (proton-gated) ion channel family member 5	284					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrogen ion channel activity (GO:0015252)|ligand-gated sodium channel activity (GO:0015280)	p.R284H(1)									CTTCACTTGGCGGATGGTTAC	0.443																																					p.R284H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G851A	4						.						131.0	115.0	121.0					4																	156764843		2203	4300	6503	156984293	SO:0001583	missense	51802	exon5			AJ252011	CCDS3793.1	4q32.1	2012-10-03	2012-03-02	2012-03-02	ENSG00000256394	ENSG00000256394			17537	protein-coding gene	gene with protein product			"""amiloride-sensitive cation channel 5, intestinal"""	ACCN5		10767424	Standard	NM_017419		Approved	INAC, HINAC	uc003ipe.1	Q9NY37	OTTHUMG00000161941	ENST00000537611.2:c.851G>A	4.37:g.156764843C>T	ENSP00000442477:p.Arg284His	Somatic		Capture	Illumina HiSeq	Phase_I	156984293	NM_017419		Missense_Mutation	SNP	ENST00000537611.2	37	CCDS3793.1	.	.	.	.	.	.	.	.	.	.	C	12.86	2.063298	0.36373	.	.	ENSG00000256394	ENST00000537611	T	0.64803	-0.12	4.58	3.72	0.42706	.	0.369047	0.23302	N	0.049663	T	0.61438	0.2347	M	0.78637	2.42	0.30663	N	0.754166	B	0.23540	0.087	B	0.23419	0.046	T	0.63514	-0.6620	10	0.44086	T	0.13	-18.9679	10.6136	0.45436	0.0:0.7894:0.134:0.0766	.	284	Q9NY37	ACCN5_HUMAN	H	284	ENSP00000442477:R284H	ENSP00000264432:R284H	R	-	2	0	ACCN5	156984293	1.000000	0.71417	0.993000	0.49108	0.608000	0.37181	2.225000	0.42954	1.210000	0.43336	0.591000	0.81541	CGC		ASIC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366464.1		
GRK4	2868	broad.mit.edu	37	4	2986263	2986263	+	Missense_Mutation	SNP	C	C	T	rs146194528		TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr4:2986263C>T	ENST00000398052.4	+	2	419	c.76C>T	c.(76-78)Cgt>Tgt	p.R26C	GRK4_ENST00000345167.6_Intron|GRK4_ENST00000504933.1_Missense_Mutation_p.R26C|GRK4_ENST00000398051.4_Intron	NM_182982.2	NP_892027.2	P32298	GRK4_HUMAN	G protein-coupled receptor kinase 4	26	N-terminal.				G-protein coupled receptor internalization (GO:0002031)|receptor internalization (GO:0031623)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|rhodopsin kinase activity (GO:0050254)	p.R26C(1)		lung(1)|upper_aerodigestive_tract(1)	2				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		AAAAAGTGGTCGTAGTAAAAA	0.388																																					p.R26C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C76T	4						.	C	,CYS/ARG,CYS/ARG	1,4405		0,1,2202	86.0	82.0	83.0		,76,76	4.7	0.9	4	dbSNP_134	83	0,8600		0,0,4300	no	intron,missense,missense	GRK4	NM_001004056.1,NM_001004057.1,NM_182982.2	,180,180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,probably-damaging,probably-damaging	,26/533,26/579	2986263	1,13005	2203	4300	6503	2956061	SO:0001583	missense	2868	exon2				CCDS33946.1, CCDS33947.1, CCDS47002.1, CCDS68656.1	4p16.3	2008-02-05	2004-02-04	2004-02-06	ENSG00000125388	ENSG00000125388			4543	protein-coding gene	gene with protein product		137026	"""G protein-coupled receptor kinase 2-like (Drosophila)"""	GPRK2L		1338872	Standard	NM_182982		Approved	GPRK4	uc003ggn.1	P32298	OTTHUMG00000159914	ENST00000398052.4:c.76C>T	4.37:g.2986263C>T	ENSP00000381129:p.Arg26Cys	Somatic		Capture	Illumina HiSeq	Phase_I	2956061	NM_182982	O00641|O00642|Q13293|Q13294|Q13295|Q14453|Q14725|Q15313|Q15314|Q15315|Q15316|Q17RH6|Q53EQ8	Missense_Mutation	SNP	ENST00000398052.4	37	CCDS33946.1	.	.	.	.	.	.	.	.	.	.	C	16.12	3.034195	0.54896	2.27E-4	0.0	ENSG00000125388	ENST00000398052;ENST00000504933	T;T	0.69685	-0.42;-0.4	4.69	4.69	0.59074	.	0.000000	0.85682	U	0.000000	D	0.82545	0.5060	M	0.82517	2.595	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.993	D	0.85486	0.1182	10	0.87932	D	0	-21.0407	15.1751	0.72903	0.0:1.0:0.0:0.0	.	26;26	P32298-4;P32298	.;GRK4_HUMAN	C	26	ENSP00000381129:R26C;ENSP00000427445:R26C	ENSP00000381129:R26C	R	+	1	0	GRK4	2956061	1.000000	0.71417	0.945000	0.38365	0.120000	0.20174	3.049000	0.49869	2.431000	0.82371	0.650000	0.86243	CGT		GRK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358176.2	NM_005307	
HTRA3	94031	broad.mit.edu	37	4	8284238	8284238	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr4:8284238G>A	ENST00000307358.2	+	2	664	c.460G>A	c.(460-462)Gtg>Atg	p.V154M	HTRA3_ENST00000382512.3_Missense_Mutation_p.V154M	NM_053044.3	NP_444272.1	P83110	HTRA3_HUMAN	HtrA serine peptidase 3	154					negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.V154M(1)		central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|prostate(1)|urinary_tract(1)	18						CGCACCAGCCGTGGTCCACAT	0.637																																					p.V154M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G460A	4						.						101.0	81.0	88.0					4																	8284238		2203	4300	6503	8335138	SO:0001583	missense	94031	exon2			AY040094	CCDS3400.1, CCDS75105.1	4p16.1	2008-02-05			ENSG00000170801	ENSG00000170801			30406	protein-coding gene	gene with protein product	"""pregnancy-related serine protease"""	608785				12513693, 14500695	Standard	XM_005248040		Approved	Tasp, Prsp	uc003gla.3	P83110	OTTHUMG00000090561	ENST00000307358.2:c.460G>A	4.37:g.8284238G>A	ENSP00000303766:p.Val154Met	Somatic		Capture	Illumina HiSeq	Phase_I	8335138	NM_053044	Q7Z7A2	Missense_Mutation	SNP	ENST00000307358.2	37	CCDS3400.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.666583	0.88251	.	.	ENSG00000170801	ENST00000307358;ENST00000382512	D;D	0.91464	-2.85;-2.85	4.37	4.37	0.52481	Peptidase cysteine/serine, trypsin-like (1);	0.078934	0.51477	D	0.000088	D	0.95258	0.8462	M	0.79926	2.475	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76575	0.985;0.988	D	0.96118	0.9082	10	0.87932	D	0	-20.4857	16.9188	0.86158	0.0:0.0:1.0:0.0	.	154;154	P83110;P83110-2	HTRA3_HUMAN;.	M	154	ENSP00000303766:V154M;ENSP00000371952:V154M	ENSP00000303766:V154M	V	+	1	0	HTRA3	8335138	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.304000	0.78882	1.996000	0.58369	0.462000	0.41574	GTG		HTRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092669.1	NM_053044	
TBC1D19	55296	broad.mit.edu	37	4	26744202	26744202	+	Nonsense_Mutation	SNP	C	C	T	rs141345574		TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr4:26744202C>T	ENST00000264866.4	+	18	1578	c.1300C>T	c.(1300-1302)Cga>Tga	p.R434*	TBC1D19_ENST00000511789.1_Nonsense_Mutation_p.R369*	NM_018317.2	NP_060787.2	Q8N5T2	TBC19_HUMAN	TBC1 domain family, member 19	434	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)	p.R434*(3)		breast(4)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	17		Breast(46;0.0503)				TTATCATCTACGAGAAATTGG	0.373																																					p.R434X												TBC1D19,breast,NS,Substitution - Missense,0 	.	3	Substitution - Nonsense(3)	large_intestine(1)|lung(1)|breast(1)	c.C1300T	4						.	C	stop/ARG	0,4406		0,0,2203	112.0	114.0	114.0		1300	5.1	1.0	4	dbSNP_134	114	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained	TBC1D19	NM_018317.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		434/527	26744202	1,13005	2203	4300	6503	26353300	SO:0001587	stop_gained	55296	exon18			AK001944	CCDS3439.1, CCDS75115.1	4p15.2	2008-02-05			ENSG00000109680	ENSG00000109680			25624	protein-coding gene	gene with protein product							Standard	XM_006713967		Approved	FLJ11082	uc003gsf.4	Q8N5T2	OTTHUMG00000097797	ENST00000264866.4:c.1300C>T	4.37:g.26744202C>T	ENSP00000264866:p.Arg434*	Somatic		Capture	Illumina HiSeq	Phase_I	26353300	NM_018317	B9A6M0|Q9NUX1	Nonsense_Mutation	SNP	ENST00000264866.4	37	CCDS3439.1	.	.	.	.	.	.	.	.	.	.	C	36	5.888657	0.97068	0.0	1.16E-4	ENSG00000109680	ENST00000264866;ENST00000511789	.	.	.	5.95	5.1	0.69264	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.7472	14.7722	0.69688	0.2632:0.7368:0.0:0.0	.	.	.	.	X	434;369	.	ENSP00000264866:R434X	R	+	1	2	TBC1D19	26353300	0.998000	0.40836	0.995000	0.50966	0.997000	0.91878	3.339000	0.52135	1.487000	0.48415	0.650000	0.86243	CGA		TBC1D19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215052.2	NM_018317	
FRYL	285527	broad.mit.edu	37	4	48575244	48575244	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr4:48575244A>T	ENST00000503238.1	-	23	2862	c.2863T>A	c.(2863-2865)Tta>Ata	p.L955I	FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000537810.1_Missense_Mutation_p.L955I|FRYL_ENST00000358350.4_Missense_Mutation_p.L955I|FRYL_ENST00000507711.1_Missense_Mutation_p.L955I|RNU5E-3P_ENST00000515913.1_RNA			O94915	FRYL_HUMAN	FRY-like	955					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)			p.L955I(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						ATGGGATGTAATTCCTCTATT	0.343																																					p.L955I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2863A	4						.						101.0	102.0	102.0					4																	48575244		1857	4091	5948	48270001	SO:0001583	missense	285527	exon26			AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.2863T>A	4.37:g.48575244A>T	ENSP00000426064:p.Leu955Ile	Somatic		Capture	Illumina HiSeq	Phase_I	48270001	NM_015030	O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	ENST00000503238.1	37	CCDS43227.1	.	.	.	.	.	.	.	.	.	.	A	23.3	4.397244	0.83120	.	.	ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810;ENST00000507711	T;T;T;T	0.05382	3.45;3.45;3.45;3.45	5.8	4.63	0.57726	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.52532	U	0.000071	T	0.23210	0.0561	M	0.80422	2.495	0.80722	D	1	D;D	0.63046	0.979;0.992	D;D	0.71414	0.973;0.91	T	0.00480	-1.1714	10	0.42905	T	0.14	.	11.2645	0.49101	0.9294:0.0:0.0706:0.0	.	955;955	F2Z2S2;O94915	.;FRYL_HUMAN	I	955	ENSP00000426064:L955I;ENSP00000351113:L955I;ENSP00000441114:L955I;ENSP00000421584:L955I	ENSP00000351113:L955I	L	-	1	2	FRYL	48270001	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.213000	0.42844	2.210000	0.71456	0.533000	0.62120	TTA		FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2		
TENM3	55714	broad.mit.edu	37	4	183714508	183714508	+	Missense_Mutation	SNP	G	G	A	rs201200379	byFrequency	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr4:183714508G>A	ENST00000511685.1	+	26	6806	c.6683G>A	c.(6682-6684)cGt>cAt	p.R2228H	TENM3_ENST00000406950.2_Missense_Mutation_p.R2228H			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	2228					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.R2228H(1)									GTGATCTACCGTTATGACGGC	0.463													G|||	2	0.000399361	0.0008	0.0	5008	,	,		18725	0.0		0.001	False		,,,				2504	0.0				p.R2228H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6683A	4						.						78.0	80.0	79.0					4																	183714508		1898	4121	6019	183951502	SO:0001583	missense	55714	exon25			AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.6683G>A	4.37:g.183714508G>A	ENSP00000424226:p.Arg2228His	Somatic		Capture	Illumina HiSeq	Phase_I	183951502	NM_001080477	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	ENST00000511685.1	37	CCDS47165.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	10.04	1.242130	0.22796	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	D;D	0.86694	-2.16;-2.16	4.65	4.65	0.58169	.	.	.	.	.	D	0.93223	0.7841	M	0.84511	2.7	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	D	0.91401	0.5143	9	0.15952	T	0.53	.	17.7429	0.88412	0.0:0.0:1.0:0.0	.	2228	Q9P273	TEN3_HUMAN	H	2228	ENSP00000424226:R2228H;ENSP00000385276:R2228H	ENSP00000385276:R2228H	R	+	2	0	ODZ3	183951502	1.000000	0.71417	0.900000	0.35374	0.648000	0.38561	7.767000	0.85331	2.417000	0.82017	0.563000	0.77884	CGT		TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361734.1		
APC	324	broad.mit.edu	37	5	112174061	112174061	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr5:112174061A>T	ENST00000457016.1	+	16	3150	c.2770A>T	c.(2770-2772)Aga>Tga	p.R924*	APC_ENST00000508376.2_Nonsense_Mutation_p.R924*|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Nonsense_Mutation_p.R924*			P25054	APC_HUMAN	adenomatous polyposis coli	924	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R924*(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TGCACTTAGAAGAAGCTCTGC	0.393		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R906X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	2	Substitution - Nonsense(1)|Unknown(1)	large_intestine(1)|skin(1)	c.A2716T	5						.						74.0	75.0	75.0					5																	112174061		2202	4300	6502	112201960	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2770A>T	5.37:g.112174061A>T	ENSP00000413133:p.Arg924*	Somatic		Capture	Illumina HiSeq	Phase_I	112201960	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	A	36	5.853106	0.97030	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.92	4.73	0.59995	.	0.150554	0.53938	D	0.000046	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.0948	13.1081	0.59259	0.8662:0.1338:0.0:0.0	.	.	.	.	X	924;906;924;924;924	.	ENSP00000257430:R924X	R	+	1	2	APC	112201960	1.000000	0.71417	0.995000	0.50966	0.643000	0.38383	3.094000	0.50227	1.017000	0.39495	0.455000	0.32223	AGA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
APC	324	broad.mit.edu	37	5	112175639	112175639	+	Nonsense_Mutation	SNP	C	C	T	rs121913332		TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr5:112175639C>T	ENST00000457016.1	+	16	4728	c.4348C>T	c.(4348-4350)Cga>Tga	p.R1450*	APC_ENST00000508376.2_Nonsense_Mutation_p.R1450*|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Nonsense_Mutation_p.R1450*			P25054	APC_HUMAN	adenomatous polyposis coli	1450	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R1450*(153)|p.?(1)|p.P1424fs*19(1)|p.K1192fs*3(1)|p.R1450fs*22(1)|p.S1436fs*22(1)|p.R1450fs*5(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TCAAACCAAGCGAGAAGTACC	0.478	R1450*(LS123_LARGE_INTESTINE)|R1450*(MKN74_STOMACH)|R1450*(SW1417_LARGE_INTESTINE)|R1450*(SW837_LARGE_INTESTINE)	12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R1432X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,rectum,Substitution - Nonsense,0 	.	159	Substitution - Nonsense(153)|Deletion - Frameshift(4)|Unknown(1)|Insertion - Frameshift(1)	large_intestine(136)|stomach(13)|soft_tissue(4)|small_intestine(3)|endometrium(1)|skin(1)|pancreas(1)	c.C4294T	5	GRCh37	CM930030	APC	M	rs121913332	.						102.0	90.0	94.0					5																	112175639		2202	4300	6502	112203538	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4348C>T	5.37:g.112175639C>T	ENSP00000413133:p.Arg1450*	Somatic		Capture	Illumina HiSeq	Phase_I	112203538	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	41	8.651223	0.98901	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.17	4.2	0.49525	.	0.600559	0.18052	N	0.153248	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-1.0649	14.037	0.64651	0.426:0.574:0.0:0.0	.	.	.	.	X	1450	.	.	R	+	1	2	APC	112203538	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.171000	0.50824	1.564000	0.49628	0.655000	0.94253	CGA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
TSSK1B	83942	broad.mit.edu	37	5	112770260	112770260	+	Missense_Mutation	SNP	C	C	T	rs373083902		TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr5:112770260C>T	ENST00000390666.3	-	1	468	c.277G>A	c.(277-279)Gcg>Acg	p.A93T	CTD-2201G3.1_ENST00000416046.2_RNA|MCC_ENST00000408903.3_Intron|CTD-2201G3.1_ENST00000510381.2_RNA|CTD-2201G3.1_ENST00000383058.4_RNA	NM_032028.3	NP_114417.1	Q9BXA7	TSSK1_HUMAN	testis-specific serine kinase 1B	93	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				multicellular organismal development (GO:0007275)|protein phosphorylation (GO:0006468)|spermatid development (GO:0007286)	cytoplasmic vesicle (GO:0031410)|motile cilium (GO:0031514)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.A93T(2)		large_intestine(8)|ovary(2)|skin(2)|stomach(1)	13		all_cancers(142;0.0138)|all_epithelial(76;0.000445)|Colorectal(10;0.00814)|Prostate(80;0.0115)|Ovarian(225;0.156)		Epithelial(69;4.15e-08)|OV - Ovarian serous cystadenocarcinoma(64;4.49e-08)|all cancers(49;3.2e-06)|COAD - Colon adenocarcinoma(37;0.0371)|Colorectal(14;0.0449)		CCCTGGACCGCGAGCTCCATG	0.512																																					p.A93T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G277A	5						.	C	THR/ALA,	0,4372		0,0,2186	60.0	65.0	63.0		277,	0.9	0.9	5		63	1,8589	1.2+/-3.3	0,1,4294	no	missense,intron	MCC,TSSK1B	NM_032028.3,NM_001085377.1	58,	0,1,6480	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,	93/368,	112770260	1,12961	2186	4295	6481	112798159	SO:0001583	missense	83942	exon1			AF348076	CCDS4112.1	5q22.2	2008-10-23	2007-01-30	2007-01-30	ENSG00000212122	ENSG00000212122			14968	protein-coding gene	gene with protein product		610709	"""serine/threonine kinase 22D (spermiogenesis associated)"", ""testis-specific serine kinase 1"""	STK22D, TSSK1		15044604	Standard	NM_032028		Approved	SPOGA4, FKSG81	uc003kqm.2	Q9BXA7	OTTHUMG00000128835	ENST00000390666.3:c.277G>A	5.37:g.112770260C>T	ENSP00000375081:p.Ala93Thr	Somatic		Capture	Illumina HiSeq	Phase_I	112798159	NM_032028	B2R8D9	Missense_Mutation	SNP	ENST00000390666.3	37	CCDS4112.1	.	.	.	.	.	.	.	.	.	.	C	14.21	2.466413	0.43839	0.0	1.16E-4	ENSG00000212122	ENST00000390666	T	0.25912	1.77	2.71	0.853	0.19001	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.35040	U	0.003487	T	0.43389	0.1245	M	0.80982	2.52	0.09310	N	1	D	0.54207	0.965	P	0.62298	0.9	T	0.23976	-1.0173	10	0.87932	D	0	.	6.5129	0.22232	0.0:0.7337:0.0:0.2663	.	93	Q9BXA7	TSSK1_HUMAN	T	93	ENSP00000375081:A93T	ENSP00000375081:A93T	A	-	1	0	TSSK1B	112798159	0.008000	0.16893	0.870000	0.34147	0.577000	0.36160	1.914000	0.39966	0.068000	0.16574	-0.244000	0.11960	GCG		TSSK1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250774.2	NM_032028	
TRPC7	57113	broad.mit.edu	37	5	135587338	135587338	+	Splice_Site	SNP	G	G	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr5:135587338G>A	ENST00000513104.1	-	6	1860	c.1578C>T	c.(1576-1578)taC>taT	p.Y526Y	TRPC7_ENST00000355180.3_Splice_Site_p.Y465Y|TRPC7_ENST00000426057.2_Splice_Site_p.Y410Y	NM_020389.2	NP_065122.1	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel, subfamily C, member 7	526					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|manganese ion transport (GO:0006828)|platelet activation (GO:0030168)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.Y526Y(2)		NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(3)	46			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CCGACTCACCGTAGGTGAAGT	0.577																																					p.Y526Y												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1578T	5						.						34.0	36.0	35.0					5																	135587338		2141	4242	6383	135615237	SO:0001630	splice_region_variant	57113	exon6			AJ272034	CCDS47267.1, CCDS47267.2, CCDS54905.1, CCDS54906.1	5q31.2	2011-12-14			ENSG00000069018	ENSG00000069018		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	20754	protein-coding gene	gene with protein product						11805119, 16382100	Standard	NM_020389		Approved		uc003lbn.2	Q9HCX4	OTTHUMG00000162035	ENST00000513104.1:c.1579+1C>T	5.37:g.135587338G>A		Somatic		Capture	Illumina HiSeq	Phase_I	135615237	NM_020389	A1A4Z4|F5H5U9|Q70T26|Q8IWP7	Silent	SNP	ENST00000513104.1	37	CCDS47267.2	.	.	.	.	.	.	.	.	.	.	G	0.471	-0.884494	0.02530	.	.	ENSG00000069018	ENST00000352189;ENST00000378459;ENST00000502753	.	.	.	5.21	0.0605	0.14336	.	.	.	.	.	T	0.42200	0.1192	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.23797	-1.0178	4	.	.	.	-14.6101	2.0168	0.03500	0.3839:0.1245:0.365:0.1266	.	.	.	.	C	410;465;471	.	.	R	-	1	0	TRPC7	135615237	0.960000	0.32886	0.998000	0.56505	0.002000	0.02628	0.131000	0.15870	0.088000	0.17205	-0.903000	0.02851	CGC		TRPC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366975.1	NM_020389	Silent
TRIO	7204	broad.mit.edu	37	5	14358329	14358329	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr5:14358329G>A	ENST00000344204.4	+	12	2113	c.2089G>A	c.(2089-2091)Gac>Aac	p.D697N	TRIO_ENST00000537187.1_Missense_Mutation_p.D697N|TRIO_ENST00000509967.2_Missense_Mutation_p.D648N	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	697					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.D697N(1)		NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					GCTGCTGGACGACGTGTATGC	0.662																																					p.D697N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2089A	5						.						71.0	58.0	63.0					5																	14358329		2203	4300	6503	14411329	SO:0001583	missense	7204	exon12			AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.2089G>A	5.37:g.14358329G>A	ENSP00000339299:p.Asp697Asn	Somatic		Capture	Illumina HiSeq	Phase_I	14411329	NM_007118	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	ENST00000344204.4	37	CCDS3883.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.529411	0.85706	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000509967;ENST00000513206	T;T;T	0.47177	0.94;0.94;0.85	4.61	4.61	0.57282	.	0.000000	0.85682	D	0.000000	T	0.64571	0.2610	L	0.55990	1.75	0.80722	D	1	D;P;D	0.76494	0.997;0.938;0.999	D;P;D	0.72625	0.916;0.459;0.978	T	0.66650	-0.5870	10	0.52906	T	0.07	.	17.7922	0.88555	0.0:0.0:1.0:0.0	.	648;697;697	F5H228;O75962-5;O75962	.;.;TRIO_HUMAN	N	697;697;648;384	ENSP00000339299:D697N;ENSP00000446348:D697N;ENSP00000445592:D648N	ENSP00000339299:D697N	D	+	1	0	TRIO	14411329	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.782000	0.99034	2.273000	0.75805	0.484000	0.47621	GAC		TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118	
OTULIN	90268	broad.mit.edu	37	5	14693060	14693060	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr5:14693060C>G	ENST00000284274.4	+	7	1040	c.962C>G	c.(961-963)aCc>aGc	p.T321S		NM_138348.4	NP_612357.4	Q96BN8	OTUL_HUMAN		321	OTU.				canonical Wnt signaling pathway (GO:0060070)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|protein linear deubiquitination (GO:1990108)|sprouting angiogenesis (GO:0002040)	cytoplasm (GO:0005737)|LUBAC complex (GO:0071797)	cysteine-type peptidase activity (GO:0008234)|ubiquitin-specific protease activity (GO:0004843)	p.T321S(1)		breast(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)	14	Lung NSC(4;0.00696)					GTCTACCCCACCGACCCACCC	0.537																																					p.T321S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C962G	5						.						95.0	102.0	99.0					5																	14693060		2094	4219	6313	14746060	SO:0001583	missense	90268	exon7																														ENST00000284274.4:c.962C>G	5.37:g.14693060C>G	ENSP00000284274:p.Thr321Ser	Somatic		Capture	Illumina HiSeq	Phase_I	14746060	NM_138348	D3DTD3|Q8NAS0|Q96IA3	Missense_Mutation	SNP	ENST00000284274.4	37	CCDS43302.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.67|13.67	2.306334|2.306334	0.40795|0.40795	.|.	.|.	ENSG00000154124|ENSG00000154124	ENST00000506417|ENST00000284274	.|T	.|0.16196	.|2.36	5.73|5.73	5.73|5.73	0.89815|0.89815	.|.	.|0.157921	.|0.56097	.|D	.|0.000032	T|T	0.11922|0.11922	0.0290|0.0290	N|N	0.22421|0.22421	0.69|0.69	0.29602|0.29602	N|N	0.847589|0.847589	.|B	.|0.06786	.|0.001	.|B	.|0.09377	.|0.004	T|T	0.04579|0.04579	-1.0941|-1.0941	5|10	.|0.51188	.|T	.|0.08	-14.9063|-14.9063	9.4734|9.4734	0.38856|0.38856	0.2627:0.603:0.1343:0.0|0.2627:0.603:0.1343:0.0	.|.	.|321	.|Q96BN8	.|F105B_HUMAN	Q|S	52|321	.|ENSP00000284274:T321S	.|ENSP00000284274:T321S	H|T	+|+	3|2	2|0	FAM105B|FAM105B	14746060|14746060	0.999000|0.999000	0.42202|0.42202	0.988000|0.988000	0.46212|0.46212	0.842000|0.842000	0.47809|0.47809	4.120000|4.120000	0.57897|0.57897	2.692000|2.692000	0.91855|0.91855	0.655000|0.655000	0.94253|0.94253	CAC|ACC		FAM105B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366012.1		
PCDHB12	56124	broad.mit.edu	37	5	140590358	140590358	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr5:140590358G>A	ENST00000239450.2	+	1	2068	c.1879G>A	c.(1879-1881)Gcc>Acc	p.A627T	PCDHB12_ENST00000541609.1_Missense_Mutation_p.A290T	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	627	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A627S(1)|p.A627T(1)		NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGTGCGCACCGCCAGGCTGCT	0.701																																					p.A627T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1879A	5						.						7.0	10.0	9.0					5																	140590358		1588	3245	4833	140570542	SO:0001583	missense	56124	exon1			AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.1879G>A	5.37:g.140590358G>A	ENSP00000239450:p.Ala627Thr	Somatic		Capture	Illumina HiSeq	Phase_I	140570542	NM_018932	B4DDU1	Missense_Mutation	SNP	ENST00000239450.2	37	CCDS4254.1	.	.	.	.	.	.	.	.	.	.	G	9.275	1.046626	0.19748	.	.	ENSG00000120328	ENST00000541609;ENST00000239450;ENST00000507840	T;T	0.48522	0.81;0.81	3.53	0.502	0.16932	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.20495	0.0493	N	0.03999	-0.3	0.09310	N	1	B	0.27166	0.17	B	0.27380	0.079	T	0.20806	-1.0264	9	0.23302	T	0.38	.	3.7634	0.08613	0.4018:0.0:0.4299:0.1683	.	627	Q9Y5F1	PCDBC_HUMAN	T	290;627;247	ENSP00000440199:A290T;ENSP00000239450:A627T	ENSP00000239450:A627T	A	+	1	0	PCDHB12	140570542	0.000000	0.05858	0.045000	0.18777	0.998000	0.95712	-2.933000	0.00687	0.115000	0.18071	0.479000	0.44913	GCC		PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251815.2	NM_018932	
FBXO4	26272	broad.mit.edu	37	5	41934414	41934414	+	Intron	SNP	A	A	G			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr5:41934414A>G	ENST00000281623.3	+	5	954				FBXO4_ENST00000296812.2_Missense_Mutation_p.K301R|FBXO4_ENST00000509134.1_Intron	NM_012176.2	NP_036308.1	Q9UKT5	FBX4_HUMAN	F-box protein 4						positive regulation of protein ubiquitination (GO:0031398)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|telomere maintenance (GO:0000723)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	protein homodimerization activity (GO:0042803)|ubiquitin-protein transferase activity (GO:0004842)	p.?(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(11)|prostate(1)|stomach(1)|urinary_tract(2)	27		Lung NSC(810;4.15e-05)|Breast(839;0.00093)|Ovarian(839;0.00965)|Myeloproliferative disorder(839;0.0255)|all_neural(839;0.0604)				CATAAAAGTAAGTACTCATAT	0.348																																					p.K301R												.	.	1	Unknown(1)	large_intestine(1)	c.A902G	5						.						105.0	106.0	106.0					5																	41934414		2203	4300	6503	41970171	SO:0001627	intron_variant	26272	exon5			AF129534	CCDS3938.1, CCDS3939.1, CCDS75238.1	5p12	2008-02-05	2004-06-15		ENSG00000151876	ENSG00000151876		"""F-boxes /  ""other"""""	13583	protein-coding gene	gene with protein product		609090	"""F-box only protein 4"""			10531035, 10531037	Standard	NM_033484		Approved	FBX4	uc003jmq.3	Q9UKT5	OTTHUMG00000094799	ENST00000281623.3:c.898+4A>G	5.37:g.41934414A>G		Somatic		Capture	Illumina HiSeq	Phase_I	41970171	NM_033484	Q68CU8|Q86VT8|Q9UK98	Missense_Mutation	SNP	ENST00000281623.3	37	CCDS3938.1	.	.	.	.	.	.	.	.	.	.	A	9.077	0.998314	0.19121	.	.	ENSG00000151876	ENST00000296812	.	.	.	5.78	5.78	0.91487	.	.	.	.	.	T	0.63745	0.2537	.	.	.	0.80722	D	1	P	0.49559	0.925	P	0.49752	0.621	T	0.63629	-0.6594	6	.	.	.	.	16.1095	0.81250	1.0:0.0:0.0:0.0	.	301	Q9UKT5-2	.	R	301	.	.	K	+	2	0	FBXO4	41970171	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	8.277000	0.89896	2.205000	0.71048	0.533000	0.62120	AAG		FBXO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211614.1		
GABRA6	2559	broad.mit.edu	37	5	161119153	161119153	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr5:161119153C>T	ENST00000274545.5	+	8	1466	c.1033C>T	c.(1033-1035)Ccc>Tcc	p.P345S	GABRA6_ENST00000523217.1_Missense_Mutation_p.P335S|RP11-348M17.2_ENST00000521984.1_RNA			Q16445	GBRA6_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 6	345					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.P345S(1)		breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|liver(2)|lung(22)|ovary(7)|skin(6)|urinary_tract(2)	57	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	TGCAGCCCCACCCACAGTGAC	0.433										TCGA Ovarian(5;0.080)																											p.P345S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1033T	5						.						153.0	135.0	141.0					5																	161119153		2203	4300	6503	161051731	SO:0001583	missense	2559	exon8				CCDS4356.1	5q34	2012-06-22			ENSG00000145863	ENSG00000145863		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4080	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 6"""	137143				8020978	Standard	NM_000811		Approved		uc003lyu.2	Q16445	OTTHUMG00000130351	ENST00000274545.5:c.1033C>T	5.37:g.161119153C>T	ENSP00000274545:p.Pro345Ser	Somatic		Capture	Illumina HiSeq	Phase_I	161051731	NM_000811	A8K096|Q4VAV2	Missense_Mutation	SNP	ENST00000274545.5	37	CCDS4356.1	.	.	.	.	.	.	.	.	.	.	C	0.653	-0.808849	0.02819	.	.	ENSG00000145863	ENST00000274545;ENST00000523217	D;D	0.83837	-1.77;-1.77	5.24	-6.53	0.01866	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.560671	0.18040	N	0.153649	T	0.57636	0.2067	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.53837	-0.8382	10	0.11794	T	0.64	.	3.1345	0.06435	0.0957:0.2259:0.376:0.3024	.	345	Q16445	GBRA6_HUMAN	S	345;335	ENSP00000274545:P345S;ENSP00000430527:P335S	ENSP00000274545:P345S	P	+	1	0	GABRA6	161051731	0.000000	0.05858	0.000000	0.03702	0.113000	0.19764	-0.177000	0.09796	-1.522000	0.01769	-0.319000	0.08680	CCC		GABRA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252707.2		
LATS1	9113	broad.mit.edu	37	6	150001235	150001235	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr6:150001235A>G	ENST00000543571.1	-	5	2916	c.2369T>C	c.(2368-2370)aTg>aCg	p.M790T	LATS1_ENST00000253339.5_Missense_Mutation_p.M790T|LATS1_ENST00000542747.1_5'UTR	NM_004690.3	NP_004681.1			large tumor suppressor kinase 1									p.M790T(2)		central_nervous_system(1)|lung(5)	6		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)		TAGGCTCATCATATCACCCCC	0.388																																					p.M790T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T2369C	6						.						122.0	121.0	121.0					6																	150001235		2203	4300	6503	150042928	SO:0001583	missense	9113	exon5			AF104413	CCDS34551.1, CCDS59040.1	6q25.1	2013-04-25	2013-04-25		ENSG00000131023	ENSG00000131023			6514	protein-coding gene	gene with protein product		603473	"""LATS (large tumor suppressor, Drosophila) homolog 1"", ""LATS, large tumor suppressor, homolog 1 (Drosophila)"""			9988268, 15122335	Standard	NM_004690		Approved	WARTS	uc003qmu.2	O95835	OTTHUMG00000016437	ENST00000543571.1:c.2369T>C	6.37:g.150001235A>G	ENSP00000437550:p.Met790Thr	Somatic		Capture	Illumina HiSeq	Phase_I	150042928	NM_004690		Missense_Mutation	SNP	ENST00000543571.1	37	CCDS34551.1	.	.	.	.	.	.	.	.	.	.	A	19.58	3.853843	0.71719	.	.	ENSG00000131023	ENST00000543571;ENST00000253339	T;T	0.08193	3.12;3.12	5.5	5.5	0.81552	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	T	0.10423	0.0255	L	0.28556	0.865	0.80722	D	1	D	0.62365	0.991	D	0.69654	0.965	T	0.28106	-1.0054	9	.	.	.	.	15.9043	0.79412	1.0:0.0:0.0:0.0	.	790	O95835	LATS1_HUMAN	T	790	ENSP00000437550:M790T;ENSP00000253339:M790T	.	M	-	2	0	LATS1	150042928	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.287000	0.95975	2.203000	0.70933	0.460000	0.39030	ATG		LATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043923.4	NM_004690	
TRERF1	55809	broad.mit.edu	37	6	42236002	42236002	+	Missense_Mutation	SNP	G	G	A	rs371552696		TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr6:42236002G>A	ENST00000372922.4	-	5	1889	c.1327C>T	c.(1327-1329)Cgg>Tgg	p.R443W	TRERF1_ENST00000541110.1_Missense_Mutation_p.R443W|TRERF1_ENST00000340840.2_Missense_Mutation_p.R443W|TRERF1_ENST00000354325.2_Missense_Mutation_p.R443W|TRERF1_ENST00000372917.4_Missense_Mutation_p.R443W	NM_033502.2	NP_277037.1	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	443	Interacts with CREBBP.				cholesterol catabolic process (GO:0006707)|homeostatic process (GO:0042592)|multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone biosynthetic process (GO:0046885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|steroid biosynthetic process (GO:0006694)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.R443W(1)		breast(1)|central_nervous_system(2)|endometrium(7)|kidney(1)|large_intestine(12)|lung(13)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(2)	45	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			CTGCTGACCCGGGTCAGATCT	0.632																																					p.R443W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1327T	6						.						49.0	53.0	51.0					6																	42236002		2203	4300	6503	42343980	SO:0001583	missense	55809	exon5			AF297872	CCDS4867.1, CCDS75455.1	6p21.1-p12.1	2012-09-25			ENSG00000124496	ENSG00000124496			18273	protein-coding gene	gene with protein product		610322	"""breast cancer anti-estrogen resistance 2"""	BCAR2		11349124	Standard	XM_005249223		Approved	TReP-132, HSA277276, RAPA, dJ139D8.5	uc003osd.2	Q96PN7	OTTHUMG00000014698	ENST00000372922.4:c.1327C>T	6.37:g.42236002G>A	ENSP00000362013:p.Arg443Trp	Somatic		Capture	Illumina HiSeq	Phase_I	42343980	NM_033502	Q05GC6|Q7Z6T2|Q7Z6T3|Q9NQ72|Q9NQ73|Q9NUN9	Missense_Mutation	SNP	ENST00000372922.4	37	CCDS4867.1	.	.	.	.	.	.	.	.	.	.	G	10.86	1.470434	0.26423	.	.	ENSG00000124496	ENST00000541110;ENST00000372917;ENST00000372922;ENST00000340840;ENST00000354325	T;T;T;T;T	0.12774	2.85;2.65;2.86;2.65;2.65	4.97	4.97	0.65823	.	0.378221	0.22589	N	0.058112	T	0.08626	0.0214	N	0.19112	0.55	0.29834	N	0.829778	D;D;D;D;D	0.67145	0.996;0.993;0.993;0.996;0.996	P;P;P;P;P	0.59546	0.802;0.638;0.638;0.859;0.859	T	0.07868	-1.0750	10	0.66056	D	0.02	-39.1213	6.4908	0.22115	0.1235:0.1803:0.6962:0.0	.	443;443;443;282;282	Q96PN7-4;Q05GC8;Q96PN7;Q96PN7-2;Q96PN7-3	.;.;TREF1_HUMAN;.;.	W	443	ENSP00000439689:R443W;ENSP00000362008:R443W;ENSP00000362013:R443W;ENSP00000339438:R443W;ENSP00000346285:R443W	ENSP00000339438:R443W	R	-	1	2	TRERF1	42343980	0.980000	0.34600	0.997000	0.53966	0.076000	0.17211	2.551000	0.45820	2.688000	0.91661	0.491000	0.48974	CGG		TRERF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040551.2	NM_033502	
RSPH9	221421	broad.mit.edu	37	6	43623376	43623376	+	Silent	SNP	C	C	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr6:43623376C>T	ENST00000372163.4	+	3	524	c.471C>T	c.(469-471)ggC>ggT	p.G157G	RSPH9_ENST00000372165.4_Silent_p.G142G	NM_152732.4	NP_689945.2	Q9H1X1	RSPH9_HUMAN	radial spoke head 9 homolog (Chlamydomonas)	157					axoneme assembly (GO:0035082)|cilium movement (GO:0003341)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|motile cilium (GO:0031514)		p.G157G(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12						TCCCCCGAGGCGCCCTCTTCA	0.572									Kartagener syndrome																												p.G142G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C426T	6						.						142.0	144.0	143.0					6																	43623376		2203	4300	6503	43731354	SO:0001819	synonymous_variant	221421	exon3	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AK055407	CCDS4905.1, CCDS55005.1	6p21.1	2012-05-03	2009-02-17	2009-02-17	ENSG00000172426	ENSG00000172426			21057	protein-coding gene	gene with protein product		612648	"""mitochondrial ribosomal protein S18A-like 1"", ""chromosome 6 open reading frame 206"""	MRPS18AL1, C6orf206		19200523	Standard	NM_152732		Approved	FLJ30845, CILD12	uc003ovx.2	Q9H1X1	OTTHUMG00000014746	ENST00000372163.4:c.471C>T	6.37:g.43623376C>T		Somatic		Capture	Illumina HiSeq	Phase_I	43731354	NM_001193341	A8K5T4|Q96NH9	Silent	SNP	ENST00000372163.4	37	CCDS4905.1	.	.	.	.	.	.	.	.	.	.	C	9.689	1.151384	0.21371	.	.	ENSG00000172426	ENST00000417236	.	.	.	5.68	-11.4	0.00090	.	.	.	.	.	T	0.18882	0.0453	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45920	-0.9228	4	.	.	.	-8.401	4.5425	0.12066	0.3523:0.4283:0.0846:0.1349	.	.	.	.	C	82	.	.	R	+	1	0	RSPH9	43731354	0.000000	0.05858	0.671000	0.29857	0.975000	0.68041	-3.794000	0.00364	-1.699000	0.01416	-0.469000	0.05056	CGC		RSPH9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040690.1	NM_152732	
OOEP	441161	broad.mit.edu	37	6	74079008	74079008	+	Silent	SNP	G	G	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr6:74079008G>A	ENST00000370359.5	-	2	290	c.291C>T	c.(289-291)ttC>ttT	p.F97F	OOEP-AS1_ENST00000445350.2_RNA|OOEP_ENST00000370363.1_Silent_p.F42F	NM_001080507.2	NP_001073976.1	A6NGQ2	OOEP_HUMAN	oocyte expressed protein	97	KH; atypical.				cellular protein complex assembly (GO:0043623)|embryo implantation (GO:0007566)|embryonic pattern specification (GO:0009880)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|protein phosphorylation (GO:0006468)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|protein complex (GO:0043234)	RNA binding (GO:0003723)	p.F97F(1)		large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	8						GGGGCCGCCCGAAAACGGTGA	0.567																																					p.F97F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C291T	6						.						53.0	52.0	52.0					6																	74079008		1958	4140	6098	74135729	SO:0001819	synonymous_variant	441161	exon2			BC024931	CCDS47451.1	6q13	2012-02-22	2012-02-22	2007-11-13	ENSG00000203907	ENSG00000203907			21382	protein-coding gene	gene with protein product	"""KH homology domain containing 2"""	611689	"""chromosome 6 open reading frame 156"", ""oocyte expressed protein homolog (dog)"""	C6orf156		17913455	Standard	NM_001080507		Approved	Em:AC019205.2, KHDC2	uc003pgu.4	A6NGQ2	OTTHUMG00000150057	ENST00000370359.5:c.291C>T	6.37:g.74079008G>A		Somatic		Capture	Illumina HiSeq	Phase_I	74135729	NM_001080507	A6NIN5|A9UIB7	Silent	SNP	ENST00000370359.5	37	CCDS47451.1																																																																																				OOEP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000108414.2	NM_001080507	
RRAGD	58528	broad.mit.edu	37	6	90088991	90088991	+	Silent	SNP	C	C	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr6:90088991C>A	ENST00000369415.4	-	4	987	c.711G>T	c.(709-711)ctG>ctT	p.L237L	RRAGD_ENST00000359203.3_Silent_p.L86L|RRAGD_ENST00000492783.1_5'UTR	NM_021244.4	NP_067067.1			Ras-related GTP binding D									p.L237L(1)		breast(1)|central_nervous_system(1)|large_intestine(4)|lung(7)|ovary(2)	15		all_cancers(76;7.01e-07)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00139)		BRCA - Breast invasive adenocarcinoma(108;0.0144)		GTTGTGGAATCAGTTTCTGAA	0.323																																					p.L237L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G711T	6						.						99.0	100.0	100.0					6																	90088991		2203	4300	6503	90145710	SO:0001819	synonymous_variant	58528	exon4			AF272036	CCDS5022.1	6q15-q16	2008-02-05			ENSG00000025039	ENSG00000025039			19903	protein-coding gene	gene with protein product		608268				11073942	Standard	NM_021244		Approved	DKFZP761H171, bA11D8.2.1	uc003pnd.4	Q9NQL2	OTTHUMG00000015200	ENST00000369415.4:c.711G>T	6.37:g.90088991C>A		Somatic		Capture	Illumina HiSeq	Phase_I	90145710	NM_021244		Silent	SNP	ENST00000369415.4	37	CCDS5022.1																																																																																				RRAGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041484.1	NM_021244	
CASP8AP2	9994	broad.mit.edu	37	6	90577908	90577908	+	RNA	SNP	T	T	G			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr6:90577908T>G	ENST00000551025.1	+	0	6336									caspase 8 associated protein 2									p.A1633A(1)		NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		TTAAAGATGCTTCAGATAAGA	0.368																																					p.A1633A	Colon(187;1656 2025 17045 31481 39901)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T4899G	6						.						55.0	55.0	55.0					6																	90577908		1880	4107	5987	90634629			9994	exon8			AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90577908T>G		Somatic		Capture	Illumina HiSeq	Phase_I	90634629	NM_001137667		Silent	SNP	ENST00000551025.1	37																																																																																					CASP8AP2-202	KNOWN	basic	processed_transcript	processed_transcript		NM_001137667	
DLL1	28514	broad.mit.edu	37	6	170592118	170592118	+	Silent	SNP	G	G	A	rs150208957		TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr6:170592118G>A	ENST00000366756.3	-	10	2457	c.2124C>T	c.(2122-2124)taC>taT	p.Y708Y		NM_005618.3	NP_005609.3	O00548	DLL1_HUMAN	delta-like 1 (Drosophila)	708					cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|cell-cell signaling (GO:0007267)|compartment pattern specification (GO:0007386)|determination of left/right symmetry (GO:0007368)|heart looping (GO:0001947)|hemopoiesis (GO:0030097)|inner ear development (GO:0048839)|left/right axis specification (GO:0070986)|loop of Henle development (GO:0072070)|negative regulation of auditory receptor cell differentiation (GO:0045608)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of myeloid cell differentiation (GO:0045638)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal tubule development (GO:0072014)|regulation of cell adhesion (GO:0030155)|somite specification (GO:0001757)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|Notch binding (GO:0005112)	p.Y708Y(1)		NS(2)|breast(1)|endometrium(1)|large_intestine(7)|lung(17)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	33		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;6.71e-23)|BRCA - Breast invasive adenocarcinoma(81;4.81e-06)|GBM - Glioblastoma multiforme(31;0.0584)		CGGATATGACGTACACCGACT	0.517													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16711	0.0		0.0	False		,,,				2504	0.0				p.Y708Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2124T	6						.	G		0,4406		0,0,2203	184.0	181.0	182.0		2124	-2.6	0.9	6	dbSNP_134	182	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	DLL1	NM_005618.3		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		708/724	170592118	2,13004	2203	4300	6503	170434043	SO:0001819	synonymous_variant	28514	exon10			AF003522	CCDS5313.1	6q13-q22.33	2008-07-28	2001-12-03		ENSG00000198719	ENSG00000198719			2908	protein-coding gene	gene with protein product		606582	"""delta (Drosophila)-like 1"""				Standard	NM_005618		Approved		uc003qxm.3	O00548	OTTHUMG00000016078	ENST00000366756.3:c.2124C>T	6.37:g.170592118G>A		Somatic		Capture	Illumina HiSeq	Phase_I	170434043	NM_005618	B2RAK7|B5M0B3|Q9NU41|Q9UJV2	Silent	SNP	ENST00000366756.3	37	CCDS5313.1																																																																																				DLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043254.1		
LAMB4	22798	broad.mit.edu	37	7	107746291	107746291	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr7:107746291G>A	ENST00000388781.3	-	8	924	c.841C>T	c.(841-843)Cgg>Tgg	p.R281W	LAMB4_ENST00000388780.3_Missense_Mutation_p.R281W|LAMB4_ENST00000418464.1_Missense_Mutation_p.R281W|LAMB4_ENST00000414450.2_Missense_Mutation_p.R281W|LAMB4_ENST00000205386.4_Missense_Mutation_p.R281W	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	281	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)		p.R281W(1)		NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						ACATCTCCCCGCATCTTCTGC	0.463																																					p.R281W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C841T	7						.						101.0	90.0	93.0					7																	107746291		2203	4300	6503	107533527	SO:0001583	missense	22798	exon8			AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.841C>T	7.37:g.107746291G>A	ENSP00000373433:p.Arg281Trp	Somatic		Capture	Illumina HiSeq	Phase_I	107533527	NM_007356	A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	ENST00000388781.3	37	CCDS34732.1	.	.	.	.	.	.	.	.	.	.	G	16.75	3.210838	0.58343	.	.	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000388780;ENST00000418464;ENST00000414450	T;T;T;T;T	0.35048	1.33;1.33;1.35;1.33;1.37	4.55	1.7	0.24286	EGF-like, laminin (3);	0.149436	0.30347	N	0.009829	T	0.54743	0.1877	M	0.77486	2.375	0.21802	N	0.999535	D	0.89917	1.0	D	0.74674	0.984	T	0.45338	-0.9268	10	0.66056	D	0.02	.	8.3114	0.32073	0.0738:0.0:0.6489:0.2773	.	281	A4D0S4	LAMB4_HUMAN	W	281	ENSP00000205386:R281W;ENSP00000373433:R281W;ENSP00000373432:R281W;ENSP00000402353:R281W;ENSP00000402265:R281W	ENSP00000205386:R281W	R	-	1	2	LAMB4	107533527	0.008000	0.16893	0.001000	0.08648	0.865000	0.49528	1.586000	0.36611	0.162000	0.19483	0.655000	0.94253	CGG		LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337442.1	XM_209857	
KCND2	3751	broad.mit.edu	37	7	119915013	119915013	+	Silent	SNP	C	C	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr7:119915013C>T	ENST00000331113.4	+	1	1292	c.327C>T	c.(325-327)caC>caT	p.H109H		NM_012281.2	NP_036413.1	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 2	109					action potential (GO:0001508)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)	p.H109H(2)		NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(35)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	75	all_neural(327;0.117)				Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	ATCCTCGCCACGAGTGCATCT	0.527																																					p.H109H												.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.C327T	7						.						150.0	150.0	150.0					7																	119915013		2203	4300	6503	119702249	SO:0001819	synonymous_variant	3751	exon1			AJ010969	CCDS5776.1	7q31	2012-07-05			ENSG00000184408	ENSG00000184408		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6238	protein-coding gene	gene with protein product		605410				10551270, 16382104	Standard	NM_012281		Approved	Kv4.2, RK5, KIAA1044	uc003vjj.1	Q9NZV8	OTTHUMG00000156989	ENST00000331113.4:c.327C>T	7.37:g.119915013C>T		Somatic		Capture	Illumina HiSeq	Phase_I	119702249	NM_012281	O95012|O95021|Q2TBD3|Q9UBY7|Q9UN98|Q9UNH9	Silent	SNP	ENST00000331113.4	37	CCDS5776.1																																																																																				KCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346996.1	NM_012281	
CADPS2	93664	broad.mit.edu	37	7	122303536	122303536	+	Missense_Mutation	SNP	T	T	A	rs41281722		TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr7:122303536T>A	ENST00000449022.2	-	3	560	c.541A>T	c.(541-543)Ata>Tta	p.I181L	CADPS2_ENST00000313070.7_Missense_Mutation_p.I181L|CADPS2_ENST00000412584.2_Missense_Mutation_p.I181L|CADPS2_ENST00000334010.7_Missense_Mutation_p.I181L	NM_017954.10	NP_060424.9	Q86UW7	CAPS2_HUMAN	Ca++-dependent secretion activator 2	181					cellular response to starvation (GO:0009267)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasmic membrane-bounded vesicle (GO:0016023)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)	p.I181L(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(2)	43						CGTTTTTCTATGTTTTTCTTA	0.413																																					p.I181L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A541T	7						.						78.0	70.0	72.0					7																	122303536		1846	4114	5960	122090772	SO:0001583	missense	93664	exon3				CCDS47691.1, CCDS55158.1	7q31.32	2013-01-10	2008-08-28		ENSG00000081803	ENSG00000081803		"""Pleckstrin homology (PH) domain containing"""	16018	protein-coding gene	gene with protein product		609978	"""Ca++-dependent activator protein for secretion 2"""				Standard	NM_017954		Approved		uc010lkq.3	Q86UW7	OTTHUMG00000157093	ENST00000449022.2:c.541A>T	7.37:g.122303536T>A	ENSP00000398481:p.Ile181Leu	Somatic		Capture	Illumina HiSeq	Phase_I	122090772	NM_001167940	A4D0X3|B7ZM56|Q658Q2|Q7Z5T7|Q8IZW9|Q8N7M4|Q9H6P4|Q9HCI1|Q9NWK8	Missense_Mutation	SNP	ENST00000449022.2	37	CCDS55158.1	.	.	.	.	.	.	.	.	.	.	T	34	5.403930	0.96051	.	.	ENSG00000081803	ENST00000313070;ENST00000334010;ENST00000420900;ENST00000545465;ENST00000412584;ENST00000449022	D;D;D;D	0.87571	-2.27;-2.27;-2.27;-2.27	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	D	0.92740	0.7692	M	0.80422	2.495	0.80722	D	1	B;D	0.53462	0.058;0.96	B;P	0.61592	0.065;0.891	D	0.93767	0.7071	10	0.87932	D	0	-15.9912	15.1818	0.72965	0.0:0.0:0.0:1.0	.	181;181	Q86UW7-2;Q86UW7	.;CAPS2_HUMAN	L	181;181;181;148;181;181	ENSP00000325581:I181L;ENSP00000333940:I181L;ENSP00000400401:I181L;ENSP00000398481:I181L	ENSP00000325581:I181L	I	-	1	0	CADPS2	122090772	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.013000	0.88655	1.997000	0.58415	0.528000	0.53228	ATA		CADPS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347414.2	NM_017954	
SLC4A2	6522	broad.mit.edu	37	7	150771262	150771262	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr7:150771262A>G	ENST00000485713.1	+	17	3712	c.2672A>G	c.(2671-2673)cAg>cGg	p.Q891R	SLC4A2_ENST00000461735.1_Missense_Mutation_p.Q877R|SLC4A2_ENST00000310317.5_Missense_Mutation_p.Q809R|FASTK_ENST00000489884.1_5'Flank|SLC4A2_ENST00000392826.2_Missense_Mutation_p.Q882R|SLC4A2_ENST00000413384.2_Missense_Mutation_p.Q891R|RP11-148K1.12_ENST00000485974.1_RNA	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2	891	Membrane (anion exchange).				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CAGTCTGGGCAGGGGAAGCCC	0.652																																					p.Q877R												.	.	0			c.A2630G	7						.						20.0	25.0	23.0					7																	150771262		2199	4294	6493	150402195	SO:0001583	missense	6522	exon16				CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.2672A>G	7.37:g.150771262A>G	ENSP00000419412:p.Gln891Arg	None		Capture	Illumina HiSeq	Phase_I	150402195	NM_001199694	B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	Missense_Mutation	SNP	ENST00000485713.1	37	CCDS5917.1	.	.	.	.	.	.	.	.	.	.	A	7.696	0.692059	0.15039	.	.	ENSG00000164889	ENST00000485713;ENST00000413384;ENST00000310317;ENST00000392826;ENST00000461735	T;T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19;-1.19	5.54	-1.88	0.07713	Bicarbonate transporter, C-terminal (1);	0.967223	0.08474	N	0.940605	T	0.48660	0.1512	N	0.04508	-0.205	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.001	T	0.31138	-0.9954	10	0.17369	T	0.5	.	3.1783	0.06576	0.3328:0.4403:0.0843:0.1425	.	882;877;891	F8W682;P04920-2;P04920	.;.;B3A2_HUMAN	R	891;891;809;882;877	ENSP00000419412:Q891R;ENSP00000405600:Q891R;ENSP00000311402:Q809R;ENSP00000376571:Q882R;ENSP00000419164:Q877R	ENSP00000311402:Q809R	Q	+	2	0	SLC4A2	150402195	0.000000	0.05858	0.065000	0.19835	0.747000	0.42532	0.172000	0.16704	0.013000	0.14918	0.459000	0.35465	CAG		SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351039.1	NM_003040	
WBSCR17	64409	broad.mit.edu	37	7	70853279	70853279	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr7:70853279G>A	ENST00000333538.5	+	3	1115	c.481G>A	c.(481-483)Gtg>Atg	p.V161M	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	161	Catalytic subdomain A.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.V161M(2)		NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				ATTCATCTTCGTGAACGAGGC	0.532																																					p.V161M												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G481A	7						.						124.0	109.0	114.0					7																	70853279		2203	4300	6503	70491215	SO:0001583	missense	64409	exon3			AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.481G>A	7.37:g.70853279G>A	ENSP00000329654:p.Val161Met	Somatic		Capture	Illumina HiSeq	Phase_I	70491215	NM_022479	Q8NFV9|Q9NTA8	Missense_Mutation	SNP	ENST00000333538.5	37	CCDS5540.1	.	.	.	.	.	.	.	.	.	.	G	18.38	3.611267	0.66558	.	.	ENSG00000185274	ENST00000333538;ENST00000447516	T;T	0.61392	0.11;0.11	5.44	5.44	0.79542	Glycosyl transferase, family 2 (1);	0.000000	0.85682	D	0.000000	T	0.73885	0.3644	L	0.61387	1.9	0.58432	D	0.999998	D	0.89917	1.0	D	0.79108	0.992	T	0.71041	-0.4707	10	0.37606	T	0.19	.	18.6108	0.91284	0.0:0.0:1.0:0.0	.	161	Q6IS24	GLTL3_HUMAN	M	161;139	ENSP00000329654:V161M;ENSP00000392019:V139M	ENSP00000329654:V161M	V	+	1	0	WBSCR17	70491215	1.000000	0.71417	0.993000	0.49108	0.977000	0.68977	7.812000	0.86109	2.702000	0.92279	0.655000	0.94253	GTG		WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252006.1	NM_022479	
TRIM50	135892	broad.mit.edu	37	7	72732871	72732871	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr7:72732871C>T	ENST00000333149.2	-	4	876	c.676G>A	c.(676-678)Gag>Aag	p.E226K	TRIM50_ENST00000453152.1_Missense_Mutation_p.E226K	NM_178125.2	NP_835226.2	Q86XT4	TRI50_HUMAN	tripartite motif containing 50	226						cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.E226K(2)		endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(1)|skin(2)	20						AGCACACACTCGGCTTGGGCC	0.672																																					p.E226K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G676A	7						.						86.0	83.0	84.0					7																	72732871		2203	4300	6503	72370807	SO:0001583	missense	135892	exon4			AY081948	CCDS34654.1	7q11.23	2013-01-09	2011-01-25	2006-03-31	ENSG00000146755	ENSG00000146755		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19017	protein-coding gene	gene with protein product		612548	"""tripartite motif-containing 50A"", ""tripartite motif-containing 50"""	TRIM50A			Standard	NM_001281450		Approved	FLJ32804	uc003txy.1	Q86XT4	OTTHUMG00000156805	ENST00000333149.2:c.676G>A	7.37:g.72732871C>T	ENSP00000327994:p.Glu226Lys	Somatic		Capture	Illumina HiSeq	Phase_I	72370807	NM_178125	Q86XT3	Missense_Mutation	SNP	ENST00000333149.2	37	CCDS34654.1	.	.	.	.	.	.	.	.	.	.	C	10.78	1.445814	0.25987	.	.	ENSG00000146755	ENST00000333149;ENST00000453152	T;T	0.64438	-0.1;-0.1	4.36	1.39	0.22231	.	0.638932	0.14013	N	0.347340	T	0.43567	0.1253	L	0.27053	0.805	0.09310	N	1	B;B	0.13145	0.007;0.004	B;B	0.09377	0.004;0.002	T	0.24404	-1.0161	10	0.33141	T	0.24	.	6.7388	0.23424	0.0:0.5941:0.233:0.1729	.	226;226	Q86XT4-2;Q86XT4	.;TRI50_HUMAN	K	226	ENSP00000327994:E226K;ENSP00000413875:E226K	ENSP00000327994:E226K	E	-	1	0	TRIM50	72370807	0.000000	0.05858	0.001000	0.08648	0.491000	0.33493	-0.112000	0.10791	0.484000	0.27630	0.461000	0.40582	GAG		TRIM50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345925.1	NM_178125	
SEMA3D	223117	broad.mit.edu	37	7	84629091	84629091	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr7:84629091C>T	ENST00000284136.6	-	17	2042	c.1999G>A	c.(1999-2001)Gcc>Acc	p.A667T	SEMA3D_ENST00000484038.1_5'UTR	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D	667	Ig-like C2-type.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)	p.A667T(1)		NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						TGCTCCTGGGCTTTGCAGTAA	0.443																																					p.A667T	Ovarian(63;442 1191 17318 29975 31528)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1999A	7						.						85.0	73.0	77.0					7																	84629091		2203	4300	6503	84467027	SO:0001583	missense	223117	exon17			BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.1999G>A	7.37:g.84629091C>T	ENSP00000284136:p.Ala667Thr	Somatic		Capture	Illumina HiSeq	Phase_I	84467027	NM_152754	A6NK46|Q6UW77|Q8NCQ1	Missense_Mutation	SNP	ENST00000284136.6	37	CCDS34676.1	.	.	.	.	.	.	.	.	.	.	C	17.76	3.468305	0.63625	.	.	ENSG00000153993	ENST00000284136	T	0.65732	-0.17	5.83	5.83	0.93111	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.052300	0.85682	D	0.000000	T	0.66665	0.2812	L	0.34521	1.04	0.80722	D	1	P	0.52842	0.956	P	0.55545	0.778	T	0.60276	-0.7295	10	0.26408	T	0.33	.	20.1162	0.97934	0.0:1.0:0.0:0.0	.	667	O95025	SEM3D_HUMAN	T	667	ENSP00000284136:A667T	ENSP00000284136:A667T	A	-	1	0	SEMA3D	84467027	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.655000	0.46707	2.756000	0.94617	0.655000	0.94253	GCC		SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336084.2	NM_152754	
KMT2C	58508	broad.mit.edu	37	7	151884823	151884823	+	Silent	SNP	T	T	C			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr7:151884823T>C	ENST00000262189.6	-	32	4988	c.4770A>G	c.(4768-4770)gcA>gcG	p.A1590A	KMT2C_ENST00000355193.2_Silent_p.A1590A	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1590					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.A1590A(2)									AAGAGGATTGTGCAATTGCAG	0.398																																					p.A1590A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A4770G	7						.						108.0	103.0	105.0					7																	151884823		2203	4300	6503	151515756	SO:0001819	synonymous_variant	58508	exon32			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.4770A>G	7.37:g.151884823T>C		Somatic		Capture	Illumina HiSeq	Phase_I	151515756	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Silent	SNP	ENST00000262189.6	37	CCDS5931.1																																																																																				KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
PKHD1L1	93035	broad.mit.edu	37	8	110497276	110497276	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr8:110497276G>A	ENST00000378402.5	+	58	9684	c.9580G>A	c.(9580-9582)Gga>Aga	p.G3194R		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	3194					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.G3196R(1)		NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TTCTAAGGAGGGAGAAGAGAT	0.274										HNSCC(38;0.096)																											p.G3194R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G9580A	8						.						56.0	52.0	54.0					8																	110497276		1806	4060	5866	110566452	SO:0001583	missense	93035	exon58			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.9580G>A	8.37:g.110497276G>A	ENSP00000367655:p.Gly3194Arg	Somatic		Capture	Illumina HiSeq	Phase_I	110566452	NM_177531	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.696924	0.88830	.	.	ENSG00000205038	ENST00000378402;ENST00000526472	D;D	0.92149	-2.98;-2.98	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	D	0.97201	0.9085	H	0.94222	3.51	0.46678	D	0.999152	D	0.89917	1.0	D	0.97110	1.0	D	0.98249	1.0492	10	0.87932	D	0	.	16.4319	0.83847	0.0:0.0:1.0:0.0	.	3194	Q86WI1	PKHL1_HUMAN	R	3194;122	ENSP00000367655:G3194R;ENSP00000437376:G122R	ENSP00000367655:G3194R	G	+	1	0	PKHD1L1	110566452	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.037000	0.76531	2.463000	0.83235	0.563000	0.77884	GGA		PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
KLHL38	340359	broad.mit.edu	37	8	124665021	124665021	+	Missense_Mutation	SNP	C	C	T	rs375513752		TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr8:124665021C>T	ENST00000325995.7	-	1	169	c.146G>A	c.(145-147)cGc>cAc	p.R49H	CTD-2552K11.2_ENST00000524355.1_RNA	NM_001081675.2	NP_001075144.2	Q2WGJ6	KLH38_HUMAN	kelch-like family member 38	49	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.							p.R49H(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(16)|pancreas(1)|prostate(3)|stomach(1)	38						CAGCACGTTGCGGTGGCAGGG	0.572													C|||	1	0.000199681	0.0	0.0	5008	,	,		19799	0.001		0.0	False		,,,				2504	0.0				p.R49H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G146A	8						.						54.0	58.0	57.0					8																	124665021		2054	4210	6264	124734202	SO:0001583	missense	340359	exon1				CCDS43766.1	8q24.13	2013-02-22	2013-02-22		ENSG00000175946	ENSG00000175946		"""Kelch-like"", ""BTB/POZ domain containing"""	34435	protein-coding gene	gene with protein product			"""kelch-like 38 (Drosophila)"""				Standard	NM_001081675		Approved	C8ORFK36	uc003yqs.1	Q2WGJ6	OTTHUMG00000164983	ENST00000325995.7:c.146G>A	8.37:g.124665021C>T	ENSP00000321475:p.Arg49His	Somatic		Capture	Illumina HiSeq	Phase_I	124734202	NM_001081675	A0PK12	Missense_Mutation	SNP	ENST00000325995.7	37	CCDS43766.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.438072	0.83885	.	.	ENSG00000175946	ENST00000325995	T	0.75367	-0.93	5.52	4.63	0.57726	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.91586	0.7342	H	0.98802	4.335	0.51767	D	0.999931	D	0.89917	1.0	D	0.97110	1.0	D	0.94404	0.7625	10	0.87932	D	0	.	14.7241	0.69329	0.0:0.9287:0.0:0.0713	.	49	Q2WGJ6	KLH38_HUMAN	H	49	ENSP00000321475:R49H	ENSP00000321475:R49H	R	-	2	0	KLHL38	124734202	1.000000	0.71417	0.984000	0.44739	0.949000	0.60115	6.010000	0.70753	2.596000	0.87737	0.561000	0.74099	CGC		KLHL38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381288.1		
PHF20L1	51105	broad.mit.edu	37	8	133851741	133851741	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr8:133851741G>C	ENST00000395386.2	+	18	2600	c.2301G>C	c.(2299-2301)aaG>aaC	p.K767N	PHF20L1_ENST00000220847.7_Missense_Mutation_p.K154N|PHF20L1_ENST00000395390.2_Missense_Mutation_p.K742N|AF230666.2_ENST00000608375.1_RNA|AF230666.2_ENST00000429151.1_RNA	NM_016018.4	NP_057102.4	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1	767							zinc ion binding (GO:0008270)	p.K741N(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(10)|ovary(2)	15	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			ATGCCAAAAAGATAGTTTCTA	0.388																																					p.K767N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2301C	8						.						135.0	127.0	130.0					8																	133851741		1874	4099	5973	133920923	SO:0001583	missense	51105	exon18			AF230666	CCDS6367.2, CCDS6368.1, CCDS75791.1	8q24.22	2014-03-24			ENSG00000129292	ENSG00000129292		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24280	protein-coding gene	gene with protein product	"""tudor domain containing 20B"""					10810093, 24492612	Standard	NM_016018		Approved	CGI-72, FLJ13649, MGC64923, FLJ21615, TDRD20B	uc003ytt.3	A8MW92	OTTHUMG00000148656	ENST00000395386.2:c.2301G>C	8.37:g.133851741G>C	ENSP00000378784:p.Lys767Asn	Somatic		Capture	Illumina HiSeq	Phase_I	133920923	NM_016018	A8MZC9|Q86U89|Q86W43|Q96BT0|Q9H702|Q9HBK3|Q9NYR3|Q9Y381	Missense_Mutation	SNP	ENST00000395386.2	37	CCDS6367.2	.	.	.	.	.	.	.	.	.	.	G	17.41	3.382818	0.61845	.	.	ENSG00000129292	ENST00000395386;ENST00000220847;ENST00000395390	T;T	0.37915	1.18;1.17	5.41	2.6	0.31112	.	0.142052	0.45606	U	0.000344	T	0.57784	0.2077	M	0.74881	2.28	0.38692	D	0.952797	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.994	T	0.60929	-0.7165	10	0.72032	D	0.01	-13.8041	12.3144	0.54946	0.1997:0.0:0.8003:0.0	.	742;767	F8W9L8;A8MW92	.;P20L1_HUMAN	N	767;154;742	ENSP00000378784:K767N;ENSP00000378788:K742N	ENSP00000220847:K154N	K	+	3	2	PHF20L1	133920923	1.000000	0.71417	0.998000	0.56505	0.981000	0.71138	3.857000	0.55972	0.020000	0.15106	-0.797000	0.03246	AAG		PHF20L1-008	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308949.3	NM_016018	
TEX15	56154	broad.mit.edu	37	8	30694788	30694788	+	Silent	SNP	A	A	G			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr8:30694788A>G	ENST00000256246.2	-	3	7937	c.7863T>C	c.(7861-7863)aaT>aaC	p.N2621N		NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	2621					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)			p.N2621N(1)		NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		GGACTTTTGAATTTTTGTCAT	0.378																																					p.N2621N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T7863C	8						.						98.0	100.0	99.0					8																	30694788		2203	4300	6503	30814330	SO:0001819	synonymous_variant	56154	exon3			AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.7863T>C	8.37:g.30694788A>G		Somatic		Capture	Illumina HiSeq	Phase_I	30814330	NM_031271		Silent	SNP	ENST00000256246.2	37	CCDS6080.1																																																																																				TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1		
LSM1	27257	broad.mit.edu	37	8	38027405	38027405	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr8:38027405C>T	ENST00000311351.4	-	3	541	c.146G>A	c.(145-147)cGt>cAt	p.R49H	LSM1_ENST00000520755.1_Intron|LSM1_ENST00000522515.1_5'UTR	NM_014462.2	NP_055277.1	O15116	LSM1_HUMAN	LSM1, U6 small nuclear RNA associated	49					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)	p.R49H(1)		kidney(2)|large_intestine(3)|lung(2)	7	Colorectal(12;0.000442)					CACATGAATACGCTCCACAGT	0.378																																					p.R49H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G146A	8						.						169.0	157.0	161.0					8																	38027405		2203	4300	6503	38146562	SO:0001583	missense	27257	exon3			AF000177	CCDS6103.1	8p11.2	2014-02-14	2014-02-14		ENSG00000175324	ENSG00000175324			20472	protein-coding gene	gene with protein product		607281	"""LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae)"""			12515382, 11953827	Standard	NM_014462		Approved	CASM, YJL124C	uc003xkw.3	O15116	OTTHUMG00000164051	ENST00000311351.4:c.146G>A	8.37:g.38027405C>T	ENSP00000310596:p.Arg49His	Somatic		Capture	Illumina HiSeq	Phase_I	38146562	NM_014462	B2R5E6	Missense_Mutation	SNP	ENST00000311351.4	37	CCDS6103.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.833729	0.91036	.	.	ENSG00000175324	ENST00000311351	T	0.43688	0.94	5.71	3.91	0.45181	Like-Sm ribonucleoprotein (LSM) domain, eukaryotic/archaea-type (1);Like-Sm ribonucleoprotein (LSM) domain (1);Like-Sm ribonucleoprotein (LSM)-related domain (1);	0.000000	0.85682	D	0.000000	T	0.69424	0.3109	M	0.91090	3.175	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.74799	-0.3542	10	0.87932	D	0	-11.9857	11.6962	0.51544	0.0:0.8091:0.1242:0.0667	.	49	O15116	LSM1_HUMAN	H	49	ENSP00000310596:R49H	ENSP00000310596:R49H	R	-	2	0	LSM1	38146562	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.701000	0.84566	0.763000	0.33175	-0.189000	0.12847	CGT		LSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376965.1	NM_014462	
CHD7	55636	broad.mit.edu	37	8	61765406	61765406	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr8:61765406C>T	ENST00000423902.2	+	31	6601	c.6122C>T	c.(6121-6123)tCc>tTc	p.S2041F	CHD7_ENST00000524602.1_Intron	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	2041					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.S2041F(2)		NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			GACCTCTCCTCCATAATTGAG	0.498																																					p.S2041F												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C6122T	8						.						104.0	106.0	105.0					8																	61765406		1885	4106	5991	61927960	SO:0001583	missense	55636	exon31			AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.6122C>T	8.37:g.61765406C>T	ENSP00000392028:p.Ser2041Phe	Somatic		Capture	Illumina HiSeq	Phase_I	61927960	NM_017780	D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	SNP	ENST00000423902.2	37	CCDS47865.1	.	.	.	.	.	.	.	.	.	.	C	7.558	0.664168	0.14710	.	.	ENSG00000171316	ENST00000307121;ENST00000423902	T	0.72282	-0.64	5.21	4.33	0.51752	.	0.284299	0.31624	N	0.007338	T	0.57740	0.2074	N	0.22421	0.69	0.29444	N	0.858976	B	0.22276	0.067	B	0.30716	0.119	T	0.57608	-0.7782	10	0.54805	T	0.06	-7.0515	9.3633	0.38208	0.0:0.7789:0.1456:0.0754	.	2041	Q9P2D1	CHD7_HUMAN	F	2041	ENSP00000392028:S2041F	ENSP00000307304:S2041F	S	+	2	0	CHD7	61927960	0.998000	0.40836	0.992000	0.48379	0.895000	0.52256	4.810000	0.62598	1.181000	0.42912	0.655000	0.94253	TCC		CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2	XM_098762	
KCNK9	51305	broad.mit.edu	37	8	140630718	140630718	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr8:140630718C>T	ENST00000520439.1	-	2	971	c.908G>A	c.(907-909)cGc>cAc	p.R303H	KCNK9_ENST00000303015.1_Missense_Mutation_p.R303H|KCNK9_ENST00000523477.1_5'Flank	NM_001282534.1	NP_001269463.1	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9	303					cochlea development (GO:0090102)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)	p.R303H(1)		NS(1)|endometrium(9)|kidney(1)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)	43	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)		Doxapram(DB00561)|Halothane(DB01159)	GTCCTGCGAGCGGTAGCAGGT	0.637																																					p.R303H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G908A	8						.						51.0	57.0	55.0					8																	140630718		2203	4300	6503	140699900	SO:0001583	missense	51305	exon2			AF212829	CCDS6377.1	8q24.3	2012-03-07			ENSG00000169427	ENSG00000169427		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6283	protein-coding gene	gene with protein product		605874				10734076, 16382106	Standard	NM_001282534		Approved	K2p9.1, TASK3, TASK-3	uc003yvf.1	Q9NPC2	OTTHUMG00000164186	ENST00000520439.1:c.908G>A	8.37:g.140630718C>T	ENSP00000430676:p.Arg303His	Somatic		Capture	Illumina HiSeq	Phase_I	140699900	NM_016601	Q2M290|Q540F2	Missense_Mutation	SNP	ENST00000520439.1	37	CCDS6377.1	.	.	.	.	.	.	.	.	.	.	C	12.90	2.076160	0.36662	.	.	ENSG00000169427	ENST00000522317;ENST00000303015;ENST00000520439	T;T;T	0.16743	2.32;2.32;2.32	5.85	3.08	0.35506	.	0.295996	0.31648	N	0.007282	T	0.14356	0.0347	L	0.41824	1.3	0.21984	N	0.99943	B	0.22746	0.074	B	0.18561	0.022	T	0.16012	-1.0417	10	0.49607	T	0.09	.	10.8401	0.46710	0.0:0.7991:0.0:0.2009	.	303	Q9NPC2	KCNK9_HUMAN	H	303	ENSP00000429847:R303H;ENSP00000302166:R303H;ENSP00000430676:R303H	ENSP00000302166:R303H	R	-	2	0	KCNK9	140699900	0.999000	0.42202	0.227000	0.23927	0.918000	0.54935	1.384000	0.34396	0.368000	0.24481	0.655000	0.94253	CGC		KCNK9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378473.1	NM_016601	
DFNB31	25861	broad.mit.edu	37	9	117165140	117165140	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr9:117165140C>T	ENST00000362057.3	-	12	2786	c.2618G>A	c.(2617-2619)cGg>cAg	p.R873Q	DFNB31_ENST00000374059.3_Missense_Mutation_p.R522Q|DFNB31_ENST00000265134.6_Missense_Mutation_p.R490Q	NM_001173425.1|NM_015404.3	NP_001166896.1|NP_056219	Q9P202	WHRN_HUMAN	deafness, autosomal recessive 31	873	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				inner ear receptor stereocilium organization (GO:0060122)|retina homeostasis (GO:0001895)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	actin filament (GO:0005884)|cilium (GO:0005929)|cytoplasm (GO:0005737)|stereocilia ankle link complex (GO:0002142)|stereocilium (GO:0032420)		p.R873Q(1)		central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|ovary(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CTCCTTGCCCCGAAGCGTCAG	0.582																																					p.R873Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2618A	9						.						55.0	49.0	51.0					9																	117165140		2203	4300	6503	116204961	SO:0001583	missense	25861	exon12			AK056190	CCDS6806.1, CCDS43870.1	9q32	2013-06-19			ENSG00000095397	ENSG00000095397			16361	protein-coding gene	gene with protein product	"""whirlin"""	607928				12833159, 17171570	Standard	NM_015404		Approved	CIP98, WHRN, USH2D, PDZD7B	uc004biz.4	Q9P202	OTTHUMG00000020539	ENST00000362057.3:c.2618G>A	9.37:g.117165140C>T	ENSP00000354623:p.Arg873Gln	Somatic		Capture	Illumina HiSeq	Phase_I	116204961	NM_015404	A5PKU1|A5PKZ9|Q5TAU9|Q5TAV0|Q5TAV1|Q5TAV2|Q96MZ9|Q9H9F4|Q9UFZ3	Missense_Mutation	SNP	ENST00000362057.3	37	CCDS6806.1	.	.	.	.	.	.	.	.	.	.	C	19.55	3.849518	0.71603	.	.	ENSG00000095397	ENST00000265134;ENST00000374059;ENST00000362057	T;T;T	0.28895	1.59;1.59;1.59	4.7	4.7	0.59300	PDZ/DHR/GLGF (4);	0.069082	0.56097	D	0.000028	T	0.21427	0.0516	N	0.03071	-0.42	0.80722	D	1	D;D;D	0.69078	0.984;0.972;0.997	P;P;P	0.52672	0.577;0.577;0.706	T	0.17137	-1.0379	10	0.54805	T	0.06	-20.063	11.5192	0.50541	0.0:0.9167:0.0:0.0833	.	872;873;522	B9EGE6;Q9P202;Q9P202-4	.;WHRN_HUMAN;.	Q	490;522;873	ENSP00000265134:R490Q;ENSP00000363172:R522Q;ENSP00000354623:R873Q	ENSP00000265134:R490Q	R	-	2	0	DFNB31	116204961	1.000000	0.71417	0.956000	0.39512	0.496000	0.33645	4.354000	0.59417	2.297000	0.77311	0.655000	0.94253	CGG		DFNB31-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053776.2	NM_015404	
SLC24A2	25769	broad.mit.edu	37	9	19786175	19786175	+	Silent	SNP	G	G	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr9:19786175G>T	ENST00000341998.2	-	1	751	c.690C>A	c.(688-690)atC>atA	p.I230I	SLC24A2_ENST00000286344.3_Silent_p.I230I	NM_001193288.2|NM_020344.3	NP_001180217.1|NP_065077.1	Q9UI40	NCKX2_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 2	230					cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	cadmium ion binding (GO:0046870)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium, potassium:sodium antiporter activity (GO:0008273)|manganese ion binding (GO:0030145)|nickel cation binding (GO:0016151)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|symporter activity (GO:0015293)	p.I230I(1)		endometrium(3)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33				GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)		TCAGGTTTAAGATTTCTCTAG	0.408																																					p.I230I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C690A	9						.						93.0	87.0	89.0					9																	19786175		2203	4300	6503	19776175	SO:0001819	synonymous_variant	25769	exon2			AF097366	CCDS6493.1, CCDS55297.1	9p22.1	2013-05-22			ENSG00000155886	ENSG00000155886		"""Solute carriers"""	10976	protein-coding gene	gene with protein product		609838				10662833	Standard	NM_020344		Approved	NCKX2	uc003zoa.2	Q9UI40	OTTHUMG00000019646	ENST00000341998.2:c.690C>A	9.37:g.19786175G>T		Somatic		Capture	Illumina HiSeq	Phase_I	19776175	NM_020344	B7ZLL8|Q9NTN5|Q9NZQ4	Silent	SNP	ENST00000341998.2	37	CCDS6493.1																																																																																				SLC24A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051866.2	NM_020344	
POLR1E	64425	broad.mit.edu	37	9	37503059	37503059	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr9:37503059G>C	ENST00000377798.4	+	12	1233	c.1120G>C	c.(1120-1122)Gcc>Ccc	p.A374P	POLR1E_ENST00000442009.2_Missense_Mutation_p.A304P|POLR1E_ENST00000377792.3_Missense_Mutation_p.A436P	NM_022490.1	NP_071935.1	O15160	RPAC1_HUMAN	polymerase (RNA) I polypeptide E, 53kDa	0					gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase I transcription (GO:0006363)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)	p.A374P(1)		autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(1)|skin(1)|stomach(1)	12				GBM - Glioblastoma multiforme(29;0.00851)|Lung(182;0.229)		GATAGCCAAAGCCATGAGGCT	0.537																																					p.A374P	Ovarian(116;843 1620 18506 32459 34463)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1120C	9						.						127.0	134.0	132.0					9																	37503059		2203	4300	6503	37493059	SO:0001583	missense	64425	exon12			AK091294	CCDS6611.1	9p13.1	2013-01-21	2006-03-09	2006-03-09	ENSG00000137054	ENSG00000137054		"""RNA polymerase subunits"""	17631	protein-coding gene	gene with protein product	"""RNA polymerase I associated factor 53"""		"""polymerase (RNA) I associated factor 1"""	PRAF1		8641287	Standard	XM_005251547		Approved	FLJ13390, PAF53, FLJ13970	uc003zzy.1	Q9GZS1	OTTHUMG00000019920	ENST00000377798.4:c.1120G>C	9.37:g.37503059G>C	ENSP00000367029:p.Ala374Pro	Somatic		Capture	Illumina HiSeq	Phase_I	37493059	NM_022490	O75395|Q5JTE3	Missense_Mutation	SNP	ENST00000377798.4	37	CCDS6611.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.447092	0.84101	.	.	ENSG00000137054	ENST00000377798;ENST00000442009;ENST00000377792	T;T;T	0.25749	1.78;1.78;1.78	5.69	5.69	0.88448	.	0.051783	0.85682	D	0.000000	T	0.52175	0.1718	M	0.70275	2.135	0.58432	D	0.999991	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.996;0.989	T	0.43081	-0.9413	10	0.40728	T	0.16	-22.5568	18.576	0.91155	0.0:0.0:1.0:0.0	.	304;436;374	E7EX70;Q9GZS1;Q9GZS1-2	.;RPA49_HUMAN;.	P	374;304;436	ENSP00000367029:A374P;ENSP00000399887:A304P;ENSP00000367023:A436P	ENSP00000367023:A436P	A	+	1	0	POLR1E	37493059	1.000000	0.71417	0.986000	0.45419	0.992000	0.81027	4.259000	0.58828	2.676000	0.91093	0.655000	0.94253	GCC		POLR1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052464.1	NM_022490	
ZCCHC6	79670	broad.mit.edu	37	9	88937985	88937985	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr9:88937985C>T	ENST00000375963.3	-	13	2852	c.2680G>A	c.(2680-2682)Gaa>Aaa	p.E894K	ZCCHC6_ENST00000375960.2_Missense_Mutation_p.E771K|ZCCHC6_ENST00000469004.1_5'Flank|ZCCHC6_ENST00000277141.6_Missense_Mutation_p.E183K|ZCCHC6_ENST00000375961.2_Missense_Mutation_p.E894K	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	894	Glu-rich.				RNA 3'-end processing (GO:0031123)		poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)	p.E894K(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	46						TCATCCTCTTCAGATAGGGCG	0.433																																					p.E894K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2680A	9						.						190.0	160.0	170.0					9																	88937985		2203	4300	6503	88127805	SO:0001583	missense	79670	exon13			AL832026	CCDS35057.1, CCDS55323.1	9q21	2014-03-05			ENSG00000083223	ENSG00000083223		"""Zinc fingers, CCHC domain containing"""	25817	protein-coding gene	gene with protein product	"""TUTase7"""					11214970	Standard	NM_001185059		Approved	KIAA1711, FLJ13409, PAPD6, TUT7	uc004aoq.3	Q5VYS8	OTTHUMG00000020137	ENST00000375963.3:c.2680G>A	9.37:g.88937985C>T	ENSP00000365130:p.Glu894Lys	Somatic		Capture	Illumina HiSeq	Phase_I	88127805	NM_024617	Q5H9T0|Q5VYS5|Q5VYS7|Q658Z9|Q659A2|Q6MZJ3|Q8N5F0|Q96N57|Q96NE8|Q9C0F2|Q9H8M6	Missense_Mutation	SNP	ENST00000375963.3	37	CCDS35057.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.519510	0.85495	.	.	ENSG00000083223	ENST00000277141;ENST00000375960;ENST00000375961;ENST00000375963	T;T;T;T	0.61392	0.11;0.47;0.53;0.59	5.48	5.48	0.80851	.	0.396055	0.30620	N	0.009222	T	0.49558	0.1564	L	0.29908	0.895	0.33208	D	0.55303	B;B	0.28850	0.225;0.038	B;B	0.29716	0.106;0.01	T	0.54925	-0.8220	10	0.30854	T	0.27	-38.4931	19.5559	0.95347	0.0:1.0:0.0:0.0	.	771;894	Q5VYS8-4;Q5VYS8	.;TUT7_HUMAN	K	183;771;894;894	ENSP00000277141:E183K;ENSP00000365127:E771K;ENSP00000365128:E894K;ENSP00000365130:E894K	ENSP00000277141:E183K	E	-	1	0	ZCCHC6	88127805	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	6.411000	0.73298	2.861000	0.98227	0.650000	0.86243	GAA		ZCCHC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052918.1	NM_024617	
TDRD7	23424	broad.mit.edu	37	9	100237717	100237717	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr9:100237717T>C	ENST00000355295.4	+	12	2427	c.2132T>C	c.(2131-2133)cTc>cCc	p.L711P	TDRD7_ENST00000422139.2_Missense_Mutation_p.L637P|TDRD7_ENST00000540902.1_Intron	NM_014290.2	NP_055105.2	Q8NHU6	TDRD7_HUMAN	tudor domain containing 7	711	Tudor 2. {ECO:0000255|PROSITE- ProRule:PRU00211}.				germ cell development (GO:0007281)|lens fiber cell differentiation (GO:0070306)|lens morphogenesis in camera-type eye (GO:0002089)|posttranscriptional regulation of gene expression (GO:0010608)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|P granule (GO:0043186)|ribonucleoprotein granule (GO:0035770)	mRNA binding (GO:0003729)	p.L711P(1)		endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Acute lymphoblastic leukemia(62;0.158)				AAAATCTGCCTCTTCCATTGC	0.358																																					p.L711P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2132C	9						.						121.0	103.0	109.0					9																	100237717		2203	4300	6503	99277538	SO:0001583	missense	23424	exon12			AB025254	CCDS6725.1	9q22.33	2013-01-23			ENSG00000196116	ENSG00000196116		"""Tudor domain containing"""	30831	protein-coding gene	gene with protein product		611258				21436445	Standard	NM_014290		Approved	PCTAIRE2BP	uc004axj.3	Q8NHU6	OTTHUMG00000020326	ENST00000355295.4:c.2132T>C	9.37:g.100237717T>C	ENSP00000347444:p.Leu711Pro	Somatic		Capture	Illumina HiSeq	Phase_I	99277538	NM_014290	A6NCI6|B2RBX3|B4DG99|B4DXF7|E7EQD4|Q5VV27|Q96JT1|Q9UFF0|Q9Y2M3	Missense_Mutation	SNP	ENST00000355295.4	37	CCDS6725.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.090879	0.76756	.	.	ENSG00000196116	ENST00000355295;ENST00000422139	T;T	0.11604	2.76;2.76	5.11	5.11	0.69529	Tudor subgroup (1);Maternal tudor protein (1);Tudor domain (1);	0.061302	0.64402	D	0.000005	T	0.32912	0.0845	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.05131	-1.0904	10	0.72032	D	0.01	-16.8297	12.6998	0.57024	0.0:0.0:0.0:1.0	.	711	Q8NHU6	TDRD7_HUMAN	P	711;637	ENSP00000347444:L711P;ENSP00000413608:L637P	ENSP00000347444:L711P	L	+	2	0	TDRD7	99277538	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.525000	0.81892	2.285000	0.76669	0.533000	0.62120	CTC		TDRD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053322.1	NM_014290	
PDCL	5082	broad.mit.edu	37	9	125582764	125582764	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chr9:125582764C>A	ENST00000259467.4	-	4	671	c.506G>T	c.(505-507)gGg>gTg	p.G169V		NM_005388.4	NP_005379.3	Q13371	PHLP_HUMAN	phosducin-like	169					heterotrimeric G-protein complex assembly (GO:1902605)|intracellular signal transduction (GO:0035556)|negative regulation of protein refolding (GO:0061084)|protein folding (GO:0006457)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|visual perception (GO:0007601)	cytoplasm (GO:0005737)	receptor signaling protein activity (GO:0005057)	p.G169V(1)		endometrium(1)|large_intestine(2)|lung(5)|skin(1)|stomach(1)	10						GTCTAAAAACCCTTCTCCACT	0.463																																					p.G169V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G506T	9						.						122.0	114.0	117.0					9																	125582764		2203	4300	6503	124622585	SO:0001583	missense	5082	exon4			AF083325	CCDS6845.1	9q12-q13	2008-07-21			ENSG00000136940	ENSG00000136940			8770	protein-coding gene	gene with protein product		604421				10095058	Standard	NM_005388		Approved	PhLP, DKFZp564M1863	uc004bmz.2	Q13371	OTTHUMG00000020624	ENST00000259467.4:c.506G>T	9.37:g.125582764C>A	ENSP00000259467:p.Gly169Val	Somatic		Capture	Illumina HiSeq	Phase_I	124622585	NM_005388	Q4VXB6|Q96AF1|Q9UEW7|Q9UFL0|Q9UNX1|Q9UNX2	Missense_Mutation	SNP	ENST00000259467.4	37	CCDS6845.1	.	.	.	.	.	.	.	.	.	.	C	13.10	2.136802	0.37728	.	.	ENSG00000136940	ENST00000259467	T	0.14391	2.51	5.42	1.07	0.20283	Phosducin, thioredoxin-like domain (1);Thioredoxin-like fold (2);	0.375011	0.32987	N	0.005408	T	0.09423	0.0232	N	0.24115	0.695	0.52501	D	0.999957	B	0.28783	0.222	B	0.33121	0.158	T	0.20974	-1.0259	10	0.45353	T	0.12	-9.9198	8.7662	0.34704	0.0:0.3953:0.4528:0.1519	.	169	Q13371	PHLP_HUMAN	V	169	ENSP00000259467:G169V	ENSP00000259467:G169V	G	-	2	0	PDCL	124622585	0.244000	0.23889	0.998000	0.56505	0.998000	0.95712	0.542000	0.23222	0.308000	0.22923	0.655000	0.94253	GGG		PDCL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053956.1	NM_005388	
ARHGAP6	395	broad.mit.edu	37	X	11157552	11157553	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chrX:11157552_11157553insC	ENST00000337414.4	-	13	3227_3228	c.2355_2356insG	c.(2353-2358)gggagcfs	p.S786fs	ARHGAP6_ENST00000303025.6_Frame_Shift_Ins_p.S583fs|ARHGAP6_ENST00000380736.1_Frame_Shift_Ins_p.S583fs|ARHGAP6_ENST00000534860.1_Intron	NM_013427.2	NP_038286.2	O43182	RHG06_HUMAN	Rho GTPase activating protein 6	786					actin filament polymerization (GO:0030041)|activation of phospholipase C activity (GO:0007202)|focal adhesion assembly (GO:0048041)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of signal transduction (GO:0009967)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						TCTGCGGGGCTCCCCTGCCACC	0.678																																					p.S786fs												.	.	0			c.2356_2357insG	X						.																																			11067474	SO:0001589	frameshift_variant	395	exon13			AF012272	CCDS14140.1, CCDS14141.1, CCDS14142.1	Xp22.3	2008-02-05			ENSG00000047648	ENSG00000047648		"""Rho GTPase activating proteins"""	676	protein-coding gene	gene with protein product		300118				9417914	Standard	XM_005274507		Approved	rhoGAPX-1	uc004cup.1	O43182	OTTHUMG00000021134	ENST00000337414.4:c.2356dupG	X.37:g.11157556_11157556dupC	ENSP00000338967:p.Ser786fs	None		Capture	Illumina HiSeq	Phase_I	11067473	NM_013427	B2RWQ0|O43437|Q9P1B3|Q9UK81|Q9UK82	Frame_Shift_Ins	INS	ENST00000337414.4	37	CCDS14140.1																																																																																				ARHGAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055760.2	NM_013427	
PAK3	5063	broad.mit.edu	37	X	110439071	110439071	+	Splice_Site	SNP	G	G	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chrX:110439071G>T	ENST00000372010.1	+	16	1599	c.1157G>T	c.(1156-1158)tGc>tTc	p.C386F	PAK3_ENST00000360648.4_Splice_Site_p.C407F|PAK3_ENST00000262836.4_Splice_Site_p.C386F|PAK3_ENST00000518291.1_Splice_Site_p.C407F|PAK3_ENST00000446737.1_Splice_Site_p.C371F|PAK3_ENST00000417227.1_Splice_Site_p.C392F|PAK3_ENST00000425146.1_Splice_Site_p.C371F|PAK3_ENST00000519681.1_Splice_Site_p.C392F|PAK3_ENST00000372007.5_Splice_Site_p.C371F			O75914	PAK3_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 3	386	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|dendritic spine morphogenesis (GO:0060997)|MAPK cascade (GO:0000165)|regulation of actin filament polymerization (GO:0030833)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.C371F(1)		breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	41						ATTTAATAGTGCCTGCAAGCT	0.308										TSP Lung(19;0.15)																											p.C371F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1112T	X						.						95.0	93.0	94.0					X																	110439071		2203	4300	6503	110325727	SO:0001630	splice_region_variant	5063	exon13			AF068864	CCDS14554.1, CCDS48151.1, CCDS48152.1, CCDS48153.1	Xq22.3	2008-06-17	2008-06-17		ENSG00000077264	ENSG00000077264			8592	protein-coding gene	gene with protein product		300142	"""mental retardation, X-linked 47"", ""p21 (CDKN1A)-activated kinase 3"""	MRX30, MRX47		8826460, 9731525	Standard	NM_002578		Approved	hPAK3, bPAK	uc010npv.1	O75914	OTTHUMG00000022202	ENST00000372010.1:c.1156-1G>T	X.37:g.110439071G>T		Somatic		Capture	Illumina HiSeq	Phase_I	110325727	NM_001128166	A8K389|B1GX77|B1GX78|B1GX79|Q5JWX1|Q5JWX2|Q7Z2D6|Q7Z2E4|Q7Z3Z8|Q8WWK5|Q8WX23|Q9P0J8	Missense_Mutation	SNP	ENST00000372010.1	37	CCDS48153.1	.	.	.	.	.	.	.	.	.	.	G	19.48	3.835061	0.71373	.	.	ENSG00000077264	ENST00000446737;ENST00000425146;ENST00000372010;ENST00000519681;ENST00000372007;ENST00000518291;ENST00000360648;ENST00000417227;ENST00000262836	T;T;T;T;T;T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11;-0.11;-0.11;-0.11;-0.11;-0.11	4.72	4.72	0.59763	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.66356	0.2781	N	0.12961	0.28	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.997;0.999;0.997;0.999	D;D;D;D;D	0.81914	0.991;0.969;0.995;0.969;0.995	T	0.73880	-0.3843	10	0.87932	D	0	.	17.5819	0.87971	0.0:0.0:1.0:0.0	.	392;407;386;371;386	O75914-4;O75914-3;O75914;O75914-2;B1GX77	.;.;PAK3_HUMAN;.;.	F	371;371;386;392;371;407;407;392;386	ENSP00000410853:C371F;ENSP00000401982:C371F;ENSP00000361080:C386F;ENSP00000429113:C392F;ENSP00000361077:C371F;ENSP00000428921:C407F;ENSP00000353864:C407F;ENSP00000389172:C392F;ENSP00000262836:C386F	ENSP00000262836:C386F	C	+	2	0	PAK3	110325727	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.281000	0.95811	2.276000	0.75962	0.600000	0.82982	TGC		PAK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057918.1	NM_002578	Missense_Mutation
NDUFA1	4694	broad.mit.edu	37	X	119005968	119005968	+	Missense_Mutation	SNP	G	G	A	rs1801316	byFrequency	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chrX:119005968G>A	ENST00000371437.4	+	1	519	c.94G>A	c.(94-96)Ggg>Agg	p.G32R	RNF113A_ENST00000371442.2_5'Flank	NM_004541.3	NP_004532.1	O15239	NDUA1_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa	32			G -> R (in dbSNP:rs1801316).		cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)	p.G32R(1)		endometrium(1)|kidney(1)|large_intestine(2)|stomach(1)	5						GTTCACTAACGGGGGCAAGGT	0.617																																					p.G32R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G94A	X						.						106.0	92.0	96.0					X																	119005968		2203	4300	6503	118889996	SO:0001583	missense	4694	exon1				CCDS14590.1	Xq24	2011-07-04	2002-08-29		ENSG00000125356	ENSG00000125356		"""Mitochondrial respiratory chain complex / Complex I"""	7683	protein-coding gene	gene with protein product	"""NADH:ubiquinone oxidoreductase (complex 1)"", ""type I dehydrogenase"", ""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1 (7.5kD, MWFE)"", ""complex I MWFE subunit"""	300078	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1 (7.5kD, MWFE)"""			8938439	Standard	NM_004541		Approved	MWFE, CI-MWFE	uc004esc.4	O15239	OTTHUMG00000022287	ENST00000371437.4:c.94G>A	X.37:g.119005968G>A	ENSP00000360492:p.Gly32Arg	Somatic		Capture	Illumina HiSeq	Phase_I	118889996	NM_004541		Missense_Mutation	SNP	ENST00000371437.4	37	CCDS14590.1	.	.	.	.	.	.	.	.	.	.	G	14.84	2.655819	0.47467	.	.	ENSG00000125356	ENST00000371437	T	0.77620	-1.11	5.55	3.79	0.43588	.	0.098623	0.64402	N	0.000001	T	0.65626	0.2709	.	.	.	0.51482	D	0.999924	P	0.41978	0.767	B	0.32980	0.156	T	0.63134	-0.6705	9	0.54805	T	0.06	-14.0394	8.269	0.31833	0.1835:0.0:0.8165:0.0	.	32	O15239	NDUA1_HUMAN	R	32	ENSP00000360492:G32R	ENSP00000360492:G32R	G	+	1	0	NDUFA1	118889996	1.000000	0.71417	0.831000	0.32960	0.084000	0.17831	3.706000	0.54830	0.536000	0.28733	0.600000	0.82982	GGG		NDUFA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058080.1	NM_004541	
CXorf22	170063	broad.mit.edu	37	X	35984785	35984785	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chrX:35984785C>T	ENST00000297866.5	+	9	1580	c.1514C>T	c.(1513-1515)tCg>tTg	p.S505L		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	505								p.S505L(2)|p.S505W(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						CAATCTTTGTCGGTAAAATCT	0.368																																					p.S505L												.	.	3	Substitution - Missense(3)	large_intestine(2)|haematopoietic_and_lymphoid_tissue(1)	c.C1514T	X						.						142.0	129.0	133.0					X																	35984785		2202	4299	6501	35894706	SO:0001583	missense	170063	exon9			BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.1514C>T	X.37:g.35984785C>T	ENSP00000297866:p.Ser505Leu	Somatic		Capture	Illumina HiSeq	Phase_I	35894706	NM_152632	Q5JRM8|Q8N6X8	Missense_Mutation	SNP	ENST00000297866.5	37	CCDS14237.2	.	.	.	.	.	.	.	.	.	.	C	3.909	-0.020521	0.07634	.	.	ENSG00000165164	ENST00000297866	T	0.15256	2.44	5.7	2.71	0.32032	.	0.471841	0.21941	N	0.066878	T	0.13586	0.0329	L	0.57536	1.79	0.09310	N	1	B	0.23377	0.084	B	0.14023	0.01	T	0.23190	-1.0195	10	0.26408	T	0.33	-38.5711	3.9214	0.09245	0.3138:0.4772:0.0:0.2089	.	505	Q6ZTR5	CX022_HUMAN	L	505	ENSP00000297866:S505L	ENSP00000297866:S505L	S	+	2	0	CXorf22	35894706	0.014000	0.17966	0.001000	0.08648	0.001000	0.01503	1.445000	0.35079	0.580000	0.29522	-0.199000	0.12753	TCG		CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056216.2	NM_152632	
RGAG4	340526	broad.mit.edu	37	X	71349794	71349794	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chrX:71349794G>A	ENST00000545866.1	-	1	1964	c.1597C>T	c.(1597-1599)Cgc>Tgc	p.R533C	RGAG4_ENST00000609883.1_Missense_Mutation_p.R533C|NHSL2_ENST00000540800.1_Intron	NM_001024455.3	NP_001019626.1	Q5HYW3	RGAG4_HUMAN	retrotransposon gag domain containing 4	533								p.R606C(1)		cervix(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|skin(1)	24	Renal(35;0.156)					CCTGTGCGGCGAATCAGTTGG	0.592																																					p.R533C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1597T	X						.						47.0	50.0	49.0					X																	71349794		1964	4117	6081	71266519	SO:0001583	missense	340526	exon1			AB082532	CCDS55446.1	Xq13.1	2008-02-05			ENSG00000242732	ENSG00000242732			29430	protein-coding gene	gene with protein product						12056414, 15716091, 16093683	Standard	NM_001024455		Approved	KIAA2001, Mar5, Mart5	uc004eaj.2	Q5HYW3	OTTHUMG00000021808	ENST00000545866.1:c.1597C>T	X.37:g.71349794G>A	ENSP00000441366:p.Arg533Cys	Somatic		Capture	Illumina HiSeq	Phase_I	71266519	NM_001024455	A7E2W7|Q8NCM4|Q9NPX1	Missense_Mutation	SNP	ENST00000545866.1	37	CCDS55446.1	.	.	.	.	.	.	.	.	.	.	G	6.539	0.467768	0.12402	.	.	ENSG00000242732	ENST00000545866;ENST00000479991	T;T	0.17054	2.3;2.3	4.11	3.25	0.37280	.	.	.	.	.	T	0.12817	0.0311	N	0.19112	0.55	0.09310	N	1	D	0.69078	0.997	P	0.47603	0.551	T	0.11227	-1.0596	8	.	.	.	-1.3939	6.6381	0.22895	0.1299:0.0:0.8701:0.0	.	533	Q5HYW3	RGAG4_HUMAN	C	533	ENSP00000441366:R533C;ENSP00000418667:R533C	.	R	-	1	0	RGAG4	71266519	1.000000	0.71417	0.036000	0.18154	0.012000	0.07955	2.631000	0.46502	1.085000	0.41206	0.513000	0.50165	CGC		RGAG4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057171.1	NM_001024455	
KIAA2022	340533	broad.mit.edu	37	X	73961167	73961167	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chrX:73961167G>T	ENST00000055682.6	-	3	3836	c.3225C>A	c.(3223-3225)gaC>gaA	p.D1075E		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	1075					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)	p.D1075E(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						GACTAGGGGTGTCCGGTGGGG	0.502																																					p.D1075E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3225A	X						.						87.0	83.0	84.0					X																	73961167		2203	4300	6503	73877892	SO:0001583	missense	340533	exon3				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.3225C>A	X.37:g.73961167G>T	ENSP00000055682:p.Asp1075Glu	Somatic		Capture	Illumina HiSeq	Phase_I	73877892	NM_001008537	A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	ENST00000055682.6	37	CCDS35337.1	.	.	.	.	.	.	.	.	.	.	G	10.89	1.479719	0.26511	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.32023	1.47;1.47	5.28	1.57	0.23409	.	0.049466	0.85682	D	0.000000	T	0.19046	0.0457	N	0.20986	0.625	0.38873	D	0.95673	P	0.46784	0.884	B	0.41619	0.361	T	0.03662	-1.1015	10	0.38643	T	0.18	-12.8938	9.0008	0.36081	0.4508:0.0:0.5492:0.0	.	1075	Q5QGS0	K2022_HUMAN	E	1075	ENSP00000362567:D1075E;ENSP00000055682:D1075E	ENSP00000055682:D1075E	D	-	3	2	KIAA2022	73877892	0.999000	0.42202	0.958000	0.39756	0.963000	0.63663	0.610000	0.24253	-0.105000	0.12132	-0.192000	0.12808	GAC		KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2	NM_001008537	
KLHL4	56062	broad.mit.edu	37	X	86887358	86887358	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chrX:86887358T>A	ENST00000373119.4	+	7	1618	c.1473T>A	c.(1471-1473)aaT>aaA	p.N491K	KLHL4_ENST00000373114.4_Missense_Mutation_p.N491K	NM_019117.4	NP_061990.2	Q9C0H6	KLHL4_HUMAN	kelch-like family member 4	491						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.N491K(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(29)|ovary(2)|prostate(1)|skin(1)	67						AAACTTTGAATACAGTGGAAT	0.418																																					p.N491K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1473A	X						.						112.0	98.0	103.0					X																	86887358		2202	4300	6502	86774014	SO:0001583	missense	56062	exon7			AF284765	CCDS14456.1, CCDS14457.1	Xq21.3	2013-01-30	2013-01-30		ENSG00000102271	ENSG00000102271		"""Kelch-like"", ""BTB/POZ domain containing"""	6355	protein-coding gene	gene with protein product		300348	"""kelch (Drosophila)-like 4"", ""kelch-like 4 (Drosophila)"""			11401425	Standard	NM_019117		Approved	KIAA1687, DKELCHL, KHL4	uc004efa.2	Q9C0H6	OTTHUMG00000021946	ENST00000373119.4:c.1473T>A	X.37:g.86887358T>A	ENSP00000362211:p.Asn491Lys	Somatic		Capture	Illumina HiSeq	Phase_I	86774014	NM_057162	B2RTW2|Q9Y3J5	Missense_Mutation	SNP	ENST00000373119.4	37	CCDS14457.1	.	.	.	.	.	.	.	.	.	.	T	19.42	3.823438	0.71143	.	.	ENSG00000102271	ENST00000373119;ENST00000373114	T;T	0.80123	-1.34;-1.34	5.32	2.97	0.34412	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	D	0.85305	0.5666	M	0.69248	2.105	0.58432	D	0.999996	D;D	0.67145	0.996;0.99	D;D	0.70227	0.968;0.947	T	0.82845	-0.0256	10	0.46703	T	0.11	.	7.3952	0.26931	0.0:0.3125:0.0:0.6875	.	491;491	Q9C0H6;Q9C0H6-2	KLHL4_HUMAN;.	K	491	ENSP00000362211:N491K;ENSP00000362206:N491K	ENSP00000362206:N491K	N	+	3	2	KLHL4	86774014	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	1.759000	0.38420	0.676000	0.31285	0.412000	0.27726	AAT		KLHL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057413.1		
GABRQ	55879	broad.mit.edu	37	X	151820208	151820208	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3681-01A-01W-0900-09	TCGA-AA-3681-10A-01W-0900-09	g.chrX:151820208G>A	ENST00000370306.2	+	8	1141	c.1121G>A	c.(1120-1122)cGc>cAc	p.R374H		NM_018558.2	NP_061028.3	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) A receptor, theta	374					neurotransmitter transport (GO:0006836)|signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|neurotransmitter transporter activity (GO:0005326)|transmembrane signaling receptor activity (GO:0004888)	p.R374H(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(9)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	52	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GTCATTGCCCGCTACCGCTAC	0.537																																					p.R374H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1121A	X						.						97.0	83.0	88.0					X																	151820208		2203	4300	6503	151570864	SO:0001583	missense	55879	exon8			U47334	CCDS14707.1	Xq28	2012-06-22	2012-02-03		ENSG00000147402	ENSG00000268089		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	14454	protein-coding gene	gene with protein product	"""GABA(A) receptor, theta"""	300349	"""gamma-aminobutyric acid (GABA) receptor, theta"""			10804200, 10449790	Standard	NM_018558		Approved	THETA	uc004ffp.1	Q9UN88	OTTHUMG00000022649	ENST00000370306.2:c.1121G>A	X.37:g.151820208G>A	ENSP00000359329:p.Arg374His	Somatic		Capture	Illumina HiSeq	Phase_I	151570864	NM_018558	A6NFN1|Q32MB4|Q9NZK8	Missense_Mutation	SNP	ENST00000370306.2	37	CCDS14707.1	.	.	.	.	.	.	.	.	.	.	g	3.478	-0.106567	0.06924	.	.	ENSG00000147402	ENST00000370306	D	0.86694	-2.16	5.05	-1.31	0.09230	Neurotransmitter-gated ion-channel transmembrane domain (2);	7779.790000	0.00166	N	0.000000	D	0.84741	0.5539	L	0.55990	1.75	0.09310	N	1	B	0.29886	0.26	B	0.22386	0.039	T	0.69026	-0.5254	10	0.51188	T	0.08	.	12.068	0.53598	0.4548:0.0:0.5452:0.0	.	374	Q9UN88	GBRT_HUMAN	H	374	ENSP00000359329:R374H	ENSP00000359329:R374H	R	+	2	0	GABRQ	151570864	1.000000	0.71417	0.000000	0.03702	0.008000	0.06430	1.631000	0.37092	-0.966000	0.03587	-3.187000	0.00055	CGC		GABRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058763.2	NM_018558	
