#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MMS19	64210	broad.mit.edu	37	10	99222364	99222364	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr10:99222364G>A	ENST00000438925.2	-	20	2323	c.1988C>T	c.(1987-1989)aCt>aTt	p.T663I	MMS19_ENST00000327238.10_Missense_Mutation_p.T565I|MMS19_ENST00000355839.6_Missense_Mutation_p.T620I|MMS19_ENST00000370782.2_Missense_Mutation_p.T663I|MMS19_ENST00000327277.7_Missense_Mutation_p.T299I	NM_022362.4	NP_071757.4	Q96T76	MMS19_HUMAN	MMS19 nucleotide excision repair homolog (S. cerevisiae)	663					cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|iron-sulfur cluster assembly (GO:0016226)|nucleotide-excision repair (GO:0006289)|phosphorelay signal transduction system (GO:0000160)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	CIA complex (GO:0097361)|cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|membrane (GO:0016020)|MMXD complex (GO:0071817)|nucleus (GO:0005634)|spindle (GO:0005819)	estrogen receptor binding (GO:0030331)|protein binding, bridging (GO:0030674)|receptor signaling complex scaffold activity (GO:0030159)|transcription coactivator activity (GO:0003713)	p.T663I(1)		endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|stomach(1)	16		Colorectal(252;0.0846)		Epithelial(162;3.33e-10)|all cancers(201;2.74e-08)		GGTTGTAGCAGTGCCAATGAC	0.493								Direct reversal of damage																													p.T663I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1988T	10						.						188.0	143.0	158.0					10																	99222364		2203	4300	6503	99212354	SO:0001583	missense	64210	exon20			AF007151	CCDS7464.1, CCDS73177.1	10q24-q25	2007-08-15	2007-08-15	2007-08-15	ENSG00000155229	ENSG00000155229			13824	protein-coding gene	gene with protein product	"""MET18 homolog (S. cerevisiae)"""	614777		MMS19L		11071939	Standard	NM_022362		Approved	MET18, hMMS19	uc001kns.4	Q96T76	OTTHUMG00000018857	ENST00000438925.2:c.1988C>T	10.37:g.99222364G>A	ENSP00000412698:p.Thr663Ile	Somatic		Capture	Illumina HiSeq	Phase_I	99212354	NM_022362	B0QZ75|B3KPE5|B4DQX2|B4E2I3|D3DR55|F8W9Y2|Q17RZ8|Q5T455|Q66K82|Q7L4W8|Q969Z1|Q96DF1|Q96MR1|Q96RK5|Q96SK1|Q9BUE2|Q9BYS9	Missense_Mutation	SNP	ENST00000438925.2	37	CCDS7464.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.736280	0.89482	.	.	ENSG00000155229	ENST00000438925;ENST00000370782;ENST00000327238;ENST00000422291;ENST00000327277;ENST00000327253;ENST00000355839	T;T;T;T;T	0.65916	1.58;1.58;-0.18;-0.11;1.58	5.56	5.56	0.83823	Armadillo-like helical (1);Armadillo-type fold (1);	0.141754	0.64402	D	0.000004	T	0.76926	0.4056	M	0.69823	2.125	0.43724	D	0.996207	P;D;D;P;P	0.76494	0.911;0.999;0.992;0.911;0.956	P;D;P;P;P	0.71414	0.572;0.973;0.888;0.572;0.649	T	0.72144	-0.4379	10	0.21540	T	0.41	.	17.773	0.88499	0.0:0.0:1.0:0.0	.	684;565;620;663;620	B4DQX2;Q96T76-5;F8W9Y2;Q96T76;B4E2I3	.;.;.;MMS19_HUMAN;.	I	663;663;565;642;299;248;620	ENSP00000412698:T663I;ENSP00000359818:T663I;ENSP00000320059:T565I;ENSP00000322236:T299I;ENSP00000348097:T620I	ENSP00000320059:T565I	T	-	2	0	MMS19	99212354	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	6.011000	0.70760	2.638000	0.89438	0.644000	0.83932	ACT		MMS19-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049706.2		
DNHD1	144132	broad.mit.edu	37	11	6592514	6592514	+	Missense_Mutation	SNP	G	G	A	rs200510327		TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr11:6592514G>A	ENST00000527990.2	+	40	13772	c.13772G>A	c.(13771-13773)cGc>cAc	p.R4591H	DNHD1_ENST00000254579.6_Missense_Mutation_p.R4591H			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	4591					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)	p.R4591H(1)		NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		CACCCGCGCCGCCTGCTGCTG	0.632																																					p.R4591H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G13772A	11						.						25.0	31.0	29.0					11																	6592514		2133	4256	6389	6549090	SO:0001583	missense	144132	exon42			AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.13772G>A	11.37:g.6592514G>A	ENSP00000436180:p.Arg4591His	Somatic		Capture	Illumina HiSeq	Phase_I	6549090	NM_144666	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	ENST00000527990.2	37	CCDS44532.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.071410	0.76301	.	.	ENSG00000179532	ENST00000254579;ENST00000527990;ENST00000530197	T;T	0.08370	3.1;3.1	4.27	4.27	0.50696	Dynein heavy chain (1);	0.205916	0.34156	N	0.004218	T	0.23806	0.0576	M	0.63428	1.95	0.30726	N	0.747733	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.73380	0.98;0.941;0.976	T	0.01810	-1.1269	10	0.66056	D	0.02	-15.5713	12.3725	0.55261	0.0:0.0:1.0:0.0	.	3679;644;4591	B0I1S4;Q9NSW8;Q96M86	.;.;DNHD1_HUMAN	H	4591;4591;859	ENSP00000254579:R4591H;ENSP00000436180:R4591H	ENSP00000254579:R4591H	R	+	2	0	DNHD1	6549090	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	4.880000	0.63107	2.364000	0.80123	0.557000	0.71058	CGC		DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384673.2	NM_144666	
BCL9L	283149	broad.mit.edu	37	11	118772772	118772772	+	Silent	SNP	G	G	A			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr11:118772772G>A	ENST00000334801.3	-	6	2644	c.1680C>T	c.(1678-1680)ccC>ccT	p.P560P	BCL9L_ENST00000526143.1_5'UTR	NM_182557.2	NP_872363.1	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	560					canonical Wnt signaling pathway (GO:0060070)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell morphogenesis (GO:0022604)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|transcription coactivator activity (GO:0003713)	p.P560P(2)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	56	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		AAGGAGGCGGGGGCCCCCTCA	0.627																																					p.P560P												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1680T	11						.						55.0	57.0	57.0					11																	118772772		2200	4295	6495	118277982	SO:0001819	synonymous_variant	283149	exon6			AB094091	CCDS8403.1	11q23.3	2012-06-06				ENSG00000186174			23688	protein-coding gene	gene with protein product		609004				12964048	Standard	NM_182557		Approved	DLNB11	uc001pug.3	Q86UU0		ENST00000334801.3:c.1680C>T	11.37:g.118772772G>A		Somatic		Capture	Illumina HiSeq	Phase_I	118277982	NM_182557	A1A4C1|Q67FY1|Q6ZWJ0|Q6ZWK2	Silent	SNP	ENST00000334801.3	37	CCDS8403.1																																																																																				BCL9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389653.1	NM_182557	
CMKLR1	1240	broad.mit.edu	37	12	108686029	108686029	+	Silent	SNP	T	T	G			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr12:108686029T>G	ENST00000312143.7	-	3	1074	c.711A>C	c.(709-711)acA>acC	p.T237T	CMKLR1_ENST00000412676.1_Silent_p.T237T|CMKLR1_ENST00000552995.1_Silent_p.T235T|CMKLR1_ENST00000550402.1_Silent_p.T237T|CMKLR1_ENST00000397688.2_Silent_p.T235T	NM_001142344.1|NM_004072.2	NP_001135816.1|NP_004063.1	Q99788	CML1_HUMAN	chemokine-like receptor 1	237					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of macrophage chemotaxis (GO:0010759)|regulation of calcium-mediated signaling (GO:0050848)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)	p.T235T(1)		endometrium(5)|large_intestine(3)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	37						GGTAGCAAGCTGTGATGATGA	0.547																																					p.T237T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A711C	12						.						63.0	69.0	67.0					12																	108686029		2139	4243	6382	107210159	SO:0001819	synonymous_variant	1240	exon4			U79526	CCDS41829.1, CCDS44965.1	12q23.3	2013-07-29			ENSG00000174600	ENSG00000174600		"""GPCR / Class A : Resolvin receptors"""	2121	protein-coding gene	gene with protein product	"""resolvin E1 receptor"", ""chemerin receptor"""	602351					Standard	NM_004072		Approved	RVER1	uc009zuw.3	Q99788	OTTHUMG00000169576	ENST00000312143.7:c.711A>C	12.37:g.108686029T>G		Somatic		Capture	Illumina HiSeq	Phase_I	107210159	NM_001142343	A8K6Y5|O75748|Q3KP37|Q5U0H0|Q99789	Silent	SNP	ENST00000312143.7	37	CCDS44965.1																																																																																				CMKLR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404867.1		
PLXNC1	10154	broad.mit.edu	37	12	94641830	94641830	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr12:94641830C>T	ENST00000258526.4	+	13	2789	c.2540C>T	c.(2539-2541)aCg>aTg	p.T847M		NM_005761.2	NP_005752.1	O60486	PLXC1_HUMAN	plexin C1	847					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)	p.T847M(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(12)|lung(30)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						CCCAGATTCACGGGGTATCGG	0.498																																					p.T847M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2540T	12						.						85.0	78.0	80.0					12																	94641830		2203	4300	6503	93165961	SO:0001583	missense	10154	exon13			AF030339	CCDS9049.1	12q23	2009-04-17				ENSG00000136040		"""CD molecules"", ""Plexins"""	9106	protein-coding gene	gene with protein product		604259					Standard	NR_037687		Approved	VESPR, CD232	uc001tdc.3	O60486	OTTHUMG00000170235	ENST00000258526.4:c.2540C>T	12.37:g.94641830C>T	ENSP00000258526:p.Thr847Met	Somatic		Capture	Illumina HiSeq	Phase_I	93165961	NM_005761	Q59H25	Missense_Mutation	SNP	ENST00000258526.4	37	CCDS9049.1	.	.	.	.	.	.	.	.	.	.	C	14.37	2.515265	0.44763	.	.	ENSG00000136040	ENST00000258526	T	0.07444	3.19	6.16	6.16	0.99307	Cell surface receptor IPT/TIG (1);	0.236624	0.43747	D	0.000535	T	0.14743	0.0356	L	0.56769	1.78	0.80722	D	1	D	0.64830	0.994	P	0.50231	0.635	T	0.00468	-1.1721	10	0.34782	T	0.22	.	10.9882	0.47534	0.0:0.913:0.0:0.087	.	847	O60486	PLXC1_HUMAN	M	847	ENSP00000258526:T847M	ENSP00000258526:T847M	T	+	2	0	PLXNC1	93165961	1.000000	0.71417	0.983000	0.44433	0.076000	0.17211	2.057000	0.41365	2.937000	0.99478	0.650000	0.86243	ACG		PLXNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408126.2		
SBNO1	55206	broad.mit.edu	37	12	123800205	123800205	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr12:123800205G>A	ENST00000602398.1	-	22	3065	c.2938C>T	c.(2938-2940)Cgt>Tgt	p.R980C	SBNO1_ENST00000602750.1_Missense_Mutation_p.R979C|SBNO1_ENST00000420886.2_Missense_Mutation_p.R980C|SBNO1_ENST00000267176.4_Missense_Mutation_p.R979C			A3KN83	SBNO1_HUMAN	strawberry notch homolog 1 (Drosophila)	980					regulation of transcription, DNA-templated (GO:0006355)			p.R979C(1)		NS(2)|breast(6)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(11)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(2)	62	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		CTATGAGTACGTCCTGCAACG	0.368																																					p.R979C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2935T	12						.						123.0	115.0	118.0					12																	123800205		2203	4300	6503	122366158	SO:0001583	missense	55206	exon21			AK001563	CCDS9246.1, CCDS53844.1	12q24.31	2006-10-06	2006-10-06			ENSG00000139697			22973	protein-coding gene	gene with protein product		614274	"""sno, strawberry notch homolog 1 (Drosophila)"""				Standard	NM_018183		Approved	MOP3, FLJ10701, FLJ10833, Sno	uc010tap.2	A3KN83		ENST00000602398.1:c.2938C>T	12.37:g.123800205G>A	ENSP00000473665:p.Arg980Cys	Somatic		Capture	Illumina HiSeq	Phase_I	122366158	NM_018183	Q05C06|Q3ZTS3|Q9H3T8|Q9NVB2	De_novo_Start_OutOfFrame	SNP	ENST00000602398.1	37	CCDS53844.1	.	.	.	.	.	.	.	.	.	.	G	17.95	3.514714	0.64634	.	.	ENSG00000139697	ENST00000420886;ENST00000267176	D;D	0.98280	-4.84;-4.84	5.89	2.56	0.30785	.	0.126076	0.52532	D	0.000079	D	0.98899	0.9627	M	0.86502	2.82	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	D	0.99342	1.0912	10	0.59425	D	0.04	-20.5852	14.9079	0.70733	0.0:0.0:0.3475:0.6525	.	980;979	A3KN83;A3KN83-2	SBNO1_HUMAN;.	C	980;979	ENSP00000387361:R980C;ENSP00000267176:R979C	ENSP00000267176:R979C	R	-	1	0	SBNO1	122366158	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	1.531000	0.36018	0.670000	0.31165	0.655000	0.94253	CGT		SBNO1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467684.1	NM_018183	
NBEA	26960	broad.mit.edu	37	13	35733237	35733237	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr13:35733237A>C	ENST00000400445.3	+	22	3463	c.2929A>C	c.(2929-2931)Aag>Cag	p.K977Q	NBEA_ENST00000540320.1_Missense_Mutation_p.K977Q|NBEA_ENST00000379939.2_Missense_Mutation_p.K977Q|NBEA_ENST00000310336.4_Missense_Mutation_p.K977Q	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	977					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)		p.K977Q(1)		NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		TAAAAAGGGAAAGAAAGGGAA	0.383																																					p.K977Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2929C	13						.						97.0	89.0	91.0					13																	35733237		1902	4115	6017	34631237	SO:0001583	missense	26960	exon22			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.2929A>C	13.37:g.35733237A>C	ENSP00000383295:p.Lys977Gln	Somatic		Capture	Illumina HiSeq	Phase_I	34631237	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	37	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	A	11.15	1.553774	0.27739	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336	T;T;T;T	0.51071	0.72;0.72;0.72;0.72	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.30885	0.0779	N	0.19112	0.55	0.80722	D	1	P	0.38978	0.652	B	0.36464	0.225	T	0.11641	-1.0579	10	0.07813	T	0.8	.	15.3875	0.74714	1.0:0.0:0.0:0.0	.	977	Q5T321	.	Q	977	ENSP00000440951:K977Q;ENSP00000383295:K977Q;ENSP00000369271:K977Q;ENSP00000308534:K977Q	ENSP00000308534:K977Q	K	+	1	0	NBEA	34631237	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	9.339000	0.96797	2.041000	0.60428	0.529000	0.55759	AAG		NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
MYH6	4624	broad.mit.edu	37	14	23866461	23866461	+	Silent	SNP	A	A	G			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr14:23866461A>G	ENST00000356287.3	-	16	1997	c.1968T>C	c.(1966-1968)aaT>aaC	p.N656N	MYH6_ENST00000405093.3_Silent_p.N656N			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	656	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)	p.N656N(1)		breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		GCTTGTTGAGATTTTCCTGGA	0.542																																					p.N656N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1968C	14						.						112.0	103.0	106.0					14																	23866461		2203	4300	6503	22936301	SO:0001819	synonymous_variant	4624	exon17			D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.1968T>C	14.37:g.23866461A>G		Somatic		Capture	Illumina HiSeq	Phase_I	22936301	NM_002471	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Silent	SNP	ENST00000356287.3	37	CCDS9600.1																																																																																				MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071796.3		
RGS6	9628	broad.mit.edu	37	14	72925077	72925077	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr14:72925077C>T	ENST00000553530.1	+	5	541	c.334C>T	c.(334-336)Cgt>Tgt	p.R112C	RGS6_ENST00000553525.1_Missense_Mutation_p.R112C|RGS6_ENST00000404301.2_Missense_Mutation_p.R112C|RGS6_ENST00000402788.2_Missense_Mutation_p.R112C|RGS6_ENST00000355512.6_Missense_Mutation_p.R112C|RGS6_ENST00000553690.1_3'UTR|RGS6_ENST00000554782.1_5'Flank|RGS6_ENST00000343854.6_Missense_Mutation_p.R112C|RGS6_ENST00000406236.4_Missense_Mutation_p.R112C|RGS6_ENST00000434263.2_Missense_Mutation_p.R43C|RGS6_ENST00000555571.1_Missense_Mutation_p.R112C|RGS6_ENST00000556437.1_Missense_Mutation_p.R112C|RGS6_ENST00000407322.4_Missense_Mutation_p.R112C	NM_001204417.1|NM_001204418.1|NM_001204420.1|NM_001204421.1|NM_001204422.1|NM_004296.5	NP_001191346.1|NP_001191347.1|NP_001191349.1|NP_001191350.1|NP_001191351.1|NP_004287.3	P49758	RGS6_HUMAN	regulator of G-protein signaling 6	112	DEP. {ECO:0000255|PROSITE- ProRule:PRU00066}.				G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neuron differentiation (GO:0045666)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)	p.R112C(1)		endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		CACCTTTTATCGTTTCCAGGT	0.453																																					p.R112C	Ovarian(143;1926 2468 21071 48641)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C334T	14						.						146.0	104.0	118.0					14																	72925077		2203	4300	6503	71994830	SO:0001583	missense	9628	exon5			AF073920	CCDS9808.1, CCDS55924.1, CCDS73655.1	14q24.3	2008-07-28	2007-08-14			ENSG00000182732		"""Regulators of G-protein signaling"""	10002	protein-coding gene	gene with protein product		603894	"""regulator of G-protein signalling 6"""			10083744, 14734556	Standard	NM_004296		Approved		uc010ttn.2	P49758		ENST00000553530.1:c.334C>T	14.37:g.72925077C>T	ENSP00000452331:p.Arg112Cys	Somatic		Capture	Illumina HiSeq	Phase_I	71994830	NM_004296	C9JE95|F8W7W5|O75576|O75577|Q7Z4K3|Q7Z4K4|Q7Z4K5|Q7Z4K6|Q8TE13|Q8TE14|Q8TE15|Q8TE16|Q8TE17|Q8TE18|Q8TE19|Q8TE20|Q8TE21|Q8TE22|Q9UDS8|Q9UDT0|Q9Y245|Q9Y647	Missense_Mutation	SNP	ENST00000553530.1	37	CCDS9808.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.793233	0.90453	.	.	ENSG00000182732	ENST00000553525;ENST00000555571;ENST00000553530;ENST00000556437;ENST00000355512;ENST00000404301;ENST00000406236;ENST00000407322;ENST00000402788;ENST00000343854;ENST00000453330;ENST00000434263	T;T;T;T;T;T;T;T;T;T;T	0.27557	1.66;1.66;1.66;1.66;1.66;1.66;1.66;1.66;1.66;1.66;1.66	6.02	6.02	0.97574	DEP domain (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.66479	0.2793	M	0.90198	3.095	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.71447	-0.4590	10	0.87932	D	0	0.2708	20.5407	0.99260	0.0:1.0:0.0:0.0	.	43;117;112	B7Z7N5;Q59FJ8;P49758	.;.;RGS6_HUMAN	C	112;112;112;112;112;112;112;112;112;112;84;43	ENSP00000451030:R112C;ENSP00000450936:R112C;ENSP00000452331:R112C;ENSP00000451855:R112C;ENSP00000347699:R112C;ENSP00000385243:R112C;ENSP00000384218:R112C;ENSP00000384612:R112C;ENSP00000383953:R112C;ENSP00000341199:R112C;ENSP00000412144:R43C	ENSP00000341199:R112C	R	+	1	0	RGS6	71994830	1.000000	0.71417	0.997000	0.53966	0.978000	0.69477	5.947000	0.70242	2.865000	0.98341	0.655000	0.94253	CGT		RGS6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413033.2		
MAP1A	4130	broad.mit.edu	37	15	43818801	43818801	+	Silent	SNP	C	C	T			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr15:43818801C>T	ENST00000300231.5	+	4	5580	c.5130C>T	c.(5128-5130)caC>caT	p.H1710H	MAP1A_ENST00000399453.1_Silent_p.H1710H|MAP1A_ENST00000382031.1_Silent_p.H1948H			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	1710					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)	p.H1710H(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	GGTTCCCTCACGAGCTGGATG	0.582																																					p.H1710H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C5130T	15						.						50.0	57.0	54.0					15																	43818801		2003	4155	6158	41606093	SO:0001819	synonymous_variant	4130	exon4			U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.5130C>T	15.37:g.43818801C>T		Somatic		Capture	Illumina HiSeq	Phase_I	41606093	NM_002373	O95643|Q12973|Q15882|Q9UJT4	Silent	SNP	ENST00000300231.5	37	CCDS42031.1																																																																																				MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132894.5	NM_002373	
CHSY1	22856	broad.mit.edu	37	15	101717646	101717646	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr15:101717646C>T	ENST00000254190.3	-	3	2831	c.2356G>A	c.(2356-2358)Gat>Aat	p.D786N	CHSY1_ENST00000543813.1_5'UTR	NM_014918.4	NP_055733.2	Q86X52	CHSS1_HUMAN	chondroitin sulfate synthase 1	786					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|negative regulation of ossification (GO:0030279)|response to nutrient levels (GO:0031667)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)	p.D786N(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(5)|skin(1)	24	Lung NSC(78;0.00217)|all_lung(78;0.00271)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TAACTTGGATCATTTTTTTCC	0.423																																					p.D786N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2356A	15						.						75.0	76.0	76.0					15																	101717646		2203	4300	6503	99535169	SO:0001583	missense	22856	exon3			AB023207	CCDS10390.1	15q26.3	2013-02-19	2008-01-24	2008-01-24	ENSG00000131873	ENSG00000131873	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	17198	protein-coding gene	gene with protein product		608183	"""carbohydrate (chondroitin) synthase 1"""			11514575	Standard	NM_014918		Approved	KIAA0990, CSS1	uc021sxt.1	Q86X52	OTTHUMG00000149873	ENST00000254190.3:c.2356G>A	15.37:g.101717646C>T	ENSP00000254190:p.Asp786Asn	Somatic		Capture	Illumina HiSeq	Phase_I	99535169	NM_014918	Q6UX38|Q7LFU5|Q9Y2J5	Missense_Mutation	SNP	ENST00000254190.3	37	CCDS10390.1	.	.	.	.	.	.	.	.	.	.	C	13.64	2.299008	0.40694	.	.	ENSG00000131873	ENST00000254190;ENST00000543813	T	0.35973	1.28	5.87	5.87	0.94306	.	0.106093	0.64402	D	0.000008	T	0.27134	0.0665	N	0.19112	0.55	0.58432	D	0.99999	B	0.11235	0.004	B	0.12837	0.008	T	0.10776	-1.0615	10	0.11794	T	0.64	-35.8769	20.1947	0.98239	0.0:1.0:0.0:0.0	.	786	Q86X52	CHSS1_HUMAN	N	786;514	ENSP00000254190:D786N	ENSP00000254190:D786N	D	-	1	0	CHSY1	99535169	0.998000	0.40836	0.397000	0.26308	0.982000	0.71751	2.905000	0.48727	2.780000	0.95670	0.561000	0.74099	GAT		CHSY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313624.1	NM_014918	
ABAT	18	broad.mit.edu	37	16	8862780	8862780	+	Missense_Mutation	SNP	G	G	A	rs150277326		TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr16:8862780G>A	ENST00000396600.2	+	11	1704	c.766G>A	c.(766-768)Gaa>Aaa	p.E256K	ABAT_ENST00000268251.8_Missense_Mutation_p.E256K|ABAT_ENST00000425191.2_Missense_Mutation_p.E256K|ABAT_ENST00000567812.1_Missense_Mutation_p.E271K|ABAT_ENST00000569156.1_Missense_Mutation_p.E256K	NM_000663.4	NP_000654.2	P80404	GABT_HUMAN	4-aminobutyrate aminotransferase	256					behavioral response to cocaine (GO:0048148)|copulation (GO:0007620)|gamma-aminobutyric acid catabolic process (GO:0009450)|locomotory behavior (GO:0007626)|negative regulation of blood pressure (GO:0045776)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to iron ion (GO:0010039)|response to nicotine (GO:0035094)|synaptic transmission (GO:0007268)	4-aminobutyrate transaminase complex (GO:0032144)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	(S)-3-amino-2-methylpropionate transaminase activity (GO:0047298)|4-aminobutyrate transaminase activity (GO:0003867)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|succinate-semialdehyde dehydrogenase binding (GO:0032145)	p.E256K(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	26					L-Alanine(DB00160)|Phenelzine(DB00780)|Pyruvic acid(DB00119)|Valproic Acid(DB00313)|Vigabatrin(DB01080)	ATACCCTCTGGAAGAGTTTGT	0.542																																					p.E256K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G766A	16						.						147.0	146.0	146.0					16																	8862780		2197	4300	6497	8770281	SO:0001583	missense	18	exon11			L32961	CCDS10534.1	16p13.2	2011-01-10			ENSG00000183044	ENSG00000183044	2.6.1.19		23	protein-coding gene	gene with protein product	"""4-aminobutyrate transaminase"""	137150				7721088	Standard	NM_020686		Approved	GABAT	uc002czc.4	P80404	OTTHUMG00000048201	ENST00000396600.2:c.766G>A	16.37:g.8862780G>A	ENSP00000379845:p.Glu256Lys	Somatic		Capture	Illumina HiSeq	Phase_I	8770281	NM_000663	A8K386|Q16260|Q8N5W2|Q96BG2|Q99800	Missense_Mutation	SNP	ENST00000396600.2	37	CCDS10534.1	.	.	.	.	.	.	.	.	.	.	G	35	5.553239	0.96501	.	.	ENSG00000183044	ENST00000268251;ENST00000396600;ENST00000425191	T;T;T	0.76316	-1.01;-1.01;-1.01	5.7	5.7	0.88788	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.047189	0.85682	D	0.000000	D	0.85596	0.5733	M	0.87827	2.91	0.80722	D	1	P	0.49862	0.929	P	0.48627	0.584	D	0.88199	0.2882	10	0.87932	D	0	-14.6651	18.8829	0.92364	0.0:0.0:1.0:0.0	.	256	P80404	GABT_HUMAN	K	256	ENSP00000268251:E256K;ENSP00000379845:E256K;ENSP00000411916:E256K	ENSP00000268251:E256K	E	+	1	0	ABAT	8770281	1.000000	0.71417	1.000000	0.80357	0.845000	0.48019	9.709000	0.98729	2.712000	0.92718	0.485000	0.47835	GAA		ABAT-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433620.2	NM_020686	
GRIN2A	2903	broad.mit.edu	37	16	9928072	9928072	+	Missense_Mutation	SNP	G	G	T	rs587780349		TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr16:9928072G>T	ENST00000396573.2	-	9	1976	c.1667C>A	c.(1666-1668)tCt>tAt	p.S556Y	GRIN2A_ENST00000396575.2_Missense_Mutation_p.S556Y|GRIN2A_ENST00000535259.1_Missense_Mutation_p.S399Y|GRIN2A_ENST00000562109.1_Missense_Mutation_p.S556Y|GRIN2A_ENST00000330684.3_Missense_Mutation_p.S556Y|GRIN2A_ENST00000404927.2_Missense_Mutation_p.S556Y	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	556					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.S556Y(1)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CACCCAGACAGAGGCGCTGAA	0.438																																					p.S556Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1667A	16						.						129.0	121.0	124.0					16																	9928072		2197	4300	6497	9835573	SO:0001583	missense	2903	exon8				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.1667C>A	16.37:g.9928072G>T	ENSP00000379818:p.Ser556Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	9835573	NM_001134408	O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	37	CCDS10539.1	.	.	.	.	.	.	.	.	.	.	G	13.87	2.366086	0.41902	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	T;T;T;T;T	0.51071	0.72;0.72;0.72;0.72;0.72	4.45	4.45	0.53987	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.112431	0.64402	D	0.000007	T	0.61837	0.2379	L	0.52905	1.665	0.58432	D	0.999991	D;D;D	0.65815	0.989;0.992;0.995	P;D;D	0.65140	0.888;0.932;0.912	T	0.61554	-0.7039	9	.	.	.	.	16.4505	0.83984	0.0:0.0:1.0:0.0	.	399;556;556	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	Y	556;556;399;556;556	ENSP00000379818:S556Y;ENSP00000385872:S556Y;ENSP00000441572:S399Y;ENSP00000332549:S556Y;ENSP00000379820:S556Y	.	S	-	2	0	GRIN2A	9835573	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	3.070000	0.50033	2.181000	0.69327	0.557000	0.71058	TCT		GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		
NUP93	9688	broad.mit.edu	37	16	56792463	56792463	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr16:56792463G>A	ENST00000308159.5	+	3	314	c.193G>A	c.(193-195)Ggg>Agg	p.G65R	NUP93_ENST00000569842.1_Missense_Mutation_p.G65R	NM_014669.4	NP_055484.3	Q8N1F7	NUP93_HUMAN	nucleoporin 93kDa	65					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)	p.G65R(2)		breast(2)|endometrium(6)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27						AGTTCTCCTCGGGTCTCGGGG	0.453																																					p.G65R	Colon(33;610 796 1305 1705 38917)											.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G193A	16						.						94.0	85.0	88.0					16																	56792463		2198	4300	6498	55349964	SO:0001583	missense	9688	exon3			D42085	CCDS10769.1, CCDS55996.1	16q13	2008-02-05			ENSG00000102900	ENSG00000102900			28958	protein-coding gene	gene with protein product		614351				9348540, 9531546	Standard	NM_014669		Approved	KIAA0095	uc002eka.3	Q8N1F7	OTTHUMG00000133278	ENST00000308159.5:c.193G>A	16.37:g.56792463G>A	ENSP00000310668:p.Gly65Arg	Somatic		Capture	Illumina HiSeq	Phase_I	55349964	NM_014669	B3KPQ8|Q14705	Missense_Mutation	SNP	ENST00000308159.5	37	CCDS10769.1	.	.	.	.	.	.	.	.	.	.	G	14.87	2.665283	0.47677	.	.	ENSG00000102900	ENST00000308159	T	0.46063	0.88	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	T	0.38188	0.1031	L	0.54965	1.715	0.80722	D	1	P	0.41524	0.753	B	0.29716	0.106	T	0.48948	-0.8989	10	0.87932	D	0	-22.0488	18.679	0.91540	0.0:0.0:1.0:0.0	.	65	Q8N1F7	NUP93_HUMAN	R	65	ENSP00000310668:G65R	ENSP00000310668:G65R	G	+	1	0	NUP93	55349964	1.000000	0.71417	0.998000	0.56505	0.356000	0.29392	9.452000	0.97615	2.401000	0.81631	0.555000	0.69702	GGG		NUP93-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257058.4	NM_014669	
EPX	8288	broad.mit.edu	37	17	56280670	56280670	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr17:56280670A>T	ENST00000225371.5	+	11	2047	c.1937A>T	c.(1936-1938)gAc>gTc	p.D646V		NM_000502.4	NP_000493.1	P11678	PERE_HUMAN	eosinophil peroxidase	646				RDGDRFWWQKRGVFTK -> ETETGSGGRTRCFHQ (in Ref. 3; AA sequence). {ECO:0000305}.	defense response to nematode (GO:0002215)|eosinophil migration (GO:0072677)|hydrogen peroxide catabolic process (GO:0042744)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-5 production (GO:0032714)|positive regulation of interleukin-4 production (GO:0032753)	extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.D646V(1)		breast(2)|endometrium(9)|kidney(1)|large_intestine(9)|liver(2)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	48					Melatonin(DB01065)	AGAGCCCGAGACGGAGACAGG	0.512																																					p.D646V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1937T	17						.						44.0	47.0	46.0					17																	56280670		2203	4300	6503	53635669	SO:0001583	missense	8288	exon11			M26515	CCDS11602.1	17q23.1	2006-09-25				ENSG00000121053	1.11.1.7		3423	protein-coding gene	gene with protein product		131399				2550461, 2541222	Standard	NM_000502		Approved	EPO, EPP, EPX-PEN	uc002ivq.3	P11678		ENST00000225371.5:c.1937A>T	17.37:g.56280670A>T	ENSP00000225371:p.Asp646Val	Somatic		Capture	Illumina HiSeq	Phase_I	53635669	NM_000502	Q4TVP3	Missense_Mutation	SNP	ENST00000225371.5	37	CCDS11602.1	.	.	.	.	.	.	.	.	.	.	A	17.64	3.440383	0.63067	.	.	ENSG00000121053	ENST00000225371	T	0.70399	-0.48	5.7	-2.3	0.06785	.	0.324208	0.39759	N	0.001278	T	0.75882	0.3910	M	0.76328	2.33	0.46798	D	0.9992	P	0.51653	0.947	P	0.61658	0.892	T	0.72164	-0.4373	10	0.87932	D	0	-0.3732	6.1369	0.20239	0.4418:0.3554:0.2028:0.0	.	646	P11678	PERE_HUMAN	V	646	ENSP00000225371:D646V	ENSP00000225371:D646V	D	+	2	0	EPX	53635669	0.010000	0.17322	0.031000	0.17742	0.948000	0.59901	1.543000	0.36147	-0.818000	0.04329	-0.291000	0.09656	GAC		EPX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443367.1	NM_000502	
NOL4	8715	broad.mit.edu	37	18	31537435	31537435	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr18:31537435G>T	ENST00000261592.5	-	8	1580	c.1283C>A	c.(1282-1284)cCa>cAa	p.P428Q	NOL4_ENST00000589544.1_Intron|NOL4_ENST00000538587.1_Missense_Mutation_p.P354Q|NOL4_ENST00000535384.1_Missense_Mutation_p.P143Q|NOL4_ENST00000535475.1_Intron|NOL4_ENST00000269185.4_Intron	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	O94818	NOL4_HUMAN	nucleolar protein 4	428						nucleolus (GO:0005730)	RNA binding (GO:0003723)	p.P428Q(1)		NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	51						CTTAGAGATTGGGACCATTCG	0.478																																					p.P143Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C428A	18						.						114.0	92.0	100.0					18																	31537435		2203	4300	6503	29791433	SO:0001583	missense	8715	exon4			AB017800	CCDS11907.2, CCDS56058.1, CCDS56059.1, CCDS59308.1	18q12	2010-05-04			ENSG00000101746	ENSG00000101746			7870	protein-coding gene	gene with protein product	"""cancer/testis antigen 125"""	603577				9813152	Standard	NM_003787		Approved	NOLP, HRIHFB2255, CT125	uc010dmi.3	O94818	OTTHUMG00000132291	ENST00000261592.5:c.1283C>A	18.37:g.31537435G>T	ENSP00000261592:p.Pro428Gln	Somatic		Capture	Illumina HiSeq	Phase_I	29791433	NM_001198549	B4DSQ0|B7Z3Z7|F5H1E3|Q6IBS2|Q9BWF1	Missense_Mutation	SNP	ENST00000261592.5	37	CCDS11907.2	.	.	.	.	.	.	.	.	.	.	G	21.8	4.203451	0.79127	.	.	ENSG00000101746	ENST00000261592;ENST00000535384;ENST00000538587	T;T	0.78816	-1.21;-1.21	6.01	6.01	0.97437	.	0.000000	0.85682	D	0.000000	D	0.88481	0.6448	M	0.70595	2.14	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.88276	0.2933	10	0.87932	D	0	-12.8671	20.5073	0.99209	0.0:0.0:1.0:0.0	.	354;428	B4DSQ0;O94818	.;NOL4_HUMAN	Q	428;143;354	ENSP00000445733:P143Q;ENSP00000443472:P354Q	ENSP00000261592:P428Q	P	-	2	0	NOL4	29791433	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.855000	0.98099	0.585000	0.79938	CCA		NOL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255386.1	NM_003787	
ZNF208	7757	broad.mit.edu	37	19	22155029	22155029	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr19:22155029T>G	ENST00000397126.4	-	4	2955	c.2807A>C	c.(2806-2808)aAg>aCg	p.K936T	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	936					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.K836T(2)|p.K936T(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				ATGAGTTTTCTTATGTTTACT	0.368																																					p.K936T												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.A2807C	19						.						47.0	49.0	49.0					19																	22155029		2029	4198	6227	21946869	SO:0001583	missense	7757	exon4			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.2807A>C	19.37:g.22155029T>G	ENSP00000380315:p.Lys936Thr	Somatic		Capture	Illumina HiSeq	Phase_I	21946869	NM_007153		Missense_Mutation	SNP	ENST00000397126.4	37	CCDS54240.1	.	.	.	.	.	.	.	.	.	.	T	12.84	2.059953	0.36373	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.07327	3.2	2.9	-1.15	0.09709	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17365	0.0417	.	.	.	0.09310	N	1	D	0.64830	0.994	D	0.65443	0.935	T	0.11690	-1.0577	8	0.51188	T	0.08	.	3.2147	0.06695	0.1745:0.2242:0.0:0.6013	.	836	O43345	ZN208_HUMAN	T	936;836	ENSP00000380315:K936T	ENSP00000380315:K936T	K	-	2	0	ZNF208	21946869	0.000000	0.05858	0.000000	0.03702	0.067000	0.16453	0.104000	0.15313	-0.885000	0.03971	0.240000	0.17902	AAG		ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153	
GLTSCR1	29998	broad.mit.edu	37	19	48176864	48176864	+	Silent	SNP	C	C	T			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr19:48176864C>T	ENST00000396720.3	+	3	227	c.33C>T	c.(31-33)gaC>gaT	p.D11D	CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_015711.3	NP_056526.3	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	11								p.D11D(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|pancreas(3)|prostate(4)|skin(2)	20		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		GCTTACTAGACGTGATTTGGT	0.592																																					p.D11D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C33T	19						.						130.0	120.0	123.0					19																	48176864		1568	3582	5150	52868676	SO:0001819	synonymous_variant	29998	exon3			AF182077	CCDS46134.1	19q13.3	2012-11-29			ENSG00000063169	ENSG00000063169			4332	protein-coding gene	gene with protein product		605690				10708517	Standard	NM_015711		Approved		uc002phh.4	Q9NZM4		ENST00000396720.3:c.33C>T	19.37:g.48176864C>T		Somatic		Capture	Illumina HiSeq	Phase_I	52868676	NM_015711	A8MW01	Silent	SNP	ENST00000396720.3	37	CCDS46134.1																																																																																				GLTSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465846.1	NM_015711	
PLEKHA4	57664	broad.mit.edu	37	19	49363612	49363612	+	Silent	SNP	G	G	A			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr19:49363612G>A	ENST00000263265.6	-	6	1026	c.471C>T	c.(469-471)gaC>gaT	p.D157D	PLEKHA4_ENST00000355496.5_Silent_p.D157D|PLEKHA4_ENST00000596713.1_5'Flank	NM_020904.2	NP_065955.2	Q9H4M7	PKHA4_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4	157						cytoplasm (GO:0005737)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)	p.D157D(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	30		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;0.000108)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.00027)|all cancers(93;0.00084)|GBM - Glioblastoma multiforme(486;0.0244)|Epithelial(262;0.0364)		CTCACTAGTCGTCCCCCTCCG	0.652																																					p.D157D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C471T	19						.						48.0	51.0	50.0					19																	49363612		2203	4300	6503	54055424	SO:0001819	synonymous_variant	57664	exon6			AY007233	CCDS12737.1, CCDS54291.1	19q13.33	2013-01-10	2002-01-14			ENSG00000105559		"""Pleckstrin homology (PH) domain containing"""	14339	protein-coding gene	gene with protein product		607769	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 4"""			11001876	Standard	NM_020904		Approved	PEPP1	uc002pkx.3	Q9H4M7		ENST00000263265.6:c.471C>T	19.37:g.49363612G>A		Somatic		Capture	Illumina HiSeq	Phase_I	54055424	NM_020904	Q8N4M8|Q8N658	Silent	SNP	ENST00000263265.6	37	CCDS12737.1																																																																																				PLEKHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466216.1		
PHTF1	10745	broad.mit.edu	37	1	114254432	114254432	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr1:114254432C>T	ENST00000369604.1	-	10	1466	c.983G>A	c.(982-984)tGt>tAt	p.C328Y	PHTF1_ENST00000447664.2_3'UTR|PHTF1_ENST00000369600.1_Missense_Mutation_p.C275Y|PHTF1_ENST00000474926.1_5'UTR|PHTF1_ENST00000393357.2_Missense_Mutation_p.C328Y|PHTF1_ENST00000369598.1_Missense_Mutation_p.C283Y|PHTF1_ENST00000369596.2_Missense_Mutation_p.C275Y|PHTF1_ENST00000357783.2_Missense_Mutation_p.C328Y			Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1	328					transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.C328Y(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CACAATATGACACCACCTTGT	0.368																																					p.C328Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G983A	1						.						60.0	59.0	59.0					1																	114254432		2203	4300	6503	114055955	SO:0001583	missense	10745	exon9			AJ011863	CCDS861.1	1p13-p11	2008-07-18			ENSG00000116793	ENSG00000116793			8939	protein-coding gene	gene with protein product		604950		PHTF		10395808	Standard	NM_006608		Approved		uc009wgp.1	Q9UMS5	OTTHUMG00000011800	ENST00000369604.1:c.983G>A	1.37:g.114254432C>T	ENSP00000358617:p.Cys328Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	114055955	NM_006608	Q5VWP7|Q5VWP8|Q9BUP2|Q9H1X8	Missense_Mutation	SNP	ENST00000369604.1	37	CCDS861.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.840|8.840	0.941995|0.941995	0.18281|0.18281	.|.	.|.	ENSG00000116793|ENSG00000116793	ENST00000369597;ENST00000393357;ENST00000369596;ENST00000369598;ENST00000369600;ENST00000369604;ENST00000357783|ENST00000412670	.|.	.|.	.|.	5.32|5.32	4.4|4.4	0.53042|0.53042	.|.	0.292336|.	0.35903|.	N|.	0.002907|.	T|T	0.25827|0.25827	0.0629|0.0629	N|N	0.19112|0.19112	0.55|0.55	0.80722|0.80722	D|D	1|1	B;B;B|.	0.09022|.	0.001;0.002;0.001|.	B;B;B|.	0.08055|.	0.001;0.003;0.002|.	T|T	0.09378|0.09378	-1.0677|-1.0677	9|5	0.02654|.	T|.	1|.	-9.3516|-9.3516	10.0758|10.0758	0.42360|0.42360	0.0:0.9086:0.0:0.0914|0.0:0.9086:0.0:0.0914	.|.	328;83;328|.	Q9UMS5;Q5TCR1;Q9UMS5-2|.	PHTF1_HUMAN;.;.|.	Y|I	283;328;275;283;275;328;328|84	.|.	ENSP00000350428:C328Y|.	C|V	-|-	2|1	0|0	PHTF1|PHTF1	114055955|114055955	0.997000|0.997000	0.39634|0.39634	0.992000|0.992000	0.48379|0.48379	0.283000|0.283000	0.27025|0.27025	0.669000|0.669000	0.25142|0.25142	1.453000|1.453000	0.47775|0.47775	0.557000|0.557000	0.71058|0.71058	TGT|GTC		PHTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032666.1	NM_006608	
SPAG17	200162	broad.mit.edu	37	1	118537114	118537114	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr1:118537114G>T	ENST00000336338.5	-	35	5158	c.5093C>A	c.(5092-5094)gCa>gAa	p.A1698E		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1698						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)		p.A1698E(1)		NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		CCATGGTGATGCTTCATGGAA	0.418																																					p.A1698E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5093A	1						.						168.0	144.0	152.0					1																	118537114		2203	4300	6503	118338637	SO:0001583	missense	200162	exon35				CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.5093C>A	1.37:g.118537114G>T	ENSP00000337804:p.Ala1698Glu	Somatic		Capture	Illumina HiSeq	Phase_I	118338637	NM_206996	Q8NAZ1|Q9NT21	Missense_Mutation	SNP	ENST00000336338.5	37	CCDS899.1	.	.	.	.	.	.	.	.	.	.	G	14.88	2.666158	0.47677	.	.	ENSG00000155761	ENST00000336338;ENST00000437255	T	0.19394	2.15	5.64	2.54	0.30619	.	0.265604	0.44483	D	0.000460	T	0.16599	0.0399	L	0.56769	1.78	0.26960	N	0.965828	D	0.61080	0.989	P	0.58266	0.836	T	0.03364	-1.1044	10	0.33940	T	0.23	.	6.7417	0.23439	0.1745:0.152:0.6735:0.0	.	1698	Q6Q759	SPG17_HUMAN	E	1698;178	ENSP00000337804:A1698E	ENSP00000337804:A1698E	A	-	2	0	SPAG17	118338637	0.262000	0.24073	1.000000	0.80357	0.216000	0.24613	0.478000	0.22212	0.913000	0.36797	0.650000	0.86243	GCA		SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033723.1	NM_206996	
SEC16B	89866	broad.mit.edu	37	1	177923427	177923427	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr1:177923427A>T	ENST00000308284.6	-	11	1539	c.1450T>A	c.(1450-1452)Tgg>Agg	p.W484R	RP4-798P15.3_ENST00000354921.3_RNA|SEC16B_ENST00000464631.2_Missense_Mutation_p.W485R	NM_033127.2	NP_149118.2	Q96JE7	SC16B_HUMAN	SEC16 homolog B (S. cerevisiae)	484					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|peroxisome fission (GO:0016559)|peroxisome organization (GO:0007031)|positive regulation of gene expression (GO:0010628)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endoplasmic reticulum (GO:0070972)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)		p.W485R(1)		central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)|stomach(1)	35						CTCATGACCCAGCTGTAGGTC	0.532																																					p.W484R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1450A	1						.						34.0	34.0	34.0					1																	177923427		1946	4134	6080	176190050	SO:0001583	missense	89866	exon11			AK090411	CCDS44281.1	1q25.2	2012-10-08	2007-06-20	2007-06-20	ENSG00000120341	ENSG00000120341			30301	protein-coding gene	gene with protein product	"""regucalcin gene promotor region related protein"""	612855	"""leucine zipper transcription regulator 2"""	LZTR2		11572484, 11605020	Standard	NM_033127		Approved	RGPR, PGPR-p117	uc001gli.1	Q96JE7	OTTHUMG00000167206	ENST00000308284.6:c.1450T>A	1.37:g.177923427A>T	ENSP00000308339:p.Trp484Arg	Somatic		Capture	Illumina HiSeq	Phase_I	176190050	NM_033127	A3EYF1|Q5HYF6|Q8N7D6|Q96GX6	Missense_Mutation	SNP	ENST00000308284.6	37	CCDS44281.1	.	.	.	.	.	.	.	.	.	.	A	16.66	3.185193	0.57909	.	.	ENSG00000120341	ENST00000308284;ENST00000414025;ENST00000239472;ENST00000464631	T;T	0.37584	2.79;1.19	5.78	5.78	0.91487	.	0.000000	0.64402	D	0.000004	T	0.25644	0.0624	N	0.17838	0.53	0.35052	D	0.760725	B;B;B;B	0.22800	0.044;0.075;0.005;0.075	B;B;B;B	0.27608	0.081;0.081;0.012;0.081	T	0.24404	-1.0161	10	0.10377	T	0.69	-10.8717	15.7815	0.78264	1.0:0.0:0.0:0.0	.	485;485;484;181	E9PK14;B1AM08;Q96JE7;Q96PW0	.;.;SC16B_HUMAN;.	R	484;168;199;485	ENSP00000308339:W484R;ENSP00000431727:W485R	ENSP00000239472:W199R	W	-	1	0	AL359075.1	176190050	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.244000	0.58728	2.206000	0.71126	0.519000	0.50382	TGG		SEC16B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084773.16	NM_033127	
MYBPH	4608	broad.mit.edu	37	1	203140639	203140639	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr1:203140639A>C	ENST00000255416.4	-	5	722	c.665T>G	c.(664-666)aTg>aGg	p.M222R		NM_004997.2	NP_004988.2	Q13203	MYBPH_HUMAN	myosin binding protein H	222	Ig-like C2-type 1.				cell adhesion (GO:0007155)|regulation of striated muscle contraction (GO:0006942)	myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)	p.M222R(1)		endometrium(5)|large_intestine(6)|lung(7)|skin(1)|urinary_tract(1)	20			BRCA - Breast invasive adenocarcinoma(75;0.153)	Colorectal(1306;0.0306)		CCCGGTGCGCATGCTCACCCG	0.672																																					p.M222R	NSCLC(32;174 1025 14462 23899 42933)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T665G	1						.						61.0	61.0	61.0					1																	203140639		2203	4300	6503	201407262	SO:0001583	missense	4608	exon5			BC044226	CCDS30975.1	1q32.1	2013-02-11	2001-11-28		ENSG00000133055	ENSG00000133055		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7552	protein-coding gene	gene with protein product		160795	"""myosin-binding protein H"""			8486381	Standard	NM_004997		Approved		uc001gzh.1	Q13203	OTTHUMG00000042121	ENST00000255416.4:c.665T>G	1.37:g.203140639A>C	ENSP00000255416:p.Met222Arg	Somatic		Capture	Illumina HiSeq	Phase_I	201407262	NM_004997	Q16886|Q86YC5	Missense_Mutation	SNP	ENST00000255416.4	37	CCDS30975.1	.	.	.	.	.	.	.	.	.	.	A	17.42	3.384862	0.61956	.	.	ENSG00000133055	ENST00000255416	T	0.68479	-0.33	4.62	4.62	0.57501	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.310631	0.23591	N	0.046556	T	0.61937	0.2387	L	0.49126	1.545	0.26680	N	0.971551	B	0.06786	0.001	B	0.01281	0.0	T	0.60591	-0.7233	10	0.87932	D	0	.	14.4751	0.67541	1.0:0.0:0.0:0.0	.	222	Q13203	MYBPH_HUMAN	R	222	ENSP00000255416:M222R	ENSP00000255416:M222R	M	-	2	0	MYBPH	201407262	0.994000	0.37717	0.925000	0.36789	0.984000	0.73092	8.626000	0.90969	2.065000	0.61736	0.459000	0.35465	ATG		MYBPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100264.1	NM_004997	
CR1	1378	broad.mit.edu	37	1	207790100	207790100	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr1:207790100G>A	ENST00000367049.4	+	41	6842	c.6842G>A	c.(6841-6843)gGg>gAg	p.G2281E	CR1_ENST00000400960.2_Missense_Mutation_p.G1831E|CR1_ENST00000367053.1_Missense_Mutation_p.G1831E|CR1_ENST00000367052.1_Missense_Mutation_p.G1831E|CR1_ENST00000367051.1_Missense_Mutation_p.G1831E	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1831					complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)	p.G1836E(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						CAAGGGAATGGGGTTTGGAGC	0.512																																					p.G2281E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6842A	1						.						143.0	146.0	145.0					1																	207790100		1960	4138	6098	205856723	SO:0001583	missense	1378	exon41			Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.6842G>A	1.37:g.207790100G>A	ENSP00000356016:p.Gly2281Glu	Somatic		Capture	Illumina HiSeq	Phase_I	205856723	NM_000651	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Missense_Mutation	SNP	ENST00000367049.4	37	CCDS44308.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.12|13.12	2.142052|2.142052	0.37825|0.37825	.|.	.|.	ENSG00000203710|ENSG00000203710	ENST00000367052;ENST00000367051;ENST00000367053;ENST00000400960;ENST00000367049|ENST00000529814	T;T;T;T;T|T	0.72725|0.72615	-0.68;-0.68;-0.68;-0.68;-0.68|-0.67	4.15|4.15	3.24|3.24	0.37175|0.37175	Complement control module (2);Sushi/SCR/CCP (3);|.	.|.	.|.	.|.	.|.	D|D	0.84884|0.84884	0.5571|0.5571	H|H	0.96460|0.96460	3.825|3.825	0.09310|0.09310	N|N	1|1	P;D|.	0.89917|.	0.763;1.0|.	P;D|.	0.97110|.	0.461;1.0|.	T|T	0.76263|0.76263	-0.3023|-0.3023	9|7	0.87932|0.72032	D|D	0|0.01	.|.	8.0286|8.0286	0.30451|0.30451	0.1096:0.0:0.8904:0.0|0.1096:0.0:0.8904:0.0	.|.	1831;2281|.	P17927;E9PDY4|.	CR1_HUMAN;.|.	E|R	1831;1831;1831;1831;2281|454	ENSP00000356019:G1831E;ENSP00000356018:G1831E;ENSP00000356020:G1831E;ENSP00000383744:G1831E;ENSP00000356016:G2281E|ENSP00000434718:G454R	ENSP00000356016:G2281E|ENSP00000434718:G454R	G|G	+|+	2|1	0|0	CR1|CR1	205856723|205856723	0.870000|0.870000	0.30015|0.30015	0.226000|0.226000	0.23910|0.23910	0.376000|0.376000	0.30014|0.30014	2.816000|2.816000	0.48026|0.48026	1.356000|1.356000	0.45884|0.45884	0.609000|0.609000	0.83330|0.83330	GGG|GGG		CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1	NM_000573	
CSMD2	114784	broad.mit.edu	37	1	34554620	34554620	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr1:34554620G>A	ENST00000373381.4	-	2	538	c.362C>T	c.(361-363)tCg>tTg	p.S121L		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	81	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S81L(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				ATCAAACACCGACAGGACATC	0.547																																					p.S81L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C242T	1						.						124.0	94.0	104.0					1																	34554620		2203	4300	6503	34327207	SO:0001583	missense	114784	exon2			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.362C>T	1.37:g.34554620G>A	ENSP00000362479:p.Ser121Leu	Somatic		Capture	Illumina HiSeq	Phase_I	34327207	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373381.4	37		.	.	.	.	.	.	.	.	.	.	G	26.1	4.706772	0.89018	.	.	ENSG00000121904	ENST00000373381	T	0.18338	2.22	5.42	5.42	0.78866	CUB (5);	0.000000	0.64402	U	0.000018	T	0.37544	0.1007	L	0.46614	1.455	0.80722	D	1	D;D	0.89917	0.995;1.0	P;D	0.91635	0.795;0.999	T	0.02214	-1.1194	10	0.52906	T	0.07	.	18.5714	0.91136	0.0:0.0:1.0:0.0	.	81;121	Q7Z408;E7EUA6	CSMD2_HUMAN;.	L	121	ENSP00000362479:S121L	ENSP00000241312:S81L	S	-	2	0	CSMD2	34327207	1.000000	0.71417	0.989000	0.46669	0.760000	0.43138	8.062000	0.89475	2.700000	0.92200	0.655000	0.94253	TCG		CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896	
GRIK3	2899	broad.mit.edu	37	1	37291412	37291412	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr1:37291412C>A	ENST00000373091.3	-	11	1562	c.1546G>T	c.(1546-1548)Gtg>Ttg	p.V516L	GRIK3_ENST00000373093.4_Missense_Mutation_p.V516L	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	516					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)	p.V516L(1)		breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				AGGGGGGCCACGGCCAGATCT	0.527																																					p.V516L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1546T	1						.						88.0	84.0	85.0					1																	37291412		2203	4300	6503	37063999	SO:0001583	missense	2899	exon11			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.1546G>T	1.37:g.37291412C>A	ENSP00000362183:p.Val516Leu	Somatic		Capture	Illumina HiSeq	Phase_I	37063999	NM_000831	A9Z1Z8|B1AMS6|Q13004|Q16136	Missense_Mutation	SNP	ENST00000373091.3	37	CCDS416.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.951683	0.92660	.	.	ENSG00000163873	ENST00000373091;ENST00000373093	T;T	0.11821	2.74;2.74	5.25	5.25	0.73442	Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	T	0.29652	0.0740	L	0.39467	1.215	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.65010	0.931;0.931	T	0.01697	-1.1293	10	0.87932	D	0	.	18.8546	0.92246	0.0:1.0:0.0:0.0	.	516;516	A9Z1Z8;Q13003	.;GRIK3_HUMAN	L	516	ENSP00000362183:V516L;ENSP00000362185:V516L	ENSP00000362183:V516L	V	-	1	0	GRIK3	37063999	1.000000	0.71417	0.989000	0.46669	0.842000	0.47809	7.720000	0.84759	2.443000	0.82685	0.462000	0.41574	GTG		GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012053.1	NM_000831	
FAM73A	374986	broad.mit.edu	37	1	78340564	78340564	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr1:78340564G>T	ENST00000370791.3	+	16	1746	c.1714G>T	c.(1714-1716)Gac>Tac	p.D572Y	FAM73A_ENST00000443751.2_Missense_Mutation_p.D535Y	NM_001270384.1|NM_198549.3	NP_001257313.1|NP_940951.1	Q8NAN2	FA73A_HUMAN	family with sequence similarity 73, member A	572						integral component of membrane (GO:0016021)		p.D572Y(1)		breast(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	19				Colorectal(170;0.226)		AGACATTTTTGACTTTGAGAA	0.353																																					p.D572Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1714T	1						.						61.0	59.0	59.0					1																	78340564		2203	4300	6503	78113152	SO:0001583	missense	374986	exon16				CCDS681.1, CCDS72809.1	1p31.1	2008-02-05			ENSG00000180488	ENSG00000180488			24741	protein-coding gene	gene with protein product							Standard	NM_001270384		Approved	FLJ35093	uc010ork.3	Q8NAN2	OTTHUMG00000009766	ENST00000370791.3:c.1714G>T	1.37:g.78340564G>T	ENSP00000359827:p.Asp572Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	78113152	NM_198549	Q6MZG0	Missense_Mutation	SNP	ENST00000370791.3	37	CCDS681.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.532779	0.85812	.	.	ENSG00000180488	ENST00000370791;ENST00000443751	T;T	0.29142	1.58;1.58	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.53658	0.1810	M	0.79475	2.455	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.998	T	0.57820	-0.7745	10	0.87932	D	0	-17.3027	19.6119	0.95610	0.0:0.0:1.0:0.0	.	535;573;572	F8W7S1;B7ZLZ8;Q8NAN2	.;.;FA73A_HUMAN	Y	572;535	ENSP00000359827:D572Y;ENSP00000393675:D535Y	ENSP00000359827:D572Y	D	+	1	0	FAM73A	78113152	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	9.096000	0.94182	2.648000	0.89879	0.563000	0.77884	GAC		FAM73A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000026931.1	NM_198549	
KIAA1804	84451	broad.mit.edu	37	1	233511709	233511709	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr1:233511709C>T	ENST00000366624.3	+	7	1984	c.1723C>T	c.(1723-1725)Cga>Tga	p.R575*	MLK4_ENST00000366622.1_Nonsense_Mutation_p.R21*	NM_032435.2	NP_115811.2												p.R575*(3)									CACAGTCTTTCGACAAGAAGA	0.318																																					p.R575X												.	.	3	Substitution - Nonsense(3)	ovary(1)|prostate(1)|large_intestine(1)	c.C1723T	1						.						80.0	83.0	82.0					1																	233511709		2203	4299	6502	231578332	SO:0001587	stop_gained	84451	exon7																														ENST00000366624.3:c.1723C>T	1.37:g.233511709C>T	ENSP00000355583:p.Arg575*	Somatic		Capture	Illumina HiSeq	Phase_I	231578332	NM_032435		Nonsense_Mutation	SNP	ENST00000366624.3	37	CCDS1598.1	.	.	.	.	.	.	.	.	.	.	C	43	9.898159	0.99290	.	.	ENSG00000143674	ENST00000366624;ENST00000366622	.	.	.	5.44	5.44	0.79542	.	0.076288	0.49305	D	0.000143	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.4568	0.94895	0.0:1.0:0.0:0.0	.	.	.	.	X	575;21	.	ENSP00000355581:R21X	R	+	1	2	RP5-862P8.2	231578332	0.932000	0.31603	0.993000	0.49108	0.988000	0.76386	4.339000	0.59322	2.832000	0.97577	0.655000	0.94253	CGA		MLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092495.1		
NKX2-2	4821	broad.mit.edu	37	20	21493012	21493013	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr20:21493012_21493013insC	ENST00000377142.4	-	2	726_727	c.370_371insG	c.(370-372)gacfs	p.D124fs	NKX2-2-AS1_ENST00000549659.1_RNA	NM_002509.3	NP_002500.1	O95096	NKX22_HUMAN	NK2 homeobox 2	124					astrocyte differentiation (GO:0048708)|brain development (GO:0007420)|digestive tract development (GO:0048565)|endocrine pancreas development (GO:0031018)|negative regulation of neuron differentiation (GO:0045665)|neuron fate specification (GO:0048665)|oligodendrocyte development (GO:0014003)|optic nerve development (GO:0021554)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)|spinal cord oligodendrocyte cell fate specification (GO:0021530)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell fate commitment (GO:0003327)|ventral spinal cord interneuron fate determination (GO:0060580)	nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|core promoter proximal region DNA binding (GO:0001159)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.D124fs*>151(1)		endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21						CTTGCCGGCGTCCCCCCCGCCG	0.703																																					p.D124fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.371_372insG	20						.																																			21441013	SO:0001589	frameshift_variant	4821	exon2			AF019415	CCDS13145.1	20p11.22	2012-03-09	2007-07-09	2002-10-04	ENSG00000125820	ENSG00000125820		"""Homeoboxes / ANTP class : NKL subclass"""	7835	protein-coding gene	gene with protein product		604612	"""NK-2 (Drosophila) homolog B"", ""NK2 transcription factor related, locus 2 (Drosophila)"""	NKX2B		9703340, 1346742	Standard	NM_002509		Approved	NKX2.2	uc002wsi.3	O95096	OTTHUMG00000170524	ENST00000377142.4:c.371dupG	20.37:g.21493019_21493019dupC	ENSP00000366347:p.Asp124fs	Somatic		Capture	Illumina HiSeq	Phase_I	21441012	NM_002509		Frame_Shift_Ins	INS	ENST00000377142.4	37	CCDS13145.1																																																																																				NKX2-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078278.9		
PCNA	5111	broad.mit.edu	37	20	5098117	5098117	+	Splice_Site	SNP	G	G	A			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr20:5098117G>A	ENST00000379160.3	-	5	823	c.581C>T	c.(580-582)gCt>gTt	p.A194V	PCNA_ENST00000379143.5_Splice_Site_p.A194V	NM_002592.2	NP_002583.1	P12004	PCNA_HUMAN	proliferating cell nuclear antigen	194					base-excision repair (GO:0006284)|cell proliferation (GO:0008283)|DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|epithelial cell differentiation (GO:0030855)|G1/S transition of mitotic cell cycle (GO:0000082)|heart development (GO:0007507)|leading strand elongation (GO:0006272)|mismatch repair (GO:0006298)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of deoxyribonuclease activity (GO:0032077)|regulation of DNA replication (GO:0006275)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|response to cadmium ion (GO:0046686)|response to lipid (GO:0033993)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)|translesion synthesis (GO:0019985)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|DNA replication factor C complex (GO:0005663)|extracellular vesicular exosome (GO:0070062)|nuclear replication fork (GO:0043596)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCNA complex (GO:0043626)|PCNA-p21 complex (GO:0070557)	dinucleotide insertion or deletion binding (GO:0032139)|DNA polymerase binding (GO:0070182)|DNA polymerase processivity factor activity (GO:0030337)|identical protein binding (GO:0042802)|MutLalpha complex binding (GO:0032405)|purine-specific mismatch base pair DNA N-glycosylase activity (GO:0000701)|receptor tyrosine kinase binding (GO:0030971)	p.A194V(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(2)	9						ACTACTTACAGCTTCCTCCTC	0.323								DNA polymerases (catalytic subunits)																													p.A194V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C581T	20						.						47.0	49.0	48.0					20																	5098117		2202	4299	6501	5046117	SO:0001630	splice_region_variant	5111	exon5			J04718	CCDS13087.1	20p13-p12.3	2013-09-19			ENSG00000132646	ENSG00000132646			8729	protein-coding gene	gene with protein product		176740				2565339	Standard	NM_002592		Approved		uc002wlp.3	P12004	OTTHUMG00000031798	ENST00000379160.3:c.582+1C>T	20.37:g.5098117G>A		Somatic		Capture	Illumina HiSeq	Phase_I	5046117	NM_002592	B2R897|D3DW02	Missense_Mutation	SNP	ENST00000379160.3	37	CCDS13087.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.154282	0.78114	.	.	ENSG00000132646	ENST00000379143;ENST00000379160	.	.	.	5.4	5.4	0.78164	Proliferating cell nuclear antigen, PCNA, C-terminal (1);	0.096296	0.64402	D	0.000001	T	0.74122	0.3675	M	0.84948	2.725	0.80722	D	1	B	0.33280	0.405	B	0.37451	0.25	T	0.76049	-0.3101	9	0.48119	T	0.1	-11.7382	17.7444	0.88416	0.0:0.0:1.0:0.0	.	194	P12004	PCNA_HUMAN	V	194	.	ENSP00000368438:A194V	A	-	2	0	PCNA	5046117	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.683000	0.98657	2.541000	0.85698	0.462000	0.41574	GCT		PCNA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077852.2		Missense_Mutation
CACNA1I	8911	broad.mit.edu	37	22	40068312	40068312	+	Splice_Site	SNP	C	C	T			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr22:40068312C>T	ENST00000402142.3	+	27	4648	c.4648C>T	c.(4648-4650)Cga>Tga	p.R1550*	CACNA1I_ENST00000404898.1_Splice_Site_p.R1515*|CACNA1I_ENST00000336649.4_Splice_Site_p.R1556*|CACNA1I_ENST00000401624.1_Splice_Site_p.R1550*|CACNA1I_ENST00000400164.3_Splice_Site_p.R1515*|CACNA1I_ENST00000407673.1_Splice_Site_p.R1515*	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	1550					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)	p.R1515*(1)		breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	CTTCAAGGACCGGTGAGTGGC	0.542																																					p.R1550X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C4648T	22						.						195.0	195.0	195.0					22																	40068312		2065	4224	6289	38398258	SO:0001630	splice_region_variant	8911	exon27			AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.4649+1C>T	22.37:g.40068312C>T		Somatic		Capture	Illumina HiSeq	Phase_I	38398258	NM_021096	B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Nonsense_Mutation	SNP	ENST00000402142.3	37	CCDS46710.1	.	.	.	.	.	.	.	.	.	.	C	43	10.216233	0.99361	.	.	ENSG00000100346	ENST00000402142;ENST00000404898;ENST00000401624;ENST00000407673;ENST00000336649;ENST00000400164	.	.	.	4.55	0.246	0.15516	.	0.124032	0.64402	D	0.000015	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.367	0.55234	0.736:0.264:0.0:0.0	.	.	.	.	X	1550;1515;1550;1515;1556;1515	.	ENSP00000337829:R1556X	R	+	1	2	CACNA1I	38398258	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.186000	0.50942	0.386000	0.24997	0.655000	0.94253	CGA		CACNA1I-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321290.1	NM_001003406	Nonsense_Mutation
PKDREJ	10343	broad.mit.edu	37	22	46658262	46658262	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr22:46658262C>T	ENST00000253255.5	-	1	957	c.958G>A	c.(958-960)Gag>Aag	p.E320K		NM_006071.1	NP_006062.1	Q9NTG1	PKDRE_HUMAN	polycystin (PKD) family receptor for egg jelly	320	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				acrosome reaction (GO:0007340)|calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|neuropeptide signaling pathway (GO:0007218)|regulation of acrosome reaction (GO:0060046)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)	p.E320K(1)		NS(2)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(4)|kidney(5)|large_intestine(21)|lung(16)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	73		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		TCTTTCACCTCGGGCATCTTG	0.512																																					p.E320K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G958A	22						.						148.0	160.0	156.0					22																	46658262		2203	4300	6503	45036926	SO:0001583	missense	10343	exon1			AF116458	CCDS14073.1	22q13.31	2013-07-31	2013-07-31		ENSG00000130943	ENSG00000130943			9015	protein-coding gene	gene with protein product		604670	"""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like"", ""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like"", ""polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin)"""			9949214, 10591208	Standard	NM_006071		Approved		uc003bhh.3	Q9NTG1	OTTHUMG00000150493	ENST00000253255.5:c.958G>A	22.37:g.46658262C>T	ENSP00000253255:p.Glu320Lys	Somatic		Capture	Illumina HiSeq	Phase_I	45036926	NM_006071	B1AJY3|O95850	Missense_Mutation	SNP	ENST00000253255.5	37	CCDS14073.1	.	.	.	.	.	.	.	.	.	.	C	5.886	0.347580	0.11126	.	.	ENSG00000130943	ENST00000253255	T	0.68765	-0.35	4.16	-8.32	0.00996	Egg jelly receptor, REJ-like (1);PKD/REJ-like protein (1);	5.530480	0.00424	N	0.000075	T	0.43612	0.1255	N	0.22421	0.69	0.09310	N	1	B	0.23591	0.088	B	0.20184	0.028	T	0.46582	-0.9181	10	0.06099	T	0.92	3.0074	7.978	0.30166	0.0922:0.1088:0.5786:0.2204	.	320	Q9NTG1	PKDRE_HUMAN	K	320	ENSP00000253255:E320K	ENSP00000253255:E320K	E	-	1	0	PKDREJ	45036926	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-6.231000	0.00075	-2.145000	0.00801	-0.243000	0.11985	GAG		PKDREJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318466.1	NM_006071	
CERK	64781	broad.mit.edu	37	22	47116881	47116881	+	Silent	SNP	G	G	A			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr22:47116881G>A	ENST00000216264.8	-	2	286	c.174C>T	c.(172-174)atC>atT	p.I58I	CERK_ENST00000541677.1_5'UTR	NM_022766.5	NP_073603.2	Q8TCT0	CERK1_HUMAN	ceramide kinase	58	Required for binding to sulfatide and phosphoinositides.				ceramide metabolic process (GO:0006672)|glycosphingolipid metabolic process (GO:0006687)|lipid phosphorylation (GO:0046834)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ceramide kinase activity (GO:0001729)|diacylglycerol kinase activity (GO:0004143)|magnesium ion binding (GO:0000287)|NAD+ kinase activity (GO:0003951)	p.I58I(1)		cervix(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(2)|skin(2)	20		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)|BRCA - Breast invasive adenocarcinoma(115;0.171)		CCTCAACGGCGATGATCTCAG	0.448																																					p.I58I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C174T	22						.						195.0	176.0	182.0					22																	47116881		2203	4300	6503	45495545	SO:0001819	synonymous_variant	64781	exon2			AB079066	CCDS14077.1	22q13.31	2008-06-10			ENSG00000100422	ENSG00000100422			19256	protein-coding gene	gene with protein product		610307				11956206, 11258795	Standard	NM_022766		Approved	hCERK, FLJ23239, dA59H18.3, DKFZp434E0211, FLJ21430, KIAA1646, LK4, dA59H18.2	uc003bia.3	Q8TCT0	OTTHUMG00000150395	ENST00000216264.8:c.174C>T	22.37:g.47116881G>A		Somatic		Capture	Illumina HiSeq	Phase_I	45495545	NM_022766	A0JNT4|A8K611|Q6NX59|Q9BYB3|Q9UGE5	Silent	SNP	ENST00000216264.8	37	CCDS14077.1																																																																																				CERK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317924.2	NM_022766	
STAT1	6772	broad.mit.edu	37	2	191847187	191847187	+	Silent	SNP	G	G	A			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr2:191847187G>A	ENST00000361099.3	-	18	1891	c.1504C>T	c.(1504-1506)Ctg>Ttg	p.L502L	STAT1_ENST00000392323.2_Silent_p.L504L|STAT1_ENST00000392322.3_Silent_p.L502L|STAT1_ENST00000540176.1_3'UTR|STAT1_ENST00000409465.1_Silent_p.L502L	NM_007315.3	NP_009330.1	P42224	STAT1_HUMAN	signal transducer and activator of transcription 1, 91kDa	502					apoptotic process (GO:0006915)|blood circulation (GO:0008015)|cellular response to insulin stimulus (GO:0032869)|cellular response to interferon-beta (GO:0035458)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of macrophage fusion (GO:0034240)|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003340)|negative regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|renal tubule development (GO:0061326)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|tumor necrosis factor receptor binding (GO:0005164)	p.L502L(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)			TGCCAACTCAGCACTTCTGAA	0.438																																					p.L502L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1504T	2						.						109.0	110.0	110.0					2																	191847187		2203	4300	6503	191555432	SO:0001819	synonymous_variant	6772	exon18				CCDS2309.1, CCDS42793.1	2q32.2-q32.3	2014-09-17	2002-08-29		ENSG00000115415	ENSG00000115415		"""SH2 domain containing"""	11362	protein-coding gene	gene with protein product	"""transcription factor ISGF-3 components p91/p84"""	600555	"""signal transducer and activator of transcription 1, 91kD"""			7885841	Standard	NM_139266		Approved	STAT91, ISGF-3	uc002usj.2	P42224	OTTHUMG00000132699	ENST00000361099.3:c.1504C>T	2.37:g.191847187G>A		Somatic		Capture	Illumina HiSeq	Phase_I	191555432	NM_007315	A8K989|B2RCA0|D2KFR8|D3DPI7|Q53S88|Q53XW4|Q68D00|Q9UDL5	Silent	SNP	ENST00000361099.3	37	CCDS2309.1																																																																																				STAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255997.3	NM_007315	
CCDC108	255101	broad.mit.edu	37	2	219884355	219884355	+	Missense_Mutation	SNP	T	T	C	rs34309488		TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr2:219884355T>C	ENST00000341552.5	-	20	3429	c.3346A>G	c.(3346-3348)Atg>Gtg	p.M1116V	CCDC108_ENST00000453220.1_Missense_Mutation_p.M1116V|CCDC108_ENST00000441968.1_Missense_Mutation_p.M1116V	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	1116						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)	p.M1116V(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GCACTGCCCATGGAGCTGACA	0.607																																					p.M1116V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3346G	2						.						46.0	47.0	47.0					2																	219884355		2203	4300	6503	219592599	SO:0001583	missense	255101	exon20			NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.3346A>G	2.37:g.219884355T>C	ENSP00000340776:p.Met1116Val	Somatic		Capture	Illumina HiSeq	Phase_I	219592599	NM_194302	A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Missense_Mutation	SNP	ENST00000341552.5	37	CCDS2430.2	.	.	.	.	.	.	.	.	.	.	T	2.437	-0.329523	0.05314	.	.	ENSG00000181378	ENST00000341552;ENST00000441968;ENST00000453220	T;T;T	0.04551	3.6;3.6;3.6	5.04	2.56	0.30785	.	0.109085	0.41194	D	0.000934	T	0.04679	0.0127	M	0.63428	1.95	0.31182	N	0.701921	B	0.23591	0.088	B	0.21360	0.034	T	0.26360	-1.0105	10	0.18710	T	0.47	-30.8964	1.9663	0.03396	0.1345:0.1408:0.14:0.5848	.	1116	Q6ZU64	CC108_HUMAN	V	1116	ENSP00000340776:M1116V;ENSP00000413377:M1116V;ENSP00000409117:M1116V	ENSP00000340776:M1116V	M	-	1	0	CCDC108	219592599	0.345000	0.24835	0.998000	0.56505	0.974000	0.67602	-0.211000	0.09332	0.353000	0.24079	0.459000	0.35465	ATG		CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256598.4	NM_194302	
CEBPZ	10153	broad.mit.edu	37	2	37455864	37455864	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr2:37455864T>C	ENST00000234170.5	-	2	617	c.472A>G	c.(472-474)Aaa>Gaa	p.K158E	NDUFAF7_ENST00000002125.4_5'Flank|NDUFAF7_ENST00000336237.6_5'Flank	NM_005760.2	NP_005751.2	Q03701	CEBPZ_HUMAN	CCAAT/enhancer binding protein (C/EBP), zeta	158					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.K158E(1)		breast(3)|endometrium(2)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28		all_hematologic(82;0.21)				TTCTTTACTTTCGGTGTGGTA	0.363																																					p.K158E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A472G	2						.						136.0	133.0	134.0					2																	37455864		2203	4300	6503	37309368	SO:0001583	missense	10153	exon2			M37197	CCDS1787.1	2p22.3	2008-09-03	2008-09-03		ENSG00000115816	ENSG00000115816			24218	protein-coding gene	gene with protein product		612828				2247079, 12534345	Standard	NM_005760		Approved	CBF2, CTF2	uc002rpz.3	Q03701	OTTHUMG00000100960	ENST00000234170.5:c.472A>G	2.37:g.37455864T>C	ENSP00000234170:p.Lys158Glu	Somatic		Capture	Illumina HiSeq	Phase_I	37309368	NM_005760	Q8NE75	Missense_Mutation	SNP	ENST00000234170.5	37	CCDS1787.1	.	.	.	.	.	.	.	.	.	.	T	2.827	-0.243606	0.05906	.	.	ENSG00000115816	ENST00000234170;ENST00000545744;ENST00000446769	T;T	0.02369	4.32;4.32	5.38	1.17	0.20885	.	0.520968	0.21214	N	0.078257	T	0.03220	0.0094	L	0.53249	1.67	0.09310	N	0.999999	B	0.15719	0.014	B	0.12156	0.007	T	0.36407	-0.9749	10	0.46703	T	0.11	.	5.3796	0.16183	0.0:0.2278:0.1505:0.6217	.	158	Q03701	CEBPZ_HUMAN	E	158;158;109	ENSP00000234170:K158E;ENSP00000391881:K109E	ENSP00000234170:K158E	K	-	1	0	CEBPZ	37309368	0.001000	0.12720	0.028000	0.17463	0.168000	0.22595	0.551000	0.23361	0.328000	0.23435	0.533000	0.62120	AAA		CEBPZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218569.2	NM_005760	
PRKCE	5581	broad.mit.edu	37	2	46203604	46203604	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr2:46203604G>A	ENST00000306156.3	+	3	776	c.449G>A	c.(448-450)cGc>cAc	p.R150H		NM_005400.2	NP_005391.1	Q02156	KPCE_HUMAN	protein kinase C, epsilon	150					activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to ethanol (GO:0071361)|cellular response to hypoxia (GO:0071456)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|locomotory exploration behavior (GO:0035641)|macrophage activation involved in immune response (GO:0002281)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cellular glucuronidation (GO:2001031)|positive regulation of cytokinesis (GO:0032467)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of insulin secretion (GO:0032024)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|release of sequestered calcium ion into cytosol (GO:0051209)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|TRAM-dependent toll-like receptor 4 signaling pathway (GO:0035669)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|ethanol binding (GO:0035276)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|receptor activator activity (GO:0030546)|signal transducer activity (GO:0004871)	p.R150H(2)	MBOAT2/PRKCE(2)	breast(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(13)|ovary(3)|upper_aerodigestive_tract(2)	34		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)		Tamoxifen(DB00675)	TTCAGGGAACGCATGCGGCCG	0.587																																					p.R150H												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G449A	2						.						65.0	74.0	71.0					2																	46203604		2171	4272	6443	46057108	SO:0001583	missense	5581	exon3				CCDS1824.1	2p21	2009-07-10			ENSG00000171132	ENSG00000171132	2.7.11.1		9401	protein-coding gene	gene with protein product		176975				1382605, 7877991	Standard	NM_005400		Approved		uc002rut.3	Q02156	OTTHUMG00000128817	ENST00000306156.3:c.449G>A	2.37:g.46203604G>A	ENSP00000306124:p.Arg150His	Somatic		Capture	Illumina HiSeq	Phase_I	46057108	NM_005400	B0LPH7|Q32MQ3|Q53SL4|Q53SM5|Q9UE81	Missense_Mutation	SNP	ENST00000306156.3	37	CCDS1824.1	.	.	.	.	.	.	.	.	.	.	G	19.84	3.902286	0.72754	.	.	ENSG00000171132	ENST00000306156	D	0.84873	-1.91	4.33	4.33	0.51752	.	0.066579	0.64402	D	0.000011	D	0.82898	0.5137	L	0.58101	1.795	0.80722	D	1	B	0.26775	0.159	B	0.21917	0.037	T	0.81814	-0.0760	10	0.45353	T	0.12	.	17.3732	0.87384	0.0:0.0:1.0:0.0	.	150	Q02156	KPCE_HUMAN	H	150	ENSP00000306124:R150H	ENSP00000306124:R150H	R	+	2	0	PRKCE	46057108	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.537000	0.98070	2.388000	0.81334	0.563000	0.77884	CGC		PRKCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250751.2		
BCL11A	53335	broad.mit.edu	37	2	60687864	60687864	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr2:60687864G>A	ENST00000335712.6	-	4	2410	c.2183C>T	c.(2182-2184)cCg>cTg	p.P728L	BCL11A_ENST00000537768.1_Missense_Mutation_p.P397L|BCL11A_ENST00000359629.5_Intron|BCL11A_ENST00000538214.1_Missense_Mutation_p.P694L|BCL11A_ENST00000358510.4_Missense_Mutation_p.P694L|BCL11A_ENST00000477659.1_5'UTR|BCL11A_ENST00000356842.4_Missense_Mutation_p.P728L	NM_022893.3	NP_075044.2	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A (zinc finger protein)	728					B cell differentiation (GO:0030183)|negative regulation of axon extension (GO:0030517)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|negative regulation of protein homooligomerization (GO:0032463)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of dendrite development (GO:0050773)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)	p.P728L(2)		NS(1)|breast(6)|central_nervous_system(6)|endometrium(4)|kidney(1)|large_intestine(8)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	59			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			GCCCGGGCCCGGACCACTAAT	0.627			T	IGH@	B-CLL																																p.P728L			Dom	yes		2	2p13	53335	B-cell CLL/lymphoma 11A		L	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2183T	2						.						57.0	63.0	61.0					2																	60687864		2203	4300	6503	60541368	SO:0001583	missense	53335	exon4			AJ404611	CCDS1861.1, CCDS1862.1, CCDS46295.1	2p16.1	2013-01-08	2002-05-08		ENSG00000119866	ENSG00000119866		"""Zinc fingers, C2H2-type"""	13221	protein-coding gene	gene with protein product		606557	"""ecotropic viral integration site 9"""	EVI9		11719382, 18245381	Standard	NM_018014		Approved	BCL11A-XL, BCL11A-L, BCL11A-S, CTIP1, HBFQTL5, ZNF856	uc002sae.1	Q9H165	OTTHUMG00000129420	ENST00000335712.6:c.2183C>T	2.37:g.60687864G>A	ENSP00000338774:p.Pro728Leu	Somatic		Capture	Illumina HiSeq	Phase_I	60541368	NM_022893	D6W5D7|Q86W14|Q8WU92|Q96JL6|Q9H163|Q9H164|Q9H3G9|Q9NWA7	Missense_Mutation	SNP	ENST00000335712.6	37	CCDS1862.1	.	.	.	.	.	.	.	.	.	.	G	12.84	2.057150	0.36277	.	.	ENSG00000119866	ENST00000356842;ENST00000378117;ENST00000538214;ENST00000537768;ENST00000335712;ENST00000358510	T;T;T;T;T	0.11169	2.8;3.13;2.8;3.16;3.07	5.93	5.93	0.95920	.	0.159701	0.45126	D	0.000387	T	0.28699	0.0711	L	0.43923	1.385	0.80722	D	1	D;P;P;D;D	0.89917	1.0;0.907;0.851;0.995;0.999	D;B;B;P;P	0.91635	0.999;0.216;0.388;0.663;0.866	T	0.00083	-1.2103	10	0.40728	T	0.16	-2.3782	20.3311	0.98718	0.0:0.0:1.0:0.0	.	694;397;694;728;728	F5H2Y4;B4DT16;Q9H165-6;Q9H165;D9YZV9	.;.;.;BC11A_HUMAN;.	L	728;753;694;397;728;694	ENSP00000349300:P728L;ENSP00000438303:P694L;ENSP00000443712:P397L;ENSP00000338774:P728L;ENSP00000351307:P694L	ENSP00000338774:P728L	P	-	2	0	BCL11A	60541368	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	6.582000	0.74049	2.797000	0.96272	0.655000	0.94253	CCG		BCL11A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251579.2	NM_022893	
MEIS1	4211	broad.mit.edu	37	2	66664881	66664881	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr2:66664881C>T	ENST00000272369.9	+	2	482	c.25C>T	c.(25-27)Ccc>Tcc	p.P9S	MEIS1_ENST00000444274.2_5'Flank|MEIS1_ENST00000407092.2_Missense_Mutation_p.P9S|MEIS1-AS1_ENST00000454595.1_RNA|MEIS1_ENST00000488550.1_Missense_Mutation_p.P9S|MEIS1_ENST00000398506.2_Missense_Mutation_p.P7S|MEIS1_ENST00000495021.2_5'Flank|MEIS1-AS2_ENST00000439433.1_RNA|MEIS1_ENST00000560281.2_Missense_Mutation_p.P9S	NM_002398.2	NP_002389.1	O00470	MEIS1_HUMAN	Meis homeobox 1	9					angiogenesis (GO:0001525)|definitive hemopoiesis (GO:0060216)|lens morphogenesis in camera-type eye (GO:0002089)|megakaryocyte development (GO:0035855)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron differentiation (GO:0045665)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)	p.P9S(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(10)|prostate(2)|skin(1)|urinary_tract(1)	24						CGACGATCTACCCCATTACGG	0.577																																					p.P9S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C25T	2						.						46.0	45.0	46.0					2																	66664881		2004	4182	6186	66518385	SO:0001583	missense	4211	exon2				CCDS46309.1	2p14	2011-06-20	2007-02-15		ENSG00000143995	ENSG00000143995		"""Homeoboxes / TALE class"""	7000	protein-coding gene	gene with protein product		601739	"""Meis1 (mouse) homolog"", ""Meis1, myeloid ecotropic viral integration site 1 homolog (mouse)"""			7565694	Standard	NM_002398		Approved		uc002sdu.3	O00470	OTTHUMG00000150714	ENST00000272369.9:c.25C>T	2.37:g.66664881C>T	ENSP00000272369:p.Pro9Ser	Somatic		Capture	Illumina HiSeq	Phase_I	66518385	NM_002398	A8MV50	Missense_Mutation	SNP	ENST00000272369.9	37	CCDS46309.1	.	.	.	.	.	.	.	.	.	.	C	15.98	2.992862	0.54041	.	.	ENSG00000143995	ENST00000272369;ENST00000407092;ENST00000398506	T;T;T	0.28069	1.63;1.63;1.63	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.36908	0.0984	L	0.58101	1.795	0.80722	D	1	B;B;B	0.15930	0.015;0.001;0.008	B;B;B	0.21917	0.037;0.004;0.037	T	0.13388	-1.0511	10	0.56958	D	0.05	.	19.3962	0.94608	0.0:1.0:0.0:0.0	.	7;9;9	O00470-2;O00470;F8W8U3	.;MEIS1_HUMAN;.	S	9;9;7	ENSP00000272369:P9S;ENSP00000384461:P9S;ENSP00000381518:P7S	ENSP00000272369:P9S	P	+	1	0	MEIS1	66518385	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.383000	0.59600	2.746000	0.94184	0.655000	0.94253	CCC		MEIS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319725.4	NM_002398	
SP140	11262	broad.mit.edu	37	2	231150495	231150495	+	Silent	SNP	C	C	A			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr2:231150495C>A	ENST00000392045.3	+	17	1707	c.1593C>A	c.(1591-1593)gtC>gtA	p.V531V	SP140_ENST00000420434.3_Silent_p.V504V|SP140_ENST00000417495.3_Silent_p.V417V|SP140_ENST00000350136.5_Silent_p.V400V|SP140_ENST00000343805.6_Silent_p.V471V|SP140_ENST00000486687.2_Silent_p.V455V	NM_007237.4	NP_009168.4	Q13342	SP140_HUMAN	SP140 nuclear body protein	531					defense response (GO:0006952)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.V531V(1)		NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		GCCAGGTGGTCTCCAGTGAAA	0.468																																					p.V531V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1593A	2						.						160.0	159.0	159.0					2																	231150495		1871	4100	5971	230858739	SO:0001819	synonymous_variant	11262	exon17			U63420	CCDS33392.1, CCDS42831.1, CCDS63149.1, CCDS63150.1, CCDS63151.1	2q37.1	2013-01-28			ENSG00000079263	ENSG00000079263		"""Zinc fingers, PHD-type"""	17133	protein-coding gene	gene with protein product		608602				8695863, 8910577, 12368356	Standard	NM_001005176		Approved	LYSP100-B, LYSP100-A	uc002vql.3	Q13342	OTTHUMG00000153670	ENST00000392045.3:c.1593C>A	2.37:g.231150495C>A		Somatic		Capture	Illumina HiSeq	Phase_I	230858739	NM_007237	E7ESH9|E7EUR5|E9PFJ6|Q0VGE5|Q13341|Q3KR17|Q4ZG66|Q53TG1|Q6NSG4|Q92881|Q96TG3	Silent	SNP	ENST00000392045.3	37	CCDS42831.1																																																																																				SP140-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000332015.1	NM_007237	
BCL6	604	broad.mit.edu	37	3	187446269	187446270	+	Frame_Shift_Ins	INS	-	-	G	rs149258247		TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr3:187446269_187446270insG	ENST00000406870.2	-	6	1784_1785	c.1418_1419insC	c.(1417-1419)ccgfs	p.P473fs	RP11-211G3.3_ENST00000437407.1_Intron|BCL6_ENST00000232014.4_Frame_Shift_Ins_p.P473fs|RP11-211G3.3_ENST00000449623.1_Intron|BCL6_ENST00000450123.2_Frame_Shift_Ins_p.P473fs	NM_001706.4	NP_001697.2	P41182	BCL6_HUMAN	B-cell CLL/lymphoma 6	473					actin cytoskeleton organization (GO:0030036)|B cell differentiation (GO:0030183)|cell morphogenesis (GO:0000902)|cellular response to DNA damage stimulus (GO:0006974)|erythrocyte development (GO:0048821)|germinal center formation (GO:0002467)|inflammatory response (GO:0006954)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of mast cell cytokine production (GO:0032764)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cellular component movement (GO:0051272)|protein import into nucleus, translocation (GO:0000060)|regulation of germinal center formation (GO:0002634)|regulation of immune response (GO:0050776)|regulation of inflammatory response (GO:0050727)|regulation of memory T cell differentiation (GO:0043380)|regulation of Rho GTPase activity (GO:0032319)|Rho protein signal transduction (GO:0007266)|spermatogenesis (GO:0007283)|type 2 immune response (GO:0042092)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P473L(1)|p.K474fs*26(1)		central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(9)|lung(10)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	40	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)		ACGTGCACTTCGGGGGGTGCAT	0.629			"""T, Mis"""	"""IG loci, ZNFN1A1, LCP1, PIM1, TFRC, CIITA, NACA, HSPCB, HSPCA, HIST1H4I, IL21R,  POU2AF1, ARHH, EIF4A2, SFRS3"""	"""NHL, CLL"""																																p.P473fs			Dom	yes		3	3q27	604	B-cell CLL/lymphoma 6		L	.	.	2	Substitution - Missense(1)|Insertion - Frameshift(1)	large_intestine(2)	c.1419_1420insC	3						.																																			188928964	SO:0001589	frameshift_variant	604	exon6				CCDS3289.1, CCDS46975.1	3q27	2013-01-09	2008-08-01		ENSG00000113916	ENSG00000113916		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1001	protein-coding gene	gene with protein product		109565	"""zinc finger protein 51"""	ZNF51			Standard	NM_001130845		Approved	ZBTB27, LAZ3, BCL5, BCL6A	uc003frq.2	P41182	OTTHUMG00000156441	ENST00000406870.2:c.1419dupC	3.37:g.187446275_187446275dupG	ENSP00000384371:p.Pro473fs	Somatic		Capture	Illumina HiSeq	Phase_I	188928963	NM_001130845	A7E241|B8PSA7|D3DNV5	Frame_Shift_Ins	INS	ENST00000406870.2	37	CCDS3289.1																																																																																				BCL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344202.1	NM_138931	
GRM7	2917	broad.mit.edu	37	3	7456754	7456754	+	Silent	SNP	A	A	C			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr3:7456754A>C	ENST00000357716.4	+	5	1352	c.1078A>C	c.(1078-1080)Aga>Cga	p.R360R	GRM7_ENST00000389336.4_Silent_p.R360R|GRM7_ENST00000486284.1_Silent_p.R360R|GRM7_ENST00000402647.2_Silent_p.R360R|GRM7_ENST00000403881.1_Silent_p.R360R	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7	360					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)	p.R360R(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						AAACAACAGAAGAAATGTATG	0.428																																					p.R360R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1078C	3						.						91.0	84.0	86.0					3																	7456754		2203	4300	6503	7431754	SO:0001819	synonymous_variant	2917	exon5			U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.1078A>C	3.37:g.7456754A>C		Somatic		Capture	Illumina HiSeq	Phase_I	7431754	NM_000844	Q8NFS2|Q8NFS3|Q8NFS4	Silent	SNP	ENST00000357716.4	37	CCDS43042.1																																																																																				GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246895.3	NM_000844	
NR2C2	7182	broad.mit.edu	37	3	15062401	15062401	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr3:15062401G>A	ENST00000425241.1	+	5	880	c.518G>A	c.(517-519)cGg>cAg	p.R173Q	NR2C2_ENST00000323373.6_Missense_Mutation_p.R192Q|NR2C2_ENST00000393102.3_Missense_Mutation_p.R173Q|NR2C2_ENST00000406272.2_Missense_Mutation_p.R173Q			P49116	NR2C2_HUMAN	nuclear receptor subfamily 2, group C, member 2	173					cell differentiation (GO:0030154)|gene expression (GO:0010467)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.R192Q(1)		breast(1)|endometrium(2)|large_intestine(5)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						CAGTTTTGCCGGCTGAAAAAA	0.413																																					p.R192Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G575A	3						.						92.0	88.0	89.0					3																	15062401		2203	4300	6503	15037405	SO:0001583	missense	7182	exon6			L27586	CCDS2621.1, CCDS74905.1	3p25	2013-01-16			ENSG00000177463	ENSG00000177463		"""Nuclear hormone receptors"""	7972	protein-coding gene	gene with protein product		601426		TR4		8661150, 8016112	Standard	XM_005265428		Approved	TAK1, TR2R1, hTAK1	uc003bzi.3	P49116	OTTHUMG00000129839	ENST00000425241.1:c.518G>A	3.37:g.15062401G>A	ENSP00000388387:p.Arg173Gln	Somatic		Capture	Illumina HiSeq	Phase_I	15037405	NM_003298	A8K3H5|B6ZGT8|P55092	Missense_Mutation	SNP	ENST00000425241.1	37		.	.	.	.	.	.	.	.	.	.	G	35	5.535107	0.96460	.	.	ENSG00000177463	ENST00000425241;ENST00000323373;ENST00000393102;ENST00000437120;ENST00000406272	D;D;D;D;D	0.98550	-4.99;-4.99;-4.99;-4.99;-4.99	5.78	4.9	0.64082	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (4);	0.000000	0.85682	D	0.000000	D	0.99456	0.9807	H	0.98936	4.375	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.97110	1.0;0.992	D	0.97910	1.0308	10	0.87932	D	0	.	17.2309	0.86984	0.0:0.1259:0.8741:0.0	.	173;192	P49116;F2YGU2	NR2C2_HUMAN;.	Q	173;192;173;192;173	ENSP00000388387:R173Q;ENSP00000320447:R192Q;ENSP00000376814:R173Q;ENSP00000401807:R192Q;ENSP00000384463:R173Q	ENSP00000320447:R192Q	R	+	2	0	NR2C2	15037405	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.773000	0.98989	1.574000	0.49760	0.591000	0.81541	CGG		NR2C2-002	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000340729.1	NM_003298	
EPHA3	2042	broad.mit.edu	37	3	89259350	89259350	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr3:89259350A>G	ENST00000336596.2	+	3	719	c.494A>G	c.(493-495)aAc>aGc	p.N165S	EPHA3_ENST00000452448.2_Missense_Mutation_p.N165S|EPHA3_ENST00000494014.1_Missense_Mutation_p.N165S	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	165	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)	p.N165S(2)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		CTGAAGCTCAACACTGAGATT	0.423										TSP Lung(6;0.00050)																											p.N165S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A494G	3						.						157.0	136.0	143.0					3																	89259350		2203	4300	6503	89342040	SO:0001583	missense	2042	exon3			M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.494A>G	3.37:g.89259350A>G	ENSP00000337451:p.Asn165Ser	Somatic		Capture	Illumina HiSeq	Phase_I	89342040	NM_005233	Q9H2V3|Q9H2V4	Missense_Mutation	SNP	ENST00000336596.2	37	CCDS2922.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.289082	0.80914	.	.	ENSG00000044524	ENST00000336596;ENST00000452448;ENST00000494014	T;T;T	0.06449	3.3;3.3;3.3	5.92	5.92	0.95590	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	T	0.31979	0.0814	M	0.88241	2.94	0.80722	D	1	D;D	0.89917	0.992;1.0	D;D	0.97110	0.987;1.0	T	0.13872	-1.0493	9	.	.	.	.	16.3678	0.83341	1.0:0.0:0.0:0.0	.	165;165	P29320;P29320-2	EPHA3_HUMAN;.	S	165	ENSP00000337451:N165S;ENSP00000399926:N165S;ENSP00000419190:N165S	.	N	+	2	0	EPHA3	89342040	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.339000	0.96797	2.254000	0.74563	0.528000	0.53228	AAC		EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233	
EPHA5	2044	broad.mit.edu	37	4	66286237	66286238	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr4:66286237_66286238insT	ENST00000273854.3	-	6	2048_2049	c.1448_1449insA	c.(1447-1449)aacfs	p.N483fs	EPHA5_ENST00000432638.2_Frame_Shift_Ins_p.N319fs|EPHA5_ENST00000511294.1_Frame_Shift_Ins_p.N483fs|EPHA5_ENST00000354839.4_Frame_Shift_Ins_p.N483fs	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	483	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)	p.N483S(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						AAGAGATGCTGTTTTTTGCAAT	0.347										TSP Lung(17;0.13)																											p.N483fs												.	.	1	Substitution - Missense(1)	endometrium(1)	c.1449_1450insA	4						.																																			65968833	SO:0001589	frameshift_variant	2044	exon6			L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.1449dupA	4.37:g.66286243_66286243dupT	ENSP00000273854:p.Asn483fs	None		Capture	Illumina HiSeq	Phase_I	65968832	NM_004439	Q7Z3F2	Frame_Shift_Ins	INS	ENST00000273854.3	37	CCDS3513.1																																																																																				EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439	
BOD1L1	259282	broad.mit.edu	37	4	13578551	13578551	+	Silent	SNP	C	C	T			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr4:13578551C>T	ENST00000040738.5	-	25	9084	c.8949G>A	c.(8947-8949)gaG>gaA	p.E2983E		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	2983						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.E2983E(1)									cagactcctgctctttcttgt	0.488																																					p.E2983E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G8949A	4						.						157.0	145.0	149.0					4																	13578551		2203	4300	6503	13187649	SO:0001819	synonymous_variant	259282	exon25			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.8949G>A	4.37:g.13578551C>T		Somatic		Capture	Illumina HiSeq	Phase_I	13187649	NM_148894	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Silent	SNP	ENST00000040738.5	37	CCDS3411.2	.	.	.	.	.	.	.	.	.	.	C	5.588	0.293212	0.10567	.	.	ENSG00000038219	ENST00000507943	.	.	.	5.67	1.3	0.21679	.	.	.	.	.	T	0.54240	0.1846	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43196	-0.9406	4	.	.	.	-3.4885	7.0803	0.25227	0.1845:0.4162:0.3992:0.0	.	.	.	.	N	92	.	.	S	-	2	0	BOD1L	13187649	0.980000	0.34600	1.000000	0.80357	0.689000	0.40095	-0.030000	0.12308	0.185000	0.20105	-0.868000	0.02995	AGC		BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894	
CTNND2	1501	broad.mit.edu	37	5	11111106	11111106	+	Missense_Mutation	SNP	G	G	A	rs200147870		TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr5:11111106G>A	ENST00000304623.8	-	14	2516	c.2327C>T	c.(2326-2328)gCg>gTg	p.A776V	CTNND2_ENST00000511377.1_Missense_Mutation_p.A685V|CTNND2_ENST00000359640.2_Missense_Mutation_p.A776V|CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000458100.2_Missense_Mutation_p.A343V|CTNND2_ENST00000503622.1_Missense_Mutation_p.A439V	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	776					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.A776V(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						CGTTTCTGCCGCCAGCCGGTA	0.552													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17316	0.0		0.0	False		,,,				2504	0.0				p.A776V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2327T	5						.						93.0	97.0	95.0					5																	11111106		2203	4300	6503	11164106	SO:0001583	missense	1501	exon14			U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.2327C>T	5.37:g.11111106G>A	ENSP00000307134:p.Ala776Val	Somatic		Capture	Illumina HiSeq	Phase_I	11164106	NM_001332	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	ENST00000304623.8	37	CCDS3881.1	.	.	.	.	.	.	.	.	.	.	G	35	5.544637	0.96488	.	.	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000511377;ENST00000458100;ENST00000503622	T;T;T;T;T	0.50277	0.75;0.75;0.75;0.75;0.75	5.72	5.72	0.89469	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.61974	0.2390	L	0.47716	1.5	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	P;P;P	0.60949	0.881;0.881;0.881	T	0.61917	-0.6964	10	0.62326	D	0.03	-13.6918	19.8968	0.96969	0.0:0.0:1.0:0.0	.	439;343;776	B4DRK2;B4DG58;Q9UQB3	.;.;CTND2_HUMAN	V	776;776;685;343;439	ENSP00000307134:A776V;ENSP00000352661:A776V;ENSP00000426510:A685V;ENSP00000391155:A343V;ENSP00000426887:A439V	ENSP00000307134:A776V	A	-	2	0	CTNND2	11164106	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.476000	0.97823	2.691000	0.91804	0.655000	0.94253	GCG		CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332	
PAM	5066	broad.mit.edu	37	5	102260707	102260707	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr5:102260707G>A	ENST00000438793.3	+	5	873	c.403G>A	c.(403-405)Gcc>Acc	p.A135T	PAM_ENST00000304400.7_Missense_Mutation_p.A135T|PAM_ENST00000379787.4_5'UTR|PAM_ENST00000274392.9_Missense_Mutation_p.A38T|PAM_ENST00000348126.2_Missense_Mutation_p.A135T|PAM_ENST00000455264.2_Missense_Mutation_p.A135T|PAM_ENST00000346918.2_Missense_Mutation_p.A135T	NM_000919.3|NM_001177306.1|NM_138766.2	NP_000910.2|NP_001170777.1|NP_620121.1	P19021	AMD_HUMAN	peptidylglycine alpha-amidating monooxygenase	135	Peptidylglycine alpha-hydroxylating monooxygenase. {ECO:0000250}.				central nervous system development (GO:0007417)|heart development (GO:0007507)|lactation (GO:0007595)|limb development (GO:0060173)|long-chain fatty acid metabolic process (GO:0001676)|maternal process involved in female pregnancy (GO:0060135)|odontogenesis (GO:0042476)|ovulation cycle process (GO:0022602)|peptide amidation (GO:0001519)|protein amidation (GO:0018032)|protein homooligomerization (GO:0051260)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of protein secretion (GO:0050708)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to pH (GO:0009268)|toxin metabolic process (GO:0009404)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network (GO:0005802)	calcium ion binding (GO:0005509)|copper ion binding (GO:0005507)|L-ascorbic acid binding (GO:0031418)|peptidylamidoglycolate lyase activity (GO:0004598)|peptidylglycine monooxygenase activity (GO:0004504)|zinc ion binding (GO:0008270)	p.A135T(2)		endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	25		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)	TATTCTGTATGCCTGGGCGAG	0.398																																					p.A135T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G403A	5						.						92.0	102.0	98.0					5																	102260707		2203	4300	6503	102288606	SO:0001583	missense	5066	exon5			AB095007	CCDS4092.1, CCDS4093.1, CCDS4094.1, CCDS43348.1, CCDS54885.1	5q	2008-02-05			ENSG00000145730	ENSG00000145730	1.14.17.3		8596	protein-coding gene	gene with protein product	"""peptidyl-alpha-hydroxyglycine alpha-amidating lyase"", ""peptidylglycine alpha-hydroxylating monooxygenase"""	170270				2357221	Standard	NM_000919		Approved	PAL, PHM	uc003knt.3	P19021	OTTHUMG00000128729	ENST00000438793.3:c.403G>A	5.37:g.102260707G>A	ENSP00000396493:p.Ala135Thr	Somatic		Capture	Illumina HiSeq	Phase_I	102288606	NM_138822	A6NMR0|A8K293|O43211|O95080|Q16252|Q16253|Q54A45|Q86U53|Q8WVC7|Q9UCG0	Missense_Mutation	SNP	ENST00000438793.3	37	CCDS54885.1	.	.	.	.	.	.	.	.	.	.	G	15.06	2.721118	0.48728	.	.	ENSG00000145730	ENST00000438793;ENST00000346918;ENST00000348126;ENST00000304400;ENST00000274392;ENST00000455264	T;T;T;T;T;T	0.37411	1.2;1.2;1.2;1.2;1.2;1.2	5.67	5.67	0.87782	Copper type II, ascorbate-dependent monooxygenase, N-terminal (2);PHM/PNGase F domain (1);	0.095498	0.64402	D	0.000001	T	0.67887	0.2941	M	0.90252	3.1	0.80722	D	1	D;D;D;D;D;D	0.89917	0.996;0.996;0.997;0.997;0.996;1.0	D;D;D;D;D;D	0.79108	0.938;0.972;0.96;0.971;0.952;0.992	T	0.73911	-0.3833	10	0.87932	D	0	.	17.0417	0.86491	0.0:0.0:1.0:0.0	.	38;135;135;135;135;135	F8WE90;P19021;P19021-4;P19021-3;P19021-5;P19021-2	.;AMD_HUMAN;.;.;.;.	T	135;135;135;135;38;135	ENSP00000396493:A135T;ENSP00000282992:A135T;ENSP00000314638:A135T;ENSP00000306100:A135T;ENSP00000274392:A38T;ENSP00000403461:A135T	ENSP00000274392:A38T	A	+	1	0	PAM	102288606	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.924000	0.75823	2.839000	0.97877	0.655000	0.94253	GCC		PAM-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250640.2	NM_000919	
APC	324	broad.mit.edu	37	5	112174112	112174112	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr5:112174112G>T	ENST00000457016.1	+	16	3201	c.2821G>T	c.(2821-2823)Gaa>Taa	p.E941*	APC_ENST00000508376.2_Nonsense_Mutation_p.E941*|APC_ENST00000257430.4_Nonsense_Mutation_p.E941*|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	941	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.E941*(2)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		CACTAAGTCGGAAAATTCAAA	0.358		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.E923X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,stomach,NS,Substitution - Nonsense,+2 	.	3	Substitution - Nonsense(2)|Unknown(1)	large_intestine(2)|skin(1)	c.G2767T	5						.						67.0	69.0	68.0					5																	112174112		2202	4300	6502	112202011	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2821G>T	5.37:g.112174112G>T	ENSP00000413133:p.Glu941*	Somatic		Capture	Illumina HiSeq	Phase_I	112202011	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	G	38	6.655375	0.97739	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.77	5.77	0.91146	.	0.202408	0.43919	D	0.000509	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-15.8963	19.9941	0.97377	0.0:0.0:1.0:0.0	.	.	.	.	X	941;923;941;941;941	.	ENSP00000257430:E941X	E	+	1	0	APC	112202011	1.000000	0.71417	1.000000	0.80357	0.800000	0.45204	9.353000	0.97080	2.729000	0.93468	0.557000	0.71058	GAA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
PCDHGA1	56114	broad.mit.edu	37	5	140712390	140712390	+	Silent	SNP	G	G	A			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr5:140712390G>A	ENST00000517417.1	+	1	2139	c.2139G>A	c.(2137-2139)gcG>gcA	p.A713A	PCDHGA1_ENST00000378105.3_Silent_p.A713A	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	713					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A713A(2)		breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCTGCTGGCGCACAGGCTGC	0.662																																					p.A713A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G2139A	5						.						65.0	73.0	70.0					5																	140712390		2203	4300	6503	140692574	SO:0001819	synonymous_variant	56114	exon1			AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.2139G>A	5.37:g.140712390G>A		Somatic		Capture	Illumina HiSeq	Phase_I	140692574	NM_031993	Q2M273|Q9Y5D6	Silent	SNP	ENST00000517417.1	37	CCDS54922.1																																																																																				PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374737.1	NM_018912	
ZNF300	91975	broad.mit.edu	37	5	150275249	150275249	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr5:150275249C>A	ENST00000274599.5	-	6	1972	c.1552G>T	c.(1552-1554)Gaa>Taa	p.E518*	ZNF300_ENST00000394226.2_Nonsense_Mutation_p.E518*|ZNF300_ENST00000427179.1_3'UTR|ZNF300_ENST00000446148.2_Nonsense_Mutation_p.E534*|ZNF300_ENST00000418587.2_Nonsense_Mutation_p.E482*	NM_052860.2	NP_443092.1	Q96RE9	ZN300_HUMAN	zinc finger protein 300	518					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E518*(1)		endometrium(4)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)	27		Medulloblastoma(196;0.109)|all_hematologic(541;0.131)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TAAGGTTTTTCTCCTGTGTGA	0.428																																					p.E534X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1600T	5						.						48.0	50.0	49.0					5																	150275249		2203	4298	6501	150255442	SO:0001587	stop_gained	91975	exon7			AF395541	CCDS4311.2, CCDS54939.1, CCDS54940.1	5q33.1	2013-01-08			ENSG00000145908	ENSG00000145908		"""Zinc fingers, C2H2-type"", ""-"""	13091	protein-coding gene	gene with protein product		612429				14746915	Standard	NM_052860		Approved		uc021yfx.1	Q96RE9	OTTHUMG00000130076	ENST00000274599.5:c.1552G>T	5.37:g.150275249C>A	ENSP00000274599:p.Glu518*	Somatic		Capture	Illumina HiSeq	Phase_I	150255442	NM_001172831	A8MY91|B3KU35|B4DU78|F5GWS1|Q06DQ3|Q17RP3|Q5H9N5	Nonsense_Mutation	SNP	ENST00000274599.5	37	CCDS4311.2	.	.	.	.	.	.	.	.	.	.	C	41	8.795786	0.98956	.	.	ENSG00000145908	ENST00000446148;ENST00000274599;ENST00000418587;ENST00000394226	.	.	.	3.9	2.98	0.34508	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	10.3788	0.44099	0.1975:0.8024:0.0:0.0	.	.	.	.	X	534;518;482;518	.	ENSP00000274599:E518X	E	-	1	0	ZNF300	150255442	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.133000	0.64764	0.931000	0.37242	0.591000	0.81541	GAA		ZNF300-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_052860	
ITGA2	3673	broad.mit.edu	37	5	52347328	52347328	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr5:52347328T>A	ENST00000296585.5	+	7	861	c.718T>A	c.(718-720)Tcc>Acc	p.S240T		NM_002203.3	NP_002194.2	P17301	ITA2_HUMAN	integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)	240	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular response to hormone stimulus (GO:0032870)|collagen-activated signaling pathway (GO:0038065)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|hepatocyte differentiation (GO:0070365)|hypotonic response (GO:0006971)|integrin-mediated signaling pathway (GO:0007229)|mammary gland development (GO:0030879)|mesodermal cell differentiation (GO:0048333)|organ morphogenesis (GO:0009887)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell projection organization (GO:0031346)|positive regulation of collagen binding (GO:0033343)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA binding (GO:0043388)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|response to amine (GO:0014075)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to muscle activity (GO:0014850)|response to organic cyclic compound (GO:0014070)|skin morphogenesis (GO:0043589)|substrate-dependent cell migration (GO:0006929)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	axon terminus (GO:0043679)|basal part of cell (GO:0045178)|cell outer membrane (GO:0009279)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin alpha2-beta1 complex (GO:0034666)|integrin complex (GO:0008305)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)	p.S240T(1)		breast(3)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(1)|lung(18)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	47		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				TGTAGCAACATCCCAGACATC	0.383																																					p.S240T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T718A	5						.						121.0	115.0	117.0					5																	52347328		2203	4300	6503	52383085	SO:0001583	missense	3673	exon7				CCDS3957.1	5q11.2	2010-03-23			ENSG00000164171	ENSG00000164171		"""CD molecules"", ""Integrins"""	6137	protein-coding gene	gene with protein product		192974		CD49B			Standard	NM_002203		Approved	CD49b	uc003joy.3	P17301	OTTHUMG00000131165	ENST00000296585.5:c.718T>A	5.37:g.52347328T>A	ENSP00000296585:p.Ser240Thr	Somatic		Capture	Illumina HiSeq	Phase_I	52383085	NM_002203	Q14595	Missense_Mutation	SNP	ENST00000296585.5	37	CCDS3957.1	.	.	.	.	.	.	.	.	.	.	T	7.913	0.736822	0.15574	.	.	ENSG00000164171	ENST00000296585	T	0.55930	0.49	5.77	4.58	0.56647	von Willebrand factor, type A (3);	0.355390	0.29775	N	0.011227	T	0.38081	0.1027	L	0.38531	1.155	0.45046	D	0.998063	B;B	0.09022	0.0;0.002	B;B	0.06405	0.002;0.002	T	0.15150	-1.0447	10	0.23302	T	0.38	.	7.0421	0.25025	0.24:0.0:0.14:0.62	.	240;240	E7ESP4;P17301	.;ITA2_HUMAN	T	240	ENSP00000296585:S240T	ENSP00000296585:S240T	S	+	1	0	ITGA2	52383085	0.998000	0.40836	0.977000	0.42913	0.056000	0.15407	1.930000	0.40124	0.983000	0.38602	0.528000	0.53228	TCC		ITGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253857.2	NM_002203	
IL12B	3593	broad.mit.edu	37	5	158743720	158743720	+	Silent	SNP	G	G	A			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr5:158743720G>A	ENST00000231228.2	-	7	1415	c.960C>T	c.(958-960)agC>agT	p.S320S	RNU4ATAC2P_ENST00000408674.1_RNA	NM_002187.2	NP_002178.2	P29460	IL12B_HUMAN	interleukin 12B	320	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|defense response to Gram-negative bacterium (GO:0050829)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|interferon-gamma biosynthetic process (GO:0042095)|natural killer cell activation (GO:0030101)|natural killer cell activation involved in immune response (GO:0002323)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of cell adhesion (GO:0045785)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of mononuclear cell proliferation (GO:0032946)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NK T cell activation (GO:0051135)|positive regulation of NK T cell proliferation (GO:0051142)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of tissue remodeling (GO:0034105)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat4 protein (GO:0042520)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of tyrosine phosphorylation of Stat1 protein (GO:0042510)|response to UV-B (GO:0010224)|sensory perception of pain (GO:0019233)|sexual reproduction (GO:0019953)|T-helper 1 type immune response (GO:0042088)|T-helper cell differentiation (GO:0042093)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|interleukin-12 complex (GO:0043514)|interleukin-23 complex (GO:0070743)|membrane (GO:0016020)	cytokine receptor activity (GO:0004896)|identical protein binding (GO:0042802)|interleukin-12 alpha subunit binding (GO:0042164)|interleukin-12 receptor binding (GO:0005143)|protein heterodimerization activity (GO:0046982)	p.S320S(1)		cervix(1)|endometrium(1)|large_intestine(5)|lung(4)	11	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ATGCCCATTCGCTCCAAGATG	0.582											OREG0016989	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S320S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C960T	5						.						62.0	54.0	57.0					5																	158743720		2203	4300	6503	158676298	SO:0001819	synonymous_variant	3593	exon7			M65290	CCDS4346.1	5q31.1-q33.1	2014-09-17	2014-04-04		ENSG00000113302	ENSG00000113302		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5970	protein-coding gene	gene with protein product	"""natural killer cell stimulatory factor-2"", ""cytotoxic lymphocyte maturation factor 2, p40"", ""interleukin 12, p40"", ""natural killer cell stimulatory factor, 40 kD subunit"", ""interleukin-12 beta chain"", ""IL12, subunit p40"""	161561	"""interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2, p40)"""	NKSF2		1673147	Standard	NM_002187		Approved	CLMF, IL-12B, NKSF, CLMF2	uc003lxr.1	P29460	OTTHUMG00000130307	ENST00000231228.2:c.960C>T	5.37:g.158743720G>A		Somatic	1796	Capture	Illumina HiSeq	Phase_I	158676298	NM_002187		Silent	SNP	ENST00000231228.2	37	CCDS4346.1																																																																																				IL12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252652.2	NM_002187	
KIF13A	63971	broad.mit.edu	37	6	17794482	17794482	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr6:17794482G>A	ENST00000259711.6	-	25	3325	c.3220C>T	c.(3220-3222)Cag>Tag	p.Q1074*	KIF13A_ENST00000378816.5_Nonsense_Mutation_p.Q1074*|KIF13A_ENST00000378843.2_Nonsense_Mutation_p.Q1074*|KIF13A_ENST00000378826.2_Nonsense_Mutation_p.Q1074*|KIF13A_ENST00000378814.5_Nonsense_Mutation_p.Q1074*	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	1074					ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.Q1074*(1)		breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			TGTCTTACCTGGTAACTGTCC	0.463																																					p.Q1074X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C3220T	6						.						104.0	95.0	98.0					6																	17794482		1870	4107	5977	17902461	SO:0001587	stop_gained	63971	exon25			AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.3220C>T	6.37:g.17794482G>A	ENSP00000259711:p.Gln1074*	Somatic		Capture	Illumina HiSeq	Phase_I	17902461	NM_022113	A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Nonsense_Mutation	SNP	ENST00000259711.6	37	CCDS47381.1	.	.	.	.	.	.	.	.	.	.	G	43	10.138399	0.99345	.	.	ENSG00000137177	ENST00000378814;ENST00000502297;ENST00000259711;ENST00000378826;ENST00000378843;ENST00000378816	.	.	.	5.29	5.29	0.74685	.	0.060387	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	19.301	0.94144	0.0:0.0:1.0:0.0	.	.	.	.	X	1074;91;1074;1074;1074;1074	.	ENSP00000259711:Q1074X	Q	-	1	0	KIF13A	17902461	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.361000	0.97122	2.624000	0.88883	0.655000	0.94253	CAG		KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039954.4		
DEF6	50619	broad.mit.edu	37	6	35280244	35280244	+	Missense_Mutation	SNP	G	G	A	rs200254432		TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr6:35280244G>A	ENST00000316637.5	+	4	594	c.589G>A	c.(589-591)Gtg>Atg	p.V197M	DEF6_ENST00000542066.1_Intron	NM_022047.3	NP_071330.3	Q9H4E7	DEFI6_HUMAN	differentially expressed in FDCP 6 homolog (mouse)	197						cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.V197L(1)|p.V197M(1)		cervix(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)	15						CCTGCGGGGCGTGGGCCGGGA	0.657																																					p.V197M												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G589A	6						.	G	MET/VAL	3,4403	2.1+/-5.4	0,3,2200	33.0	39.0	37.0		589	5.5	1.0	6		37	0,8600		0,0,4300	yes	missense	DEF6	NM_022047.3	21	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	benign	197/632	35280244	3,13003	2203	4300	6503	35388222	SO:0001583	missense	50619	exon4			AJ276095	CCDS4802.1	6p21.33-p21.1	2013-01-10	2001-11-28		ENSG00000023892	ENSG00000023892		"""Pleckstrin homology (PH) domain containing"""	2760	protein-coding gene	gene with protein product	"""SWAP-70-like adaptor protein of T cells"""	610094	"""differentially expressed in FDCP (mouse homolog) 6"""			19251698	Standard	NM_022047		Approved	IBP, SLAT, SWAP70L	uc003okk.3	Q9H4E7	OTTHUMG00000014563	ENST00000316637.5:c.589G>A	6.37:g.35280244G>A	ENSP00000319831:p.Val197Met	Somatic		Capture	Illumina HiSeq	Phase_I	35388222	NM_022047	Q86VF4	Missense_Mutation	SNP	ENST00000316637.5	37	CCDS4802.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.424|6.424	0.446285|0.446285	0.12164|0.12164	6.81E-4|6.81E-4	0.0|0.0	ENSG00000023892|ENSG00000023892	ENST00000444278|ENST00000394658;ENST00000316637	.|T	.|0.22336	.|1.96	5.52|5.52	5.52|5.52	0.82312|0.82312	.|.	.|0.188756	.|0.51477	.|D	.|0.000094	T|T	0.02119|0.02119	0.0066|0.0066	N|N	0.04090|0.04090	-0.28|-0.28	0.80722|0.80722	D|D	1|1	.|B;P	.|0.36144	.|0.342;0.539	.|B;B	.|0.19391	.|0.01;0.025	T|T	0.35968|0.35968	-0.9767|-0.9767	5|10	.|0.07644	.|T	.|0.81	-40.7828|-40.7828	7.5186|7.5186	0.27614|0.27614	0.198:0.0:0.802:0.0|0.198:0.0:0.802:0.0	.|.	.|197;197	.|B2RBP7;Q9H4E7	.|.;DEFI6_HUMAN	H|M	105|160;197	.|ENSP00000319831:V197M	.|ENSP00000319831:V197M	R|V	+|+	2|1	0|0	DEF6|DEF6	35388222|35388222	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.998000|0.998000	0.95712|0.95712	5.125000|5.125000	0.64715|0.64715	2.767000|2.767000	0.95098|0.95098	0.655000|0.655000	0.94253|0.94253	CGT|GTG		DEF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040276.1	NM_022047	
SERAC1	84947	broad.mit.edu	37	6	158538804	158538804	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr6:158538804T>C	ENST00000367104.3	-	13	1489	c.1358A>G	c.(1357-1359)tAt>tGt	p.Y453C	SERAC1_ENST00000367102.2_Missense_Mutation_p.Y453C|SERAC1_ENST00000367101.1_Missense_Mutation_p.Y453C	NM_032861.3	NP_116250.3	Q96JX3	SRAC1_HUMAN	serine active site containing 1	453					extracellular matrix organization (GO:0030198)|GPI anchor metabolic process (GO:0006505)|intracellular protein transport (GO:0006886)|phospholipid biosynthetic process (GO:0008654)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)	p.Y453C(1)		endometrium(1)|kidney(2)|large_intestine(6)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	15		Breast(66;0.00519)|Ovarian(120;0.123)|Prostate(117;0.178)		OV - Ovarian serous cystadenocarcinoma(65;1.37e-18)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)		GCTGGTGTCATACTCCACAGA	0.453																																					p.Y453C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1358G	6						.						109.0	101.0	104.0					6																	158538804		2203	4300	6503	158458792	SO:0001583	missense	84947	exon13			BC001705	CCDS5255.1	6q25.3	2003-05-12			ENSG00000122335	ENSG00000122335			21061	protein-coding gene	gene with protein product		614725					Standard	NM_032861		Approved	FLJ14917	uc003qrc.2	Q96JX3	OTTHUMG00000015905	ENST00000367104.3:c.1358A>G	6.37:g.158538804T>C	ENSP00000356071:p.Tyr453Cys	Somatic		Capture	Illumina HiSeq	Phase_I	158458792	NM_032861	Q49AT1|Q5VTX3|Q6PKF3	Missense_Mutation	SNP	ENST00000367104.3	37	CCDS5255.1	.	.	.	.	.	.	.	.	.	.	.	19.47	3.834174	0.71373	.	.	ENSG00000122335	ENST00000367102;ENST00000367104;ENST00000435180;ENST00000367101	D;D;D;D	0.93859	-3.3;-2.17;-2.17;-3.3	5.7	4.52	0.55395	.	0.161503	0.56097	D	0.000023	D	0.96935	0.8999	H	0.94886	3.595	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97397	0.9993	10	0.87932	D	0	-21.4821	12.1134	0.53852	0.1287:0.0:0.0:0.8713	.	453	Q96JX3	SRAC1_HUMAN	C	453;453;28;453	ENSP00000356069:Y453C;ENSP00000356071:Y453C;ENSP00000391168:Y28C;ENSP00000356068:Y453C	ENSP00000356068:Y453C	Y	-	2	0	SERAC1	158458792	1.000000	0.71417	0.590000	0.28732	0.812000	0.45895	7.498000	0.81546	0.960000	0.38005	0.533000	0.62120	TAT		SERAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042862.1	NM_032861	
CPA1	1357	broad.mit.edu	37	7	130021519	130021519	+	Nonsense_Mutation	SNP	C	C	T	rs371401173		TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr7:130021519C>T	ENST00000011292.3	+	3	346	c.196C>T	c.(196-198)Cga>Tga	p.R66*	CPA1_ENST00000484324.1_5'UTR	NM_001868.2	NP_001859.1	P15085	CBPA1_HUMAN	carboxypeptidase A1 (pancreatic)	66					proteolysis (GO:0006508)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.R66*(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)	21	Melanoma(18;0.0435)					CATCGACGTCCGAGTGCCCTT	0.662																																					p.R66X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C196T	7						.						54.0	43.0	47.0					7																	130021519		2203	4300	6503	129808755	SO:0001587	stop_gained	1357	exon3				CCDS5820.1	7q32	2012-02-10			ENSG00000091704	ENSG00000091704	3.4.17.1		2296	protein-coding gene	gene with protein product	"""pancreatic carboxypeptidase A"""	114850		CPA			Standard	NM_001868		Approved		uc003vpx.3	P15085	OTTHUMG00000157826	ENST00000011292.3:c.196C>T	7.37:g.130021519C>T	ENSP00000011292:p.Arg66*	Somatic		Capture	Illumina HiSeq	Phase_I	129808755	NM_001868	A4D1M1|Q53XU0|Q9BS67|Q9UCF2	Nonsense_Mutation	SNP	ENST00000011292.3	37	CCDS5820.1	.	.	.	.	.	.	.	.	.	.	C	37	6.364710	0.97507	.	.	ENSG00000091704	ENST00000011292	.	.	.	5.4	4.51	0.55191	.	0.058120	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.1278	0.59364	0.1595:0.8405:0.0:0.0	.	.	.	.	X	66	.	ENSP00000011292:R66X	R	+	1	2	CPA1	129808755	0.989000	0.36119	0.995000	0.50966	0.957000	0.61999	2.287000	0.43505	1.256000	0.44068	0.561000	0.74099	CGA		CPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349736.2	NM_001868	
CHRM2	1129	broad.mit.edu	37	7	136700928	136700928	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr7:136700928G>A	ENST00000445907.2	+	3	1844	c.1316G>A	c.(1315-1317)tGc>tAc	p.C439Y	hsa-mir-490_ENST00000425981.2_RNA|hsa-mir-490_ENST00000586239.1_RNA|CHRM2_ENST00000397608.3_Missense_Mutation_p.C439Y|CHRM2_ENST00000453373.1_Missense_Mutation_p.C439Y|CHRM2_ENST00000402486.3_Missense_Mutation_p.C439Y|CHRM2_ENST00000401861.1_Missense_Mutation_p.C439Y|CHRM2_ENST00000320658.5_Missense_Mutation_p.C439Y|hsa-mir-490_ENST00000439694.1_RNA|hsa-mir-490_ENST00000597642.1_RNA|hsa-mir-490_ENST00000592183.1_RNA|hsa-mir-490_ENST00000593789.1_RNA|hsa-mir-490_ENST00000598184.1_RNA	NM_001006627.1|NM_001006629.1	NP_001006628.1|NP_001006630.1	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	439					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|nervous system development (GO:0007399)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|regulation of heart contraction (GO:0008016)|response to virus (GO:0009615)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)	p.C439Y(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(13)|liver(1)|lung(29)|ovary(4)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	68					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Bethanechol(DB01019)|Brompheniramine(DB00835)|Carbachol(DB00411)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Dimetindene(DB08801)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxacurium chloride(DB01135)|Doxepin(DB01142)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Rocuronium(DB00728)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	AACCCTGCCTGCTATGCACTT	0.413																																					p.C439Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1316A	7						.						230.0	196.0	208.0					7																	136700928		2203	4300	6503	136351468	SO:0001583	missense	1129	exon4				CCDS5843.1	7q35-q36	2014-09-17			ENSG00000181072	ENSG00000181072		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1951	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 2"""	118493					Standard	NM_000739		Approved		uc003vtl.1	P08172	OTTHUMG00000155658	ENST00000445907.2:c.1316G>A	7.37:g.136700928G>A	ENSP00000399745:p.Cys439Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	136351468	NM_000739	Q4VBK6|Q9P1X9	Missense_Mutation	SNP	ENST00000445907.2	37	CCDS5843.1	.	.	.	.	.	.	.	.	.	.	G	19.13	3.767431	0.69878	.	.	ENSG00000181072	ENST00000445907;ENST00000453373;ENST00000320658;ENST00000397608;ENST00000402486;ENST00000401861	T;T;T;T;T;T	0.37411	1.2;1.2;1.2;1.2;1.2;1.2	5.81	5.81	0.92471	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.70605	0.3243	M	0.91510	3.215	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.76605	-0.2898	10	0.87932	D	0	-0.8965	20.0912	0.97820	0.0:0.0:1.0:0.0	.	439	P08172	ACM2_HUMAN	Y	439	ENSP00000399745:C439Y;ENSP00000415386:C439Y;ENSP00000319984:C439Y;ENSP00000380733:C439Y;ENSP00000384937:C439Y;ENSP00000384401:C439Y	ENSP00000319984:C439Y	C	+	2	0	CHRM2	136351468	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.807000	0.99171	2.746000	0.94184	0.591000	0.81541	TGC		CHRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341010.1		
SDK1	221935	broad.mit.edu	37	7	4153693	4153693	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr7:4153693G>A	ENST00000404826.2	+	25	3749	c.3610G>A	c.(3610-3612)Ggg>Agg	p.G1204R	SDK1_ENST00000389531.3_Missense_Mutation_p.G1204R	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1204	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.G1204R(1)		NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		TCAGTACAACGGGAACCCCGA	0.587																																					p.G1204R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3610A	7						.						57.0	55.0	56.0					7																	4153693		2203	4300	6503	4120219	SO:0001583	missense	221935	exon25			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.3610G>A	7.37:g.4153693G>A	ENSP00000385899:p.Gly1204Arg	Somatic		Capture	Illumina HiSeq	Phase_I	4120219	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	37	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.368127	0.82463	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.65178	-0.14;-0.14	5.52	5.52	0.82312	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	D	0.86481	0.5943	H	0.96430	3.82	0.51482	D	0.999928	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.988	D	0.90523	0.4490	10	0.87932	D	0	.	19.4741	0.94979	0.0:0.0:1.0:0.0	.	1204;1204	F8W6X9;Q7Z5N4	.;SDK1_HUMAN	R	1204	ENSP00000385899:G1204R;ENSP00000374182:G1204R	ENSP00000374182:G1204R	G	+	1	0	SDK1	4120219	1.000000	0.71417	0.996000	0.52242	0.971000	0.66376	6.196000	0.72094	2.595000	0.87683	0.655000	0.94253	GGG		SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
ABCA13	154664	broad.mit.edu	37	7	48431678	48431678	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr7:48431678T>C	ENST00000435803.1	+	38	11839	c.11815T>C	c.(11815-11817)Ttt>Ctt	p.F3939L		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3939	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.F3939L(1)|p.F3884L(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TTTGCTGCTCTTTGCTTCCAT	0.537																																					p.S3884S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T11652C	7						.						117.0	119.0	118.0					7																	48431678		2013	4179	6192	48402224	SO:0001583	missense	154664	exon36			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.11815T>C	7.37:g.48431678T>C	ENSP00000411096:p.Phe3939Leu	Somatic		Capture	Illumina HiSeq	Phase_I	48402224	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	T	17.73	3.461317	0.63513	.	.	ENSG00000179869	ENST00000435803	D	0.86562	-2.14	5.32	5.32	0.75619	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.41712	U	0.000835	D	0.91327	0.7265	L	0.58810	1.83	0.80722	D	1	D;D	0.71674	0.989;0.998	P;D	0.72338	0.854;0.977	D	0.91884	0.5518	10	0.66056	D	0.02	.	12.6486	0.56748	0.0:0.0:0.0:1.0	.	1641;3939	Q86UQ4-3;Q86UQ4	.;ABCAD_HUMAN	L	3939	ENSP00000411096:F3939L	ENSP00000411096:F3939L	F	+	1	0	ABCA13	48402224	1.000000	0.71417	0.210000	0.23637	0.203000	0.24098	6.538000	0.73852	2.010000	0.58986	0.383000	0.25322	TTT		ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
CNTNAP2	26047	broad.mit.edu	37	7	147914500	147914500	+	Missense_Mutation	SNP	C	C	T	rs369724886		TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr7:147914500C>T	ENST00000361727.3	+	19	3647	c.3131C>T	c.(3130-3132)cCg>cTg	p.P1044L	CNTNAP2_ENST00000538075.1_Missense_Mutation_p.P103L	NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	1044					adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)	p.P1044L(2)		NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			AACTCCCACCCGGACCTGGCA	0.562										HNSCC(39;0.1)			C|||	1	0.000199681	0.0	0.0	5008	,	,		18094	0.0		0.0	False		,,,				2504	0.001				p.P1044L												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C3131T	7						.	C	LEU/PRO	0,4406		0,0,2203	116.0	112.0	113.0		3131	3.4	0.0	7		113	1,8599	1.2+/-3.3	0,1,4299	no	missense	CNTNAP2	NM_014141.5	98	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	1044/1332	147914500	1,13005	2203	4300	6503	147545433	SO:0001583	missense	26047	exon19			AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.3131C>T	7.37:g.147914500C>T	ENSP00000354778:p.Pro1044Leu	Somatic		Capture	Illumina HiSeq	Phase_I	147545433	NM_014141	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	ENST00000361727.3	37	CCDS5889.1	.	.	.	.	.	.	.	.	.	.	C	4.676	0.125619	0.08931	0.0	1.16E-4	ENSG00000174469	ENST00000361727;ENST00000538075	D;T	0.88277	-2.36;2.78	5.25	3.39	0.38822	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.483859	0.22141	N	0.064051	T	0.75004	0.3791	N	0.24115	0.695	0.09310	N	1	P	0.39094	0.659	B	0.21708	0.036	T	0.62039	-0.6938	10	0.09590	T	0.72	.	13.0547	0.58973	0.3141:0.6859:0.0:0.0	.	1044	Q9UHC6	CNTP2_HUMAN	L	1044;103	ENSP00000354778:P1044L;ENSP00000440732:P103L	ENSP00000354778:P1044L	P	+	2	0	CNTNAP2	147545433	0.013000	0.17824	0.001000	0.08648	0.006000	0.05464	2.542000	0.45744	0.545000	0.28902	-0.397000	0.06425	CCG		CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1		
ADCY8	114	broad.mit.edu	37	8	131861945	131861945	+	Missense_Mutation	SNP	C	C	T	rs147278965	byFrequency	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr8:131861945C>T	ENST00000286355.5	-	10	4407	c.2315G>A	c.(2314-2316)cGg>cAg	p.R772Q	ADCY8_ENST00000377928.3_Intron	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	772					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)	p.R772Q(2)		NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			GCAAGTTTTCCGGAGGATGAG	0.443										HNSCC(32;0.087)																											p.R772Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|pancreas(1)	c.G2315A	8						.	C	GLN/ARG	0,4406		0,0,2203	118.0	109.0	112.0		2315	5.3	1.0	8	dbSNP_134	112	3,8597	3.0+/-9.4	0,3,4297	yes	missense	ADCY8	NM_001115.2	43	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	benign	772/1252	131861945	3,13003	2203	4300	6503	131931127	SO:0001583	missense	114	exon10			Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.2315G>A	8.37:g.131861945C>T	ENSP00000286355:p.Arg772Gln	Somatic		Capture	Illumina HiSeq	Phase_I	131931127	NM_001115		Missense_Mutation	SNP	ENST00000286355.5	37	CCDS6363.1	.	.	.	.	.	.	.	.	.	.	C	11.72	1.721467	0.30503	0.0	3.49E-4	ENSG00000155897	ENST00000286355	T	0.38887	1.11	5.31	5.31	0.75309	.	0.183771	0.47455	D	0.000235	T	0.25938	0.0632	N	0.14661	0.345	0.80722	D	1	B	0.29571	0.249	B	0.15484	0.013	T	0.07328	-1.0778	10	0.17369	T	0.5	.	17.9575	0.89074	0.0:1.0:0.0:0.0	.	772	P40145	ADCY8_HUMAN	Q	772	ENSP00000286355:R772Q	ENSP00000286355:R772Q	R	-	2	0	ADCY8	131931127	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	7.375000	0.79646	2.465000	0.83290	0.655000	0.94253	CGG		ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1		
SLA	6503	broad.mit.edu	37	8	134062168	134062168	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr8:134062168C>A	ENST00000338087.5	-	5	1046	c.227G>T	c.(226-228)tGt>tTt	p.C76F	TG_ENST00000220616.4_Intron|TG_ENST00000542445.1_Intron|SLA_ENST00000427060.2_Missense_Mutation_p.C116F|TG_ENST00000519543.1_Intron|TG_ENST00000377869.1_Intron|SLA_ENST00000395352.3_Missense_Mutation_p.C93F|SLA_ENST00000518565.1_5'UTR|SLA_ENST00000524345.1_5'UTR|SLA_ENST00000517648.1_Missense_Mutation_p.C93F	NM_001045556.2	NP_001039021.1	Q13239	SLAP1_HUMAN	Src-like-adaptor	76	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				positive regulation of signal transduction (GO:0009967)	endosome (GO:0005768)	SH3/SH2 adaptor activity (GO:0005070)	p.C116F(1)|p.C76F(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(1)|lung(6)|prostate(1)|skin(1)	17	all_epithelial(106;3.51e-21)|Lung NSC(106;4.24e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0279)|Breast(495;0.037)	BRCA - Breast invasive adenocarcinoma(115;0.000701)			TCTGGCCACACATATTCCAGG	0.448																																					p.C76F												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G227T	8						.						146.0	121.0	130.0					8																	134062168		2203	4300	6503	134131350	SO:0001583	missense	6503	exon5				CCDS6370.1, CCDS47922.1, CCDS47923.1, CCDS64977.1, CCDS64978.1	8q24.22	2013-09-19	2001-11-28		ENSG00000155926	ENSG00000155926		"""SH2 domain containing"""	10902	protein-coding gene	gene with protein product		601099	"""Src-like-adapter"""			8825655, 11179692	Standard	NM_001045556		Approved	SLA1	uc011ljd.2	Q13239	OTTHUMG00000164439	ENST00000338087.5:c.227G>T	8.37:g.134062168C>A	ENSP00000337548:p.Cys76Phe	Somatic		Capture	Illumina HiSeq	Phase_I	134131350	NM_001045556	B7Z4J2|B7Z4L6|Q6FI01|Q9UMQ8	Missense_Mutation	SNP	ENST00000338087.5	37	CCDS6370.1	.	.	.	.	.	.	.	.	.	.	C	11.52	1.661785	0.29515	.	.	ENSG00000155926	ENST00000338087;ENST00000427060;ENST00000395352;ENST00000517648;ENST00000522119;ENST00000519341	T;T;T;D;D;T	0.92099	-1.09;-1.04;-1.03;-2.97;-2.97;1.48	5.65	4.78	0.61160	Src homology-3 domain (3);	0.138103	0.64402	D	0.000002	T	0.79707	0.4492	N	0.03224	-0.385	0.41322	D	0.987188	B;B;B;B;B;B	0.28783	0.222;0.138;0.138;0.002;0.005;0.138	B;B;B;B;B;B	0.23716	0.048;0.013;0.013;0.001;0.016;0.013	T	0.76061	-0.3097	10	0.18710	T	0.47	-12.7543	12.1729	0.54169	0.0:0.9172:0.0:0.0828	.	93;76;76;76;76;76	B7Z4J2;Q6FI01;Q5TZW1;E5RHT2;E5RJ69;Q13239	.;.;.;.;.;SLAP1_HUMAN	F	76;116;93;93;76;76	ENSP00000337548:C76F;ENSP00000394049:C116F;ENSP00000378759:C93F;ENSP00000428559:C93F;ENSP00000430596:C76F;ENSP00000429681:C76F	ENSP00000337548:C76F	C	-	2	0	SLA	134131350	1.000000	0.71417	0.946000	0.38457	0.942000	0.58702	3.186000	0.50942	1.393000	0.46605	0.655000	0.94253	TGT		SLA-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378771.1		
DIRAS2	54769	broad.mit.edu	37	9	93376013	93376013	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr9:93376013G>A	ENST00000375765.3	-	2	485	c.97C>T	c.(97-99)Cgg>Tgg	p.R33W		NM_017594.3	NP_060064.2	Q96HU8	DIRA2_HUMAN	DIRAS family, GTP-binding RAS-like 2	33					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)	p.R33W(1)		kidney(1)|large_intestine(6)|lung(3)|skin(2)	12						TAGCTCTCCCGGAATGTGCCT	0.567																																					p.R33W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C97T	9						.						178.0	158.0	164.0					9																	93376013		2203	4300	6503	92415833	SO:0001583	missense	54769	exon2			AB076889	CCDS6687.1	9q22.32	2014-05-09			ENSG00000165023	ENSG00000165023			19323	protein-coding gene	gene with protein product		607863				12194967	Standard	NM_017594		Approved	Di-Ras2, DKFZp761C07121	uc004aqx.1	Q96HU8	OTTHUMG00000020196	ENST00000375765.3:c.97C>T	9.37:g.93376013G>A	ENSP00000364919:p.Arg33Trp	Somatic		Capture	Illumina HiSeq	Phase_I	92415833	NM_017594	B3KVM2	Missense_Mutation	SNP	ENST00000375765.3	37	CCDS6687.1	.	.	.	.	.	.	.	.	.	.	G	17.82	3.482595	0.63962	.	.	ENSG00000165023	ENST00000375765	T	0.77750	-1.12	5.06	4.14	0.48551	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85452	0.5700	M	0.72479	2.2	0.80722	D	1	D	0.89917	1.0	D	0.69824	0.966	D	0.86699	0.1928	10	0.87932	D	0	.	11.4625	0.50219	0.0:0.0:0.5303:0.4697	.	33	Q96HU8	DIRA2_HUMAN	W	33	ENSP00000364919:R33W	ENSP00000364919:R33W	R	-	1	2	DIRAS2	92415833	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.161000	0.42358	1.449000	0.47699	0.655000	0.94253	CGG		DIRAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053012.1		
OR13F1	138805	broad.mit.edu	37	9	107266907	107266907	+	Missense_Mutation	SNP	C	C	T	rs201311592		TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chr9:107266907C>T	ENST00000334726.2	+	1	453	c.364C>T	c.(364-366)Cgg>Tgg	p.R122W		NM_001004485.1	NP_001004485.1	Q8NGS4	O13F1_HUMAN	olfactory receptor, family 13, subfamily F, member 1	122						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R122W(1)		endometrium(3)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						GGCATATGACCGGTATGTGGC	0.537																																					p.R122W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C364T	9						.						88.0	75.0	79.0					9																	107266907		2203	4300	6503	106306728	SO:0001583	missense	138805	exon1				CCDS35087.1	9q31.1	2013-09-24			ENSG00000186881	ENSG00000186881		"""GPCR / Class A : Olfactory receptors"""	14723	protein-coding gene	gene with protein product							Standard	NM_001004485		Approved		uc011lvm.2	Q8NGS4	OTTHUMG00000020404	ENST00000334726.2:c.364C>T	9.37:g.107266907C>T	ENSP00000334452:p.Arg122Trp	Somatic		Capture	Illumina HiSeq	Phase_I	106306728	NM_001004485	Q6IF50	Missense_Mutation	SNP	ENST00000334726.2	37	CCDS35087.1	.	.	.	.	.	.	.	.	.	.	C	16.82	3.229519	0.58777	.	.	ENSG00000186881	ENST00000334726	T	0.77620	-1.11	4.3	-0.056	0.13807	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47852	D	0.000219	D	0.88588	0.6477	H	0.97587	4.035	0.39159	D	0.962364	D	0.89917	1.0	D	0.65010	0.931	D	0.84909	0.0847	10	0.87932	D	0	.	4.4927	0.11820	0.1912:0.5389:0.0:0.2699	.	122	Q8NGS4	O13F1_HUMAN	W	122	ENSP00000334452:R122W	ENSP00000334452:R122W	R	+	1	2	OR13F1	106306728	0.978000	0.34361	0.996000	0.52242	0.996000	0.88848	0.830000	0.27462	-0.009000	0.14296	0.655000	0.94253	CGG		OR13F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053475.1		
CCDC160	347475	broad.mit.edu	37	X	133379411	133379411	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3688-01A-01W-0900-09	TCGA-AA-3688-10A-01W-0900-09	g.chrX:133379411C>A	ENST00000517294.1	+	3	964	c.581C>A	c.(580-582)aCg>aAg	p.T194K	CCDC160_ENST00000370809.4_Missense_Mutation_p.T194K			A6NGH7	CC160_HUMAN	coiled-coil domain containing 160	194								p.T194K(1)		endometrium(1)|kidney(2)|large_intestine(10)|lung(2)|prostate(1)|skin(1)	17						GAAACAGAGACGGATGCTTCA	0.328																																					p.T194K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C581A	X						.						25.0	20.0	22.0					X																	133379411		1794	4031	5825	133207077	SO:0001583	missense	347475	exon2			BC017958	CCDS48171.1	Xq26.2	2010-02-17			ENSG00000203952	ENSG00000203952			37286	protein-coding gene	gene with protein product							Standard	NM_001101357		Approved		uc011mvj.2	A6NGH7	OTTHUMG00000164183	ENST00000517294.1:c.581C>A	X.37:g.133379411C>A	ENSP00000427951:p.Thr194Lys	Somatic		Capture	Illumina HiSeq	Phase_I	133207077	NM_001101357		Missense_Mutation	SNP	ENST00000517294.1	37	CCDS48171.1	.	.	.	.	.	.	.	.	.	.	C	0.009	-1.812019	0.00600	.	.	ENSG00000203952	ENST00000517294;ENST00000370809	D;D	0.90261	-2.64;-2.64	4.99	-9.99	0.00435	.	2.552720	0.01625	N	0.023226	T	0.70692	0.3253	N	0.04508	-0.205	0.09310	N	1	B	0.13594	0.008	B	0.06405	0.002	T	0.66874	-0.5813	10	0.05436	T	0.98	-12.5583	4.4892	0.11805	0.2749:0.5714:0.0644:0.0894	.	194	A6NGH7	CC160_HUMAN	K	194	ENSP00000427951:T194K;ENSP00000359845:T194K	ENSP00000359845:T194K	T	+	2	0	CCDC160	133207077	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.591000	0.00421	-3.308000	0.00191	-1.258000	0.01471	ACG		CCDC160-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377679.1	NM_001101357	
