#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
IL15RA	3601	broad.mit.edu	37	10	6002329	6002329	+	Splice_Site	SNP	C	C	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr10:6002329C>T	ENST00000379977.3	-	4	681		c.e4+1		IL15RA_ENST00000397250.2_Splice_Site|IL15RA_ENST00000397255.3_Splice_Site|IL15RA_ENST00000530685.1_Splice_Site|IL15RA_ENST00000397251.3_Splice_Site|IL15RA_ENST00000528354.1_Splice_Site|IL15RA_ENST00000525219.2_Splice_Site|IL15RA_ENST00000534292.1_Splice_Site|IL15RA_ENST00000379971.1_Splice_Site|IL15RA_ENST00000397248.2_Splice_Site			Q13261	I15RA_HUMAN	interleukin 15 receptor, alpha						cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|JAK-STAT cascade (GO:0007259)|negative regulation of neuron projection development (GO:0010977)|positive regulation of natural killer cell differentiation (GO:0032825)|response to nutrient levels (GO:0031667)|signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|signal transducer activity (GO:0004871)	p.?(1)		cervix(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5						CGAGTGCTAACCTGGCGGCTG	0.567																																					.												.	.	1	Unknown(1)	large_intestine(1)	.	10						.						113.0	111.0	112.0					10																	6002329		2203	4300	6503	6042335	SO:0001630	splice_region_variant	3601	.			U31628	CCDS7074.1, CCDS7075.1, CCDS7075.2, CCDS58069.1, CCDS73065.1	10p15.1	2012-02-27			ENSG00000134470	ENSG00000134470		"""Interleukins and interleukin receptors"", ""CD molecules"""	5978	protein-coding gene	gene with protein product		601070				8530383	Standard	NM_002189		Approved	CD215, IL-15RA	uc021pmo.1	Q13261	OTTHUMG00000017612	ENST00000379977.3:c.583+1G>A	10.37:g.6002329C>T		Somatic		Capture	Illumina HiSeq	Phase_I	6042335	.	B4E2C2|Q3B769|Q5JVA1|Q5JVA2|Q5JVA4|Q6B0J2|Q7LDR4|Q7Z609	Splice_Site	SNP	ENST00000379977.3	37	CCDS7074.1	.	.	.	.	.	.	.	.	.	.	C	12.30	1.898064	0.33535	.	.	ENSG00000134470	ENST00000435171;ENST00000397246;ENST00000397251;ENST00000379977;ENST00000397248;ENST00000319465;ENST00000528354;ENST00000447291;ENST00000532039;ENST00000397250;ENST00000379971;ENST00000530685;ENST00000397255;ENST00000525219;ENST00000429135	.	.	.	4.06	4.06	0.47325	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.9312	0.52847	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	IL15RA	6042335	1.000000	0.71417	0.997000	0.53966	0.345000	0.29048	3.095000	0.50235	2.260000	0.74910	0.561000	0.74099	.		IL15RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046615.2	NM_172200, NM_002189	Intron
ABI1	10006	broad.mit.edu	37	10	27037565	27037565	+	Silent	SNP	G	G	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr10:27037565G>A	ENST00000376142.2	-	12	1532	c.1461C>T	c.(1459-1461)gtC>gtT	p.V487V	ABI1_ENST00000536334.1_Silent_p.V373V|ABI1_ENST00000346832.5_Silent_p.V475V|ABI1_ENST00000376139.2_Silent_p.V455V|ABI1_ENST00000376137.4_Silent_p.V402V|ABI1_ENST00000376160.1_Silent_p.V454V|ABI1_ENST00000359188.4_Silent_p.V459V|ABI1_ENST00000355394.4_Silent_p.V488V|ABI1_ENST00000376166.1_Silent_p.V425V|ABI1_ENST00000490841.2_Silent_p.V308V|ABI1_ENST00000376138.3_Silent_p.V431V|ABI1_ENST00000376140.3_Silent_p.V460V|ABI1_ENST00000376170.4_Silent_p.V430V|ABI1_ENST00000376134.3_Silent_p.V461V	NM_005470.3	NP_005461.2	Q8IZP0	ABI1_HUMAN	abl-interactor 1	487	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin polymerization or depolymerization (GO:0008154)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|lamellipodium morphogenesis (GO:0072673)|megakaryocyte development (GO:0035855)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|SCAR complex (GO:0031209)	cytoskeletal protein binding (GO:0008092)|protein complex binding (GO:0032403)|protein tyrosine kinase activator activity (GO:0030296)	p.V487V(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(9)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						CTCGATTGCAGACTCCTTCAT	0.338																																					p.V367V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1101T	10						.						121.0	103.0	109.0					10																	27037565		2203	4300	6503	27077571	SO:0001819	synonymous_variant	10006	exon8			U87166	CCDS7150.1, CCDS31169.1, CCDS31170.1, CCDS31171.1, CCDS53497.1, CCDS53498.1, CCDS53499.1, CCDS53500.1, CCDS53501.1, CCDS73077.1, CCDS73078.1	10p12.1	2009-05-29	2004-03-17	2004-03-19	ENSG00000136754	ENSG00000136754			11320	protein-coding gene	gene with protein product		603050	"""spectrin SH3 domain binding protein 1"""	SSH3BP1		9593709, 9010225	Standard	NM_005470		Approved	E3B1, ABI-1	uc001isx.3	Q8IZP0	OTTHUMG00000017848	ENST00000376142.2:c.1461C>T	10.37:g.27037565G>A		Somatic		Capture	Illumina HiSeq	Phase_I	27077571	NM_001178124	A9Z1Y6|B3KX62|B4DQ58|H7BXI6|O15147|O76049|O95060|Q5T2R3|Q5T2R4|Q5T2R6|Q5T2R7|Q5T2R9|Q5W070|Q5W072|Q8TB63|Q96S81|Q9NXZ9|Q9NYB8	Silent	SNP	ENST00000376142.2	37	CCDS7150.1																																																																																				ABI1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047287.1	NM_005470	
ASAH2	56624	broad.mit.edu	37	10	52008306	52008306	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr10:52008306G>A	ENST00000395526.4	-	1	64	c.65C>T	c.(64-66)gCc>gTc	p.A22V	ASAH2_ENST00000329428.6_Missense_Mutation_p.A3V|ASAH2_ENST00000447815.1_Missense_Mutation_p.A22V	NM_019893.2	NP_063946.2	Q9NR71	ASAH2_HUMAN	N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2	22					apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|glycosphingolipid metabolic process (GO:0006687)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ceramidase activity (GO:0017040)	p.A22V(1)|p.A3V(1)		large_intestine(1)|lung(9)|urinary_tract(1)	11						CACTGTGATGGCACTCATCAT	0.448																																					p.A22V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C65T	10						.						130.0	124.0	126.0					10																	52008306		2203	4300	6503	51678312	SO:0001583	missense	56624	exon1			AF250847	CCDS7239.2, CCDS44398.1	10q11.23	2008-08-11			ENSG00000188611	ENSG00000188611			18860	protein-coding gene	gene with protein product		611202				10781606	Standard	NM_019893		Approved		uc001jjd.3	Q9NR71	OTTHUMG00000018223	ENST00000395526.4:c.65C>T	10.37:g.52008306G>A	ENSP00000378897:p.Ala22Val	Somatic		Capture	Illumina HiSeq	Phase_I	51678312	NM_019893	Q3KNU1|Q5SNT7|Q5SZP6|Q5SZP7|Q5T1D5|Q71ME6	Missense_Mutation	SNP	ENST00000395526.4	37	CCDS7239.2	.	.	.	.	.	.	.	.	.	.	G	14.83	2.651287	0.47362	.	.	ENSG00000188611	ENST00000395526;ENST00000447815;ENST00000329428	T;T;T	0.32023	1.53;1.47;1.47	5.94	4.06	0.47325	.	0.333100	0.30311	N	0.009910	T	0.22126	0.0533	L	0.32530	0.975	0.80722	D	1	B;B	0.15930	0.015;0.009	B;B	0.17433	0.018;0.008	T	0.04242	-1.0966	10	0.34782	T	0.22	.	8.6367	0.33953	0.0823:0.1596:0.7581:0.0	.	22;22	Q9NR71-2;Q9NR71	.;ASAH2_HUMAN	V	22;22;3	ENSP00000378897:A22V;ENSP00000388206:A22V;ENSP00000329886:A3V	ENSP00000329886:A3V	A	-	2	0	ASAH2	51678312	0.097000	0.21791	0.463000	0.27130	0.993000	0.82548	0.948000	0.29096	0.820000	0.34516	0.563000	0.77884	GCC		ASAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048061.3	NM_019893	
TET1	80312	broad.mit.edu	37	10	70405458	70405458	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr10:70405458C>A	ENST00000373644.4	+	4	3181	c.2972C>A	c.(2971-2973)aCa>aAa	p.T991K		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	991					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)	p.T991K(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						CAAGCATCCACAAAGTCACAT	0.353																																					p.T991K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2972A	10						.						110.0	103.0	106.0					10																	70405458		2203	4300	6503	70075464	SO:0001583	missense	80312	exon4			AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.2972C>A	10.37:g.70405458C>A	ENSP00000362748:p.Thr991Lys	Somatic		Capture	Illumina HiSeq	Phase_I	70075464	NM_030625	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	ENST00000373644.4	37	CCDS7281.1	.	.	.	.	.	.	.	.	.	.	C	15.80	2.940655	0.52972	.	.	ENSG00000138336	ENST00000373644	T	0.06768	3.26	5.79	-2.44	0.06502	.	15.496500	0.00166	N	0.000000	T	0.04634	0.0126	L	0.27053	0.805	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.24835	-1.0149	10	0.05721	T	0.95	.	1.3128	0.02101	0.2519:0.1715:0.3743:0.2023	.	991	Q8NFU7	TET1_HUMAN	K	991	ENSP00000362748:T991K	ENSP00000362748:T991K	T	+	2	0	TET1	70075464	0.000000	0.05858	0.000000	0.03702	0.951000	0.60555	-0.261000	0.08694	-0.498000	0.06632	0.563000	0.77884	ACA		TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625	
EBF3	253738	broad.mit.edu	37	10	131640443	131640443	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr10:131640443C>T	ENST00000355311.5	-	13	1381	c.1309G>A	c.(1309-1311)Gtc>Atc	p.V437I	MIR4297_ENST00000579857.1_RNA|EBF3_ENST00000368648.3_Missense_Mutation_p.V428I			Q9H4W6	COE3_HUMAN	early B-cell factor 3	437					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V437I(1)|p.V428I(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	44		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		AAGGAGTTGACGCCCATCATG	0.627																																					p.V428I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1282A	10						.						270.0	204.0	226.0					10																	131640443		2203	4300	6503	131530433	SO:0001583	missense	253738	exon13				CCDS31314.1	10q26.3	2007-03-30			ENSG00000108001	ENSG00000108001			19087	protein-coding gene	gene with protein product		607407				12355068	Standard	NM_001005463		Approved	COE3, DKFZp667B0210	uc001lki.2	Q9H4W6	OTTHUMG00000019265	ENST00000355311.5:c.1309G>A	10.37:g.131640443C>T	ENSP00000347463:p.Val437Ile	Somatic		Capture	Illumina HiSeq	Phase_I	131530433	NM_001005463	A0AUY1|Q5T6H9|Q9H4W5	Missense_Mutation	SNP	ENST00000355311.5	37		.	.	.	.	.	.	.	.	.	.	C	14.32	2.501566	0.44455	.	.	ENSG00000108001	ENST00000355311;ENST00000368648	T;T	0.39056	1.1;1.1	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.33527	0.0866	L	0.34521	1.04	0.58432	D	0.999999	B	0.09022	0.002	B	0.12837	0.008	T	0.17319	-1.0373	10	0.08599	T	0.76	-17.2848	19.2947	0.94117	0.0:1.0:0.0:0.0	.	428	Q9H4W6-2	.	I	437;428	ENSP00000347463:V437I;ENSP00000357637:V428I	ENSP00000347463:V437I	V	-	1	0	EBF3	131530433	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.743000	0.85020	2.632000	0.89209	0.655000	0.94253	GTC		EBF3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051015.2	NM_001005463	
TRPC6	7225	broad.mit.edu	37	11	101375148	101375148	+	Silent	SNP	C	C	T	rs201872553		TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr11:101375148C>T	ENST00000344327.3	-	2	976	c.552G>A	c.(550-552)ccG>ccA	p.P184P	TRPC6_ENST00000360497.4_Silent_p.P184P|TRPC6_ENST00000526713.1_5'Flank|TRPC6_ENST00000532133.1_Silent_p.P184P|TRPC6_ENST00000348423.4_Silent_p.P184P	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	184					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.P184P(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		CAGCAAAAGCCGGATGACTGA	0.453																																					p.P184P	Colon(166;1315 1927 11094 12848 34731)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G552A	11						.						91.0	86.0	88.0					11																	101375148		2203	4299	6502	100880358	SO:0001819	synonymous_variant	7225	exon2			AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.552G>A	11.37:g.101375148C>T		Somatic		Capture	Illumina HiSeq	Phase_I	100880358	NM_004621	Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Silent	SNP	ENST00000344327.3	37	CCDS8311.1																																																																																				TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394770.1	NM_004621	
DYNC2H1	79659	broad.mit.edu	37	11	103041639	103041639	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr11:103041639C>T	ENST00000375735.2	+	34	5320	c.5176C>T	c.(5176-5178)Cga>Tga	p.R1726*	DYNC2H1_ENST00000334267.7_Intron|DYNC2H1_ENST00000398093.3_Nonsense_Mutation_p.R1726*	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	1726	AAA 1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		GTCAATGGGACGAATATTTGT	0.333																																					p.R1726X												.	.	0			c.C5176T	11						.						195.0	172.0	179.0					11																	103041639		1829	4087	5916	102546849	SO:0001587	stop_gained	79659	exon34			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.5176C>T	11.37:g.103041639C>T	ENSP00000364887:p.Arg1726*	Somatic		Capture	Illumina HiSeq	Phase_I	102546849	NM_001377	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Nonsense_Mutation	SNP	ENST00000375735.2	37	CCDS53701.1	.	.	.	.	.	.	.	.	.	.	C	45	11.443144	0.99562	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	.	.	.	4.92	3.98	0.46160	.	1.177540	0.06574	N	0.749146	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.3852	0.55328	0.4337:0.5663:0.0:0.0	.	.	.	.	X	1726	.	ENSP00000364887:R1726X	R	+	1	2	DYNC2H1	102546849	0.914000	0.31030	0.990000	0.47175	0.975000	0.68041	1.866000	0.39489	1.144000	0.42321	0.650000	0.86243	CGA		DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	
RBM7	10179	broad.mit.edu	37	11	114278321	114278321	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr11:114278321G>A	ENST00000540163.1	+	5	1235	c.593G>A	c.(592-594)cGt>cAt	p.R198H	RP11-212D19.4_ENST00000544347.1_Intron|RBM7_ENST00000541475.1_3'UTR|RBM7_ENST00000375490.5_Missense_Mutation_p.R199H|RBM7_ENST00000545678.1_Missense_Mutation_p.R78H|RBM7_ENST00000544582.1_Intron			Q9Y580	RBM7_HUMAN	RNA binding motif protein 7	198					meiotic nuclear division (GO:0007126)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R198H(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17		all_cancers(61;5.06e-12)|all_epithelial(67;5.3e-06)|all_hematologic(158;7.68e-05)|Acute lymphoblastic leukemia(157;0.000966)|Melanoma(852;0.00153)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Breast(348;0.0818)|Prostate(24;0.104)		BRCA - Breast invasive adenocarcinoma(274;2.56e-06)|Epithelial(105;4.17e-05)|all cancers(92;0.000348)		TCATCACAGCGTAAAGTCAGA	0.443																																					p.R198H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G593A	11						.						146.0	124.0	132.0					11																	114278321		2201	4296	6497	113783531	SO:0001583	missense	10179	exon5			AF156098	CCDS8370.1, CCDS66233.1, CCDS73395.1	11q23.1-q23.2	2013-02-12			ENSG00000076053	ENSG00000076053		"""RNA binding motif (RRM) containing"""	9904	protein-coding gene	gene with protein product		612413				12477932	Standard	NM_001286045		Approved		uc001pov.3	Q9Y580		ENST00000540163.1:c.593G>A	11.37:g.114278321G>A	ENSP00000439918:p.Arg198His	Somatic		Capture	Illumina HiSeq	Phase_I	113783531	NM_016090	B2R6K8|Q9NUT4	Missense_Mutation	SNP	ENST00000540163.1	37	CCDS8370.1	.	.	.	.	.	.	.	.	.	.	G	14.20	2.463879	0.43736	.	.	ENSG00000076053	ENST00000540163;ENST00000375490;ENST00000545678	T;T	0.30981	1.51;2.46	5.75	5.75	0.90469	.	0.113875	0.56097	D	0.000039	T	0.32526	0.0832	M	0.61703	1.905	0.50171	D	0.999851	P;B	0.35363	0.497;0.039	B;B	0.23716	0.048;0.007	T	0.21042	-1.0257	10	0.87932	D	0	-18.8709	18.53	0.90987	0.0:0.0:1.0:0.0	.	198;198	Q6IRX3;Q9Y580	.;RBM7_HUMAN	H	198;199;78	ENSP00000439918:R198H;ENSP00000364639:R199H	ENSP00000364639:R199H	R	+	2	0	RBM7	113783531	0.983000	0.35010	0.985000	0.45067	0.408000	0.30992	4.011000	0.57124	2.701000	0.92244	0.650000	0.86243	CGT		RBM7-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399010.1	NM_016090	
OR10G9	219870	broad.mit.edu	37	11	123893871	123893871	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr11:123893871C>T	ENST00000375024.1	+	1	152	c.152C>T	c.(151-153)tCt>tTt	p.S51F		NM_001001953.1	NP_001001953.1	Q8NGN4	O10G9_HUMAN	olfactory receptor, family 10, subfamily G, member 9	51						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S51F(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(33)|prostate(2)|skin(4)|stomach(8)|urinary_tract(1)	61		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		AGGGTGGATTCTCACCTCCAC	0.557																																					p.S51F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C152T	11						.						65.0	62.0	63.0					11																	123893871		2200	4277	6477	123399081	SO:0001583	missense	219870	exon1			AB065756	CCDS31703.1	11q24.1	2012-08-09			ENSG00000236981	ENSG00000236981		"""GPCR / Class A : Olfactory receptors"""	15129	protein-coding gene	gene with protein product				OR10G10P			Standard	NM_001001953		Approved		uc010sad.2	Q8NGN4	OTTHUMG00000165967	ENST00000375024.1:c.152C>T	11.37:g.123893871C>T	ENSP00000364164:p.Ser51Phe	Somatic		Capture	Illumina HiSeq	Phase_I	123399081	NM_001001953		Missense_Mutation	SNP	ENST00000375024.1	37	CCDS31703.1	.	.	.	.	.	.	.	.	.	.	C	13.94	2.385670	0.42308	.	.	ENSG00000236981	ENST00000375024	T	0.01099	5.34	3.33	3.33	0.38152	GPCR, rhodopsin-like superfamily (1);	0.284313	0.25487	N	0.030333	T	0.02727	0.0082	M	0.64080	1.96	0.09310	N	1	P	0.46578	0.88	P	0.51701	0.677	T	0.29397	-1.0013	10	0.87932	D	0	.	6.1811	0.20472	0.327:0.5013:0.1716:0.0	.	51	Q8NGN4	O10G9_HUMAN	F	51	ENSP00000364164:S51F	ENSP00000364164:S51F	S	+	2	0	OR10G9	123399081	0.000000	0.05858	0.480000	0.27341	0.985000	0.73830	-0.600000	0.05693	1.854000	0.53819	0.655000	0.94253	TCT		OR10G9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387269.1	NM_001001953	
OR52A5	390054	broad.mit.edu	37	11	5153865	5153865	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr11:5153865G>A	ENST00000307388.1	-	1	7	c.8C>T	c.(7-9)aCa>aTa	p.T3I		NM_001005160.2	NP_001005160.1	Q9H2C5	O52A5_HUMAN	olfactory receptor, family 52, subfamily A, member 5	3					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T3I(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(18)|skin(3)	35		Medulloblastoma(188;0.0049)|all_neural(188;0.0442)|Breast(177;0.0675)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.2)		GCCATTGAATGTCGGCATGAT	0.388																																					p.T3I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C8T	11						.						49.0	48.0	48.0					11																	5153865		2201	4294	6495	5110441	SO:0001583	missense	390054	exon1			BK004433	CCDS31373.1	11p15.4	2012-08-09			ENSG00000171944	ENSG00000171944		"""GPCR / Class A : Olfactory receptors"""	19580	protein-coding gene	gene with protein product							Standard	NM_001005160		Approved		uc010qyx.2	Q9H2C5	OTTHUMG00000066616	ENST00000307388.1:c.8C>T	11.37:g.5153865G>A	ENSP00000303469:p.Thr3Ile	Somatic		Capture	Illumina HiSeq	Phase_I	5110441	NM_001005160		Missense_Mutation	SNP	ENST00000307388.1	37	CCDS31373.1	.	.	.	.	.	.	.	.	.	.	G	4.355	0.065334	0.08388	.	.	ENSG00000171944	ENST00000307388	T	0.37235	1.21	5.12	-4.04	0.04010	.	2.326820	0.01862	N	0.036677	T	0.13072	0.0317	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.09335	-1.0679	10	0.17832	T	0.49	.	0.8988	0.01269	0.286:0.099:0.2555:0.3595	.	3	Q9H2C5	O52A5_HUMAN	I	3	ENSP00000303469:T3I	ENSP00000303469:T3I	T	-	2	0	OR52A5	5110441	0.000000	0.05858	0.000000	0.03702	0.107000	0.19398	-1.584000	0.02114	-0.286000	0.09076	0.585000	0.79938	ACA		OR52A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142823.1	NM_001005160	
DCHS1	8642	broad.mit.edu	37	11	6661968	6661968	+	Missense_Mutation	SNP	C	C	T	rs140867718		TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr11:6661968C>T	ENST00000299441.3	-	2	1288	c.877G>A	c.(877-879)Gag>Aag	p.E293K		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	293	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E293K(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CGGTTGATCTCGTAAGTCACA	0.607																																					p.E293K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G877A	11						.	C	LYS/GLU	0,4402		0,0,2201	89.0	82.0	84.0		877	5.0	1.0	11	dbSNP_134	84	4,8588	3.7+/-12.6	0,4,4292	yes	missense	DCHS1	NM_003737.2	56	0,4,6493	TT,TC,CC		0.0466,0.0,0.0308	probably-damaging	293/3299	6661968	4,12990	2201	4296	6497	6618544	SO:0001583	missense	8642	exon2			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.877G>A	11.37:g.6661968C>T	ENSP00000299441:p.Glu293Lys	Somatic		Capture	Illumina HiSeq	Phase_I	6618544	NM_003737	O15098	Missense_Mutation	SNP	ENST00000299441.3	37	CCDS7771.1	.	.	.	.	.	.	.	.	.	.	C	19.30	3.801866	0.70682	0.0	4.66E-4	ENSG00000166341	ENST00000299441	T	0.51071	0.72	5.01	5.01	0.66863	Cadherin (4);Cadherin-like (1);	0.000000	0.47093	D	0.000245	T	0.54581	0.1867	N	0.21282	0.65	0.50171	D	0.999857	D	0.71674	0.998	D	0.80764	0.994	T	0.51616	-0.8683	10	0.27082	T	0.32	.	17.3033	0.87188	0.0:1.0:0.0:0.0	.	293	Q96JQ0	PCD16_HUMAN	K	293	ENSP00000299441:E293K	ENSP00000299441:E293K	E	-	1	0	DCHS1	6618544	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	3.861000	0.56002	2.312000	0.78011	0.544000	0.68410	GAG		DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737	
LGR4	55366	broad.mit.edu	37	11	27389488	27389488	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr11:27389488G>A	ENST00000379214.4	-	18	3225	c.2782C>T	c.(2782-2784)Cga>Tga	p.R928*	LGR4_ENST00000389858.4_Nonsense_Mutation_p.R904*	NM_018490.2	NP_060960.2	Q9BXB1	LGR4_HUMAN	leucine-rich repeat containing G protein-coupled receptor 4	928					bone mineralization (GO:0030282)|bone remodeling (GO:0046849)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cell differentiation involved in metanephros development (GO:0072202)|epithelial cell proliferation (GO:0050673)|innate immune response (GO:0045087)|male genitalia development (GO:0030539)|metanephric glomerulus development (GO:0072224)|metanephric nephron tubule morphogenesis (GO:0072282)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast differentiation (GO:0001649)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)	p.R928*(1)		NS(3)|breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(10)|ovary(1)	32						AAGCAGGCTCGTCCACAGGCC	0.502																																					p.R928X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2782T	11						.						96.0	96.0	96.0					11																	27389488		2202	4299	6501	27346064	SO:0001587	stop_gained	55366	exon18			AF257182	CCDS31449.1	11p14-p13	2012-08-21	2011-01-25	2004-11-12	ENSG00000205213	ENSG00000205213		"""GPCR / Class A : Orphans"""	13299	protein-coding gene	gene with protein product		606666	"""G protein-coupled receptor 48"", ""leucine-rich repeat-containing G protein-coupled receptor 4"""	GPR48		10894923	Standard	NM_018490		Approved		uc001mrj.4	Q9BXB1	OTTHUMG00000133508	ENST00000379214.4:c.2782C>T	11.37:g.27389488G>A	ENSP00000368516:p.Arg928*	Somatic		Capture	Illumina HiSeq	Phase_I	27346064	NM_018490	A6NCH3|G5E9B3|Q8N537|Q9NYD1	Nonsense_Mutation	SNP	ENST00000379214.4	37	CCDS31449.1	.	.	.	.	.	.	.	.	.	.	G	43	9.831154	0.99275	.	.	ENSG00000205213	ENST00000379214;ENST00000389858	.	.	.	5.88	3.96	0.45880	.	0.057593	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.181	0.72960	0.0:0.0:0.7421:0.2579	.	.	.	.	X	928;904	.	ENSP00000368516:R928X	R	-	1	2	LGR4	27346064	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.376000	0.66178	0.789000	0.33779	0.555000	0.69702	CGA		LGR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257467.1	NM_018490	
OR5M8	219484	broad.mit.edu	37	11	56258503	56258503	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr11:56258503G>C	ENST00000327216.2	-	1	368	c.344C>G	c.(343-345)gCt>gGt	p.A115G		NM_001005282.1	NP_001005282.1	Q8NGP6	OR5M8_HUMAN	olfactory receptor, family 5, subfamily M, member 8	115						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A115G(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(22)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	Esophageal squamous(21;0.00352)					GGCCATCACAGCCAGGATGTA	0.478																																					p.A115G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C344G	11						.						111.0	94.0	100.0					11																	56258503		2201	4296	6497	56015079	SO:0001583	missense	219484	exon1			AB065744	CCDS31533.1	11q11	2012-08-09			ENSG00000181371	ENSG00000181371		"""GPCR / Class A : Olfactory receptors"""	14846	protein-coding gene	gene with protein product							Standard	NM_001005282		Approved		uc001nix.1	Q8NGP6	OTTHUMG00000166877	ENST00000327216.2:c.344C>G	11.37:g.56258503G>C	ENSP00000323354:p.Ala115Gly	Somatic		Capture	Illumina HiSeq	Phase_I	56015079	NM_001005282	B2RNM5|Q6IEW3|Q96RB8	Missense_Mutation	SNP	ENST00000327216.2	37	CCDS31533.1	.	.	.	.	.	.	.	.	.	.	G	14.55	2.568910	0.45798	.	.	ENSG00000181371	ENST00000327216	T	0.02032	4.49	4.41	3.47	0.39725	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39834	N	0.001248	T	0.07593	0.0191	M	0.67569	2.06	0.09310	N	1	P	0.50943	0.94	P	0.58721	0.844	T	0.02464	-1.1155	10	0.62326	D	0.03	-17.34	9.7293	0.40350	0.1036:0.0:0.8964:0.0	.	115	Q8NGP6	OR5M8_HUMAN	G	115	ENSP00000323354:A115G	ENSP00000323354:A115G	A	-	2	0	OR5M8	56015079	0.100000	0.21855	0.984000	0.44739	0.597000	0.36814	2.482000	0.45224	2.157000	0.67596	0.638000	0.83543	GCT		OR5M8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391641.1	NM_001005282	
TUT1	64852	broad.mit.edu	37	11	62348678	62348678	+	Splice_Site	SNP	C	C	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr11:62348678C>T	ENST00000476907.1	-	4	1281	c.590G>A	c.(589-591)gGc>gAc	p.G197D	TUT1_ENST00000308436.7_Splice_Site_p.G235D|MIR3654_ENST00000496634.2_Splice_Site_p.G197D			Q9H6E5	STPAP_HUMAN	terminal uridylyl transferase 1, U6 snRNA-specific	197					mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|snRNA processing (GO:0016180)	intercellular bridge (GO:0045171)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mRNA 3'-UTR binding (GO:0003730)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)|RNA uridylyltransferase activity (GO:0050265)	p.G197D(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						GACCACACAGCCTGGGTGCCG	0.507																																					p.G235D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G704A	11						.						82.0	76.0	78.0					11																	62348678		2202	4299	6501	62105254	SO:0001630	splice_region_variant	64852	exon4			BC005013	CCDS8021.1, CCDS8021.2	11q12.2	2014-03-05	2006-10-06	2006-10-06	ENSG00000149016	ENSG00000149016	2.7.7.52	"""RNA binding motif (RRM) containing"""	26184	protein-coding gene	gene with protein product	"""RNA uridylyltransferase"", ""U6 TUTase"", ""TUTase 6"""	610641	"""RNA binding motif protein 21"""	RBM21		16790842	Standard	NM_022830		Approved	FLJ22347, FLJ22267, FLJ21850, PAPD2, TUTase	uc001nto.2	Q9H6E5	OTTHUMG00000158564	ENST00000476907.1:c.590-1G>A	11.37:g.62348678C>T		Somatic		Capture	Illumina HiSeq	Phase_I	62105254	NM_022830	A1A527|A8K995|Q2NL65|Q7L583|Q9H6H7	Missense_Mutation	SNP	ENST00000476907.1	37		.	.	.	.	.	.	.	.	.	.	C	16.74	3.207486	0.58343	.	.	ENSG00000149016	ENST00000308436;ENST00000476907;ENST00000494385	T;T;T	0.39229	1.09;1.09;1.09	5.5	5.5	0.81552	.	0.655470	0.16037	N	0.232575	T	0.40670	0.1126	N	0.17872	0.535	0.37914	D	0.931454	D	0.61080	0.989	P	0.52710	0.707	T	0.18053	-1.0349	10	0.16420	T	0.52	.	16.9396	0.86213	0.0:1.0:0.0:0.0	.	235	F5H0R1	.	D	235;197;111	ENSP00000308000:G235D;ENSP00000419607:G197D;ENSP00000420739:G111D	ENSP00000441670:G197D	G	-	2	0	TUT1	62105254	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	4.772000	0.62324	2.576000	0.86940	0.555000	0.69702	GGC		TUT1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000351319.2	NM_022830	Missense_Mutation
CAPN1	823	broad.mit.edu	37	11	64953733	64953733	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr11:64953733G>A	ENST00000527323.1	+	5	923	c.683G>A	c.(682-684)cGc>cAc	p.R228H	CAPN1_ENST00000524773.1_Missense_Mutation_p.R228H|CAPN1_ENST00000533820.1_Missense_Mutation_p.R228H|CAPN1_ENST00000533129.1_Missense_Mutation_p.R228H|CAPN1_ENST00000279247.6_Missense_Mutation_p.R228H			P07384	CAN1_HUMAN	calpain 1, (mu/I) large subunit	228	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell proliferation (GO:0008284)|proteolysis (GO:0006508)|receptor catabolic process (GO:0032801)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)	p.R228H(1)		breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	13		Lung NSC(402;0.094)|Melanoma(852;0.16)		Lung(977;0.00168)|LUSC - Lung squamous cell carcinoma(976;0.00813)		TACGAGTTGCGCAAGGCTCCC	0.637																																					p.R228H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G683A	11						.						39.0	45.0	43.0					11																	64953733		2001	4160	6161	64710309	SO:0001583	missense	823	exon6			X04366	CCDS44644.1	11q13	2013-01-10			ENSG00000014216	ENSG00000014216	3.4.22.52	"""EF-hand domain containing"""	1476	protein-coding gene	gene with protein product		114220				3017764, 2209092	Standard	NM_005186		Approved	muCANP, muCL, CANP, CANPL1	uc009yqd.2	P07384	OTTHUMG00000165614	ENST00000527323.1:c.683G>A	11.37:g.64953733G>A	ENSP00000431984:p.Arg228His	Somatic		Capture	Illumina HiSeq	Phase_I	64710309	NM_001198868	Q2TTR0|Q6DHV4	Missense_Mutation	SNP	ENST00000527323.1	37	CCDS44644.1	.	.	.	.	.	.	.	.	.	.	G	11.67	1.708746	0.30322	.	.	ENSG00000014216	ENST00000533820;ENST00000533129;ENST00000524773;ENST00000279247;ENST00000259755;ENST00000527323;ENST00000526468	D;D;D;D;D;D	0.88818	-2.43;-2.43;-2.43;-2.43;-2.43;-2.43	4.53	2.63	0.31362	Peptidase C2, calpain, catalytic domain (3);	0.479915	0.19439	N	0.114239	D	0.87120	0.6098	M	0.65498	2.005	0.23754	N	0.996932	B	0.33883	0.43	B	0.39531	0.302	T	0.79983	-0.1573	10	0.87932	D	0	.	6.1585	0.20350	0.3291:0.0:0.6709:0.0	.	228	P07384	CAN1_HUMAN	H	228;228;228;228;174;228;123	ENSP00000435272:R228H;ENSP00000431686:R228H;ENSP00000434176:R228H;ENSP00000279247:R228H;ENSP00000431984:R228H;ENSP00000433366:R123H	ENSP00000259755:R174H	R	+	2	0	CAPN1	64710309	0.000000	0.05858	0.543000	0.28128	0.210000	0.24377	0.498000	0.22530	0.353000	0.24079	0.563000	0.77884	CGC		CAPN1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385325.1		
PCNXL3	399909	broad.mit.edu	37	11	65384319	65384319	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr11:65384319G>T	ENST00000355703.3	+	2	717	c.178G>T	c.(178-180)Gcc>Tcc	p.A60S	MAP3K11_ENST00000309100.3_5'Flank	NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	60						integral component of membrane (GO:0016021)		p.A60S(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						CTTGATGGTGGCCGGCGTGTA	0.527																																					p.A60S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G178T	11						.						72.0	76.0	75.0					11																	65384319		2051	4196	6247	65140895	SO:0001583	missense	399909	exon2			BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	ENST00000355703.3:c.178G>T	11.37:g.65384319G>T	ENSP00000347931:p.Ala60Ser	Somatic		Capture	Illumina HiSeq	Phase_I	65140895	NM_032223	Q6MZN8	Missense_Mutation	SNP	ENST00000355703.3	37	CCDS44650.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.558128	0.86231	.	.	ENSG00000197136	ENST00000355703	T	0.61980	0.06	4.37	4.37	0.52481	.	0.282138	0.12284	U	0.482618	T	0.64438	0.2598	L	0.61218	1.895	0.32065	N	0.595237	D	0.58268	0.982	P	0.48627	0.584	T	0.68838	-0.5303	10	0.45353	T	0.12	.	9.9291	0.41512	0.0:0.0:0.7971:0.2029	.	60	Q9H6A9	PCX3_HUMAN	S	60	ENSP00000347931:A60S	ENSP00000347931:A60S	A	+	1	0	PCNXL3	65140895	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	6.954000	0.76001	2.428000	0.82296	0.561000	0.74099	GCC		PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390321.1	NM_032223	
SHANK2	22941	broad.mit.edu	37	11	70332927	70332927	+	Silent	SNP	G	G	A	rs556412006		TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr11:70332927G>A	ENST00000423696.2	-	15	2370	c.2334C>T	c.(2332-2334)ttC>ttT	p.F778F	SHANK2_ENST00000409161.1_Silent_p.F561F|SHANK2_ENST00000449833.2_Silent_p.F562F|SHANK2_ENST00000338508.4_Silent_p.F1158F			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	778					adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)	p.F1158F(1)|p.F562F(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			CGCCACCCACGAAATGGTTTT	0.672													G|||	1	0.000199681	0.0	0.0	5008	,	,		14779	0.001		0.0	False		,,,				2504	0.0				p.R1094C												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C3280T	11						.						31.0	37.0	35.0					11																	70332927		2199	4288	6487	70010575	SO:0001819	synonymous_variant	22941	exon22			AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.2334C>T	11.37:g.70332927G>A		Somatic		Capture	Illumina HiSeq	Phase_I	70010575	NM_012309	C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Silent	SNP	ENST00000423696.2	37																																																																																					SHANK2-203	KNOWN	basic	protein_coding	protein_coding		NM_012309	
OR10G7	390265	broad.mit.edu	37	11	123909584	123909584	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr11:123909584A>T	ENST00000330487.5	-	1	133	c.125T>A	c.(124-126)cTc>cAc	p.L42H		NM_001004463.1	NP_001004463.1	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G, member 7	42						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(6)|lung(20)|ovary(2)|prostate(2)|stomach(3)|urinary_tract(1)	47		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		CAGCAGGATGAGGAGGTTCCC	0.577																																					p.L42H												.	.	0			c.T125A	11						.						47.0	44.0	45.0					11																	123909584		2200	4291	6491	123414794	SO:0001583	missense	390265	exon1			AB065754	CCDS31705.1	11q24.1	2012-08-09			ENSG00000182634	ENSG00000182634		"""GPCR / Class A : Olfactory receptors"""	14842	protein-coding gene	gene with protein product							Standard	NM_001004463		Approved		uc001pzq.1	Q8NGN6	OTTHUMG00000165969	ENST00000330487.5:c.125T>A	11.37:g.123909584A>T	ENSP00000329689:p.Leu42His	None		Capture	Illumina HiSeq	Phase_I	123414794	NM_001004463	Q6IFE8	Missense_Mutation	SNP	ENST00000330487.5	37	CCDS31705.1	.	.	.	.	.	.	.	.	.	.	A	14.40	2.524832	0.44969	.	.	ENSG00000182634	ENST00000330487	T	0.02890	4.12	3.53	3.53	0.40419	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44097	D	0.000499	T	0.21103	0.0508	H	0.95151	3.63	0.34360	D	0.690861	D	0.76494	0.999	D	0.72338	0.977	T	0.51442	-0.8705	10	0.72032	D	0.01	.	12.1998	0.54319	1.0:0.0:0.0:0.0	.	42	Q8NGN6	O10G7_HUMAN	H	42	ENSP00000329689:L42H	ENSP00000329689:L42H	L	-	2	0	OR10G7	123414794	0.062000	0.20869	0.996000	0.52242	0.467000	0.32768	0.717000	0.25851	1.613000	0.50231	0.455000	0.32223	CTC		OR10G7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387271.1	NM_001004463	
SART3	9733	broad.mit.edu	37	12	108932758	108932758	+	Silent	SNP	G	G	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr12:108932758G>A	ENST00000228284.3	-	7	1248	c.1014C>T	c.(1012-1014)gtC>gtT	p.V338V	SART3_ENST00000431469.2_Silent_p.V338V	NM_014706.3	NP_055521.1	Q15020	SART3_HUMAN	squamous cell carcinoma antigen recognized by T cells 3	338					cell morphogenesis (GO:0000902)|hematopoietic stem cell proliferation (GO:0071425)|homeostasis of number of cells (GO:0048872)|regulation of gene expression (GO:0010468)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.V338V(1)		NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|stomach(1)	25						GGCAGTTCTCGACCAGGGCGC	0.423									Porokeratosis																												p.V338V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1014T	12						.						100.0	90.0	93.0					12																	108932758		2203	4300	6503	107456888	SO:0001819	synonymous_variant	9733	exon7	Familial Cancer Database	incl.: Porokeratosis of Mibelli, Disseminated Superficial Actinic Porokertosis, Porokeratosis Palmaris Plantaris et Disseminata, Porokeratosis Punctata Palmaris et Plantaris, Linear Porokeratosis	AB020880	CCDS9117.1	12q24.11	2013-02-12	2006-12-07			ENSG00000075856		"""RNA binding motif (RRM) containing"""	16860	protein-coding gene	gene with protein product		611684	"""squamous cell carcinoma antigen recognised by T cells 3"""			12032085, 15840095, 20595234	Standard	NM_014706		Approved	KIAA0156, RP11-13G14, TIP110, p110	uc001tmz.1	Q15020	OTTHUMG00000169449	ENST00000228284.3:c.1014C>T	12.37:g.108932758G>A		Somatic		Capture	Illumina HiSeq	Phase_I	107456888	NM_014706	A8K2E4|Q2M2H0|Q58F06|Q8IUS1|Q96J95	Silent	SNP	ENST00000228284.3	37	CCDS9117.1																																																																																				SART3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404094.1		
GPR19	2842	broad.mit.edu	37	12	12814910	12814910	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr12:12814910G>T	ENST00000540510.1	-	2	665	c.473C>A	c.(472-474)tCc>tAc	p.S158Y	GPR19_ENST00000332427.2_Missense_Mutation_p.S158Y			P46093	GPR4_HUMAN	G protein-coupled receptor 19	110					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.S158Y(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	17		Prostate(47;0.0802)		BRCA - Breast invasive adenocarcinoma(232;0.048)		TATGCAGATGGAGAGGAGAAC	0.488																																					p.S158Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C473A	12						.						146.0	123.0	131.0					12																	12814910		2203	4300	6503	12706177	SO:0001583	missense	2842	exon4				CCDS8652.1	12p12.3	2014-01-30				ENSG00000183150		"""GPCR / Class A : Orphans"""	4473	protein-coding gene	gene with protein product		602927					Standard	NM_006143		Approved		uc001raq.2	Q15760		ENST00000540510.1:c.473C>A	12.37:g.12814910G>T	ENSP00000441832:p.Ser158Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	12706177	NM_006143	A8K3T3|B0M0K1|Q6NWM4	Missense_Mutation	SNP	ENST00000540510.1	37	CCDS8652.1	.	.	.	.	.	.	.	.	.	.	G	13.66	2.303353	0.40795	.	.	ENSG00000183150	ENST00000540510;ENST00000332427	T;T	0.19806	2.12;2.12	5.67	4.76	0.60689	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.44932	0.1317	M	0.66939	2.045	0.58432	D	0.999996	D	0.69078	0.997	D	0.69479	0.964	T	0.47935	-0.9078	10	0.87932	D	0	-18.0559	16.1612	0.81712	0.0:0.1338:0.8662:0.0	.	158	Q15760	GPR19_HUMAN	Y	158	ENSP00000441832:S158Y;ENSP00000333744:S158Y	ENSP00000333744:S158Y	S	-	2	0	GPR19	12706177	1.000000	0.71417	1.000000	0.80357	0.020000	0.10135	9.793000	0.99091	1.359000	0.45940	0.561000	0.74099	TCC		GPR19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400662.1	NM_006143	
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000311936.3_Missense_Mutation_p.G12V|KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12V	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0 	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35T	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	12.37:g.25398284C>A	ENSP00000256078:p.Gly12Val	Somatic		Capture	Illumina HiSeq	Phase_I	25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
ASUN	55726	broad.mit.edu	37	12	27064230	27064230	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr12:27064230C>T	ENST00000261191.7	-	15	2362	c.1826G>A	c.(1825-1827)cGt>cAt	p.R609H	ASUN_ENST00000539625.1_Missense_Mutation_p.R508H	NM_018164.2	NP_060634.2	Q9NVM9	ASUN_HUMAN	asunder spermatogenesis regulator	609					centrosome localization (GO:0051642)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|protein localization to nuclear envelope (GO:0090435)|regulation of fertilization (GO:0080154)|regulation of mitotic cell cycle (GO:0007346)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.R609H(2)									TTCTTTTCCACGCTCTAAGAT	0.333																																					p.R609H												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G1826A	12						.						88.0	87.0	88.0					12																	27064230		2203	4299	6502	26955497	SO:0001583	missense	55726	exon15			AK001222	CCDS8708.1	12p12.3	2013-05-08	2013-05-08	2011-12-09	ENSG00000064102	ENSG00000064102			20174	protein-coding gene	gene with protein product	"""spermatogenesis associated 30"""	615079	"""chromosome 12 open reading frame 11"", ""asunder, spermatogenesis regulator homolog (Drosphila)"""	C12orf11		12414650, 19357193, 23097494	Standard	NM_018164		Approved	FLJ10637, NET48, Mat89Bb, SPATA30	uc001rhk.4	Q9NVM9	OTTHUMG00000169193	ENST00000261191.7:c.1826G>A	12.37:g.27064230C>T	ENSP00000261191:p.Arg609His	Somatic		Capture	Illumina HiSeq	Phase_I	26955497	NM_018164	B4DNK1|Q86WE2|Q96HM2|Q9BTX2|Q9NTB6|Q9NVM5	Missense_Mutation	SNP	ENST00000261191.7	37	CCDS8708.1	.	.	.	.	.	.	.	.	.	.	C	19.62	3.861210	0.71949	.	.	ENSG00000064102	ENST00000538155;ENST00000261191;ENST00000539625;ENST00000335745	T;T;T	0.44881	0.91;0.91;0.91	5.4	4.52	0.55395	.	0.131721	0.49916	N	0.000133	T	0.35422	0.0931	L	0.47716	1.5	0.51767	D	0.999937	B;B	0.14012	0.002;0.009	B;B	0.10450	0.005;0.003	T	0.13229	-1.0517	10	0.15066	T	0.55	-10.5037	14.2541	0.66040	0.0:0.9282:0.0:0.0718	.	609;508	Q9NVM9;B4DNK1	M89BB_HUMAN;.	H	256;609;508;196	ENSP00000445645:R256H;ENSP00000261191:R609H;ENSP00000443724:R508H	ENSP00000261191:R609H	R	-	2	0	C12orf11	26955497	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.212000	0.58514	1.428000	0.47296	0.561000	0.74099	CGT		ASUN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402819.1	NM_018164	
COL2A1	1280	broad.mit.edu	37	12	48391435	48391435	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr12:48391435C>G	ENST00000380518.3	-	7	649	c.485G>C	c.(484-486)gGc>gCc	p.G162A	COL2A1_ENST00000337299.6_Missense_Mutation_p.G93A	NM_001844.4|NM_033150.2	NP_001835.3|NP_149162.2	P02458	CO2A1_HUMAN	collagen, type II, alpha 1	162					axon guidance (GO:0007411)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to BMP stimulus (GO:0071773)|central nervous system development (GO:0007417)|chondrocyte differentiation (GO:0002062)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal joint morphogenesis (GO:0060272)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|limb bud formation (GO:0060174)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|notochord development (GO:0030903)|otic vesicle development (GO:0071599)|palate development (GO:0060021)|proteoglycan metabolic process (GO:0006029)|regulation of gene expression (GO:0010468)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen type II trimer (GO:0005585)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)	p.G162A(1)|p.G93A(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(3)	64		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	accaggggggccaggATTTCC	0.572																																					p.G93A												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G278C	12						.						42.0	47.0	45.0					12																	48391435		2202	4300	6502	46677702	SO:0001583	missense	1280	exon6			X16468	CCDS8759.1, CCDS41778.1	12q12-q13.2	2013-11-14	2008-02-04		ENSG00000139219	ENSG00000139219		"""Collagens"""	2200	protein-coding gene	gene with protein product		120140	"""collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)"", ""arthroophthalmopathy, progressive (Stickler syndrome)"""	SEDC, AOM		1677770	Standard	NM_033150		Approved	STL1	uc001rqu.3	P02458	OTTHUMG00000149896	ENST00000380518.3:c.485G>C	12.37:g.48391435C>G	ENSP00000369889:p.Gly162Ala	Somatic		Capture	Illumina HiSeq	Phase_I	46677702	NM_033150	A6NGA0|Q12985|Q14009|Q14044|Q14045|Q14046|Q14047|Q14056|Q14058|Q16672|Q1JQ82|Q2V4X7|Q6LBY1|Q6LBY2|Q6LBY3|Q96IT5|Q99227|Q9UE38|Q9UE39|Q9UE40|Q9UE41|Q9UE42|Q9UE43	Missense_Mutation	SNP	ENST00000380518.3	37	CCDS41778.1	.	.	.	.	.	.	.	.	.	.	C	18.40	3.616735	0.66672	.	.	ENSG00000139219	ENST00000380518;ENST00000395281;ENST00000337299	D;D	0.99607	-6.27;-6.27	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	D	0.99704	0.9887	M	0.92317	3.295	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.91635	0.994;0.999	D	0.97543	1.0087	10	0.66056	D	0.02	.	17.375	0.87390	0.0:1.0:0.0:0.0	.	93;162	P02458-1;P02458	.;CO2A1_HUMAN	A	162;93;93	ENSP00000369889:G162A;ENSP00000338213:G93A	ENSP00000338213:G93A	G	-	2	0	COL2A1	46677702	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.252000	0.78309	2.712000	0.92718	0.650000	0.86243	GGC		COL2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313810.2	NM_001844	
RASAL1	8437	broad.mit.edu	37	12	113537857	113537857	+	Silent	SNP	G	G	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr12:113537857G>A	ENST00000261729.5	-	22	2607	c.2292C>T	c.(2290-2292)gtC>gtT	p.V764V	RASAL1_ENST00000446861.3_Silent_p.V736V|RASAL1_ENST00000546530.1_Silent_p.V766V|RASAL1_ENST00000418411.2_5'Flank|RASAL1_ENST00000548055.1_Silent_p.V765V			O95294	RASL1_HUMAN	RAS protein activator like 1 (GAP1 like)	764					intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	metal ion binding (GO:0046872)|phospholipid binding (GO:0005543)|Ras GTPase activator activity (GO:0005099)	p.V764V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(3)|prostate(2)|skin(2)	43						GCCGGGCCAGGACCTCAGGAC	0.652																																					p.V764V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2292T	12						.						19.0	22.0	21.0					12																	113537857		2203	4299	6502	112022240	SO:0001819	synonymous_variant	8437	exon22			AF086713	CCDS9165.1, CCDS55888.1, CCDS55889.1, CCDS73529.1	12q23-q24	2013-01-10			ENSG00000111344	ENSG00000111344		"""Pleckstrin homology (PH) domain containing"""	9873	protein-coding gene	gene with protein product		604118				9751798	Standard	NM_001193520		Approved	RASAL	uc001tul.3	O95294	OTTHUMG00000169705	ENST00000261729.5:c.2292C>T	12.37:g.113537857G>A		Somatic		Capture	Illumina HiSeq	Phase_I	112022240	NM_004658	B7ZKM4|C9JFK5|F8VQX1|Q52M03|Q59H24|Q96CC7	Silent	SNP	ENST00000261729.5	37	CCDS9165.1																																																																																				RASAL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405522.2	NM_004658	
RNF17	56163	broad.mit.edu	37	13	25428235	25428235	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr13:25428235G>T	ENST00000255324.5	+	25	3615	c.3563G>T	c.(3562-3564)aGc>aTc	p.S1188I	RNF17_ENST00000339524.3_Missense_Mutation_p.S240I|RNF17_ENST00000381921.1_Missense_Mutation_p.S1188I	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	1188					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.S1188I(1)		NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		GCAACAGTCAGCTGTGTTGGT	0.408																																					p.S1184I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3551T	13						.						128.0	127.0	127.0					13																	25428235		2203	4300	6503	24326235	SO:0001583	missense	56163	exon25			AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.3563G>T	13.37:g.25428235G>T	ENSP00000255324:p.Ser1188Ile	Somatic		Capture	Illumina HiSeq	Phase_I	24326235	NM_001184993	Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Missense_Mutation	SNP	ENST00000255324.5	37	CCDS9308.2	.	.	.	.	.	.	.	.	.	.	G	16.06	3.014614	0.54468	.	.	ENSG00000132972	ENST00000255324;ENST00000381921;ENST00000429047;ENST00000418120;ENST00000339524	T;T;T;T	0.11712	2.75;2.75;2.75;2.75	4.86	0.912	0.19349	Maternal tudor protein (1);	0.175542	0.48286	D	0.000191	T	0.20007	0.0481	L	0.34521	1.04	0.80722	D	1	D;D;P;D	0.71674	0.993;0.998;0.835;0.998	P;D;P;D	0.66602	0.889;0.921;0.466;0.945	T	0.00334	-1.1809	10	0.62326	D	0.03	-2.6213	15.4557	0.75311	0.0:0.5365:0.4635:0.0	.	1184;240;1188;1188	B7Z7S1;Q5T6R1;Q9BXT8-5;Q9BXT8	.;.;.;RNF17_HUMAN	I	1188;1188;1047;512;240	ENSP00000255324:S1188I;ENSP00000371346:S1188I;ENSP00000388892:S512I;ENSP00000344776:S240I	ENSP00000255324:S1188I	S	+	2	0	RNF17	24326235	1.000000	0.71417	0.991000	0.47740	0.943000	0.58893	0.534000	0.23098	0.022000	0.15160	-0.282000	0.10007	AGC		RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044217.1	NM_031994	
DCLK1	9201	broad.mit.edu	37	13	36700082	36700082	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr13:36700082C>T	ENST00000360631.3	-	2	404	c.193G>A	c.(193-195)Gga>Aga	p.G65R	DCLK1_ENST00000379892.4_Missense_Mutation_p.G65R|DCLK1_ENST00000255448.4_Missense_Mutation_p.G65R			O15075	DCLK1_HUMAN	doublecortin-like kinase 1	65	Doublecortin 1. {ECO:0000255|PROSITE- ProRule:PRU00072}.				axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)	p.G65R(2)		breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		TATCGATCTCCGTTTCGATAG	0.557																																					p.G65R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G193A	13						.						102.0	92.0	95.0					13																	36700082		2203	4300	6503	35598082	SO:0001583	missense	9201	exon2			AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.193G>A	13.37:g.36700082C>T	ENSP00000353846:p.Gly65Arg	Somatic		Capture	Illumina HiSeq	Phase_I	35598082	NM_004734	B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Missense_Mutation	SNP	ENST00000360631.3	37		.	.	.	.	.	.	.	.	.	.	C	32	5.115741	0.94339	.	.	ENSG00000133083	ENST00000255448;ENST00000360631;ENST00000539451;ENST00000379892	D;D;D	0.95272	-3.66;-3.66;-3.66	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	D	0.98488	0.9496	H	0.97564	4.03	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99331	1.0909	10	0.87932	D	0	.	19.7606	0.96314	0.0:1.0:0.0:0.0	.	65	O15075-2	.	R	65	ENSP00000255448:G65R;ENSP00000353846:G65R;ENSP00000369222:G65R	ENSP00000255448:G65R	G	-	1	0	DCLK1	35598082	1.000000	0.71417	0.991000	0.47740	0.892000	0.51952	7.643000	0.83403	2.671000	0.90904	0.650000	0.86243	GGA		DCLK1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000044487.1	NM_004734	
SPG20	23111	broad.mit.edu	37	13	36909170	36909170	+	Silent	SNP	G	G	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr13:36909170G>T	ENST00000451493.1	-	2	1015	c.798C>A	c.(796-798)ccC>ccA	p.P266P	SPG20_ENST00000355182.4_Silent_p.P266P|SPG20_ENST00000438666.2_Silent_p.P266P|SPG20_ENST00000494062.2_Silent_p.P266P|SPG20_ENST00000495510.1_5'UTR	NM_001142295.1	NP_001135767.1	Q8N0X7	SPG20_HUMAN	spastic paraplegia 20 (Troyer syndrome)	266					abscission (GO:0009838)|adipose tissue development (GO:0060612)|cell death (GO:0008219)|cell division (GO:0051301)|lipid particle organization (GO:0034389)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of collateral sprouting in absence of injury (GO:0048698)|neuromuscular process (GO:0050905)|regulation of mitochondrial membrane potential (GO:0051881)	cytoplasm (GO:0005737)|lipid particle (GO:0005811)|midbody (GO:0030496)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ubiquitin protein ligase binding (GO:0031625)	p.P266P(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	27		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;2.42e-08)|Epithelial(112;1.58e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00128)|BRCA - Breast invasive adenocarcinoma(63;0.0125)|GBM - Glioblastoma multiforme(144;0.026)		GAAGAAACCCGGGAGGACGGT	0.388																																					p.P266P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C798A	13						.						86.0	94.0	91.0					13																	36909170		2203	4299	6502	35807170	SO:0001819	synonymous_variant	23111	exon2			AB011182	CCDS9356.1	13q13.1	2008-07-04	2007-04-23		ENSG00000133104	ENSG00000133104			18514	protein-coding gene	gene with protein product	"""spartin"""	607111				6022528, 12134148	Standard	NM_001142294		Approved	KIAA0610, TAHCCP1	uc001uvm.3	Q8N0X7	OTTHUMG00000016730	ENST00000451493.1:c.798C>A	13.37:g.36909170G>T		Somatic		Capture	Illumina HiSeq	Phase_I	35807170	NM_001142295	O60349|Q86Y67|Q9H1T2|Q9H1T3	Silent	SNP	ENST00000451493.1	37	CCDS9356.1																																																																																				SPG20-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044494.2		
TSC22D1	8848	broad.mit.edu	37	13	45147955	45147955	+	Silent	SNP	T	T	C			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr13:45147955T>C	ENST00000458659.2	-	1	2746	c.2256A>G	c.(2254-2256)tcA>tcG	p.S752S	TSC22D1_ENST00000460842.1_5'Flank|TSC22D1_ENST00000501704.2_Intron	NM_183422.3	NP_904358.2	Q15714	T22D1_HUMAN	TSC22 domain family, member 1	752	Gln-rich.				negative regulation of apoptotic process (GO:0043066)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S752S(1)		breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_hematologic(4;8.74e-08)|Acute lymphoblastic leukemia(4;1.78e-07)|Lung NSC(96;2.21e-05)|Breast(139;0.000625)|Prostate(109;0.000947)|Hepatocellular(98;0.0202)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;0.000522)|BRCA - Breast invasive adenocarcinoma(63;0.118)		GCTGAATAACTGAAGGTGGAA	0.502																																					p.S752S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A2256G	13						.						64.0	65.0	65.0					13																	45147955		2203	4300	6503	44045955	SO:0001819	synonymous_variant	8848	exon1			AJ222700	CCDS9392.1, CCDS31966.1, CCDS58291.1, CCDS73565.1	13q14	2008-02-05	2005-03-01	2005-03-03	ENSG00000102804	ENSG00000102804			16826	protein-coding gene	gene with protein product		607715	"""transforming growth factor beta 1 induced transcript 4"""	TGFB1I4		8651929, 9022669	Standard	NM_183422		Approved	TSC22, MGC17597	uc001uzn.4	Q15714	OTTHUMG00000016838	ENST00000458659.2:c.2256A>G	13.37:g.45147955T>C		Somatic		Capture	Illumina HiSeq	Phase_I	44045955	NM_183422	B3KRL7|B9EGI0|O00666|Q6AHX5|Q6IBU1|Q8NCN1|Q96JS5	Silent	SNP	ENST00000458659.2	37	CCDS31966.1																																																																																				TSC22D1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044743.2	NM_006022	
SPACA7	122258	broad.mit.edu	37	13	113055411	113055411	+	Silent	SNP	C	C	T	rs140194752		TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr13:113055411C>T	ENST00000283550.3	+	5	445	c.378C>T	c.(376-378)ggC>ggT	p.G126G	SPACA7_ENST00000375699.3_Silent_p.G95G	NM_145248.4	NP_660291.2	Q96KW9	SPAC7_HUMAN	sperm acrosome associated 7	126						acrosomal vesicle (GO:0001669)|extracellular region (GO:0005576)		p.G126G(1)		large_intestine(5)|lung(4)|skin(3)|urinary_tract(1)	13						atctccatggcgatccttctg	0.428																																					p.G126G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C378T	13						.	C		0,4406		0,0,2203	132.0	116.0	121.0		378	-1.5	0.0	13	dbSNP_134	121	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SPACA7	NM_145248.4		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		126/196	113055411	1,13005	2203	4300	6503	112103412	SO:0001819	synonymous_variant	122258	exon5			BC016750	CCDS9524.1	13q34	2013-10-11	2011-03-15	2011-03-15	ENSG00000153498	ENSG00000153498			29575	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 28"""	C13orf28		22495889	Standard	NM_145248		Approved		uc001vsd.2	Q96KW9	OTTHUMG00000017365	ENST00000283550.3:c.378C>T	13.37:g.113055411C>T		Somatic		Capture	Illumina HiSeq	Phase_I	112103412	NM_145248	Q5T8L1	Silent	SNP	ENST00000283550.3	37	CCDS9524.1																																																																																				SPACA7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045820.2	NM_145248	
PPP1R36	145376	broad.mit.edu	37	14	65053957	65053957	+	Missense_Mutation	SNP	C	C	T	rs140512732		TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr14:65053957C>T	ENST00000298705.1	+	10	853	c.757C>T	c.(757-759)Cgt>Tgt	p.R253C	RP11-973N13.3_ENST00000556634.1_RNA|RP11-973N13.3_ENST00000554454.1_RNA	NM_172365.1	NP_758953.1	Q96LQ0	PPR36_HUMAN	protein phosphatase 1, regulatory subunit 36	253					negative regulation of phosphatase activity (GO:0010923)		phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)	p.R253C(1)									TGTCTTCCGACGTCAACACTT	0.413																																					p.R253C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C757T	14						.	C	CYS/ARG	0,4406		0,0,2203	140.0	131.0	134.0		757	5.6	1.0	14	dbSNP_134	134	1,8599	1.2+/-3.3	0,1,4299	no	missense	C14orf50	NM_172365.1	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	253/423	65053957	1,13005	2203	4300	6503	64123710	SO:0001583	missense	145376	exon10				CCDS9767.1	14q23.2	2012-04-17	2011-10-11	2011-10-11	ENSG00000165807	ENSG00000165807		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	20097	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 50"""	C14orf50			Standard	NM_172365		Approved		uc001xhl.1	Q96LQ0	OTTHUMG00000141316	ENST00000298705.1:c.757C>T	14.37:g.65053957C>T	ENSP00000298705:p.Arg253Cys	Somatic		Capture	Illumina HiSeq	Phase_I	64123710	NM_172365	Q6NTH6	De_novo_Start_OutOfFrame	SNP	ENST00000298705.1	37	CCDS9767.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.301375	0.81136	0.0	1.16E-4	ENSG00000165807	ENST00000298705	T	0.59502	0.26	5.55	5.55	0.83447	.	0.000000	0.64402	D	0.000007	T	0.79082	0.4386	M	0.87758	2.905	0.53688	D	0.99997	D	0.89917	1.0	D	0.87578	0.998	T	0.82544	-0.0404	10	0.87932	D	0	-13.1722	15.0284	0.71687	0.0:1.0:0.0:0.0	.	253	Q96LQ0	PPR36_HUMAN	C	253	ENSP00000298705:R253C	ENSP00000298705:R253C	R	+	1	0	C14orf50	64123710	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.000000	0.57039	2.596000	0.87737	0.655000	0.94253	CGT		PPP1R36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280667.1	NM_172365	
RYR3	6263	broad.mit.edu	37	15	33873782	33873782	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr15:33873782T>C	ENST00000389232.4	+	14	1581	c.1511T>C	c.(1510-1512)aTt>aCt	p.I504T	RYR3_ENST00000415757.3_Missense_Mutation_p.I504T	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	504					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.I504T(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TTTGCAGGGATTGCAAGGGAA	0.453																																					p.I504T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1511C	15						.						138.0	139.0	139.0					15																	33873782		1910	4146	6056	31661074	SO:0001583	missense	6263	exon14				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.1511T>C	15.37:g.33873782T>C	ENSP00000373884:p.Ile504Thr	Somatic		Capture	Illumina HiSeq	Phase_I	31661074	NM_001036	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	T	9.684	1.149992	0.21371	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	T;D	0.88741	-0.8;-2.42	5.31	5.31	0.75309	Intracellular calcium-release channel (1);	0.885835	0.09715	N	0.765176	D	0.83746	0.5321	N	0.14661	0.345	0.09310	N	1	B;B	0.33777	0.066;0.425	B;B	0.36808	0.041;0.233	T	0.76721	-0.2855	10	0.66056	D	0.02	.	15.2683	0.73681	0.0:0.0:0.0:1.0	.	504;504	Q15413-2;Q15413	.;RYR3_HUMAN	T	504	ENSP00000373884:I504T;ENSP00000399610:I504T	ENSP00000354735:I504T	I	+	2	0	RYR3	31661074	0.058000	0.20735	0.018000	0.16275	0.582000	0.36321	1.959000	0.40412	2.005000	0.58758	0.460000	0.39030	ATT		RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
PLEKHO2	80301	broad.mit.edu	37	15	65152192	65152192	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr15:65152192G>A	ENST00000323544.4	+	4	507	c.379G>A	c.(379-381)Gat>Aat	p.D127N	AC069368.3_ENST00000437723.1_Missense_Mutation_p.D127N	NM_001195059.1|NM_025201.4	NP_001181988.1|NP_079477.2	Q8TD55	PKHO2_HUMAN	pleckstrin homology domain containing, family O member 2	127								p.D127N(1)		NS(1)|breast(1)|cervix(3)|endometrium(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	25						CAAGGCTTTCGATGAGGTGCG	0.547																																					p.D77N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G229A	15						.						156.0	125.0	136.0					15																	65152192		2202	4299	6501	62939245	SO:0001583	missense	80301	exon3			AF318373	CCDS10196.1, CCDS73739.1	15q22.31	2013-01-10	2007-12-14	2007-12-14	ENSG00000241839	ENSG00000241839		"""Pleckstrin homology (PH) domain containing"""	30026	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family Q member 1"""	PLEKHQ1		12477932	Standard	NM_025201		Approved	DKFZp761K2312, PP1628, pp9099	uc002anv.3	Q8TD55	OTTHUMG00000133050	ENST00000323544.4:c.379G>A	15.37:g.65152192G>A	ENSP00000326706:p.Asp127Asn	Somatic		Capture	Illumina HiSeq	Phase_I	62939245	NM_001195059	Q7L4H4|Q8WYS8	Missense_Mutation	SNP	ENST00000323544.4	37	CCDS10196.1	.	.	.	.	.	.	.	.	.	.	G	32	5.189974	0.94923	.	.	ENSG00000249240;ENSG00000241839;ENSG00000241839	ENST00000437723;ENST00000323544;ENST00000546008	T;T	0.24151	1.87;1.87	5.74	5.74	0.90152	.	0.051961	0.85682	D	0.000000	T	0.41534	0.1163	L	0.32530	0.975	0.58432	D	0.99999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.996	T	0.07539	-1.0767	10	0.42905	T	0.14	.	17.0661	0.86559	0.0:0.0:1.0:0.0	.	77;127	Q8TD55-2;Q8TD55	.;PKHO2_HUMAN	N	127	ENSP00000397942:D127N;ENSP00000326706:D127N	ENSP00000397942:D127N	D	+	1	0	PLEKHO2;AC069368.3	62939245	1.000000	0.71417	0.848000	0.33437	0.909000	0.53808	8.040000	0.89188	2.711000	0.92665	0.462000	0.41574	GAT		PLEKHO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256659.1	NM_025201	
HCN4	10021	broad.mit.edu	37	15	73617435	73617435	+	Silent	SNP	G	G	A	rs117731813	byFrequency	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr15:73617435G>A	ENST00000261917.3	-	6	2832	c.1839C>T	c.(1837-1839)ttC>ttT	p.F613F		NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	613					blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)	p.F613F(1)		NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		GGAAGACCTCGAAACGCAGCT	0.552													G|||	130	0.0259585	0.0	0.085	5008	,	,		21308	0.0675		0.001	False		,,,				2504	0.002				p.F613F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1839T	15						.	G		2,4394	4.2+/-10.8	0,2,2196	145.0	119.0	128.0		1839	-4.5	1.0	15	dbSNP_132	128	3,8591	2.2+/-6.3	0,3,4294	no	coding-synonymous	HCN4	NM_005477.2		0,5,6490	AA,AG,GG		0.0349,0.0455,0.0385		613/1204	73617435	5,12985	2198	4297	6495	71404488	SO:0001819	synonymous_variant	10021	exon6			AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.1839C>T	15.37:g.73617435G>A		Somatic		Capture	Illumina HiSeq	Phase_I	71404488	NM_005477	Q9UMQ7	Silent	SNP	ENST00000261917.3	37	CCDS10248.1																																																																																				HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268900.2	NM_005477	
UMOD	7369	broad.mit.edu	37	16	20357449	20357449	+	Splice_Site	SNP	G	G	A	rs532447307		TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr16:20357449G>A	ENST00000570689.1	-	5	1327	c.1181C>T	c.(1180-1182)aCg>aTg	p.T394M	UMOD_ENST00000396134.2_Splice_Site_p.T427M|UMOD_ENST00000302509.4_Splice_Site_p.T394M|UMOD_ENST00000396142.2_Splice_Site_p.T394M|UMOD_ENST00000424589.1_Splice_Site_p.T427M|UMOD_ENST00000396138.4_Splice_Site_p.T443M			P07911	UROM_HUMAN	uromodulin	394	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				cellular defense response (GO:0006968)|chemical homeostasis (GO:0048878)|excretion (GO:0007588)|heterophilic cell-cell adhesion (GO:0007157)|leukocyte cell-cell adhesion (GO:0007159)|metanephric ascending thin limb development (GO:0072218)|metanephric distal convoluted tubule development (GO:0072221)|metanephric thick ascending limb development (GO:0072233)|negative regulation of cell proliferation (GO:0008285)|neutrophil migration (GO:1990266)|regulation of ion homeostasis (GO:2000021)|response to organic substance (GO:0010033)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|primary cilium (GO:0072372)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|IgG binding (GO:0019864)	p.T394M(1)		endometrium(5)|kidney(1)|large_intestine(7)|lung(20)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						AGGACGTACCGTCAACACTGT	0.567													G|||	1	0.000199681	0.0	0.0	5008	,	,		18519	0.001		0.0	False		,,,				2504	0.0				p.T394M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1181T	16						.						32.0	33.0	33.0					16																	20357449		2203	4300	6503	20264950	SO:0001630	splice_region_variant	7369	exon5			M17778	CCDS10583.1, CCDS61876.1	16p12.3	2008-06-23	2008-06-23		ENSG00000169344	ENSG00000169344			12559	protein-coding gene	gene with protein product	"""Tamm-Horsfall glycoprotein"", ""uromucoid"""	191845	"""uromodulin (uromucoid, Tamm-Horsfall glycoprotein)"""			8382593	Standard	NM_003361		Approved		uc002dha.3	P07911	OTTHUMG00000131488	ENST00000570689.1:c.1182+1C>T	16.37:g.20357449G>A		Somatic		Capture	Illumina HiSeq	Phase_I	20264950	NM_003361	B3KP48|B3KRN9|E9PEA4|Q540J6|Q6ZS84|Q8IYG0	Missense_Mutation	SNP	ENST00000570689.1	37	CCDS10583.1	.	.	.	.	.	.	.	.	.	.	G	11.03	1.520286	0.27211	.	.	ENSG00000169344	ENST00000396138;ENST00000396134;ENST00000424589;ENST00000302509;ENST00000429954;ENST00000396142	D;D;D;D	0.82344	-1.6;-1.6;-1.6;-1.6	4.85	1.14	0.20703	Endoglin/CD105 antigen subgroup (1);Zona pellucida sperm-binding protein (3);	0.386132	0.22253	N	0.062527	T	0.64461	0.2600	N	0.19112	0.55	0.26258	N	0.978613	B;B	0.30511	0.282;0.153	B;B	0.21546	0.035;0.028	T	0.55496	-0.8132	10	0.48119	T	0.1	-8.2654	4.7982	0.13282	0.2971:0.1786:0.5244:0.0	.	427;394	E9PEA4;P07911	.;UROM_HUMAN	M	394;427;427;394;372;394	ENSP00000379438:T427M;ENSP00000416346:T427M;ENSP00000306279:T394M;ENSP00000379446:T394M	ENSP00000306279:T394M	T	-	2	0	UMOD	20264950	0.970000	0.33590	1.000000	0.80357	0.841000	0.47740	-0.116000	0.10724	0.409000	0.25649	0.491000	0.48974	ACG		UMOD-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436862.1		Missense_Mutation
GTF3C1	2975	broad.mit.edu	37	16	27475925	27475925	+	Missense_Mutation	SNP	C	C	T	rs370190480		TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr16:27475925C>T	ENST00000356183.4	-	34	5603	c.5588G>A	c.(5587-5589)cGc>cAc	p.R1863H	GTF3C1_ENST00000561623.1_Missense_Mutation_p.R1863H	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	1863					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)	p.R1863H(1)		breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						CCAGCTGGCGCGCCTCTTGGT	0.692																																					p.R1863H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5588A	16						.	T	HIS/ARG	1,4391		0,1,2195	35.0	44.0	41.0		5588	1.2	0.0	16		41	0,8588		0,0,4294	no	missense	GTF3C1	NM_001520.3	29	0,1,6489	TT,TC,CC		0.0,0.0228,0.0077	benign	1863/2110	27475925	1,12979	2196	4294	6490	27383426	SO:0001583	missense	2975	exon34			U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.5588G>A	16.37:g.27475925C>T	ENSP00000348510:p.Arg1863His	Somatic		Capture	Illumina HiSeq	Phase_I	27383426	NM_001520	B2RP21|Q12838|Q6DKN9|Q9Y4W9	Missense_Mutation	SNP	ENST00000356183.4	37	CCDS32414.1	.	.	.	.	.	.	.	.	.	.	c	15.75	2.924873	0.52759	2.28E-4	0.0	ENSG00000077235	ENST00000356183	T	0.26373	1.74	4.71	1.18	0.20946	.	0.662303	0.14249	N	0.331597	T	0.30417	0.0764	L	0.36672	1.1	0.09310	N	1	B;D	0.69078	0.014;0.997	B;P	0.57548	0.005;0.823	T	0.11179	-1.0598	10	0.39692	T	0.17	-16.5542	9.1594	0.37012	0.0:0.7077:0.0:0.2923	.	1863;1863	Q12789;Q12789-3	TF3C1_HUMAN;.	H	1863	ENSP00000348510:R1863H	ENSP00000348510:R1863H	R	-	2	0	GTF3C1	27383426	0.000000	0.05858	0.024000	0.17045	0.006000	0.05464	0.046000	0.14035	0.449000	0.26747	-1.402000	0.01139	CGC		GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433856.1	NM_001520	
ATP2A1	487	broad.mit.edu	37	16	28906268	28906268	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr16:28906268C>A	ENST00000357084.3	+	12	1680	c.1413C>A	c.(1411-1413)tgC>tgA	p.C471*	ATP2A1_ENST00000536376.1_Nonsense_Mutation_p.C346*|ATP2A1_ENST00000395503.4_Nonsense_Mutation_p.C471*	NM_173201.3	NP_775293.1	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, cardiac muscle, fast twitch 1	471					apoptotic mitochondrial changes (GO:0008637)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|ion transmembrane transport (GO:0034220)|maintenance of mitochondrion location (GO:0051659)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of striated muscle contraction (GO:0045988)|positive regulation of endoplasmic reticulum calcium ion concentration (GO:0032470)|positive regulation of fast-twitch skeletal muscle fiber contraction (GO:0031448)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|regulation of striated muscle contraction (GO:0006942)|relaxation of skeletal muscle (GO:0090076)|response to endoplasmic reticulum stress (GO:0034976)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|H zone (GO:0031673)|I band (GO:0031674)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|protein homodimerization activity (GO:0042803)	p.C471*(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	38						CCAACGCCTGCAACTCGGTGA	0.607																																					p.C471X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1413A	16						.						51.0	51.0	51.0					16																	28906268		2197	4300	6497	28813769	SO:0001587	stop_gained	487	exon12				CCDS10643.1, CCDS42139.1, CCDS66997.1	16p12.1	2012-10-22			ENSG00000196296	ENSG00000196296	3.6.3.8	"""ATPases / P-type"""	811	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 1"", ""calcium pump 1"""	108730		ATP2A			Standard	NM_004320		Approved	SERCA1	uc002dro.1	O14983	OTTHUMG00000131760	ENST00000357084.3:c.1413C>A	16.37:g.28906268C>A	ENSP00000349595:p.Cys471*	Somatic		Capture	Illumina HiSeq	Phase_I	28813769	NM_004320	A8K5J9|B3KY17|O14984	Nonsense_Mutation	SNP	ENST00000357084.3	37	CCDS10643.1	.	.	.	.	.	.	.	.	.	.	C	38	6.699744	0.97772	.	.	ENSG00000196296	ENST00000357084;ENST00000395503;ENST00000395498;ENST00000536376	.	.	.	4.97	4.02	0.46733	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.0438	0.53469	0.0:0.9139:0.0:0.0861	.	.	.	.	X	471;471;508;346	.	ENSP00000349595:C471X	C	+	3	2	ATP2A1	28813769	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.018000	0.57174	1.095000	0.41419	0.585000	0.79938	TGC		ATP2A1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254686.2	NM_004320	
ITGAX	3687	broad.mit.edu	37	16	31383944	31383944	+	Silent	SNP	C	C	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr16:31383944C>T	ENST00000268296.4	+	19	2440	c.2319C>T	c.(2317-2319)gcC>gcT	p.A773A	ITGAX_ENST00000562522.1_Silent_p.A773A	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	773					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)	p.A773A(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						ACTGTGGAGCCGACCATATCT	0.617																																					p.A773A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2319T	16						.						111.0	101.0	105.0					16																	31383944		2197	4300	6497	31291445	SO:0001819	synonymous_variant	3687	exon19			BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.2319C>T	16.37:g.31383944C>T		Somatic		Capture	Illumina HiSeq	Phase_I	31291445	NM_000887	Q8IVA6	Silent	SNP	ENST00000268296.4	37	CCDS10711.1																																																																																				ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255628.2	NM_000887	
PHKB	5257	broad.mit.edu	37	16	47581457	47581457	+	Silent	SNP	G	G	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr16:47581457G>A	ENST00000323584.5	+	7	732	c.708G>A	c.(706-708)tcG>tcA	p.S236S	PHKB_ENST00000566044.1_Silent_p.S229S|PHKB_ENST00000455779.1_Silent_p.S229S|PHKB_ENST00000299167.8_Silent_p.S236S|PHKB_ENST00000567402.1_3'UTR	NM_000293.2	NP_000284.1	Q93100	KPBB_HUMAN	phosphorylase kinase, beta	236					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)	p.S236S(2)|p.S229S(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|liver(1)|lung(18)|ovary(1)|skin(1)	41		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				AGCTACATTCGAGGTAATTTG	0.338																																					p.S229S												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.G687A	16						.						78.0	75.0	76.0					16																	47581457		2201	4300	6501	46138958	SO:0001819	synonymous_variant	5257	exon8				CCDS10729.1, CCDS42161.1	16q12-q13	2009-07-10			ENSG00000102893	ENSG00000102893	2.7.11.19		8927	protein-coding gene	gene with protein product		172490					Standard	NM_000293		Approved		uc002eev.4	Q93100	OTTHUMG00000133102	ENST00000323584.5:c.708G>A	16.37:g.47581457G>A		Somatic		Capture	Illumina HiSeq	Phase_I	46138958	NM_001031835	Q8N4T5	Silent	SNP	ENST00000323584.5	37	CCDS10729.1																																																																																				PHKB-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000430413.1		
ABCC11	85320	broad.mit.edu	37	16	48245003	48245003	+	Silent	SNP	G	G	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr16:48245003G>A	ENST00000394747.1	-	10	1813	c.1464C>T	c.(1462-1464)ccC>ccT	p.P488P	ABCC11_ENST00000353782.5_Silent_p.P488P|ABCC11_ENST00000394748.1_Silent_p.P488P|ABCC11_ENST00000537808.1_Silent_p.P488P|ABCC11_ENST00000356608.2_Silent_p.P488P	NM_033151.3	NP_149163.2	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 11	488					organic anion transport (GO:0015711)|purine nucleotide transport (GO:0015865)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)|purine nucleotide transmembrane transporter activity (GO:0015216)	p.P488P(1)		breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(3)|prostate(2)|skin(5)|urinary_tract(2)	83		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)			Conjugated Estrogens(DB00286)|Folic Acid(DB00158)|Indomethacin(DB00328)|Methotrexate(DB00563)|Probenecid(DB01032)	TGACGATCCCGGGACAGGTCT	0.572																																					p.P488P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1464T	16						.						106.0	98.0	100.0					16																	48245003		2201	4300	6501	46802504	SO:0001819	synonymous_variant	85320	exon11			AF367202	CCDS10732.1, CCDS10733.1	16q12	2012-03-14			ENSG00000121270	ENSG00000121270		"""ATP binding cassette transporters / subfamily C"""	14639	protein-coding gene	gene with protein product		607040				11483364, 11435397	Standard	NM_033151		Approved	MRP8	uc002efg.1	Q96J66	OTTHUMG00000133146	ENST00000394747.1:c.1464C>T	16.37:g.48245003G>A		Somatic		Capture	Illumina HiSeq	Phase_I	46802504	NM_145186	Q8TDJ0|Q96JA6|Q9BX80	Silent	SNP	ENST00000394747.1	37	CCDS10732.1																																																																																				ABCC11-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429984.1	NM_032583	
NAGPA	51172	broad.mit.edu	37	16	5078965	5078965	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr16:5078965A>T	ENST00000312251.3	-	5	855	c.836T>A	c.(835-837)gTg>gAg	p.V279E	RP11-165E7.1_ENST00000588778.1_RNA|NAGPA_ENST00000381955.3_Missense_Mutation_p.V279E|NAGPA_ENST00000564922.1_5'Flank	NM_016256.3	NP_057340.2	Q9UK23	NAGPA_HUMAN	N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase	279					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|lysosome organization (GO:0007040)|protein glycosylation (GO:0006486)|protein targeting to lysosome (GO:0006622)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase activity (GO:0003944)	p.V279E(1)		endometrium(4)|large_intestine(4)|lung(3)|urinary_tract(1)	12					N-Acetyl-D-glucosamine(DB00141)	GGCGTTGACCACGTCCTGTTT	0.572																																					p.V279E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T836A	16						.						142.0	121.0	128.0					16																	5078965		2197	4300	6497	5018966	SO:0001583	missense	51172	exon5			AF187072	CCDS10527.1	16p13.3	2008-02-05			ENSG00000103174	ENSG00000103174	3.1.4.45		17378	protein-coding gene	gene with protein product		607985				10551838, 12058031	Standard	NM_016256		Approved	APAA, UCE	uc002cyg.3	Q9UK23	OTTHUMG00000090515	ENST00000312251.3:c.836T>A	16.37:g.5078965A>T	ENSP00000310998:p.Val279Glu	Somatic		Capture	Illumina HiSeq	Phase_I	5018966	NM_016256	B2RAS1|Q96EJ8	Missense_Mutation	SNP	ENST00000312251.3	37	CCDS10527.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.445232	0.83993	.	.	ENSG00000103174	ENST00000312251;ENST00000381955	T;T	0.38240	1.15;1.38	5.45	5.45	0.79879	.	0.277545	0.34460	N	0.003943	T	0.64670	0.2619	M	0.85777	2.775	0.49687	D	0.999815	D;D;D	0.89917	0.991;1.0;0.988	P;D;P	0.75484	0.865;0.986;0.885	T	0.71467	-0.4584	10	0.87932	D	0	-27.2288	15.5167	0.75830	1.0:0.0:0.0:0.0	.	279;279;279	Q9UK23-3;Q9UK23;Q9UK23-2	.;NAGPA_HUMAN;.	E	279	ENSP00000310998:V279E;ENSP00000371381:V279E	ENSP00000310998:V279E	V	-	2	0	NAGPA	5018966	1.000000	0.71417	0.869000	0.34112	0.546000	0.35178	9.211000	0.95120	2.067000	0.61834	0.459000	0.35465	GTG		NAGPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207003.1	NM_016256	
ABCC11	85320	broad.mit.edu	37	16	48258247	48258247	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr16:48258247C>A	ENST00000394747.1	-	4	838	c.489G>T	c.(487-489)ttG>ttT	p.L163F	ABCC11_ENST00000353782.5_Missense_Mutation_p.L163F|ABCC11_ENST00000394748.1_Missense_Mutation_p.L163F|ABCC11_ENST00000537808.1_Missense_Mutation_p.L163F|ABCC11_ENST00000356608.2_Missense_Mutation_p.L163F	NM_033151.3	NP_149163.2	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 11	163	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				organic anion transport (GO:0015711)|purine nucleotide transport (GO:0015865)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)|purine nucleotide transmembrane transporter activity (GO:0015216)	p.L163F(2)		breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(3)|prostate(2)|skin(5)|urinary_tract(2)	83		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)			Conjugated Estrogens(DB00286)|Folic Acid(DB00158)|Indomethacin(DB00328)|Methotrexate(DB00563)|Probenecid(DB01032)	CATCGAAAATCAACCTTGTTC	0.507																																					p.L163F												.	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.G489T	16						.						125.0	104.0	111.0					16																	48258247		2200	4300	6500	46815748	SO:0001583	missense	85320	exon5			AF367202	CCDS10732.1, CCDS10733.1	16q12	2012-03-14			ENSG00000121270	ENSG00000121270		"""ATP binding cassette transporters / subfamily C"""	14639	protein-coding gene	gene with protein product		607040				11483364, 11435397	Standard	NM_033151		Approved	MRP8	uc002efg.1	Q96J66	OTTHUMG00000133146	ENST00000394747.1:c.489G>T	16.37:g.48258247C>A	ENSP00000378230:p.Leu163Phe	Somatic		Capture	Illumina HiSeq	Phase_I	46815748	NM_145186	Q8TDJ0|Q96JA6|Q9BX80	Missense_Mutation	SNP	ENST00000394747.1	37	CCDS10732.1	.	.	.	.	.	.	.	.	.	.	C	9.967	1.224511	0.22457	.	.	ENSG00000121270	ENST00000353782;ENST00000356608;ENST00000394748;ENST00000394747;ENST00000537808	T;T;T;T;T	0.58797	0.31;0.31;0.31;0.31;0.31	4.39	0.942	0.19525	ABC transporter, transmembrane domain, type 1 (1);	0.932371	0.09020	N	0.860290	T	0.32704	0.0838	N	0.11560	0.145	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.09377	0.0;0.004	T	0.16689	-1.0394	10	0.05620	T	0.96	0.3991	10.222	0.43203	0.7573:0.2427:0.0:0.0	.	163;163	Q96J66-2;Q96J66	.;ABCCB_HUMAN	F	163	ENSP00000311326:L163F;ENSP00000349017:L163F;ENSP00000378231:L163F;ENSP00000378230:L163F;ENSP00000438530:L163F	ENSP00000311326:L163F	L	-	3	2	ABCC11	46815748	0.000000	0.05858	0.000000	0.03702	0.147000	0.21601	0.308000	0.19314	-0.051000	0.13334	0.460000	0.39030	TTG		ABCC11-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429984.1	NM_032583	
IRX6	79190	broad.mit.edu	37	16	55362883	55362883	+	Silent	SNP	G	G	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr16:55362883G>A	ENST00000290552.7	+	5	2325	c.993G>A	c.(991-993)tcG>tcA	p.S331S	RP11-26L20.3_ENST00000558730.2_RNA	NM_024335.2	NP_077311.2	P78412	IRX6_HUMAN	iroquois homeobox 6	331					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.S331S(1)		breast(2)|central_nervous_system(5)|endometrium(3)|kidney(2)|large_intestine(6)|liver(2)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	33						ACTTCCTCTCGGCGGAGACAG	0.632																																					p.S331S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G993A	16						.						42.0	44.0	44.0					16																	55362883		2197	4298	6495	53920384	SO:0001819	synonymous_variant	79190	exon5			AF319966	CCDS32449.1	16q12.2	2011-06-20	2007-07-13	2003-01-10		ENSG00000159387		"""Homeoboxes / TALE class"""	14675	protein-coding gene	gene with protein product		606196	"""iroquois homeobox protein 7"", ""iroquois homeobox protein 6"""	IRX7			Standard	NM_024335		Approved	IRX-3	uc002ehy.3	P78412		ENST00000290552.7:c.993G>A	16.37:g.55362883G>A		Somatic		Capture	Illumina HiSeq	Phase_I	53920384	NM_024335	B2RN06|Q7Z2K0	Silent	SNP	ENST00000290552.7	37	CCDS32449.1																																																																																				IRX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417445.4	NM_024335	
TUBB3	10381	broad.mit.edu	37	16	90001393	90001393	+	Silent	SNP	G	G	A	rs143029958	byFrequency	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr16:90001393G>A	ENST00000315491.7	+	4	657	c.534G>A	c.(532-534)acG>acA	p.T178T	TUBB3_ENST00000555576.1_Intron|TUBB3_ENST00000556922.1_Silent_p.T525T|TUBB3_ENST00000304984.5_Silent_p.T106T|TUBB3_ENST00000554444.1_Silent_p.T106T	NM_006086.3	NP_006077.2	Q13509	TBB3_HUMAN	tubulin, beta 3 class III	178			T -> M (in CDCBM1; can form tubulin heterodimers that are properly incorporated into microtubules; the microtubules are less stable than wild- type). {ECO:0000269|PubMed:20829227}.		'de novo' posttranslational protein folding (GO:0051084)|axon guidance (GO:0007411)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.T178T(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(3)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17		all_cancers(9;1.69e-11)|Lung NSC(15;8.94e-06)|all_lung(18;1.39e-05)|all_neural(9;0.00581)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0273)	Ixabepilone(DB04845)	TGTCAGACACGGTGGTGGAGC	0.597																																					p.T178T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G534A	16						.	G	,	5,4391	9.9+/-24.2	0,5,2193	218.0	166.0	183.0		318,534	-9.3	0.1	16	dbSNP_134	183	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	TUBB3	NM_001197181.1,NM_006086.3	,	0,6,6492	AA,AG,GG		0.0116,0.1137,0.0462	,	106/379,178/451	90001393	6,12990	2198	4300	6498	88528894	SO:0001819	synonymous_variant	10381	exon4			BC000748	CCDS10988.1, CCDS56012.1	16q24.3	2014-02-04	2011-10-10		ENSG00000198211	ENSG00000198211		"""Tubulins"""	20772	protein-coding gene	gene with protein product	"""class III beta-tubulin"""	602661	"""tubulin, beta 3"", ""fibrosis of extraocular muscles, congenital, 3"""	FEOM3		9473684, 8098743, 20074521	Standard	NM_006086		Approved	beta-4, CFEOM3, CFEOM3A	uc002fph.2	Q13509	OTTHUMG00000138985	ENST00000315491.7:c.534G>A	16.37:g.90001393G>A		Somatic		Capture	Illumina HiSeq	Phase_I	88528894	NM_006086	A8K854|Q9BTZ0|Q9BW10	Silent	SNP	ENST00000315491.7	37	CCDS10988.1																																																																																				TUBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272874.1	NM_006086	
NAGLU	4669	broad.mit.edu	37	17	40695185	40695185	+	Silent	SNP	C	C	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr17:40695185C>T	ENST00000225927.2	+	6	1262	c.1161C>T	c.(1159-1161)agC>agT	p.S387S	RP11-400F19.8_ENST00000585572.1_RNA	NM_000263.3	NP_000254.2	P54802	ANAG_HUMAN	N-acetylglucosaminidase, alpha	387					carbohydrate metabolic process (GO:0005975)|cerebellar Purkinje cell layer development (GO:0021680)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|inner ear receptor cell development (GO:0060119)|locomotor rhythm (GO:0045475)|lysosome organization (GO:0007040)|middle ear morphogenesis (GO:0042474)|nervous system development (GO:0007399)|retinal rod cell development (GO:0046548)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	alpha-N-acetylglucosaminidase activity (GO:0004561)	p.S387S(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(1)|ovary(2)|skin(1)	12		all_cancers(22;1.58e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)	N-Acetyl-D-glucosamine(DB00141)	TTGCTGAGAGCCAGCCTGTGT	0.627																																					p.S387S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1161T	17						.						52.0	55.0	54.0					17																	40695185		2203	4300	6503	37948711	SO:0001819	synonymous_variant	4669	exon6				CCDS11427.1	17q21.2	2010-07-27	2010-07-27		ENSG00000108784	ENSG00000108784	3.2.1.50		7632	protein-coding gene	gene with protein product	"""Sanfilippo disease IIIB"""	609701					Standard	XM_006721920		Approved	NAG	uc002hzv.3	P54802		ENST00000225927.2:c.1161C>T	17.37:g.40695185C>T		Somatic		Capture	Illumina HiSeq	Phase_I	37948711	NM_000263		Silent	SNP	ENST00000225927.2	37	CCDS11427.1																																																																																				NAGLU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450385.1	NM_000263	
OSBPL7	114881	broad.mit.edu	37	17	45886548	45886548	+	Silent	SNP	G	G	A	rs368998627		TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr17:45886548G>A	ENST00000007414.3	-	20	2255	c.2064C>T	c.(2062-2064)ggC>ggT	p.G688G	OSBPL7_ENST00000392507.3_Silent_p.G688G	NM_145798.2	NP_665741.1	Q9BZF2	OSBL7_HUMAN	oxysterol binding protein-like 7	688					cellular response to cholesterol (GO:0071397)|lipid transport (GO:0006869)|positive regulation of proteasomal protein catabolic process (GO:1901800)	autophagic vacuole (GO:0005776)|cytosol (GO:0005829)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	cholesterol binding (GO:0015485)	p.G688G(1)		autonomic_ganglia(1)|endometrium(6)|kidney(2)|large_intestine(5)|liver(2)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32						TGAGCACAGCGCCCTGCACCT	0.647																																					p.G688G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2064T	17						.	G		0,4406		0,0,2203	51.0	53.0	53.0		2064	-10.0	0.7	17		53	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	OSBPL7	NM_145798.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		688/843	45886548	1,13005	2203	4300	6503	43241547	SO:0001819	synonymous_variant	114881	exon20			AF392446	CCDS11515.1	17q21	2013-01-10				ENSG00000006025		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16387	protein-coding gene	gene with protein product		606735				14593528, 11735225	Standard	NM_145798		Approved	ORP7, MGC71150	uc002ilx.1	Q9BZF2		ENST00000007414.3:c.2064C>T	17.37:g.45886548G>A		Somatic		Capture	Illumina HiSeq	Phase_I	43241547	NM_145798	D3DTT6|Q6PIV6	Silent	SNP	ENST00000007414.3	37	CCDS11515.1																																																																																				OSBPL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441367.1	NM_017731	
FAM20A	54757	broad.mit.edu	37	17	66538287	66538287	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr17:66538287G>T	ENST00000592554.1	-	7	1670	c.948C>A	c.(946-948)ttC>ttA	p.F316L	FAM20A_ENST00000226094.5_5'UTR|AC079210.1_ENST00000600820.1_5'Flank|PRKAR1A_ENST00000588188.2_Intron	NM_001243746.1|NM_017565.3	NP_001230675.1|NP_060035.2	Q96MK3	FA20A_HUMAN	family with sequence similarity 20, member A	316					calcium ion homeostasis (GO:0055074)|enamel mineralization (GO:0070166)|tooth eruption (GO:0044691)	cell (GO:0005623)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)		p.F316L(1)		cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|prostate(1)|stomach(1)	9	Breast(10;1.64e-13)					GACACTTGGCGAAGAAGCACA	0.582																																					p.F316L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C948A	17						.						96.0	76.0	83.0					17																	66538287		2203	4300	6503	64049882	SO:0001583	missense	54757	exon7			AK056789	CCDS11679.1	17q24.2	2014-02-07			ENSG00000108950	ENSG00000108950			23015	protein-coding gene	gene with protein product		611062					Standard	NM_017565		Approved	DKFZp434F2322	uc002jho.3	Q96MK3	OTTHUMG00000180152	ENST00000592554.1:c.948C>A	17.37:g.66538287G>T	ENSP00000468308:p.Phe316Leu	Somatic		Capture	Illumina HiSeq	Phase_I	64049882	NM_017565	B2RN47|B2RN49|Q9UF95	Nonsense_Mutation	SNP	ENST00000592554.1	37	CCDS11679.1	.	.	.	.	.	.	.	.	.	.	G	19.43	3.825675	0.71143	.	.	ENSG00000108950	ENST00000226094	.	.	.	6.04	-4.98	0.03019	.	0.087328	0.85682	D	0.000000	T	0.76421	0.3985	M	0.81239	2.535	0.45005	D	0.998024	D	0.89917	1.0	D	0.87578	0.998	T	0.78666	-0.2115	9	0.62326	D	0.03	-24.8943	17.4691	0.87641	0.4702:0.0:0.5298:0.0	.	316	Q96MK3	FA20A_HUMAN	L	316	.	ENSP00000226094:F316L	F	-	3	2	FAM20A	64049882	0.121000	0.22262	0.831000	0.32960	0.931000	0.56810	-0.352000	0.07701	-1.126000	0.02929	-1.119000	0.02030	TTC		FAM20A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450029.2	NM_017565	
ZNF524	147807	broad.mit.edu	37	19	56113645	56113646	+	Frame_Shift_Ins	INS	-	-	C	rs376080949|rs555870179	byFrequency	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr19:56113645_56113646insC	ENST00000591046.1	+	1	401_402	c.167_168insC	c.(166-171)cgccccfs	p.RP56fs	ZNF524_ENST00000301073.3_Frame_Shift_Ins_p.RP56fs|FIZ1_ENST00000592585.1_5'Flank|FIZ1_ENST00000221665.3_5'Flank			Q96C55	ZN524_HUMAN	zinc finger protein 524	56					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K59fs*31(1)		breast(1)|large_intestine(2)|lung(6)|prostate(1)	10			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.105)		AAGCGGGGCCGCCCCCCCAAGT	0.688																																					p.R56fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.167_168insC	19						.																																			60805458	SO:0001589	frameshift_variant	147807	exon2			BC014666	CCDS12929.1	19q13.43	2013-01-08				ENSG00000171443		"""Zinc fingers, C2H2-type"""	28322	protein-coding gene	gene with protein product						12477932	Standard	NM_153219		Approved	MGC23143	uc002qlk.1	Q96C55		ENST00000591046.1:c.174dupC	19.37:g.56113652_56113652dupC	ENSP00000466907:p.Arg56fs	Somatic		Capture	Illumina HiSeq	Phase_I	60805457	NM_153219	Q6NW31|Q96IL7	Frame_Shift_Ins	INS	ENST00000591046.1	37	CCDS12929.1																																																																																				ZNF524-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457938.1	NM_153219	
MKNK2	2872	broad.mit.edu	37	19	2043518	2043518	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr19:2043518G>A	ENST00000591601.1	-	5	438	c.403C>T	c.(403-405)Cag>Tag	p.Q135*	MKNK2_ENST00000250896.3_Nonsense_Mutation_p.Q135*|MKNK2_ENST00000591142.1_5'Flank|MKNK2_ENST00000541165.1_Nonsense_Mutation_p.Q4*|MKNK2_ENST00000591588.1_5'Flank|MKNK2_ENST00000309340.7_Nonsense_Mutation_p.Q135*|MKNK2_ENST00000588014.1_5'Flank			Q9HBH9	MKNK2_HUMAN	MAP kinase interacting serine/threonine kinase 2	135	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell surface receptor signaling pathway (GO:0007166)|cellular response to arsenic-containing substance (GO:0071243)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|hemopoiesis (GO:0030097)|intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of translation (GO:0006417)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.Q135*(2)		breast(1)|kidney(3)|large_intestine(3)|lung(3)	10		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCTGGCACTGGTACAGCATC	0.582																																					p.Q135X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C403T	19						.						158.0	108.0	125.0					19																	2043518		2203	4300	6503	1994518	SO:0001587	stop_gained	2872	exon6			AF125532	CCDS12079.1, CCDS12080.1	19p13.3	2012-12-20			ENSG00000099875	ENSG00000099875			7111	protein-coding gene	gene with protein product	"""Putative map kinase interacting kinase"""	605069	"""G protein-coupled receptor kinase 7"""	GPRK7		11013076	Standard	NM_199054		Approved	MNK2	uc002lus.2	Q9HBH9	OTTHUMG00000180020	ENST00000591601.1:c.403C>T	19.37:g.2043518G>A	ENSP00000467811:p.Gln135*	Somatic		Capture	Illumina HiSeq	Phase_I	1994518	NM_017572	Q6GPI3|Q9HBH8|Q9UHR0|Q9Y2N6	Nonsense_Mutation	SNP	ENST00000591601.1	37	CCDS12080.1	.	.	.	.	.	.	.	.	.	.	G	39	7.672309	0.98425	.	.	ENSG00000099875	ENST00000309340;ENST00000250896;ENST00000541165;ENST00000545627	.	.	.	4.47	4.47	0.54385	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-16.1682	14.6262	0.68624	0.0:0.0:1.0:0.0	.	.	.	.	X	135;135;4;88	.	ENSP00000250896:Q135X	Q	-	1	0	MKNK2	1994518	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.600000	0.98282	2.009000	0.58944	0.561000	0.74099	CAG		MKNK2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449312.1	NM_199054	
PTPRS	5802	broad.mit.edu	37	19	5244149	5244149	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr19:5244149C>T	ENST00000587303.1	-	10	1432	c.1333G>A	c.(1333-1335)Gtg>Atg	p.V445M	PTPRS_ENST00000372412.4_Missense_Mutation_p.V446M|PTPRS_ENST00000353284.2_Missense_Mutation_p.V432M|PTPRS_ENST00000588012.1_Missense_Mutation_p.V432M|PTPRS_ENST00000592099.1_Missense_Mutation_p.V432M|PTPRS_ENST00000348075.2_Missense_Mutation_p.V432M|PTPRS_ENST00000357368.4_Missense_Mutation_p.V445M|PTPRS_ENST00000588552.1_5'UTR|PTPRS_ENST00000262963.6_Missense_Mutation_p.V441M			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	445	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.V445M(1)		NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	TCCCACTGCACAATCATGGTG	0.697																																					p.V445M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1333A	19						.						72.0	72.0	72.0					19																	5244149		2203	4300	6503	5195149	SO:0001583	missense	5802	exon11			U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.1333G>A	19.37:g.5244149C>T	ENSP00000467537:p.Val445Met	Somatic		Capture	Illumina HiSeq	Phase_I	5195149	NM_002850	O75255|O75870|Q15718|Q16341|Q2M3R7	Missense_Mutation	SNP	ENST00000587303.1	37	CCDS45930.1	.	.	.	.	.	.	.	.	.	.	C	15.95	2.982847	0.53827	.	.	ENSG00000105426	ENST00000536396;ENST00000372412;ENST00000357368;ENST00000355005;ENST00000356037;ENST00000262963;ENST00000348075;ENST00000355322;ENST00000544524;ENST00000353284	T;T;T;T;T	0.59772	0.24;0.24;0.24;0.24;0.24	3.93	0.573	0.17363	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.089923	0.40818	U	0.001006	T	0.75250	0.3824	M	0.91354	3.2	0.35894	D	0.829911	P;P;P;D;P;P	0.76494	0.507;0.678;0.534;0.999;0.925;0.87	P;B;P;D;D;P	0.75484	0.647;0.418;0.647;0.986;0.949;0.798	T	0.76578	-0.2908	10	0.87932	D	0	.	6.4244	0.21762	0.0:0.4014:0.0:0.5986	.	445;432;436;432;445;458	F8W800;Q13332-7;F5H2T4;Q13332-6;Q13332;Q59FX6	.;.;.;.;PTPRS_HUMAN;.	M	458;446;445;445;445;441;432;445;436;432	ENSP00000361489:V446M;ENSP00000349932:V445M;ENSP00000262963:V441M;ENSP00000269907:V432M;ENSP00000327313:V432M	ENSP00000262963:V441M	V	-	1	0	PTPRS	5195149	1.000000	0.71417	0.996000	0.52242	0.685000	0.39939	2.003000	0.40844	-0.038000	0.13624	0.462000	0.41574	GTG		PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450762.2		
ZNF443	10224	broad.mit.edu	37	19	12542282	12542282	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr19:12542282G>C	ENST00000301547.5	-	4	901	c.704C>G	c.(703-705)tCt>tGt	p.S235C	CTD-3105H18.16_ENST00000595562.1_Intron	NM_005815.4	NP_005806	Q9Y2A4	ZN443_HUMAN	zinc finger protein 443	235					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S235C(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(11)|lung(10)|pancreas(1)|prostate(1)	28						ACTGTAAAAAGAAAAGGCTTT	0.373																																					p.S235C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C704G	19						.						126.0	131.0	129.0					19																	12542282		2203	4296	6499	12403282	SO:0001583	missense	10224	exon4			AB011414	CCDS32918.1	19p13.13	2013-01-08			ENSG00000180855	ENSG00000180855		"""Zinc fingers, C2H2-type"", ""-"""	20878	protein-coding gene	gene with protein product		606697				9731181	Standard	NM_005815		Approved	ZK1	uc002mtu.3	Q9Y2A4	OTTHUMG00000156404	ENST00000301547.5:c.704C>G	19.37:g.12542282G>C	ENSP00000301547:p.Ser235Cys	Somatic		Capture	Illumina HiSeq	Phase_I	12403282	NM_005815		Missense_Mutation	SNP	ENST00000301547.5	37	CCDS32918.1	.	.	.	.	.	.	.	.	.	.	G	12.61	1.990240	0.35131	.	.	ENSG00000180855	ENST00000301547;ENST00000411622	T	0.07688	3.17	1.14	-2.27	0.06846	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.18087	0.0434	M	0.78801	2.425	0.09310	N	1	D	0.61080	0.989	P	0.59357	0.856	T	0.05818	-1.0862	9	0.42905	T	0.14	.	3.9474	0.09353	0.3024:0.3398:0.3578:0.0	.	235	Q9Y2A4	ZN443_HUMAN	C	235	ENSP00000301547:S235C	ENSP00000301547:S235C	S	-	2	0	ZNF443	12403282	0.000000	0.05858	0.000000	0.03702	0.649000	0.38597	-6.039000	0.00084	-0.981000	0.03520	0.395000	0.25975	TCT		ZNF443-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344084.1	NM_005815	
RASIP1	54922	broad.mit.edu	37	19	49225213	49225213	+	Missense_Mutation	SNP	C	C	T	rs374430911		TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr19:49225213C>T	ENST00000222145.4	-	11	2794	c.2590G>A	c.(2590-2592)Gcc>Acc	p.A864T	MAMSTR_ENST00000377367.3_5'Flank|MAMSTR_ENST00000318083.6_5'Flank|MAMSTR_ENST00000419611.1_5'Flank	NM_017805.2	NP_060275.2	Q5U651	RAIN_HUMAN	Ras interacting protein 1	864	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|negative regulation of autophagy (GO:0010507)|regulation of Rho GTPase activity (GO:0032319)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	Golgi apparatus (GO:0005794)		p.A864T(1)		central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	21		all_lung(116;4.89e-06)|all_epithelial(76;7.04e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000272)|Epithelial(262;0.0155)|GBM - Glioblastoma multiforme(486;0.0222)		TGCAGCTGGGCGGGGGTCAAG	0.647																																					p.A864T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2590A	19						.	C	THR/ALA	0,4406		0,0,2203	39.0	44.0	42.0		2590	3.5	0.6	19		42	1,8599	1.2+/-3.3	0,1,4299	no	missense	RASIP1	NM_017805.2	58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	864/964	49225213	1,13005	2203	4300	6503	53917025	SO:0001583	missense	54922	exon11			BC028614	CCDS12731.1	19q13.33	2008-02-05				ENSG00000105538			24716	protein-coding gene	gene with protein product		609623				15031288	Standard	NM_017805		Approved	FLJ20401, RAIN	uc002pki.3	Q5U651		ENST00000222145.4:c.2590G>A	19.37:g.49225213C>T	ENSP00000222145:p.Ala864Thr	Somatic		Capture	Illumina HiSeq	Phase_I	53917025	NM_017805	Q6U676	Missense_Mutation	SNP	ENST00000222145.4	37	CCDS12731.1	.	.	.	.	.	.	.	.	.	.	C	15.05	2.717035	0.48622	0.0	1.16E-4	ENSG00000105538	ENST00000222145	T	0.27104	1.69	4.51	3.48	0.39840	Dilute (1);Dil domain (1);	0.316078	0.28730	N	0.014321	T	0.25606	0.0623	L	0.43152	1.355	0.33366	D	0.572915	P	0.46706	0.883	P	0.45276	0.475	T	0.42616	-0.9441	10	0.66056	D	0.02	-6.0303	10.513	0.44872	0.0:0.9041:0.0:0.0959	.	864	Q5U651	RAIN_HUMAN	T	864	ENSP00000222145:A864T	ENSP00000222145:A864T	A	-	1	0	RASIP1	53917025	0.958000	0.32768	0.577000	0.28562	0.248000	0.25809	2.206000	0.42779	1.269000	0.44280	0.484000	0.47621	GCC		RASIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466185.1	NM_017805	
LHB	3972	broad.mit.edu	37	19	49519407	49519407	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr19:49519407C>T	ENST00000221421.2	-	3	343	c.344G>A	c.(343-345)cGc>cAc	p.R115H	CTB-60B18.10_ENST00000600007.1_lincRNA	NM_000894.2	NP_000885.1	P01229	LSHB_HUMAN	luteinizing hormone beta polypeptide	115					cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|male gonad development (GO:0008584)|peptide hormone processing (GO:0016486)|progesterone biosynthetic process (GO:0006701)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	receptor binding (GO:0005102)	p.R115H(1)		cervix(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	8		all_epithelial(76;9.62e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)		AGAGGTGCTGCGGCGGCAGGG	0.662																																					p.R115H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G344A	19						.						55.0	61.0	59.0					19																	49519407		2203	4300	6503	54211219	SO:0001583	missense	3972	exon3				CCDS12748.1	19q13.3	2013-02-26				ENSG00000104826		"""Endogenous ligands"""	6584	protein-coding gene	gene with protein product	"""lutropin, beta chain"", ""interstitial cell stimulating hormone, beta chain"", ""luteinizing hormone beta subunit"""	152780				1191677	Standard	NM_000894		Approved	LSH-B, CGB4, hLHB	uc002plt.3	P01229		ENST00000221421.2:c.344G>A	19.37:g.49519407C>T	ENSP00000221421:p.Arg115His	Somatic		Capture	Illumina HiSeq	Phase_I	54211219	NM_000894	Q9UDI0	Missense_Mutation	SNP	ENST00000221421.2	37	CCDS12748.1	.	.	.	.	.	.	.	.	.	.	C	13.08	2.130814	0.37630	.	.	ENSG00000104826	ENST00000221421;ENST00000391870	T	0.57752	0.38	4.71	3.68	0.42216	Cystine knot (1);Gonadotropin, beta subunit, conserved site (1);	0.298608	0.34025	N	0.004337	T	0.66694	0.2815	M	0.68317	2.08	0.26800	N	0.969222	D	0.89917	1.0	D	0.85130	0.997	T	0.58907	-0.7553	10	0.72032	D	0.01	-14.5685	8.5687	0.33556	0.7918:0.2082:0.0:0.0	.	115	P01229	LSHB_HUMAN	H	115;131	ENSP00000221421:R115H	ENSP00000221421:R115H	R	-	2	0	LHB	54211219	1.000000	0.71417	0.999000	0.59377	0.002000	0.02628	2.278000	0.43426	0.762000	0.33152	-0.521000	0.04368	CGC		LHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466246.1	NM_000894	
KCNA7	3743	broad.mit.edu	37	19	49574067	49574067	+	Silent	SNP	C	C	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr19:49574067C>T	ENST00000221444.1	-	2	979	c.624G>A	c.(622-624)ccG>ccA	p.P208P		NM_031886.2	NP_114092.2	Q96RP8	KCNA7_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 7	208					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.P208P(1)		central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|skin(2)	11		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_epithelial(76;3.83e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000397)|OV - Ovarian serous cystadenocarcinoma(262;0.000519)|GBM - Glioblastoma multiforme(486;0.00541)|Epithelial(262;0.0441)	Dalfampridine(DB06637)	CCACGAAGAACGGGTCATTGA	0.557																																					p.P208P	Colon(74;686 1235 3793 23366 48562)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G624A	19						.						108.0	77.0	87.0					19																	49574067		2203	4300	6503	54265879	SO:0001819	synonymous_variant	3743	exon2			AF315818	CCDS12755.1	19q13.3	2012-07-05				ENSG00000104848		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6226	protein-coding gene	gene with protein product		176268				16382104	Standard	NM_031886		Approved	Kv1.7, HAK6	uc002pmg.3	Q96RP8		ENST00000221444.1:c.624G>A	19.37:g.49574067C>T		Somatic		Capture	Illumina HiSeq	Phase_I	54265879	NM_031886	A1KYX7|Q9BYS4	Silent	SNP	ENST00000221444.1	37	CCDS12755.1																																																																																				KCNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466263.1	NM_031886	
SIGLEC6	946	broad.mit.edu	37	19	52034573	52034573	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr19:52034573G>A	ENST00000425629.3	-	2	422	c.268C>T	c.(268-270)Cgg>Tgg	p.R90W	SIGLEC6_ENST00000474054.1_5'Flank|SIGLEC6_ENST00000359982.4_Missense_Mutation_p.R90W|SIGLEC6_ENST00000343300.4_Missense_Mutation_p.R90W|SIGLEC6_ENST00000436458.1_Missense_Mutation_p.R54W|SIGLEC6_ENST00000391797.3_Missense_Mutation_p.R90W|SIGLEC6_ENST00000346477.3_Missense_Mutation_p.R90W	NM_001245.5	NP_001236.4	O43699	SIGL6_HUMAN	sialic acid binding Ig-like lectin 6	90	Ig-like V-type.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)	p.R90W(1)|p.R79W(1)		endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(15)|ovary(1)|stomach(1)	28		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00115)|OV - Ovarian serous cystadenocarcinoma(262;0.0165)		AATCGGCCCCGGGTCTCCTCC	0.567																																					p.R90W												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C268T	19						.						69.0	75.0	73.0					19																	52034573		2194	4299	6493	56726385	SO:0001583	missense	946	exon2			D86358	CCDS12834.3, CCDS12835.3, CCDS12836.3, CCDS54307.1, CCDS54308.1, CCDS59417.1	19q13.3	2013-01-29			ENSG00000105492	ENSG00000105492		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10875	protein-coding gene	gene with protein product		604405		CD33L, CD33L1		9465907	Standard	NM_001245		Approved	OB-BP1, SIGLEC-6, CD327	uc002pwy.3	O43699	OTTHUMG00000133571	ENST00000425629.3:c.268C>T	19.37:g.52034573G>A	ENSP00000401502:p.Arg90Trp	Somatic		Capture	Illumina HiSeq	Phase_I	56726385	NM_001245	A8MV71|B2RTS8|C9JBE5|F8WA78|O15388|O43700	Missense_Mutation	SNP	ENST00000425629.3	37	CCDS12834.3	.	.	.	.	.	.	.	.	.	.	G	13.52	2.261375	0.39995	.	.	ENSG00000105492	ENST00000346477;ENST00000391797;ENST00000425629;ENST00000359982;ENST00000436458;ENST00000343300;ENST00000426829	T;T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22;-0.22	2.93	2.93	0.34026	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	1.144880	0.06837	N	0.795001	T	0.78464	0.4287	L	0.58510	1.815	0.09310	N	1	B;D;P;B;B;B;P	0.89917	0.16;1.0;0.668;0.16;0.141;0.252;0.921	B;D;B;B;B;B;B	0.76071	0.068;0.987;0.198;0.04;0.017;0.046;0.208	T	0.61907	-0.6966	10	0.87932	D	0	.	9.4448	0.38690	0.0:0.0:1.0:0.0	.	90;54;90;90;90;90;90	F8WA78;C9JBE5;C9JUT6;O43699-4;O43699-2;O43699-3;O43699	.;.;.;.;.;.;SIGL6_HUMAN	W	79;90;90;90;54;90;90	ENSP00000375674:R90W;ENSP00000401502:R90W;ENSP00000353071:R90W;ENSP00000410679:R54W;ENSP00000345907:R90W	ENSP00000345907:R90W	R	-	1	2	SIGLEC6	56726385	0.001000	0.12720	0.095000	0.20976	0.107000	0.19398	0.317000	0.19487	1.637000	0.50538	0.313000	0.20887	CGG		SIGLEC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257670.3	NM_001245	
MUC16	94025	broad.mit.edu	37	19	9058007	9058007	+	Silent	SNP	C	C	A	rs374622998	byFrequency	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr19:9058007C>A	ENST00000397910.4	-	3	29642	c.29439G>T	c.(29437-29439)gcG>gcT	p.A9813A		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9815	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.A9813A(1)|p.A5446A(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTTTGGCCACCGCTGTGTTTG	0.453																																					p.A9813A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G29439T	19						.						109.0	107.0	108.0					19																	9058007		1998	4170	6168	8919007	SO:0001819	synonymous_variant	94025	exon3			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.29439G>T	19.37:g.9058007C>A		Somatic		Capture	Illumina HiSeq	Phase_I	8919007	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																				MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC16	94025	broad.mit.edu	37	19	9065457	9065457	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr19:9065457G>T	ENST00000397910.4	-	3	22192	c.21989C>A	c.(21988-21990)aCa>aAa	p.T7330K		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	7332	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.T7330K(2)|p.T2963K(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGGAGGACTTGTTTGGGTCTT	0.438																																					p.T7330K												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.C21989A	19						.						143.0	139.0	140.0					19																	9065457		1946	4131	6077	8926457	SO:0001583	missense	94025	exon3			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.21989C>A	19.37:g.9065457G>T	ENSP00000381008:p.Thr7330Lys	Somatic		Capture	Illumina HiSeq	Phase_I	8926457	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	N	5.907	0.351372	0.11182	.	.	ENSG00000181143	ENST00000397910	T	0.02472	4.28	2.97	0.674	0.17946	.	.	.	.	.	T	0.03520	0.0101	N	0.24115	0.695	.	.	.	P	0.44344	0.833	P	0.50270	0.636	T	0.39461	-0.9613	8	0.87932	D	0	.	3.9938	0.09549	0.1454:0.249:0.6056:0.0	.	7330	B5ME49	.	K	7330	ENSP00000381008:T7330K	ENSP00000381008:T7330K	T	-	2	0	MUC16	8926457	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.612000	0.02061	0.252000	0.21531	0.385000	0.25706	ACA		MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
NLRP2	55655	broad.mit.edu	37	19	55494669	55494669	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr19:55494669G>A	ENST00000543010.1	+	6	1746	c.1603G>A	c.(1603-1605)Gta>Ata	p.V535I	NLRP2_ENST00000448584.2_Missense_Mutation_p.V535I|NLRP2_ENST00000391721.4_Missense_Mutation_p.V511I|NLRP2_ENST00000263437.6_Missense_Mutation_p.V532I|NLRP2_ENST00000538819.1_Missense_Mutation_p.V511I|NLRP2_ENST00000339757.7_Missense_Mutation_p.V513I|NLRP2_ENST00000427260.2_Missense_Mutation_p.V512I|NLRP2_ENST00000537859.1_Missense_Mutation_p.V513I	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	535					positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)	p.V535I(1)		large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		CATTGGGGACGTACAGAAGCT	0.557																																					p.V512I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1534A	19						.						91.0	83.0	86.0					19																	55494669		2203	4300	6503	60186481	SO:0001583	missense	55655	exon7			AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.1603G>A	19.37:g.55494669G>A	ENSP00000445135:p.Val535Ile	Somatic		Capture	Illumina HiSeq	Phase_I	60186481	NM_001174083	B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Missense_Mutation	SNP	ENST00000543010.1	37	CCDS12913.1	.	.	.	.	.	.	.	.	.	.	G	6.382	0.438555	0.12104	.	.	ENSG00000022556	ENST00000543010;ENST00000391721;ENST00000339757;ENST00000448584;ENST00000537859;ENST00000427260;ENST00000538819;ENST00000263437	T;T;T;T;T;T;T;T	0.75050	-0.88;-0.81;-0.82;-0.88;-0.82;-0.9;-0.81;-0.87	1.79	-0.529	0.11901	.	1.199260	0.06581	N	0.750327	T	0.59307	0.2184	L	0.45051	1.395	0.09310	N	1	P;P;P;P;P	0.50156	0.932;0.82;0.726;0.82;0.726	B;B;B;B;B	0.41894	0.252;0.369;0.204;0.369;0.204	T	0.48747	-0.9008	10	0.06891	T	0.86	.	4.1006	0.10012	0.4527:0.0:0.5473:0.0	.	512;513;532;511;535	B4DZL7;Q9NX02-2;A8K9G6;Q9NX02-4;Q9NX02	.;.;.;.;NALP2_HUMAN	I	535;511;513;535;513;512;511;532	ENSP00000445135:V535I;ENSP00000375601:V511I;ENSP00000344074:V513I;ENSP00000409370:V535I;ENSP00000440601:V513I;ENSP00000402474:V512I;ENSP00000441133:V511I;ENSP00000263437:V532I	ENSP00000263437:V532I	V	+	1	0	NLRP2	60186481	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	-0.131000	0.10482	-0.072000	0.12864	-0.224000	0.12420	GTA		NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396152.1	NM_017852	
KIF1B	23095	broad.mit.edu	37	1	10428581	10428581	+	Silent	SNP	C	C	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr1:10428581C>T	ENST00000377086.1	+	44	5011	c.4809C>T	c.(4807-4809)agC>agT	p.S1603S	KIF1B_ENST00000377081.1_Silent_p.S1603S|KIF1B_ENST00000263934.6_Silent_p.S1557S			O60333	KIF1B_HUMAN	kinesin family member 1B	1603					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)	p.S1557S(1)		breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		TGCACGGCAGCGTCAGTGACT	0.433																																					p.S1557S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4671T	1						.						151.0	127.0	135.0					1																	10428581		2203	4300	6503	10351168	SO:0001819	synonymous_variant	23095	exon42			AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.4809C>T	1.37:g.10428581C>T		Somatic		Capture	Illumina HiSeq	Phase_I	10351168	NM_015074	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Silent	SNP	ENST00000377086.1	37																																																																																					KIF1B-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000005102.1		
KCND3	3752	broad.mit.edu	37	1	112524481	112524481	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr1:112524481G>A	ENST00000315987.2	-	2	1347	c.868C>T	c.(868-870)Cgg>Tgg	p.R290W	KCND3_ENST00000369697.1_Missense_Mutation_p.R290W|KCND3_ENST00000302127.4_Missense_Mutation_p.R290W	NM_004980.4	NP_004971.2	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 3	290					cell death (GO:0008219)|membrane repolarization (GO:0086009)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.R290W(1)		NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	49		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)	Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	CGGAAGACCCGGAGCGTGACG	0.597																																					p.R290W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C868T	1						.						78.0	80.0	79.0					1																	112524481		2203	4300	6503	112326004	SO:0001583	missense	3752	exon2			AF048713	CCDS843.1, CCDS844.1	1p13.2	2014-09-17			ENSG00000171385	ENSG00000171385		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6239	protein-coding gene	gene with protein product		605411	"""spinocerebellar ataxia 22"", ""spinocerebellar ataxia 19"""	SCA22, SCA19		10942109, 16382104, 23280837	Standard	NM_172198		Approved	Kv4.3, KSHIVB	uc001ebu.1	Q9UK17	OTTHUMG00000011989	ENST00000315987.2:c.868C>T	1.37:g.112524481G>A	ENSP00000319591:p.Arg290Trp	Somatic		Capture	Illumina HiSeq	Phase_I	112326004	NM_004980	O60576|O60577|Q14D71|Q5T0M0|Q9UH85|Q9UH86|Q9UK16	Missense_Mutation	SNP	ENST00000315987.2	37	CCDS843.1	.	.	.	.	.	.	.	.	.	.	G	19.89	3.910127	0.72983	.	.	ENSG00000171385	ENST00000369697;ENST00000315987;ENST00000302127	D;D;D	0.98633	-5.04;-5.04;-5.04	5.63	5.63	0.86233	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99591	0.9852	H	0.99498	4.595	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97718	1.0195	10	0.87932	D	0	.	14.1682	0.65490	0.0:0.0:0.8123:0.1877	.	290;290	Q14D71;Q9UK17	.;KCND3_HUMAN	W	290	ENSP00000358711:R290W;ENSP00000319591:R290W;ENSP00000306923:R290W	ENSP00000306923:R290W	R	-	1	2	KCND3	112326004	1.000000	0.71417	0.990000	0.47175	0.987000	0.75469	4.101000	0.57769	2.659000	0.90383	0.655000	0.94253	CGG		KCND3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000033144.1	NM_172198	
PRAMEF1	65121	broad.mit.edu	37	1	12855901	12855901	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr1:12855901T>A	ENST00000332296.7	+	4	1284	c.1181T>A	c.(1180-1182)cTg>cAg	p.L394Q	PRAMEF1_ENST00000400814.3_Missense_Mutation_p.L149Q	NM_023013.2	NP_075389.1	O95521	PRAM1_HUMAN	PRAME family member 1	394					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.L394Q(2)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		ATTGACGCCCTGAAGGACCTG	0.552																																					p.L394Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T1181A	1						.						60.0	55.0	57.0					1																	12855901		2202	4296	6498	12778488	SO:0001583	missense	65121	exon4			AL049686	CCDS148.1	1p36.21	2013-01-17			ENSG00000116721	ENSG00000116721		"""-"""	28840	protein-coding gene	gene with protein product							Standard	NM_023013		Approved		uc001auj.2	O95521	OTTHUMG00000001928	ENST00000332296.7:c.1181T>A	1.37:g.12855901T>A	ENSP00000332134:p.Leu394Gln	Somatic		Capture	Illumina HiSeq	Phase_I	12778488	NM_023013	Q9UQP2	Missense_Mutation	SNP	ENST00000332296.7	37	CCDS148.1	.	.	.	.	.	.	.	.	.	.	.	11.78	1.739983	0.30865	.	.	ENSG00000116721	ENST00000332296;ENST00000400814	T;T	0.15952	2.38;2.38	1.56	1.56	0.23342	.	0.357546	0.25408	N	0.030887	T	0.40570	0.1122	M	0.88570	2.965	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	T	0.09574	-1.0668	10	0.87932	D	0	.	5.2173	0.15350	0.0:0.0:0.0:1.0	.	394	O95521	PRAM1_HUMAN	Q	394;149	ENSP00000332134:L394Q;ENSP00000383616:L149Q	ENSP00000332134:L394Q	L	+	2	0	PRAMEF1	12778488	0.002000	0.14202	0.005000	0.12908	0.007000	0.05969	0.751000	0.26348	0.966000	0.38159	0.172000	0.16884	CTG		PRAMEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005458.1	NM_023013	
IGSF3	3321	broad.mit.edu	37	1	117142956	117142956	+	Missense_Mutation	SNP	C	C	T	rs138769450		TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr1:117142956C>T	ENST00000369486.3	-	7	2401	c.1636G>A	c.(1636-1638)Gca>Aca	p.A546T	IGSF3_ENST00000318837.6_Missense_Mutation_p.A566T|IGSF3_ENST00000369483.1_Missense_Mutation_p.A566T	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	546	Ig-like C2-type 5.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)		p.A546T(1)|p.A566T(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		GCTGTGACTGCGAAGCCCATT	0.562													C|||	1	0.000199681	0.0	0.0	5008	,	,		19292	0.001		0.0	False		,,,				2504	0.0				p.A566T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1696A	1						.	C	THR/ALA,THR/ALA	1,4403		0,1,2201	29.0	33.0	32.0		1636,1696	4.5	0.9	1	dbSNP_134	32	0,8592		0,0,4296	no	missense,missense	IGSF3	NM_001007237.1,NM_001542.2	58,58	0,1,6497	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging	546/1195,566/1215	117142956	1,12995	2202	4296	6498	116944479	SO:0001583	missense	3321	exon8			AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.1636G>A	1.37:g.117142956C>T	ENSP00000358498:p.Ala546Thr	Somatic		Capture	Illumina HiSeq	Phase_I	116944479	NM_001542	A6NJZ6|A6NMC7	Missense_Mutation	SNP	ENST00000369486.3	37	CCDS30813.1	.	.	.	.	.	.	.	.	.	.	C	12.19	1.862427	0.32884	2.27E-4	0.0	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.02974	4.09;4.09;4.09	4.48	4.48	0.54585	.	0.121115	0.56097	D	0.000021	T	0.03520	0.0101	N	0.22421	0.69	0.40435	D	0.979981	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.981;0.998;0.957	T	0.65664	-0.6113	10	0.24483	T	0.36	-45.6919	14.6794	0.69006	0.0:1.0:0.0:0.0	.	566;546;566	O75054-2;O75054;A6NJZ6	.;IGSF3_HUMAN;.	T	546;566;566	ENSP00000358498:A546T;ENSP00000358495:A566T;ENSP00000321184:A566T	ENSP00000321184:A566T	A	-	1	0	IGSF3	116944479	1.000000	0.71417	0.950000	0.38849	0.324000	0.28378	1.515000	0.35845	2.297000	0.77311	0.455000	0.32223	GCA		IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542	
OTUD7B	56957	broad.mit.edu	37	1	149943015	149943015	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr1:149943015G>A	ENST00000369135.4	-	3	544	c.250C>T	c.(250-252)Cag>Tag	p.Q84*	OTUD7B_ENST00000479905.1_5'UTR	NM_020205.2	NP_064590.2	Q6GQQ9	OTU7B_HUMAN	OTU deubiquitinase 7B	84					mucosal immune response (GO:0002385)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of protein localization to nucleus (GO:1900181)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|DNA binding (GO:0003677)|Lys48-specific deubiquitinase activity (GO:1990380)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.Q84*(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Breast(34;0.0009)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.247)			TCCTGCCGCTGGAGGATGGGT	0.527																																					p.Q84X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C250T	1						.						87.0	85.0	86.0					1																	149943015		1901	4120	6021	148209639	SO:0001587	stop_gained	56957	exon3			AJ293573	CCDS72903.1	1q21.2	2014-02-24	2014-02-24	2006-07-07	ENSG00000163113	ENSG00000264522		"""OTU domain containing"""	16683	protein-coding gene	gene with protein product		611748	"""zinc finger, A20 domain containing 1"", ""OTU domain containing 7B"""	ZA20D1		11463333, 23827681	Standard	NM_020205		Approved	CEZANNE	uc001etn.3	Q6GQQ9	OTTHUMG00000012291	ENST00000369135.4:c.250C>T	1.37:g.149943015G>A	ENSP00000358131:p.Gln84*	Somatic		Capture	Illumina HiSeq	Phase_I	148209639	NM_020205	B7Z643|D3DUZ8|Q5SZ60|Q8WWA7|Q9NQ53|Q9UFF4	Nonsense_Mutation	SNP	ENST00000369135.4	37	CCDS41389.1	.	.	.	.	.	.	.	.	.	.	G	38	6.751205	0.97813	.	.	ENSG00000163113	ENST00000369135;ENST00000543330;ENST00000417191	.	.	.	5.34	5.34	0.76211	.	0.113895	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-34.4278	17.776	0.88508	0.0:0.0:1.0:0.0	.	.	.	.	X	84	.	.	Q	-	1	0	OTUD7B	148209639	1.000000	0.71417	0.967000	0.41034	0.968000	0.65278	9.150000	0.94667	2.776000	0.95493	0.650000	0.86243	CAG		OTUD7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034146.3	NM_020205	
FBLIM1	54751	broad.mit.edu	37	1	16097002	16097002	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr1:16097002T>C	ENST00000375766.3	+	6	1280	c.640T>C	c.(640-642)Tgc>Cgc	p.C214R	FBLIM1_ENST00000332305.5_Missense_Mutation_p.C117R|FBLIM1_ENST00000441801.2_Missense_Mutation_p.C214R|FBLIM1_ENST00000375771.1_Missense_Mutation_p.C214R|FBLIM1_ENST00000400773.1_Missense_Mutation_p.C117R	NM_017556.2	NP_060026.2	Q8WUP2	FBLI1_HUMAN	filamin binding LIM protein 1	214	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell junction assembly (GO:0034329)|regulation of cell shape (GO:0008360)|regulation of integrin activation (GO:0033623)|single organismal cell-cell adhesion (GO:0016337)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|stress fiber (GO:0001725)	filamin binding (GO:0031005)|zinc ion binding (GO:0008270)	p.C214R(1)		large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	16		Colorectal(325;0.000257)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.56e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|READ - Rectum adenocarcinoma(331;0.0649)|STAD - Stomach adenocarcinoma(313;0.138)		GTGCCGCACCTGCCGCCGCCA	0.642																																					p.C214R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T640C	1						.						50.0	48.0	49.0					1																	16097002		2203	4300	6503	15969589	SO:0001583	missense	54751	exon6				CCDS163.1, CCDS30609.1, CCDS44064.1	1p36.13	2014-04-07			ENSG00000162458	ENSG00000162458			24686	protein-coding gene	gene with protein product		607747				12679033, 12496242	Standard	XM_005245900		Approved	FBLP-1, CAL, migfilin	uc001axe.1	Q8WUP2	OTTHUMG00000003079	ENST00000375766.3:c.640T>C	1.37:g.16097002T>C	ENSP00000364921:p.Cys214Arg	Somatic		Capture	Illumina HiSeq	Phase_I	15969589	NM_017556	B3KNY0|Q5VVE0|Q5VVE1|Q8IX23|Q96T00|Q9UFD6	Missense_Mutation	SNP	ENST00000375766.3	37	CCDS163.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.961765	0.74016	.	.	ENSG00000162458	ENST00000375771;ENST00000375766;ENST00000400773;ENST00000502739;ENST00000441801;ENST00000332305	D;D;D;D;D;D	0.99898	-7.61;-7.61;-7.61;-4.71;-7.61;-7.61	5.51	5.51	0.81932	Zinc finger, LIM-type (5);	0.000000	0.85682	D	0.000000	D	0.99930	0.9968	H	0.98918	4.37	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79108	0.989;0.991;0.992	D	0.95983	0.8979	10	0.87932	D	0	.	15.1149	0.72394	0.0:0.0:0.0:1.0	.	117;214;214	Q8WUP2-3;Q8WUP2-2;Q8WUP2	.;.;FBLI1_HUMAN	R	214;214;117;117;214;117	ENSP00000364926:C214R;ENSP00000364921:C214R;ENSP00000383584:C117R;ENSP00000424920:C117R;ENSP00000416387:C214R;ENSP00000364920:C117R	ENSP00000364920:C117R	C	+	1	0	FBLIM1	15969589	1.000000	0.71417	1.000000	0.80357	0.645000	0.38454	5.668000	0.68074	2.233000	0.73108	0.482000	0.46254	TGC		FBLIM1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008511.3	NM_001024215	
FLG2	388698	broad.mit.edu	37	1	152326460	152326460	+	Nonsense_Mutation	SNP	G	G	A	rs374835256		TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr1:152326460G>A	ENST00000388718.5	-	3	3874	c.3802C>T	c.(3802-3804)Cga>Tga	p.R1268*	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1268	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.R1268*(1)		NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTAGATCTTCGTCTTCTAGTT	0.463																																					p.R1268X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C3802T	1						.	G	stop/ARG	0,4406		0,0,2203	345.0	318.0	327.0		3802	-6.9	0.0	1		327	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained	FLG2	NM_001014342.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		1268/2392	152326460	1,13005	2203	4300	6503	150593084	SO:0001587	stop_gained	388698	exon3			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.3802C>T	1.37:g.152326460G>A	ENSP00000373370:p.Arg1268*	Somatic		Capture	Illumina HiSeq	Phase_I	150593084	NM_001014342	Q9H4U1	Nonsense_Mutation	SNP	ENST00000388718.5	37	CCDS30861.1	.	.	.	.	.	.	.	.	.	.	G	38	7.231003	0.98150	0.0	1.16E-4	ENSG00000143520	ENST00000388718	.	.	.	3.44	-6.88	0.01665	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	-17.9278	3.9866	0.09519	0.1003:0.1166:0.1673:0.6158	.	.	.	.	X	1268	.	ENSP00000373370:R1268X	R	-	1	2	FLG2	150593084	0.000000	0.05858	0.000000	0.03702	0.233000	0.25261	-1.417000	0.02464	-1.308000	0.02318	0.306000	0.20318	CGA		FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342	
FMO1	2326	broad.mit.edu	37	1	171250069	171250069	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr1:171250069C>T	ENST00000354841.4	+	5	903	c.772C>T	c.(772-774)Cga>Tga	p.R258*	FMO1_ENST00000402921.2_Nonsense_Mutation_p.R195*|FMO1_ENST00000367750.3_Nonsense_Mutation_p.R258*|FMO1_ENST00000469112.1_3'UTR	NM_001282692.1	NP_001269621.1	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1	258					NADPH oxidation (GO:0070995)|organic acid metabolic process (GO:0006082)|small molecule metabolic process (GO:0044281)|toxin metabolic process (GO:0009404)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|monooxygenase activity (GO:0004497)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)	p.R258*(1)		NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(2)|skin(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Cevimeline(DB00185)|Cimetidine(DB00501)|Lorcaserin(DB04871)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	GTTGATGGAGCGAAAGATAAA	0.448																																					p.R258X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C772T	1						.						102.0	97.0	98.0					1																	171250069		2203	4300	6503	169516693	SO:0001587	stop_gained	2326	exon6			M64082	CCDS1294.1, CCDS60351.1	1q24.3	2011-08-04			ENSG00000010932	ENSG00000010932	1.14.13.8		3769	protein-coding gene	gene with protein product		136130					Standard	XM_005245037		Approved		uc001ghl.3	Q01740	OTTHUMG00000035502	ENST00000354841.4:c.772C>T	1.37:g.171250069C>T	ENSP00000346901:p.Arg258*	Somatic		Capture	Illumina HiSeq	Phase_I	169516693	NM_002021	A8K248|B7Z3P4|Q5QPT2|Q9UJC2	Nonsense_Mutation	SNP	ENST00000354841.4	37	CCDS1294.1	.	.	.	.	.	.	.	.	.	.	C	18.81	3.703175	0.68501	.	.	ENSG00000010932	ENST00000367750;ENST00000402921;ENST00000354841	.	.	.	6.06	3.68	0.42216	.	0.566735	0.21148	N	0.079371	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12103	T	0.63	-9.3219	12.4712	0.55787	0.7248:0.2752:0.0:0.0	.	.	.	.	X	258;195;258	.	ENSP00000346901:R258X	R	+	1	2	FMO1	169516693	0.000000	0.05858	0.013000	0.15412	0.169000	0.22640	0.616000	0.24344	1.116000	0.41820	-0.262000	0.10625	CGA		FMO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086212.1	NM_002021	
PLA2G2C	391013	broad.mit.edu	37	1	20501550	20501550	+	Silent	SNP	G	G	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr1:20501550G>A	ENST00000429261.2	-	2	189	c.129C>T	c.(127-129)ggC>ggT	p.G43G	PLA2G2C_ENST00000247992.5_Silent_p.G46G|PLA2G2C_ENST00000495760.2_5'UTR			Q5R387	PA2GC_HUMAN	phospholipase A2, group IIC	43					lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)	p.G46G(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(1)	7		Colorectal(325;0.000147)|Renal(390;0.000469)|Lung NSC(340;0.00412)|all_lung(284;0.00419)|Breast(348;0.00526)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|COAD - Colon adenocarcinoma(152;1.14e-05)|BRCA - Breast invasive adenocarcinoma(304;8.01e-05)|Kidney(64;0.000171)|GBM - Glioblastoma multiforme(114;0.000528)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CACAGTAGCAGCCATATCCGT	0.527																																					p.G46G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C138T	1						.						68.0	74.0	72.0					1																	20501550		1967	4165	6132	20374137	SO:0001819	synonymous_variant	391013	exon1					1p36.12	2010-06-04	2003-10-13		ENSG00000187980	ENSG00000187980			9032	protein-coding gene	gene with protein product			"""phospholipase A2, group IIC (possible pseudogene)"""			8838795	Standard	NM_001105572		Approved		uc009vpq.1	Q5R387	OTTHUMG00000002705	ENST00000429261.2:c.129C>T	1.37:g.20501550G>A		Somatic		Capture	Illumina HiSeq	Phase_I	20374137	NM_001105572	Q7M4M6	Silent	SNP	ENST00000429261.2	37																																																																																					PLA2G2C-001	PUTATIVE	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000007689.3	NM_001105572	
AIM1L	55057	broad.mit.edu	37	1	26664941	26664941	+	Silent	SNP	G	G	A	rs377077531		TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr1:26664941G>A	ENST00000308182.5	-	6	666	c.237C>T	c.(235-237)ttC>ttT	p.F79F	AIM1L_ENST00000527815.1_Silent_p.F250F|AIM1L_ENST00000522993.1_5'Flank			Q8N1P7	AIM1L_HUMAN	absent in melanoma 1-like	79	Beta/gamma crystallin 'Greek key' 2. {ECO:0000255|PROSITE-ProRule:PRU00028}.						carbohydrate binding (GO:0030246)	p.F79F(1)		endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|pancreas(1)|skin(2)	12		all_cancers(24;4.67e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.51e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000792)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.00858)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.165)|LUSC - Lung squamous cell carcinoma(448;0.239)		GAGTGTCTTCGAATAATGGTT	0.587																																					p.F1124F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3372T	1						.	G		0,4406		0,0,2203	123.0	124.0	124.0		3372	0.1	1.0	1		124	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	AIM1L	NM_001039775.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		1124/1662	26664941	1,13005	2203	4300	6503	26537528	SO:0001819	synonymous_variant	55057	exon7					1p35	2010-07-14			ENSG00000176092	ENSG00000176092			17295	protein-coding gene	gene with protein product	"""beta-gamma crystallin domain containing 2"""						Standard	NM_001039775		Approved	CRYBG2, FLJ38020	uc001bmd.4	Q8N1P7	OTTHUMG00000003490	ENST00000308182.5:c.237C>T	1.37:g.26664941G>A		Somatic		Capture	Illumina HiSeq	Phase_I	26537528	NM_001039775	B2RNG3|Q5T137|Q5T150	Silent	SNP	ENST00000308182.5	37		.	.	.	.	.	.	.	.	.	.	G	7.232	0.599531	0.13939	0.0	1.16E-4	ENSG00000176092	ENST00000429942	.	.	.	5.16	0.123	0.14709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.5269	0.39169	0.7063:0.0:0.2937:0.0	.	.	.	.	X	29	.	.	R	-	1	2	AIM1L	26537528	1.000000	0.71417	0.995000	0.50966	0.557000	0.35523	1.966000	0.40481	0.092000	0.17331	-1.152000	0.01820	CGA		AIM1L-201	KNOWN	basic	protein_coding	protein_coding		NM_001039775.2	
CSMD2	114784	broad.mit.edu	37	1	34002691	34002691	+	Silent	SNP	C	C	T	rs199832735	byFrequency	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr1:34002691C>T	ENST00000373381.4	-	62	9986	c.9810G>A	c.(9808-9810)ccG>ccA	p.P3270P		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	3126						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P3126P(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TGGTCAGGGTCGGATCTGGAT	0.517													C|||	17	0.00339457	0.0	0.0	5008	,	,		21196	0.0		0.0	False		,,,				2504	0.0174				p.P3126P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G9378A	1						.						136.0	116.0	123.0					1																	34002691		2203	4300	6503	33775278	SO:0001819	synonymous_variant	114784	exon61			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.9810G>A	1.37:g.34002691C>T		Somatic		Capture	Illumina HiSeq	Phase_I	33775278	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	ENST00000373381.4	37																																																																																					CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896	
CYP4B1	1580	broad.mit.edu	37	1	47278192	47278192	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr1:47278192G>T	ENST00000271153.4	+	4	428	c.392G>T	c.(391-393)gGg>gTg	p.G131V	CYP4B1_ENST00000371919.4_Missense_Mutation_p.G116V|CYP4B1_ENST00000371923.4_Missense_Mutation_p.G131V|CYP4B1_ENST00000452782.2_5'UTR			P13584	CP4B1_HUMAN	cytochrome P450, family 4, subfamily B, polypeptide 1	131					biphenyl metabolic process (GO:0018879)|exogenous drug catabolic process (GO:0042738)|fluorene metabolic process (GO:0018917)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|drug binding (GO:0008144)|fluorene oxygenase activity (GO:0018585)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)	p.G131V(1)		NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	36	Acute lymphoblastic leukemia(166;0.155)				Midazolam(DB00683)|Phenobarbital(DB01174)|Thiamine(DB00152)	GTTCTTGAGGGGCCCAAGTGG	0.587																																					p.G131V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G392T	1						.						105.0	83.0	90.0					1																	47278192		2203	4300	6503	47050779	SO:0001583	missense	1580	exon4			BC017758	CCDS542.1, CCDS41328.1	1p33	2013-11-11	2003-01-14		ENSG00000142973	ENSG00000142973		"""Cytochrome P450s"""	2644	protein-coding gene	gene with protein product		124075	"""cytochrome P450, subfamily IVB, polypeptide 1"""				Standard	NM_000779		Approved		uc001cqn.4	P13584	OTTHUMG00000007984	ENST00000271153.4:c.392G>T	1.37:g.47278192G>T	ENSP00000271153:p.Gly131Val	Somatic		Capture	Illumina HiSeq	Phase_I	47050779	NM_001099772	Q1HBI2|Q8TD85|Q8WWF2|Q8WWU9|Q8WWV0	Missense_Mutation	SNP	ENST00000271153.4	37	CCDS542.1	.	.	.	.	.	.	.	.	.	.	G	32	5.133708	0.94517	.	.	ENSG00000142973	ENST00000371923;ENST00000271153;ENST00000371919	D;D;T	0.84730	-1.89;-1.89;-0.94	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	D	0.95059	0.8400	H	0.94582	3.555	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;0.999	D	0.95571	0.8638	10	0.87932	D	0	.	20.2876	0.98536	0.0:0.0:1.0:0.0	.	116;131;131	Q8IZB0;P13584-2;P13584	.;.;CP4B1_HUMAN	V	131;131;116	ENSP00000360991:G131V;ENSP00000271153:G131V;ENSP00000360987:G116V	ENSP00000271153:G131V	G	+	2	0	CYP4B1	47050779	1.000000	0.71417	0.300000	0.25030	0.985000	0.73830	7.564000	0.82326	2.801000	0.96364	0.591000	0.81541	GGG		CYP4B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021911.1	NM_000779	
EPS15	2060	broad.mit.edu	37	1	51866591	51866591	+	Splice_Site	SNP	G	G	A	rs148068749		TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr1:51866591G>A	ENST00000371733.3	-	19	2013	c.1917C>T	c.(1915-1917)atC>atT	p.I639I	EPS15_ENST00000493793.1_5'Flank|EPS15_ENST00000396122.4_Splice_Site_p.I316I|EPS15_ENST00000371730.2_Splice_Site_p.I505I	NM_001981.2	NP_001972.1	P42566	EPS15_HUMAN	epidermal growth factor receptor pathway substrate 15	639	15 X 3 AA repeats of D-P-F.				cell proliferation (GO:0008283)|clathrin coat assembly (GO:0048268)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|protein transport (GO:0015031)|vesicle organization (GO:0016050)	AP-2 adaptor complex (GO:0030122)|ciliary membrane (GO:0060170)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|polyubiquitin binding (GO:0031593)	p.0?(2)|p.I639I(1)		endometrium(3)|kidney(5)|large_intestine(8)|lung(13)|prostate(2)|skin(1)|stomach(1)|urinary_tract(2)	35						GATACTGACCGATTTTTCCAA	0.328			T	MLL	ALL								G|||	1	0.000199681	0.0008	0.0	5008	,	,		17124	0.0		0.0	False		,,,				2504	0.0				p.I325I			Dom	yes		1	1p32	2060	epidermal growth factor receptor pathway substrate 15 (AF1p)		L	.	.	3	Whole gene deletion(2)|Substitution - coding silent(1)	thyroid(1)|large_intestine(1)|central_nervous_system(1)	c.C975T	1						.	G	,	0,4406		0,0,2203	76.0	77.0	77.0		975,1917	-2.4	1.0	1	dbSNP_134	77	1,8593	1.2+/-3.3	0,1,4296	yes	coding-synonymous-near-splice,coding-synonymous-near-splice	EPS15	NM_001159969.1,NM_001981.2	,	0,1,6499	AA,AG,GG		0.0116,0.0,0.0077	,	325/583,639/897	51866591	1,12999	2203	4297	6500	51639179	SO:0001630	splice_region_variant	2060	exon7			BC054006	CCDS557.1	1p32	2013-01-10			ENSG00000085832	ENSG00000085832		"""EF-hand domain containing"""	3419	protein-coding gene	gene with protein product		600051				8183552	Standard	NM_001159969		Approved	AF-1P, MLLT5	uc001csq.1	P42566	OTTHUMG00000008192	ENST00000371733.3:c.1918+1C>T	1.37:g.51866591G>A		Somatic		Capture	Illumina HiSeq	Phase_I	51639179	NM_001159969	B2R8J7|D3DPJ2|Q5SRH4	Silent	SNP	ENST00000371733.3	37	CCDS557.1																																																																																				EPS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022422.1	NM_001981	Silent
PRKAA2	5563	broad.mit.edu	37	1	57173324	57173324	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr1:57173324G>T	ENST00000371244.4	+	9	1663	c.1597G>T	c.(1597-1599)Ggc>Tgc	p.G533C		NM_006252.3	NP_006243.2	P54646	AAPK2_HUMAN	protein kinase, AMP-activated, alpha 2 catalytic subunit	533					autophagy (GO:0006914)|carnitine shuttle (GO:0006853)|cell cycle arrest (GO:0007050)|cellular lipid metabolic process (GO:0044255)|cellular response to glucose starvation (GO:0042149)|cellular response to nutrient levels (GO:0031669)|cholesterol biosynthetic process (GO:0006695)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid homeostasis (GO:0055089)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|positive regulation of glycolytic process (GO:0045821)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|regulation of energy homeostasis (GO:2000505)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	[acetyl-CoA carboxylase] kinase activity (GO:0050405)|[hydroxymethylglutaryl-CoA reductase (NADPH)] kinase activity (GO:0047322)|AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|histone serine kinase activity (GO:0035174)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)	p.G533C(2)		breast(6)|endometrium(1)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)|stomach(1)	23					Acetylsalicylic acid(DB00945)	ACCTCGCCTGGGCAGTCACAC	0.433																																					p.G533C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1597T	1						.						149.0	133.0	138.0					1																	57173324		2203	4300	6503	56945912	SO:0001583	missense	5563	exon9			BC069823	CCDS605.1	1p31	2011-08-25			ENSG00000162409	ENSG00000162409			9377	protein-coding gene	gene with protein product		600497		PRKAA		7959015	Standard	NM_006252		Approved	AMPK, AMPKa2	uc001cyk.4	P54646	OTTHUMG00000008282	ENST00000371244.4:c.1597G>T	1.37:g.57173324G>T	ENSP00000360290:p.Gly533Cys	Somatic		Capture	Illumina HiSeq	Phase_I	56945912	NM_006252	Q9H1E8|Q9UD43	Missense_Mutation	SNP	ENST00000371244.4	37	CCDS605.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.852651	0.91355	.	.	ENSG00000162409	ENST00000371244	T	0.72505	-0.66	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	T	0.80215	0.4582	L	0.55990	1.75	0.80722	D	1	D	0.76494	0.999	P	0.57776	0.827	T	0.80585	-0.1317	10	0.87932	D	0	-19.7706	20.4777	0.99188	0.0:0.0:1.0:0.0	.	533	P54646	AAPK2_HUMAN	C	533	ENSP00000360290:G533C	ENSP00000360290:G533C	G	+	1	0	PRKAA2	56945912	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	9.476000	0.97823	2.840000	0.97914	0.655000	0.94253	GGC		PRKAA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022753.2	NM_006252	
ZNF326	284695	broad.mit.edu	37	1	90475679	90475679	+	Silent	SNP	C	C	T	rs371249300	byFrequency	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr1:90475679C>T	ENST00000340281.4	+	6	791	c.648C>T	c.(646-648)ccC>ccT	p.P216P	ZNF326_ENST00000370447.3_Silent_p.P127P|ZNF326_ENST00000455342.2_Silent_p.P10P	NM_182976.2	NP_892021.1	Q5BKZ1	ZN326_HUMAN	zinc finger protein 326	216					mRNA processing (GO:0006397)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, elongation (GO:0032784)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	DBIRD complex (GO:0044609)|nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)|zinc ion binding (GO:0008270)	p.P216P(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(7)|ovary(1)	25		all_lung(203;0.0116)|Lung NSC(277;0.0417)		all cancers(265;0.00728)|Epithelial(280;0.0265)		TTCATAGACCCGGAATTGTTG	0.328													C|||	2	0.000399361	0.0	0.0029	5008	,	,		16336	0.0		0.0	False		,,,				2504	0.0				p.P216P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C648T	1						.	C		1,4405	2.1+/-5.4	0,1,2202	82.0	88.0	86.0		648	-3.8	1.0	1		86	0,8596		0,0,4298	no	coding-synonymous	ZNF326	NM_182976.2		0,1,6500	TT,TC,CC		0.0,0.0227,0.0077		216/583	90475679	1,13001	2203	4298	6501	90248267	SO:0001819	synonymous_variant	284695	exon6			BC013102	CCDS727.1, CCDS728.1	1p22	2012-04-19			ENSG00000162664	ENSG00000162664		"""Zinc fingers, C2H2-type"""	14104	protein-coding gene	gene with protein product	"""ZNF-protein interacting with nuclear mRNPs and DBC1"""	614601				22446626	Standard	NM_182976		Approved	Zfp326, ZAN75, FLJ20403, ZIRD	uc001dnq.2	Q5BKZ1	OTTHUMG00000010675	ENST00000340281.4:c.648C>T	1.37:g.90475679C>T		Somatic		Capture	Illumina HiSeq	Phase_I	90248267	NM_182976	A8MYX1|B4DLN0|B4E179|Q5VW93|Q5VW94|Q5VW96|Q5VW97|Q6NSA2|Q7Z638|Q7Z6C2	Silent	SNP	ENST00000340281.4	37	CCDS727.1																																																																																				ZNF326-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029428.2	NM_181781	
BARHL2	343472	broad.mit.edu	37	1	91182632	91182632	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr1:91182632C>T	ENST00000370445.4	-	1	162	c.121G>A	c.(121-123)Gcg>Acg	p.A41T		NM_020063.1	NP_064447.1	Q9NY43	BARH2_HUMAN	BarH-like homeobox 2	41					cell fate determination (GO:0001709)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|positive regulation of translation (GO:0045727)|regulation of axon extension (GO:0030516)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)	p.A41T(1)		cervix(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		all_lung(203;0.0263)|Lung SC(238;0.128)		all cancers(265;0.000897)|Epithelial(280;0.00516)|OV - Ovarian serous cystadenocarcinoma(397;0.211)		CTAAAATCCGCGGTCCTGGCC	0.577																																					p.A41T	GBM(199;3561 4100 22440)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G121A	1						.						88.0	97.0	94.0					1																	91182632		2203	4300	6503	90955220	SO:0001583	missense	343472	exon1			AJ251753	CCDS730.1	1p22.2	2011-07-08	2007-07-09		ENSG00000143032	ENSG00000143032		"""Homeoboxes / ANTP class : NKL subclass"""	954	protein-coding gene	gene with protein product		605212	"""BarH (Drosophila)-like 2"""				Standard	NM_020063		Approved		uc001dns.3	Q9NY43	OTTHUMG00000010020	ENST00000370445.4:c.121G>A	1.37:g.91182632C>T	ENSP00000359474:p.Ala41Thr	Somatic		Capture	Illumina HiSeq	Phase_I	90955220	NM_020063	A0AVP2|Q7Z4N7	Missense_Mutation	SNP	ENST00000370445.4	37	CCDS730.1	.	.	.	.	.	.	.	.	.	.	C	11.65	1.701573	0.30142	.	.	ENSG00000143032	ENST00000370445	D	0.91124	-2.79	5.92	2.35	0.29111	.	0.211171	0.49916	N	0.000134	T	0.54727	0.1876	N	0.03608	-0.345	0.32649	N	0.51967	B	0.02656	0.0	B	0.01281	0.0	T	0.31668	-0.9935	10	0.09338	T	0.73	.	7.4523	0.27246	0.0:0.5463:0.0:0.4537	.	41	Q9NY43	BARH2_HUMAN	T	41	ENSP00000359474:A41T	ENSP00000359474:A41T	A	-	1	0	BARHL2	90955220	0.999000	0.42202	1.000000	0.80357	0.997000	0.91878	1.970000	0.40520	0.707000	0.31934	0.650000	0.86243	GCG		BARHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027728.2		
SWT1	54823	broad.mit.edu	37	1	185183712	185183712	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr1:185183712T>A	ENST00000367500.4	+	14	2211	c.2046T>A	c.(2044-2046)agT>agA	p.S682R	SWT1_ENST00000367501.3_Missense_Mutation_p.S682R	NM_017673.6	NP_060143.4	Q5T5J6	SWT1_HUMAN	SWT1 RNA endoribonuclease homolog (S. cerevisiae)	682								p.S682R(1)		breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(16)|ovary(1)|prostate(1)|urinary_tract(1)	41						ATGCTTTCAGTACAAGGTCAA	0.373																																					p.S682R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2046A	1						.						103.0	98.0	100.0					1																	185183712		2203	4300	6503	183450335	SO:0001583	missense	54823	exon14			AF288392	CCDS1367.1	1q25	2013-08-29	2011-01-24	2011-01-24	ENSG00000116668	ENSG00000116668			16785	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 26"""	C1orf26		11318611, 19127978, 23768067	Standard	NM_017673		Approved	FLJ20121, HsSwt1	uc001grg.4	Q5T5J6	OTTHUMG00000035390	ENST00000367500.4:c.2046T>A	1.37:g.185183712T>A	ENSP00000356470:p.Ser682Arg	Somatic		Capture	Illumina HiSeq	Phase_I	183450335	NM_001105518	Q8NEK9|Q9BZQ7|Q9NXQ0	Missense_Mutation	SNP	ENST00000367500.4	37	CCDS1367.1	.	.	.	.	.	.	.	.	.	.	T	18.63	3.665426	0.67700	.	.	ENSG00000116668	ENST00000367501;ENST00000367500	T;T	0.20200	2.09;2.09	5.35	4.93E-5	0.14040	.	0.175801	0.48767	D	0.000177	T	0.40815	0.1132	M	0.73962	2.25	0.39141	D	0.962049	D	0.76494	0.999	D	0.83275	0.996	T	0.27054	-1.0085	10	0.66056	D	0.02	.	9.6099	0.39657	0.0:0.4477:0.0:0.5523	.	682	Q5T5J6	SWT1_HUMAN	R	682	ENSP00000356471:S682R;ENSP00000356470:S682R	ENSP00000356470:S682R	S	+	3	2	SWT1	183450335	1.000000	0.71417	0.993000	0.49108	0.991000	0.79684	0.745000	0.26259	-0.182000	0.10602	-0.250000	0.11733	AGT		SWT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085790.1	NM_017673	
MACROD2	140733	broad.mit.edu	37	20	15412073	15412073	+	Silent	SNP	C	C	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr20:15412073C>A	ENST00000310348.4	+	7	564	c.564C>A	c.(562-564)ggC>ggA	p.G188G	MACROD2_ENST00000217246.4_Silent_p.G188G|MACROD2_ENST00000402914.1_5'UTR			A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2	188	Macro. {ECO:0000255|PROSITE- ProRule:PRU00490}.|Substrate binding.				brain development (GO:0007420)|cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)	p.G188G(1)		breast(2)|kidney(4)|large_intestine(5)|lung(8)|skin(1)	20		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				TCTCAACAGGCATTTATGGTA	0.318																																					p.G188G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C564A	20						.						307.0	274.0	284.0					20																	15412073		1845	4087	5932	15360073	SO:0001819	synonymous_variant	140733	exon7			BC101218	CCDS13120.2, CCDS33443.1	20p12.1	2011-04-28	2007-07-24	2007-07-24	ENSG00000172264	ENSG00000172264			16126	protein-coding gene	gene with protein product		611567	"""chromosome 20 open reading frame 133"""	C20orf133			Standard	NM_080676		Approved	dJ631M13.5	uc002wot.3	A1Z1Q3	OTTHUMG00000031919	ENST00000310348.4:c.564C>A	20.37:g.15412073C>A		Somatic		Capture	Illumina HiSeq	Phase_I	15360073	NM_080676	A6NFF7|B0QZ39|B3KWV0|Q0P6D5|Q495E0|Q5W199|Q6ZN71	Silent	SNP	ENST00000310348.4	37	CCDS13120.2																																																																																				MACROD2-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_080676	
SNTA1	6640	broad.mit.edu	37	20	32005542	32005542	+	Silent	SNP	G	G	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr20:32005542G>A	ENST00000217381.2	-	3	955	c.684C>T	c.(682-684)ccC>ccT	p.P228P		NM_003098.2	NP_003089.1	Q13424	SNTA1_HUMAN	syntrophin, alpha 1	228	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				muscle contraction (GO:0006936)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|neuromuscular junction development (GO:0007528)|regulation of heart rate (GO:0002027)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of vasoconstriction by circulating norepinephrine (GO:0003117)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|ventricular cardiac muscle cell action potential (GO:0086005)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular (GO:0005622)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	ATPase binding (GO:0051117)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)	p.P228P(1)		breast(1)|large_intestine(4)|liver(1)|lung(4)|skin(1)|stomach(1)|urinary_tract(1)	13						CCGGGTCATTGGGGGTGCACC	0.592																																					p.P228P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C684T	20						.						54.0	55.0	55.0					20																	32005542		2203	4300	6503	31469203	SO:0001819	synonymous_variant	6640	exon3			U40571	CCDS13220.1	20q11.2	2014-09-17	2012-06-15		ENSG00000101400	ENSG00000101400			11167	protein-coding gene	gene with protein product	"""pro-TGF-alpha cytoplasmic domain-interacting protein 1"", ""dystrophin-associated protein A1, 59kDa, acidic component"""	601017	"""syntrophin, alpha 1 (dystrophin-associated protein A1, 59kD, acidic component)"""	SNT1		8576247, 8612778	Standard	NM_003098		Approved	TACIP1, LQT12	uc002wzd.1	Q13424	OTTHUMG00000032259	ENST00000217381.2:c.684C>T	20.37:g.32005542G>A		Somatic		Capture	Illumina HiSeq	Phase_I	31469203	NM_003098	A8K7H9|B4DX40|E1P5N1|Q16438	Silent	SNP	ENST00000217381.2	37	CCDS13220.1																																																																																				SNTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078704.2	NM_003098	
CDH22	64405	broad.mit.edu	37	20	44869815	44869815	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr20:44869815C>T	ENST00000372262.3	-	2	737	c.337G>A	c.(337-339)Gac>Aac	p.D113N	CDH22_ENST00000537909.1_Missense_Mutation_p.D113N	NM_021248.1	NP_067071.1	Q9UJ99	CAD22_HUMAN	cadherin 22, type 2	113	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D113N(1)		endometrium(3)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	44		Myeloproliferative disorder(115;0.0122)				GTCAGCTCGTCGATCAGGAAG	0.617																																					p.D113N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G337A	20						.						78.0	66.0	70.0					20																	44869815		2203	4300	6503	44303222	SO:0001583	missense	64405	exon2			AF035300	CCDS13395.1	20q13.1	2010-01-26	2009-11-20		ENSG00000149654	ENSG00000149654		"""Cadherins / Major cadherins"""	13251	protein-coding gene	gene with protein product		609920	"""cadherin-like 22"""	C20orf25		8626716	Standard	NM_021248		Approved	dJ998H6.1	uc010ghk.2	Q9UJ99	OTTHUMG00000033073	ENST00000372262.3:c.337G>A	20.37:g.44869815C>T	ENSP00000361336:p.Asp113Asn	Somatic		Capture	Illumina HiSeq	Phase_I	44303222	NM_021248	B9EGK7|O43205	Missense_Mutation	SNP	ENST00000372262.3	37	CCDS13395.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.515254	0.85389	.	.	ENSG00000149654	ENST00000372262;ENST00000537909	T;T	0.62788	-0.0;-0.0	4.21	4.21	0.49690	Cadherin (5);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.71517	0.3349	L	0.42744	1.35	0.58432	D	0.999999	D	0.89917	1.0	D	0.85130	0.997	T	0.68884	-0.5291	10	0.30854	T	0.27	.	16.127	0.81402	0.0:1.0:0.0:0.0	.	113	Q9UJ99	CAD22_HUMAN	N	113	ENSP00000361336:D113N;ENSP00000437790:D113N	ENSP00000361336:D113N	D	-	1	0	CDH22	44303222	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	7.320000	0.79064	2.364000	0.80123	0.455000	0.32223	GAC		CDH22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080491.1	NM_021248	
SALL4	57167	broad.mit.edu	37	20	50401201	50401201	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr20:50401201G>A	ENST00000217086.4	-	4	2876	c.2765C>T	c.(2764-2766)gCg>gTg	p.A922V	SALL4_ENST00000371539.3_Missense_Mutation_p.A145V|SALL4_ENST00000395997.3_Missense_Mutation_p.A485V	NM_020436.3	NP_065169.1	Q9UJQ4	SALL4_HUMAN	spalt-like transcription factor 4	922					embryonic limb morphogenesis (GO:0030326)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A922V(1)		endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(27)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GTTATTGTTCGCCCCGTGTGT	0.468																																					p.A922V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2765T	20						.						81.0	72.0	75.0					20																	50401201		2203	4300	6503	49834608	SO:0001583	missense	57167	exon4			AK001666	CCDS13438.1	20q13.2	2014-09-17	2013-10-17		ENSG00000101115	ENSG00000101115		"""Zinc fingers, C2H2-type"""	15924	protein-coding gene	gene with protein product		607343	"""sal (Drosophila)-like 4"", ""sal-like 4 (Drosophila)"""				Standard	NM_020436		Approved	dJ1112F19.1, ZNF797	uc002xwh.4	Q9UJQ4	OTTHUMG00000032752	ENST00000217086.4:c.2765C>T	20.37:g.50401201G>A	ENSP00000217086:p.Ala922Val	Somatic		Capture	Illumina HiSeq	Phase_I	49834608	NM_020436	A2A2D8|Q540H3|Q6Y8G6	Missense_Mutation	SNP	ENST00000217086.4	37	CCDS13438.1	.	.	.	.	.	.	.	.	.	.	G	12.32	1.901649	0.33535	.	.	ENSG00000101115	ENST00000217086;ENST00000395997;ENST00000371539	T;T;T	0.35048	3.0;3.0;1.33	3.56	3.56	0.40772	Zinc finger, C2H2 (1);	0.000000	0.42821	D	0.000641	T	0.42359	0.1199	L	0.36672	1.1	0.30361	N	0.783777	D;P;P	0.76494	0.999;0.783;0.527	D;B;B	0.70716	0.97;0.058;0.054	T	0.18116	-1.0347	10	0.13108	T	0.6	-22.8172	10.9269	0.47195	0.0:0.0:1.0:0.0	.	485;145;922	A2A2D8;Q6Y8G5;Q9UJQ4	.;.;SALL4_HUMAN	V	922;485;145	ENSP00000217086:A922V;ENSP00000379319:A485V;ENSP00000360594:A145V	ENSP00000217086:A922V	A	-	2	0	SALL4	49834608	1.000000	0.71417	0.873000	0.34254	0.681000	0.39784	2.406000	0.44557	2.303000	0.77524	0.561000	0.74099	GCG		SALL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079738.3		
PAK7	57144	broad.mit.edu	37	20	9546755	9546755	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr20:9546755G>T	ENST00000378429.3	-	6	1813	c.1267C>A	c.(1267-1269)Cag>Aag	p.Q423K	PAK7_ENST00000353224.5_Missense_Mutation_p.Q423K|PAK7_ENST00000378423.1_Missense_Mutation_p.Q423K	NM_020341.3	NP_065074.1	Q9P286	PAK7_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 7	423	Linker.				apoptotic process (GO:0006915)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|learning (GO:0007612)|locomotory behavior (GO:0007626)|memory (GO:0007613)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.Q423K(1)|p.Q423E(1)		NS(1)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(44)|ovary(2)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)	81			COAD - Colon adenocarcinoma(9;0.194)			CTGGAGGGCTGCTGGTCGGAG	0.622																																					p.Q423K												.	.	2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	c.C1267A	20						.						56.0	58.0	57.0					20																	9546755		2203	4300	6503	9494755	SO:0001583	missense	57144	exon5			AB033090	CCDS13107.1	20p12	2008-06-17	2008-06-17		ENSG00000101349	ENSG00000101349			15916	protein-coding gene	gene with protein product		608038	"""p21(CDKN1A)-activated kinase 7"""			11756552, 10574462	Standard	NM_020341		Approved	KIAA1264, PAK5	uc002wnk.2	Q9P286	OTTHUMG00000031857	ENST00000378429.3:c.1267C>A	20.37:g.9546755G>T	ENSP00000367686:p.Gln423Lys	Somatic		Capture	Illumina HiSeq	Phase_I	9494755	NM_177990	A8K5T6|D3DW14|Q5W115|Q9BX09|Q9ULF6	Missense_Mutation	SNP	ENST00000378429.3	37	CCDS13107.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.506097	0.85282	.	.	ENSG00000101349	ENST00000378429;ENST00000353224;ENST00000378423;ENST00000439520	T;T;T	0.72942	-0.7;-0.7;-0.7	5.66	5.66	0.87406	.	0.109437	0.64402	D	0.000004	T	0.70124	0.3188	M	0.62723	1.935	0.80722	D	1	B;B	0.27068	0.167;0.167	B;B	0.26517	0.07;0.07	T	0.65360	-0.6187	9	.	.	.	.	19.7589	0.96306	0.0:0.0:1.0:0.0	.	423;423	B0AZM9;Q9P286	.;PAK7_HUMAN	K	423;423;423;371	ENSP00000367686:Q423K;ENSP00000322957:Q423K;ENSP00000367679:Q423K	.	Q	-	1	0	PAK7	9494755	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.373000	0.66162	2.654000	0.90174	0.585000	0.79938	CAG		PAK7-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077962.1		
TSHZ2	128553	broad.mit.edu	37	20	51871827	51871827	+	Silent	SNP	G	G	A	rs147016688	byFrequency	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr20:51871827G>A	ENST00000371497.5	+	2	2717	c.1830G>A	c.(1828-1830)gcG>gcA	p.A610A	RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000603338.2_Silent_p.A607A|TSHZ2_ENST00000329613.6_Silent_p.A607A	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	610					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A610A(1)		NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			AAGATGAAGCGGTGAAGGAGT	0.502																																					p.A610A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1830A	20						.						92.0	93.0	93.0					20																	51871827		2203	4300	6503	51305234	SO:0001819	synonymous_variant	128553	exon2			AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.1830G>A	20.37:g.51871827G>A		Somatic		Capture	Illumina HiSeq	Phase_I	51305234	NM_173485	B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Silent	SNP	ENST00000371497.5	37	CCDS33490.1																																																																																				TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	NM_173485	
MCM3AP	8888	broad.mit.edu	37	21	47655283	47655283	+	Missense_Mutation	SNP	C	C	T	rs138113935		TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr21:47655283C>T	ENST00000397708.1	-	29	6096	c.5842G>A	c.(5842-5844)Gaa>Aaa	p.E1948K	MCM3AP-AS1_ENST00000591223.1_RNA|MCM3AP-AS1_ENST00000455567.1_RNA|MCM3AP-AS1_ENST00000444998.1_RNA|MCM3AP-AS1_ENST00000420074.1_RNA|MCM3AP-AS1_ENST00000421927.1_RNA|MCM3AP-AS1_ENST00000588753.1_RNA|MCM3AP-AS1_ENST00000590829.1_RNA|MCM3AP-AS1_ENST00000432735.1_RNA|MCM3AP_ENST00000291688.1_Missense_Mutation_p.E1948K|MCM3AP-AS1_ENST00000414659.1_RNA|MCM3AP_ENST00000467026.1_5'UTR			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	1948					DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)	p.E1948K(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					TTTAGTCGTTCGCCTAGACAC	0.483																																					p.E1948K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5842A	21						.	C	LYS/GLU	1,4405	2.1+/-5.4	0,1,2202	107.0	79.0	89.0		5842	4.9	0.7	21	dbSNP_134	89	0,8600		0,0,4300	no	missense	MCM3AP	NM_003906.3	56	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	1948/1981	47655283	1,13005	2203	4300	6503	46479711	SO:0001583	missense	8888	exon28			AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.5842G>A	21.37:g.47655283C>T	ENSP00000380820:p.Glu1948Lys	Somatic		Capture	Illumina HiSeq	Phase_I	46479711	NM_003906	C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Missense_Mutation	SNP	ENST00000397708.1	37	CCDS13734.1	.	.	.	.	.	.	.	.	.	.	C	12.55	1.970869	0.34754	2.27E-4	0.0	ENSG00000160294	ENST00000397708;ENST00000291688;ENST00000539647	T;T	0.03580	3.88;3.88	4.94	4.94	0.65067	.	0.445920	0.24917	N	0.034577	T	0.03827	0.0108	L	0.29908	0.895	0.09310	N	0.999996	P;B	0.43352	0.804;0.41	B;B	0.35859	0.212;0.058	T	0.38222	-0.9671	10	0.66056	D	0.02	-13.8784	15.3438	0.74317	0.0:1.0:0.0:0.0	.	1948;443	O60318;B3KT88	MCM3A_HUMAN;.	K	1948;1948;443	ENSP00000380820:E1948K;ENSP00000291688:E1948K	ENSP00000291688:E1948K	E	-	1	0	MCM3AP	46479711	0.038000	0.19896	0.713000	0.30519	0.087000	0.18053	1.470000	0.35354	2.297000	0.77311	0.655000	0.94253	GAA		MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207254.1	NM_003906	
MCM3AP	8888	broad.mit.edu	37	21	47695209	47695209	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr21:47695209G>A	ENST00000397708.1	-	7	2143	c.1889C>T	c.(1888-1890)gCg>gTg	p.A630V	MCM3AP_ENST00000291688.1_Missense_Mutation_p.A630V			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	630					DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)	p.A630V(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					AAAAGTCCTCGCTTTGTCCAG	0.507																																					p.A630V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1889T	21						.						102.0	80.0	88.0					21																	47695209		2203	4300	6503	46519637	SO:0001583	missense	8888	exon6			AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.1889C>T	21.37:g.47695209G>A	ENSP00000380820:p.Ala630Val	Somatic		Capture	Illumina HiSeq	Phase_I	46519637	NM_003906	C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Missense_Mutation	SNP	ENST00000397708.1	37	CCDS13734.1	.	.	.	.	.	.	.	.	.	.	G	35	5.557723	0.96514	.	.	ENSG00000160294	ENST00000397708;ENST00000291688	T;T	0.06768	3.26;3.26	5.73	5.73	0.89815	.	0.105778	0.64402	D	0.000004	T	0.28928	0.0718	M	0.66939	2.045	0.58432	D	0.999999	D	0.89917	1.0	D	0.65987	0.94	T	0.00240	-1.1887	10	0.72032	D	0.01	-23.0461	19.9025	0.96993	0.0:0.0:1.0:0.0	.	630	O60318	MCM3A_HUMAN	V	630	ENSP00000380820:A630V;ENSP00000291688:A630V	ENSP00000291688:A630V	A	-	2	0	MCM3AP	46519637	1.000000	0.71417	0.963000	0.40424	0.866000	0.49608	9.647000	0.98478	2.722000	0.93159	0.655000	0.94253	GCG		MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207254.1	NM_003906	
PCNT	5116	broad.mit.edu	37	21	47831398	47831398	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr21:47831398G>A	ENST00000359568.5	+	28	5518	c.5411G>A	c.(5410-5412)cGg>cAg	p.R1804Q	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	1804					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)		p.R1804Q(1)		NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					GCCCTGAGCCGGCTGCTGGCT	0.726																																					p.R1804Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5411A	21						.						9.0	12.0	11.0					21																	47831398		2116	4215	6331	46655826	SO:0001583	missense	5116	exon28			AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.5411G>A	21.37:g.47831398G>A	ENSP00000352572:p.Arg1804Gln	Somatic		Capture	Illumina HiSeq	Phase_I	46655826	NM_006031	O43152|Q7Z7C9	Missense_Mutation	SNP	ENST00000359568.5	37	CCDS33592.1	.	.	.	.	.	.	.	.	.	.	G	0.485	-0.878070	0.02550	.	.	ENSG00000160299	ENST00000359568	T	0.01133	5.29	5.79	-6.4	0.01944	.	0.625490	0.12269	N	0.483972	T	0.00552	0.0018	N	0.04508	-0.205	0.09310	N	0.999999	B;B	0.14438	0.01;0.006	B;B	0.06405	0.002;0.001	T	0.42565	-0.9444	10	0.02654	T	1	.	13.4193	0.60987	0.5505:0.0:0.4495:0.0	.	1686;1804	O95613-2;O95613	.;PCNT_HUMAN	Q	1804	ENSP00000352572:R1804Q	ENSP00000352572:R1804Q	R	+	2	0	PCNT	46655826	0.013000	0.17824	0.092000	0.20876	0.052000	0.14988	-0.058000	0.11750	-1.421000	0.02007	-0.991000	0.02546	CGG		PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031	
MAPK12	6300	broad.mit.edu	37	22	50696732	50696733	+	Splice_Site	INS	-	-	G			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr22:50696732_50696733insG	ENST00000215659.8	-	3	571		c.e3-2		MAPK12_ENST00000497036.1_Splice_Site|MAPK12_ENST00000395780.1_Splice_Site|MAPK12_ENST00000395778.3_Splice_Site	NM_002969.3	NP_002960.2	P53778	MK12_HUMAN	mitogen-activated protein kinase 12						cell cycle arrest (GO:0007050)|DNA damage induced protein phosphorylation (GO:0006975)|muscle cell differentiation (GO:0042692)|muscle organ development (GO:0007517)|myoblast differentiation (GO:0045445)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of peptidase activity (GO:0010952)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)	p.?(4)		endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)	8		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CCCGATCACCTGGGGGGGCCAC	0.639																																					.												.	.	4	Unknown(4)	large_intestine(2)|ovary(2)	.	22						.																																			49038860	SO:0001630	splice_region_variant	6300	.			U66243	CCDS14089.1	22q13.3	2012-05-08			ENSG00000188130	ENSG00000188130	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6874	protein-coding gene	gene with protein product		602399		SAPK3		9169156	Standard	NM_002969		Approved	ERK6, PRKM12, p38gamma, SAPK-3	uc003bkm.1	P53778	OTTHUMG00000030145	ENST00000215659.8:c.256-2->C	22.37:g.50696739_50696739dupG		Somatic		Capture	Illumina HiSeq	Phase_I	49038859	.	Q14260|Q6IC53|Q99588|Q99672	Splice_Site	INS	ENST00000215659.8	37	CCDS14089.1																																																																																				MAPK12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074999.2	NM_002969	Intron
PI4KA	5297	broad.mit.edu	37	22	21096961	21096961	+	Missense_Mutation	SNP	C	C	T	rs373302183		TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr22:21096961C>T	ENST00000572273.1	-	31	3604	c.3374G>A	c.(3373-3375)cGc>cAc	p.R1125H	PI4KA_ENST00000255882.6_Missense_Mutation_p.R1183H			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	1125					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)	p.R1125H(2)		breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			AGGATGACTGCGGTCTAAAGC	0.488																																					p.R1125H	GBM(136;1332 1831 3115 23601 50806)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3374A	22						.	C	HIS/ARG	1,4405		0,1,2202	254.0	179.0	205.0		3374	-3.9	0.0	22		205	0,8600		0,0,4300	no	missense	PI4KA	NM_058004.3	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	1125/2045	21096961	1,13005	2203	4300	6503	19426961	SO:0001583	missense	5297	exon31			L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.3374G>A	22.37:g.21096961C>T	ENSP00000458238:p.Arg1125His	Somatic		Capture	Illumina HiSeq	Phase_I	19426961	NM_058004	Q7Z625|Q9UPG2	Missense_Mutation	SNP	ENST00000572273.1	37		.	.	.	.	.	.	.	.	.	.	C	10.07	1.250788	0.22880	2.27E-4	0.0	ENSG00000241973	ENST00000255882	.	.	.	5.87	-3.86	0.04230	.	1.430320	0.03879	N	0.276909	T	0.17066	0.0410	N	0.14661	0.345	0.09310	N	1	B	0.22346	0.068	B	0.15052	0.012	T	0.11324	-1.0592	9	0.37606	T	0.19	-5.0462	0.541	0.00645	0.2314:0.2864:0.2353:0.2469	.	1125	P42356	PI4KA_HUMAN	H	1125	.	ENSP00000255882:R1125H	R	-	2	0	PI4KA	19426961	0.000000	0.05858	0.000000	0.03702	0.254000	0.26022	-1.017000	0.03630	-0.388000	0.07797	-0.143000	0.13931	CGC		PI4KA-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_058004	
CSF2RB	1439	broad.mit.edu	37	22	37322192	37322192	+	Missense_Mutation	SNP	C	C	T	rs202034054	byFrequency	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr22:37322192C>T	ENST00000403662.3	+	4	586	c.364C>T	c.(364-366)Cgg>Tgg	p.R122W	CSF2RB_ENST00000262825.5_Missense_Mutation_p.R122W|CSF2RB_ENST00000406230.1_Missense_Mutation_p.R122W|CSF2RB_ENST00000536485.1_Missense_Mutation_p.R63W			P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)	122					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)|interleukin-5-mediated signaling pathway (GO:0038043)|respiratory gaseous exchange (GO:0007585)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	granulocyte macrophage colony-stimulating factor receptor complex (GO:0030526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)	p.R122W(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(3)|pancreas(1)|skin(5)|upper_aerodigestive_tract(2)	42					Sargramostim(DB00020)	TCTGGGCACCCGGCTCACCGT	0.642													C|||	2	0.000399361	0.0008	0.0014	5008	,	,		17217	0.0		0.0	False		,,,				2504	0.0				p.R122W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C364T	22						.						58.0	52.0	54.0					22																	37322192		2203	4300	6503	35652138	SO:0001583	missense	1439	exon4			M59941	CCDS13936.1	22q12.3	2014-09-09			ENSG00000100368	ENSG00000100368		"""CD molecules"", ""Fibronectin type III domain containing"""	2436	protein-coding gene	gene with protein product		138981		IL3RB		1833064, 1424804	Standard	NM_000395		Approved	IL5RB, CD131	uc003aqa.4	P32927	OTTHUMG00000150546	ENST00000403662.3:c.364C>T	22.37:g.37322192C>T	ENSP00000384053:p.Arg122Trp	Somatic		Capture	Illumina HiSeq	Phase_I	35652138	NM_000395	Q5JZI1|Q6ICE0	Missense_Mutation	SNP	ENST00000403662.3	37	CCDS13936.1	2	9.157509157509158E-4	1	0.0020325203252032522	1	0.0027624309392265192	0	0.0	0	0.0	C	16.14	3.039562	0.55003	.	.	ENSG00000100368	ENST00000403662;ENST00000539104;ENST00000262825;ENST00000406230;ENST00000421539;ENST00000536485	T;T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15;-0.15	5.36	0.539	0.17156	Fibronectin, type III (1);	0.813726	0.10305	N	0.690733	T	0.55289	0.1911	L	0.29908	0.895	0.09310	N	1	D;D	0.71674	0.998;0.997	P;B	0.51229	0.663;0.357	T	0.47873	-0.9083	10	0.62326	D	0.03	-8.2524	7.3134	0.26488	0.3139:0.3804:0.3057:0.0	.	122;122	P32927-2;P32927	.;IL3RB_HUMAN	W	122;122;122;122;42;63	ENSP00000384053:R122W;ENSP00000262825:R122W;ENSP00000385271:R122W;ENSP00000393585:R42W;ENSP00000440003:R63W	ENSP00000262825:R122W	R	+	1	2	CSF2RB	35652138	0.002000	0.14202	0.045000	0.18777	0.028000	0.11728	-0.569000	0.05902	0.708000	0.31955	0.555000	0.69702	CGG		CSF2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318854.1	NM_000395	
KCNJ4	3761	broad.mit.edu	37	22	38824016	38824016	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr22:38824016C>T	ENST00000303592.3	-	2	380	c.122G>A	c.(121-123)cGc>cAc	p.R41H	RP3-434P1.6_ENST00000433230.1_RNA	NM_004981.1|NM_152868.2	NP_004972.1|NP_690607.1	P48050	KCNJ4_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 4	41					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)|PDZ domain binding (GO:0030165)	p.R41H(1)		endometrium(7)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	23	Melanoma(58;0.0286)					CGCCATGTAGCGCTGCGACTT	0.617																																					p.R41H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G122A	22						.						306.0	224.0	252.0					22																	38824016		2203	4300	6503	37153962	SO:0001583	missense	3761	exon2			U07364	CCDS13971.1	22q13.1	2011-07-05			ENSG00000168135	ENSG00000168135		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6265	protein-coding gene	gene with protein product		600504				8016146, 16382105	Standard	NM_152868		Approved	Kir2.3, HIR, HRK1, hIRK2, IRK3	uc003avs.1	P48050	OTTHUMG00000151131	ENST00000303592.3:c.122G>A	22.37:g.38824016C>T	ENSP00000306497:p.Arg41His	Somatic		Capture	Illumina HiSeq	Phase_I	37153962	NM_004981	Q14D44	Missense_Mutation	SNP	ENST00000303592.3	37	CCDS13971.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676034	0.88445	.	.	ENSG00000168135	ENST00000303592	D	0.96856	-4.15	4.86	4.86	0.63082	Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);	0.000000	0.85682	D	0.000000	D	0.98526	0.9508	M	0.91406	3.205	0.58432	D	0.999996	D	0.89917	1.0	D	0.91635	0.999	D	0.99712	1.1007	10	0.87932	D	0	.	18.4317	0.90628	0.0:1.0:0.0:0.0	.	41	P48050	IRK4_HUMAN	H	41	ENSP00000306497:R41H	ENSP00000306497:R41H	R	-	2	0	KCNJ4	37153962	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.784000	0.85713	2.428000	0.82296	0.555000	0.69702	CGC		KCNJ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321447.1	NM_004981	
CYB5R3	1727	broad.mit.edu	37	22	43024193	43024193	+	Missense_Mutation	SNP	C	C	T	rs370695594		TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr22:43024193C>T	ENST00000352397.5	-	5	680	c.428G>A	c.(427-429)cGg>cAg	p.R143Q	CYB5R3_ENST00000402438.1_Missense_Mutation_p.R120Q|CYB5R3_ENST00000407623.3_Missense_Mutation_p.R120Q|CYB5R3_ENST00000407332.1_Missense_Mutation_p.R120Q|CYB5R3_ENST00000361740.4_Missense_Mutation_p.R176Q|CYB5R3_ENST00000396303.3_Missense_Mutation_p.R120Q	NM_000398.6	NP_000389.1	P00387	NB5R3_HUMAN	cytochrome b5 reductase 3	143	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				blood circulation (GO:0008015)|cholesterol biosynthetic process (GO:0006695)|L-ascorbic acid metabolic process (GO:0019852)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|hemoglobin complex (GO:0005833)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)|FAD binding (GO:0071949)|flavin adenine dinucleotide binding (GO:0050660)|NAD binding (GO:0051287)	p.R120Q(1)		kidney(2)|large_intestine(1)|lung(2)|skin(1)	6					Flavin adenine dinucleotide(DB03147)	ACTGGGGCCCCGGAACTCAAT	0.562																																					p.R120Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G359A	22						.	C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	118.0	120.0	120.0		428,359,527,359,359	1.8	1.0	22		120	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense	CYB5R3	NM_000398.6,NM_001129819.2,NM_001171660.1,NM_001171661.1,NM_007326.4	43,43,43,43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	143/302,120/279,176/335,120/279,120/279	43024193	1,13005	2203	4300	6503	41354137	SO:0001583	missense	1727	exon5			M16461	CCDS14040.1, CCDS33658.1, CCDS54535.1	22q13.2	2012-10-02		2005-07-13	ENSG00000100243	ENSG00000100243	1.6.2.2		2873	protein-coding gene	gene with protein product		613213	"""diaphorase (NADH) (cytochrome b-5 reductase)"""	DIA1		2479590, 3268037	Standard	NM_001129819		Approved		uc011aps.2	P00387	OTTHUMG00000150745	ENST00000352397.5:c.428G>A	22.37:g.43024193C>T	ENSP00000338461:p.Arg143Gln	Somatic		Capture	Illumina HiSeq	Phase_I	41354137	NM_001129819	B1AHF2|B7Z7L3|O75675|Q8TDL8|Q8WTS8|Q9UEN4|Q9UEN5|Q9UL55|Q9UL56	Missense_Mutation	SNP	ENST00000352397.5	37	CCDS33658.1	.	.	.	.	.	.	.	.	.	.	C	13.44	2.236541	0.39498	0.0	1.16E-4	ENSG00000100243	ENST00000361740;ENST00000396303;ENST00000352397;ENST00000407623;ENST00000407332;ENST00000402438;ENST00000438270	D;D;D;D;D;D;D	0.85088	-1.94;-1.94;-1.94;-1.94;-1.94;-1.94;-1.94	3.92	1.76	0.24704	Riboflavin synthase-like beta-barrel (1);Ferredoxin reductase-type FAD-binding domain (1);Oxidoreductase, FAD-binding domain (1);	0.102570	0.64402	N	0.000005	D	0.91998	0.7465	M	0.90425	3.115	0.80722	D	1	D;D	0.89917	1.0;0.993	D;P	0.87578	0.998;0.672	D	0.90638	0.4572	10	0.54805	T	0.06	-25.1066	9.0317	0.36262	0.0:0.8191:0.0:0.1809	.	176;143	B7Z7L3;P00387	.;NB5R3_HUMAN	Q	176;120;143;120;120;120;120	ENSP00000354468:R176Q;ENSP00000379597:R120Q;ENSP00000338461:R143Q;ENSP00000384834:R120Q;ENSP00000384457:R120Q;ENSP00000385679:R120Q;ENSP00000403439:R120Q	ENSP00000338461:R143Q	R	-	2	0	CYB5R3	41354137	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.256000	0.78350	0.574000	0.29417	0.555000	0.69702	CGG		CYB5R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320439.1		
GYPC	2995	broad.mit.edu	37	2	127451467	127451467	+	Missense_Mutation	SNP	C	C	T	rs139780142		TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr2:127451467C>T	ENST00000259254.4	+	3	465	c.134C>T	c.(133-135)cCg>cTg	p.P45L	GYPC_ENST00000409836.3_Missense_Mutation_p.P26L|GYPC_ENST00000356887.7_Missense_Mutation_p.P24L|GYPC_ENST00000464053.1_3'UTR	NM_002101.4	NP_002092.1	P04921	GLPC_HUMAN	glycophorin C (Gerbich blood group)	45						cortical cytoskeleton (GO:0030863)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.P45L(1)		central_nervous_system(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|prostate(2)|urinary_tract(1)	13	Colorectal(110;0.0533)			BRCA - Breast invasive adenocarcinoma(221;0.075)		TCTGGATGGCCGGATGGCAGA	0.562													t|||	1	0.000199681	0.0	0.0	5008	,	,		21069	0.0		0.0	False		,,,				2504	0.001				p.P26L	Melanoma(110;806 1600 6704 9981 33404)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C77T	2	GRCh37	CD910525	GYPC	D	rs139780142	.	T	LEU/PRO,LEU/PRO	1,4405	826.1+/-416.6	0,1,2202	155.0	130.0	139.0		134,77		0.0	2	dbSNP_134	139	0,8600		0,0,4300	no	missense,missense	GYPC	NM_002101.3,NM_016815.2	98,98	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign	45/129,26/110	127451467	1,13005	2203	4300	6503	127167937	SO:0001583	missense	2995	exon2				CCDS2136.1, CCDS46402.1, CCDS58724.1	2q14-q21	2014-07-19			ENSG00000136732	ENSG00000136732		"""CD molecules"", ""Blood group antigens"""	4704	protein-coding gene	gene with protein product		110750					Standard	NM_016815		Approved	GPC, GYPD, Ge, CD236, CD236R	uc002tnq.4	P04921	OTTHUMG00000131464	ENST00000259254.4:c.134C>T	2.37:g.127451467C>T	ENSP00000259254:p.Pro45Leu	Somatic		Capture	Illumina HiSeq	Phase_I	127167937	NM_016815	B2R522|Q53SV9|Q92642	Missense_Mutation	SNP	ENST00000259254.4	37	CCDS2136.1	.	.	.	.	.	.	.	.	.	.	t	3.892	-0.023825	0.07634	2.27E-4	0.0	ENSG00000136732	ENST00000259254;ENST00000356887;ENST00000409836	T;T;T	0.17528	2.73;2.27;2.75	.	.	.	.	.	.	.	.	T	0.05456	0.0144	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.01281	0.0;0.0	T	0.34428	-0.9829	7	0.20046	T	0.44	.	.	.	.	.	24;45	P04921-2;P04921	.;GLPC_HUMAN	L	45;24;26	ENSP00000259254:P45L;ENSP00000349354:P24L;ENSP00000386904:P26L	ENSP00000259254:P45L	P	+	2	0	GYPC	127167937	0.024000	0.19004	0.001000	0.08648	0.002000	0.02628	0.000000	0.12993	-1.984000	0.00985	-2.041000	0.00417	CCG		GYPC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254297.1	NM_002101	
LCT	3938	broad.mit.edu	37	2	136547322	136547322	+	Silent	SNP	C	C	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr2:136547322C>T	ENST00000264162.2	-	16	5392	c.5382G>A	c.(5380-5382)gcG>gcA	p.A1794A		NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	1794	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)	p.A1794A(1)		breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	AATTGTCCATCGCACTCCAAA	0.488																																					p.A1794A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G5382A	2						.						144.0	137.0	140.0					2																	136547322		2203	4300	6503	136263792	SO:0001819	synonymous_variant	3938	exon16			X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.5382G>A	2.37:g.136547322C>T		Somatic		Capture	Illumina HiSeq	Phase_I	136263792	NM_002299	Q4ZG58	Silent	SNP	ENST00000264162.2	37	CCDS2178.1																																																																																				LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299	
NEB	4703	broad.mit.edu	37	2	152527651	152527651	+	Silent	SNP	G	G	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr2:152527651G>A	ENST00000172853.10	-	38	4539	c.4392C>T	c.(4390-4392)ggC>ggT	p.G1464G	NEB_ENST00000397345.3_Silent_p.G1464G|NEB_ENST00000603639.1_Silent_p.G1464G|NEB_ENST00000409198.1_Silent_p.G1464G|NEB_ENST00000427231.2_Silent_p.G1464G|NEB_ENST00000604864.1_Silent_p.G1464G			P20929	NEBU_HUMAN	nebulin	1464					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.G1464G(2)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TTAATGCATCGCCTGCTTTCT	0.463																																					p.G1464G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C4392T	2						.						169.0	160.0	163.0					2																	152527651		2031	4183	6214	152235897	SO:0001819	synonymous_variant	4703	exon38			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.4392C>T	2.37:g.152527651G>A		Somatic		Capture	Illumina HiSeq	Phase_I	152235897	NM_001164507	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	ENST00000172853.10	37																																																																																					NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
PXDN	7837	broad.mit.edu	37	2	1664678	1664678	+	Silent	SNP	C	C	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr2:1664678C>T	ENST00000252804.4	-	14	1862	c.1812G>A	c.(1810-1812)tcG>tcA	p.S604S		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	604	Ig-like C2-type 4.				extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.S604S(1)		breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		CCATGCTCACCGAGGCCGACC	0.557																																					p.S604S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1812A	2						.						91.0	96.0	94.0					2																	1664678		2076	4194	6270	1643685	SO:0001819	synonymous_variant	7837	exon14			AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.1812G>A	2.37:g.1664678C>T		Somatic		Capture	Illumina HiSeq	Phase_I	1643685	NM_012293	A8QM65|D6W4Y0|Q4KMG2	Silent	SNP	ENST00000252804.4	37	CCDS46221.1	.	.	.	.	.	.	.	.	.	.	C	1.385	-0.582440	0.03827	.	.	ENSG00000130508	ENST00000433670	.	.	.	5.05	-10.1	0.00402	.	.	.	.	.	T	0.34658	0.0905	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	T	0.50651	-0.8803	4	.	.	.	-15.9771	2.738	0.05245	0.4553:0.0701:0.1811:0.2935	.	.	.	.	Q	600	.	.	R	-	2	0	PXDN	1643685	0.000000	0.05858	0.007000	0.13788	0.247000	0.25773	-5.120000	0.00149	-3.938000	0.00089	-1.057000	0.02308	CGG		PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1	XM_056455	
TANC1	85461	broad.mit.edu	37	2	160086822	160086822	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr2:160086822A>G	ENST00000263635.6	+	27	5122	c.4885A>G	c.(4885-4887)Agg>Ggg	p.R1629G	TANC1_ENST00000454300.1_Missense_Mutation_p.R1523G	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	1629					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)		p.R1629G(1)		breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						AACCACAGAGAGGCTTCTGTC	0.612																																					p.R1629G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4885G	2						.						42.0	47.0	45.0					2																	160086822		2007	4176	6183	159795068	SO:0001583	missense	85461	exon27			AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.4885A>G	2.37:g.160086822A>G	ENSP00000263635:p.Arg1629Gly	Somatic		Capture	Illumina HiSeq	Phase_I	159795068	NM_033394	C9JD88|Q49AI8	Missense_Mutation	SNP	ENST00000263635.6	37	CCDS42766.1	.	.	.	.	.	.	.	.	.	.	A	13.98	2.399365	0.42512	.	.	ENSG00000115183	ENST00000454300;ENST00000263635	T;T	0.72394	-0.65;-0.64	5.63	1.66	0.24008	.	0.095914	0.64402	D	0.000001	T	0.59636	0.2208	L	0.47716	1.5	0.34393	D	0.694396	B	0.27559	0.181	B	0.24541	0.054	T	0.59021	-0.7532	9	.	.	.	.	11.8175	0.52220	0.572:0.428:0.0:0.0	.	1629	Q9C0D5	TANC1_HUMAN	G	1523;1629	ENSP00000396339:R1523G;ENSP00000263635:R1629G	.	R	+	1	2	TANC1	159795068	0.937000	0.31787	0.999000	0.59377	0.769000	0.43574	0.265000	0.18515	0.033000	0.15463	0.533000	0.62120	AGG		TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333135.1		
SLC16A14	151473	broad.mit.edu	37	2	230911221	230911221	+	Silent	SNP	C	C	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr2:230911221C>T	ENST00000295190.4	-	4	1079	c.621G>A	c.(619-621)gcG>gcA	p.A207A		NM_152527.4	NP_689740.2	Q7RTX9	MOT14_HUMAN	solute carrier family 16, member 14	207						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)	p.A207A(2)		NS(1)|cervix(1)|endometrium(7)|large_intestine(7)|lung(3)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.149)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;7.31e-13)|all cancers(144;5.1e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00948)		GCCTCATGAGCGCCCCACAAA	0.542																																					p.A207A												.	.	2	Substitution - coding silent(2)	ovary(1)|large_intestine(1)	c.G621A	2						.						65.0	69.0	68.0					2																	230911221		2203	4300	6503	230619465	SO:0001819	synonymous_variant	151473	exon4			BN000146	CCDS2473.1	2q37.1	2013-07-18	2013-07-18		ENSG00000163053	ENSG00000163053		"""Solute carriers"""	26417	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 14"""		"""solute carrier family 16 (monocarboxylic acid transporters), member 14"""				Standard	NM_152527		Approved	FLJ30794, MCT14	uc002vqd.2	Q7RTX9	OTTHUMG00000133205	ENST00000295190.4:c.621G>A	2.37:g.230911221C>T		Somatic		Capture	Illumina HiSeq	Phase_I	230619465	NM_152527	A8KA08|Q53R92|Q96NI7	Silent	SNP	ENST00000295190.4	37	CCDS2473.1																																																																																				SLC16A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256918.2	NM_152527	
COL6A3	1293	broad.mit.edu	37	2	238303525	238303525	+	Silent	SNP	G	G	A	rs148996231		TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr2:238303525G>A	ENST00000295550.4	-	3	866	c.414C>T	c.(412-414)gcC>gcT	p.A138A	COL6A3_ENST00000392003.2_Intron|COL6A3_ENST00000347401.3_Silent_p.A138A|COL6A3_ENST00000392004.3_Intron|COL6A3_ENST00000353578.4_Intron|COL6A3_ENST00000346358.4_Silent_p.A138A|COL6A3_ENST00000409809.1_Intron|COL6A3_ENST00000472056.1_Intron	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	138	Nonhelical region.|VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.A138A(1)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CTCCGTCACCGGCCCGGCTTC	0.488													G|||	1	0.000199681	0.0	0.0	5008	,	,		19967	0.0		0.001	False		,,,				2504	0.0				p.A138A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C414T	2						.	G	,,,,	0,4406		0,0,2203	77.0	80.0	79.0		414,,,,	0.7	0.2	2	dbSNP_134	79	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous,intron,intron,intron,intron	COL6A3	NM_004369.3,NM_057164.4,NM_057165.4,NM_057166.4,NM_057167.3	,,,,	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	,,,,	138/3178,,,,	238303525	3,13003	2203	4300	6503	237968264	SO:0001819	synonymous_variant	1293	exon3			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.414C>T	2.37:g.238303525G>A		Somatic		Capture	Illumina HiSeq	Phase_I	237968264	NM_004369	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Silent	SNP	ENST00000295550.4	37	CCDS33412.1																																																																																				COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
AGTR1	185	broad.mit.edu	37	3	148459740	148459741	+	Frame_Shift_Ins	INS	-	-	A	rs1064535		TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr3:148459740_148459741insA	ENST00000497524.1	+	2	1309_1310	c.918_919insA	c.(919-921)aaafs	p.K307fs	AGTR1_ENST00000542281.1_Frame_Shift_Ins_p.K307fs|AGTR1_ENST00000404754.2_Frame_Shift_Ins_p.K307fs|AGTR1_ENST00000402260.1_Frame_Shift_Ins_p.K307fs|AGTR1_ENST00000349243.3_Frame_Shift_Ins_p.K307fs|AGTR1_ENST00000474935.1_Frame_Shift_Ins_p.K307fs|AGTR1_ENST00000475347.1_Frame_Shift_Ins_p.K307fs|AGTR1_ENST00000461609.1_Frame_Shift_Ins_p.K307fs|AGTR1_ENST00000418473.2_Frame_Shift_Ins_p.K307fs	NM_009585.3	NP_033611.1	P30556	AGTR1_HUMAN	angiotensin II receptor, type 1	307					angiotensin-activated signaling pathway (GO:0038166)|calcium-mediated signaling (GO:0019722)|cell chemotaxis (GO:0060326)|G-protein coupled receptor signaling pathway (GO:0007186)|kidney development (GO:0001822)|low-density lipoprotein particle remodeling (GO:0034374)|phospholipase C-activating angiotensin-activated signaling pathway (GO:0086097)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of NAD(P)H oxidase activity (GO:0033864)|positive regulation of phospholipase A2 activity (GO:0032430)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|regulation of blood vessel size by renin-angiotensin (GO:0002034)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of inflammatory response (GO:0050727)|regulation of renal sodium excretion (GO:0035813)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)|renin-angiotensin regulation of aldosterone production (GO:0002018)|Rho protein signal transduction (GO:0007266)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	angiotensin type I receptor activity (GO:0001596)|angiotensin type II receptor activity (GO:0004945)|bradykinin receptor binding (GO:0031711)|protein heterodimerization activity (GO:0046982)			breast(4)|endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30			LUSC - Lung squamous cell carcinoma(72;0.127)|Lung(72;0.152)		Azilsartan medoxomil(DB08822)|Candesartan(DB00796)|Eprosartan(DB00876)|Forasartan(DB01342)|Irbesartan(DB01029)|Losartan(DB00678)|Olmesartan(DB00275)|Saprisartan(DB01347)|Tasosartan(DB01349)|Telmisartan(DB00966)|Valsartan(DB00177)	GCTTTCTGGGGAAAAAATTTAA	0.371																																					p.G306fs												.	.	0			c.918_919insA	3						.																																			149942431	SO:0001589	frameshift_variant	185	exon3			M87290	CCDS3137.1	3q24	2012-08-08	2002-02-20		ENSG00000144891	ENSG00000144891		"""GPCR / Class A : Angiotensin receptors"""	336	protein-coding gene	gene with protein product		106165	"""angiotensin receptor 1B"""	AGTR1B		1550596	Standard	NM_009585		Approved	AT1, AT2R1, AGTR1A, AT2R1A, HAT1R, AG2S, AT2R1B, AT1B	uc003ewh.4	P30556	OTTHUMG00000159503	ENST00000497524.1:c.924dupA	3.37:g.148459746_148459746dupA	ENSP00000419422:p.Lys307fs	None		Capture	Illumina HiSeq	Phase_I	149942430	NM_032049	Q13725|Q8TBK4	Frame_Shift_Ins	INS	ENST00000497524.1	37	CCDS3137.1																																																																																				AGTR1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355807.1		
EFCAB12	90288	broad.mit.edu	37	3	129130030	129130030	+	Missense_Mutation	SNP	G	G	A	rs548363275		TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr3:129130030G>A	ENST00000505956.1	-	5	1168	c.1006C>T	c.(1006-1008)Cgg>Tgg	p.R336W	EFCAB12_ENST00000326085.3_Missense_Mutation_p.R336W	NM_207307.1	NP_997190.1	Q6NXP0	EFC12_HUMAN	EF-hand calcium binding domain 12	336							calcium ion binding (GO:0005509)	p.R336W(1)									TCGCGGTACCGCTTGCCCACT	0.642													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18592	0.0		0.0	False		,,,				2504	0.0				p.R336W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1006T	3						.						28.0	33.0	31.0					3																	129130030		2151	4235	6386	130612720	SO:0001583	missense	90288	exon5			AK096099	CCDS54638.1	3q21.3	2013-01-10	2012-07-20	2012-07-20	ENSG00000172771	ENSG00000172771		"""EF-hand domain containing"""	28061	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 25"""	C3orf25			Standard	NM_207307		Approved		uc003emg.3	Q6NXP0	OTTHUMG00000159464	ENST00000505956.1:c.1006C>T	3.37:g.129130030G>A	ENSP00000420854:p.Arg336Trp	Somatic		Capture	Illumina HiSeq	Phase_I	130612720	NM_207307	Q69YX4	Missense_Mutation	SNP	ENST00000505956.1	37	CCDS54638.1	.	.	.	.	.	.	.	.	.	.	G	14.46	2.542915	0.45280	.	.	ENSG00000172771	ENST00000505956;ENST00000326085	T;T	0.03580	3.88;3.88	4.24	3.38	0.38709	.	0.747208	0.11018	N	0.608736	T	0.08846	0.0219	L	0.32530	0.975	0.23356	N	0.997842	D	0.89917	1.0	D	0.69824	0.966	T	0.34750	-0.9816	10	0.87932	D	0	-13.621	5.3708	0.16138	0.1033:0.0:0.6987:0.198	.	336	Q6NXP0	CC025_HUMAN	W	336	ENSP00000420854:R336W;ENSP00000324241:R336W	ENSP00000324241:R336W	R	-	1	2	C3orf25	130612720	0.011000	0.17503	0.801000	0.32222	0.347000	0.29111	0.323000	0.19593	1.009000	0.39289	-0.355000	0.07637	CGG		EFCAB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355530.1	NM_207307	
SI	6476	broad.mit.edu	37	3	164741456	164741456	+	Silent	SNP	G	G	A	rs143631771		TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr3:164741456G>A	ENST00000264382.3	-	26	3063	c.3001C>T	c.(3001-3003)Cta>Tta	p.L1001L		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1001	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)	p.L1001L(1)		NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	GCAGTATTTAGTTGGAGGTCA	0.403										HNSCC(35;0.089)																											p.L1001L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3001T	3						.						140.0	133.0	135.0					3																	164741456		2203	4300	6503	166224150	SO:0001819	synonymous_variant	6476	exon26			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.3001C>T	3.37:g.164741456G>A		Somatic		Capture	Illumina HiSeq	Phase_I	166224150	NM_001041	A2RUC3|Q1JQ80|Q1RMC2	Silent	SNP	ENST00000264382.3	37	CCDS3196.1																																																																																				SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041	
SI	6476	broad.mit.edu	37	3	164783108	164783108	+	Missense_Mutation	SNP	G	G	A	rs200745562		TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr3:164783108G>A	ENST00000264382.3	-	7	810	c.748C>T	c.(748-750)Cgt>Tgt	p.R250C		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	250	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)	p.R250C(2)		NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	AAATCATGACGAAATCTCTTA	0.343										HNSCC(35;0.089)																											p.R250C												.	.	2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	c.C748T	3						.						76.0	75.0	75.0					3																	164783108		2203	4300	6503	166265802	SO:0001583	missense	6476	exon7			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.748C>T	3.37:g.164783108G>A	ENSP00000264382:p.Arg250Cys	Somatic		Capture	Illumina HiSeq	Phase_I	166265802	NM_001041	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	CCDS3196.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.035583	0.75617	.	.	ENSG00000090402	ENST00000264382	D	0.90955	-2.76	5.9	5.9	0.94986	Glycoside hydrolase-type carbohydrate-binding (1);	0.105792	0.64402	D	0.000003	D	0.97049	0.9036	H	0.97540	4.025	0.58432	D	0.999998	D	0.89917	1.0	D	0.83275	0.996	D	0.97789	1.0237	10	0.72032	D	0.01	.	14.5224	0.67859	0.0:0.0:0.7337:0.2663	.	250	P14410	SUIS_HUMAN	C	250	ENSP00000264382:R250C	ENSP00000264382:R250C	R	-	1	0	SI	166265802	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.105000	0.57797	2.788000	0.95919	0.650000	0.86243	CGT		SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041	
PIK3CA	5290	broad.mit.edu	37	3	178916876	178916876	+	Missense_Mutation	SNP	G	G	A	rs121913287		TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr3:178916876G>A	ENST00000263967.3	+	2	420	c.263G>A	c.(262-264)cGa>cAa	p.R88Q		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	88	PI3K-ABD. {ECO:0000255|PROSITE- ProRule:PRU00877}.		R -> Q (in MCAP; also found in a glioblastoma multiforme sample; may disrupt the interaction between the PI3K- ABD domain and the N-terminal lobe of PI3K/PI4K kinase domain possibly affecting the conformation of the kinase domain). {ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.R88Q(53)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	GAAACAAGACGACTTTGTGAC	0.363	R88Q(JHUEM1_ENDOMETRIUM)|R88Q(SKUT1_SOFT_TISSUE)|R88Q(SNGM_ENDOMETRIUM)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.R88Q	Colon(199;1504 1750 3362 26421 31210 32040)		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA,central_nervous_system,brain,Substitution - Missense,0 	.	53	Substitution - Missense(53)	endometrium(27)|large_intestine(13)|central_nervous_system(8)|cervix(3)|soft_tissue(1)|breast(1)	c.G263A	3						.						107.0	102.0	104.0					3																	178916876		1821	4078	5899	180399570	SO:0001583	missense	5290	exon2				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.263G>A	3.37:g.178916876G>A	ENSP00000263967:p.Arg88Gln	Somatic		Capture	Illumina HiSeq	Phase_I	180399570	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.971870	0.92919	.	.	ENSG00000121879	ENST00000263967;ENST00000468036	T;T	0.80033	-1.33;-1.33	5.44	5.44	0.79542	Phosphatidylinositol 3-kinase, p85-binding (2);	0.000000	0.85682	D	0.000000	D	0.89079	0.6613	M	0.72353	2.195	0.80722	D	1	D	0.89917	1.0	D	0.70935	0.971	D	0.88404	0.3017	9	.	.	.	-14.8194	19.2635	0.93977	0.0:0.0:1.0:0.0	.	88	P42336	PK3CA_HUMAN	Q	88	ENSP00000263967:R88Q;ENSP00000417479:R88Q	.	R	+	2	0	PIK3CA	180399570	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.571000	0.82399	2.547000	0.85894	0.555000	0.69702	CGA		PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
SUMF1	285362	broad.mit.edu	37	3	4461752	4461752	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr3:4461752G>A	ENST00000272902.5	-	4	633	c.598C>T	c.(598-600)Cac>Tac	p.H200Y	SUMF1_ENST00000383843.5_Missense_Mutation_p.H175Y|SUMF1_ENST00000458465.2_Intron|SUMF1_ENST00000405420.2_Missense_Mutation_p.H200Y|SUMF1_ENST00000534863.1_Missense_Mutation_p.H200Y	NM_182760.3	NP_877437.2	Q8NBK3	SUMF1_HUMAN	sulfatase modifying factor 1	200					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)	metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)	p.H200Y(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(3)	13		Melanoma(143;0.068)|Colorectal(144;0.233)		Epithelial(13;0.0147)|OV - Ovarian serous cystadenocarcinoma(96;0.0444)|all cancers(10;0.0549)		CCTCACCTGTGCAGAATAGTA	0.507																																					p.H200Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C598T	3						.						77.0	68.0	71.0					3																	4461752		2203	4300	6503	4436752	SO:0001583	missense	285362	exon4			BC017005	CCDS2564.1, CCDS54548.1, CCDS54549.1	3p26.1	2009-07-23			ENSG00000144455	ENSG00000144455			20376	protein-coding gene	gene with protein product		607939				12757705, 12757706	Standard	NM_182760		Approved	FGE, UNQ3037	uc003bpz.2	Q8NBK3	OTTHUMG00000090269	ENST00000272902.5:c.598C>T	3.37:g.4461752G>A	ENSP00000272902:p.His200Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	4436752	NM_001164675	B4DXK5|B7XD05|E9PGL0|G5E9B0|Q0VAC6|Q0VAC7|Q2NL78|Q53ZE4|Q6UY39|Q96AK5|Q96DK8	Missense_Mutation	SNP	ENST00000272902.5	37	CCDS2564.1	.	.	.	.	.	.	.	.	.	.	G	10.65	1.410799	0.25465	.	.	ENSG00000144455	ENST00000534982;ENST00000534863;ENST00000272902;ENST00000383843;ENST00000405420	D;D;D;D	0.94330	-3.4;-3.4;-3.4;-3.4	5.33	4.39	0.52855	C-type lectin fold (1);Formylglycine-generating sulphatase enzyme domain (2);	0.142760	0.64402	D	0.000009	D	0.85864	0.5796	N	0.17082	0.46	0.40035	D	0.975587	B;B;B	0.14438	0.002;0.01;0.002	B;B;B	0.18263	0.001;0.021;0.001	T	0.82230	-0.0560	10	0.66056	D	0.02	.	8.2607	0.31783	0.0:0.1436:0.5818:0.2746	.	175;200;200	G5E9B0;E9PGL0;Q8NBK3	.;.;SUMF1_HUMAN	Y	200;200;200;175;200	ENSP00000440421:H200Y;ENSP00000272902:H200Y;ENSP00000373355:H175Y;ENSP00000384977:H200Y	ENSP00000272902:H200Y	H	-	1	0	SUMF1	4436752	0.998000	0.40836	0.959000	0.39883	0.346000	0.29079	2.891000	0.48617	2.652000	0.90054	0.655000	0.94253	CAC		SUMF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206591.2	NM_182760	
ZNF502	91392	broad.mit.edu	37	3	44762890	44762890	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr3:44762890G>A	ENST00000296091.4	+	4	837	c.581G>A	c.(580-582)cGt>cAt	p.R194H	ZNF502_ENST00000436624.2_Missense_Mutation_p.R194H|ZNF502_ENST00000449836.1_Missense_Mutation_p.R194H	NM_001134440.1|NM_001282880.1|NM_033210.4	NP_001127912.1|NP_001269809.1|NP_149987.2	Q8TBZ5	ZN502_HUMAN	zinc finger protein 502	194					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R194H(1)		NS(1)|endometrium(4)|large_intestine(8)|lung(4)|prostate(1)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.00855)|KIRC - Kidney renal clear cell carcinoma(197;0.0471)|Kidney(197;0.0589)		GCCTTTAGTCGTAGTTCATTC	0.423																																					p.R194H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G581A	3						.						155.0	164.0	161.0					3																	44762890		2203	4300	6503	44737894	SO:0001583	missense	91392	exon4			AK022577	CCDS2719.1	3p21.32	2013-01-08			ENSG00000196653	ENSG00000196653		"""Zinc fingers, C2H2-type"""	23718	protein-coding gene	gene with protein product							Standard	NM_033210		Approved	FLJ14855, FLJ12515	uc003cnt.3	Q8TBZ5	OTTHUMG00000133086	ENST00000296091.4:c.581G>A	3.37:g.44762890G>A	ENSP00000296091:p.Arg194His	Somatic		Capture	Illumina HiSeq	Phase_I	44737894	NM_033210		Missense_Mutation	SNP	ENST00000296091.4	37	CCDS2719.1	.	.	.	.	.	.	.	.	.	.	G	10.10	1.257862	0.22965	.	.	ENSG00000196653	ENST00000449836;ENST00000296091;ENST00000436624;ENST00000427783	T;T;T	0.17854	2.25;2.25;2.25	4.79	1.42	0.22433	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09423	0.0232	L	0.28115	0.83	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.39187	-0.9626	9	0.16896	T	0.51	-3.4416	4.101	0.10014	0.4525:0.177:0.3705:0.0	.	194	Q8TBZ5	ZN502_HUMAN	H	194	ENSP00000397390:R194H;ENSP00000296091:R194H;ENSP00000406469:R194H	ENSP00000296091:R194H	R	+	2	0	ZNF502	44737894	0.000000	0.05858	0.094000	0.20943	0.788000	0.44548	-0.210000	0.09345	0.491000	0.27793	0.655000	0.94253	CGT		ZNF502-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256744.4	NM_033210	
CCR1	1230	broad.mit.edu	37	3	46244960	46244960	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr3:46244960G>A	ENST00000296140.3	-	2	970	c.845C>T	c.(844-846)gCt>gTt	p.A282V	CCR3_ENST00000357422.2_Intron	NM_001295.2	NP_001286.1	P32246	CCR1_HUMAN	chemokine (C-C motif) receptor 1	282					calcium ion transport (GO:0006816)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell chemotaxis (GO:0002407)|exocytosis (GO:0006887)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|negative regulation of bone mineralization (GO:0030502)|negative regulation of gene expression (GO:0010629)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of osteoclast differentiation (GO:0045672)|response to wounding (GO:0009611)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine binding (GO:0019957)|C-C chemokine receptor activity (GO:0016493)|chemokine (C-C motif) ligand 5 binding (GO:0071791)|chemokine (C-C motif) ligand 7 binding (GO:0035717)|chemokine receptor activity (GO:0004950)|phosphatidylinositol phospholipase C activity (GO:0004435)	p.A282V(1)		autonomic_ganglia(1)|large_intestine(6)|lung(6)|pancreas(1)|skin(3)	17				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		CACTTGCACAGCCAGGTCCAA	0.502																																					p.A282V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C845T	3						.						66.0	59.0	61.0					3																	46244960		2203	4300	6503	46219964	SO:0001583	missense	1230	exon2				CCDS2737.1	3p21	2012-08-08			ENSG00000163823	ENSG00000163823		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1602	protein-coding gene	gene with protein product		601159		SCYAR1, CMKBR1		7679328	Standard	NM_001295		Approved	CKR-1, MIP1aR, CD191	uc003cph.1	P32246	OTTHUMG00000133451	ENST00000296140.3:c.845C>T	3.37:g.46244960G>A	ENSP00000296140:p.Ala282Val	Somatic		Capture	Illumina HiSeq	Phase_I	46219964	NM_001295	Q86VA9	Missense_Mutation	SNP	ENST00000296140.3	37	CCDS2737.1	.	.	.	.	.	.	.	.	.	.	G	15.64	2.893491	0.52121	.	.	ENSG00000163823	ENST00000296140	T	0.37058	1.22	5.33	4.46	0.54185	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000001	T	0.54515	0.1863	M	0.85777	2.775	0.47476	D	0.999435	P	0.41848	0.763	P	0.48982	0.597	T	0.62431	-0.6856	10	0.59425	D	0.04	.	14.5782	0.68265	0.0707:0.0:0.9293:0.0	.	282	P32246	CCR1_HUMAN	V	282	ENSP00000296140:A282V	ENSP00000296140:A282V	A	-	2	0	CCR1	46219964	1.000000	0.71417	0.888000	0.34837	0.008000	0.06430	5.377000	0.66184	1.396000	0.46663	-0.126000	0.14955	GCT		CCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257325.2	NM_001295	
UBA7	7318	broad.mit.edu	37	3	49842272	49842272	+	IGR	SNP	G	G	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr3:49842272G>A	ENST00000333486.3	-	0	3299				MIR5193_ENST00000584510.1_RNA|FAM212A_ENST00000333323.4_Missense_Mutation_p.R239K	NM_003335.2	NP_003326.2	P41226	UBA7_HUMAN	ubiquitin-like modifier activating enzyme 7						cellular protein modification process (GO:0006464)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|modification-dependent protein catabolic process (GO:0019941)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ISG15 activating enzyme activity (GO:0019782)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)	p.R239K(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(15)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;3.58e-06)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		CGGCTGGCCAGGGCTCGGCGG	0.662																																					p.R239K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G716A	3						.						44.0	50.0	48.0					3																	49842272		2202	4299	6501	49817276	SO:0001628	intergenic_variant	389119	exon2			BC006378	CCDS2805.1	3p21	2007-11-30	2007-11-30	2007-11-30	ENSG00000182179	ENSG00000182179		"""Ubiquitin-like modifier activating enzymes"""	12471	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog B (yeast)"", ""UBA7, ubiquitin-activating enzyme E1"""	191325	"""ubiquitin-activating enzyme E1-like"""	UBE1L		8327486	Standard	NM_003335		Approved	D8, UBE2, UBA1B	uc003cxr.3	P41226	OTTHUMG00000158267		3.37:g.49842272G>A		Somatic		Capture	Illumina HiSeq	Phase_I	49817276	NM_203370	Q9BRB2	Missense_Mutation	SNP	ENST00000333486.3	37	CCDS2805.1	.	.	.	.	.	.	.	.	.	.	G	12.91	2.078864	0.36662	.	.	ENSG00000185614	ENST00000333323	.	.	.	5.8	4.93	0.64822	.	0.329762	0.26627	N	0.023337	T	0.50326	0.1609	L	0.36672	1.1	0.39537	D	0.968763	B	0.09022	0.002	B	0.09377	0.004	T	0.46373	-0.9196	9	0.12430	T	0.62	.	14.5831	0.68305	0.0708:0.0:0.9292:0.0	.	237	Q96EL1	CC054_HUMAN	K	239	.	ENSP00000329735:R239K	R	+	2	0	C3orf54	49817276	0.027000	0.19231	1.000000	0.80357	0.713000	0.41058	0.042000	0.13949	1.472000	0.48140	-0.140000	0.14226	AGG		UBA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350503.1	NM_003335	
TLR9	54106	broad.mit.edu	37	3	52255618	52255618	+	Missense_Mutation	SNP	C	C	T	rs376675219	byFrequency	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr3:52255618C>T	ENST00000360658.2	-	2	3347	c.2714G>A	c.(2713-2715)cGc>cAc	p.R905H	TLR9_ENST00000494383.1_Silent_p.P1058P|TLR9_ENST00000597542.1_Missense_Mutation_p.R929H	NM_017442.3	NP_059138.1	Q9NR96	TLR9_HUMAN	toll-like receptor 9	905	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|maintenance of gastrointestinal epithelium (GO:0030277)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to molecule of bacterial origin (GO:0002237)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)	p.R905H(1)		endometrium(4)|large_intestine(11)|lung(9)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;2.41e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Chloroquine(DB00608)|Hydroxychloroquine(DB01611)	CAGGCACAGGCGGAGTGCCCA	0.637													C|||	2	0.000399361	0.0	0.0014	5008	,	,		18547	0.0		0.001	False		,,,				2504	0.0				p.R905H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2714A	3						.	C	HIS/ARG	0,4406		0,0,2203	79.0	87.0	84.0		2714	5.6	1.0	3		84	2,8598	2.2+/-6.3	0,2,4298	no	missense	TLR9	NM_017442.3	29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	905/1033	52255618	2,13004	2203	4300	6503	52230658	SO:0001583	missense	54106	exon2			AF259262	CCDS2848.1	3p21.3	2006-02-23			ENSG00000239732	ENSG00000239732		"""CD molecules"""	15633	protein-coding gene	gene with protein product		605474				11022119	Standard	NM_017442		Approved	CD289	uc003ddb.3	Q9NR96	OTTHUMG00000158106	ENST00000360658.2:c.2714G>A	3.37:g.52255618C>T	ENSP00000353874:p.Arg905His	Somatic		Capture	Illumina HiSeq	Phase_I	52230658	NM_017442	B3Y661|D1CS56|Q6UVZ2|Q9HD68|Q9HD69|Q9HD70|Q9NYC2|Q9NYC3	Missense_Mutation	SNP	ENST00000360658.2	37	CCDS2848.1	.	.	.	.	.	.	.	.	.	.	C	14.08	2.428723	0.43122	0.0	2.33E-4	ENSG00000239732	ENST00000360658	T	0.08282	3.11	5.6	5.6	0.85130	Toll/interleukin-1 receptor homology (TIR) domain (3);	0.000000	0.39834	N	0.001260	T	0.26085	0.0636	M	0.69463	2.115	0.32645	N	0.520194	D;D	0.89917	1.0;1.0	D;D	0.97110	0.98;1.0	T	0.15292	-1.0442	10	0.52906	T	0.07	.	12.7914	0.57537	0.0:0.8354:0.1646:0.0	.	1002;905	B4E0A1;Q9NR96	.;TLR9_HUMAN	H	905	ENSP00000353874:R905H	ENSP00000353874:R905H	R	-	2	0	TLR9	52230658	0.008000	0.16893	0.974000	0.42286	0.107000	0.19398	0.896000	0.28377	2.625000	0.88918	0.655000	0.94253	CGC		TLR9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000350203.1		
ROBO1	6091	broad.mit.edu	37	3	78689016	78689016	+	Missense_Mutation	SNP	G	G	A	rs554782891		TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr3:78689016G>A	ENST00000464233.1	-	22	3028	c.2915C>T	c.(2914-2916)gCg>gTg	p.A972V	ROBO1_ENST00000495273.1_Missense_Mutation_p.A927V|ROBO1_ENST00000467549.1_Missense_Mutation_p.A927V|ROBO1_ENST00000436010.2_Missense_Mutation_p.A933V	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	972					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)	p.A927V(1)|p.A972V(1)|p.A949V(1)		breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		CCATGGCTGCGCGGCAGGTTC	0.428													G|||	1	0.000199681	0.0	0.0	5008	,	,		16924	0.001		0.0	False		,,,				2504	0.0				p.A972V												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.C2915T	3						.						52.0	49.0	50.0					3																	78689016		1938	4145	6083	78771706	SO:0001583	missense	6091	exon22			AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.2915C>T	3.37:g.78689016G>A	ENSP00000420321:p.Ala972Val	Somatic		Capture	Illumina HiSeq	Phase_I	78771706	NM_002941	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	ENST00000464233.1	37	CCDS54611.1	.	.	.	.	.	.	.	.	.	.	G	11.61	1.689869	0.29962	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	T;T;T;T	0.60548	0.22;0.2;0.2;0.18	5.65	5.65	0.86999	.	0.361650	0.33959	N	0.004387	T	0.42630	0.1211	N	0.19112	0.55	0.09310	N	1	B;B;B;B;B	0.26635	0.046;0.155;0.081;0.045;0.081	B;B;B;B;B	0.25987	0.036;0.047;0.022;0.018;0.065	T	0.23261	-1.0193	9	.	.	.	.	14.5415	0.67999	0.0:0.0:0.8536:0.1464	.	936;972;927;927;933	Q9Y6N7-3;Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	.;ROBO1_HUMAN;.;.;.	V	933;927;972;927;927;976	ENSP00000406043:A933V;ENSP00000420321:A972V;ENSP00000420637:A927V;ENSP00000417992:A927V	.	A	-	2	0	ROBO1	78771706	0.997000	0.39634	0.056000	0.19401	0.057000	0.15508	7.500000	0.81588	2.664000	0.90586	0.491000	0.48974	GCG		ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
ARL13B	200894	broad.mit.edu	37	3	93761957	93761957	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr3:93761957G>C	ENST00000394222.3	+	7	1172	c.897G>C	c.(895-897)gaG>gaC	p.E299D	ARL13B_ENST00000471138.1_Missense_Mutation_p.E299D|ARL13B_ENST00000303097.7_Missense_Mutation_p.E192D|ARL13B_ENST00000535334.1_Missense_Mutation_p.E196D|ARL13B_ENST00000539730.1_Missense_Mutation_p.E20D	NM_001174150.1	NP_001167621.1	Q3SXY8	AR13B_HUMAN	ADP-ribosylation factor-like 13B	299					cilium assembly (GO:0042384)|dorsal/ventral pattern formation (GO:0009953)|formation of radial glial scaffolds (GO:0021943)|heart looping (GO:0001947)|interneuron migration from the subpallium to the cortex (GO:0021830)|left/right axis specification (GO:0070986)|neural tube patterning (GO:0021532)|nonmotile primary cilium assembly (GO:0035058)|small GTPase mediated signal transduction (GO:0007264)|smoothened signaling pathway (GO:0007224)	ciliary membrane (GO:0060170)|cilium (GO:0005929)|intracellular (GO:0005622)|primary cilium (GO:0072372)	GTP binding (GO:0005525)	p.E299D(1)|p.E192D(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|urinary_tract(2)	10						AGCAAATAGAGACACAAGGCC	0.353																																					p.E299D												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G897C	3						.						85.0	82.0	83.0					3																	93761957		2203	4299	6502	95244647	SO:0001583	missense	200894	exon7			AL713789	CCDS2924.1, CCDS2925.1, CCDS54615.1	3q11	2014-05-09	2005-11-18	2005-11-18	ENSG00000169379	ENSG00000169379		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	25419	protein-coding gene	gene with protein product		608922	"""ADP-ribosylation factor-like 2-like 1"""	ARL2L1		15314642, 18674751	Standard	NR_033427		Approved	DKFZp761H079, JBTS8	uc003drf.3	Q3SXY8	OTTHUMG00000159012	ENST00000394222.3:c.897G>C	3.37:g.93761957G>C	ENSP00000377769:p.Glu299Asp	Somatic		Capture	Illumina HiSeq	Phase_I	95244647	NM_001174150	D3DN29|G3V1S8|Q504W8|Q8TCL5	Missense_Mutation	SNP	ENST00000394222.3	37	CCDS2925.1	.	.	.	.	.	.	.	.	.	.	G	3.451	-0.112010	0.06881	.	.	ENSG00000169379	ENST00000535334;ENST00000303097;ENST00000394222;ENST00000471138;ENST00000539730	T;T;T;T;T	0.66460	1.6;-0.21;0.05;0.05;0.77	5.33	2.0	0.26442	.	0.349951	0.31834	N	0.006987	T	0.52757	0.1754	L	0.49350	1.555	0.27460	N	0.953188	B;B;B;B	0.24043	0.021;0.008;0.096;0.007	B;B;B;B	0.22152	0.013;0.005;0.038;0.005	T	0.37842	-0.9688	10	0.25751	T	0.34	-3.5227	5.2029	0.15275	0.2214:0.0:0.5984:0.1802	.	196;299;192;299	G3V1S8;B4DLH1;Q3SXY8-2;Q3SXY8	.;.;.;AR13B_HUMAN	D	196;192;299;299;20	ENSP00000445145:E196D;ENSP00000306225:E192D;ENSP00000377769:E299D;ENSP00000420780:E299D;ENSP00000437977:E20D	ENSP00000306225:E192D	E	+	3	2	ARL13B	95244647	0.992000	0.36948	0.019000	0.16419	0.032000	0.12392	0.059000	0.14322	0.157000	0.19338	0.655000	0.94253	GAG		ARL13B-005	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352904.1	NM_182896	
PIK3CA	5290	broad.mit.edu	37	3	178921553	178921553	+	Missense_Mutation	SNP	T	T	A	rs121913284		TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr3:178921553T>A	ENST00000263967.3	+	5	1192	c.1035T>A	c.(1033-1035)aaT>aaA	p.N345K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	345	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.N345K(44)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	CCTACGTGAATGTAAATATTC	0.308		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.N345K	Colon(199;1504 1750 3362 26421 31210 32040)		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA,breast,NS,Substitution - Missense,0 	.	44	Substitution - Missense(44)	breast(27)|endometrium(6)|large_intestine(6)|central_nervous_system(5)	c.T1035A	3						.						67.0	66.0	66.0					3																	178921553		1807	4074	5881	180404247	SO:0001583	missense	5290	exon5				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1035T>A	3.37:g.178921553T>A	ENSP00000263967:p.Asn345Lys	Somatic		Capture	Illumina HiSeq	Phase_I	180404247	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	T	16.01	3.002090	0.54254	.	.	ENSG00000121879	ENST00000263967	T	0.70164	-0.46	5.41	3.03	0.35002	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (1);	0.000000	0.85682	D	0.000000	T	0.77745	0.4176	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.75465	-0.3308	10	0.49607	T	0.09	-21.0442	9.7159	0.40274	0.0:0.1415:0.0:0.8585	.	345	P42336	PK3CA_HUMAN	K	345	ENSP00000263967:N345K	ENSP00000263967:N345K	N	+	3	2	PIK3CA	180404247	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.030000	0.41108	0.441000	0.26529	0.402000	0.26972	AAT		PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
KIAA1109	84162	broad.mit.edu	37	4	123255577	123255577	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr4:123255577A>G	ENST00000264501.4	+	69	12098	c.11725A>G	c.(11725-11727)Aaa>Gaa	p.K3909E	KIAA1109_ENST00000388738.3_Missense_Mutation_p.K3909E			Q2LD37	K1109_HUMAN	KIAA1109	3909					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)		p.K3909E(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						AACACTGTCCAAAGAGTCCAA	0.428																																					p.K3909E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A11725G	4						.						132.0	130.0	130.0					4																	123255577		1976	4160	6136	123475027	SO:0001583	missense	84162	exon67			AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.11725A>G	4.37:g.123255577A>G	ENSP00000264501:p.Lys3909Glu	Somatic		Capture	Illumina HiSeq	Phase_I	123475027	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	37	CCDS43267.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.289676	0.80914	.	.	ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000438707	T;T;T	0.33438	2.47;2.47;1.41	5.21	5.21	0.72293	.	0.115149	0.64402	D	0.000020	T	0.44603	0.1301	L	0.44542	1.39	0.80722	D	1	D;D	0.67145	0.996;0.993	D;D	0.76071	0.987;0.971	T	0.19160	-1.0314	10	0.12430	T	0.62	.	15.3741	0.74590	1.0:0.0:0.0:0.0	.	3908;3909	Q2LD37-4;Q2LD37	.;K1109_HUMAN	E	3909;3909;613	ENSP00000264501:K3909E;ENSP00000373390:K3909E;ENSP00000410874:K613E	ENSP00000264501:K3909E	K	+	1	0	KIAA1109	123475027	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.287000	0.95975	2.097000	0.63578	0.454000	0.30748	AAA		KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
FBXW7	55294	broad.mit.edu	37	4	153258955	153258955	+	Splice_Site	SNP	T	T	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr4:153258955T>A	ENST00000281708.4	-	5	2089	c.860A>T	c.(859-861)gAg>gTg	p.E287V	FBXW7_ENST00000393956.3_Splice_Site_p.E111V|FBXW7_ENST00000296555.5_Splice_Site_p.E169V|FBXW7_ENST00000263981.5_Splice_Site_p.E207V|FBXW7_ENST00000603841.1_Splice_Site_p.E287V|FBXW7_ENST00000603548.1_Splice_Site_p.E287V|RP11-461L13.2_ENST00000605147.1_RNA	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	287	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.E287V(2)|p.E207V(1)|p.?(1)|p.E48V(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				AATCTTTACCTCTTTAGGGAG	0.343			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																p.E207V			Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	.	.	5	Substitution - Missense(4)|Unknown(1)	large_intestine(4)|haematopoietic_and_lymphoid_tissue(1)	c.A620T	4						.						146.0	143.0	144.0					4																	153258955		2203	4300	6503	153478405	SO:0001630	splice_region_variant	55294	exon4			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.861+1A>T	4.37:g.153258955T>A		Somatic		Capture	Illumina HiSeq	Phase_I	153478405	NM_018315	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	ENST00000281708.4	37	CCDS3777.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.152928	0.78001	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.69306	-0.39;-0.39;-0.39;-0.39	5.63	5.63	0.86233	F-box domain, cyclin-like (2);F-box domain, Skp2-like (1);	0.046212	0.85682	D	0.000000	D	0.84447	0.5474	M	0.89353	3.025	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.76071	0.987;0.987;0.977;0.977	D	0.87653	0.2529	10	0.87932	D	0	-22.6201	15.8279	0.78727	0.0:0.0:0.0:1.0	.	111;287;169;207	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	V	287;169;207;111	ENSP00000281708:E287V;ENSP00000296555:E169V;ENSP00000263981:E207V;ENSP00000377528:E111V	ENSP00000263981:E207V	E	-	2	0	FBXW7	153478405	1.000000	0.71417	1.000000	0.80357	0.709000	0.40893	7.980000	0.88113	2.133000	0.65898	0.528000	0.53228	GAG		FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1		Missense_Mutation
MAP9	79884	broad.mit.edu	37	4	156277029	156277029	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr4:156277029T>C	ENST00000311277.4	-	9	1392	c.1129A>G	c.(1129-1131)Acc>Gcc	p.T377A	AC097467.2_ENST00000600928.1_RNA|AC097467.2_ENST00000594492.1_RNA|AC097467.2_ENST00000596165.1_RNA|AC097467.2_ENST00000594666.1_RNA|AC097467.2_ENST00000609716.1_RNA|AC097467.2_ENST00000608544.1_RNA|AC097467.2_ENST00000609254.1_RNA|AC097467.2_ENST00000596754.1_RNA|AC097467.2_ENST00000598890.1_RNA|AC097467.2_ENST00000608092.1_RNA|AC097467.2_ENST00000417474.1_RNA|AC097467.2_ENST00000597831.1_RNA|MAP9_ENST00000515654.1_Missense_Mutation_p.T353A|AC097467.2_ENST00000593387.2_RNA|AC097467.2_ENST00000608762.1_RNA|AC097467.2_ENST00000597939.1_RNA|AC097467.2_ENST00000601977.1_RNA|AC097467.2_ENST00000608463.1_RNA|AC097467.2_ENST00000610249.1_RNA|AC097467.2_ENST00000608406.1_RNA|AC097467.2_ENST00000609486.1_RNA|AC097467.2_ENST00000598252.1_RNA	NM_001039580.1	NP_001034669.1	Q49MG5	MAP9_HUMAN	microtubule-associated protein 9	377					cytokinesis (GO:0000910)|regulation of mitosis (GO:0007088)|spindle assembly involved in mitosis (GO:0090307)	astral microtubule (GO:0000235)|mitotic spindle midzone (GO:1990023)		p.T377A(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	26	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.143)		AACTCAGAGGTCATTAATCTG	0.328																																					p.T377A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1129G	4						.						46.0	45.0	46.0					4																	156277029		2202	4300	6502	156496479	SO:0001583	missense	79884	exon9			AK024812	CCDS35493.1	4q32.1	2008-02-05			ENSG00000164114	ENSG00000164114			26118	protein-coding gene	gene with protein product	"""aster-associated protein"""	610070				16049101	Standard	XM_006714306		Approved	ASAP, FLJ21159	uc003ios.3	Q49MG5	OTTHUMG00000133628	ENST00000311277.4:c.1129A>G	4.37:g.156277029T>C	ENSP00000310593:p.Thr377Ala	Somatic		Capture	Illumina HiSeq	Phase_I	156496479	NM_001039580	Q4W5I7|Q68DU1|Q9H781|Q9H7B6	Missense_Mutation	SNP	ENST00000311277.4	37	CCDS35493.1	.	.	.	.	.	.	.	.	.	.	T	19.38	3.815696	0.70912	.	.	ENSG00000164114	ENST00000311277;ENST00000515654;ENST00000433024	T;T;T	0.38401	1.96;3.19;1.14	5.28	5.28	0.74379	.	0.000000	0.64402	D	0.000002	T	0.50411	0.1614	M	0.63428	1.95	0.80722	D	1	P;P;P	0.50156	0.873;0.932;0.873	P;P;P	0.55545	0.638;0.778;0.638	T	0.52660	-0.8546	10	0.62326	D	0.03	-11.0904	12.9416	0.58348	0.0:0.0:0.0:1.0	.	352;377;377	B4DVG9;B9EJB6;Q49MG5	.;.;MAP9_HUMAN	A	377;353;376	ENSP00000310593:T377A;ENSP00000427402:T353A;ENSP00000394048:T376A	ENSP00000310593:T377A	T	-	1	0	MAP9	156496479	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	0.504000	0.22626	2.130000	0.65690	0.472000	0.43445	ACC		MAP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257771.3	NM_001039580	
TLL1	7092	broad.mit.edu	37	4	166986902	166986902	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr4:166986902T>G	ENST00000061240.2	+	16	2722	c.2075T>G	c.(2074-2076)tTc>tGc	p.F692C	TLL1_ENST00000507499.1_Missense_Mutation_p.F715C	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	692	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.F692C(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		CATGGCAAATTCTGTGGCGCT	0.398																																					p.F692C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2075G	4						.						153.0	149.0	150.0					4																	166986902		2203	4300	6503	167206352	SO:0001583	missense	7092	exon16			AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.2075T>G	4.37:g.166986902T>G	ENSP00000061240:p.Phe692Cys	Somatic		Capture	Illumina HiSeq	Phase_I	167206352	NM_012464	B2RMU2|Q96AN3|Q9NQS4	Missense_Mutation	SNP	ENST00000061240.2	37	CCDS3811.1	.	.	.	.	.	.	.	.	.	.	T	14.24	2.475884	0.44044	.	.	ENSG00000038295	ENST00000061240;ENST00000507499	T;T	0.21932	1.98;1.98	5.97	4.78	0.61160	CUB (5);	0.141423	0.49305	U	0.000142	T	0.55909	0.1950	H	0.95187	3.635	0.80722	D	1	D;D	0.63046	0.992;0.973	D;P	0.65233	0.933;0.882	T	0.68488	-0.5395	10	0.87932	D	0	.	12.5801	0.56386	0.1246:0.0:0.0:0.8754	.	715;692	E9PD25;O43897	.;TLL1_HUMAN	C	692;715	ENSP00000061240:F692C;ENSP00000426082:F715C	ENSP00000061240:F692C	F	+	2	0	TLL1	167206352	1.000000	0.71417	1.000000	0.80357	0.147000	0.21601	3.348000	0.52209	1.064000	0.40671	0.533000	0.62120	TTC		TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363821.1		
APC	324	broad.mit.edu	37	5	112116525	112116526	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr5:112116525_112116526insT	ENST00000457016.1	+	6	950_951	c.570_571insT	c.(571-573)tatfs	p.Y191fs	APC_ENST00000257430.4_Frame_Shift_Ins_p.Y191fs|RNU6-482P_ENST00000391068.1_RNA|APC_ENST00000508376.2_Frame_Shift_Ins_p.Y191fs			P25054	APC_HUMAN	adenomatous polyposis coli	191	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Y191fs*2(1)|p.Q188fs*2(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GGCAATTGGAATATGAAGCAAG	0.342		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.E190fs	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	2	Deletion - Frameshift(1)|Insertion - Frameshift(1)	large_intestine(2)	c.570_571insT	5						.																																			112144425	SO:0001589	frameshift_variant	324	exon6	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.571dupT	5.37:g.112116526_112116526dupT	ENSP00000413133:p.Tyr191fs	Somatic		Capture	Illumina HiSeq	Phase_I	112144424	NM_000038	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Ins	INS	ENST00000457016.1	37	CCDS4107.1																																																																																				APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
SLCO4C1	353189	broad.mit.edu	37	5	101606381	101606381	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr5:101606381C>T	ENST00000310954.6	-	3	1035	c.749G>A	c.(748-750)gGa>gAa	p.G250E		NM_180991.4	NP_851322.3			solute carrier organic anion transporter family, member 4C1									p.G250E(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	50		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)		AAAGGCTGTTCCCAGAGTATA	0.388																																					p.G250E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G749A	5						.						97.0	98.0	98.0					5																	101606381		2203	4300	6503	101634280	SO:0001583	missense	353189	exon3			AY273896	CCDS34205.1	5q21	2013-05-22	2003-11-25		ENSG00000173930	ENSG00000173930		"""Solute carriers"""	23612	protein-coding gene	gene with protein product		609013					Standard	NM_180991		Approved	SLC21A20, OATP4C1, OATPX, OATP-H	uc003knm.3	Q6ZQN7	OTTHUMG00000162757	ENST00000310954.6:c.749G>A	5.37:g.101606381C>T	ENSP00000309741:p.Gly250Glu	Somatic		Capture	Illumina HiSeq	Phase_I	101634280	NM_180991		Missense_Mutation	SNP	ENST00000310954.6	37	CCDS34205.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.670548	0.88348	.	.	ENSG00000173930	ENST00000310954	T	0.64618	-0.11	5.94	5.94	0.96194	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.64402	D	0.000001	D	0.87346	0.6154	H	0.97103	3.94	0.49798	D	0.999823	D	0.89917	1.0	D	0.97110	1.0	D	0.90597	0.4541	10	0.87932	D	0	.	20.3736	0.98901	0.0:1.0:0.0:0.0	.	250	Q6ZQN7	SO4C1_HUMAN	E	250	ENSP00000309741:G250E	ENSP00000309741:G250E	G	-	2	0	SLCO4C1	101634280	1.000000	0.71417	0.989000	0.46669	0.916000	0.54674	5.288000	0.65651	2.820000	0.97059	0.650000	0.86243	GGA		SLCO4C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370332.1	NM_180991	
APC	324	broad.mit.edu	37	5	112175171	112175171	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr5:112175171C>T	ENST00000457016.1	+	16	4260	c.3880C>T	c.(3880-3882)Cag>Tag	p.Q1294*	APC_ENST00000257430.4_Nonsense_Mutation_p.Q1294*|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Nonsense_Mutation_p.Q1294*			P25054	APC_HUMAN	adenomatous polyposis coli	1294	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Q1294*(11)|p.T1293fs*2(1)|p.Q1294fs*6(1)|p.K1192fs*3(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TCAGACGACACAGGAAGCAGA	0.383		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Q1276X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,right,Substitution - Nonsense,0 	.	15	Substitution - Nonsense(11)|Deletion - Frameshift(3)|Unknown(1)	large_intestine(13)|soft_tissue(1)|skin(1)	c.C3826T	5	GRCh37	CM930027	APC	M		.						55.0	57.0	56.0					5																	112175171		2202	4300	6502	112203070	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3880C>T	5.37:g.112175171C>T	ENSP00000413133:p.Gln1294*	Somatic		Capture	Illumina HiSeq	Phase_I	112203070	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	38	6.839479	0.97877	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.73	4.85	0.62838	.	0.122222	0.53938	D	0.000054	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-3.559	13.8243	0.63342	0.2784:0.7216:0.0:0.0	.	.	.	.	X	1294	.	.	Q	+	1	0	APC	112203070	0.993000	0.37304	1.000000	0.80357	0.962000	0.63368	2.731000	0.47343	1.533000	0.49186	0.655000	0.94253	CAG		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
MCC	4163	broad.mit.edu	37	5	112406863	112406863	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr5:112406863G>A	ENST00000302475.4	-	10	1846	c.1283C>T	c.(1282-1284)gCc>gTc	p.A428V	MCC_ENST00000515367.2_Missense_Mutation_p.A365V|MCC_ENST00000514701.3_5'UTR|MCC_ENST00000408903.3_Missense_Mutation_p.A618V	NM_002387.2	NP_002378	P23508	CRCM_HUMAN	mutated in colorectal cancers	428					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.A428V(1)|p.A618V(1)		endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		CATCCTCTCGGCATTGCTTTT	0.488																																					p.A618V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1853T	5						.						264.0	221.0	236.0					5																	112406863		2202	4300	6502	112434762	SO:0001583	missense	4163	exon12				CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000302475.4:c.1283C>T	5.37:g.112406863G>A	ENSP00000305617:p.Ala428Val	Somatic		Capture	Illumina HiSeq	Phase_I	112434762	NM_001085377	D3DT05|Q6ZR04	Missense_Mutation	SNP	ENST00000302475.4	37	CCDS4111.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.680572	0.88542	.	.	ENSG00000171444	ENST00000302475;ENST00000515367;ENST00000408903	T;T;T	0.45668	0.89;0.89;0.89	4.93	4.93	0.64822	Usher syndrome type-1C protein-binding protein 1, PDZ domain (1);	0.000000	0.85682	D	0.000000	T	0.56558	0.1993	L	0.43152	1.355	0.58432	D	0.999999	D;P;D;D	0.69078	0.997;0.899;0.996;0.993	D;P;D;D	0.74348	0.983;0.787;0.98;0.914	T	0.49986	-0.8880	10	0.27785	T	0.31	-14.82	18.4994	0.90876	0.0:0.0:1.0:0.0	.	428;390;618;428	B7Z6G0;B3KTX0;P23508-2;P23508	.;.;.;CRCM_HUMAN	V	428;365;618	ENSP00000305617:A428V;ENSP00000421615:A365V;ENSP00000386227:A618V	ENSP00000305617:A428V	A	-	2	0	MCC	112434762	1.000000	0.71417	0.756000	0.31282	0.955000	0.61496	7.786000	0.85741	2.449000	0.82847	0.591000	0.81541	GCC		MCC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250736.3	NM_001085377	
KCNN2	3781	broad.mit.edu	37	5	113831879	113831879	+	Nonstop_Mutation	SNP	G	G	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr5:113831879G>T	ENST00000512097.3	+	9	2758	c.1740G>T	c.(1738-1740)taG>taT	p.*580Y	RP11-492A10.1_ENST00000514115.1_RNA|KCNN2_ENST00000264773.3_Nonstop_Mutation_p.*580Y|KCNN2_ENST00000503706.1_Nonstop_Mutation_p.*232Y			Q9H2S1	KCNN2_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2	0					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transport (GO:1901379)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|protein homodimerization activity (GO:0042803)|small conductance calcium-activated potassium channel activity (GO:0016286)	p.*580Y(1)|p.*232Y(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(21)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)	Miconazole(DB01110)|Procaine(DB00721)	AGAGTAGCTAGAAGAGAATAA	0.458																																					p.X580Y												.	.	2	Nonstop extension(2)	large_intestine(2)	c.G1740T	5						.						56.0	56.0	56.0					5																	113831879		2202	4300	6502	113859778	SO:0001578	stop_lost	3781	exon8			AF239613	CCDS4114.1, CCDS43352.1	5q22.3	2012-07-05			ENSG00000080709	ENSG00000080709		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6291	protein-coding gene	gene with protein product		605879				16382103	Standard	NM_001278204		Approved	KCa2.2, hSK2	uc003kqo.3	Q9H2S1	OTTHUMG00000128836	ENST00000512097.3:c.1740G>T	5.37:g.113831879G>T	ENSP00000427120:p.*580Tyrext*5	Somatic		Capture	Illumina HiSeq	Phase_I	113859778	NM_021614	A6NF94|Q0VFZ4|Q6PJI0|Q6X2Y2	Nonstop_Mutation	SNP	ENST00000512097.3	37	CCDS4114.1	.	.	.	.	.	.	.	.	.	.	G	17.68	3.448510	0.63178	.	.	ENSG00000080709	ENST00000264773;ENST00000503706	.	.	.	5.44	5.44	0.79542	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8853	0.92375	0.0:0.0:1.0:0.0	.	.	.	.	Y	580;232	.	.	X	+	3	2	KCNN2	113859778	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.295000	0.72744	2.558000	0.86282	0.643000	0.83706	TAG		KCNN2-001	KNOWN	not_organism_supported|upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250775.2	NM_021614	
PCDHA8	56140	broad.mit.edu	37	5	140222296	140222296	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr5:140222296G>A	ENST00000531613.1	+	1	1390	c.1390G>A	c.(1390-1392)Gtg>Atg	p.V464M	PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA8_ENST00000378123.3_Missense_Mutation_p.V464M|PCDHA5_ENST00000529859.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	464	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.V464M(4)		NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CACGGTGTTCGTGAAGGAGAA	0.662																																					p.V464M												.	.	4	Substitution - Missense(4)	large_intestine(2)|prostate(2)	c.G1390A	5						.						48.0	51.0	50.0					5																	140222296		2194	4267	6461	140202480	SO:0001583	missense	56140	exon1			AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.1390G>A	5.37:g.140222296G>A	ENSP00000434655:p.Val464Met	Somatic		Capture	Illumina HiSeq	Phase_I	140202480	NM_031856	B9EGT7|O75281	Missense_Mutation	SNP	ENST00000531613.1	37	CCDS54919.1	.	.	.	.	.	.	.	.	.	.	G	15.51	2.856218	0.51376	.	.	ENSG00000204962	ENST00000531613;ENST00000378123	T;T	0.58358	0.34;0.34	3.72	2.82	0.32997	Cadherin (4);Cadherin-like (1);	0.239019	0.20818	N	0.085118	T	0.70780	0.3263	M	0.86651	2.83	0.23120	N	0.998262	D;D	0.89917	1.0;0.997	D;D	0.69824	0.964;0.966	T	0.61008	-0.7149	10	0.87932	D	0	.	7.2717	0.26260	0.0933:0.1726:0.734:0.0	.	464;464	Q9Y5H6;Q9Y5H6-2	PCDA8_HUMAN;.	M	464	ENSP00000434655:V464M;ENSP00000367363:V464M	ENSP00000367363:V464M	V	+	1	0	PCDHA8	140202480	0.052000	0.20516	0.996000	0.52242	0.623000	0.37688	0.334000	0.19787	0.650000	0.30769	0.306000	0.20318	GTG		PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372830.2	NM_018911	
PCDHAC2	56134	broad.mit.edu	37	5	140348166	140348166	+	Silent	SNP	C	C	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr5:140348166C>T	ENST00000289269.5	+	1	2347	c.1815C>T	c.(1813-1815)acC>acT	p.T605T	PCDHA11_ENST00000398640.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHAC1_ENST00000253807.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529619.1_Intron	NM_018899.5|NM_031883.2	NP_061722.1|NP_114089.1	Q9Y5I4	PCDC2_HUMAN	protocadherin alpha subfamily C, 2	605	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.T605T(1)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|liver(2)|lung(9)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	45			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACCTGGTCACCAAAGTCATAG	0.517																																					p.T605T	Melanoma(190;638 2083 3390 11909 52360)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1815T	5						.						88.0	79.0	82.0					5																	140348166		2203	4300	6503	140328350	SO:0001819	synonymous_variant	56134	exon1			AF152474	CCDS4242.1	5q31	2010-11-26			ENSG00000243232	ENSG00000243232		"""Cadherins / Protocadherins : Clustered"""	8677	other	complex locus constituent		606321				10380929	Standard	NM_031883		Approved	PCDH-ALPHA-C2		Q9Y5I4	OTTHUMG00000129607	ENST00000289269.5:c.1815C>T	5.37:g.140348166C>T		Somatic		Capture	Illumina HiSeq	Phase_I	140328350	NM_018899	Q2M3V1|Q9Y5F4	Silent	SNP	ENST00000289269.5	37	CCDS4242.1																																																																																				PCDHAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251802.2	NM_018899	
PCDHB3	56132	broad.mit.edu	37	5	140480941	140480941	+	Silent	SNP	C	C	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr5:140480941C>T	ENST00000231130.2	+	1	708	c.708C>T	c.(706-708)aaC>aaT	p.N236N	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	236	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.N236N(1)		NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TAGATATAAACGACAATGCAC	0.532																																					p.N236N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C708T	5						.						50.0	54.0	53.0					5																	140480941		2202	4300	6502	140461125	SO:0001819	synonymous_variant	56132	exon1			AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.708C>T	5.37:g.140480941C>T		Somatic		Capture	Illumina HiSeq	Phase_I	140461125	NM_018937	B2R8P2	Silent	SNP	ENST00000231130.2	37	CCDS4245.1																																																																																				PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251817.2	NM_018937	
PCDHB15	56121	broad.mit.edu	37	5	140626892	140626892	+	Silent	SNP	G	G	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr5:140626892G>A	ENST00000231173.3	+	1	1746	c.1746G>A	c.(1744-1746)ccG>ccA	p.P582P		NM_018935.2	NP_061758.1	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15	582	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.P582P(1)		NS(1)|breast(3)|endometrium(8)|kidney(3)|large_intestine(14)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	61			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGGCCGAGCCGGGCTACCTGG	0.706																																					p.P582P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1746A	5						.						8.0	13.0	12.0					5																	140626892		1657	3498	5155	140607076	SO:0001819	synonymous_variant	56121	exon1			AF152494	CCDS4257.1	5q31	2011-06-07			ENSG00000113248	ENSG00000113248		"""Cadherins / Protocadherins : Clustered"""	8686	other	protocadherin		606341				10380929	Standard	NM_018935		Approved	PCDH-BETA15	uc003lje.3	Q9Y5E8	OTTHUMG00000129609	ENST00000231173.3:c.1746G>A	5.37:g.140626892G>A		Somatic		Capture	Illumina HiSeq	Phase_I	140607076	NM_018935	Q8IUX5	Silent	SNP	ENST00000231173.3	37	CCDS4257.1																																																																																				PCDHB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251804.2	NM_018935	
PCDHGA2	56113	broad.mit.edu	37	5	140720260	140720260	+	Silent	SNP	C	C	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr5:140720260C>T	ENST00000394576.2	+	1	1722	c.1722C>T	c.(1720-1722)ggC>ggT	p.G574G	PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	574	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G574G(2)		breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTTCCACTGGCGTGGAGCTGG	0.627																																					p.G574G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1722T	5						.						110.0	116.0	114.0					5																	140720260		2203	4300	6503	140700444	SO:0001819	synonymous_variant	56113	exon1			AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.1722C>T	5.37:g.140720260C>T		Somatic		Capture	Illumina HiSeq	Phase_I	140700444	NM_032009	Q52LL6|Q9Y5D5	Silent	SNP	ENST00000394576.2	37	CCDS47289.1																																																																																				PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374738.1	NM_018915	
PCDHGA11	56105	broad.mit.edu	37	5	140802815	140802815	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr5:140802815C>T	ENST00000398587.2	+	1	2054	c.2021C>T	c.(2020-2022)gCg>gTg	p.A674V	PCDHGA11_ENST00000518882.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA5_ENST00000518069.1_Intron	NM_018914.2|NM_032092.1	NP_061737.1|NP_114481.1	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11	674	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A674V(1)		breast(3)|endometrium(8)|kidney(3)|large_intestine(9)|lung(22)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAAGTCCTGGCGGACCTCGGC	0.662																																					p.A674V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2021T	5						.						43.0	50.0	48.0					5																	140802815		2203	4300	6503	140782999	SO:0001583	missense	56105	exon1			AF152505	CCDS47294.1, CCDS54930.1, CCDS75345.1	5q31	2010-01-26			ENSG00000253873	ENSG00000253873		"""Cadherins / Protocadherins : Clustered"""	8698	other	protocadherin		606298				10380929	Standard	NM_018914		Approved	PCDH-GAMMA-A11		Q9Y5H2	OTTHUMG00000164055	ENST00000398587.2:c.2021C>T	5.37:g.140802815C>T	ENSP00000381589:p.Ala674Val	Somatic		Capture	Illumina HiSeq	Phase_I	140782999	NM_018914	B7ZVY8|Q9Y5D8|Q9Y5D9	Missense_Mutation	SNP	ENST00000398587.2	37	CCDS47294.1	.	.	.	.	.	.	.	.	.	.	c	8.270	0.813079	0.16537	.	.	ENSG00000253873	ENST00000398587	T	0.48522	0.81	5.03	3.18	0.36537	.	1.552340	0.06057	U	0.657740	T	0.33731	0.0873	N	0.17800	0.525	0.80722	D	1	B;P	0.43607	0.215;0.812	B;B	0.36244	0.038;0.22	T	0.02774	-1.1112	10	0.87932	D	0	.	9.3372	0.38058	0.1494:0.7749:0.0:0.0757	.	674;674	Q9Y5H2;Q9Y5H2-2	PCDGB_HUMAN;.	V	674	ENSP00000381589:A674V	ENSP00000381589:A674V	A	+	2	0	PCDHGA11	140782999	0.014000	0.17966	0.535000	0.28026	0.172000	0.22775	0.940000	0.28992	0.600000	0.29862	0.556000	0.70494	GCG		PCDHGA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376974.1	NM_018914	
RELL2	285613	broad.mit.edu	37	5	141019845	141019845	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr5:141019845G>A	ENST00000297164.3	+	5	2062	c.862G>A	c.(862-864)Gac>Aac	p.D288N	FCHSD1_ENST00000435817.2_3'UTR|RELL2_ENST00000444782.1_Missense_Mutation_p.D288N|RELL2_ENST00000518856.1_Missense_Mutation_p.D222N|FCHSD1_ENST00000523856.1_5'UTR|RELL2_ENST00000518025.1_3'UTR|RELL2_ENST00000521367.1_Missense_Mutation_p.D222N	NM_173828.4	NP_776189.3	Q8NC24	RELL2_HUMAN	RELT-like 2	288					positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.D288N(1)		large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAGCAAACCAGACACTTCTGA	0.602																																					p.D288N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G862A	5						.						71.0	75.0	74.0					5																	141019845		2203	4300	6503	141000029	SO:0001583	missense	285613	exon6			AK054889	CCDS4265.1	5q31.3	2011-10-11	2007-06-15	2007-06-15	ENSG00000164620	ENSG00000164620			26902	protein-coding gene	gene with protein product		611213	"""chromosome 5 open reading frame 16"""	C5orf16		12975309, 16389068	Standard	NM_173828		Approved	FLJ90583	uc003lli.3	Q8NC24	OTTHUMG00000129612	ENST00000297164.3:c.862G>A	5.37:g.141019845G>A	ENSP00000297164:p.Asp288Asn	Somatic		Capture	Illumina HiSeq	Phase_I	141000029	NM_001130029	D3DQE2|Q6P4E7|Q6UXY2	Missense_Mutation	SNP	ENST00000297164.3	37	CCDS4265.1	.	.	.	.	.	.	.	.	.	.	G	17.57	3.422483	0.62622	.	.	ENSG00000164620	ENST00000444782;ENST00000521367;ENST00000297164;ENST00000518856	T;T;T;T	0.18016	2.32;2.24;2.32;2.24	5.54	5.54	0.83059	.	0.073236	0.53938	D	0.000048	T	0.25606	0.0623	N	0.24115	0.695	0.80722	D	1	D;D	0.67145	0.996;0.978	P;P	0.60541	0.876;0.651	T	0.01401	-1.1364	10	0.72032	D	0.01	-12.1297	14.9801	0.71306	0.0:0.0:1.0:0.0	.	222;288	E5RHA7;Q8NC24	.;RELL2_HUMAN	N	288;222;288;222	ENSP00000409443:D288N;ENSP00000430948:D222N;ENSP00000297164:D288N;ENSP00000427992:D222N	ENSP00000297164:D288N	D	+	1	0	RELL2	141000029	0.991000	0.36638	0.968000	0.41197	0.383000	0.30230	2.535000	0.45685	2.606000	0.88127	0.655000	0.94253	GAC		RELL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251807.2	NM_173828	
SPDL1	54908	broad.mit.edu	37	5	169028523	169028523	+	Missense_Mutation	SNP	G	G	A	rs143182474		TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr5:169028523G>A	ENST00000265295.4	+	11	1843	c.1564G>A	c.(1564-1566)Gtg>Atg	p.V522M		NM_017785.4	NP_060255.3			spindle apparatus coiled-coil protein 1									p.V522L(1)|p.V522M(1)									AAATCTGCCCGTGGATATGCA	0.428																																					p.V522M												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G1564A	5						.	G	MET/VAL	2,4404	4.2+/-10.8	0,2,2201	83.0	81.0	82.0		1564	-11.6	0.0	5	dbSNP_134	82	1,8599	1.2+/-3.3	0,1,4299	no	missense	CCDC99	NM_017785.4	21	0,3,6500	AA,AG,GG		0.0116,0.0454,0.0231	benign	522/606	169028523	3,13003	2203	4300	6503	168961101	SO:0001583	missense	54908	exon11			BC012568	CCDS4370.1	5q35.1	2012-09-27	2012-09-27	2012-09-27	ENSG00000040275	ENSG00000040275			26010	protein-coding gene	gene with protein product	"""spindly homolog (Drosophila)"""		"""coiled-coil domain containing 99"""	CCDC99		20427577	Standard	NM_017785		Approved	FLJ20364, hSpindly	uc003mae.4	Q96EA4	OTTHUMG00000130438	ENST00000265295.4:c.1564G>A	5.37:g.169028523G>A	ENSP00000265295:p.Val522Met	Somatic		Capture	Illumina HiSeq	Phase_I	168961101	NM_017785		Missense_Mutation	SNP	ENST00000265295.4	37	CCDS4370.1	.	.	.	.	.	.	.	.	.	.	G	10.60	1.396328	0.25205	4.54E-4	1.16E-4	ENSG00000040275	ENST00000265295;ENST00000274631	T	0.31510	1.49	5.81	-11.6	0.00059	.	1.949640	0.01743	N	0.029506	T	0.16171	0.0389	N	0.08118	0	0.09310	N	1	B;B;B	0.11235	0.004;0.001;0.001	B;B;B	0.06405	0.002;0.001;0.001	T	0.19811	-1.0294	10	0.33940	T	0.23	5.7423	16.6446	0.85173	0.1732:0.1975:0.6293:0.0	.	444;423;522	B4E393;Q96EA4-2;Q96EA4	.;.;SPDLY_HUMAN	M	522;423	ENSP00000265295:V522M	ENSP00000265295:V522M	V	+	1	0	CCDC99	168961101	0.000000	0.05858	0.000000	0.03702	0.067000	0.16453	-3.039000	0.00633	-2.646000	0.00426	-0.290000	0.09829	GTG		SPDL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252829.2	NM_017785	
AP3B1	8546	broad.mit.edu	37	5	77423931	77423931	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr5:77423931T>G	ENST00000255194.6	-	17	2066	c.1891A>C	c.(1891-1893)Act>Cct	p.T631P	AP3B1_ENST00000519295.1_Missense_Mutation_p.T582P	NM_001271769.1	NP_001258698.1	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1 subunit	631					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein targeting to lysosome (GO:0006622)	AP-3 adaptor complex (GO:0030123)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	GTP-dependent protein binding (GO:0030742)|protein phosphatase binding (GO:0019903)	p.T631P(1)		breast(5)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(12)|lung(12)|prostate(1)|skin(2)|urinary_tract(1)	39		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		AGGTACCCAGTAGCTTTAATG	0.363									Hermansky-Pudlak syndrome																												p.T631P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1891C	5						.						64.0	66.0	65.0					5																	77423931		2203	4300	6503	77459687	SO:0001583	missense	8546	exon17	Familial Cancer Database	HPS, HPS1-8	U81504	CCDS4041.1, CCDS64186.1	5q14.1	2014-09-17			ENSG00000132842	ENSG00000132842			566	protein-coding gene	gene with protein product		603401				9182526, 9151686	Standard	NM_003664		Approved	ADTB3A, HPS2	uc003kfj.4	O00203	OTTHUMG00000106919	ENST00000255194.6:c.1891A>C	5.37:g.77423931T>G	ENSP00000255194:p.Thr631Pro	Somatic		Capture	Illumina HiSeq	Phase_I	77459687	NM_003664	E5RJ68|O00580|Q7Z393|Q9HD66	Missense_Mutation	SNP	ENST00000255194.6	37	CCDS4041.1	.	.	.	.	.	.	.	.	.	.	T	8.913	0.959196	0.18507	.	.	ENSG00000132842	ENST00000255194;ENST00000519295;ENST00000535760;ENST00000535667	T;T	0.55588	0.51;0.51	5.91	-0.251	0.13003	Armadillo-like helical (1);	0.448808	0.26546	N	0.023768	T	0.35682	0.0940	L	0.37750	1.13	0.19300	N	0.999971	B	0.14012	0.009	B	0.09377	0.004	T	0.25813	-1.0121	10	0.66056	D	0.02	-3.0429	5.6277	0.17492	0.3521:0.1348:0.0:0.513	.	631	O00203	AP3B1_HUMAN	P	631;582;631;535	ENSP00000255194:T631P;ENSP00000430597:T582P	ENSP00000255194:T631P	T	-	1	0	AP3B1	77459687	0.118000	0.22208	0.502000	0.27614	0.987000	0.75469	0.476000	0.22180	0.107000	0.17824	0.533000	0.62120	ACT		AP3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000225548.2		
HRH2	3274	broad.mit.edu	37	5	175110302	175110302	+	Silent	SNP	C	C	T	rs139350514	byFrequency	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr5:175110302C>T	ENST00000231683.2	+	1	1839	c.66C>T	c.(64-66)acC>acT	p.T22T	HRH2_ENST00000377291.2_Silent_p.T22T	NM_022304.2	NP_071640.1	P25021	HRH2_HUMAN	histamine receptor H2	22					digestive tract development (GO:0048565)|epithelial cell morphogenesis (GO:0003382)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|gastrin-induced gastric acid secretion (GO:0001698)|gland development (GO:0048732)|histamine-induced gastric acid secretion (GO:0001697)|immune response (GO:0006955)|memory (GO:0007613)|positive regulation of vasoconstriction (GO:0045907)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	histamine receptor activity (GO:0004969)	p.T22T(2)		breast(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(10)|ovary(1)	22	all_cancers(89;0.00805)|Renal(175;0.000269)|Lung NSC(126;0.00419)|all_lung(126;0.00711)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Colorectal(1;0.0154)|COAD - Colon adenocarcinoma(1;0.149)	Amitriptyline(DB00321)|Asenapine(DB06216)|Betazole(DB00272)|Cimetidine(DB00501)|Doxepin(DB01142)|Epinastine(DB00751)|Famotidine(DB00927)|Histamine Phosphate(DB00667)|Loxapine(DB00408)|Methantheline(DB00940)|Nizatidine(DB00585)|Olanzapine(DB00334)|Ranitidine(DB00863)|Roxatidine acetate(DB08806)|Tolazoline(DB00797)	TCACCATCACCGTGGTCCTTG	0.592																																					p.T22T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C66T	5						.						238.0	212.0	221.0					5																	175110302		2203	4300	6503	175042908	SO:0001819	synonymous_variant	3274	exon1				CCDS4395.1, CCDS47344.1	5q35	2012-08-08			ENSG00000113749	ENSG00000113749		"""GPCR / Class A : Histamine receptors"""	5183	protein-coding gene	gene with protein product		142703				1714721	Standard	NM_022304		Approved		uc003mdc.4	P25021	OTTHUMG00000130660	ENST00000231683.2:c.66C>T	5.37:g.175110302C>T		Somatic		Capture	Illumina HiSeq	Phase_I	175042908	NM_022304	B5BUP7|Q14464|Q7Z5R9	Silent	SNP	ENST00000231683.2	37	CCDS4395.1																																																																																				HRH2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253151.1		
GRIK2	2898	broad.mit.edu	37	6	102074444	102074444	+	Missense_Mutation	SNP	G	G	A	rs376865962		TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr6:102074444G>A	ENST00000421544.1	+	3	963	c.473G>A	c.(472-474)cGt>cAt	p.R158H	GRIK2_ENST00000369134.4_Missense_Mutation_p.R109H|GRIK2_ENST00000318991.6_Missense_Mutation_p.R158H|GRIK2_ENST00000413795.1_Missense_Mutation_p.R158H|GRIK2_ENST00000369137.3_Missense_Mutation_p.R158H|GRIK2_ENST00000358361.3_Missense_Mutation_p.R158H|GRIK2_ENST00000369138.1_Missense_Mutation_p.R158H	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	158					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.R158H(2)		NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	TCACTCAGCCGTGCCATTTTA	0.473													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16519	0.0		0.0	False		,,,				2504	0.0				p.R158H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G473A	6						.	G	HIS/ARG,HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	92.0	93.0	92.0		473,473,473	5.8	1.0	6		92	0,8600		0,0,4300	no	missense,missense,missense	GRIK2	NM_175768.3,NM_021956.4,NM_001166247.1	29,29,29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign,benign	158/870,158/909,158/893	102074444	1,13005	2203	4300	6503	102181137	SO:0001583	missense	2898	exon3				CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.473G>A	6.37:g.102074444G>A	ENSP00000397026:p.Arg158His	Somatic		Capture	Illumina HiSeq	Phase_I	102181137	NM_021956	A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Missense_Mutation	SNP	ENST00000421544.1	37	CCDS5048.1	.	.	.	.	.	.	.	.	.	.	G	17.54	3.415342	0.62511	2.27E-4	0.0	ENSG00000164418	ENST00000421544;ENST00000413795;ENST00000369138;ENST00000358361;ENST00000369137;ENST00000318991;ENST00000403289;ENST00000369134;ENST00000540076	D;D;D;D;D;D;D	0.83506	-1.73;-1.73;-1.73;-1.73;-1.73;-1.73;-1.73	5.79	5.79	0.91817	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	T	0.68081	0.2962	L	0.31664	0.95	0.54753	D	0.999987	B;B;B	0.17038	0.016;0.02;0.016	B;B;B	0.13407	0.008;0.009;0.008	T	0.62534	-0.6834	10	0.31617	T	0.26	.	20.024	0.97514	0.0:0.0:1.0:0.0	.	158;158;158	Q13002-5;Q13002;Q13002-2	.;GRIK2_HUMAN;.	H	158;158;158;158;158;158;158;109;120	ENSP00000397026:R158H;ENSP00000405596:R158H;ENSP00000358134:R158H;ENSP00000351128:R158H;ENSP00000358133:R158H;ENSP00000313276:R158H;ENSP00000358130:R109H	ENSP00000313276:R158H	R	+	2	0	GRIK2	102181137	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	9.476000	0.97823	2.718000	0.92993	0.655000	0.94253	CGT		GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043718.1		
NOL7	51406	broad.mit.edu	37	6	13616700	13616700	+	Silent	SNP	A	A	G			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr6:13616700A>G	ENST00000451315.2	+	3	365	c.333A>G	c.(331-333)agA>agG	p.R111R	RP1-223E5.4_ENST00000566170.1_RNA|NOL7_ENST00000474485.1_3'UTR|AL441883.1_ENST00000600057.1_3'UTR	NM_016167.3	NP_057251.2	Q9UMY1	NOL7_HUMAN	nucleolar protein 7, 27kDa	111						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.R111R(1)		breast(1)|large_intestine(3)|lung(1)	5	Breast(50;0.00669)|Ovarian(93;0.0634)	all_hematologic(90;0.135)	Epithelial(50;0.176)			AAAAGAAAAGAAAACTCCTTC	0.338																																					p.R111R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A333G	6						.						69.0	74.0	72.0					6																	13616700		2203	4299	6502	13724679	SO:0001819	synonymous_variant	51406	exon3			AF172066	CCDS4528.1	6p23	2008-05-23	2004-02-10		ENSG00000225921	ENSG00000225921			21040	protein-coding gene	gene with protein product		611533	"""chromosome 6 open reading frame 90"", ""polyglutamine binding protein 3"""	C6orf90, PQBP3		16205646	Standard	NM_016167		Approved	NOP27, RARG-1, dJ223E5.2	uc003naz.3	Q9UMY1	OTTHUMG00000014277	ENST00000451315.2:c.333A>G	6.37:g.13616700A>G		Somatic		Capture	Illumina HiSeq	Phase_I	13724679	NM_016167	Q5T297|Q9Y3U7	Silent	SNP	ENST00000451315.2	37	CCDS4528.1	.	.	.	.	.	.	.	.	.	.	A	11.09	1.535961	0.27475	.	.	ENSG00000225921	ENST00000420088	.	.	.	5.55	2.75	0.32379	.	.	.	.	.	T	0.39462	0.1079	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.23048	-1.0199	4	.	.	.	-7.9998	6.6284	0.22843	0.7832:0.0:0.2168:0.0	.	.	.	.	E	49	.	.	K	+	1	0	NOL7	13724679	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	1.070000	0.30653	0.242000	0.21303	0.528000	0.53228	AAA		NOL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039904.1	NM_016167	
TNXB	7148	broad.mit.edu	37	6	32049373	32049373	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr6:32049373C>T	ENST00000375244.3	-	10	4015	c.3814G>A	c.(3814-3816)Gtg>Atg	p.V1272M	TNXB_ENST00000375247.2_Missense_Mutation_p.V1272M|RNA5SP206_ENST00000516703.1_RNA			P22105	TENX_HUMAN	tenascin XB	1359	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)	p.V1359M(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						TCTGGGGTCACGCCGGTCACT	0.622																																					p.V1272M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3814A	6						.						22.0	23.0	23.0					6																	32049373		1981	4169	6150	32157351	SO:0001583	missense	7148	exon10			X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.3814G>A	6.37:g.32049373C>T	ENSP00000364393:p.Val1272Met	Somatic		Capture	Illumina HiSeq	Phase_I	32157351	NM_019105	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000375244.3	37		.	.	.	.	.	.	.	.	.	.	C	14.43	2.533782	0.45073	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.60171	0.21;0.21	5.44	1.45	0.22620	.	0.382752	0.18797	N	0.130891	T	0.35189	0.0923	M	0.82823	2.61	0.09310	N	1	B	0.29886	0.26	B	0.29440	0.102	T	0.40534	-0.9558	10	0.62326	D	0.03	.	3.3722	0.07225	0.1383:0.5749:0.1339:0.153	.	1272	P22105-3	.	M	1272	ENSP00000364393:V1272M;ENSP00000364396:V1272M	ENSP00000364393:V1272M	V	-	1	0	TNXB	32157351	0.000000	0.05858	0.000000	0.03702	0.682000	0.39822	-0.098000	0.11024	0.256000	0.21614	0.407000	0.27541	GTG		TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105	
CEP85L	387119	broad.mit.edu	37	6	118803070	118803070	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr6:118803070C>A	ENST00000368491.3	-	8	2238	c.1617G>T	c.(1615-1617)aaG>aaT	p.K539N	CEP85L_ENST00000368488.5_Missense_Mutation_p.K542N	NM_001042475.2	NP_001035940.1	Q5SZL2	CE85L_HUMAN	centrosomal protein 85kDa-like	539						centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.K539N(1)									CTTGTAAATTCTTATTTTTTT	0.303																																					p.K542N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1626T	6						.						70.0	61.0	64.0					6																	118803070		1790	4062	5852	118909763	SO:0001583	missense	387119	exon9			AF308284	CCDS5119.2, CCDS43498.1, CCDS55052.1	6q22.31	2011-11-25	2011-11-25	2011-11-25	ENSG00000111860	ENSG00000111860			21638	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 204"""	C6orf204			Standard	NM_206921		Approved	NY-BR-15, bA57K17.2	uc003pya.2	Q5SZL2	OTTHUMG00000015465	ENST00000368491.3:c.1617G>T	6.37:g.118803070C>A	ENSP00000357477:p.Lys539Asn	Somatic		Capture	Illumina HiSeq	Phase_I	118909763	NM_001178035	A1A4E1|A2A3P2|A2IDE5|F8W6J2|G3V0H3|Q2TAM2|Q5T323|Q7Z5K7|Q9H289	Missense_Mutation	SNP	ENST00000368491.3	37	CCDS43498.1	.	.	.	.	.	.	.	.	.	.	C	17.27	3.346456	0.61073	.	.	ENSG00000111860	ENST00000368491;ENST00000368488;ENST00000434604	T;T;T	0.11604	2.76;2.76;2.76	5.24	3.46	0.39613	.	0.280137	0.36972	N	0.002304	T	0.15046	0.0363	L	0.56769	1.78	0.40287	D	0.978464	D;D	0.89917	1.0;1.0	D;D	0.74348	0.983;0.983	T	0.01156	-1.1434	10	0.38643	T	0.18	-22.5207	11.295	0.49274	0.0:0.8496:0.0:0.1504	.	542;539	F8W6J2;Q5SZL2	.;CF204_HUMAN	N	539;542;542	ENSP00000357477:K539N;ENSP00000357474:K542N;ENSP00000392131:K542N	ENSP00000357474:K542N	K	-	3	2	C6orf204	118909763	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	0.967000	0.29344	0.697000	0.31718	0.561000	0.74099	AAG		CEP85L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041996.2	NM_001042475	
THSD7A	221981	broad.mit.edu	37	7	11630258	11630258	+	Missense_Mutation	SNP	T	T	C	rs199673570	byFrequency	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr7:11630258T>C	ENST00000423059.4	-	4	1533	c.1282A>G	c.(1282-1284)Aga>Gga	p.R428G		NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	428	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		TCTGTAGTTCTCCAGCCATAC	0.493										HNSCC(18;0.044)																											p.R428G												.	.	0			c.A1282G	7						.						27.0	31.0	30.0					7																	11630258		1998	4182	6180	11596783	SO:0001583	missense	221981	exon4				CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.1282A>G	7.37:g.11630258T>C	ENSP00000406482:p.Arg428Gly	None		Capture	Illumina HiSeq	Phase_I	11596783	NM_015204		Missense_Mutation	SNP	ENST00000423059.4	37	CCDS47543.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.190324	0.78789	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	T	0.59364	0.27	6.02	4.81	0.61882	.	0.211548	0.56097	D	0.000024	T	0.72606	0.3481	M	0.80746	2.51	0.58432	D	0.999999	P	0.34699	0.464	P	0.52823	0.71	T	0.70234	-0.4928	10	0.28530	T	0.3	.	13.1233	0.59340	0.0:0.0:0.2108:0.7891	.	428	Q9UPZ6	THS7A_HUMAN	G	428	ENSP00000406482:R428G	ENSP00000262042:R428G	R	-	1	2	THSD7A	11596783	1.000000	0.71417	0.963000	0.40424	0.821000	0.46438	3.566000	0.53805	2.311000	0.77944	0.533000	0.62120	AGA		THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2	
RELN	5649	broad.mit.edu	37	7	103206800	103206800	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr7:103206800G>C	ENST00000428762.1	-	33	4966	c.4807C>G	c.(4807-4809)Caa>Gaa	p.Q1603E	RELN_ENST00000343529.5_Missense_Mutation_p.Q1603E|RELN_ENST00000424685.2_Missense_Mutation_p.Q1603E	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	1603					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.Q1603E(1)|p.Q1603K(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		AATCCAGTTTGAGAGCTGTCA	0.403																																					p.Q1603E	NSCLC(146;835 1944 15585 22231 52158)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C4807G	7						.						96.0	93.0	94.0					7																	103206800		2203	4300	6503	102994036	SO:0001583	missense	5649	exon33				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.4807C>G	7.37:g.103206800G>C	ENSP00000392423:p.Gln1603Glu	Somatic		Capture	Illumina HiSeq	Phase_I	102994036	NM_005045	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	G	13.59	2.283533	0.40394	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.39787	1.06;1.99;1.06	6.08	6.08	0.98989	.	0.173332	0.53938	D	0.000055	T	0.37625	0.1010	L	0.29908	0.895	0.35521	D	0.801472	B;B	0.24963	0.068;0.115	B;B	0.25614	0.062;0.037	T	0.31833	-0.9929	10	0.39692	T	0.17	.	20.6634	0.99662	0.0:0.0:1.0:0.0	.	1603;1603	P78509-2;P78509	.;RELN_HUMAN	E	1603	ENSP00000392423:Q1603E;ENSP00000345694:Q1603E;ENSP00000388446:Q1603E	ENSP00000345694:Q1603E	Q	-	1	0	RELN	102994036	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.856000	0.75450	2.894000	0.99253	0.655000	0.94253	CAA		RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
SDK1	221935	broad.mit.edu	37	7	4011111	4011111	+	Silent	SNP	C	C	T	rs140973897	byFrequency	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr7:4011111C>T	ENST00000404826.2	+	12	1867	c.1728C>T	c.(1726-1728)atC>atT	p.I576I	SDK1_ENST00000389531.3_Silent_p.I576I	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	576	Ig-like C2-type 6.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.I576I(2)		NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		GGACGTCCATCGTCCACCCTC	0.552													C|||	3	0.000599042	0.0	0.0	5008	,	,		19888	0.002		0.001	False		,,,				2504	0.0				p.I576I												.	.	2	Substitution - coding silent(2)	large_intestine(1)|central_nervous_system(1)	c.C1728T	7						.	C		0,4406		0,0,2203	91.0	78.0	83.0		1728	1.0	0.1	7	dbSNP_134	83	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous	SDK1	NM_152744.3		0,3,6500	TT,TC,CC		0.0349,0.0,0.0231		576/2214	4011111	3,13003	2203	4300	6503	3977637	SO:0001819	synonymous_variant	221935	exon12			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.1728C>T	7.37:g.4011111C>T		Somatic		Capture	Illumina HiSeq	Phase_I	3977637	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Silent	SNP	ENST00000404826.2	37	CCDS34590.1																																																																																				SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
MACC1	346389	broad.mit.edu	37	7	20197897	20197897	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr7:20197897A>G	ENST00000400331.5	-	5	2395	c.2087T>C	c.(2086-2088)gTt>gCt	p.V696A	MACC1_ENST00000589011.1_Missense_Mutation_p.V696A|MACC1_ENST00000332878.4_Missense_Mutation_p.V696A	NM_182762.3	NP_877439.3	Q6ZN28	MACC1_HUMAN	metastasis associated in colon cancer 1	696					positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.V696A(1)		endometrium(1)|kidney(1)|large_intestine(15)|lung(12)|ovary(2)|prostate(1)|skin(3)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(1)	39						CTTCTTTATAACATAAGAAAC	0.353																																					p.V696A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2087C	7						.						73.0	78.0	77.0					7																	20197897		2203	4298	6501	20164422	SO:0001583	missense	346389	exon5				CCDS5369.1	7p15.3	2008-10-14			ENSG00000183742	ENSG00000183742			30215	protein-coding gene	gene with protein product		612646					Standard	NM_182762		Approved	7A5, SH3BP4L	uc003sus.4	Q6ZN28	OTTHUMG00000128415	ENST00000400331.5:c.2087T>C	7.37:g.20197897A>G	ENSP00000383185:p.Val696Ala	Somatic		Capture	Illumina HiSeq	Phase_I	20164422	NM_182762	A8MUS5|B2RNR9|Q6ZQN8|Q7Z5A5	Missense_Mutation	SNP	ENST00000400331.5	37	CCDS5369.1	.	.	.	.	.	.	.	.	.	.	A	16.36	3.101969	0.56183	.	.	ENSG00000183742	ENST00000400331;ENST00000332878	T;T	0.34472	1.36;1.36	5.75	5.75	0.90469	.	0.166739	0.52532	D	0.000065	T	0.46619	0.1402	M	0.79475	2.455	0.80722	D	1	P	0.48694	0.914	B	0.43754	0.43	T	0.55724	-0.8096	10	0.87932	D	0	-11.3448	16.0436	0.80701	1.0:0.0:0.0:0.0	.	696	Q6ZN28	MACC1_HUMAN	A	696	ENSP00000383185:V696A;ENSP00000328410:V696A	ENSP00000328410:V696A	V	-	2	0	MACC1	20164422	1.000000	0.71417	0.901000	0.35422	0.968000	0.65278	9.339000	0.96797	2.188000	0.69820	0.533000	0.62120	GTT		MACC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250202.5	NM_182762	
BMPER	168667	broad.mit.edu	37	7	34118611	34118611	+	Silent	SNP	C	C	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr7:34118611C>T	ENST00000297161.2	+	13	1595	c.1221C>T	c.(1219-1221)aaC>aaT	p.N407N	BMPER_ENST00000426693.1_Silent_p.N407N	NM_133468.4	NP_597725.1	Q8N8U9	BMPER_HUMAN	BMP binding endothelial regulator	407	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|endothelial cell activation (GO:0042118)|inner ear development (GO:0048839)|negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of endothelial cell migration (GO:0010594)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|ureteric bud development (GO:0001657)	extracellular space (GO:0005615)		p.N407N(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(24)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						TGGTGAAGAACGACGCCCGCC	0.607																																					p.N407N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1221T	7						.						92.0	97.0	96.0					7																	34118611		2203	4300	6503	34085136	SO:0001819	synonymous_variant	168667	exon12				CCDS5442.1	7p14.3	2009-02-18			ENSG00000164619	ENSG00000164619			24154	protein-coding gene	gene with protein product	"""crossveinless-2"""	608699				12897139, 14766204	Standard	NM_133468		Approved	Cv2, CRIM3	uc011kap.2	Q8N8U9	OTTHUMG00000128675	ENST00000297161.2:c.1221C>T	7.37:g.34118611C>T		Somatic		Capture	Illumina HiSeq	Phase_I	34085136	NM_133468	A8K1P8|Q8TF36	Silent	SNP	ENST00000297161.2	37	CCDS5442.1																																																																																				BMPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250570.2	NM_133468	
ABCA13	154664	broad.mit.edu	37	7	48318758	48318758	+	Missense_Mutation	SNP	C	C	T	rs375861638		TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr7:48318758C>T	ENST00000435803.1	+	18	7991	c.7967C>T	c.(7966-7968)gCg>gTg	p.A2656V		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	2656					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.A2656V(1)|p.A2601V(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						AGGAGTCTTGCGGTAGCATTT	0.338													c|||	1	0.000199681	0.0	0.0	5008	,	,		17812	0.0		0.0	False		,,,				2504	0.001				p.R2602W												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C7804T	7						.	C	VAL/ALA	0,3640		0,0,1820	27.0	26.0	26.0		7967	1.2	0.0	7		26	1,8149		0,1,4074	no	missense	ABCA13	NM_152701.3	64	0,1,5894	TT,TC,CC		0.0123,0.0,0.0085	benign	2656/5059	48318758	1,11789	1820	4075	5895	48289304	SO:0001583	missense	154664	exon16			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.7967C>T	7.37:g.48318758C>T	ENSP00000411096:p.Ala2656Val	Somatic		Capture	Illumina HiSeq	Phase_I	48289304	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	c	0.005	-2.204150	0.00296	0.0	1.23E-4	ENSG00000179869	ENST00000435803	T	0.35789	1.29	4.93	1.18	0.20946	.	1.852100	0.03054	N	0.154990	T	0.12646	0.0307	N	0.01352	-0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32640	-0.9899	10	0.02654	T	1	.	6.9884	0.24741	0.0:0.2777:0.0:0.7223	.	2656	Q86UQ4	ABCAD_HUMAN	V	2656	ENSP00000411096:A2656V	ENSP00000411096:A2656V	A	+	2	0	ABCA13	48289304	0.001000	0.12720	0.000000	0.03702	0.092000	0.18411	0.218000	0.17622	-0.032000	0.13758	-0.285000	0.09966	GCG		ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
COL1A2	1278	broad.mit.edu	37	7	94029554	94029554	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr7:94029554G>A	ENST00000297268.6	+	5	650	c.179G>A	c.(178-180)gGc>gAc	p.G60D		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	60					blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)	p.G60V(1)|p.G60D(1)	COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	GGTCCCACAGGCCCTCCTGGT	0.527										HNSCC(75;0.22)																											p.G60D												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G179A	7						.						93.0	91.0	92.0					7																	94029554		2203	4300	6503	93867490	SO:0001583	missense	1278	exon5			Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.179G>A	7.37:g.94029554G>A	ENSP00000297268:p.Gly60Asp	Somatic		Capture	Illumina HiSeq	Phase_I	93867490	NM_000089	P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Missense_Mutation	SNP	ENST00000297268.6	37	CCDS34682.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.995407	0.74703	.	.	ENSG00000164692	ENST00000297268;ENST00000545487	D	0.99353	-5.77	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	D	0.99654	0.9872	H	0.96398	3.815	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97762	1.0221	10	0.87932	D	0	.	19.8519	0.96744	0.0:0.0:1.0:0.0	.	60;60	B4DTF5;P08123	.;CO1A2_HUMAN	D	60;61	ENSP00000297268:G60D	ENSP00000297268:G60D	G	+	2	0	COL1A2	93867490	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.182000	0.94881	2.861000	0.98227	0.655000	0.94253	GGC		COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2	NM_000089	
C7orf33	202865	broad.mit.edu	37	7	148288117	148288117	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr7:148288117C>T	ENST00000307003.2	+	1	461	c.100C>T	c.(100-102)Cgc>Tgc	p.R34C		NM_145304.2	NP_660347.1	Q8WU49	CG033_HUMAN	chromosome 7 open reading frame 33	34								p.R34C(1)		central_nervous_system(1)|large_intestine(4)|lung(7)|prostate(2)	14	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			TGGGGCAAGGCGCCGGATTGA	0.567																																					p.R34C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C100T	7						.						77.0	68.0	71.0					7																	148288117		2203	4300	6503	147919050	SO:0001583	missense	202865	exon1			BC021251	CCDS5890.1	7q36.1	2011-11-24			ENSG00000170279	ENSG00000170279			21724	protein-coding gene	gene with protein product							Standard	NM_145304		Approved		uc003wew.3	Q8WU49	OTTHUMG00000152756	ENST00000307003.2:c.100C>T	7.37:g.148288117C>T	ENSP00000304071:p.Arg34Cys	Somatic		Capture	Illumina HiSeq	Phase_I	147919050	NM_145304		Missense_Mutation	SNP	ENST00000307003.2	37	CCDS5890.1	.	.	.	.	.	.	.	.	.	.	C	9.130	1.011187	0.19277	.	.	ENSG00000170279	ENST00000307003	.	.	.	2.33	-3.6	0.04570	.	.	.	.	.	T	0.13970	0.0338	N	0.08118	0	0.09310	N	1	B	0.13594	0.008	B	0.09377	0.004	T	0.18053	-1.0349	8	0.87932	D	0	.	0.1919	0.00135	0.3407:0.2469:0.1682:0.2442	.	34	Q8WU49	CG033_HUMAN	C	34	.	ENSP00000304071:R34C	R	+	1	0	C7orf33	147919050	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.277000	0.02812	-1.065000	0.03168	-0.233000	0.12211	CGC		C7orf33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327684.1	NM_145304	
SNTG1	54212	broad.mit.edu	37	8	51503441	51503442	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr8:51503441_51503442insA	ENST00000522124.1	+	13	1474_1475	c.813_814insA	c.(814-816)aaafs	p.K272fs	SNTG1_ENST00000517473.1_Frame_Shift_Ins_p.K272fs|SNTG1_ENST00000518864.1_Frame_Shift_Ins_p.K272fs|SNTG1_ENST00000276467.5_Frame_Shift_Ins_p.K272fs	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	272					cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				CATTGCAGATTAAAAAAATCAA	0.267																																					p.I271fs												.	.	0			c.813_814insA	8						.																																			51665995	SO:0001589	frameshift_variant	54212	exon13			AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.820dupA	8.37:g.51503448_51503448dupA	ENSP00000429842:p.Lys272fs	None		Capture	Illumina HiSeq	Phase_I	51665994	NM_018967	Q2M3Q0|Q9NY98	Frame_Shift_Ins	INS	ENST00000522124.1	37	CCDS6147.1																																																																																				SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377964.1		
RP1L1	94137	broad.mit.edu	37	8	10480644	10480644	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr8:10480644C>T	ENST00000382483.3	-	2	291	c.68G>A	c.(67-69)cGc>cAc	p.R23H	RP1L1_ENST00000329335.3_5'UTR	NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	23					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)		p.R23H(1)		breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		CGAGGGGGTGCGAGCCACAGA	0.662																																					p.R23H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G68A	8						.						35.0	39.0	38.0					8																	10480644		2007	4158	6165	10518054	SO:0001583	missense	94137	exon2			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.68G>A	8.37:g.10480644C>T	ENSP00000371923:p.Arg23His	Somatic		Capture	Illumina HiSeq	Phase_I	10518054	NM_178857	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	c	9.997	1.232357	0.22626	.	.	ENSG00000183638	ENST00000382483	T	0.06528	3.29	4.5	2.16	0.27623	.	.	.	.	.	T	0.04724	0.0128	L	0.39397	1.21	0.09310	N	1	P	0.44429	0.835	B	0.33568	0.166	T	0.39461	-0.9613	9	0.38643	T	0.18	-6.9789	6.6567	0.22990	0.0:0.7018:0.1624:0.1358	.	23	A6NKC6	.	H	23	ENSP00000371923:R23H	ENSP00000371923:R23H	R	-	2	0	RP1L1	10518054	.	.	0.763000	0.31416	0.351000	0.29236	.	.	0.267000	0.21916	0.457000	0.33378	CGC		RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
OSR2	116039	broad.mit.edu	37	8	99961420	99961420	+	Silent	SNP	C	C	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr8:99961420C>T	ENST00000297565.4	+	2	736	c.240C>T	c.(238-240)gaC>gaT	p.D80D	OSR2_ENST00000435298.2_Silent_p.D80D|OSR2_ENST00000522510.1_Silent_p.D80D|OSR2_ENST00000457907.2_Silent_p.D201D|OSR2_ENST00000523368.1_Silent_p.D80D	NM_001142462.1	NP_001135934.1	Q8N2R0	OSR2_HUMAN	odd-skipped related transciption factor 2	80					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|chondrocyte differentiation (GO:0002062)|embryo development (GO:0009790)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal joint development (GO:0072498)|embryonic skeletal joint morphogenesis (GO:0060272)|embryonic skeletal limb joint morphogenesis (GO:0036023)|embryonic skeletal system morphogenesis (GO:0048704)|eyelid development in camera-type eye (GO:0061029)|head development (GO:0060322)|mesonephros development (GO:0001823)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis (GO:0042476)|osteoblast proliferation (GO:0033687)|palate development (GO:0060021)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gastrulation (GO:2000543)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)	p.D80D(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Breast(36;4.14e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.0136)			GCCTCGTGGACGCGCGCTTCC	0.657																																					p.D80D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C240T	8						.						49.0	55.0	53.0					8																	99961420		2007	4148	6155	100030596	SO:0001819	synonymous_variant	116039	exon2			AY038072	CCDS47901.1, CCDS47902.1, CCDS69520.1	8q22.2	2013-10-17	2013-10-17			ENSG00000164920		"""Zinc fingers, C2H2-type"""	15830	protein-coding gene	gene with protein product		611297	"""odd-skipped related 2 (Drosophila)"""				Standard	XM_005250779		Approved	FLJ90037	uc003yir.3	Q8N2R0		ENST00000297565.4:c.240C>T	8.37:g.99961420C>T		Somatic		Capture	Illumina HiSeq	Phase_I	100030596	NM_053001	A8K626|B4E3B7|Q96AM6|Q96LB6|Q96LB7	Silent	SNP	ENST00000297565.4	37	CCDS47901.1																																																																																				OSR2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000379505.1	NM_053001	
PI15	51050	broad.mit.edu	37	8	75756325	75756325	+	Missense_Mutation	SNP	G	G	A	rs200713288		TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr8:75756325G>A	ENST00000260113.2	+	3	562	c.383G>A	c.(382-384)cGc>cAc	p.R128H	PI15_ENST00000523773.1_Missense_Mutation_p.R128H|RP11-758M4.4_ENST00000518128.1_RNA|RP11-758M4.4_ENST00000523860.1_RNA|RP11-758M4.4_ENST00000522914.1_RNA	NM_015886.3	NP_056970.1	O43692	PI15_HUMAN	peptidase inhibitor 15	128	SCP.					extracellular vesicular exosome (GO:0070062)	peptidase inhibitor activity (GO:0030414)	p.R128H(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|skin(1)	30	Breast(64;0.137)		BRCA - Breast invasive adenocarcinoma(89;0.104)|Epithelial(68;0.118)			CTATCTGTACGCACTGGAAGG	0.408																																					p.R128H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G383A	8						.						164.0	162.0	163.0					8																	75756325		2203	4300	6503	75918880	SO:0001583	missense	51050	exon3			D45027	CCDS6218.1	8q13.3	2005-08-17	2005-08-17		ENSG00000137558	ENSG00000137558			8946	protein-coding gene	gene with protein product		607076	"""protease inhibitor 15"""			8882727, 9473672	Standard	XM_005251255		Approved	P25TI	uc003yal.3	O43692	OTTHUMG00000164528	ENST00000260113.2:c.383G>A	8.37:g.75756325G>A	ENSP00000260113:p.Arg128His	Somatic		Capture	Illumina HiSeq	Phase_I	75918880	NM_015886	Q68CY1	Missense_Mutation	SNP	ENST00000260113.2	37	CCDS6218.1	.	.	.	.	.	.	.	.	.	.	G	7.771	0.707509	0.15239	.	.	ENSG00000137558	ENST00000260113;ENST00000523773	T;T	0.07688	3.17;3.17	4.97	4.97	0.65823	CAP domain (3);	0.000000	0.85682	D	0.000000	T	0.04543	0.0124	N	0.02368	-0.58	0.58432	D	0.999995	B	0.19200	0.034	B	0.12837	0.008	T	0.51560	-0.8690	10	0.28530	T	0.3	.	18.7851	0.91951	0.0:0.0:1.0:0.0	.	128	O43692	PI15_HUMAN	H	128	ENSP00000260113:R128H;ENSP00000428567:R128H	ENSP00000260113:R128H	R	+	2	0	PI15	75918880	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.875000	0.63072	2.736000	0.93811	0.591000	0.81541	CGC		PI15-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379115.1	NM_015886	
TP53INP1	94241	broad.mit.edu	37	8	95942781	95942781	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr8:95942781C>T	ENST00000342697.4	-	4	1056	c.649G>A	c.(649-651)Gat>Aat	p.D217N	TP53INP1_ENST00000378776.4_Splice_Site_p.D162N|TP53INP1_ENST00000448464.2_3'UTR|NDUFAF6_ENST00000396113.1_Intron	NM_033285.3	NP_150601.1	Q96A56	T53I1_HUMAN	tumor protein p53 inducible nuclear protein 1	217					apoptotic process (GO:0006915)|autophagic cell death (GO:0048102)|autophagy (GO:0006914)|cell cycle arrest (GO:0007050)|cellular response to ethanol (GO:0071361)|cellular response to hydroperoxide (GO:0071447)|cellular response to methyl methanesulfonate (GO:0072703)|cellular response to UV (GO:0034644)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of autophagy (GO:0010508)|positive regulation of transcription, DNA-templated (GO:0045893)|response to heat (GO:0009408)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)	antioxidant activity (GO:0016209)	p.D217N(1)		kidney(2)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	9	Breast(36;8.75e-07)					GGGTGGCAATCCCTGGTAAGA	0.473																																					p.D217N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G649A	8						.						205.0	213.0	211.0					8																	95942781		2203	4300	6503	96011957	SO:0001583	missense	94241	exon4			AF409115	CCDS6265.1, CCDS47899.1	8q22	2004-03-11				ENSG00000164938			18022	protein-coding gene	gene with protein product		606185				11511362, 12438758	Standard	NM_033285		Approved	DKFZp434M1317, FLJ22139, P53DINP1, SIP, TP53INP1A, TP53INP1B, Teap	uc003yhg.3	Q96A56		ENST00000342697.4:c.649G>A	8.37:g.95942781C>T	ENSP00000344215:p.Asp217Asn	Somatic		Capture	Illumina HiSeq	Phase_I	96011957	NM_033285	B2RCE5|Q969R9	Missense_Mutation	SNP	ENST00000342697.4	37	CCDS6265.1	.	.	.	.	.	.	.	.	.	.	C	18.81	3.703771	0.68501	.	.	ENSG00000164938	ENST00000342697;ENST00000378776	T;T	0.52057	0.83;0.68	5.98	5.11	0.69529	.	0.286307	0.38897	N	0.001533	T	0.50360	0.1611	L	0.51422	1.61	0.37663	D	0.922848	P	0.49559	0.925	P	0.47075	0.536	T	0.59247	-0.7490	10	0.52906	T	0.07	-6.3737	15.2488	0.73526	0.0:0.9328:0.0:0.0672	.	217	Q96A56	T53I1_HUMAN	N	217;162	ENSP00000344215:D217N;ENSP00000368052:D162N	ENSP00000344215:D217N	D	-	1	0	TP53INP1	96011957	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	6.475000	0.73582	1.543000	0.49345	-0.140000	0.14226	GAT		TP53INP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379818.1		
TG	7038	broad.mit.edu	37	8	133899063	133899063	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr8:133899063G>T	ENST00000220616.4	+	9	1486	c.1446G>T	c.(1444-1446)caG>caT	p.Q482H	TG_ENST00000377869.1_Missense_Mutation_p.Q482H	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	482					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)		p.Q482H(1)		NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		ATGTTGGCCAGTTTAACTTGT	0.478																																					p.Q482H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1446T	8						.						78.0	82.0	81.0					8																	133899063		2203	4300	6503	133968245	SO:0001583	missense	7038	exon9			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.1446G>T	8.37:g.133899063G>T	ENSP00000220616:p.Gln482His	Somatic		Capture	Illumina HiSeq	Phase_I	133968245	NM_003235	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	ENST00000220616.4	37	CCDS34944.1	.	.	.	.	.	.	.	.	.	.	G	14.56	2.571351	0.45798	.	.	ENSG00000042832	ENST00000377869;ENST00000220616;ENST00000535932	T;T	0.65364	-0.15;-0.14	5.67	3.61	0.41365	.	0.311546	0.27792	N	0.017830	T	0.53738	0.1815	L	0.53249	1.67	0.20563	N	0.999887	P	0.49961	0.93	P	0.45037	0.467	T	0.54938	-0.8218	10	0.52906	T	0.07	.	3.6179	0.08085	0.128:0.1529:0.5617:0.1574	.	482	P01266	THYG_HUMAN	H	482	ENSP00000367100:Q482H;ENSP00000220616:Q482H	ENSP00000220616:Q482H	Q	+	3	2	TG	133968245	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.126000	0.31344	2.672000	0.90937	0.557000	0.71058	CAG		TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235	
ZNF483	158399	broad.mit.edu	37	9	114296576	114296576	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr9:114296576C>A	ENST00000309235.5	+	5	822	c.664C>A	c.(664-666)Cta>Ata	p.L222I	ZNF483_ENST00000355824.3_Missense_Mutation_p.L222I|ZNF483_ENST00000358151.4_Missense_Mutation_p.L222I	NM_133464.2	NP_597721.2	Q8TF39	ZN483_HUMAN	zinc finger protein 483	222	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L222I(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(11)|ovary(1)|skin(5)	31						GATTTCCCAGCTAAAGTGGGT	0.388																																					p.L222I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C664A	9						.						96.0	101.0	99.0					9																	114296576		2203	4300	6503	113336397	SO:0001583	missense	158399	exon5			AB075842	CCDS35105.1, CCDS35106.1	9q32	2013-01-09			ENSG00000173258	ENSG00000173258		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23384	protein-coding gene	gene with protein product							Standard	NM_001007169		Approved	ZKSCAN16, KIAA1962, ZSCAN48	uc004bff.2	Q8TF39	OTTHUMG00000020490	ENST00000309235.5:c.664C>A	9.37:g.114296576C>A	ENSP00000311679:p.Leu222Ile	Somatic		Capture	Illumina HiSeq	Phase_I	113336397	NM_001007169	Q5VZN2|Q8NAE1	Missense_Mutation	SNP	ENST00000309235.5	37	CCDS35106.1	.	.	.	.	.	.	.	.	.	.	C	8.615	0.890035	0.17540	.	.	ENSG00000173258	ENST00000358151;ENST00000355824;ENST00000309235	T;T;T	0.00995	5.46;5.46;5.46	4.59	2.75	0.32379	Krueppel-associated box (3);	0.000000	0.35407	N	0.003228	T	0.02807	0.0084	M	0.89601	3.045	0.27484	N	0.952497	P;P;P	0.52061	0.911;0.95;0.673	P;P;B	0.47981	0.466;0.563;0.268	T	0.16335	-1.0406	10	0.62326	D	0.03	-4.4714	6.5782	0.22579	0.0:0.7895:0.0:0.2105	.	222;222;222	Q6P088;Q8NAE1;Q8TF39	.;.;ZN483_HUMAN	I	222	ENSP00000350871:L222I;ENSP00000438048:L222I;ENSP00000311679:L222I	ENSP00000311679:L222I	L	+	1	2	ZNF483	113336397	0.986000	0.35501	0.983000	0.44433	0.035000	0.12851	0.505000	0.22642	1.305000	0.44909	0.650000	0.86243	CTA		ZNF483-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053641.1	XM_088567	
PPAPDC3	84814	broad.mit.edu	37	9	134183374	134183374	+	Silent	SNP	C	C	T	rs139175795	byFrequency	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr9:134183374C>T	ENST00000372264.3	+	2	820	c.516C>T	c.(514-516)taC>taT	p.Y172Y		NM_032728.3	NP_116117.3	Q8NBV4	PPAC3_HUMAN	phosphatidic acid phosphatase type 2 domain containing 3	172					negative regulation of myotube differentiation (GO:0010832)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)	hydrolase activity (GO:0016787)	p.Y172Y(1)		breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	16	all_hematologic(7;0.0119)			OV - Ovarian serous cystadenocarcinoma(145;1.22e-05)|Epithelial(140;0.000173)		GCGGCCCGTACGAGACGAGCC	0.672													C|||	12	0.00239617	0.0091	0.0	5008	,	,		15607	0.0		0.0	False		,,,				2504	0.0				p.Y172Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C516T	9						.	C		34,4372	39.2+/-71.8	0,34,2169	49.0	44.0	45.0		516	-3.0	0.4	9	dbSNP_134	45	0,8600		0,0,4300	no	coding-synonymous	PPAPDC3	NM_032728.3		0,34,6469	TT,TC,CC		0.0,0.7717,0.2614		172/272	134183374	34,12972	2203	4300	6503	133173195	SO:0001819	synonymous_variant	84814	exon2			AK027568	CCDS6942.1	9q34.2-q34.3	2008-02-26	2005-07-15	2005-07-15	ENSG00000160539	ENSG00000160539			28174	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 67"""	C9orf67		12958361	Standard	NM_032728		Approved	MGC12921, FLJ14662, NET39	uc004cal.2	Q8NBV4	OTTHUMG00000020822	ENST00000372264.3:c.516C>T	9.37:g.134183374C>T		Somatic		Capture	Illumina HiSeq	Phase_I	133173195	NM_032728	Q5T6P0|Q96SS7|Q9BRC3	Silent	SNP	ENST00000372264.3	37	CCDS6942.1																																																																																				PPAPDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054724.1	NM_032728	
KCNT1	57582	broad.mit.edu	37	9	138667250	138667250	+	Silent	SNP	C	C	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr9:138667250C>A	ENST00000263604.3	+	20	2281	c.2281C>A	c.(2281-2283)Cgg>Agg	p.R761R	KCNT1_ENST00000486577.2_Silent_p.R739R|KCNT1_ENST00000487664.1_Silent_p.R735R|KCNT1_ENST00000298480.5_Silent_p.R780R|KCNT1_ENST00000488444.2_Silent_p.R761R|KCNT1_ENST00000371757.2_Silent_p.R780R|KCNT1_ENST00000490355.2_Silent_p.R759R|KCNT1_ENST00000491806.2_Silent_p.R747R			Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	761					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)	p.R780R(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		CTGCTGCCTGCGGCTGGACAA	0.642																																					p.R780R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2338A	9						.						67.0	57.0	60.0					9																	138667250		2203	4300	6503	137807071	SO:0001819	synonymous_variant	57582	exon20			AB037843	CCDS35175.1, CCDS35175.2, CCDS65188.1	9q34.3	2012-07-05			ENSG00000107147	ENSG00000107147		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18865	protein-coding gene	gene with protein product		608167				10718198, 16382103	Standard	NM_020822		Approved	KCa4.1, KIAA1422	uc011mdq.2	Q5JUK3	OTTHUMG00000020917	ENST00000263604.3:c.2281C>A	9.37:g.138667250C>A		Somatic		Capture	Illumina HiSeq	Phase_I	137807071	NM_020822	B3KXF7|B7ZVY4|B9EGP2|G5E9V0|Q9P2C5	Silent	SNP	ENST00000263604.3	37																																																																																					KCNT1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_020822	
PHF2	5253	broad.mit.edu	37	9	96415578	96415578	+	Silent	SNP	C	C	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr9:96415578C>T	ENST00000359246.4	+	6	1087	c.720C>T	c.(718-720)tgC>tgT	p.C240C	PHF2_ENST00000375376.4_Intron	NM_005392.3	NP_005383.3	O75151	PHF2_HUMAN	PHD finger protein 2	240	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				liver development (GO:0001889)|negative regulation of chromatin silencing at rDNA (GO:0061188)|protein demethylation (GO:0006482)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K9 specific) (GO:0032454)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.C240C(1)		breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		GCCTAATCTGCGTGAAGGACA	0.557																																					p.C240C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C720T	9						.						151.0	113.0	126.0					9																	96415578		2203	4300	6503	95455399	SO:0001819	synonymous_variant	5253	exon6			AF043725	CCDS35069.1	9q22	2013-01-28			ENSG00000197724	ENSG00000197724		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	8920	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1E"", ""centromere protein 35"""	604351				10051327, 20129925	Standard	NM_005392		Approved	KIAA0662, JHDM1E, CENP-35	uc004aub.3	O75151	OTTHUMG00000020253	ENST00000359246.4:c.720C>T	9.37:g.96415578C>T		Somatic		Capture	Illumina HiSeq	Phase_I	95455399	NM_005392	Q4VXG0|Q8N3K2|Q9Y6N4	Silent	SNP	ENST00000359246.4	37	CCDS35069.1																																																																																				PHF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053162.1	NM_005392	
PNPLA7	375775	broad.mit.edu	37	9	140437097	140437097	+	Silent	SNP	G	G	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chr9:140437097G>A	ENST00000277531.4	-	6	774	c.588C>T	c.(586-588)gaC>gaT	p.D196D	PNPLA7_ENST00000406427.1_Silent_p.D221D	NM_152286.3	NP_689499.3	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7	196					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	lysophospholipase activity (GO:0004622)	p.D196D(1)		breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)		GACTCACAGTGTCCTGGATGC	0.627																																					p.D196D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C588T	9						.						29.0	31.0	30.0					9																	140437097		2203	4300	6503	139556918	SO:0001819	synonymous_variant	375775	exon6			AK126267	CCDS7045.1, CCDS48070.1	9q34.3	2009-01-12	2006-06-12	2006-06-12	ENSG00000130653	ENSG00000130653		"""Patatin-like phospholipase domain containing"""	24768	protein-coding gene	gene with protein product		612122	"""chromosome 9 open reading frame 111"""	C9orf111		16799181, 12640454, 19029121	Standard	XM_005266082		Approved	FLJ43070, FLJ31318, FLJ44279, RP11-48C7.2, NTEL1, NTE-R1	uc010ncj.1	Q6ZV29	OTTHUMG00000020990	ENST00000277531.4:c.588C>T	9.37:g.140437097G>A		Somatic		Capture	Illumina HiSeq	Phase_I	139556918	NM_152286	B5MDD3|Q5T364|Q658X0|Q658Y3|Q6ZTS1|Q86YU8|Q8TAY5|Q96N75|Q9H7N5	Silent	SNP	ENST00000277531.4	37	CCDS7045.1																																																																																				PNPLA7-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254787.1	NM_152286	
TRPC5	7224	broad.mit.edu	37	X	111155754	111155754	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chrX:111155754C>T	ENST00000262839.2	-	3	1583	c.665G>A	c.(664-666)cGt>cAt	p.R222H		NM_012471.2	NP_036603.1	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel, subfamily C, member 5	222					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.R222H(1)		biliary_tract(1)|breast(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(38)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						CCAGCCCAGACGGAAGGCAGT	0.557																																					p.R222H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G665A	X						.						157.0	148.0	151.0					X																	111155754		2203	4300	6503	111042410	SO:0001583	missense	7224	exon3			AF054568	CCDS14561.1	Xq23	2014-06-13			ENSG00000072315	ENSG00000072315		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12337	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 159"""	300334				10493832, 16382100	Standard	NM_012471		Approved	PPP1R159	uc004epl.1	Q9UL62	OTTHUMG00000022212	ENST00000262839.2:c.665G>A	X.37:g.111155754C>T	ENSP00000262839:p.Arg222His	Somatic		Capture	Illumina HiSeq	Phase_I	111042410	NM_012471	B2RP53|O75233|Q5JXY8|Q9Y514	Missense_Mutation	SNP	ENST00000262839.2	37	CCDS14561.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.452011	0.84209	.	.	ENSG00000072315	ENST00000262839	T	0.76839	-1.05	5.92	5.92	0.95590	Transient receptor potential II (1);	0.000000	0.85682	D	0.000000	T	0.78033	0.4220	N	0.05351	-0.065	0.53005	D	0.999966	D;D	0.69078	0.991;0.997	P;D	0.66847	0.88;0.947	T	0.82494	-0.0429	10	0.54805	T	0.06	-5.9832	19.2293	0.93831	0.0:1.0:0.0:0.0	.	223;222	Q59G51;Q9UL62	.;TRPC5_HUMAN	H	222	ENSP00000262839:R222H	ENSP00000262839:R222H	R	-	2	0	TRPC5	111042410	0.963000	0.33076	0.981000	0.43875	0.981000	0.71138	1.704000	0.37857	2.492000	0.84095	0.600000	0.82982	CGT		TRPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057945.1	NM_012471	
HTR2C	3358	broad.mit.edu	37	X	114141285	114141285	+	Silent	SNP	G	G	A			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chrX:114141285G>A	ENST00000276198.1	+	6	1412	c.684G>A	c.(682-684)acG>acA	p.T228T	HTR2C_ENST00000371950.3_Missense_Mutation_p.D197N|HTR2C_ENST00000371951.1_Silent_p.T228T	NM_000868.2	NP_000859.1	P28335	5HT2C_HUMAN	5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled	228					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|cGMP biosynthetic process (GO:0006182)|feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|regulation of appetite (GO:0032098)|regulation of corticotropin-releasing hormone secretion (GO:0043397)|regulation of neurological system process (GO:0031644)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|Gq/11-coupled serotonin receptor activity (GO:0001587)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.T228T(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50					Agomelatine(DB06594)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Doxepin(DB01142)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Lorcaserin(DB04871)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	TACCGCTGACGATTATGGTGA	0.507																																					p.T228T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G684A	X						.						377.0	319.0	339.0					X																	114141285		2203	4300	6503	114047541	SO:0001819	synonymous_variant	3358	exon6				CCDS14564.1, CCDS59174.1	Xq23	2013-12-19	2012-02-03		ENSG00000147246	ENSG00000147246		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5295	protein-coding gene	gene with protein product		312861	"""5-hydroxytryptamine (serotonin) receptor 2C"""	HTR1C		7895773	Standard	NM_000868		Approved	5-HT2C, 5HTR2C	uc004epu.1	P28335	OTTHUMG00000022226	ENST00000276198.1:c.684G>A	X.37:g.114141285G>A		Somatic		Capture	Illumina HiSeq	Phase_I	114047541	NM_000868	B1AMW4|Q5VUF8|Q9NP28	Missense_Mutation	SNP	ENST00000276198.1	37	CCDS14564.1	.	.	.	.	.	.	.	.	.	.	G	16.90	3.251277	0.59212	.	.	ENSG00000147246	ENST00000371950	T	0.56275	0.47	4.87	-4.93	0.03066	.	.	.	.	.	T	0.34832	0.0911	.	.	.	0.22401	N	0.999135	B	0.09022	0.002	B	0.04013	0.001	T	0.30650	-0.9971	8	0.59425	D	0.04	.	6.048	0.19770	0.1676:0.5705:0.1579:0.1039	.	197	B1AMW4	.	N	197	ENSP00000361018:D197N	ENSP00000361018:D197N	D	+	1	0	HTR2C	114047541	1.000000	0.71417	0.946000	0.38457	0.911000	0.54048	1.319000	0.33655	-0.892000	0.03935	-0.288000	0.09946	GAT		HTR2C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057962.1	NM_000868	
DMD	1756	broad.mit.edu	37	X	31747811	31747811	+	Missense_Mutation	SNP	C	C	T	rs369583884		TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chrX:31747811C>T	ENST00000357033.4	-	52	7803	c.7597G>A	c.(7597-7599)Gct>Act	p.A2533T	DMD_ENST00000541735.1_Missense_Mutation_p.A73T|DMD_ENST00000474231.1_Missense_Mutation_p.A73T|DMD_ENST00000343523.2_Missense_Mutation_p.A73T|DMD_ENST00000378677.2_Missense_Mutation_p.A2529T|DMD_ENST00000378707.3_Missense_Mutation_p.A73T|DMD_ENST00000359836.1_Missense_Mutation_p.A73T	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2533					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.A1192T(1)|p.A73T(1)|p.A2528T(1)|p.A2529T(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TTTTGGGCAGCGGTAATGAGT	0.428																																					p.A73T												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.G217A	X						.						223.0	190.0	201.0					X																	31747811		2202	4300	6502	31657732	SO:0001583	missense	1756	exon9			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.7597G>A	X.37:g.31747811C>T	ENSP00000354923:p.Ala2533Thr	Somatic		Capture	Illumina HiSeq	Phase_I	31657732	NM_004021	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	CCDS14233.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.2|20.2	3.958087|3.958087	0.73902|0.73902	.|.	.|.	ENSG00000198947|ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000358062;ENST00000378677;ENST00000357033;ENST00000359836;ENST00000343523;ENST00000542849;ENST00000535280;ENST00000378707;ENST00000541735;ENST00000474231|ENST00000465285	T;T;T;T;T;T;T;T|.	0.47528|.	0.84;0.84;0.84;0.84;0.84;0.84;0.84;0.84|.	5.23|5.23	5.23|5.23	0.72850|0.72850	.|.	0.000000|.	0.34725|.	U|.	0.003738|.	T|T	0.68439|0.68439	0.3001|0.3001	L|L	0.46741|0.46741	1.465|1.465	0.58432|0.58432	D|D	0.999996|0.999996	D;D;D;D;D;P;D;D;D;D|.	0.89917|.	0.983;1.0;0.999;1.0;1.0;0.576;0.991;0.991;0.999;0.999|.	P;D;D;D;D;B;P;P;D;D|.	0.91635|.	0.766;0.999;0.996;0.999;0.999;0.095;0.887;0.887;0.996;0.994|.	T|T	0.65504|0.65504	-0.6152|-0.6152	10|5	0.20519|.	T|.	0.43|.	.|.	18.1287|18.1287	0.89595|0.89595	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	2525;2533;2529;1192;1189;73;73;73;73;73|.	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6;F8VX32;E7ESB2;E7EQS5;E7EQR9;F5GZY3|.	.;DMD_HUMAN;.;.;.;.;.;.;.;.|.	T|H	2525;1192;1189;229;2529;2533;73;73;2533;2410;73;73;73|261	ENSP00000350765:A229T;ENSP00000367948:A2529T;ENSP00000354923:A2533T;ENSP00000352894:A73T;ENSP00000340057:A73T;ENSP00000367979:A73T;ENSP00000444119:A73T;ENSP00000417123:A73T|.	ENSP00000340057:A73T|.	A|R	-|-	1|2	0|0	DMD|DMD	31657732|31657732	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	6.586000|6.586000	0.74067|0.74067	2.304000|2.304000	0.77564|0.77564	0.506000|0.506000	0.49869|0.49869	GCT|CGC		DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
HUWE1	10075	broad.mit.edu	37	X	53610837	53610837	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chrX:53610837T>C	ENST00000342160.3	-	41	5658	c.5201A>G	c.(5200-5202)gAg>gGg	p.E1734G	HUWE1_ENST00000262854.6_Missense_Mutation_p.E1734G			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	1734					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.E1597G(1)		NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						CAGGCTTGTCTCCTTTTCAGT	0.448																																					p.E1734G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A5201G	X						.						67.0	64.0	65.0					X																	53610837		2203	4300	6503	53627562	SO:0001583	missense	10075	exon42			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.5201A>G	X.37:g.53610837T>C	ENSP00000340648:p.Glu1734Gly	Somatic		Capture	Illumina HiSeq	Phase_I	53627562	NM_031407	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	37	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	T	11.95	1.792760	0.31685	.	.	ENSG00000086758	ENST00000342160;ENST00000262854	T;T	0.39056	1.1;1.1	5.6	5.6	0.85130	.	0.522085	0.19219	N	0.119707	T	0.32882	0.0844	L	0.40543	1.245	0.41740	D	0.989605	B;P	0.37330	0.435;0.59	B;B	0.30646	0.076;0.118	T	0.12426	-1.0548	10	0.35671	T	0.21	.	13.6324	0.62202	0.0:0.0:0.0:1.0	.	1734;1734	Q7Z6Z7;Q7Z6Z7-2	HUWE1_HUMAN;.	G	1734	ENSP00000340648:E1734G;ENSP00000262854:E1734G	ENSP00000262854:E1734G	E	-	2	0	HUWE1	53627562	0.998000	0.40836	0.918000	0.36340	0.711000	0.40976	3.589000	0.53972	1.862000	0.54008	0.486000	0.48141	GAG		HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	
TENM1	10178	broad.mit.edu	37	X	123587294	123587294	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3837-01A-01W-0900-09	TCGA-AA-3837-10A-01W-0900-09	g.chrX:123587294T>C	ENST00000371130.3	-	22	4039	c.3976A>G	c.(3976-3978)Atg>Gtg	p.M1326V	TENM1_ENST00000422452.2_Missense_Mutation_p.M1333V|TENM1_ENST00000461429.1_5'Flank	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	1326					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.M1328V(1)									TTGCGAATCATAGTCCCATCC	0.423																																					p.M1326V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3976G	X						.						274.0	190.0	219.0					X																	123587294		2203	4300	6503	123414975	SO:0001583	missense	10178	exon22			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.3976A>G	X.37:g.123587294T>C	ENSP00000360171:p.Met1326Val	Somatic		Capture	Illumina HiSeq	Phase_I	123414975	NM_014253	B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	T	12.29	1.892420	0.33442	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.89810	-2.57;-2.57	5.97	5.97	0.96955	Six-bladed beta-propeller, TolB-like (1);	0.095988	0.64402	D	0.000001	T	0.79435	0.4445	N	0.11255	0.115	0.51767	D	0.999931	B;B;B	0.09022	0.002;0.002;0.0	B;B;B	0.09377	0.004;0.004;0.001	T	0.73895	-0.3838	10	0.25751	T	0.34	.	15.3737	0.74587	0.0:0.0:0.0:1.0	.	1332;1333;1326	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	V	1326;1333	ENSP00000360171:M1326V;ENSP00000403954:M1333V	ENSP00000360171:M1326V	M	-	1	0	ODZ1	123414975	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.960000	0.87893	2.014000	0.59158	0.486000	0.48141	ATG		TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253	
