#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ZNF22	7570	broad.mit.edu	37	10	45499897	45499898	+	3'UTR	INS	-	-	AAAATT	rs57376331|rs112642104|rs67383081	byFrequency	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	-	-	-	AAAATT	-	AAAATT	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr10:45499897_45499898insAAAATT	ENST00000298299.3	+	0	1674_1675				CEP164P1_ENST00000456938.2_RNA	NM_006963.4	NP_008894.2	P17026	ZNF22_HUMAN	zinc finger protein 22						odontogenesis (GO:0042476)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(2)|lung(2)	8		Prostate(175;0.0352)|all_neural(218;0.202)				CTGTGGAAGAAAAAAGGGAGAA	0.337														3720	0.742812	0.7761	0.8112	5008	,	,		17508	0.619		0.7624	False		,,,				2504	0.7566				.												.	.	0			.	10						.																																			44819904	SO:0001624	3_prime_UTR_variant	7570	.			BC041139	CCDS7211.1	10q11	2013-01-08	2012-07-12		ENSG00000165512	ENSG00000165512		"""Zinc fingers, C2H2-type"""	13012	protein-coding gene	gene with protein product		194529					Standard	NM_006963		Approved	KOX15, HKR-T1, ZNF422, Zfp422	uc001jbw.3	P17026	OTTHUMG00000018064	ENST00000298299.3:c.*407->AAAATT	10.37:g.45499897_45499898insAAAATT		Germline		Capture	Illumina HiSeq	Phase_I	44819903	.	Q5T741|Q96FM4	Splice_Site	INS	ENST00000298299.3	37	CCDS7211.1																																																																																				ZNF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047761.1	NM_006963	
LRRC18	474354	broad.mit.edu	37	10	50121549	50121549	+	Missense_Mutation	SNP	G	G	A	rs201494402	byFrequency	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G	G	A	G	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr10:50121549G>A	ENST00000374160.3	-	1	728	c.652C>T	c.(652-654)Cgg>Tgg	p.R218W	WDFY4_ENST00000325239.5_Intron|RP11-523O18.7_ENST00000430438.1_RNA|LRRC18_ENST00000298124.3_Missense_Mutation_p.R218W|WDFY4_ENST00000413659.2_Intron	NM_001006939.3	NP_001006940.3	Q8N456	LRC18_HUMAN	leucine rich repeat containing 18	218						cytoplasm (GO:0005737)				NS(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	18						AGGTTGTCCCGGGCGTTTTGG	0.498													G|||	2	0.000399361	0.0008	0.0	5008	,	,		19872	0.0		0.001	False		,,,				2504	0.0				p.R218W												.	.	0			c.C652T	10						.						167.0	171.0	170.0					10																	50121549		2203	4300	6503	49791555	SO:0001583	missense	474354	exon1			AY358137	CCDS31197.1	10q11.23	2011-02-10			ENSG00000165383	ENSG00000165383			23199	protein-coding gene	gene with protein product							Standard	NM_001006939		Approved	UNQ933, MGC34773, UNQ9338, VKGE9338	uc001jhd.3	Q8N456	OTTHUMG00000018182	ENST00000374160.3:c.652C>T	10.37:g.50121549G>A	ENSP00000363275:p.Arg218Trp	Germline		Capture	Illumina HiSeq	Phase_I	49791555	NM_001006939	Q6UY02	Missense_Mutation	SNP	ENST00000374160.3	37	CCDS31197.1	.	.	.	.	.	.	.	.	.	.	G	14.23	2.471973	0.43942	.	.	ENSG00000165383	ENST00000374160;ENST00000298124	T;T	0.60040	0.41;0.22	5.87	4.94	0.65067	.	0.105223	0.64402	D	0.000008	T	0.65668	0.2713	M	0.73962	2.25	0.43787	D	0.996326	D	0.71674	0.998	P	0.50791	0.65	T	0.68519	-0.5387	9	.	.	.	.	13.0508	0.58954	0.0:0.0:0.5423:0.4577	.	218	Q8N456	LRC18_HUMAN	W	218	ENSP00000363275:R218W;ENSP00000298124:R218W	.	R	-	1	2	LRRC18	49791555	0.854000	0.29725	0.288000	0.24862	0.271000	0.26615	1.917000	0.39996	1.426000	0.47256	0.655000	0.94253	CGG		LRRC18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047964.1	NM_001006939	
BICC1	80114	broad.mit.edu	37	10	60562921	60562921	+	Silent	SNP	C	C	T	rs537675644		TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr10:60562921C>T	ENST00000373886.3	+	15	2104	c.2100C>T	c.(2098-2100)cgC>cgT	p.R700R	BICC1_ENST00000263103.1_Silent_p.R326R	NM_001080512.1	NP_001073981.1	Q9H694	BICC1_HUMAN	BicC family RNA binding protein 1	700					multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.R700R(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	44						GGAGTGAGCGCGCTGCAGAGA	0.532																																					p.R700R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2100T	10						.						54.0	53.0	54.0					10																	60562921		2203	4300	6503	60232927	SO:0001819	synonymous_variant	80114	exon15			AK026129	CCDS31206.1	10q21.3	2014-09-17	2014-02-03		ENSG00000122870	ENSG00000122870		"""Sterile alpha motif (SAM) domain containing"""	19351	protein-coding gene	gene with protein product		614295	"""bicaudal C homolog 1 (Drosophila)"""				Standard	XM_005270166		Approved		uc001jki.1	Q9H694	OTTHUMG00000018271	ENST00000373886.3:c.2100C>T	10.37:g.60562921C>T		Somatic		Capture	Illumina HiSeq	Phase_I	60232927	NM_001080512		Silent	SNP	ENST00000373886.3	37	CCDS31206.1																																																																																				BICC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048150.2	NM_025044	
POLR3A	11128	broad.mit.edu	37	10	79753056	79753056	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr10:79753056C>T	ENST00000372371.3	-	20	2823	c.2686G>A	c.(2686-2688)Gat>Aat	p.D896N		NM_007055.3	NP_008986.2	O14802	RPC1_HUMAN	polymerase (RNA) III (DNA directed) polypeptide A, 155kDa	896					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|ribonucleoside binding (GO:0032549)|zinc ion binding (GO:0008270)	p.D896N(1)		breast(1)|endometrium(7)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)			TGGATAATATCGCCAGTAGAG	0.438																																					p.D896N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2686A	10						.						112.0	106.0	108.0					10																	79753056		2203	4300	6503	79423062	SO:0001583	missense	11128	exon20			AF021351	CCDS7354.1	10q22-q23	2013-01-21			ENSG00000148606	ENSG00000148606		"""RNA polymerase subunits"""	30074	protein-coding gene	gene with protein product		614258				9331371, 12391170	Standard	NM_007055		Approved	RPC1, RPC155, hRPC155	uc001jzn.3	O14802	OTTHUMG00000018550	ENST00000372371.3:c.2686G>A	10.37:g.79753056C>T	ENSP00000361446:p.Asp896Asn	Somatic		Capture	Illumina HiSeq	Phase_I	79423062	NM_007055	Q8IW34|Q8TCW5	Missense_Mutation	SNP	ENST00000372371.3	37	CCDS7354.1	.	.	.	.	.	.	.	.	.	.	C	35	5.472653	0.96274	.	.	ENSG00000148606	ENST00000372371;ENST00000540842	T	0.76578	-1.03	5.87	5.87	0.94306	RNA polymerase Rpb1, domain 5 (1);	0.000000	0.85682	D	0.000000	D	0.82788	0.5113	L	0.45698	1.435	0.80722	D	1	D	0.71674	0.998	P	0.56751	0.805	T	0.79704	-0.1692	9	.	.	.	-29.7467	20.5827	0.99408	0.0:1.0:0.0:0.0	.	896	O14802	RPC1_HUMAN	N	896	ENSP00000361446:D896N	.	D	-	1	0	POLR3A	79423062	1.000000	0.71417	0.991000	0.47740	0.993000	0.82548	7.445000	0.80570	2.941000	0.99782	0.655000	0.94253	GAT		POLR3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048923.1	NM_007055	
IFIT5	24138	broad.mit.edu	37	10	91177896	91177896	+	Silent	SNP	C	C	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr10:91177896C>T	ENST00000371795.4	+	2	1153	c.940C>T	c.(940-942)Cta>Tta	p.L314L	IFIT5_ENST00000416601.1_Silent_p.L266L	NM_012420.2	NP_036552.1	Q13325	IFIT5_HUMAN	interferon-induced protein with tetratricopeptide repeats 5	314					defense response to virus (GO:0051607)|innate immune response (GO:0045087)	actin cytoskeleton (GO:0015629)|apical part of cell (GO:0045177)|ruffle membrane (GO:0032587)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)|tRNA binding (GO:0000049)	p.L314L(1)		endometrium(1)|large_intestine(4)|lung(4)	9						AAAGGATAAACTAAAGGTTGA	0.423																																					p.L314L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C940T	10						.						129.0	124.0	126.0					10																	91177896		2203	4300	6503	91167876	SO:0001819	synonymous_variant	24138	exon2			U34605	CCDS7403.1	10q23.31	2013-01-10			ENSG00000152778	ENSG00000152778		"""Tetratricopeptide (TTC) repeat domain containing"""	13328	protein-coding gene	gene with protein product	"""retinoic acid- and interferon-inducible protein (58kD)"""					9398535	Standard	NM_012420		Approved	RI58	uc010qnh.2	Q13325	OTTHUMG00000018713	ENST00000371795.4:c.940C>T	10.37:g.91177896C>T		Somatic		Capture	Illumina HiSeq	Phase_I	91167876	NM_012420	B2R5X9|B4DDV1|Q5T7I9|Q6IAX3	Silent	SNP	ENST00000371795.4	37	CCDS7403.1																																																																																				IFIT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049303.1	NM_012420	
IDE	3416	broad.mit.edu	37	10	94269902	94269902	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr10:94269902T>A	ENST00000265986.6	-	6	858	c.802A>T	c.(802-804)Act>Tct	p.T268S		NM_004969.3	NP_004960.2	P14735	IDE_HUMAN	insulin-degrading enzyme	268					beta-amyloid metabolic process (GO:0050435)|bradykinin catabolic process (GO:0010815)|determination of adult lifespan (GO:0008340)|hormone catabolic process (GO:0042447)|insulin catabolic process (GO:1901143)|insulin metabolic process (GO:1901142)|insulin receptor signaling pathway (GO:0008286)|negative regulation of proteolysis (GO:0045861)|positive regulation of protein oligomerization (GO:0032461)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein homotetramerization (GO:0051289)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|ubiquitin homeostasis (GO:0010992)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|beta-amyloid binding (GO:0001540)|beta-endorphin binding (GO:0031626)|glycoprotein binding (GO:0001948)|insulin binding (GO:0043559)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)	p.T268S(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|urinary_tract(2)	33					"""""""Insulin(DB00071)|Bacitracin(DB00626)|Insulin Regular(DB00030)"""	ACCAGATTAGTCAAGTCATCT	0.358																																					p.T268S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A802T	10						.						88.0	90.0	89.0					10																	94269902		2203	4300	6503	94259882	SO:0001583	missense	3416	exon6			M21188	CCDS7421.1, CCDS53554.1	10q23-q25	2007-03-27			ENSG00000119912	ENSG00000119912			5381	protein-coding gene	gene with protein product	"""insulysin"""	146680				2293021	Standard	NM_004969		Approved		uc001kia.3	P14735	OTTHUMG00000018759	ENST00000265986.6:c.802A>T	10.37:g.94269902T>A	ENSP00000265986:p.Thr268Ser	Somatic		Capture	Illumina HiSeq	Phase_I	94259882	NM_004969	B2R721|B7ZAU2|D3DR35|Q5T5N2	Missense_Mutation	SNP	ENST00000265986.6	37	CCDS7421.1	.	.	.	.	.	.	.	.	.	.	T	11.60	1.686160	0.29962	.	.	ENSG00000119912	ENST00000265986;ENST00000436178	T;T	0.30182	3.16;1.54	5.6	5.6	0.85130	Peptidase M16, C-terminal (1);Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.000000	0.85682	D	0.000000	T	0.24547	0.0595	N	0.16656	0.425	0.80722	D	1	B	0.24426	0.103	B	0.32724	0.151	T	0.08166	-1.0735	10	0.51188	T	0.08	-15.2884	14.029	0.64604	0.0:0.0:0.0:1.0	.	268	P14735	IDE_HUMAN	S	268;254	ENSP00000265986:T268S;ENSP00000408850:T254S	ENSP00000265986:T268S	T	-	1	0	IDE	94259882	1.000000	0.71417	0.896000	0.35187	0.985000	0.73830	6.243000	0.72384	2.143000	0.66587	0.460000	0.39030	ACT		IDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049393.1	NM_004969	
TECTA	7007	broad.mit.edu	37	11	121000407	121000407	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr11:121000407C>T	ENST00000392793.1	+	10	2699	c.2428C>T	c.(2428-2430)Cga>Tga	p.R810*	TECTA_ENST00000264037.2_Nonsense_Mutation_p.R810*			O75443	TECTA_HUMAN	tectorin alpha	810	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.R810*(1)	TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		GGAAATTTATCGAAACAAAAA	0.438																																					p.R810X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2428T	11						.						159.0	158.0	158.0					11																	121000407		2203	4299	6502	120505617	SO:0001587	stop_gained	7007	exon9			AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.2428C>T	11.37:g.121000407C>T	ENSP00000376543:p.Arg810*	Somatic		Capture	Illumina HiSeq	Phase_I	120505617	NM_005422		Nonsense_Mutation	SNP	ENST00000392793.1	37	CCDS8434.1	.	.	.	.	.	.	.	.	.	.	C	40	7.972527	0.98588	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	.	.	.	5.39	4.47	0.54385	.	0.066465	0.64402	D	0.000017	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.6967	0.77506	0.1375:0.8625:0.0:0.0	.	.	.	.	X	810	.	ENSP00000264037:R810X	R	+	1	2	TECTA	120505617	1.000000	0.71417	0.141000	0.22245	0.977000	0.68977	4.281000	0.58965	1.265000	0.44215	0.563000	0.77884	CGA		TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	NM_005422	
ZNF215	7762	broad.mit.edu	37	11	6977508	6977508	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr11:6977508G>A	ENST00000278319.5	+	7	1888	c.1300G>A	c.(1300-1302)Gcc>Acc	p.A434T	ZNF215_ENST00000414517.2_Missense_Mutation_p.A434T|ZNF215_ENST00000529903.1_Intron	NM_013250.2	NP_037382.2	Q9UL58	ZN215_HUMAN	zinc finger protein 215	434					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A434T(1)|p.A434S(1)		NS(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(2)|skin(4)	32				Epithelial(150;6.33e-08)|BRCA - Breast invasive adenocarcinoma(625;0.134)		TGAAGCAAAGGCCTGCACAAG	0.388																																					p.A434T												.	.	2	Substitution - Missense(2)	large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	c.G1300A	11						.						81.0	80.0	81.0					11																	6977508		2201	4296	6497	6934084	SO:0001583	missense	7762	exon7			AF056618	CCDS7775.1	11p15.4	2013-01-09			ENSG00000149054	ENSG00000149054		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13007	protein-coding gene	gene with protein product		605016					Standard	XM_005253130		Approved	ZKSCAN11, ZSCAN43	uc001mey.3	Q9UL58	OTTHUMG00000165507	ENST00000278319.5:c.1300G>A	11.37:g.6977508G>A	ENSP00000278319:p.Ala434Thr	Somatic		Capture	Illumina HiSeq	Phase_I	6934084	NM_013250	Q96C84	Missense_Mutation	SNP	ENST00000278319.5	37	CCDS7775.1	.	.	.	.	.	.	.	.	.	.	G	10.34	1.323186	0.24080	.	.	ENSG00000149054	ENST00000278319;ENST00000414517	T;T	0.60424	0.19;0.19	4.74	-2.98	0.05513	Zinc finger, C2H2 (1);	1.858530	0.02917	N	0.137495	T	0.33702	0.0872	N	0.11064	0.09	0.42521	D	0.993006	B	0.21381	0.055	B	0.15052	0.012	T	0.31166	-0.9953	10	0.87932	D	0	5.15	1.5954	0.02663	0.3023:0.3569:0.2116:0.1292	.	434	Q9UL58	ZN215_HUMAN	T	434	ENSP00000278319:A434T;ENSP00000393202:A434T	ENSP00000278319:A434T	A	+	1	0	ZNF215	6934084	0.003000	0.15002	0.001000	0.08648	0.002000	0.02628	0.945000	0.29056	-0.278000	0.09180	-0.182000	0.12963	GCC		ZNF215-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384550.1		
SCGB2A2	4250	broad.mit.edu	37	11	62038450	62038450	+	Silent	SNP	C	C	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr11:62038450C>T	ENST00000227918.2	+	2	215	c.153C>T	c.(151-153)gaC>gaT	p.D51D	SCGB2A2_ENST00000525380.1_Silent_p.D51D	NM_002411.2	NP_002402.1	Q13296	SG2A2_HUMAN	secretoglobin, family 2A, member 2	51								p.D51D(1)		large_intestine(1)|lung(4)|ovary(1)|prostate(1)	7						AGTTCATAGACGACAATGCCA	0.388																																					p.D51D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C153T	11						.						149.0	140.0	143.0					11																	62038450		2202	4299	6501	61795026	SO:0001819	synonymous_variant	4250	exon2			AF015224	CCDS8018.1	11q13	2011-12-14	2002-03-22	2002-03-22	ENSG00000110484	ENSG00000110484		"""Secretoglobins"""	7050	protein-coding gene	gene with protein product	"""mammaglobin A"""	605562	"""mammaglobin 1"""	MGB1		9488047, 8631025, 22155607	Standard	XM_005274005		Approved	UGB2, MGC71974	uc001ntc.3	Q13296	OTTHUMG00000167509	ENST00000227918.2:c.153C>T	11.37:g.62038450C>T		Somatic		Capture	Illumina HiSeq	Phase_I	61795026	NM_002411	A1A522|Q86WH8	Silent	SNP	ENST00000227918.2	37	CCDS8018.1																																																																																				SCGB2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394860.1	NM_002411	
FAT3	120114	broad.mit.edu	37	11	92564831	92564831	+	Silent	SNP	T	T	A			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr11:92564831T>A	ENST00000298047.6	+	13	9542	c.9525T>A	c.(9523-9525)ggT>ggA	p.G3175G	FAT3_ENST00000409404.2_Silent_p.G3175G|FAT3_ENST00000525166.1_Silent_p.G3025G			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	3175	Cadherin 29. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G3175G(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ACTCAGCTGGTGGGGTCTTCT	0.552										TCGA Ovarian(4;0.039)																											p.G3175G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T9525A	11						.						55.0	59.0	57.0					11																	92564831		2141	4240	6381	92204479	SO:0001819	synonymous_variant	120114	exon13			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.9525T>A	11.37:g.92564831T>A		Somatic		Capture	Illumina HiSeq	Phase_I	92204479	NM_001008781	B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	37																																																																																					FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
OPCML	4978	broad.mit.edu	37	11	132399049	132399049	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr11:132399049G>T	ENST00000331898.7	-	3	1010	c.432C>A	c.(430-432)gaC>gaA	p.D144E	OPCML_ENST00000541867.1_Missense_Mutation_p.D144E|OPCML_ENST00000529038.1_5'UTR|OPCML_ENST00000524381.1_Missense_Mutation_p.D137E|OPCML_ENST00000374778.4_Missense_Mutation_p.D103E	NM_002545.3	NP_002536.1	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion molecule-like	144	Ig-like C2-type 2.				cell adhesion (GO:0007155)|neuron recognition (GO:0008038)|opioid receptor signaling pathway (GO:0038003)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	opioid receptor activity (GO:0004985)	p.D144E(1)		endometrium(5)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|skin(2)|urinary_tract(8)	47	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		TCACAGTGATGTCTGAGGAGA	0.453																																					p.D137E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C411A	11						.						113.0	89.0	97.0					11																	132399049		2201	4297	6498	131904259	SO:0001583	missense	4978	exon4			BX537377	CCDS8492.1, CCDS31722.1	11q25	2013-01-11	2001-11-28		ENSG00000183715	ENSG00000183715		"""Immunoglobulin superfamily / I-set domain containing"""	8143	protein-coding gene	gene with protein product	"""IgLON family member 1"""	600632	"""opioid-binding protein/cell adhesion molecule-like"""			8244387	Standard	XM_005271578		Approved	OPCM, OBCAM, IGLON1	uc001qgs.3	Q14982	OTTHUMG00000163658	ENST00000331898.7:c.432C>A	11.37:g.132399049G>T	ENSP00000330862:p.Asp144Glu	Somatic		Capture	Illumina HiSeq	Phase_I	131904259	NM_001012393	B2CZX2|B7ZLQ1|Q17RN7|Q7Z3W6	Missense_Mutation	SNP	ENST00000331898.7	37	CCDS8492.1	.	.	.	.	.	.	.	.	.	.	G	15.34	2.803172	0.50315	.	.	ENSG00000183715	ENST00000331898;ENST00000524381;ENST00000374778;ENST00000416724;ENST00000541867	T;T;T;T	0.68765	-0.35;-0.35;-0.35;-0.35	5.91	0.173	0.15036	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.64659	0.2618	L	0.58510	1.815	0.45025	D	0.998046	P;P;B;B	0.34562	0.457;0.457;0.248;0.248	B;B;B;B	0.41666	0.257;0.363;0.257;0.257	T	0.63382	-0.6650	10	0.87932	D	0	-28.5485	11.161	0.48516	0.1863:0.0:0.8137:0.0	.	144;137;144;144	B7ZLQ1;Q7Z3W6;B7ZLQ0;Q14982	.;.;.;OPCM_HUMAN	E	144;137;103;111;144	ENSP00000330862:D144E;ENSP00000434750:D137E;ENSP00000363910:D103E;ENSP00000445496:D144E	ENSP00000330862:D144E	D	-	3	2	OPCML	131904259	1.000000	0.71417	0.215000	0.23724	0.880000	0.50808	0.907000	0.28531	-0.228000	0.09869	0.462000	0.41574	GAC		OPCML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374689.3	NM_001012393	
PRKAB1	5564	broad.mit.edu	37	12	120106123	120106124	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr12:120106123_120106124insG	ENST00000229328.5	+	1	566_567	c.74_75insG	c.(73-78)tcggggfs	p.SG25fs	PRKAB1_ENST00000540121.1_5'Flank|PRKAB1_ENST00000541640.1_Frame_Shift_Ins_p.SG25fs	NM_006253.4	NP_006244.2	Q9Y478	AAKB1_HUMAN	protein kinase, AMP-activated, beta 1 non-catalytic subunit	25					cell cycle arrest (GO:0007050)|fatty acid biosynthetic process (GO:0006633)|insulin receptor signaling pathway (GO:0008286)|membrane organization (GO:0061024)|positive regulation of gene expression (GO:0010628)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein kinase activity (GO:0004672)	p.T28fs*39(1)		endometrium(2)|large_intestine(3)|lung(5)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.166)	Acetylsalicylic acid(DB00945)|Adenosine monophosphate(DB00131)|Metformin(DB00331)	AGGGACAGCTCGGGGGGCACCA	0.658																																					p.S25fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.74_75insG	12						.																																			118590507	SO:0001589	frameshift_variant	5564	exon1			BC001823	CCDS9191.1	12q24.1-q24.3	2008-05-14			ENSG00000111725	ENSG00000111725			9378	protein-coding gene	gene with protein product	"""AMPK beta 1"""	602740				8557660	Standard	NM_006253		Approved		uc001txg.3	Q9Y478	OTTHUMG00000168954	ENST00000229328.5:c.80dupG	12.37:g.120106129_120106129dupG	ENSP00000229328:p.Ser25fs	Somatic		Capture	Illumina HiSeq	Phase_I	118590506	NM_006253	Q9UBV0|Q9UE20|Q9UEX2|Q9Y6V8	Frame_Shift_Ins	INS	ENST00000229328.5	37	CCDS9191.1																																																																																				PRKAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401731.2	NM_006253	
TRPV4	59341	broad.mit.edu	37	12	110230484	110230484	+	Silent	SNP	C	C	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr12:110230484C>T	ENST00000418703.2	-	10	1891	c.1797G>A	c.(1795-1797)acG>acA	p.T599T	TRPV4_ENST00000537083.1_Silent_p.T539T|TRPV4_ENST00000536838.1_Silent_p.T565T|TRPV4_ENST00000346520.2_Silent_p.T539T|TRPV4_ENST00000541794.1_Silent_p.T552T|TRPV4_ENST00000544971.1_Silent_p.T492T|TRPV4_ENST00000392719.2_Silent_p.T552T|TRPV4_ENST00000261740.2_Silent_p.T599T	NM_001177431.1	NP_001170902.1	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel, subfamily V, member 4	599					actin cytoskeleton reorganization (GO:0031532)|actin filament organization (GO:0007015)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cell death (GO:0008219)|cell volume homeostasis (GO:0006884)|cell-cell junction assembly (GO:0007043)|cellular calcium ion homeostasis (GO:0006874)|cellular hypotonic response (GO:0071476)|cellular response to heat (GO:0034605)|cellular response to osmotic stress (GO:0071470)|cortical microtubule organization (GO:0043622)|hyperosmotic salinity response (GO:0042538)|ion transmembrane transport (GO:0034220)|microtubule polymerization (GO:0046785)|negative regulation of neuron projection development (GO:0010977)|osmosensory signaling pathway (GO:0007231)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of microtubule depolymerization (GO:0031117)|regulation of response to osmotic stress (GO:0047484)|response to mechanical stimulus (GO:0009612)|transmembrane transport (GO:0055085)|vasopressin secretion (GO:0030103)	adherens junction (GO:0005912)|cell surface (GO:0009986)|cilium (GO:0005929)|cortical actin cytoskeleton (GO:0030864)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|beta-tubulin binding (GO:0048487)|calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)|cation channel activity (GO:0005261)|microtubule binding (GO:0008017)|osmosensor activity (GO:0005034)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)	p.T599T(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(7)|ovary(3)|prostate(2)|skin(4)|stomach(1)	35						TATAGGTCCCCGTCAGCTTCA	0.577																																					p.T599T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1797A	12						.						97.0	78.0	85.0					12																	110230484		2203	4300	6503	108714867	SO:0001819	synonymous_variant	59341	exon11			AF263523	CCDS9134.1, CCDS9135.1, CCDS53827.1, CCDS53828.1, CCDS53829.1	12q24.1	2014-09-17				ENSG00000111199		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18083	protein-coding gene	gene with protein product	"""osmosensitive transient receptor potential channel 4"""	605427				11025659, 11081638, 16382100, 20037587	Standard	NM_147204		Approved	OTRPC4, TRP12, VROAC, VRL-2, VR-OAC, CMT2C	uc001tpk.2	Q9HBA0		ENST00000418703.2:c.1797G>A	12.37:g.110230484C>T		Somatic		Capture	Illumina HiSeq	Phase_I	108714867	NM_021625	B7ZKQ6|Q17R79|Q2Y122|Q2Y123|Q2Y124|Q86YZ6|Q8NDY7|Q8NG64|Q96Q92|Q96RS7|Q9HBC0	Silent	SNP	ENST00000418703.2	37	CCDS9134.1																																																																																				TRPV4-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403270.1	NM_021625	
NOS1	4842	broad.mit.edu	37	12	117768481	117768481	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr12:117768481C>A	ENST00000338101.4	-	1	398	c.394G>T	c.(394-396)Gcc>Tcc	p.A132S	NOS1_ENST00000549189.1_5'Flank|NOS1_ENST00000317775.6_Missense_Mutation_p.A132S|NOS1_ENST00000344089.3_Missense_Mutation_p.A132S			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)	p.A132S(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		AGATCCACGGCTTTGGTGGGG	0.652																																					p.A132S	Esophageal Squamous(162;1748 2599 51982 52956)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G394T	12						.						33.0	36.0	35.0					12																	117768481		1869	4106	5975	116252864	SO:0001583	missense	4842	exon2				CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.394G>T	12.37:g.117768481C>A	ENSP00000337459:p.Ala132Ser	Somatic		Capture	Illumina HiSeq	Phase_I	116252864	NM_000620		Missense_Mutation	SNP	ENST00000338101.4	37	CCDS55890.1	.	.	.	.	.	.	.	.	.	.	C	7.143	0.582249	0.13749	.	.	ENSG00000089250	ENST00000397605;ENST00000317775;ENST00000541241;ENST00000344089;ENST00000338101	T;T;T	0.04917	5.05;3.53;5.06	4.8	3.89	0.44902	PDZ/DHR/GLGF (1);	0.190113	0.48767	D	0.000170	T	0.04137	0.0115	L	0.27053	0.805	0.31617	N	0.650748	B	0.06786	0.001	B	0.09377	0.004	T	0.21449	-1.0245	10	0.10111	T	0.7	-19.5421	8.617	0.33838	0.149:0.7725:0.0:0.0785	.	132	P29475	NOS1_HUMAN	S	132	ENSP00000320758:A132S;ENSP00000339862:A132S;ENSP00000337459:A132S	ENSP00000320758:A132S	A	-	1	0	NOS1	116252864	0.963000	0.33076	0.379000	0.26080	0.216000	0.24613	1.562000	0.36353	2.492000	0.84095	0.555000	0.69702	GCC		NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1		
FAM90A1	55138	broad.mit.edu	37	12	8377372	8377372	+	Silent	SNP	G	G	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr12:8377372G>T	ENST00000538603.1	-	4	615	c.57C>A	c.(55-57)acC>acA	p.T19T	FAM90A1_ENST00000307435.6_Silent_p.T19T	NM_018088.3	NP_060558.3	Q86YD7	F90A1_HUMAN	family with sequence similarity 90, member A1	19							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.T19T(1)		endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	25				Kidney(36;0.0866)		GCTTCTGGAGGGTCTGGGCTC	0.597																																					p.T19T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C57A	12						.						27.0	33.0	31.0					12																	8377372		2203	4295	6498	8268639	SO:0001819	synonymous_variant	55138	exon4			AK001270	CCDS31738.1	12p13.31	2011-08-31		2005-11-20	ENSG00000171847	ENSG00000171847			25526	protein-coding gene	gene with protein product		613041					Standard	NM_018088		Approved	FLJ10408	uc001qui.2	Q86YD7	OTTHUMG00000168641	ENST00000538603.1:c.57C>A	12.37:g.8377372G>T		Somatic		Capture	Illumina HiSeq	Phase_I	8268639	NM_018088	D3DUU9|Q9NVZ6	Silent	SNP	ENST00000538603.1	37	CCDS31738.1																																																																																				FAM90A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400468.1	NM_018088	
SLCO1B3	28234	broad.mit.edu	37	12	21030715	21030715	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr12:21030715A>T	ENST00000381545.3	+	10	1199	c.980A>T	c.(979-981)cAg>cTg	p.Q327L	SLCO1B3_ENST00000553473.1_Missense_Mutation_p.Q327L|SLCO1B3_ENST00000261196.2_Missense_Mutation_p.Q327L|SLCO1B7_ENST00000554957.1_Intron|LST3_ENST00000540229.1_Missense_Mutation_p.Q327L|LST3_ENST00000381541.3_Intron	NM_019844.3	NP_062818.1	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family, member 1B3	327					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)	p.Q327L(1)		breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(23)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(2)	63	Esophageal squamous(101;0.149)				Atorvastatin(DB01076)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Digoxin(DB00390)|Docetaxel(DB01248)|Estradiol(DB00783)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Olmesartan(DB00275)|Ouabain(DB01092)|Paclitaxel(DB01229)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Rosuvastatin(DB01098)|Valsartan(DB00177)	GGTTTTTTCCAGTCTTTGAAA	0.244																																					p.Q327L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A980T	12						.						79.0	77.0	77.0					12																	21030715		2203	4299	6502	20921982	SO:0001583	missense	28234	exon9				CCDS8684.1	12p12	2013-05-22	2003-11-25	2003-11-26		ENSG00000111700		"""Solute carriers"""	10961	protein-coding gene	gene with protein product		605495	"""solute carrier family 21 (organic anion transporter), member 8"""	SLC21A8			Standard	NM_019844		Approved	OATP8, OATP1B3	uc001rel.4	Q9NPD5	OTTHUMG00000169011	ENST00000381545.3:c.980A>T	12.37:g.21030715A>T	ENSP00000370956:p.Gln327Leu	Somatic		Capture	Illumina HiSeq	Phase_I	20921982	NM_019844	E7EMT8|Q5JAR4	Missense_Mutation	SNP	ENST00000381545.3	37	CCDS8684.1	.	.	.	.	.	.	.	.	.	.	.	1.919	-0.448724	0.04572	.	.	ENSG00000111700;ENSG00000111700;ENSG00000111700;ENSG00000111700;ENSG00000257046	ENST00000261196;ENST00000381545;ENST00000553473;ENST00000544370;ENST00000540229	T;T;T;T;T	0.38401	1.14;1.14;1.14;1.14;1.14	3.13	0.574	0.17368	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.718048	0.13182	N	0.407468	T	0.22898	0.0553	N	0.21545	0.675	0.09310	N	1	P;B;B	0.45283	0.855;0.002;0.002	P;B;B	0.44647	0.456;0.038;0.038	T	0.10800	-1.0614	10	0.26408	T	0.33	.	4.4222	0.11486	0.4853:0.3913:0.1235:0.0	.	327;327;327	Q5JAR4;B3KP78;Q9NPD5	.;.;SO1B3_HUMAN	L	327;327;327;151;327	ENSP00000261196:Q327L;ENSP00000370956:Q327L;ENSP00000451758:Q327L;ENSP00000443225:Q151L;ENSP00000441269:Q327L	ENSP00000441269:Q327L	Q	+	2	0	SLCO1B3;RP11-545J16.1	20921982	0.006000	0.16342	0.044000	0.18714	0.262000	0.26303	0.485000	0.22324	-0.070000	0.12908	0.254000	0.18369	CAG		SLCO1B3-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401936.1	NM_019844	
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V|KRAS_ENST00000556131.1_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12V	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0 	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35T	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	12.37:g.25398284C>A	ENSP00000256078:p.Gly12Val	Somatic		Capture	Illumina HiSeq	Phase_I	25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
RASSF8	11228	broad.mit.edu	37	12	26217950	26217950	+	Missense_Mutation	SNP	G	G	A	rs117015558	byFrequency	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr12:26217950G>A	ENST00000405154.2	+	3	822	c.623G>A	c.(622-624)cGt>cAt	p.R208H	RASSF8_ENST00000541490.1_Missense_Mutation_p.R208H|RASSF8_ENST00000542865.1_Missense_Mutation_p.R208H|RASSF8_ENST00000282884.9_Missense_Mutation_p.R208H|RASSF8_ENST00000381352.3_Missense_Mutation_p.R208H	NM_001164748.1	NP_001158220.1	Q8NHQ8	RASF8_HUMAN	Ras association (RalGDS/AF-6) domain family (N-terminal) member 8	208	Glu-rich.				signal transduction (GO:0007165)			p.R208H(1)		cervix(2)|endometrium(1)|large_intestine(6)|lung(15)|urinary_tract(1)	25	Colorectal(261;0.0847)					GAAATTGTCCGTCTAGAGCAA	0.348													G|||	4	0.000798722	0.0	0.0	5008	,	,		19882	0.0		0.004	False		,,,				2504	0.0				p.R208H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G623A	12						.	G	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	55.0	60.0	58.0		623,623,623,623	5.0	1.0	12	dbSNP_132	58	12,8588	7.7+/-29.5	0,12,4288	yes	missense,missense,missense,missense	RASSF8	NM_001164746.1,NM_001164747.1,NM_001164748.1,NM_007211.4	29,29,29,29	0,13,6490	AA,AG,GG		0.1395,0.0227,0.1	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	208/420,208/420,208/420,208/393	26217950	13,12993	2203	4300	6503	26109217	SO:0001583	missense	11228	exon4			U82396	CCDS8705.1, CCDS53765.1	12p12.3	2013-05-30	2008-02-22	2005-09-14	ENSG00000123094	ENSG00000123094			13232	protein-coding gene	gene with protein product		608231	"""chromosome 12 open reading frame 2"""	C12orf2			Standard	NM_007211		Approved	HoJ-1	uc001rgx.3	Q8NHQ8	OTTHUMG00000169087	ENST00000405154.2:c.623G>A	12.37:g.26217950G>A	ENSP00000384491:p.Arg208His	Somatic		Capture	Illumina HiSeq	Phase_I	26109217	NM_007211	A8K1Z0|O95647|Q5SCI2|Q76KB6	Missense_Mutation	SNP	ENST00000405154.2	37	CCDS53765.1	3	0.0013736263736263737	0	0.0	0	0.0	0	0.0	3	0.00395778364116095	G	12.11	1.838956	0.32513	2.27E-4	0.001395	ENSG00000123094	ENST00000381352;ENST00000405154;ENST00000542865;ENST00000541490;ENST00000542004;ENST00000541218;ENST00000282884	D;D;D;D;T;T;D	0.93189	-3.18;-3.18;-3.18;-3.18;0.89;0.74;-3.18	5.0	5.0	0.66597	.	0.450029	0.24052	N	0.041984	D	0.89462	0.6722	L	0.46157	1.445	0.29594	N	0.848221	B;P	0.46578	0.007;0.88	B;B	0.40165	0.004;0.321	D	0.86381	0.1729	10	0.36615	T	0.2	-22.7365	11.1802	0.48623	0.0943:0.0:0.9057:0.0	.	208;208	Q8NHQ8-2;Q8NHQ8	.;RASF8_HUMAN	H	208	ENSP00000370756:R208H;ENSP00000384491:R208H;ENSP00000439839:R208H;ENSP00000443096:R208H;ENSP00000442485:R208H;ENSP00000445970:R208H;ENSP00000282884:R208H	ENSP00000282884:R208H	R	+	2	0	RASSF8	26109217	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	4.042000	0.57347	2.498000	0.84270	0.563000	0.77884	CGT		RASSF8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402209.2	NM_007211	
KRT3	3850	broad.mit.edu	37	12	53185086	53185086	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr12:53185086C>T	ENST00000417996.2	-	7	1513	c.1439G>A	c.(1438-1440)cGg>cAg	p.R480Q	KRT3_ENST00000309505.3_Missense_Mutation_p.R480Q	NM_057088.2	NP_476429.2	P12035	K2C3_HUMAN	keratin 3	480	Coil 2.|Rod.				epithelial cell differentiation (GO:0030855)|intermediate filament cytoskeleton organization (GO:0045104)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.R480Q(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|skin(1)	23						ACGTAGCAGCCGCGCCAGGTC	0.617																																					p.R480Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1439A	12						.						97.0	91.0	93.0					12																	53185086		2203	4300	6503	51471353	SO:0001583	missense	3850	exon7				CCDS44895.1	12q13.13	2013-01-16			ENSG00000186442	ENSG00000186442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6440	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 3"", ""cytokeratin 3"""	148043				7510223, 16831889	Standard	NM_057088		Approved	CK3, K3	uc001say.3	P12035	OTTHUMG00000169799	ENST00000417996.2:c.1439G>A	12.37:g.53185086C>T	ENSP00000413479:p.Arg480Gln	Somatic		Capture	Illumina HiSeq	Phase_I	51471353	NM_057088	A6NIS2|Q701L8	Missense_Mutation	SNP	ENST00000417996.2	37	CCDS44895.1	.	.	.	.	.	.	.	.	.	.	C	19.08	3.757643	0.69648	.	.	ENSG00000186442	ENST00000417996;ENST00000309505	T;T	0.76186	-1.0;-1.0	4.71	4.71	0.59529	Filament (1);	0.000000	0.41396	D	0.000899	D	0.84506	0.5487	M	0.77616	2.38	0.34747	D	0.731374	D	0.71674	0.998	P	0.58820	0.846	D	0.89865	0.4019	10	0.66056	D	0.02	.	18.2151	0.89882	0.0:1.0:0.0:0.0	.	480	P12035	K2C3_HUMAN	Q	480	ENSP00000413479:R480Q;ENSP00000312206:R480Q	ENSP00000312206:R480Q	R	-	2	0	KRT3	51471353	0.023000	0.18921	1.000000	0.80357	0.295000	0.27426	0.826000	0.27407	2.619000	0.88677	0.561000	0.74099	CGG		KRT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405930.1	NM_057088	
ARHGAP9	64333	broad.mit.edu	37	12	57869120	57869120	+	Silent	SNP	C	C	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr12:57869120C>T	ENST00000356411.2	-	12	1701	c.1563G>A	c.(1561-1563)gcG>gcA	p.A521A	ARHGAP9_ENST00000550288.1_Silent_p.A581A|ARHGAP9_ENST00000550454.1_5'Flank|ARHGAP9_ENST00000430041.2_Silent_p.A318A|ARHGAP9_ENST00000393791.3_Silent_p.A502A|ARHGAP9_ENST00000424809.2_Silent_p.A502A|ARHGAP9_ENST00000393797.2_Silent_p.A592A			Q9BRR9	RHG09_HUMAN	Rho GTPase activating protein 9	521	Lipid binding.				positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)	p.A521A(1)		endometrium(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)	30			GBM - Glioblastoma multiforme(3;3.37e-34)			GCGGTCTCTTCGCGATGAGCC	0.642																																					p.A318A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G954A	12						.						38.0	37.0	37.0					12																	57869120		2203	4300	6503	56155387	SO:0001819	synonymous_variant	64333	exon10			AB051853	CCDS8941.2, CCDS44928.1, CCDS44929.1	12q13.3	2013-01-10			ENSG00000123329	ENSG00000123329		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	14130	protein-coding gene	gene with protein product		610576				11396949	Standard	NM_032496		Approved	MGC1295, 10C	uc001soc.3	Q9BRR9	OTTHUMG00000150147	ENST00000356411.2:c.1563G>A	12.37:g.57869120C>T		Somatic		Capture	Illumina HiSeq	Phase_I	56155387	NM_001080156	B4DVI3|E9PDX9|Q8NAF3|Q8TCJ3|Q8WYR0|Q96EZ2|Q96S74	Silent	SNP	ENST00000356411.2	37																																																																																					ARHGAP9-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_032496	
TMEM132D	121256	broad.mit.edu	37	12	129559375	129559375	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr12:129559375C>T	ENST00000422113.2	-	9	2671	c.2345G>A	c.(2344-2346)cGg>cAg	p.R782Q	TMEM132D_ENST00000389441.4_Missense_Mutation_p.R320Q	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	782					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.R782Q(1)		NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		CACACTCTTCCGCTTGGATTT	0.488																																					p.R782Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2345A	12						.						168.0	143.0	152.0					12																	129559375		2203	4300	6503	128125328	SO:0001583	missense	121256	exon9			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.2345G>A	12.37:g.129559375C>T	ENSP00000408581:p.Arg782Gln	Somatic		Capture	Illumina HiSeq	Phase_I	128125328	NM_133448	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	ENST00000422113.2	37	CCDS9266.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.001586	0.74818	.	.	ENSG00000151952	ENST00000389441;ENST00000422113	T;T	0.21543	2.0;2.0	4.2	4.2	0.49525	.	0.000000	0.64402	D	0.000001	T	0.53449	0.1797	M	0.89287	3.02	0.58432	D	0.999999	D;D	0.89917	1.0;0.998	D;P	0.83275	0.996;0.9	T	0.65005	-0.6273	9	.	.	.	-32.3207	16.8845	0.86072	0.0:1.0:0.0:0.0	.	782;320	Q14C87;Q14C87-2	T132D_HUMAN;.	Q	320;782	ENSP00000374092:R320Q;ENSP00000408581:R782Q	.	R	-	2	0	TMEM132D	128125328	1.000000	0.71417	0.916000	0.36221	0.270000	0.26580	7.518000	0.81795	2.033000	0.60031	0.462000	0.41574	CGG		TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448	
MAB21L1	4081	broad.mit.edu	37	13	36050235	36050235	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr13:36050235T>G	ENST00000379919.4	-	1	597	c.41A>C	c.(40-42)aAa>aCa	p.K14T	NBEA_ENST00000537702.1_5'Flank|NBEA_ENST00000540320.1_Intron|NBEA_ENST00000379939.2_Intron|NBEA_ENST00000400445.3_Intron|NBEA_ENST00000310336.4_Intron	NM_005584.4	NP_005575.1	Q13394	MB211_HUMAN	mab-21-like 1 (C. elegans)	14					anatomical structure morphogenesis (GO:0009653)|camera-type eye development (GO:0043010)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)		p.K14T(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	20		Breast(139;0.014)|Lung SC(185;0.051)|Prostate(109;0.202)		all cancers(112;9.63e-08)|Epithelial(112;1.37e-06)|BRCA - Breast invasive adenocarcinoma(63;0.000659)|OV - Ovarian serous cystadenocarcinoma(117;0.00372)|GBM - Glioblastoma multiforme(144;0.115)		GTTGTAGTATTTATTCAGATG	0.502																																					p.K14T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A41C	13						.						73.0	78.0	77.0					13																	36050235		2203	4300	6503	34948235	SO:0001583	missense	4081	exon1			BC028170	CCDS9353.1	13q13.3	2008-02-05	2001-11-28		ENSG00000180660	ENSG00000180660			6757	protein-coding gene	gene with protein product		601280	"""mab-21 (C. elegans)-like 1"""			8733127	Standard	NM_005584		Approved	CAGR1		Q13394	OTTHUMG00000016723	ENST00000379919.4:c.41A>C	13.37:g.36050235T>G	ENSP00000369251:p.Lys14Thr	Somatic		Capture	Illumina HiSeq	Phase_I	34948235	NM_005584	Q6I9T5	Missense_Mutation	SNP	ENST00000379919.4	37	CCDS9353.1	.	.	.	.	.	.	.	.	.	.	T	13.49	2.253272	0.39797	.	.	ENSG00000180660	ENST00000379919	T	0.18960	2.18	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.28167	0.0695	M	0.72118	2.19	0.80722	D	1	B	0.16396	0.017	B	0.18263	0.021	T	0.02713	-1.1120	10	0.40728	T	0.16	.	16.0659	0.80870	0.0:0.0:0.0:1.0	.	14	Q13394	MB211_HUMAN	T	14	ENSP00000369251:K14T	ENSP00000369251:K14T	K	-	2	0	MAB21L1	34948235	1.000000	0.71417	0.999000	0.59377	0.969000	0.65631	8.040000	0.89188	2.209000	0.71365	0.533000	0.62120	AAA		MAB21L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044459.3	NM_005584	
ARL11	115761	broad.mit.edu	37	13	50204799	50204799	+	Silent	SNP	C	C	A			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr13:50204799C>A	ENST00000282026.1	+	2	551	c.216C>A	c.(214-216)gcC>gcA	p.A72A	ARL11_ENST00000490932.1_Intron	NM_138450.5	NP_612459.1	Q969Q4	ARL11_HUMAN	ADP-ribosylation factor-like 11	72					hematopoietic progenitor cell differentiation (GO:0002244)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)	p.A72A(1)		kidney(1)|large_intestine(4)|ovary(1)	6		Lung NSC(96;2.1e-05)|Breast(56;0.00015)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.119)|Kidney(9;0.169)	GBM - Glioblastoma multiforme(99;1.67e-09)		CGCTCAGAGCCAGCTGGAAGG	0.602																																					p.A72A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C216A	13						.						65.0	64.0	65.0					13																	50204799		2203	4300	6503	49102800	SO:0001819	synonymous_variant	115761	exon2			AF441378	CCDS9419.1	13q14.12	2014-05-09			ENSG00000152213	ENSG00000152213		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	24046	protein-coding gene	gene with protein product		609351				12477932	Standard	NM_138450		Approved	ARLTS1, FLJ33930	uc001vdf.2	Q969Q4	OTTHUMG00000016919	ENST00000282026.1:c.216C>A	13.37:g.50204799C>A		Somatic		Capture	Illumina HiSeq	Phase_I	49102800	NM_138450		Silent	SNP	ENST00000282026.1	37	CCDS9419.1																																																																																				ARL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044929.2	NM_138450	
UGGT2	55757	broad.mit.edu	37	13	96543132	96543132	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr13:96543132A>G	ENST00000376747.3	-	25	3012	c.2942T>C	c.(2941-2943)aTg>aCg	p.M981T		NM_020121.3	NP_064506.3	Q9NYU1	UGGG2_HUMAN	UDP-glucose glycoprotein glucosyltransferase 2	981					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-glucosylation (GO:0097359)	endoplasmic reticulum lumen (GO:0005788)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)	p.M981T(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(17)|lung(20)|ovary(3)|pancreas(1)|prostate(4)|urinary_tract(2)	60						CAACTGTGCCATTTTCTGTGC	0.274																																					p.M981T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2942C	13						.						74.0	72.0	73.0					13																	96543132		2203	4295	6498	95341133	SO:0001583	missense	55757	exon25			AF227906	CCDS9480.1	13q32.1	2009-07-23	2009-07-23	2009-07-23	ENSG00000102595	ENSG00000102595			15664	protein-coding gene	gene with protein product	"""UDP-glucose:glycoprotein glucosyltransferase 2"""	605898	"""UDP-glucose ceramide glucosyltransferase-like 2"""	UGCGL2		10694380	Standard	NM_020121		Approved	FLJ11485, HUGT2, FLJ10873, MGC150689, MGC87276, MGC117360	uc001vmt.3	Q9NYU1	OTTHUMG00000017230	ENST00000376747.3:c.2942T>C	13.37:g.96543132A>G	ENSP00000365938:p.Met981Thr	Somatic		Capture	Illumina HiSeq	Phase_I	95341133	NM_020121	A6NKL4|Q08AD0|Q5JQR8|Q8N5K0|Q9UFC4	Missense_Mutation	SNP	ENST00000376747.3	37	CCDS9480.1	.	.	.	.	.	.	.	.	.	.	A	18.70	3.680297	0.68042	.	.	ENSG00000102595	ENST00000376747	T	0.32272	1.46	5.46	5.46	0.80206	.	0.076387	0.85682	D	0.000000	T	0.60274	0.2256	M	0.85373	2.75	0.80722	D	1	D;P	0.76494	0.999;0.943	D;P	0.72075	0.976;0.698	T	0.67185	-0.5734	10	0.72032	D	0.01	-23.551	15.8412	0.78845	1.0:0.0:0.0:0.0	.	981;981	Q9NV86;Q9NYU1	.;UGGG2_HUMAN	T	981	ENSP00000365938:M981T	ENSP00000365938:M981T	M	-	2	0	UGGT2	95341133	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	8.648000	0.91062	2.202000	0.70862	0.533000	0.62120	ATG		UGGT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045507.1	NM_020121	
OR4K5	79317	broad.mit.edu	37	14	20388945	20388945	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr14:20388945C>A	ENST00000315915.4	+	1	205	c.180C>A	c.(178-180)taC>taA	p.Y60*		NM_001005483.1	NP_001005483.1	Q8NGD3	OR4K5_HUMAN	olfactory receptor, family 4, subfamily K, member 5	60						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y60*(1)		central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|liver(1)|lung(27)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CCCCTATGTACTTTCTCTTGG	0.408																																					p.Y60X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C180A	14						.						240.0	255.0	250.0					14																	20388945		2203	4300	6503	19458785	SO:0001587	stop_gained	79317	exon1			BK004355	CCDS32024.1	14q11.22	2012-08-09				ENSG00000176281		"""GPCR / Class A : Olfactory receptors"""	14745	protein-coding gene	gene with protein product						14983052	Standard	NM_001005483		Approved		uc010tkw.2	Q8NGD3		ENST00000315915.4:c.180C>A	14.37:g.20388945C>A	ENSP00000319511:p.Tyr60*	Somatic		Capture	Illumina HiSeq	Phase_I	19458785	NM_001005483	Q6IFA7	Nonsense_Mutation	SNP	ENST00000315915.4	37	CCDS32024.1	.	.	.	.	.	.	.	.	.	.	.	17.05	3.290598	0.59976	.	.	ENSG00000176281	ENST00000315915	.	.	.	4.31	2.41	0.29592	.	0.000000	0.44902	D	0.000418	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.4077	0.32625	0.0:0.795:0.0:0.205	.	.	.	.	X	60	.	ENSP00000319511:Y60X	Y	+	3	2	OR4K5	19458785	0.187000	0.23238	0.997000	0.53966	0.443000	0.32047	-0.511000	0.06321	1.008000	0.39264	0.655000	0.94253	TAC		OR4K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409867.1	NM_001005483	
ESRRB	2103	broad.mit.edu	37	14	76957867	76957867	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr14:76957867G>A	ENST00000509242.1	+	7	963	c.865G>A	c.(865-867)Gtg>Atg	p.V289M	ESRRB_ENST00000380887.2_Missense_Mutation_p.V289M|ESRRB_ENST00000261532.7_Missense_Mutation_p.V289M|ESRRB_ENST00000556177.1_Missense_Mutation_p.V289M	NM_004452.3	NP_004443.3	O95718	ERR2_HUMAN	estrogen-related receptor beta	289					gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|trophectodermal cell proliferation (GO:0001834)|trophectodermal cellular morphogenesis (GO:0001831)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding (GO:0043565)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.V289M(1)		endometrium(2)|large_intestine(4)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	24				BRCA - Breast invasive adenocarcinoma(234;0.0213)		CCTGGGCATCGTGTACCGCTC	0.617																																					p.V289M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G865A	14						.						58.0	43.0	48.0					14																	76957867		2203	4300	6503	76027620	SO:0001583	missense	2103	exon8			X51417	CCDS9850.1, CCDS9850.2	14q24.3	2013-01-16				ENSG00000119715		"""Nuclear hormone receptors"""	3473	protein-coding gene	gene with protein product		602167	"""deafness, autosomal recessive 35"""	ESRL2, DFNB35		3267207, 9344655, 18179891	Standard	NM_004452		Approved	ERR2, ERRbeta, NR3B2, ERRb	uc001xsr.3	O95718		ENST00000509242.1:c.865G>A	14.37:g.76957867G>A	ENSP00000422488:p.Val289Met	Somatic		Capture	Illumina HiSeq	Phase_I	76027620	NM_004452	A2VDJ2|B6ZGU4|Q5F0P7|Q5F0P8|Q9HCB4	Missense_Mutation	SNP	ENST00000509242.1	37	CCDS9850.2	.	.	.	.	.	.	.	.	.	.	G	33	5.214672	0.95104	.	.	ENSG00000119715	ENST00000512784;ENST00000509242;ENST00000556177;ENST00000380887;ENST00000261532	D;D;D;D;D	0.96745	-4.11;-4.11;-4.11;-4.11;-4.11	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.97222	0.9092	L	0.41236	1.265	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.71870	0.959;0.975	D	0.97427	1.0013	10	0.87932	D	0	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	289;294	Q5F0P7;E7EWD9	.;.	M	294;289;289;289;289	ENSP00000424992:V294M;ENSP00000422488:V289M;ENSP00000451658:V289M;ENSP00000370270:V289M;ENSP00000261532:V289M	ENSP00000261532:V289M	V	+	1	0	ESRRB	76027620	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.941000	0.99782	0.655000	0.94253	GTG		ESRRB-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000360663.1		
DICER1	23405	broad.mit.edu	37	14	95556927	95556927	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr14:95556927C>A	ENST00000526495.1	-	29	5968	c.5677G>T	c.(5677-5679)Gtt>Ttt	p.V1893F	DICER1_ENST00000343455.3_Missense_Mutation_p.V1893F|DICER1_ENST00000541352.1_3'UTR|DICER1_ENST00000393063.1_Missense_Mutation_p.V1893F|DICER1_ENST00000527416.2_5'UTR|DICER1_ENST00000527414.1_Missense_Mutation_p.V1893F|DICER1_ENST00000556045.1_Missense_Mutation_p.V791F			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III	1893	DRBM. {ECO:0000255|PROSITE- ProRule:PRU00266}.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)	p.V1893F(1)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		CTTCGACCAACACCTTTAAAT	0.468			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome																												p.V1893F		yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	23405	"""dicer 1, ribonuclease type III """		"""E, M, O"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5677T	14						.						223.0	223.0	223.0					14																	95556927		2203	4300	6503	94626680	SO:0001583	missense	23405	exon27	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.5677G>T	14.37:g.95556927C>A	ENSP00000437256:p.Val1893Phe	Somatic		Capture	Illumina HiSeq	Phase_I	94626680	NM_177438	A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Missense_Mutation	SNP	ENST00000526495.1	37	CCDS9931.1	.	.	.	.	.	.	.	.	.	.	C	31	5.065663	0.93898	.	.	ENSG00000100697	ENST00000343455;ENST00000526495;ENST00000393063;ENST00000527414;ENST00000556045	T;T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05;-0.05	6.07	6.07	0.98685	Double-stranded RNA-binding (2);Double-stranded RNA-binding-like (1);	0.000000	0.85682	D	0.000000	T	0.73063	0.3539	L	0.42245	1.32	0.80722	D	1	D;D	0.65815	0.995;0.992	D;D	0.68353	0.935;0.957	T	0.64253	-0.6451	10	0.20519	T	0.43	-29.1107	20.6593	0.99626	0.0:1.0:0.0:0.0	.	791;1893	B3KRG4;Q9UPY3	.;DICER_HUMAN	F	1893;1893;1893;1893;791	ENSP00000343745:V1893F;ENSP00000437256:V1893F;ENSP00000376783:V1893F;ENSP00000435681:V1893F;ENSP00000451041:V791F	ENSP00000343745:V1893F	V	-	1	0	DICER1	94626680	1.000000	0.71417	0.231000	0.23993	0.920000	0.55202	7.308000	0.78929	2.885000	0.99019	0.655000	0.94253	GTT		DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387997.1		
PML	5371	broad.mit.edu	37	15	74315196	74315196	+	Silent	SNP	G	G	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr15:74315196G>T	ENST00000268058.3	+	3	726	c.630G>T	c.(628-630)ccG>ccT	p.P210P	PML_ENST00000565898.1_Silent_p.P210P|PML_ENST00000567543.1_Silent_p.P210P|PML_ENST00000569965.1_Silent_p.P210P|PML_ENST00000395132.2_Silent_p.P210P|PML_ENST00000354026.6_Silent_p.P210P|PML_ENST00000563500.1_Silent_p.P210P|PML_ENST00000359928.4_Silent_p.P210P|PML_ENST00000564428.1_Silent_p.P210P|PML_ENST00000436891.3_Silent_p.P210P|PML_ENST00000569477.1_Silent_p.P210P|PML_ENST00000435786.2_Silent_p.P210P|PML_ENST00000395135.3_Silent_p.P210P|PML_ENST00000268059.6_Silent_p.P210P	NM_033238.2	NP_150241.2	P29590	PML_HUMAN	promyelocytic leukemia	210					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to interleukin-4 (GO:0071353)|cellular senescence (GO:0090398)|circadian regulation of gene expression (GO:0032922)|common-partner SMAD protein phosphorylation (GO:0007182)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|entrainment of circadian clock by photoperiod (GO:0043153)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|maintenance of protein location in nucleus (GO:0051457)|myeloid cell differentiation (GO:0030099)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation in response to oxidative stress (GO:0032938)|negative regulation of viral release from host cell (GO:1902187)|PML body organization (GO:0030578)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of histone deacetylation (GO:0031065)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)|regulation of calcium ion transport into cytosol (GO:0010522)|regulation of circadian rhythm (GO:0042752)|regulation of double-strand break repair (GO:2000779)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of protein phosphorylation (GO:0001932)|regulation of transcription, DNA-templated (GO:0006355)|response to cytokine (GO:0034097)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|retinoic acid receptor signaling pathway (GO:0048384)|SMAD protein import into nucleus (GO:0007184)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extrinsic component of endoplasmic reticulum membrane (GO:0042406)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	cobalt ion binding (GO:0050897)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|SUMO binding (GO:0032183)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.P210P(3)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	31						GTTCCAAGCCGCTGTGCTGCT	0.542			T	"""RARA, PAX5"""	"""APL, ALL"""																																p.P210P			Dom	yes		15	15q22	5371	promyelocytic leukemia		L	.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.G630T	15						.						39.0	39.0	39.0					15																	74315196		2198	4297	6495	72102249	SO:0001819	synonymous_variant	5371	exon3			AB208950	CCDS10255.1, CCDS10256.1, CCDS10257.1, CCDS10258.1, CCDS45297.1, CCDS45298.1, CCDS45299.1, CCDS45300.1, CCDS58386.1	15q24.1	2011-04-21			ENSG00000140464	ENSG00000140464		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9113	protein-coding gene	gene with protein product		102578					Standard	NM_033244		Approved	MYL, TRIM19, RNF71	uc002awv.3	P29590	OTTHUMG00000137607	ENST00000268058.3:c.630G>T	15.37:g.74315196G>T		Somatic		Capture	Illumina HiSeq	Phase_I	72102249	NM_033238	E9PBR7|P29591|P29592|P29593|Q00755|Q15959|Q59FP9|Q8WUA0|Q96S41|Q9BPW2|Q9BWP7|Q9BZX6|Q9BZX7|Q9BZX8|Q9BZX9|Q9BZY0|Q9BZY2|Q9BZY3	Silent	SNP	ENST00000268058.3	37	CCDS10255.1																																																																																				PML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269021.3	NM_002675	
SLCO3A1	28232	broad.mit.edu	37	15	92669371	92669371	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr15:92669371G>C	ENST00000318445.6	+	6	1469	c.1255G>C	c.(1255-1257)Ggg>Cgg	p.G419R	SLCO3A1_ENST00000555549.1_3'UTR|SLCO3A1_ENST00000424469.2_Missense_Mutation_p.G419R	NM_013272.3	NP_037404.2	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family, member 3A1	419					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.G419R(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	25	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)		Alprostadil(DB00770)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Iloprost(DB01088)|Methotrexate(DB00563)	GTCTGCCCTGGGGGCCATTCG	0.587																																					p.G419R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1255C	15						.						171.0	141.0	151.0					15																	92669371		2198	4298	6496	90470375	SO:0001583	missense	28232	exon6			AB031050	CCDS10371.1, CCDS45354.1	15q26	2013-05-22	2003-11-25	2003-11-26	ENSG00000176463	ENSG00000176463		"""Solute carriers"""	10952	protein-coding gene	gene with protein product		612435	"""solute carrier family 21 (organic anion transporter), member 11"""	SLC21A11			Standard	NM_001145044		Approved	OATP-D, OATP3A1	uc002bqx.2	Q9UIG8	OTTHUMG00000149846	ENST00000318445.6:c.1255G>C	15.37:g.92669371G>C	ENSP00000320634:p.Gly419Arg	Somatic		Capture	Illumina HiSeq	Phase_I	90470375	NM_013272	A8K4A7|B3KPY5|B3KUR7|C6G486|Q9BW73|Q9GZV2	Missense_Mutation	SNP	ENST00000318445.6	37	CCDS10371.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.685321	0.88639	.	.	ENSG00000176463	ENST00000318445;ENST00000424469;ENST00000555549	D;D	0.86769	-2.17;-2.17	5.48	5.48	0.80851	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	D	0.88276	0.6393	L	0.55213	1.73	0.80722	D	1	P;P;B	0.47034	0.796;0.889;0.025	B;P;B	0.47075	0.28;0.536;0.082	D	0.87974	0.2738	10	0.45353	T	0.12	.	19.3564	0.94416	0.0:0.0:1.0:0.0	.	361;419;419	Q9UIG8-3;Q9UIG8-2;Q9UIG8	.;.;SO3A1_HUMAN	R	419;419;138	ENSP00000320634:G419R;ENSP00000387846:G419R	ENSP00000320634:G419R	G	+	1	0	SLCO3A1	90470375	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.152000	0.94680	2.572000	0.86782	0.561000	0.74099	GGG		SLCO3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313529.1	NM_013272	
CIITA	4261	broad.mit.edu	37	16	10997703	10997703	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr16:10997703C>A	ENST00000324288.8	+	9	1021	c.888C>A	c.(886-888)gaC>gaA	p.D296E	CIITA_ENST00000537380.1_3'UTR|CIITA_ENST00000381835.5_Missense_Mutation_p.D247E	NM_000246.3	NP_000237	P33076	C2TA_HUMAN	class II, major histocompatibility complex, transactivator	296					aging (GO:0007568)|cellular response to electrical stimulus (GO:0071257)|cellular response to exogenous dsRNA (GO:0071360)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to antibiotic (GO:0046677)|response to interferon-gamma (GO:0034341)|transcription, DNA-templated (GO:0006351)	cell surface (GO:0009986)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|kinase activity (GO:0016301)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transferase activity, transferring acyl groups (GO:0016746)	p.D296E(1)		central_nervous_system(1)|large_intestine(7)|ovary(1)|skin(1)|stomach(2)	12						CAGCCACTGACCTGCCCAGCA	0.617			T	"""FLJ27352, CD274, CD273, RALGDS, RUNDC2A, C16orf75, BCL6"""	"""PMBL, Hodgkin Lymphona, """																																p.D296E			Dom	yes		16	16p13	4261	"""class II, major histocompatibility complex, transactivator"""		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C888A	16						.						111.0	100.0	103.0					16																	10997703		2197	4300	6497	10905204	SO:0001583	missense	4261	exon9			U18259	CCDS10544.1, CCDS66943.1, CCDS73826.1	16p13	2014-09-17	2005-08-12	2005-08-12	ENSG00000179583	ENSG00000179583		"""Nucleotide-binding domain and leucine rich repeat containing"""	7067	protein-coding gene	gene with protein product	"""NLR family, acid domain containing"", ""nucleotide-binding oligomerization domain, leucine rich repeat and acid domain containing"""	600005	"""MHC class II transactivator"""	MHC2TA		8402893	Standard	NM_000246		Approved	C2TA, NLRA	uc002dai.4	P33076	OTTHUMG00000129753	ENST00000324288.8:c.888C>A	16.37:g.10997703C>A	ENSP00000316328:p.Asp296Glu	Somatic		Capture	Illumina HiSeq	Phase_I	10905204	NM_000246	A0N0N9|D3DUG0|E9PFE0|Q29675|Q8SNB8|Q96KL4	Missense_Mutation	SNP	ENST00000324288.8	37	CCDS10544.1	.	.	.	.	.	.	.	.	.	.	C	14.48	2.548852	0.45383	.	.	ENSG00000179583	ENST00000324288;ENST00000381835;ENST00000388910;ENST00000537380	T;T	0.73897	-0.79;0.93	5.47	1.91	0.25777	.	0.000000	0.64402	D	0.000020	T	0.65015	0.2651	M	0.74258	2.255	0.23421	N	0.997712	P;B;B;B;B;B	0.42556	0.783;0.023;0.182;0.182;0.278;0.146	B;B;B;B;B;B	0.39562	0.303;0.013;0.059;0.113;0.226;0.059	T	0.55792	-0.8085	10	0.07644	T	0.81	.	6.2427	0.20800	0.0:0.6506:0.1576:0.1918	.	296;247;296;296;248;296	F5H2J4;E9PFE0;A0N0N9;P33076;F2Z2G8;Q96KL4	.;.;.;C2TA_HUMAN;.;.	E	296;247;248;296	ENSP00000316328:D296E;ENSP00000371257:D247E	ENSP00000316328:D296E	D	+	3	2	CIITA	10905204	0.993000	0.37304	0.988000	0.46212	0.794000	0.44872	1.101000	0.31037	0.658000	0.30925	-0.150000	0.13652	GAC		CIITA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251966.2	NM_000246	
ACSM5	54988	broad.mit.edu	37	16	20441043	20441043	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr16:20441043G>T	ENST00000331849.4	+	8	1192	c.1045G>T	c.(1045-1047)Gcc>Tcc	p.A349S		NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	349					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)	p.A349S(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						CGGAGGAGAGGCCCTCAACCC	0.567																																					p.A349S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1045T	16						.						94.0	96.0	96.0					16																	20441043		2203	4300	6503	20348544	SO:0001583	missense	54988	exon8				CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.1045G>T	16.37:g.20441043G>T	ENSP00000327916:p.Ala349Ser	Somatic		Capture	Illumina HiSeq	Phase_I	20348544	NM_017888	Q96AV1|Q96CX8|Q9NWV3	Missense_Mutation	SNP	ENST00000331849.4	37	CCDS10585.1	.	.	.	.	.	.	.	.	.	.	G	6.266	0.417160	0.11870	.	.	ENSG00000183549	ENST00000331849	T	0.54071	0.59	4.44	-0.237	0.13061	AMP-dependent synthetase/ligase (1);	0.390122	0.21561	N	0.072577	T	0.31104	0.0786	L	0.31752	0.955	0.25274	N	0.989493	B	0.14805	0.011	B	0.15870	0.014	T	0.08229	-1.0732	10	0.37606	T	0.19	-18.9713	2.3421	0.04263	0.1776:0.2538:0.4323:0.1362	.	349	Q6NUN0	ACSM5_HUMAN	S	349	ENSP00000327916:A349S	ENSP00000327916:A349S	A	+	1	0	ACSM5	20348544	0.029000	0.19370	0.992000	0.48379	0.498000	0.33706	0.270000	0.18607	0.380000	0.24823	-0.252000	0.11476	GCC		ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254413.1	NM_017888	
PLEKHG4	25894	broad.mit.edu	37	16	67319277	67319277	+	Silent	SNP	C	C	T	rs151308785		TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr16:67319277C>T	ENST00000360461.5	+	13	4815	c.2280C>T	c.(2278-2280)ccC>ccT	p.P760P	PLEKHG4_ENST00000379344.3_Silent_p.P760P|PLEKHG4_ENST00000427155.2_Silent_p.P760P|PLEKHG4_ENST00000450733.1_Silent_p.P679P	NM_001129727.1|NM_015432.3	NP_001123199.1|NP_056247.1	Q58EX7	PKHG4_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4	760	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.P760P(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)|Kidney(780;0.119)		ACTATTTCCCCGAGCTGGATC	0.617																																					p.P760P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2280T	16						.	C	,,,,	0,4396		0,0,2198	98.0	102.0	100.0		2280,2280,2280,2037,2280	-4.1	1.0	16	dbSNP_134	100	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEKHG4	NM_001129727.1,NM_001129728.1,NM_001129729.1,NM_001129731.1,NM_015432.3	,,,,	0,1,6497	TT,TC,CC		0.0116,0.0,0.0077	,,,,	760/1192,760/1192,760/1192,679/1111,760/1192	67319277	1,12995	2198	4300	6498	65876778	SO:0001819	synonymous_variant	25894	exon15			AK024475	CCDS32466.1, CCDS45512.1	16q22.1	2013-01-11						"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	24501	protein-coding gene	gene with protein product	"""puratrophin-1"""	609526	"""spinocerebellar ataxia 4"""	SCA4		16491300, 16001362	Standard	NM_015432		Approved	DKFZP434I216, ARHGEF44	uc010cef.3	Q58EX7		ENST00000360461.5:c.2280C>T	16.37:g.67319277C>T		Somatic		Capture	Illumina HiSeq	Phase_I	65876778	NM_001129727	Q4G0J8|Q4H485|Q56A69|Q9H7K4|Q9UFW0	Silent	SNP	ENST00000360461.5	37	CCDS32466.1																																																																																				PLEKHG4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421395.2	NM_015432	
SPPL2C	162540	broad.mit.edu	37	17	43923210	43923210	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr17:43923210C>T	ENST00000329196.5	+	1	955	c.938C>T	c.(937-939)cCg>cTg	p.P313L	MAPT-AS1_ENST00000579599.1_RNA|MAPT-AS1_ENST00000579244.1_RNA|MAPT-AS1_ENST00000581125.1_RNA	NM_175882.2	NP_787078.2	Q8IUH8	SPP2C_HUMAN	signal peptide peptidase like 2C	313						endoplasmic reticulum membrane (GO:0005789)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)	aspartic-type endopeptidase activity (GO:0004190)|protein homodimerization activity (GO:0042803)	p.P313L(1)									CAGAGGCCTCCGCACAGCCTC	0.647																																					p.P313L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C938T	17						.						49.0	53.0	52.0					17																	43923210		2203	4300	6503	41278990	SO:0001583	missense	162540	exon1				CCDS32673.1	17q21.31	2014-02-12			ENSG00000185294	ENSG00000185294			28902	protein-coding gene	gene with protein product	"""intramembrane protease 5"""	608284				12139484	Standard	NM_175882		Approved	IMP5	uc010wka.2	Q8IUH8		ENST00000329196.5:c.938C>T	17.37:g.43923210C>T	ENSP00000332488:p.Pro313Leu	Somatic		Capture	Illumina HiSeq	Phase_I	41278990	NM_175882	Q8TC67|Q8WVZ6	Missense_Mutation	SNP	ENST00000329196.5	37	CCDS32673.1	.	.	.	.	.	.	.	.	.	.	C	0.375	-0.931970	0.02359	.	.	ENSG00000185294	ENST00000329196	T	0.14144	2.53	5.18	0.443	0.16587	.	0.789398	0.10252	N	0.697041	T	0.02807	0.0084	N	0.00219	-1.825	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.45145	-0.9281	10	0.23302	T	0.38	.	7.5861	0.27993	0.0:0.3745:0.0:0.6255	.	313	Q8IUH8	IMP5_HUMAN	L	313	ENSP00000332488:P313L	ENSP00000332488:P313L	P	+	2	0	AC217771.1	41278990	0.095000	0.21747	0.000000	0.03702	0.000000	0.00434	1.329000	0.33770	-0.117000	0.11872	-0.768000	0.03414	CCG		SPPL2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441156.1	NM_175882	
TP53	7157	broad.mit.edu	37	17	7577121	7577121	+	Missense_Mutation	SNP	G	G	A	rs121913343		TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr17:7577121G>A	ENST00000269305.4	-	8	1006	c.817C>T	c.(817-819)Cgt>Tgt	p.R273C	TP53_ENST00000445888.2_Missense_Mutation_p.R273C|TP53_ENST00000359597.4_Missense_Mutation_p.R273C|TP53_ENST00000420246.2_Missense_Mutation_p.R273C|TP53_ENST00000455263.2_Missense_Mutation_p.R273C|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273C(481)|p.R273S(16)|p.R273G(9)|p.0?(8)|p.?(2)|p.R273fs*72(2)|p.R273fs*33(2)|p.R273fs*32(2)|p.V272>?(2)|p.F270fs*72(1)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCACAAACACGCACCTCAAAG	0.542	R273C(8MGBA_CENTRAL_NERVOUS_SYSTEM)|R273C(BL70_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(EFO27_OVARY)|R273C(KARPAS299_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(MFE319_ENDOMETRIUM)|R273C(NCIH1048_LUNG)|R273C(PANC0213_PANCREAS)|R273C(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(RDES_BONE)|R273C(RH30_SOFT_TISSUE)|R273C(RPMI8402_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SH10TC_STOMACH)|R273C(SJRH30_SOFT_TISSUE)|R273C(SUDHL4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SW1710_URINARY_TRACT)|R273C(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273C(TT2609C02_THYROID)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R273C	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,central_nervous_system,brain,Substitution - Missense,0 	.	533	Substitution - Missense(506)|Whole gene deletion(8)|Deletion - Frameshift(8)|Deletion - In frame(5)|Insertion - Frameshift(2)|Unknown(2)|Complex(2)	central_nervous_system(117)|large_intestine(108)|ovary(32)|haematopoietic_and_lymphoid_tissue(31)|upper_aerodigestive_tract(30)|stomach(25)|urinary_tract(23)|lung(21)|breast(21)|liver(20)|endometrium(17)|oesophagus(17)|bone(16)|pancreas(15)|prostate(8)|skin(7)|cervix(6)|biliary_tract(6)|kidney(3)|thyroid(3)|vulva(2)|genital_tract(1)|penis(1)|adrenal_gland(1)|salivary_gland(1)|small_intestine(1)	c.C817T	17	GRCh37	CM010471|CM010473|CM951233	TP53	M	rs121913343	.						65.0	56.0	59.0					17																	7577121		2203	4300	6503	7517846	SO:0001583	missense	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.817C>T	17.37:g.7577121G>A	ENSP00000269305:p.Arg273Cys	Somatic		Capture	Illumina HiSeq	Phase_I	7517846	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	17.48	3.400216	0.62177	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.92	3.95	0.45737	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99851	0.9931	M	0.90759	3.145	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.998;0.999;0.996	D	0.96877	0.9643	10	0.87932	D	0	-11.9995	11.2235	0.48869	0.0895:0.0:0.9105:0.0	.	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	C	273;273;273;273;273;262;141	ENSP00000352610:R273C;ENSP00000269305:R273C;ENSP00000398846:R273C;ENSP00000391127:R273C;ENSP00000391478:R273C;ENSP00000425104:R141C	ENSP00000269305:R273C	R	-	1	0	TP53	7517846	1.000000	0.71417	0.066000	0.19879	0.723000	0.41478	4.540000	0.60664	1.299000	0.44798	0.462000	0.41574	CGT		TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
EVPLL	645027	broad.mit.edu	37	17	18286637	18286637	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr17:18286637delA	ENST00000399134.4	+	8	1083	c.725delA	c.(724-726)gagfs	p.E243fs	RP1-37N7.1_ENST00000579352.1_RNA	NM_001145127.1	NP_001138599.1	A8MZ36	EVPLL_HUMAN	envoplakin-like	243								p.E242fs*25(1)		NS(1)|endometrium(1)|large_intestine(1)|lung(2)	5						AACCAGCTGGAGGAGGACGGC	0.701																																					p.E242fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.725delA	17						.						29.0	36.0	34.0					17																	18286637		692	1591	2283	18227362	SO:0001589	frameshift_variant	645027	exon8				CCDS45626.1	17p11.2	2009-08-25			ENSG00000214860	ENSG00000214860			35236	protein-coding gene	gene with protein product							Standard	NM_001145127		Approved		uc002gte.3	A8MZ36	OTTHUMG00000059095	ENST00000399134.4:c.725delA	17.37:g.18286637delA	ENSP00000382086:p.Glu243fs	Somatic		Capture	Illumina HiSeq	Phase_I	18227362	NM_001145127	B4DPD4	Frame_Shift_Del	DEL	ENST00000399134.4	37	CCDS45626.1																																																																																				EVPLL-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000130836.2	NM_001145127	
SSTR2	6752	broad.mit.edu	37	17	71165785	71165785	+	Silent	SNP	C	C	G			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr17:71165785C>G	ENST00000357585.2	+	2	696	c.327C>G	c.(325-327)ccC>ccG	p.P109P	RP11-143K11.5_ENST00000580671.1_RNA|SSTR2_ENST00000315332.2_Silent_p.P109P	NM_001050.2	NP_001041.1	P30874	SSR2_HUMAN	somatostatin receptor 2	109					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cellular response to glucocorticoid stimulus (GO:0071385)|cerebellum development (GO:0021549)|digestion (GO:0007586)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cell proliferation (GO:0008285)|peristalsis (GO:0030432)|regulation of muscle contraction (GO:0006937)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|somatostatin receptor activity (GO:0004994)	p.P109P(1)		endometrium(2)|large_intestine(5)|lung(2)|prostate(2)	11			LUSC - Lung squamous cell carcinoma(166;0.197)		Octreotide(DB00104)|Pasireotide(DB06663)|Vapreotide(DB04894)	TCCACTGGCCCTTTGGCAAGG	0.542																																					p.P109P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C327G	17						.						119.0	105.0	110.0					17																	71165785		2203	4300	6503	68677380	SO:0001819	synonymous_variant	6752	exon2				CCDS11691.1	17q24	2012-08-08				ENSG00000180616		"""GPCR / Class A : Somatostatin receptors"""	11331	protein-coding gene	gene with protein product		182452				8449518	Standard	NM_001050		Approved		uc002jje.3	P30874		ENST00000357585.2:c.327C>G	17.37:g.71165785C>G		Somatic		Capture	Illumina HiSeq	Phase_I	68677380	NM_001050	A8K3Y0|B2R9P7|Q4VBP0|Q96GE0|Q96TF2|Q9BWH1	Silent	SNP	ENST00000357585.2	37	CCDS11691.1																																																																																				SSTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441633.1		
SETBP1	26040	broad.mit.edu	37	18	42530999	42530999	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr18:42530999C>A	ENST00000282030.5	+	4	1990	c.1694C>A	c.(1693-1695)aCc>aAc	p.T565N		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	565						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.T511N(1)		NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		TATCCCATCACCCCATCCAGC	0.522									Schinzel-Giedion syndrome																												p.T565N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1694A	18						.						144.0	143.0	143.0					18																	42530999		2203	4300	6503	40784997	SO:0001583	missense	26040	exon4	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.1694C>A	18.37:g.42530999C>A	ENSP00000282030:p.Thr565Asn	Somatic		Capture	Illumina HiSeq	Phase_I	40784997	NM_015559	A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	ENST00000282030.5	37	CCDS11923.2	.	.	.	.	.	.	.	.	.	.	C	18.48	3.632737	0.67015	.	.	ENSG00000152217	ENST00000282030	T	0.72835	-0.69	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.79488	0.4454	L	0.34521	1.04	0.58432	D	0.999994	D	0.89917	1.0	D	0.81914	0.995	T	0.79075	-0.1952	10	0.59425	D	0.04	.	20.6634	0.99662	0.0:1.0:0.0:0.0	.	565	Q9Y6X0	SETBP_HUMAN	N	565	ENSP00000282030:T565N	ENSP00000282030:T565N	T	+	2	0	SETBP1	40784997	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.792000	0.85828	2.894000	0.99253	0.655000	0.94253	ACC		SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4	NM_001130110	
ALPK2	115701	broad.mit.edu	37	18	56182291	56182291	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr18:56182291G>A	ENST00000361673.3	-	10	6176	c.5963C>T	c.(5962-5964)gCc>gTc	p.A1988V		NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	1988	Alpha-type protein kinase. {ECO:0000255|PROSITE-ProRule:PRU00501}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.A1349V(1)|p.A1988V(1)		NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						ATAATACCTGGCAGTATTTTG	0.448																																					p.A1988V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C5963T	18						.						120.0	98.0	105.0					18																	56182291		2203	4300	6503	54333271	SO:0001583	missense	115701	exon10			AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.5963C>T	18.37:g.56182291G>A	ENSP00000354991:p.Ala1988Val	Somatic		Capture	Illumina HiSeq	Phase_I	54333271	NM_052947	Q6ZUX0|Q8NAT5|Q96L95	Missense_Mutation	SNP	ENST00000361673.3	37	CCDS11966.2	.	.	.	.	.	.	.	.	.	.	G	32	5.171771	0.94807	.	.	ENSG00000198796	ENST00000361673	T	0.15139	2.45	6.02	6.02	0.97574	MHCK/EF2 kinase (3);Protein kinase-like domain (1);	0.146908	0.46145	D	0.000315	T	0.45236	0.1332	M	0.71581	2.175	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	T	0.22977	-1.0201	10	0.87932	D	0	-17.9023	20.1358	0.98028	0.0:0.0:1.0:0.0	.	1988	Q86TB3	ALPK2_HUMAN	V	1988	ENSP00000354991:A1988V	ENSP00000354991:A1988V	A	-	2	0	ALPK2	54333271	1.000000	0.71417	1.000000	0.80357	0.800000	0.45204	9.047000	0.93823	2.865000	0.98341	0.655000	0.94253	GCC		ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947	
MRPL4	51073	broad.mit.edu	37	19	10369175	10369175	+	Silent	SNP	G	G	C			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr19:10369175G>C	ENST00000253099.6	+	7	926	c.639G>C	c.(637-639)ggG>ggC	p.G213G	MRPL4_ENST00000307422.5_Silent_p.G213G|MRPL4_ENST00000588502.1_Silent_p.G212G|MRPL4_ENST00000393733.2_Silent_p.G213G|CTD-2369P2.5_ENST00000592893.1_RNA|MRPL4_ENST00000590669.1_Silent_p.G213G|CTD-2369P2.4_ENST00000587088.1_RNA	NM_015956.2|NM_146388.1	NP_057040.2|NP_666500.1	Q9BYD3	RM04_HUMAN	mitochondrial ribosomal protein L4	213					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.G213G(1)		breast(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	11		Renal(1328;0.0112)	OV - Ovarian serous cystadenocarcinoma(20;1.39e-09)|Epithelial(33;1.99e-06)|all cancers(31;4.81e-06)	Lung(535;0.00705)		GCCGCTGGGGGGACTCCGTAC	0.647																																					p.G213G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G639C	19						.						64.0	70.0	68.0					19																	10369175		2203	4300	6503	10230175	SO:0001819	synonymous_variant	51073	exon7			AB049635	CCDS12230.1, CCDS42499.1	19p13.2	2012-11-14			ENSG00000105364	ENSG00000105364		"""Mitochondrial ribosomal proteins / large subunits"""	14276	protein-coding gene	gene with protein product		611823					Standard	NM_015956		Approved	CGI-28	uc002mnn.3	Q9BYD3	OTTHUMG00000180400	ENST00000253099.6:c.639G>C	19.37:g.10369175G>C		Somatic		Capture	Illumina HiSeq	Phase_I	10230175	NM_146388	A6NNV7|Q9BW07|Q9H4N2|Q9Y317	Silent	SNP	ENST00000253099.6	37	CCDS12230.1																																																																																				MRPL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451197.1		
ZNF763	284390	broad.mit.edu	37	19	12087920	12087920	+	Missense_Mutation	SNP	C	C	T	rs201480354		TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr19:12087920C>T	ENST00000358987.3	+	2	198	c.71C>T	c.(70-72)tCg>tTg	p.S24L	ZNF763_ENST00000591944.1_Missense_Mutation_p.S93L|ZNF763_ENST00000538752.1_Missense_Mutation_p.S44L|ZNF763_ENST00000545530.1_Intron|ZNF763_ENST00000590798.1_Missense_Mutation_p.S44L|ZNF763_ENST00000592625.1_Missense_Mutation_p.S24L|ZNF763_ENST00000343949.5_Missense_Mutation_p.S27L			Q0D2J5	ZN763_HUMAN	zinc finger protein 763	24	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S26L(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)	15						CTGGATATTTCGCAGAGGAAA	0.493																																					p.S27L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C80T	19						.	C	LEU/SER	0,4406		0,0,2203	149.0	151.0	150.0		80	-1.7	0.0	19		150	2,8598	2.2+/-6.3	0,2,4298	no	missense	ZNF763	NM_001012753.1	145	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		27/398	12087920	2,13004	2203	4300	6503	11948920	SO:0001583	missense	284390	exon2			AK092240	CCDS45982.1	19p13.2	2014-02-12	2006-08-14		ENSG00000197054	ENSG00000197054		"""Zinc fingers, C2H2-type"", ""-"""	27614	protein-coding gene	gene with protein product							Standard	NM_001012753		Approved	ZNF440L		Q0D2J5	OTTHUMG00000156430	ENST00000358987.3:c.71C>T	19.37:g.12087920C>T	ENSP00000402017:p.Ser24Leu	Somatic		Capture	Illumina HiSeq	Phase_I	11948920	NM_001012753	B3KRU3|B4DRE7	Missense_Mutation	SNP	ENST00000358987.3	37		.	.	.	.	.	.	.	.	.	.	c	9.730	1.162007	0.21538	0.0	2.33E-4	ENSG00000197054	ENST00000538752;ENST00000343949;ENST00000358987	T;T;T	0.01838	4.61;4.61;4.61	0.864	-1.73	0.08081	Krueppel-associated box (4);	.	.	.	.	T	0.04815	0.0130	M	0.90082	3.085	0.09310	N	1	P;P;B	0.38767	0.593;0.646;0.331	B;B;B	0.35655	0.131;0.207;0.019	T	0.03221	-1.1059	9	0.59425	D	0.04	.	6.6454	0.22933	0.0:0.5087:0.0:0.4913	.	44;24;27	F5H0A9;Q0D2J5;Q0D2J5-2	.;ZN763_HUMAN;.	L	44;27;24	ENSP00000438117:S44L;ENSP00000369774:S27L;ENSP00000402017:S24L	ENSP00000369774:S27L	S	+	2	0	ZNF763	11948920	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.467000	0.06664	-1.501000	0.01817	-1.076000	0.02234	TCG		ZNF763-002	KNOWN	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000344158.1	NM_001012753	
TMPRSS9	360200	broad.mit.edu	37	19	2408481	2408481	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr19:2408481G>A	ENST00000332578.3	+	7	868	c.868G>A	c.(868-870)Gac>Aac	p.D290N		NM_182973.1	NP_892018.1	Q7Z410	TMPS9_HUMAN	transmembrane protease, serine 9	290	Peptidase S1 1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				plasminogen activation (GO:0031639)	integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)	p.D290N(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGACACGGCCGACTTTGACGT	0.672																																					p.D290N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G868A	19						.						107.0	92.0	97.0					19																	2408481		2203	4300	6503	2359481	SO:0001583	missense	360200	exon7			AJ488946	CCDS12088.1	19p13.3	2010-04-13						"""Serine peptidases / Transmembrane"""	30079	protein-coding gene	gene with protein product	"""polyserase 1"""	610477				12886014	Standard	NM_182973		Approved		uc010xgx.2	Q7Z410		ENST00000332578.3:c.868G>A	19.37:g.2408481G>A	ENSP00000330264:p.Asp290Asn	Somatic		Capture	Illumina HiSeq	Phase_I	2359481	NM_182973	Q6ZND6|Q7Z411	Missense_Mutation	SNP	ENST00000332578.3	37	CCDS12088.1	.	.	.	.	.	.	.	.	.	.	G	17.69	3.452560	0.63290	.	.	ENSG00000178297	ENST00000395264;ENST00000332578	D	0.89746	-2.56	4.67	4.67	0.58626	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.49305	U	0.000152	D	0.91264	0.7246	L	0.32530	0.975	0.58432	D	0.999993	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.92645	0.6128	10	0.87932	D	0	.	16.1046	0.81212	0.0:0.0:1.0:0.0	.	290;324	Q7Z410;E7EMP4	TMPS9_HUMAN;.	N	324;290	ENSP00000330264:D290N	ENSP00000330264:D290N	D	+	1	0	TMPRSS9	2359481	1.000000	0.71417	0.925000	0.36789	0.163000	0.22366	7.327000	0.79147	2.155000	0.67459	0.491000	0.48974	GAC		TMPRSS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451330.3	NM_182973	
SYCE2	256126	broad.mit.edu	37	19	13029109	13029109	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr19:13029109G>T	ENST00000293695.7	-	2	76	c.58C>A	c.(58-60)Ccc>Acc	p.P20T	MIR5695_ENST00000579717.1_RNA	NM_001105578.1	NP_001099048.1	Q6PIF2	SYCE2_HUMAN	synaptonemal complex central element protein 2	20					synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)		p.P20T(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(1)	8						TCCCCCAAGGGCTGCGGTTCC	0.612																																					p.P20T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C58A	19						.						80.0	87.0	84.0					19																	13029109		2118	4226	6344	12890109	SO:0001583	missense	256126	exon2			AK097443	CCDS42509.1	19p13.13	2008-02-05				ENSG00000161860			27411	protein-coding gene	gene with protein product	"""central element synaptonemal complex 1"""	611487				15944401	Standard	NM_001105578		Approved	CESC1	uc002mvr.2	Q6PIF2		ENST00000293695.7:c.58C>A	19.37:g.13029109G>T	ENSP00000293695:p.Pro20Thr	Somatic		Capture	Illumina HiSeq	Phase_I	12890109	NM_001105578	B4DYD3	Missense_Mutation	SNP	ENST00000293695.7	37	CCDS42509.1	.	.	.	.	.	.	.	.	.	.	G	7.025	0.559405	0.13436	.	.	ENSG00000161860	ENST00000293695	.	.	.	3.46	1.07	0.20283	.	1.394180	0.05080	N	0.483323	T	0.23766	0.0575	N	0.22421	0.69	0.09310	N	1	B	0.32160	0.358	B	0.29785	0.107	T	0.24764	-1.0151	9	0.44086	T	0.13	-3.6569	4.7504	0.13057	0.1334:0.3216:0.5449:0.0	.	20	Q6PIF2	SYCE2_HUMAN	T	20	.	ENSP00000293695:P20T	P	-	1	0	SYCE2	12890109	0.013000	0.17824	0.001000	0.08648	0.025000	0.11179	1.034000	0.30204	0.368000	0.24481	0.561000	0.74099	CCC		SYCE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451913.1	XM_497609	
ZNF536	9745	broad.mit.edu	37	19	30934982	30934982	+	Silent	SNP	G	G	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr19:30934982G>T	ENST00000355537.3	+	2	660	c.513G>T	c.(511-513)ggG>ggT	p.G171G		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	171					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)	p.G171G(1)		NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					CGCAGAAGGGGAACCTCAAGA	0.657																																					p.G171G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G513T	19						.						32.0	29.0	30.0					19																	30934982		2203	4299	6502	35626822	SO:0001819	synonymous_variant	9745	exon2				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.513G>T	19.37:g.30934982G>T		Somatic		Capture	Illumina HiSeq	Phase_I	35626822	NM_014717	A2RU18	Silent	SNP	ENST00000355537.3	37	CCDS32984.1																																																																																				ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717	
FCGBP	8857	broad.mit.edu	37	19	40368478	40368478	+	Silent	SNP	G	G	A	rs77170940		TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr19:40368478G>A	ENST00000221347.6	-	28	12877	c.12870C>T	c.(12868-12870)ccC>ccT	p.P4290P		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	4290	VWFD 10. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)		p.P4290P(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			AGGTGGTGAAGGGGCCCCCTG	0.617																																					p.P4290P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C12870T	19						.						105.0	100.0	102.0					19																	40368478		2203	4298	6501	45060318	SO:0001819	synonymous_variant	8857	exon28			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.12870C>T	19.37:g.40368478G>A		Somatic		Capture	Illumina HiSeq	Phase_I	45060318	NM_003890	O95784	Silent	SNP	ENST00000221347.6	37	CCDS12546.1																																																																																				FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
ZNF235	9310	broad.mit.edu	37	19	44791507	44791507	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr19:44791507T>A	ENST00000291182.4	-	5	2183	c.2081A>T	c.(2080-2082)cAg>cTg	p.Q694L	ZNF235_ENST00000589248.1_Intron|ZNF235_ENST00000589799.1_Intron	NM_004234.4	NP_004225.3	Q14590	ZN235_HUMAN	zinc finger protein 235	694					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q694L(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29		Prostate(69;0.0352)|all_neural(266;0.116)				ATGTGAGGCCTGACTGAAGCC	0.512																																					p.Q694L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2081T	19						.						144.0	128.0	134.0					19																	44791507		2203	4300	6503	49483347	SO:0001583	missense	9310	exon5			X78929	CCDS33048.1	19q13.2	2013-01-08	2002-11-04	2002-11-08	ENSG00000159917	ENSG00000159917		"""Zinc fingers, C2H2-type"", ""-"""	12866	protein-coding gene	gene with protein product		604749	"""zinc finger protein homologous to Zfp93 in mouse"""	ZNF270, ZFP93		7865130, 9570955	Standard	NM_004234		Approved	HZF6, ANF270	uc002oza.4	Q14590		ENST00000291182.4:c.2081A>T	19.37:g.44791507T>A	ENSP00000291182:p.Gln694Leu	Somatic		Capture	Illumina HiSeq	Phase_I	49483347	NM_004234	B4DTQ7|O14898|O14899|Q17RR8	Missense_Mutation	SNP	ENST00000291182.4	37	CCDS33048.1	.	.	.	.	.	.	.	.	.	.	T	14.45	2.540241	0.45176	.	.	ENSG00000159917	ENST00000391957;ENST00000291182;ENST00000359844	T	0.01133	5.29	4.97	2.7	0.31948	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.39020	N	0.001484	T	0.00967	0.0032	L	0.27053	0.805	0.09310	N	1	B;B	0.26258	0.096;0.145	B;B	0.20767	0.012;0.031	T	0.49881	-0.8892	10	0.27082	T	0.32	-35.2447	7.8785	0.29608	0.1347:0.0:0.1399:0.7254	.	690;694	Q14590-2;Q14590	.;ZN235_HUMAN	L	694;694;586	ENSP00000291182:Q694L	ENSP00000291182:Q694L	Q	-	2	0	ZNF235	49483347	0.000000	0.05858	1.000000	0.80357	0.922000	0.55478	0.595000	0.24029	0.833000	0.34828	0.260000	0.18958	CAG		ZNF235-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460732.1		
MUC16	94025	broad.mit.edu	37	19	8982253	8982253	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr19:8982253G>A	ENST00000397910.4	-	70	42225	c.42022C>T	c.(42022-42024)Cct>Tct	p.P14008S	MUC16_ENST00000380951.5_Missense_Mutation_p.P649S	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	14033	SEA 13. {ECO:0000255|PROSITE- ProRule:PRU00188}.			Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.P14008S(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGCTTGATAGGCAGACCTGGG	0.602																																					p.P14008S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C42022T	19						.						59.0	63.0	62.0					19																	8982253		2052	4205	6257	8843253	SO:0001583	missense	94025	exon70			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.42022C>T	19.37:g.8982253G>A	ENSP00000381008:p.Pro14008Ser	Somatic		Capture	Illumina HiSeq	Phase_I	8843253	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	G	9.500	1.103066	0.20632	.	.	ENSG00000181143	ENST00000397910;ENST00000380951	T;T	0.28255	1.62;1.62	3.89	-1.02	0.10135	SEA (1);	2.345960	0.02328	N	0.073668	T	0.54565	0.1866	M	0.89287	3.02	.	.	.	B;D	0.62365	0.011;0.991	B;D	0.79108	0.01;0.992	T	0.39820	-0.9595	9	0.26408	T	0.33	.	0.8178	0.01105	0.2222:0.1851:0.4035:0.1892	.	21653;14008	Q8WXI7;B5ME49	MUC16_HUMAN;.	S	14008;649	ENSP00000381008:P14008S;ENSP00000370338:P649S	ENSP00000370338:P649S	P	-	1	0	MUC16	8843253	0.002000	0.14202	0.000000	0.03702	0.000000	0.00434	1.022000	0.30052	-0.067000	0.12976	-0.283000	0.09986	CCT		MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
COL5A3	50509	broad.mit.edu	37	19	10108786	10108786	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr19:10108786T>A	ENST00000264828.3	-	9	1235	c.1150A>T	c.(1150-1152)Att>Ttt	p.I384F	CTD-2553C6.1_ENST00000592332.1_RNA	NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	384	Nonhelical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)	p.I384F(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			ACCTTTTCAATCACTGCGGGC	0.547																																					p.I384F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1150T	19						.						258.0	240.0	246.0					19																	10108786		2203	4300	6503	9969786	SO:0001583	missense	50509	exon9			AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.1150A>T	19.37:g.10108786T>A	ENSP00000264828:p.Ile384Phe	Somatic		Capture	Illumina HiSeq	Phase_I	9969786	NM_015719	Q9NZQ6	Missense_Mutation	SNP	ENST00000264828.3	37	CCDS12222.1	.	.	.	.	.	.	.	.	.	.	T	15.35	2.807120	0.50421	.	.	ENSG00000080573	ENST00000264828	D	0.90385	-2.66	4.75	-2.56	0.06268	.	0.731194	0.12282	N	0.482781	D	0.88706	0.6509	M	0.64567	1.98	0.09310	N	1	P	0.42456	0.78	P	0.45577	0.486	T	0.80291	-0.1444	10	0.30078	T	0.28	.	10.9433	0.47285	0.0:0.5515:0.0:0.4485	.	384	P25940	CO5A3_HUMAN	F	384	ENSP00000264828:I384F	ENSP00000264828:I384F	I	-	1	0	COL5A3	9969786	0.013000	0.17824	0.001000	0.08648	0.713000	0.41058	-0.024000	0.12435	-0.501000	0.06605	0.254000	0.18369	ATT		COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315788.1	NM_015719	
KIR3DL3	115653	broad.mit.edu	37	19	55241224	55241224	+	Silent	SNP	G	G	A			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr19:55241224G>A	ENST00000291860.1	+	5	939	c.921G>A	c.(919-921)ccG>ccA	p.P307P	CTB-61M7.1_ENST00000400864.3_RNA|KIR3DL1_ENST00000538269.1_Intron|KIR3DL1_ENST00000541392.1_Intron|KIR3DL1_ENST00000402254.2_Intron|KIR2DL4_ENST00000396284.2_Intron	NM_153443.3	NP_703144.2	Q8N743	KI3L3_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 3	307						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P307P(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(3)|prostate(1)|skin(1)	21				GBM - Glioblastoma multiforme(193;0.0192)		GGTCAGACCCGAGTGACCCAC	0.577																																					p.P307P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G921A	19						.																																			59933036	SO:0001819	synonymous_variant	115653	exon5			AF352324	CCDS12903.1	19q13.4	2014-05-22			ENSG00000242019	ENSG00000242019		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16312	protein-coding gene	gene with protein product		610095				11513144	Standard	NM_153443		Approved	KIRC1, KIR3DL7, KIR44, CD158z	uc002qgu.1	Q8N743	OTTHUMG00000065884	ENST00000291860.1:c.921G>A	19.37:g.55241224G>A		Somatic		Capture	Illumina HiSeq	Phase_I	59933036	NM_153443	A9PL62|A9PL64|A9PL65|A9PL66|A9PL67|A9PL68|A9PZV4|A9PZV7|A9PZV8|A9Q066|A9Q0R5|A9Q242|A9Q250|A9Q251|O95056|Q1X775|Q1X777|Q1X778|Q1X779|Q1X780|Q1X781|Q1X782|Q1X783|Q7Z7N4|Q8NHI2|Q8NHI3|Q9UEI4	Silent	SNP	ENST00000291860.1	37	CCDS12903.1																																																																																				KIR3DL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141147.1	NM_153443	
VCAM1	7412	broad.mit.edu	37	1	101186182	101186182	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr1:101186182C>T	ENST00000294728.2	+	2	316	c.215C>T	c.(214-216)aCg>aTg	p.T72M	VCAM1_ENST00000370115.1_Missense_Mutation_p.T72M|VCAM1_ENST00000347652.2_Missense_Mutation_p.T72M|VCAM1_ENST00000370119.4_Intron	NM_001078.3	NP_001069.1	P19320	VCAM1_HUMAN	vascular cell adhesion molecule 1	72	Ig-like C2-type 1.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|amine metabolic process (GO:0009308)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-matrix adhesion (GO:0007160)|cellular response to glucose stimulus (GO:0071333)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|chorio-allantoic fusion (GO:0060710)|chronic inflammatory response (GO:0002544)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|oxidation-reduction process (GO:0055114)|positive regulation of T cell proliferation (GO:0042102)|regulation of immune response (GO:0050776)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|response to lipopolysaccharide (GO:0032496)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|viral process (GO:0016032)	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex (GO:0071065)|apical part of cell (GO:0045177)|cell surface (GO:0009986)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|podosome (GO:0002102)|sarcolemma (GO:0042383)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|primary amine oxidase activity (GO:0008131)	p.T72M(1)		central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(27)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	Carvedilol(DB01136)	GGGAAGGTGACGAATGAGGGG	0.468																																					p.T72M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C215T	1						.						99.0	85.0	90.0					1																	101186182		2203	4300	6503	100958770	SO:0001583	missense	7412	exon2			M60335	CCDS773.1, CCDS774.1, CCDS55617.1	1p32-p31	2014-01-30			ENSG00000162692	ENSG00000162692		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	12663	protein-coding gene	gene with protein product		192225					Standard	NM_080682		Approved	CD106	uc001dti.3	P19320	OTTHUMG00000010982	ENST00000294728.2:c.215C>T	1.37:g.101186182C>T	ENSP00000294728:p.Thr72Met	Somatic		Capture	Illumina HiSeq	Phase_I	100958770	NM_080682	A8K6R7|B4DKS4|E9PDD1|Q6NUP8	Missense_Mutation	SNP	ENST00000294728.2	37	CCDS773.1	.	.	.	.	.	.	.	.	.	.	C	7.866	0.727025	0.15439	.	.	ENSG00000162692	ENST00000347652;ENST00000294728;ENST00000370115	T;T;T	0.69306	-0.39;-0.39;-0.39	5.82	-11.6	0.00059	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.298560	0.04298	N	0.346771	T	0.22898	0.0553	N	0.22421	0.69	0.09310	N	1	B;P	0.37466	0.276;0.596	B;B	0.42851	0.04;0.4	T	0.47368	-0.9123	9	.	.	.	-0.2294	2.66	0.05024	0.4412:0.2077:0.2127:0.1384	.	72;72	P19320-2;P19320	.;VCAM1_HUMAN	M	72	ENSP00000304611:T72M;ENSP00000294728:T72M;ENSP00000359133:T72M	.	T	+	2	0	VCAM1	100958770	0.000000	0.05858	0.000000	0.03702	0.310000	0.27922	-2.211000	0.01226	-3.360000	0.00179	-0.768000	0.03414	ACG		VCAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030213.1	NM_001078	
SLC19A2	10560	broad.mit.edu	37	1	169446645	169446645	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr1:169446645C>T	ENST00000236137.5	-	2	791	c.555G>A	c.(553-555)tgG>tgA	p.W185*	SLC19A2_ENST00000367804.4_Intron	NM_006996.2	NP_008927.1	O60779	S19A2_HUMAN	solute carrier family 19 (thiamine transporter), member 2	185					folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|thiamine transport (GO:0015888)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	folic acid transporter activity (GO:0008517)|thiamine transmembrane transporter activity (GO:0015234)|thiamine uptake transmembrane transporter activity (GO:0015403)	p.W185*(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|upper_aerodigestive_tract(1)	11	all_hematologic(923;0.208)				Thiamine(DB00152)	TGAACAGCGACCAGCCTGCCA	0.502																																					p.W185X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G555A	1						.						59.0	61.0	60.0					1																	169446645		2203	4300	6503	167713269	SO:0001587	stop_gained	10560	exon2			AF135488	CCDS1280.1	1q23.3	2013-05-22			ENSG00000117479	ENSG00000117479		"""Solute carriers"""	10938	protein-coding gene	gene with protein product		603941		TRMA		9399900, 10391221	Standard	NM_006996		Approved	THTR1	uc001gge.4	O60779	OTTHUMG00000035452	ENST00000236137.5:c.555G>A	1.37:g.169446645C>T	ENSP00000236137:p.Trp185*	Somatic		Capture	Illumina HiSeq	Phase_I	167713269	NM_006996	B2R9H0|B4E1X4|Q8WV87|Q9UBL7|Q9UKJ2|Q9UN31|Q9UN43	Nonsense_Mutation	SNP	ENST00000236137.5	37	CCDS1280.1	.	.	.	.	.	.	.	.	.	.	C	36	5.871747	0.97049	.	.	ENSG00000117479	ENST00000236137;ENST00000367802	.	.	.	5.3	5.3	0.74995	.	0.286606	0.37955	N	0.001875	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	-5.7833	18.9598	0.92673	0.0:1.0:0.0:0.0	.	.	.	.	X	185	.	ENSP00000236137:W185X	W	-	3	0	SLC19A2	167713269	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.453000	0.35167	2.484000	0.83849	0.650000	0.86243	TGG		SLC19A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086106.1	NM_006996	
KCNT2	343450	broad.mit.edu	37	1	196227474	196227474	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr1:196227474G>T	ENST00000294725.9	-	26	3976	c.3061C>A	c.(3061-3063)Ctg>Atg	p.L1021M	KCNT2_ENST00000367431.4_Missense_Mutation_p.L955M|KCNT2_ENST00000367433.5_Missense_Mutation_p.L997M|KCNT2_ENST00000451324.2_3'UTR|KCNT2_ENST00000498426.1_5'UTR|KCNT2_ENST00000609185.1_Missense_Mutation_p.L954M			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	1021					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)	p.L1021M(1)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						TTTCTGCTCAGTCTTCGGGCC	0.517																																					p.L1021M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3061A	1						.						148.0	129.0	135.0					1																	196227474		2203	4300	6503	194494097	SO:0001583	missense	343450	exon26			BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.3061C>A	1.37:g.196227474G>T	ENSP00000294725:p.Leu1021Met	Somatic		Capture	Illumina HiSeq	Phase_I	194494097	NM_198503	Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	ENST00000294725.9	37	CCDS1384.1	.	.	.	.	.	.	.	.	.	.	G	17.12	3.308572	0.60305	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000294725	T;T;T	0.22539	1.95;1.99;2.28	5.74	4.82	0.62117	.	0.000000	0.45867	D	0.000323	T	0.35970	0.0950	M	0.78916	2.43	0.80722	D	1	P;P;P;P	0.44260	0.83;0.802;0.802;0.701	P;P;P;B	0.47626	0.552;0.477;0.477;0.285	T	0.30060	-0.9991	10	0.66056	D	0.02	-10.0462	14.2974	0.66325	0.0706:0.0:0.9294:0.0	.	986;997;954;1021	Q6UVM3-4;Q6UVM3-2;Q6UVM3-3;Q6UVM3	.;.;.;KCNT2_HUMAN	M	997;955;1021	ENSP00000356403:L997M;ENSP00000356401:L955M;ENSP00000294725:L1021M	ENSP00000294725:L1021M	L	-	1	2	KCNT2	194494097	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	7.654000	0.83653	1.429000	0.47314	0.643000	0.83706	CTG		KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086418.2	NM_198503	
NFASC	23114	broad.mit.edu	37	1	204942404	204942404	+	Splice_Site	SNP	C	C	A			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr1:204942404C>A	ENST00000401399.1	+	11	1335	c.1136C>A	c.(1135-1137)tCg>tAg	p.S379*	NFASC_ENST00000513543.1_Splice_Site_p.S390*|NFASC_ENST00000338515.6_Splice_Site_p.S379*|NFASC_ENST00000338586.6_Splice_Site_p.S379*|NFASC_ENST00000404076.1_Splice_Site_p.S373*|NFASC_ENST00000367169.4_Splice_Site_p.S379*|NFASC_ENST00000403080.1_Splice_Site_p.S379*|NFASC_ENST00000367170.4_Splice_Site_p.S379*|NFASC_ENST00000539706.1_Splice_Site_p.S390*|NFASC_ENST00000404907.1_Splice_Site_p.S390*|NFASC_ENST00000360049.4_Splice_Site_p.S390*|NFASC_ENST00000367171.4_Splice_Site_p.S379*|NFASC_ENST00000339876.6_Splice_Site_p.S379*|NFASC_ENST00000367172.4_Splice_Site_p.S379*			O94856	NFASC_HUMAN	neurofascin	379	Ig-like C2-type 4.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)		p.S390*(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			TTGTCTGTAGCGGCACCACCT	0.612																																					p.S390X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1169A	1						.						120.0	112.0	115.0					1																	204942404		2203	4300	6503	203209027	SO:0001630	splice_region_variant	23114	exon10			AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.1136-1C>A	1.37:g.204942404C>A		Somatic		Capture	Illumina HiSeq	Phase_I	203209027	NM_001160331	B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Nonsense_Mutation	SNP	ENST00000401399.1	37	CCDS53460.1	.	.	.	.	.	.	.	.	.	.	C	40	7.967473	0.98585	.	.	ENSG00000163531	ENST00000367172;ENST00000367171;ENST00000367170;ENST00000338515;ENST00000339876;ENST00000338586;ENST00000295776;ENST00000539706;ENST00000360049;ENST00000367169;ENST00000403080;ENST00000404076;ENST00000401399;ENST00000404907;ENST00000513543;ENST00000430393	.	.	.	5.28	3.39	0.38822	.	0.292535	0.23502	N	0.047486	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.8132	0.18477	0.0:0.5812:0.1815:0.2373	.	.	.	.	X	379;379;379;379;379;379;390;390;390;379;379;373;379;390;390;366	.	.	S	+	2	0	NFASC	203209027	0.118000	0.22208	0.990000	0.47175	0.805000	0.45488	0.208000	0.17415	1.235000	0.43724	0.655000	0.94253	TCG		NFASC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131237.1	NM_001005388	Nonsense_Mutation
AGO4	192670	broad.mit.edu	37	1	36316488	36316488	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr1:36316488T>G	ENST00000373210.3	+	17	2556	c.2311T>G	c.(2311-2313)Tgg>Ggg	p.W771G	AGO4_ENST00000488778.1_3'UTR	NM_017629.3	NP_060099.2	Q9HCK5	AGO4_HUMAN	argonaute RISC catalytic component 4	771	Piwi. {ECO:0000255|HAMAP-Rule:MF_03033}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)	p.W771G(1)									CCAGGTCTTGTGGGATGACAA	0.428																																					p.W771G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2311G	1						.						115.0	100.0	106.0					1																	36316488		2203	4300	6503	36089075	SO:0001583	missense	192670	exon17			AB046787	CCDS397.1	1p34	2013-02-15	2013-02-15	2013-02-15	ENSG00000134698	ENSG00000134698		"""Argonaute/PIWI family"""	18424	protein-coding gene	gene with protein product	"""argonaute 4"""	607356	"""eukaryotic translation initiation factor 2C, 4"""	EIF2C4		12906857	Standard	NM_017629		Approved	hAGO4, KIAA1567, FLJ20033	uc001bzj.2	Q9HCK5	OTTHUMG00000004243	ENST00000373210.3:c.2311T>G	1.37:g.36316488T>G	ENSP00000362306:p.Trp771Gly	Somatic		Capture	Illumina HiSeq	Phase_I	36089075	NM_017629	A7MD27	Missense_Mutation	SNP	ENST00000373210.3	37	CCDS397.1	.	.	.	.	.	.	.	.	.	.	T	18.85	3.710996	0.68730	.	.	ENSG00000134698	ENST00000373210	T	0.29917	1.55	5.22	5.22	0.72569	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.61751	0.2372	H	0.95780	3.72	0.80722	D	1	D	0.53312	0.959	P	0.55260	0.772	T	0.75311	-0.3362	10	0.72032	D	0.01	-7.319	15.1133	0.72375	0.0:0.0:0.0:1.0	.	771	Q9HCK5	AGO4_HUMAN	G	771	ENSP00000362306:W771G	ENSP00000362306:W771G	W	+	1	0	EIF2C4	36089075	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.036000	0.88901	1.958000	0.56883	0.482000	0.46254	TGG		AGO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012213.3	NM_017629	
NEGR1	257194	broad.mit.edu	37	1	72076744	72076744	+	Silent	SNP	C	C	T	rs369017807		TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr1:72076744C>T	ENST00000357731.5	-	5	992	c.753G>A	c.(751-753)ccG>ccA	p.P251P	NEGR1_ENST00000306821.3_Silent_p.P123P|NEGR1_ENST00000434200.1_Silent_p.P205P	NM_173808.2	NP_776169.2	Q7Z3B1	NEGR1_HUMAN	neuronal growth regulator 1	251	Ig-like C2-type 3.				feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|positive regulation of neuron projection development (GO:0010976)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)		p.P251P(1)		endometrium(1)|kidney(4)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)		AGGCTGGAGGCGGCACACCTG	0.458																																					p.P251P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G753A	1						.	C		0,4406		0,0,2203	109.0	110.0	109.0		753	-0.8	1.0	1		109	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	NEGR1	NM_173808.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		251/355	72076744	1,13005	2203	4300	6503	71849332	SO:0001819	synonymous_variant	257194	exon5			AK092307	CCDS661.1	1p31.1	2013-01-11			ENSG00000172260	ENSG00000172260		"""Immunoglobulin superfamily / I-set domain containing"""	17302	protein-coding gene	gene with protein product	"""a kindred of IgLON"", ""neurotractin"", ""IgLON family member 4"""	613173				10075727	Standard	NM_173808		Approved	KILON, MGC46680, Ntra, IGLON4	uc001dfw.3	Q7Z3B1	OTTHUMG00000009698	ENST00000357731.5:c.753G>A	1.37:g.72076744C>T		Somatic		Capture	Illumina HiSeq	Phase_I	71849332	NM_173808	Q5VT21|Q6UY06|Q8N440|Q8NAQ3	Silent	SNP	ENST00000357731.5	37	CCDS661.1																																																																																				NEGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026722.4	NM_173808	
CLCA2	9635	broad.mit.edu	37	1	86904726	86904726	+	Silent	SNP	G	G	A			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr1:86904726G>A	ENST00000370565.4	+	7	1302	c.1140G>A	c.(1138-1140)ctG>ctA	p.L380L		NM_006536.5	NP_006527.1	Q9UQC9	CLCA2_HUMAN	chloride channel accessory 2	380	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|transport (GO:0006810)	cell junction (GO:0030054)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)|ligand-gated ion channel activity (GO:0015276)	p.L380L(1)		NS(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	42		Lung NSC(277;0.238)		all cancers(265;0.0233)|Epithelial(280;0.0452)		TTTCATATCTGCCCACCACTG	0.453																																					p.L380L	Melanoma(157;1000 1898 5363 5664 48018)|Ovarian(88;135 1366 2838 28875 34642)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1140A	1						.						135.0	115.0	121.0					1																	86904726		2203	4300	6503	86677314	SO:0001819	synonymous_variant	9635	exon7				CCDS708.1	1p22.3	2012-02-26	2009-01-29		ENSG00000137975	ENSG00000137975			2016	protein-coding gene	gene with protein product		604003	"""chloride channel, calcium activated, family member 2"", ""chloride channel regulator 2"""				Standard	NM_006536		Approved	CLCRG2	uc001dlr.4	Q9UQC9	OTTHUMG00000010256	ENST00000370565.4:c.1140G>A	1.37:g.86904726G>A		Somatic		Capture	Illumina HiSeq	Phase_I	86677314	NM_006536	A8K2T3|Q9Y6N2	Silent	SNP	ENST00000370565.4	37	CCDS708.1																																																																																				CLCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028284.1	NM_006536	
CLCA4	22802	broad.mit.edu	37	1	87043755	87043755	+	Splice_Site	SNP	G	G	A			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr1:87043755G>A	ENST00000370563.3	+	12	2164	c.2122G>A	c.(2122-2124)Ggg>Agg	p.G708R	RP4-651E10.4_ENST00000456587.1_RNA	NM_012128.3	NP_036260.2	Q14CN2	CLCA4_HUMAN	chloride channel accessory 4	708					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)	p.G708R(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44		Lung NSC(277;0.238)		all cancers(265;0.0202)|Epithelial(280;0.0404)		GGTAGTGAACGGTGAGTAACT	0.388																																					p.G708R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2122A	1						.						39.0	38.0	38.0					1																	87043755		1871	4104	5975	86816343	SO:0001630	splice_region_variant	22802	exon12			AF127035	CCDS41355.1	1p31-p22	2012-02-26	2009-01-29		ENSG00000016602	ENSG00000016602			2018	protein-coding gene	gene with protein product			"""chloride channel, calcium activated, family member 4"", ""chloride channel regulator 4"""			10437792	Standard	NM_012128		Approved	CaCC2	uc009wcs.3	Q14CN2	OTTHUMG00000010260	ENST00000370563.3:c.2122+1G>A	1.37:g.87043755G>A		Somatic		Capture	Illumina HiSeq	Phase_I	86816343	NM_012128	A8MQC9|B7Z1Q5|Q6UX81|Q9UNF7	Missense_Mutation	SNP	ENST00000370563.3	37	CCDS41355.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.468833	0.84533	.	.	ENSG00000016602	ENST00000370563	T	0.03386	3.95	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.15349	0.0370	M	0.84846	2.72	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.69654	0.965;0.965	T	0.00770	-1.1573	10	0.87932	D	0	-15.7005	18.5847	0.91185	0.0:0.0:1.0:0.0	.	260;708	Q9NXP1;Q14CN2	.;CLCA4_HUMAN	R	708	ENSP00000359594:G708R	ENSP00000359594:G708R	G	+	1	0	CLCA4	86816343	1.000000	0.71417	0.998000	0.56505	0.790000	0.44656	6.687000	0.74552	2.783000	0.95769	0.655000	0.94253	GGG		CLCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028292.1	NM_012128	Missense_Mutation
GBP7	388646	broad.mit.edu	37	1	89618400	89618400	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr1:89618400C>T	ENST00000294671.2	-	4	517	c.379G>A	c.(379-381)Gtc>Atc	p.V127I		NM_207398.2	NP_997281.2	Q8N8V2	GBP7_HUMAN	guanylate binding protein 7	127	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.					membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.V127I(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Lung NSC(277;0.0908)		all cancers(265;0.00835)|Epithelial(280;0.0322)		CTGTTGTAGACAAAGCTGCTG	0.478																																					p.V127I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G379A	1						.						90.0	87.0	88.0					1																	89618400		2203	4300	6503	89390988	SO:0001583	missense	388646	exon4			AK096141	CCDS720.1	1p22.2	2008-02-05			ENSG00000213512	ENSG00000213512			29606	protein-coding gene	gene with protein product		612468					Standard	NM_207398		Approved	FLJ38822, GBP4L	uc001dna.2	Q8N8V2	OTTHUMG00000010659	ENST00000294671.2:c.379G>A	1.37:g.89618400C>T	ENSP00000294671:p.Val127Ile	Somatic		Capture	Illumina HiSeq	Phase_I	89390988	NM_207398		Missense_Mutation	SNP	ENST00000294671.2	37	CCDS720.1	.	.	.	.	.	.	.	.	.	.	C	6.178	0.400997	0.11696	.	.	ENSG00000213512	ENST00000294671	T	0.77229	-1.08	3.69	1.76	0.24704	Guanylate-binding protein, N-terminal (1);	0.222211	0.36234	N	0.002712	T	0.48892	0.1525	L	0.36672	1.1	0.21841	N	0.999512	B	0.17268	0.021	B	0.25759	0.063	T	0.46978	-0.9152	10	0.41790	T	0.15	.	9.957	0.41673	0.0:0.7975:0.0:0.2025	.	127	Q8N8V2	GBP7_HUMAN	I	127	ENSP00000294671:V127I	ENSP00000294671:V127I	V	-	1	0	GBP7	89390988	0.120000	0.22244	0.940000	0.37924	0.205000	0.24178	0.075000	0.14686	-0.010000	0.14271	-1.021000	0.02439	GTC		GBP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029401.1	NM_207398	
OR14I1	401994	broad.mit.edu	37	1	248845364	248845364	+	Missense_Mutation	SNP	C	C	T	rs143401731	byFrequency	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr1:248845364C>T	ENST00000342623.3	-	1	265	c.242G>A	c.(241-243)cGt>cAt	p.R81H		NM_001004734.1	NP_001004734.1	A6ND48	O14I1_HUMAN	olfactory receptor, family 14, subfamily I, member 1	81						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R81H(1)		NS(1)|breast(4)|large_intestine(2)|lung(24)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	35						CAGGGAGTTACGGATGGATTT	0.478													C|||	9	0.00179712	0.0	0.0	5008	,	,		22056	0.0		0.0	False		,,,				2504	0.0092				p.R81H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G242A	1						.	T	HIS/ARG	1,4405		0,1,2202	127.0	108.0	114.0		242	-7.0	0.0	1	dbSNP_134	114	2,8598		0,2,4298	yes	missense	OR14I1	NM_001004734.1	29	0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231	benign	81/312	248845364	3,13003	2203	4300	6503	246911987	SO:0001583	missense	401994	exon1				CCDS31125.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000189181	ENSG00000189181		"""GPCR / Class A : Olfactory receptors"""	19575	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily BU, member 1"""	OR5BU1P, OR5BU1			Standard	NM_001004734		Approved		uc001ieu.1	A6ND48	OTTHUMG00000040378	ENST00000342623.3:c.242G>A	1.37:g.248845364C>T	ENSP00000339726:p.Arg81His	Somatic		Capture	Illumina HiSeq	Phase_I	246911987	NM_001004734		Missense_Mutation	SNP	ENST00000342623.3	37	CCDS31125.1	.	.	.	.	.	.	.	.	.	.	.	6.645	0.487518	0.12641	2.27E-4	2.33E-4	ENSG00000189181	ENST00000342623	T	0.00397	7.57	3.48	-6.96	0.01622	GPCR, rhodopsin-like superfamily (1);	0.311315	0.23091	N	0.052034	T	0.00073	0.0002	N	0.02345	-0.59	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38134	-0.9675	10	0.14656	T	0.56	.	1.2183	0.01918	0.2456:0.1807:0.3777:0.196	.	81	A6ND48	O14I1_HUMAN	H	81	ENSP00000339726:R81H	ENSP00000339726:R81H	R	-	2	0	OR14I1	246911987	0.000000	0.05858	0.000000	0.03702	0.100000	0.18952	-3.962000	0.00324	-1.656000	0.01495	-0.434000	0.05882	CGT		OR14I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097128.1	NM_001004734	
FOXA2	3170	broad.mit.edu	37	20	22563317	22563317	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr20:22563317A>T	ENST00000377115.4	-	3	726	c.545T>A	c.(544-546)cTg>cAg	p.L182Q	FOXA2_ENST00000419308.2_Missense_Mutation_p.L188Q	NM_153675.2	NP_710141.1	Q9Y261	FOXA2_HUMAN	forkhead box A2	182					adult locomotory behavior (GO:0008344)|cell development (GO:0048468)|cell differentiation in hindbrain (GO:0021533)|cell fate specification (GO:0001708)|chromatin modification (GO:0016568)|connective tissue development (GO:0061448)|dopaminergic neuron differentiation (GO:0071542)|dorsal/ventral neural tube patterning (GO:0021904)|ectoderm formation (GO:0001705)|endocrine pancreas development (GO:0031018)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|in utero embryonic development (GO:0001701)|lung epithelial cell differentiation (GO:0060487)|negative regulation of detection of glucose (GO:2000971)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of glucokinase activity (GO:0033132)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter by glucose (GO:0000433)|neuron fate specification (GO:0048665)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by glucose (GO:0000432)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|primitive streak formation (GO:0090009)|regulation of blood coagulation (GO:0030193)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in detection of glucose (GO:2000976)|response to interleukin-6 (GO:0070741)|signal transduction involved in regulation of gene expression (GO:0023019)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.L182Q(1)		breast(1)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(1)|lung(3)|ovary(2)|prostate(2)|urinary_tract(1)	22	Lung NSC(19;0.188)					GATCTCGCTCAGCGTCAGCAT	0.587																																					p.L188Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T563A	20						.						135.0	117.0	123.0					20																	22563317		2203	4300	6503	22511317	SO:0001583	missense	3170	exon2			AF147787	CCDS13147.1, CCDS46585.1	20p11	2008-04-10		2002-09-20	ENSG00000125798	ENSG00000125798		"""Forkhead boxes"""	5022	protein-coding gene	gene with protein product		600288	"""hepatocyte nuclear factor 3, beta"""	HNF3B		9119385, 11875061	Standard	NM_153675		Approved		uc002wsm.3	Q9Y261	OTTHUMG00000032041	ENST00000377115.4:c.545T>A	20.37:g.22563317A>T	ENSP00000366319:p.Leu182Gln	Somatic		Capture	Illumina HiSeq	Phase_I	22511317	NM_021784	Q8WUW4|Q96DF7	Missense_Mutation	SNP	ENST00000377115.4	37	CCDS13147.1	.	.	.	.	.	.	.	.	.	.	A	18.99	3.739465	0.69304	.	.	ENSG00000125798	ENST00000377115;ENST00000419308;ENST00000319993;ENST00000444877	D;D;D	0.97620	-4.46;-4.46;-4.46	4.98	4.98	0.66077	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);	0.000000	0.48286	U	0.000193	D	0.99130	0.9700	H	0.98951	4.38	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98832	1.0751	10	0.87932	D	0	.	14.3356	0.66586	1.0:0.0:0.0:0.0	.	182;188	Q9Y261;B0ZTD4	FOXA2_HUMAN;.	Q	182;182;188;68	ENSP00000366319:L182Q;ENSP00000400341:L182Q;ENSP00000315955:L188Q	ENSP00000315955:L188Q	L	-	2	0	FOXA2	22511317	1.000000	0.71417	0.999000	0.59377	0.848000	0.48234	9.257000	0.95545	1.867000	0.54127	0.468000	0.43344	CTG		FOXA2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078289.1		
TOMM34	10953	broad.mit.edu	37	20	43583827	43583827	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr20:43583827G>T	ENST00000372813.3	-	3	414	c.262C>A	c.(262-264)Ctg>Atg	p.L88M	PABPC1L_ENST00000372819.1_Intron|PABPC1L_ENST00000490798.1_Intron	NM_006809.4	NP_006800.2	Q15785	TOM34_HUMAN	translocase of outer mitochondrial membrane 34	88					protein targeting to mitochondrion (GO:0006626)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	heat shock protein binding (GO:0031072)	p.L88M(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)	11		Myeloproliferative disorder(115;0.0122)				CGCCGCAGCAGGGGCTTAATG	0.507																																					p.L88M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C262A	20						.						126.0	123.0	124.0					20																	43583827		2203	4300	6503	43017241	SO:0001583	missense	10953	exon3			U58970	CCDS13340.1	20q12-q13.1	2013-01-10			ENSG00000025772	ENSG00000025772		"""Tetratricopeptide (TTC) repeat domain containing"""	15746	protein-coding gene	gene with protein product	"""outer mitochondrial membrane translocase (34kD)"""					9324309	Standard	NM_006809		Approved	TOM34, HTOM34P	uc002xmy.3	Q15785	OTTHUMG00000032552	ENST00000372813.3:c.262C>A	20.37:g.43583827G>T	ENSP00000361900:p.Leu88Met	Somatic		Capture	Illumina HiSeq	Phase_I	43017241	NM_006809	Q53GH9|Q6IBN7|Q9NTZ3	Missense_Mutation	SNP	ENST00000372813.3	37	CCDS13340.1	.	.	.	.	.	.	.	.	.	.	G	17.41	3.383369	0.61845	.	.	ENSG00000025772	ENST00000372813	T	0.69806	-0.43	5.31	-1.42	0.08913	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.161017	0.42964	D	0.000633	T	0.79275	0.4418	M	0.86651	2.83	0.31916	N	0.614039	D	0.67145	0.996	D	0.72338	0.977	T	0.79460	-0.1794	10	0.59425	D	0.04	-37.3557	9.6543	0.39917	0.5598:0.0:0.4402:0.0	.	88	Q15785	TOM34_HUMAN	M	88	ENSP00000361900:L88M	ENSP00000361900:L88M	L	-	1	2	TOMM34	43017241	1.000000	0.71417	0.987000	0.45799	0.862000	0.49288	2.351000	0.44071	-0.065000	0.13021	-0.142000	0.14014	CTG		TOMM34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079390.3	NM_006809	
TPTE	7179	broad.mit.edu	37	21	10908871	10908871	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr21:10908871A>T	ENST00000361285.4	-	23	1803	c.1474T>A	c.(1474-1476)Tgc>Agc	p.C492S	TPTE_ENST00000342420.5_Missense_Mutation_p.C454S|TPTE_ENST00000298232.7_Missense_Mutation_p.C474S|TPTE_ENST00000415664.2_5'UTR	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	492	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.C474S(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TAAAATGAGCAATTGTCATAG	0.284																																					p.C474S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1420A	21						.						118.0	111.0	113.0					21																	10908871		2202	4297	6499	9930742	SO:0001583	missense	7179	exon22			AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.1474T>A	21.37:g.10908871A>T	ENSP00000355208:p.Cys492Ser	Somatic		Capture	Illumina HiSeq	Phase_I	9930742	NM_199259	B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	ENST00000361285.4	37	CCDS13560.2	.	.	.	.	.	.	.	.	.	.	.	9.442	1.088356	0.20390	.	.	ENSG00000166157	ENST00000298232;ENST00000361285;ENST00000342420	D;D;D	0.84944	-1.92;-1.92;-1.92	2.18	2.18	0.27775	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	0.121467	0.53938	U	0.000041	D	0.90981	0.7164	M	0.85542	2.76	0.41463	D	0.988053	D;D;P	0.89917	1.0;1.0;0.455	D;D;B	0.83275	0.986;0.996;0.344	D	0.89830	0.3995	10	0.48119	T	0.1	-21.7407	8.305	0.32036	1.0:0.0:0.0:0.0	.	454;474;492	P56180-3;P56180-2;P56180	.;.;TPTE_HUMAN	S	474;492;454	ENSP00000298232:C474S;ENSP00000355208:C492S;ENSP00000344441:C454S	ENSP00000298232:C474S	C	-	1	0	TPTE	9930742	1.000000	0.71417	0.189000	0.23252	0.032000	0.12392	5.525000	0.67110	1.246000	0.43901	0.155000	0.16302	TGC		TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1		
SF3A1	10291	broad.mit.edu	37	22	30734826	30734826	+	Silent	SNP	G	G	A			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr22:30734826G>A	ENST00000215793.8	-	11	1849	c.1695C>T	c.(1693-1695)aaC>aaT	p.N565N	SF3A1_ENST00000439242.1_Silent_p.N500N	NM_005877.4	NP_005868.1	Q15459	SF3A1_HUMAN	splicing factor 3a, subunit 1, 120kDa	565					gene expression (GO:0010467)|mRNA 3'-splice site recognition (GO:0000389)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U2-type spliceosomal complex (GO:0005684)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.N565N(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|urinary_tract(1)	29						AGCTGGGGATGTTGGTGGCTG	0.547																																					p.N500N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1500T	22						.						221.0	228.0	226.0					22																	30734826		2203	4300	6503	29064826	SO:0001819	synonymous_variant	10291	exon11			X85237	CCDS13875.1	22q12.2	2014-09-17	2002-08-29		ENSG00000099995	ENSG00000099995			10765	protein-coding gene	gene with protein product		605595	"""splicing factor 3a, subunit 1, 120kD"""			7489498	Standard	NM_005877		Approved	SF3a120, SAP114, PRPF21, Prp21	uc003ahl.3	Q15459	OTTHUMG00000151005	ENST00000215793.8:c.1695C>T	22.37:g.30734826G>A		Somatic		Capture	Illumina HiSeq	Phase_I	29064826	NM_001005409	E9PAW1	Silent	SNP	ENST00000215793.8	37	CCDS13875.1																																																																																				SF3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320916.2	NM_005877	
TRIOBP	11078	broad.mit.edu	37	22	38119804	38119804	+	Missense_Mutation	SNP	C	C	A	rs547909720		TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr22:38119804C>A	ENST00000406386.3	+	7	1496	c.1241C>A	c.(1240-1242)gCc>gAc	p.A414D		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	414					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)	p.A414D(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					AATCCCAAAGCCTCCAGAACC	0.582																																					p.A414D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1241A	22						.						116.0	121.0	119.0					22																	38119804		1926	4145	6071	36449750	SO:0001583	missense	11078	exon7			AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.1241C>A	22.37:g.38119804C>A	ENSP00000384312:p.Ala414Asp	Somatic		Capture	Illumina HiSeq	Phase_I	36449750	NM_001039141	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	37	CCDS43015.1	.	.	.	.	.	.	.	.	.	.	C	8.897	0.955456	0.18507	.	.	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.21031	2.03	.	.	.	.	.	.	.	.	T	0.14141	0.0342	N	0.08118	0	0.09310	N	1	P	0.48350	0.909	P	0.51297	0.665	T	0.20438	-1.0275	7	0.33141	T	0.24	.	.	.	.	.	414	Q9H2D6	TARA_HUMAN	D	414	ENSP00000384312:A414D	ENSP00000384312:A414D	A	+	2	0	TRIOBP	36449750	.	.	0.005000	0.12908	0.196000	0.23810	.	.	0.121000	0.18284	0.123000	0.15791	GCC		TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
TMEM163	81615	broad.mit.edu	37	2	135470848	135470848	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr2:135470848G>T	ENST00000281924.6	-	2	308	c.244C>A	c.(244-246)Cag>Aag	p.Q82K		NM_030923.4	NP_112185.1	Q8TC26	TM163_HUMAN	transmembrane protein 163	82						cell junction (GO:0030054)|early endosome membrane (GO:0031901)|integral component of synaptic vesicle membrane (GO:0030285)	zinc ion binding (GO:0008270)	p.Q82K(1)		endometrium(1)|large_intestine(5)|lung(8)|stomach(1)|urinary_tract(1)	16				BRCA - Breast invasive adenocarcinoma(221;0.154)		CTGTAGTTCTGGGCTTCGTGA	0.512																																					p.Q82K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C244A	2						.						210.0	176.0	188.0					2																	135470848		2203	4300	6503	135187318	SO:0001583	missense	81615	exon2				CCDS2172.1	2q21.3	2008-02-05			ENSG00000152128	ENSG00000152128			25380	protein-coding gene	gene with protein product						17623043	Standard	NM_030923		Approved	DKFZP566N034, SV31	uc002ttx.3	Q8TC26	OTTHUMG00000131713	ENST00000281924.6:c.244C>A	2.37:g.135470848G>T	ENSP00000281924:p.Gln82Lys	Somatic		Capture	Illumina HiSeq	Phase_I	135187318	NM_030923	Q53QM3|Q53SV7|Q69YH3|Q9UFG3	Missense_Mutation	SNP	ENST00000281924.6	37	CCDS2172.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.462512	0.84425	.	.	ENSG00000152128	ENST00000281924;ENST00000537539	.	.	.	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.76702	0.4024	L	0.56769	1.78	0.58432	D	0.999992	D	0.58268	0.982	D	0.70227	0.968	T	0.77544	-0.2548	9	0.59425	D	0.04	.	18.7075	0.91644	0.0:0.0:1.0:0.0	.	82	Q8TC26	TM163_HUMAN	K	82;21	.	ENSP00000281924:Q82K	Q	-	1	0	TMEM163	135187318	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.454000	0.97621	2.656000	0.90262	0.591000	0.81541	CAG		TMEM163-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254631.2	NM_030923	
GALNT13	114805	broad.mit.edu	37	2	155306961	155306961	+	Silent	SNP	C	C	T	rs371789307		TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr2:155306961C>T	ENST00000392825.3	+	13	2136	c.1569C>T	c.(1567-1569)ctC>ctT	p.L523L	AC009227.2_ENST00000434635.1_RNA|GALNT13_ENST00000409237.1_3'UTR	NM_052917.2	NP_443149.2	Q8IUC8	GLT13_HUMAN	polypeptide N-acetylgalactosaminyltransferase 13	523	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.L523L(1)		NS(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|lung(37)|ovary(3)|pancreas(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	65						ACCAATGTCTCGATGAACCTT	0.438																																					p.L523L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1569T	2						.						126.0	107.0	113.0					2																	155306961		2203	4300	6503	155015207	SO:0001819	synonymous_variant	114805	exon13			AB067505	CCDS2199.1	2q24.1	2014-03-13	2014-03-13		ENSG00000144278	ENSG00000144278	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	23242	protein-coding gene	gene with protein product	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13"", ""polypeptide GalNAc transferase 13"""	608369	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)"""			11572484, 12407114	Standard	XM_005246267		Approved	KIAA1918, GalNAc-T13	uc002tyr.4	Q8IUC8	OTTHUMG00000131917	ENST00000392825.3:c.1569C>T	2.37:g.155306961C>T		Somatic		Capture	Illumina HiSeq	Phase_I	155015207	NM_052917	Q08ER7|Q68VI8|Q6ZWG1|Q96PX0|Q9UIE5	Silent	SNP	ENST00000392825.3	37	CCDS2199.1	.	.	.	.	.	.	.	.	.	.	C	7.726	0.698202	0.15106	.	.	ENSG00000144278	ENST00000450838	.	.	.	6.03	-12.1	0.00011	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.2613	0.15576	0.0805:0.4014:0.3101:0.208	.	.	.	.	X	109	.	.	R	+	1	2	GALNT13	155015207	0.003000	0.15002	0.073000	0.20177	0.901000	0.52897	-1.767000	0.01795	-3.715000	0.00116	-1.133000	0.01973	CGA		GALNT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254870.2	NM_052917	
SCN9A	6335	broad.mit.edu	37	2	167134679	167134679	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr2:167134679C>A	ENST00000409435.1	-	14	2487	c.2488G>T	c.(2488-2490)Gga>Tga	p.G830*	SCN9A_ENST00000375387.4_Nonsense_Mutation_p.G831*|AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000303354.6_Nonsense_Mutation_p.G831*|SCN9A_ENST00000409672.1_Nonsense_Mutation_p.G819*			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	830					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)	p.G819*(1)		NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ACTGACAATCCTTCCACATCT	0.353																																					p.G819X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G2455T	2						.						80.0	78.0	79.0					2																	167134679		1928	4176	6104	166842925	SO:0001587	stop_gained	6335	exon15			X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.2488G>T	2.37:g.167134679C>A	ENSP00000386330:p.Gly830*	Somatic		Capture	Illumina HiSeq	Phase_I	166842925	NM_002977	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Nonsense_Mutation	SNP	ENST00000409435.1	37	CCDS46441.1	.	.	.	.	.	.	.	.	.	.	C	43	10.363858	0.99391	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435	.	.	.	5.23	5.23	0.72850	.	0.000000	0.64402	D	0.000011	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.7621	0.91856	0.0:1.0:0.0:0.0	.	.	.	.	X	819;831;831;830	.	ENSP00000304748:G831X	G	-	1	0	SCN9A	166842925	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	6.068000	0.71201	2.583000	0.87209	0.655000	0.94253	GGA		SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333639.1	NM_002977	
APOB	338	broad.mit.edu	37	2	21228796	21228796	+	Silent	SNP	G	G	A	rs370314131		TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr2:21228796G>A	ENST00000233242.1	-	26	11071	c.10944C>T	c.(10942-10944)gtC>gtT	p.V3648V		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	3648					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.V3648V(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGGAAAGCTCGACCTGGCTCT	0.458																																					p.V3648V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C10944T	2						.	G		1,4405	4.2+/-10.8	0,1,2202	68.0	66.0	67.0		10944	-8.4	0.0	2		67	0,8600		0,0,4300	no	coding-synonymous	APOB	NM_000384.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		3648/4564	21228796	1,13005	2203	4300	6503	21082301	SO:0001819	synonymous_variant	338	exon26			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.10944C>T	2.37:g.21228796G>A		Somatic		Capture	Illumina HiSeq	Phase_I	21082301	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	ENST00000233242.1	37	CCDS1703.1																																																																																				APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
TTN	7273	broad.mit.edu	37	2	179454744	179454744	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr2:179454744G>T	ENST00000591111.1	-	254	57009	c.56785C>A	c.(56785-56787)Cct>Act	p.P18929T	TTN_ENST00000589042.1_Missense_Mutation_p.P20570T|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P18002T|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.P11505T|TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P11630T|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P11697T|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000456053.1_RNA			Q8WZ42	TITIN_HUMAN	titin	18929					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.P18000T(1)|p.P11505T(1)|p.P11697T(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAAGGCCCAGGTCTGTCAAGG	0.428																																					p.D11504E												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.C34512A	2						.						96.0	89.0	91.0					2																	179454744		1901	4120	6021	179162990	SO:0001583	missense	7273	exon132			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.56785C>A	2.37:g.179454744G>T	ENSP00000465570:p.Pro18929Thr	Somatic		Capture	Illumina HiSeq	Phase_I	179162990	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	12.89	2.074968	0.36566	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	D;D;D;D	0.86432	-2.12;-2.12;-2.12;-2.12	5.99	5.99	0.97316	Fibronectin, type III (3);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.96549	0.8874	H	0.98199	4.17	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.97291	0.9924	9	0.87932	D	0	.	20.4753	0.99175	0.0:0.0:1.0:0.0	.	11505;11630;11697;18929	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	T	18002;11505;11697;11630;11503	ENSP00000343764:P18002T;ENSP00000434586:P11505T;ENSP00000340554:P11697T;ENSP00000352154:P11630T	ENSP00000340554:P11697T	P	-	1	0	TTN	179162990	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.807000	0.99171	2.844000	0.97970	0.650000	0.86243	CCT		TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
FN1	2335	broad.mit.edu	37	2	216230256	216230256	+	Silent	SNP	G	G	A	rs568449322		TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr2:216230256G>A	ENST00000359671.1	-	42	7108	c.6843C>T	c.(6841-6843)aaC>aaT	p.N2281N	FN1_ENST00000357009.2_3'UTR|FN1_ENST00000421182.1_Silent_p.N2135N|FN1_ENST00000345488.5_Silent_p.N2079N|FN1_ENST00000357867.4_Silent_p.N2071N|FN1_ENST00000446046.1_Silent_p.N2225N|FN1_ENST00000443816.1_Silent_p.N2160N|FN1_ENST00000356005.4_Silent_p.N2191N|FN1_ENST00000354785.4_Silent_p.N2372N|FN1_ENST00000323926.6_Silent_p.N2341N|FN1_ENST00000432072.2_Silent_p.N2162N|FN1_ENST00000336916.4_Silent_p.N2250N|FN1_ENST00000346544.3_Silent_p.N2106N			P02751	FINC_HUMAN	fibronectin 1	2281	Fibrin-binding 2.|Fibronectin type-I 11. {ECO:0000255|PROSITE-ProRule:PRU00478}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)	p.N2250N(1)	FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	CTCCTTTTCCGTTCCCAAGAC	0.443													G|||	1	0.000199681	0.0	0.0	5008	,	,		16708	0.0		0.001	False		,,,				2504	0.0				p.N2191N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C6573T	2						.						323.0	275.0	291.0					2																	216230256		2203	4300	6503	215938501	SO:0001819	synonymous_variant	2335	exon41				CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.6843C>T	2.37:g.216230256G>A		Somatic		Capture	Illumina HiSeq	Phase_I	215938501	NM_212476	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Silent	SNP	ENST00000359671.1	37																																																																																					FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476	
RNF25	64320	broad.mit.edu	37	2	219529216	219529216	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr2:219529216T>C	ENST00000295704.2	-	10	1284	c.844A>G	c.(844-846)Aaa>Gaa	p.K282E		NM_022453.2	NP_071898.2	Q96BH1	RNF25_HUMAN	ring finger protein 25	282					positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|NF-kappaB binding (GO:0051059)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.K282E(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24		Renal(207;0.0474)		Epithelial(149;6.99e-07)|all cancers(144;0.000129)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGGGATCCTTTGGAGACATCT	0.557																																					p.K282E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A844G	2						.						78.0	72.0	74.0					2																	219529216		2203	4300	6503	219237460	SO:0001583	missense	64320	exon10				CCDS2420.1	2q35	2008-02-05			ENSG00000163481	ENSG00000163481		"""RING-type (C3HC4) zinc fingers"""	14662	protein-coding gene	gene with protein product						12748188	Standard	NM_022453		Approved	AO7, FLJ13906	uc002vit.3	Q96BH1	OTTHUMG00000133077	ENST00000295704.2:c.844A>G	2.37:g.219529216T>C	ENSP00000295704:p.Lys282Glu	Somatic		Capture	Illumina HiSeq	Phase_I	219237460	NM_022453	A8K0D6|Q53HQ5|Q9H874	Missense_Mutation	SNP	ENST00000295704.2	37	CCDS2420.1	.	.	.	.	.	.	.	.	.	.	T	2.609	-0.291257	0.05568	.	.	ENSG00000163481	ENST00000295704	T	0.40225	1.04	5.15	1.5	0.22942	.	0.757199	0.12964	N	0.424742	T	0.20981	0.0505	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.28490	-1.0042	10	0.10636	T	0.68	-8.1939	7.3097	0.26467	0.0:0.3582:0.0:0.6418	.	282	Q96BH1	RNF25_HUMAN	E	282	ENSP00000295704:K282E	ENSP00000295704:K282E	K	-	1	0	RNF25	219237460	0.252000	0.23972	0.879000	0.34478	0.801000	0.45260	-0.034000	0.12225	0.110000	0.17919	0.459000	0.35465	AAA		RNF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256721.1	NM_022453	
ALPP	250	broad.mit.edu	37	2	233246013	233246013	+	Silent	SNP	C	C	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr2:233246013C>T	ENST00000392027.2	+	10	1514	c.1245C>T	c.(1243-1245)taC>taT	p.Y415Y	AC068134.8_ENST00000439072.1_RNA|AC068134.8_ENST00000441266.1_RNA	NM_001632.3	NP_001623.3	P05187	PPB1_HUMAN	alkaline phosphatase, placental	415					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|magnesium ion binding (GO:0000287)|zinc ion binding (GO:0008270)	p.Y415Y(2)|p.Y415*(1)		NS(1)|biliary_tract(1)|endometrium(1)|kidney(4)|large_intestine(2)|liver(1)|lung(10)|ovary(2)	22		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)		TCCTCCTATACGGAAACGGTC	0.667																																					p.Y415Y												.	.	3	Substitution - coding silent(2)|Substitution - Nonsense(1)	kidney(2)|large_intestine(1)	c.C1245T	2						.						35.0	45.0	42.0					2																	233246013		2202	4296	6498	232954257	SO:0001819	synonymous_variant	250	exon10			M14169	CCDS2490.1	2q37.1	2010-06-24	2010-06-24		ENSG00000163283	ENSG00000163283	3.1.3.1		439	protein-coding gene	gene with protein product	"""Regan isozyme"""	171800	"""alkaline phosphatase, placental (Regan isozyme)"""			3001717, 3461452	Standard	XM_005246439		Approved		uc002vsq.3	P05187	OTTHUMG00000133255	ENST00000392027.2:c.1245C>T	2.37:g.233246013C>T		Somatic		Capture	Illumina HiSeq	Phase_I	232954257	NM_001632	P05188|P06861|Q53S78|Q96DB7	Silent	SNP	ENST00000392027.2	37	CCDS2490.1																																																																																				ALPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257032.3	NM_001632	
ASAP2	8853	broad.mit.edu	37	2	9528602	9528602	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr2:9528602C>G	ENST00000281419.3	+	22	2650	c.2310C>G	c.(2308-2310)agC>agG	p.S770R	ASAP2_ENST00000491413.1_3'UTR|ASAP2_ENST00000315273.4_Missense_Mutation_p.S770R	NM_003887.2	NP_003878.1	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 2	770					positive regulation of catalytic activity (GO:0043085)|regulation of ARF GTPase activity (GO:0032312)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|enzyme activator activity (GO:0008047)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	36						TGAGTGGCAGCCCACCTCCCG	0.607																																					p.S770R												.	.	0			c.C2310G	2						.						32.0	37.0	35.0					2																	9528602		2203	4300	6503	9446053	SO:0001583	missense	8853	exon22			AB007860	CCDS1661.1, CCDS46224.1	2p24	2013-01-10	2008-09-22	2008-09-22	ENSG00000151693	ENSG00000151693		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2721	protein-coding gene	gene with protein product	"""centaurin, beta 3"""	603817	"""development and differentiation enhancing factor 2"""	DDEF2		10022920, 9455477	Standard	NM_003887		Approved	KIAA0400, PAP, SHAG1, CENTB3	uc002qzh.2	O43150	OTTHUMG00000117485	ENST00000281419.3:c.2310C>G	2.37:g.9528602C>G	ENSP00000281419:p.Ser770Arg	None		Capture	Illumina HiSeq	Phase_I	9446053	NM_001135191	D6W4Y8	Missense_Mutation	SNP	ENST00000281419.3	37	CCDS1661.1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.345453	0.61073	.	.	ENSG00000151693	ENST00000281419;ENST00000315273	T;T	0.58210	0.42;0.35	5.58	5.58	0.84498	.	0.686444	0.16305	N	0.220295	T	0.42131	0.1189	N	0.14661	0.345	0.47698	D	0.999495	P;P	0.50272	0.763;0.933	B;P	0.44860	0.361;0.462	T	0.44081	-0.9351	10	0.56958	D	0.05	.	14.7398	0.69445	0.0:0.9288:0.0:0.0712	.	770;770	O43150-2;O43150	.;ASAP2_HUMAN	R	770	ENSP00000281419:S770R;ENSP00000316404:S770R	ENSP00000281419:S770R	S	+	3	2	ASAP2	9446053	0.997000	0.39634	1.000000	0.80357	0.705000	0.40729	1.865000	0.39479	2.620000	0.88729	0.561000	0.74099	AGC		ASAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000237522.1	NM_003887	
KHK	3795	broad.mit.edu	37	2	27322321	27322321	+	Silent	SNP	C	C	A	rs142428157	byFrequency	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr2:27322321C>A	ENST00000260599.6	+	7	1200	c.687C>A	c.(685-687)ggC>ggA	p.G229G	CGREF1_ENST00000402550.1_3'UTR|CGREF1_ENST00000452318.2_3'UTR|KHK_ENST00000260598.5_Silent_p.G229G|KHK_ENST00000490823.1_3'UTR	NM_000221.2	NP_000212.1	P50053	KHK_HUMAN	ketohexokinase (fructokinase)	229					carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose catabolic process (GO:0006001)|regulation of glycogen metabolic process (GO:0070873)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ketohexokinase activity (GO:0004454)	p.G229G(4)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGAGGAGGGCGCCGACGCCC	0.652																																					p.G229G												.	.	4	Substitution - coding silent(4)	large_intestine(2)|kidney(2)	c.C687A	2						.						63.0	66.0	65.0					2																	27322321		2203	4300	6503	27175825	SO:0001819	synonymous_variant	3795	exon7				CCDS1734.1, CCDS1735.1	2p23.3-p23.2	2008-02-05			ENSG00000138030	ENSG00000138030	2.7.1.3		6315	protein-coding gene	gene with protein product		614058				7833921	Standard	NM_000221		Approved		uc002rim.2	P50053	OTTHUMG00000097077	ENST00000260599.6:c.687C>A	2.37:g.27322321C>A		Somatic		Capture	Illumina HiSeq	Phase_I	27175825	NM_006488	Q6IBK2|Q99532|Q9BRJ3|Q9UMN1	Silent	SNP	ENST00000260599.6	37	CCDS1734.1																																																																																				KHK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214196.1		
EFEMP1	2202	broad.mit.edu	37	2	56149496	56149496	+	Splice_Site	SNP	G	G	A			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr2:56149496G>A	ENST00000394555.2	-	2	515	c.80C>T	c.(79-81)aCg>aTg	p.T27M	EFEMP1_ENST00000394554.1_Splice_Site_p.T27M|EFEMP1_ENST00000497698.1_5'Flank|EFEMP1_ENST00000355426.3_Splice_Site_p.T27M|EFEMP1_ENST00000424836.2_De_novo_Start_InFrame	NM_001039348.2|NM_001039349.2	NP_001034437.1|NP_001034438.1	Q12805	FBLN3_HUMAN	EGF containing fibulin-like extracellular matrix protein 1	27	EGF-like 1; atypical. {ECO:0000255|PROSITE-ProRule:PRU00076}.				epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|negative regulation of chondrocyte differentiation (GO:0032331)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|epidermal growth factor-activated receptor activity (GO:0005006)	p.T27M(1)		NS(1)|breast(2)|endometrium(4)|large_intestine(6)|lung(5)|ovary(5)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			ACCCCTTACCGTGTACGTGAT	0.443																																					p.T27M	GBM(92;934 1319 7714 28760 40110)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C80T	2						.						158.0	139.0	145.0					2																	56149496		2203	4300	6503	56003000	SO:0001630	splice_region_variant	2202	exon3			U03877	CCDS1857.1	2p16	2013-01-08	2011-01-25		ENSG00000115380	ENSG00000115380		"""Fibulins"""	3218	protein-coding gene	gene with protein product	"""fibulin 3"""	601548	"""fibrillin-like"", ""EGF-containing fibulin-like extracellular matrix protein 1"""	DHRD, FBNL		8812496, 7799918	Standard	NM_001039348		Approved	S1-5, FBLN3, MTLV	uc002rzi.3	Q12805	OTTHUMG00000129343	ENST00000394555.2:c.81+1C>T	2.37:g.56149496G>A		Somatic		Capture	Illumina HiSeq	Phase_I	56003000	NM_001039348	A8K3I4|B4DW75|D6W5D2|Q541U7	Missense_Mutation	SNP	ENST00000394555.2	37	CCDS1857.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.770444	0.90108	.	.	ENSG00000115380	ENST00000394555;ENST00000394554;ENST00000355426;ENST00000438672;ENST00000439193;ENST00000440439;ENST00000429909;ENST00000452337;ENST00000421664;ENST00000424207	D;D;D;T;T;T;T;D;T	0.97752	-1.86;-1.86;-1.86;-1.3;-1.27;-1.13;-1.01;-4.52;-0.89	5.85	5.85	0.93711	.	0.000000	0.64402	D	0.000005	D	0.96390	0.8822	N	0.14661	0.345	0.80722	D	1	D	0.71674	0.998	P	0.54965	0.765	D	0.97395	0.9992	10	0.87932	D	0	.	18.3393	0.90299	0.0:0.0:1.0:0.0	.	27	Q12805	FBLN3_HUMAN	M	27	ENSP00000378058:T27M;ENSP00000378057:T27M;ENSP00000347596:T27M;ENSP00000392055:T27M;ENSP00000408195:T27M;ENSP00000398345:T27M;ENSP00000389319:T27M;ENSP00000399480:T27M;ENSP00000405686:T27M	ENSP00000347596:T27M	T	-	2	0	EFEMP1	56003000	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.456000	0.73501	2.770000	0.95276	0.563000	0.77884	ACG		EFEMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251491.2		Missense_Mutation
ANTXR1	84168	broad.mit.edu	37	2	69409755	69409755	+	Missense_Mutation	SNP	G	G	A	rs149800589		TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr2:69409755G>A	ENST00000303714.4	+	16	1638	c.1316G>A	c.(1315-1317)cGg>cAg	p.R439Q	RNA5SP96_ENST00000516041.1_RNA|RNU6-1216P_ENST00000362590.2_RNA	NM_032208.2	NP_115584.1	Q9H6X2	ANTR1_HUMAN	anthrax toxin receptor 1	439					actin cytoskeleton reorganization (GO:0031532)|reproductive process (GO:0022414)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|integral component of membrane (GO:0016021)|lamellipodium membrane (GO:0031258)	actin filament binding (GO:0051015)|collagen binding (GO:0005518)|metal ion binding (GO:0046872)|transmembrane signaling receptor activity (GO:0004888)	p.R439Q(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(16)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	29						AATATGCGTCGGCCTTCTTCC	0.438									Familial Infantile Hemangioma																												p.R439Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1316A	2						.	G	GLN/ARG	0,4406		0,0,2203	120.0	117.0	118.0		1316	5.0	0.9	2	dbSNP_134	118	2,8598	2.2+/-6.3	0,2,4298	no	missense	ANTXR1	NM_032208.2	43	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	possibly-damaging	439/565	69409755	2,13004	2203	4300	6503	69263259	SO:0001583	missense	84168	exon16	Familial Cancer Database	Infantile Capillary Hemangioma, HCI, Hereditary Capillary Hemangioma	AF421380	CCDS1892.1, CCDS46313.1, CCDS46314.1	2p13.1	2006-04-12			ENSG00000169604	ENSG00000169604			21014	protein-coding gene	gene with protein product	"""anthrax toxin receptor"", ""tumor endothelial marker 8 precursor"""	606410				10947988, 11559528	Standard	NM_032208		Approved	TEM8, FLJ21776, FLJ10601, ATR	uc002sfg.3	Q9H6X2	OTTHUMG00000129575	ENST00000303714.4:c.1316G>A	2.37:g.69409755G>A	ENSP00000301945:p.Arg439Gln	Somatic		Capture	Illumina HiSeq	Phase_I	69263259	NM_032208	A8K7U8|J7K7G4|J7KF88|Q4ZFV6|Q53QD8|Q96P02|Q9NVP3	Missense_Mutation	SNP	ENST00000303714.4	37	CCDS1892.1	.	.	.	.	.	.	.	.	.	.	G	15.47	2.842953	0.51057	0.0	2.33E-4	ENSG00000169604	ENST00000303714	T	0.76316	-1.01	5.84	4.96	0.65561	Anthrax toxin receptor, C-terminal (2);	0.115670	0.56097	D	0.000022	T	0.60983	0.2311	N	0.19112	0.55	0.58432	D	0.999999	D	0.54397	0.966	B	0.41332	0.354	T	0.59820	-0.7382	10	0.28530	T	0.3	-16.9252	9.737	0.40395	0.1515:0.0:0.8485:0.0	.	439	Q9H6X2	ANTR1_HUMAN	Q	439	ENSP00000301945:R439Q	ENSP00000301945:R439Q	R	+	2	0	ANTXR1	69263259	0.439000	0.25610	0.902000	0.35471	0.875000	0.50365	3.104000	0.50306	2.769000	0.95229	0.561000	0.74099	CGG		ANTXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251770.2	NM_032208	
MOGS	7841	broad.mit.edu	37	2	74691819	74691819	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr2:74691819G>A	ENST00000233616.4	-	2	545	c.383C>T	c.(382-384)cCg>cTg	p.P128L	MOGS_ENST00000462443.1_Intron|MOGS_ENST00000452063.2_Missense_Mutation_p.P22L|MOGS_ENST00000409065.1_Missense_Mutation_p.P128L|MOGS_ENST00000535045.1_Intron	NM_006302.2	NP_006293.2	Q13724	MOGS_HUMAN	mannosyl-oligosaccharide glucosidase	128	Required for endoplasmic reticulum targeting. {ECO:0000250}.				cellular protein metabolic process (GO:0044267)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucosidase activity (GO:0015926)|mannosyl-oligosaccharide glucosidase activity (GO:0004573)	p.P128L(1)		cervix(1)|endometrium(6)|large_intestine(3)|lung(10)|prostate(1)|urinary_tract(2)	23						AGGAGTCCCCGGGGTGGTGCC	0.652																																					p.P22L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C65T	2						.						37.0	41.0	40.0					2																	74691819		1936	4143	6079	74545327	SO:0001583	missense	7841	exon3			X87237	CCDS42700.1, CCDS54370.1	2p13.1	2012-01-31			ENSG00000115275	ENSG00000115275	3.2.1.106		24862	protein-coding gene	gene with protein product	"""glucosidase I"", ""processing A-glucosidase I"""	601336				7635146, 8786151	Standard	NM_006302		Approved	GCS1, CWH41, DER7	uc010ffj.3	Q13724	OTTHUMG00000152886	ENST00000233616.4:c.383C>T	2.37:g.74691819G>A	ENSP00000233616:p.Pro128Leu	Somatic		Capture	Illumina HiSeq	Phase_I	74545327	NM_001146158	A8K938|F5H6D0|Q17RN9|Q8TCT5	Missense_Mutation	SNP	ENST00000233616.4	37	CCDS42700.1	.	.	.	.	.	.	.	.	.	.	G	13.57	2.275805	0.40294	.	.	ENSG00000115275	ENST00000233616;ENST00000452063;ENST00000409065;ENST00000448666;ENST00000414701	T;T;T;T;T	0.37058	1.22;1.22;1.22;1.22;1.22	5.13	5.13	0.70059	.	0.256160	0.39615	N	0.001310	T	0.30823	0.0777	L	0.38838	1.175	0.80722	D	1	B	0.13145	0.007	B	0.12837	0.008	T	0.03969	-1.0988	10	0.30078	T	0.28	-4.9398	16.1335	0.81461	0.0:0.0:1.0:0.0	.	128	Q13724	MOGS_HUMAN	L	128;22;128;22;9	ENSP00000233616:P128L;ENSP00000388201:P22L;ENSP00000386493:P128L;ENSP00000410992:P22L;ENSP00000396298:P9L	ENSP00000233616:P128L	P	-	2	0	MOGS	74545327	0.996000	0.38824	0.998000	0.56505	0.995000	0.86356	2.873000	0.48475	2.648000	0.89879	0.655000	0.94253	CCG		MOGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328382.1	NM_006302	
PROM2	150696	broad.mit.edu	37	2	95942072	95942072	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr2:95942072G>A	ENST00000317620.9	+	4	728	c.595G>A	c.(595-597)Ggc>Agc	p.G199S	PROM2_ENST00000463580.1_Intron|PROM2_ENST00000317668.4_Missense_Mutation_p.G199S|PROM2_ENST00000403131.2_Missense_Mutation_p.G199S|PROM2_ENST00000542147.1_Missense_Mutation_p.G199S	NM_001165978.1	NP_001159450.1	Q8N271	PROM2_HUMAN	prominin 2	199					negative regulation of caveolin-mediated endocytosis (GO:2001287)|negative regulation of pinocytosis (GO:0048550)|positive regulation of cell projection organization (GO:0031346)|positive regulation of protein phosphorylation (GO:0001934)|regulation of Cdc42 GTPase activity (GO:0043088)	cell projection (GO:0042995)|cell surface (GO:0009986)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|microspike (GO:0044393)|microvillus (GO:0005902)|prominosome (GO:0071914)	cholesterol binding (GO:0015485)	p.G199S(1)		breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	32						CAGCCTCTGGGGCCTGGTCTC	0.637																																					p.G199S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G595A	2						.						97.0	81.0	87.0					2																	95942072		2203	4300	6503	95305799	SO:0001583	missense	150696	exon4			AF245303	CCDS2012.1	2q11.1	2008-02-05			ENSG00000155066	ENSG00000155066			20685	protein-coding gene	gene with protein product						12514187	Standard	NM_001165978		Approved		uc002sui.3	Q8N271	OTTHUMG00000130393	ENST00000317620.9:c.595G>A	2.37:g.95942072G>A	ENSP00000318270:p.Gly199Ser	Somatic		Capture	Illumina HiSeq	Phase_I	95305799	NM_144707	A8K2V1|Q2HIX6|Q8NB84|Q8TAE2	Missense_Mutation	SNP	ENST00000317620.9	37	CCDS2012.1	.	.	.	.	.	.	.	.	.	.	G	10.65	1.409373	0.25378	.	.	ENSG00000155066	ENST00000403131;ENST00000317668;ENST00000317620;ENST00000542147	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	4.68	2.73	0.32206	.	0.087556	0.48286	D	0.000182	T	0.33235	0.0856	L	0.59912	1.85	0.35284	D	0.781637	P	0.43788	0.817	B	0.42882	0.401	T	0.38672	-0.9650	10	0.09338	T	0.73	-20.7744	5.6356	0.17534	0.1096:0.2008:0.6896:0.0	.	199	Q8N271	PROM2_HUMAN	S	199	ENSP00000385716:G199S;ENSP00000318520:G199S;ENSP00000318270:G199S;ENSP00000442542:G199S	ENSP00000318270:G199S	G	+	1	0	PROM2	95305799	0.975000	0.34042	0.925000	0.36789	0.389000	0.30415	1.885000	0.39678	0.947000	0.37659	0.462000	0.41574	GGC		PROM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252771.1	NM_144707	
INPP4A	3631	broad.mit.edu	37	2	99175935	99175935	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr2:99175935C>A	ENST00000523221.1	+	16	1847	c.1847C>A	c.(1846-1848)cCc>cAc	p.P616H	INPP4A_ENST00000545415.1_Missense_Mutation_p.P577H|INPP4A_ENST00000074304.5_Missense_Mutation_p.P616H|INPP4A_ENST00000409016.4_Missense_Mutation_p.P577H|INPP4A_ENST00000409540.3_Missense_Mutation_p.P577H|INPP4A_ENST00000409463.1_Intron|INPP4A_ENST00000409851.3_Missense_Mutation_p.P611H			Q96PE3	INP4A_HUMAN	inositol polyphosphate-4-phosphatase, type I, 107kDa	616					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)	p.P616H(1)		breast(1)|endometrium(9)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(4)|upper_aerodigestive_tract(4)	43						GATTGCAGTCCCCCTCCTGAA	0.493																																					p.P611H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1832A	2						.						116.0	111.0	112.0					2																	99175935		2002	4193	6195	98542367	SO:0001583	missense	3631	exon17			U26398	CCDS46369.1, CCDS46370.1, CCDS46371.1, CCDS46372.1	2q11.2	2008-05-27	2002-08-29		ENSG00000040933	ENSG00000040933			6074	protein-coding gene	gene with protein product		600916	"""inositol polyphosphate-4-phosphatase, type I, 107kD"""	INPP4		7608176, 9295334	Standard	NM_004027		Approved		uc002syy.3	Q96PE3	OTTHUMG00000153106	ENST00000523221.1:c.1847C>A	2.37:g.99175935C>A	ENSP00000427722:p.Pro616His	Somatic		Capture	Illumina HiSeq	Phase_I	98542367	NM_001134225	O15326|Q13187|Q53TD8|Q8TC02	Missense_Mutation	SNP	ENST00000523221.1	37	CCDS46369.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.203062	0.79127	.	.	ENSG00000040933	ENST00000409016;ENST00000409851;ENST00000074304;ENST00000545415;ENST00000409540;ENST00000523221	T;T;T;T;T;T	0.19105	2.17;2.17;2.17;2.17;2.17;2.17	5.35	5.35	0.76521	.	0.240692	0.43260	D	0.000587	T	0.28764	0.0713	L	0.29908	0.895	0.48452	D	0.999652	P;P;P;P	0.52170	0.573;0.874;0.898;0.951	P;P;P;P	0.53760	0.542;0.561;0.661;0.734	T	0.00314	-1.1824	10	0.38643	T	0.18	-16.8862	18.5892	0.91202	0.0:1.0:0.0:0.0	.	577;577;616;611	Q96PE3-2;Q96PE3-4;Q96PE3;Q96PE3-3	.;.;INP4A_HUMAN;.	H	577;611;616;577;577;616	ENSP00000386704:P577H;ENSP00000386777:P611H;ENSP00000074304:P616H;ENSP00000442149:P577H;ENSP00000387294:P577H;ENSP00000427722:P616H	ENSP00000074304:P616H	P	+	2	0	INPP4A	98542367	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.979000	0.70508	2.941000	0.99782	0.655000	0.94253	CCC		INPP4A-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376095.1	NM_001566	
PRR21	643905	broad.mit.edu	37	2	240981996	240981996	+	Missense_Mutation	SNP	G	G	C	rs568535538|rs78477080	byFrequency	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr2:240981996G>C	ENST00000408934.1	-	1	403	c.404C>G	c.(403-405)cCt>cGt	p.P135R		NM_001080835.1	NP_001074304.1	Q8WXC7	PRR21_HUMAN	proline rich 21	135	Pro-rich.							p.P135R(4)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(5)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	29						GAGGCATGGAGGAAGGGCCGT	0.642																																					p.P135R												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.C404G	2						.						3.0	3.0	3.0					2																	240981996		1158	2510	3668	240630669	SO:0001583	missense	643905	exon1			AF453950	CCDS33417.1	2q37.3	2009-04-20			ENSG00000221961	ENSG00000221961			33866	protein-coding gene	gene with protein product							Standard	NM_001080835		Approved		uc010zod.2	Q8WXC7	OTTHUMG00000159174	ENST00000408934.1:c.404C>G	2.37:g.240981996G>C	ENSP00000386166:p.Pro135Arg	Somatic		Capture	Illumina HiSeq	Phase_I	240630669	NM_001080835		Missense_Mutation	SNP	ENST00000408934.1	37	CCDS33417.1	.	.	.	.	.	.	.	.	.	.	N	0.004	-2.241787	0.00274	.	.	ENSG00000221961	ENST00000408934;ENST00000486799	T;T	0.13307	2.6;2.6	1.73	-3.46	0.04767	.	.	.	.	.	T	0.06280	0.0162	N	0.08118	0	0.09310	N	1	B	0.16802	0.019	B	0.22753	0.041	T	0.44283	-0.9338	9	0.13853	T	0.58	.	11.1434	0.48415	0.0:0.0:0.7795:0.2205	.	135	Q8WXC7	PRR21_HUMAN	R	135	ENSP00000386166:P135R;ENSP00000418240:P135R	ENSP00000386166:P135R	P	-	2	0	PRR21	240630669	.	.	0.000000	0.03702	0.000000	0.00434	.	.	-2.073000	0.00878	-1.240000	0.01540	CCT		PRR21-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080835	
GRM7	2917	broad.mit.edu	37	3	7620629	7620629	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr3:7620629G>A	ENST00000357716.4	+	8	2310	c.2036G>A	c.(2035-2037)cGg>cAg	p.R679Q	GRM7_ENST00000403881.1_Missense_Mutation_p.R679Q|GRM7_ENST00000458641.2_3'UTR|GRM7_ENST00000389336.4_Missense_Mutation_p.R679Q|GRM7_ENST00000402647.2_Missense_Mutation_p.R679Q|GRM7_ENST00000486284.1_Missense_Mutation_p.R679Q	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7	679					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)	p.R679Q(2)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						AAAACAAATCGGATTTATCGC	0.443																																					p.R679Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2036A	3						.						101.0	89.0	93.0					3																	7620629		2203	4300	6503	7595629	SO:0001583	missense	2917	exon8			U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.2036G>A	3.37:g.7620629G>A	ENSP00000350348:p.Arg679Gln	Somatic		Capture	Illumina HiSeq	Phase_I	7595629	NM_000844	Q8NFS2|Q8NFS3|Q8NFS4	Missense_Mutation	SNP	ENST00000357716.4	37	CCDS43042.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.347946	0.82022	.	.	ENSG00000196277	ENST00000357716;ENST00000486284;ENST00000389336;ENST00000403881;ENST00000525747;ENST00000402647;ENST00000413492	D;D;D;D;D	0.90004	-2.6;-2.6;-2.6;-2.6;-2.6	6.17	6.17	0.99709	GPCR, family 3, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.95815	0.8638	M	0.89601	3.045	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.998;0.999;0.997;1.0	D;D;D;D;D	0.87578	0.982;0.986;0.994;0.979;0.998	D	0.95668	0.8721	10	0.72032	D	0.01	.	19.4432	0.94831	0.0:0.0:1.0:0.0	.	679;679;434;679;679	B7ZKK0;Q14831-5;Q59G95;Q14831;Q14831-2	.;.;.;GRM7_HUMAN;.	Q	679	ENSP00000350348:R679Q;ENSP00000417536:R679Q;ENSP00000373987:R679Q;ENSP00000385664:R679Q;ENSP00000384585:R679Q	ENSP00000350348:R679Q	R	+	2	0	GRM7	7595629	1.000000	0.71417	1.000000	0.80357	0.353000	0.29299	9.869000	0.99810	2.941000	0.99782	0.655000	0.94253	CGG		GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246895.3	NM_000844	
SCN10A	6336	broad.mit.edu	37	3	38766793	38766793	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr3:38766793G>A	ENST00000449082.2	-	17	3099	c.3100C>T	c.(3100-3102)Cag>Tag	p.Q1034*		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	1034					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.Q1034*(1)		NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	TCGACTTGCTGCAGCTGCTCC	0.577																																					p.Q1034X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C3100T	3						.						53.0	48.0	50.0					3																	38766793		2203	4300	6503	38741797	SO:0001587	stop_gained	6336	exon17			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.3100C>T	3.37:g.38766793G>A	ENSP00000390600:p.Gln1034*	Somatic		Capture	Illumina HiSeq	Phase_I	38741797	NM_006514	A6NDQ1	Nonsense_Mutation	SNP	ENST00000449082.2	37	CCDS33736.1	.	.	.	.	.	.	.	.	.	.	G	38	6.672007	0.97751	.	.	ENSG00000185313	ENST00000449082	.	.	.	3.83	3.83	0.44106	.	3.257120	0.00644	N	0.000523	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	11.5803	0.50887	0.0:0.0:1.0:0.0	.	.	.	.	X	1034	.	ENSP00000390600:Q1034X	Q	-	1	0	SCN10A	38741797	0.143000	0.22626	0.969000	0.41365	0.430000	0.31655	2.676000	0.46883	2.457000	0.83068	0.555000	0.69702	CAG		SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514	
VPRBP	9730	broad.mit.edu	37	3	51440754	51440754	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr3:51440754C>T	ENST00000335891.5	-	16	2950	c.2941G>A	c.(2941-2943)Gac>Aac	p.D981N				Q9Y4B6	VPRBP_HUMAN	Vpr (HIV-1) binding protein	1430					B cell differentiation (GO:0030183)|cell competition in a multicellular organism (GO:0035212)|histone H2A-T120 phosphorylation (GO:1990245)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone kinase activity (H2A-T120 specific) (GO:1990244)	p.D1434N(1)		breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		AGCAACTGGTCAGTGTCAAGC	0.468																																					p.D1376N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4126A	3						.						114.0	114.0	114.0					3																	51440754		2178	4277	6455	51415794	SO:0001583	missense	9730	exon22			AB018343	CCDS74943.1, CCDS74944.1	3p21.2	2011-06-17			ENSG00000145041	ENSG00000145041		"""DDB1 and CUL4 associated factors"""	30911	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 1"""					8195203, 11223251	Standard	NM_014703		Approved	KIAA0800, MGC102804, DCAF1	uc003dbe.2	Q9Y4B6	OTTHUMG00000156895	ENST00000335891.5:c.2941G>A	3.37:g.51440754C>T	ENSP00000338857:p.Asp981Asn	Somatic		Capture	Illumina HiSeq	Phase_I	51415794	NM_001171904	Q2YD74|Q8TBD9|Q9HCA1|Q9UG37	Missense_Mutation	SNP	ENST00000335891.5	37		.	.	.	.	.	.	.	.	.	.	C	19.13	3.767898	0.69878	.	.	ENSG00000145041	ENST00000423656;ENST00000335891	T;T	0.58506	0.33;0.33	5.87	5.87	0.94306	.	0.222568	0.52532	D	0.000071	T	0.57873	0.2083	N	0.08118	0	0.80722	D	1	D	0.67145	0.996	D	0.73708	0.981	T	0.57888	-0.7733	10	0.21540	T	0.41	-16.0132	18.3838	0.90459	0.0:1.0:0.0:0.0	.	1430	Q9Y4B6	VPRBP_HUMAN	N	1001;981	ENSP00000393183:D1001N;ENSP00000338857:D981N	ENSP00000338857:D981N	D	-	1	0	VPRBP	51415794	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.487000	0.73633	2.785000	0.95823	0.650000	0.86243	GAC		VPRBP-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_014703	
MITF	4286	broad.mit.edu	37	3	70008541	70008541	+	Silent	SNP	C	C	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr3:70008541C>T	ENST00000448226.2	+	9	1276	c.1149C>T	c.(1147-1149)caC>caT	p.H383H	MITF_ENST00000394355.2_Silent_p.H352H|MITF_ENST00000314589.5_Silent_p.H361H|MITF_ENST00000531774.1_Silent_p.H214H|MITF_ENST00000352241.4_Silent_p.H377H|MITF_ENST00000328528.6_Silent_p.H376H|MITF_ENST00000472437.1_Silent_p.H325H|MITF_ENST00000394351.3_Silent_p.H276H|MITF_ENST00000314557.6_Silent_p.H270H			O75030	MITF_HUMAN	microphthalmia-associated transcription factor	383	Leucine-zipper.				bone remodeling (GO:0046849)|camera-type eye development (GO:0043010)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cell fate commitment (GO:0045165)|melanocyte differentiation (GO:0030318)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)	p.H276H(1)		NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(6)|stomach(1)|urinary_tract(2)	30		Lung NSC(201;0.0384)|Prostate(884;0.0526)		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)		AACTGGAGCACGCCAACCGGC	0.443			A		melanoma		"""Waardenburg syndrome type 2, Tietz syndrome"""																														p.H270H	Melanoma(29;269 969 31479 41502 42961)		Dom	yes		3	3p14.1	4286	microphthalmia-associated transcription factor	yes	E	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C810T	3						.						81.0	71.0	75.0					3																	70008541		2203	4300	6503	70091231	SO:0001819	synonymous_variant	4286	exon8				CCDS2913.1, CCDS43106.1, CCDS43107.1, CCDS46865.1, CCDS46866.1, CCDS46866.2, CCDS54607.1, CCDS74962.1	3p14.1-p12.3	2014-09-17			ENSG00000187098	ENSG00000187098		"""Basic helix-loop-helix proteins"""	7105	protein-coding gene	gene with protein product	"""homolog of mouse microphthalmia"""	156845	"""Waardenburg syndrome, type 2A"""	WS2A, WS2		8069297, 7874167, 7951321	Standard	NM_198159		Approved	MI, bHLHe32	uc003dnz.3	O75030	OTTHUMG00000149921	ENST00000448226.2:c.1149C>T	3.37:g.70008541C>T		Somatic		Capture	Illumina HiSeq	Phase_I	70091231	NM_198158	B4DJL2|D3K197|E9PFN0|Q14841|Q9P2V0|Q9P2V1|Q9P2V2|Q9P2Y8	Silent	SNP	ENST00000448226.2	37																																																																																					MITF-007	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000313947.1	NM_198159	
PPM1L	151742	broad.mit.edu	37	3	160786842	160786842	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr3:160786842G>T	ENST00000498165.1	+	4	1081	c.980G>T	c.(979-981)gGg>gTg	p.G327V	PPM1L_ENST00000480117.1_3'UTR|PPM1L_ENST00000295839.9_Missense_Mutation_p.G200V|PPM1L_ENST00000464260.1_Missense_Mutation_p.G148V	NM_139245.2	NP_640338.2	Q5SGD2	PPM1L_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1L	327	PP2C-like.				MAPK cascade (GO:0000165)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)	p.G327V(1)|p.G148V(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	13			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			CCTCACTTTGGGGCCAAGAGC	0.453																																					p.G327V	Pancreas(86;250 1994 13715 43211)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G980T	3						.						77.0	74.0	75.0					3																	160786842		2203	4300	6503	162269536	SO:0001583	missense	151742	exon4			AK055115	CCDS33886.1	3q26.1	2012-04-17	2010-03-05		ENSG00000163590	ENSG00000163590	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	16381	protein-coding gene	gene with protein product	"""PP2Cepsilon"", ""Protein phosphatase 2C epsilon isoform"""	611931	"""protein phosphatase 1 (formerly 2C)-like"""			12556533	Standard	XM_006713507		Approved	PP2CE	uc003fdr.3	Q5SGD2	OTTHUMG00000159048	ENST00000498165.1:c.980G>T	3.37:g.160786842G>T	ENSP00000417659:p.Gly327Val	Somatic		Capture	Illumina HiSeq	Phase_I	162269536	NM_139245	Q2M3J2|Q96NM7	Missense_Mutation	SNP	ENST00000498165.1	37	CCDS33886.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.350328	0.82132	.	.	ENSG00000163590	ENST00000498165;ENST00000464260;ENST00000295839	T;T;T	0.13196	2.61;2.61;2.61	5.07	5.07	0.68467	Protein phosphatase 2C-like (5);	0.045544	0.85682	D	0.000000	T	0.30070	0.0753	L	0.42686	1.345	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.77004	0.955;0.989	T	0.00975	-1.1494	10	0.33940	T	0.23	.	17.4299	0.87536	0.0:0.0:1.0:0.0	.	200;327	Q5SGD2-3;Q5SGD2	.;PPM1L_HUMAN	V	327;148;200	ENSP00000417659:G327V;ENSP00000420746:G148V;ENSP00000295839:G200V	ENSP00000295839:G200V	G	+	2	0	PPM1L	162269536	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.447000	0.97595	2.354000	0.79902	0.650000	0.86243	GGG		PPM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353019.1	NM_139245	
EVC2	132884	broad.mit.edu	37	4	5687116	5687116	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr4:5687116G>T	ENST00000344408.5	-	6	850	c.797C>A	c.(796-798)aCc>aAc	p.T266N	EVC2_ENST00000344938.1_Missense_Mutation_p.T266N|EVC2_ENST00000310917.2_Missense_Mutation_p.T186N	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	266					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.T266N(1)		NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						GCTCTGAAAGGTGAGTTGGGC	0.537																																					p.T186N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C557A	4						.						154.0	144.0	147.0					4																	5687116		2203	4300	6503	5738017	SO:0001583	missense	132884	exon6			AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.797C>A	4.37:g.5687116G>T	ENSP00000342144:p.Thr266Asn	Somatic		Capture	Illumina HiSeq	Phase_I	5738017	NM_001166136	Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	SNP	ENST00000344408.5	37	CCDS3382.2	.	.	.	.	.	.	.	.	.	.	G	11.53	1.666423	0.29604	.	.	ENSG00000173040	ENST00000344938;ENST00000310917;ENST00000344408	T;T;T	0.81247	-1.47;-1.47;-1.47	4.52	2.72	0.32119	.	0.469628	0.21769	N	0.069395	T	0.80803	0.4693	L	0.55481	1.735	0.23903	N	0.99652	D	0.58268	0.982	P	0.55055	0.767	T	0.70880	-0.4752	10	0.66056	D	0.02	-3.6761	5.7452	0.18116	0.112:0.1998:0.6882:0.0	.	266	Q86UK5	LBN_HUMAN	N	266;186;266	ENSP00000339954:T266N;ENSP00000311683:T186N;ENSP00000342144:T266N	ENSP00000311683:T186N	T	-	2	0	EVC2	5738017	1.000000	0.71417	0.086000	0.20670	0.062000	0.15995	2.275000	0.43399	0.424000	0.26061	0.655000	0.94253	ACC		EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289822.2	NM_147127	
PPP2R2C	5522	broad.mit.edu	37	4	6325204	6325204	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr4:6325204G>A	ENST00000382599.4	-	9	1385	c.1169C>T	c.(1168-1170)cCa>cTa	p.P390L	PPP2R2C_ENST00000506140.1_Missense_Mutation_p.P383L|PPP2R2C_ENST00000335585.5_Missense_Mutation_p.P390L|PPP2R2C_ENST00000515571.1_Missense_Mutation_p.P373L|PPP2R2C_ENST00000507294.1_Missense_Mutation_p.P383L			Q9Y2T4	2ABG_HUMAN	protein phosphatase 2, regulatory subunit B, gamma	390					regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)	p.P390L(1)		central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	28						CACGCGCCGTGGCTTGAGCAC	0.632																																					p.P390L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1169T	4						.						70.0	64.0	66.0					4																	6325204		2203	4300	6503	6376105	SO:0001583	missense	5522	exon9			AF086924	CCDS3388.1, CCDS56304.1, CCDS56305.1, CCDS3387.1	4p16.1	2013-01-10	2010-04-14		ENSG00000074211	ENSG00000074211	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9306	protein-coding gene	gene with protein product	"""PP2A subunit B isoform gamma"""	605997	"""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform"""			10574460, 10945473	Standard	NM_020416		Approved	PR52, IMYPNO, MGC33570, PR55G	uc003gja.3	Q9Y2T4	OTTHUMG00000090445	ENST00000382599.4:c.1169C>T	4.37:g.6325204G>A	ENSP00000372042:p.Pro390Leu	Somatic		Capture	Illumina HiSeq	Phase_I	6376105	NM_020416	A8MSY7|B7Z3Y1|Q7Z4V7|Q8NEC4|Q9H3G7	Missense_Mutation	SNP	ENST00000382599.4	37		.	.	.	.	.	.	.	.	.	.	G	23.4	4.407198	0.83230	.	.	ENSG00000074211	ENST00000335585;ENST00000506140;ENST00000515571;ENST00000382599;ENST00000507294	T;T;T;T;T	0.31510	1.49;1.49;1.5;1.49;1.49	4.45	4.45	0.53987	WD40 repeat-like-containing domain (1);	0.056209	0.64402	D	0.000001	T	0.39064	0.1064	L	0.46157	1.445	0.80722	D	1	P;P;P;P	0.45634	0.863;0.863;0.779;0.863	P;P;P;P	0.49477	0.612;0.558;0.612;0.558	T	0.32771	-0.9894	10	0.66056	D	0.02	-40.4798	16.2691	0.82606	0.0:0.0:1.0:0.0	.	383;390;373;390	B7Z3Y1;Q9Y2T4;Q9Y2T4-3;Q9Y2T4-2	.;2ABG_HUMAN;.;.	L	390;383;373;390;383	ENSP00000335083:P390L;ENSP00000423649:P383L;ENSP00000422374:P373L;ENSP00000372042:P390L;ENSP00000425247:P383L	ENSP00000335083:P390L	P	-	2	0	PPP2R2C	6376105	1.000000	0.71417	0.992000	0.48379	0.844000	0.47949	6.709000	0.74665	2.304000	0.77564	0.555000	0.69702	CCA		PPP2R2C-001	NOVEL	overlapping_uORF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206889.2	NM_181876	
CORIN	10699	broad.mit.edu	37	4	47663795	47663795	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr4:47663795A>C	ENST00000273857.4	-	12	1667	c.1668T>G	c.(1666-1668)gaT>gaG	p.D556E	CORIN_ENST00000502252.1_Missense_Mutation_p.D489E|CORIN_ENST00000504584.1_Missense_Mutation_p.D519E|CORIN_ENST00000508498.1_Missense_Mutation_p.D417E|CORIN_ENST00000505909.1_Missense_Mutation_p.D519E	NM_006587.2	NP_006578.2	Q9Y5Q5	CORIN_HUMAN	corin, serine peptidase	556	FZ 2. {ECO:0000255|PROSITE- ProRule:PRU00090}.				female pregnancy (GO:0007565)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of blood pressure (GO:0008217)|regulation of renal sodium excretion (GO:0035813)|regulation of systemic arterial blood pressure by atrial natriuretic peptide (GO:0003050)	cell surface (GO:0009986)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)	p.D556E(1)		NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(18)|lung(39)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	79						ATTGACTGCAATCTGTGTCTT	0.408																																					p.D556E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1668G	4						.						101.0	98.0	99.0					4																	47663795		2203	4300	6503	47358552	SO:0001583	missense	10699	exon12			AF133845	CCDS3477.1, CCDS63958.1, CCDS75122.1	4p13-p12	2011-08-31	2005-08-17		ENSG00000145244	ENSG00000145244		"""Serine peptidases / Transmembrane"""	19012	protein-coding gene	gene with protein product		605236	"""corin, serine protease"""			10329693	Standard	NM_006587		Approved	PRSC, CRN, ATC2, Lrp4, TMPRSS10	uc003gxm.3	Q9Y5Q5	OTTHUMG00000099441	ENST00000273857.4:c.1668T>G	4.37:g.47663795A>C	ENSP00000273857:p.Asp556Glu	Somatic		Capture	Illumina HiSeq	Phase_I	47358552	NM_006587	B0ZBE3|Q2TBD2|Q4W5E5|Q4W5G6|Q9UHY2	Missense_Mutation	SNP	ENST00000273857.4	37	CCDS3477.1	.	.	.	.	.	.	.	.	.	.	A	16.45	3.126454	0.56721	.	.	ENSG00000145244	ENST00000273857;ENST00000508498;ENST00000502252;ENST00000505909;ENST00000504584	T;T;T;T;T	0.80033	-1.33;-1.33;-1.33;-1.33;-1.33	5.9	-7.5	0.01351	Frizzled domain (5);	0.101773	0.64402	D	0.000005	T	0.81288	0.4791	L	0.42744	1.35	0.39956	D	0.974601	D;D;D;D	0.89917	1.0;0.984;1.0;1.0	D;P;D;D	0.91635	0.998;0.847;0.99;0.999	T	0.83349	-0.0004	10	0.51188	T	0.08	.	13.6729	0.62436	0.2582:0.0959:0.6459:0.0	.	519;519;489;556	B7Z4R1;B4E2W9;B4E1Y7;Q9Y5Q5	.;.;.;CORIN_HUMAN	E	556;417;489;519;519	ENSP00000273857:D556E;ENSP00000425597:D417E;ENSP00000424212:D489E;ENSP00000425401:D519E;ENSP00000423216:D519E	ENSP00000273857:D556E	D	-	3	2	CORIN	47358552	0.917000	0.31117	0.857000	0.33713	0.288000	0.27193	-0.026000	0.12392	-1.335000	0.02241	-0.248000	0.11899	GAT		CORIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216906.2		
SPP1	6696	broad.mit.edu	37	4	88903925	88903925	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr4:88903925C>A	ENST00000395080.3	+	7	949	c.822C>A	c.(820-822)caC>caA	p.H274Q	SPP1_ENST00000237623.7_Missense_Mutation_p.H260Q|SPP1_ENST00000509659.1_3'UTR|SPP1_ENST00000360804.4_Missense_Mutation_p.H247Q	NM_001040058.1|NM_001251830.1	NP_001035147.1|NP_001238759.1	P10451	OSTP_HUMAN	secreted phosphoprotein 1	274					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|negative regulation of collateral sprouting of intact axon in response to injury (GO:0048685)|neutrophil chemotaxis (GO:0030593)|osteoblast differentiation (GO:0001649)|positive regulation of bone resorption (GO:0045780)|positive regulation of cell-substrate adhesion (GO:0010811)|response to steroid hormone (GO:0048545)|response to vitamin D (GO:0033280)	apical part of cell (GO:0045177)|cell projection (GO:0042995)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix binding (GO:0050840)	p.H274Q(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(3)|skin(1)	13		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-05)		GTGAATTCCACAGCCATGAAT	0.398																																					p.H260Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C780A	4						.						113.0	121.0	118.0					4																	88903925		2203	4300	6503	89122949	SO:0001583	missense	6696	exon6				CCDS3626.1, CCDS34027.1, CCDS43250.1	4q22.1	2014-01-30	2008-07-31		ENSG00000118785	ENSG00000118785		"""Endogenous ligands"""	11255	protein-coding gene	gene with protein product	"""early T-lymphocyte activation 1"""	166490	"""osteopontin"", ""bone sialoprotein I"""	BNSP, OPN		1575754	Standard	NM_001251829		Approved	BSPI, ETA-1	uc003hra.3	P10451	OTTHUMG00000130599	ENST00000395080.3:c.822C>A	4.37:g.88903925C>A	ENSP00000378517:p.His274Gln	Somatic		Capture	Illumina HiSeq	Phase_I	89122949	NM_000582	B2RDA1|Q15681|Q15682|Q15683|Q4W597|Q567T5|Q8NBK2|Q96IZ1	Missense_Mutation	SNP	ENST00000395080.3	37	CCDS43250.1	.	.	.	.	.	.	.	.	.	.	C	3.097	-0.185524	0.06340	.	.	ENSG00000118785	ENST00000359072;ENST00000535912;ENST00000237623;ENST00000395080;ENST00000360804;ENST00000508233	T;T;T;T	0.26518	1.73;1.73;1.73;1.73	5.24	-2.73	0.05950	.	1.623460	0.03752	N	0.256712	T	0.06325	0.0163	N	0.00841	-1.15	0.09310	N	1	B;B;B;B;B	0.21225	0.004;0.053;0.004;0.003;0.004	B;B;B;B;B	0.27262	0.004;0.078;0.004;0.01;0.015	T	0.13176	-1.0519	10	0.06891	T	0.86	-0.139	0.3961	0.00418	0.2485:0.2782:0.2395:0.2338	.	287;233;260;247;274	B7Z351;Q3LGB0;B2RDA1;Q567T5;P10451	.;.;.;.;OSTP_HUMAN	Q	252;233;260;274;247;233	ENSP00000237623:H260Q;ENSP00000378517:H274Q;ENSP00000354042:H247Q;ENSP00000422973:H233Q	ENSP00000237623:H260Q	H	+	3	2	SPP1	89122949	0.005000	0.15991	0.002000	0.10522	0.280000	0.26924	-0.189000	0.09629	-1.137000	0.02888	0.643000	0.83706	CAC		SPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253048.3		
GSTCD	79807	broad.mit.edu	37	4	106755642	106755642	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr4:106755642G>C	ENST00000515279.1	+	9	1775	c.1555G>C	c.(1555-1557)Gca>Cca	p.A519P	GSTCD_ENST00000360505.5_Missense_Mutation_p.A519P|GSTCD_ENST00000515255.1_3'UTR|GSTCD_ENST00000394730.3_Missense_Mutation_p.A432P|GSTCD_ENST00000394728.3_Missense_Mutation_p.A519P			Q8NEC7	GSTCD_HUMAN	glutathione S-transferase, C-terminal domain containing	519						extracellular vesicular exosome (GO:0070062)		p.A432P(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|skin(1)	14		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.15e-07)|READ - Rectum adenocarcinoma(30;0.139)		TTGTGGAGTGGCAACAGACAT	0.408																																					p.A432P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1294C	4						.						247.0	243.0	244.0					4																	106755642		1982	4183	6165	106975091	SO:0001583	missense	79807	exon9			BC032942	CCDS3672.2, CCDS43257.1	4q24	2008-02-05	2006-05-09		ENSG00000138780	ENSG00000138780			25806	protein-coding gene	gene with protein product		615912	"""Glutathione S-transferase, C-terminal domain containing"""			12477932	Standard	NM_001031720		Approved	FLJ13273	uc003hxz.4	Q8NEC7	OTTHUMG00000131211	ENST00000515279.1:c.1555G>C	4.37:g.106755642G>C	ENSP00000422354:p.Ala519Pro	Somatic		Capture	Illumina HiSeq	Phase_I	106975091	NM_024751	A8K8J0|A8MVD3|H9KV97|Q9H8S3	Missense_Mutation	SNP	ENST00000515279.1	37	CCDS43257.1	.	.	.	.	.	.	.	.	.	.	G	33	5.272286	0.95429	.	.	ENSG00000138780	ENST00000394730;ENST00000515279;ENST00000360505;ENST00000394728	T;T;T;T	0.55413	0.52;0.52;0.52;0.52	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.78214	0.4248	M	0.87682	2.9	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.81189	-0.1046	10	0.87932	D	0	-18.7136	19.8955	0.96956	0.0:0.0:1.0:0.0	.	519;142	Q8NEC7;B7Z8J7	GSTCD_HUMAN;.	P	432;519;519;519	ENSP00000378218:A432P;ENSP00000422354:A519P;ENSP00000353695:A519P;ENSP00000378216:A519P	ENSP00000353695:A519P	A	+	1	0	GSTCD	106975091	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.371000	0.97162	2.712000	0.92718	0.585000	0.79938	GCA		GSTCD-006	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363981.1	NM_024751	
CDO1	1036	broad.mit.edu	37	5	115152030	115152030	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr5:115152030A>G	ENST00000250535.4	-	1	621	c.65T>C	c.(64-66)cTc>cCc	p.L22P	CDO1_ENST00000502631.1_Intron	NM_001801.2	NP_001792.2	Q16878	CDO1_HUMAN	cysteine dioxygenase type 1	22					cellular nitrogen compound metabolic process (GO:0034641)|cysteine metabolic process (GO:0006534)|inflammatory response (GO:0006954)|L-cysteine catabolic process (GO:0019448)|lactation (GO:0007595)|oxidation-reduction process (GO:0055114)|response to amino acid (GO:0043200)|response to cAMP (GO:0051591)|response to ethanol (GO:0045471)|response to glucagon (GO:0033762)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|sulfur amino acid biosynthetic process (GO:0000097)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)|taurine biosynthetic process (GO:0042412)	cytosol (GO:0005829)	cysteine dioxygenase activity (GO:0017172)|ferrous iron binding (GO:0008198)	p.L22P(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(1)|skin(5)	11		all_cancers(142;0.0046)|all_epithelial(76;0.000161)|Prostate(80;0.0132)|Ovarian(225;0.0776)		OV - Ovarian serous cystadenocarcinoma(64;7.8e-08)|Epithelial(69;7.32e-07)|all cancers(49;3.24e-05)	L-Cysteine(DB00151)	GCCGGCAAAGAGCTGGTGCAG	0.612																																					p.L22P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T65C	5						.						175.0	165.0	168.0					5																	115152030		2202	4300	6502	115179929	SO:0001583	missense	1036	exon1				CCDS4121.1	5q23.2	2013-06-11	2013-06-11		ENSG00000129596	ENSG00000129596	1.13.11.20		1795	protein-coding gene	gene with protein product		603943	"""cysteine dioxygenase, type I"""			7524679	Standard	NM_001801		Approved		uc003krg.3	Q16878	OTTHUMG00000128891	ENST00000250535.4:c.65T>C	5.37:g.115152030A>G	ENSP00000250535:p.Leu22Pro	Somatic		Capture	Illumina HiSeq	Phase_I	115179929	NM_001801	B2RAK4|P78513|Q6FHZ8|Q8TB64	Missense_Mutation	SNP	ENST00000250535.4	37	CCDS4121.1	.	.	.	.	.	.	.	.	.	.	A	14.17	2.454611	0.43634	.	.	ENSG00000129596	ENST00000250535	T	0.46451	0.87	5.3	4.05	0.47172	Cupin, RmlC-type (1);	0.115539	0.56097	D	0.000036	T	0.43344	0.1243	L	0.54323	1.7	0.80722	D	1	P	0.48834	0.916	P	0.48063	0.565	T	0.30475	-0.9977	10	0.36615	T	0.2	2.0708	11.0692	0.47993	0.8612:0.0:0.0:0.1388	.	22	Q16878	CDO1_HUMAN	P	22	ENSP00000250535:L22P	ENSP00000250535:L22P	L	-	2	0	CDO1	115179929	1.000000	0.71417	1.000000	0.80357	0.206000	0.24218	6.691000	0.74573	2.132000	0.65825	0.528000	0.53228	CTC		CDO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250853.2	NM_001801	
PCDHB1	29930	broad.mit.edu	37	5	140432731	140432731	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr5:140432731G>A	ENST00000306549.3	+	1	1753	c.1676G>A	c.(1675-1677)cGt>cAt	p.R559H		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	559	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R559H(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AATGACAATCGTCCAATGATC	0.502																																					p.R559H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1676A	5						.						108.0	101.0	103.0					5																	140432731		2203	4300	6503	140412915	SO:0001583	missense	29930	exon1			AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.1676G>A	5.37:g.140432731G>A	ENSP00000307234:p.Arg559His	Somatic		Capture	Illumina HiSeq	Phase_I	140412915	NM_013340	Q2M257	Missense_Mutation	SNP	ENST00000306549.3	37	CCDS4243.1	.	.	.	.	.	.	.	.	.	.	G	12.15	1.851559	0.32699	.	.	ENSG00000171815	ENST00000306549	T	0.59502	0.26	6.08	4.22	0.49857	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	0.457422	0.18413	N	0.141992	T	0.40694	0.1127	N	0.26092	0.79	0.09310	N	1	P	0.49358	0.923	B	0.38156	0.266	T	0.44817	-0.9303	10	0.87932	D	0	.	9.9289	0.41510	0.0:0.2071:0.5853:0.2075	.	559	Q9Y5F3	PCDB1_HUMAN	H	559	ENSP00000307234:R559H	ENSP00000307234:R559H	R	+	2	0	PCDHB1	140412915	0.002000	0.14202	0.994000	0.49952	0.993000	0.82548	1.132000	0.31418	2.894000	0.99253	0.655000	0.94253	CGT		PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251822.2	NM_013340	
PCDHGB2	56103	broad.mit.edu	37	5	140742077	140742077	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr5:140742077A>T	ENST00000522605.1	+	1	2375	c.2375A>T	c.(2374-2376)aAt>aTt	p.N792I	PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA5_ENST00000518069.1_5'Flank|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018923.2|NM_032096.1	NP_061746.1|NP_115267.1	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2	792					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.N792I(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAAAATACAAATCATGGAGCC	0.408																																					p.N792I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2375T	5						.						81.0	81.0	81.0					5																	140742077		1833	4084	5917	140722261	SO:0001583	missense	56103	exon1			AF152331	CCDS54924.1, CCDS75332.1	5q31	2010-01-26				ENSG00000253910		"""Cadherins / Protocadherins : Clustered"""	8709	other	protocadherin		606300				10380929	Standard	NM_018923		Approved	PCDH-GAMMA-B2		Q9Y5G2		ENST00000522605.1:c.2375A>T	5.37:g.140742077A>T	ENSP00000429018:p.Asn792Ile	Somatic		Capture	Illumina HiSeq	Phase_I	140722261	NM_018923	Q3MIJ3|Q9UN65	Missense_Mutation	SNP	ENST00000522605.1	37	CCDS54924.1	.	.	.	.	.	.	.	.	.	.	.	7.919	0.738139	0.15574	.	.	ENSG00000253910	ENST00000522605	T	0.49432	0.78	5.1	0.859	0.19036	.	.	.	.	.	T	0.30417	0.0764	L	0.36672	1.1	0.09310	N	1	P;B	0.34977	0.478;0.136	B;B	0.35859	0.212;0.03	T	0.14727	-1.0462	9	0.22706	T	0.39	.	1.834	0.03136	0.2568:0.4515:0.1351:0.1566	.	792;792	Q9Y5G2-2;Q9Y5G2	.;PCDGE_HUMAN	I	792	ENSP00000429018:N792I	ENSP00000429018:N792I	N	+	2	0	PCDHGB2	140722261	0.000000	0.05858	0.097000	0.21041	0.005000	0.04900	0.197000	0.17197	0.676000	0.31285	0.383000	0.25322	AAT		PCDHGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374741.1	NM_018923	
GRIA1	2890	broad.mit.edu	37	5	153065792	153065792	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr5:153065792T>C	ENST00000285900.5	+	8	1380	c.1037T>C	c.(1036-1038)tTt>tCt	p.F346S	GRIA1_ENST00000448073.4_Missense_Mutation_p.F356S|GRIA1_ENST00000340592.5_Missense_Mutation_p.F346S|GRIA1_ENST00000518142.1_Missense_Mutation_p.F266S|GRIA1_ENST00000518783.1_Missense_Mutation_p.F356S|GRIA1_ENST00000521843.2_Missense_Mutation_p.F277S	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	346					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)	p.F346S(1)		NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	CAGGTGCGATTTGAAGGTTTA	0.438																																					p.F346S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1037C	5						.						143.0	129.0	134.0					5																	153065792		2203	4300	6503	153045985	SO:0001583	missense	2890	exon8				CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.1037T>C	5.37:g.153065792T>C	ENSP00000285900:p.Phe346Ser	Somatic		Capture	Illumina HiSeq	Phase_I	153045985	NM_001114183	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Missense_Mutation	SNP	ENST00000285900.5	37	CCDS4322.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.467662	0.84533	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000537037;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	D;D;D;D;D;D;D	0.88509	-2.39;-2.39;-2.39;-2.39;-2.39;-2.39;-2.39	5.23	5.23	0.72850	Extracellular ligand-binding receptor (1);	0.166051	0.52532	D	0.000067	D	0.87665	0.6234	N	0.22421	0.69	0.43000	D	0.994517	P;P;P;P;P;D	0.54397	0.951;0.951;0.911;0.951;0.858;0.966	P;P;P;P;B;P	0.54270	0.631;0.631;0.51;0.631;0.375;0.747	D	0.89522	0.3779	10	0.66056	D	0.02	.	14.2691	0.66140	0.0:0.0:0.0:1.0	.	356;356;266;356;346;346	E7ESV8;B7Z9G9;B7Z3F6;B7Z2W8;P42261-2;P42261	.;.;.;.;.;GRIA1_HUMAN	S	346;346;266;300;346;277;277;356;356	ENSP00000285900:F346S;ENSP00000427920:F266S;ENSP00000339343:F346S;ENSP00000427864:F277S;ENSP00000442108:F277S;ENSP00000428994:F356S;ENSP00000415569:F356S	ENSP00000285900:F346S	F	+	2	0	GRIA1	153045985	0.997000	0.39634	0.977000	0.42913	0.962000	0.63368	7.417000	0.80156	1.967000	0.57214	0.533000	0.62120	TTT		GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252456.3		
ICE1	23379	broad.mit.edu	37	5	5464683	5464683	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr5:5464683G>C	ENST00000296564.7	+	13	5458	c.5236G>C	c.(5236-5238)Gag>Cag	p.E1746Q		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1746					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)	p.E1746Q(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						AGGGCCTCAGGAGAATTCTGT	0.577																																					p.E1746Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5236C	5						.						30.0	31.0	31.0					5																	5464683		1993	4153	6146	5517683	SO:0001583	missense	23379	exon13																														ENST00000296564.7:c.5236G>C	5.37:g.5464683G>C	ENSP00000296564:p.Glu1746Gln	Somatic		Capture	Illumina HiSeq	Phase_I	5517683	NM_015325	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	ENST00000296564.7	37	CCDS47187.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.672021	0.88348	.	.	ENSG00000164151	ENST00000296564	T	0.32272	1.46	5.52	5.52	0.82312	.	.	.	.	.	T	0.54464	0.1860	M	0.61703	1.905	0.54753	D	0.999988	D	0.89917	1.0	D	0.85130	0.997	T	0.55704	-0.8099	9	0.87932	D	0	-14.0625	16.9186	0.86158	0.0:0.0:1.0:0.0	.	1746	Q9Y2F5	K0947_HUMAN	Q	1746	ENSP00000296564:E1746Q	ENSP00000296564:E1746Q	E	+	1	0	KIAA0947	5517683	1.000000	0.71417	0.999000	0.59377	0.771000	0.43674	7.210000	0.77924	2.594000	0.87642	0.460000	0.39030	GAG		KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1		
MTMR12	54545	broad.mit.edu	37	5	32235100	32235100	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr5:32235100A>C	ENST00000382142.3	-	14	1650	c.1480T>G	c.(1480-1482)Ttc>Gtc	p.F494V	RNU6-1079P_ENST00000362861.1_RNA|MTMR12_ENST00000510216.1_5'Flank|MTMR12_ENST00000264934.5_Intron|MTMR12_ENST00000280285.5_Missense_Mutation_p.F494V	NM_001040446.1	NP_001035536.1	Q9C0I1	MTMRC_HUMAN	myotubularin related protein 12	494	Interaction with MTM1.|Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.					cytoplasm (GO:0005737)	phosphatase activity (GO:0016791)	p.F494V(1)		breast(3)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						GGTGAATTGAAGAAGAAGGTG	0.418																																					p.F494V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1480G	5						.						110.0	109.0	109.0					5																	32235100		2203	4300	6503	32270857	SO:0001583	missense	54545	exon14			AB051469	CCDS34138.1, CCDS75230.1	5p15.33	2011-06-09	2005-04-07	2005-04-07	ENSG00000150712	ENSG00000150712		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	18191	protein-coding gene	gene with protein product		606501	"""phosphatidylinositol-3-phosphate associated protein"""	PIP3AP		11504939, 12495846	Standard	XM_005248313		Approved	3-PAP, FLJ20476, KIAA1682, 3PAP	uc003jhq.3	Q9C0I1	OTTHUMG00000161978	ENST00000382142.3:c.1480T>G	5.37:g.32235100A>C	ENSP00000371577:p.Phe494Val	Somatic		Capture	Illumina HiSeq	Phase_I	32270857	NM_001040446	Q69YJ4|Q6PFW3|Q96QU2|Q9NX27	Missense_Mutation	SNP	ENST00000382142.3	37	CCDS34138.1	.	.	.	.	.	.	.	.	.	.	A	26.4	4.730738	0.89390	.	.	ENSG00000150712	ENST00000280285;ENST00000382142	D;D	0.90620	-2.7;-2.7	5.49	5.49	0.81192	Myotubularin phosphatase domain (1);	0.109136	0.64402	D	0.000007	D	0.95796	0.8632	M	0.87971	2.92	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.991	D	0.96430	0.9318	10	0.72032	D	0.01	.	15.5928	0.76550	1.0:0.0:0.0:0.0	.	494;494	Q9C0I1-2;Q9C0I1	.;MTMRC_HUMAN	V	494	ENSP00000280285:F494V;ENSP00000371577:F494V	ENSP00000280285:F494V	F	-	1	0	MTMR12	32270857	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.952000	0.93031	2.075000	0.62263	0.459000	0.35465	TTC		MTMR12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366579.1	NM_019061	
BDP1	55814	broad.mit.edu	37	5	70840881	70840881	+	Silent	SNP	A	A	G			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr5:70840881A>G	ENST00000358731.4	+	32	6842	c.6579A>G	c.(6577-6579)gaA>gaG	p.E2193E	BDP1_ENST00000380675.2_Silent_p.E329E	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	2193					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.E2193E(1)		NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		AAAATCAAGAAGAGAGCTCTC	0.418																																					p.E2193E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A6579G	5						.						95.0	92.0	93.0					5																	70840881		1855	4092	5947	70876637	SO:0001819	synonymous_variant	55814	exon32			AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.6579A>G	5.37:g.70840881A>G		Somatic		Capture	Illumina HiSeq	Phase_I	70876637	NM_018429	Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Silent	SNP	ENST00000358731.4	37	CCDS43328.1																																																																																				BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374681.2	NM_018429	
PDE8B	8622	broad.mit.edu	37	5	76640711	76640711	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr5:76640711C>G	ENST00000264917.5	+	7	876	c.831C>G	c.(829-831)caC>caG	p.H277Q	PDE8B_ENST00000340978.3_Missense_Mutation_p.H277Q|PDE8B_ENST00000346042.3_Missense_Mutation_p.H277Q|PDE8B_ENST00000342343.4_Missense_Mutation_p.H257Q|PDE8B_ENST00000333194.4_Missense_Mutation_p.H277Q	NM_003719.3	NP_003710.1	O95263	PDE8B_HUMAN	phosphodiesterase 8B	277	PAS. {ECO:0000255|PROSITE- ProRule:PRU00140}.				cAMP catabolic process (GO:0006198)|cyclic nucleotide metabolic process (GO:0009187)|negative regulation of insulin secretion (GO:0046676)|negative regulation of steroid hormone biosynthetic process (GO:0090032)|phosphorelay signal transduction system (GO:0000160)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.H277Q(1)	GMDS/PDE8B(2)	NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(10)|lung(15)|ovary(1)|prostate(2)|skin(3)	40		all_lung(232;0.00043)|Lung NSC(167;0.00114)|Ovarian(174;0.0107)|Prostate(461;0.0605)		OV - Ovarian serous cystadenocarcinoma(54;2.21e-49)|Epithelial(54;5.82e-43)|all cancers(79;4.06e-38)	Caffeine(DB00201)|Ketotifen(DB00920)	CATTAGATCACTGTCATGAAG	0.338																																					p.H277Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C831G	5						.						144.0	140.0	142.0					5																	76640711		2203	4300	6503	76676467	SO:0001583	missense	8622	exon7			AF079529	CCDS4037.1, CCDS34190.1, CCDS34191.1, CCDS34192.1, CCDS34193.1	5q14.1	2008-05-15			ENSG00000113231	ENSG00000113231	3.1.4.17	"""Phosphodiesterases"""	8794	protein-coding gene	gene with protein product		603390				9784418	Standard	NM_003719		Approved		uc003kfa.3	O95263	OTTHUMG00000102170	ENST00000264917.5:c.831C>G	5.37:g.76640711C>G	ENSP00000264917:p.His277Gln	Somatic		Capture	Illumina HiSeq	Phase_I	76676467	NM_003719	Q5J7V7|Q86XK8|Q8IUJ7|Q8IUJ8|Q8IUJ9|Q8IUK0|Q8N3T2	Missense_Mutation	SNP	ENST00000264917.5	37	CCDS4037.1	.	.	.	.	.	.	.	.	.	.	C	12.90	2.077586	0.36662	.	.	ENSG00000113231	ENST00000340978;ENST00000346042;ENST00000264917;ENST00000342343;ENST00000333194;ENST00000503963	T;T;T;T;T;T	0.75821	-0.42;-0.43;-0.97;-0.97;-0.97;1.02	6.05	5.18	0.71444	PAS (3);PAS fold (1);	0.152273	0.64402	D	0.000020	T	0.53753	0.1816	N	0.03948	-0.315	0.80722	D	1	B;B;B;B;B	0.14012	0.009;0.007;0.007;0.007;0.004	B;B;B;B;B	0.19391	0.025;0.013;0.008;0.013;0.006	T	0.50800	-0.8785	10	0.36615	T	0.2	.	14.0213	0.64558	0.0:0.9268:0.0:0.0732	.	277;277;277;257;277	O95263-2;O95263-6;O95263-3;O95263-4;O95263	.;.;.;.;PDE8B_HUMAN	Q	277;277;277;257;277;39	ENSP00000345446:H277Q;ENSP00000330428:H277Q;ENSP00000264917:H277Q;ENSP00000345646:H257Q;ENSP00000331336:H277Q;ENSP00000422861:H39Q	ENSP00000264917:H277Q	H	+	3	2	PDE8B	76676467	0.999000	0.42202	1.000000	0.80357	0.997000	0.91878	0.655000	0.24933	1.565000	0.49641	0.650000	0.86243	CAC		PDE8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000220015.3	NM_003719	
PCDHGB4	8641	broad.mit.edu	37	5	140767492	140767497	+	In_Frame_Del	DEL	TGCCAG	TGCCAG	-	rs145222727|rs370380135	byFrequency	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	TGCCAG	TGCCAG	TGCCAG	-	TGCCAG	-	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr5:140767492_140767497delTGCCAG	ENST00000519479.1	+	1	41_46	c.41_46delTGCCAG	c.(40-48)ctgccagtg>ctg	p.PV15del	PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_003736.2|NM_018925.2|NM_032098.1	NP_003727.1|NP_061748.1|NP_115269.1	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4	15					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P15_V16delPV(1)		endometrium(9)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(2)	37			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTGAGAGGCTGCCAGTGCTCTTTCT	0.617											OREG0016859	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)		166	0.033147	0.0045	0.0476	5008	,	,		16199	0.0		0.0944	False		,,,				2504	0.0327				p.14_16del												.	.	1	Deletion - In frame(1)	prostate(1)	c.41_46del	5						.		,,,,,,,,,,,	50,3074		6,38,1518					,,,,,,,,,,,	3.7	0.9		dbSNP_134	6	518,6570		64,390,3090	no	coding,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,coding	PCDHGB4,PCDHGB3,PCDHGB2,PCDHGB1,PCDHGA7,PCDHGA6,PCDHGA5,PCDHGA4,PCDHGA3,PCDHGA2,PCDHGA1	NM_032098.1,NM_018924.2,NM_018923.2,NM_018922.2,NM_018920.2,NM_018919.2,NM_018918.2,NM_018917.2,NM_018916.3,NM_018915.2,NM_018912.2,NM_003736.2	,,,,,,,,,,,	70,428,4608	A1A1,A1R,RR		7.3081,1.6005,5.5621	,,,,,,,,,,,	,,,,,,,,,,,		568,9644				140747681	SO:0001651	inframe_deletion	8641	exon1			AF152520	CCDS54928.1, CCDS75337.1	5q31	2010-01-26				ENSG00000253953		"""Cadherins / Protocadherins : Clustered"""	8711	other	protocadherin	"""fibroblast cadherin FIB2"", ""cadherin 20"""	603058				10380929	Standard	NM_003736		Approved	FIB2, CDH20, PCDH-GAMMA-B4		Q9UN71		ENST00000519479.1:c.41_46delTGCCAG	5.37:g.140767492_140767497delTGCCAG	ENSP00000428288:p.Pro15_Val16del	Germline	1658	Capture	Illumina HiSeq	Phase_I	140747676	NM_032098	O15099|Q2M267|Q9UN64	In_Frame_Del	DEL	ENST00000519479.1	37	CCDS54928.1																																																																																				PCDHGB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374745.1	NM_003736	
NKX2-5	1482	broad.mit.edu	37	5	172659671	172659671	+	Silent	SNP	G	G	A	rs538010963		TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr5:172659671G>A	ENST00000329198.4	-	2	1149	c.876C>T	c.(874-876)ttC>ttT	p.F292F		NM_001166175.1|NM_001166176.1|NM_004387.3	NP_001159647.1|NP_001159648.1|NP_004378.1	P52952	NKX25_HUMAN	NK2 homeobox 5	292					adult heart development (GO:0007512)|apoptotic process involved in heart morphogenesis (GO:0003278)|atrial cardiac muscle cell development (GO:0055014)|atrial septum morphogenesis (GO:0060413)|atrioventricular node cell development (GO:0060928)|atrioventricular node cell fate commitment (GO:0060929)|BMP signaling pathway (GO:0030509)|bundle of His development (GO:0003166)|canonical Wnt signaling pathway (GO:0060070)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac ventricle formation (GO:0003211)|cell differentiation (GO:0030154)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|hemopoiesis (GO:0030097)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|pharyngeal system development (GO:0060037)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart contraction (GO:0045823)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription via serum response element binding (GO:0010735)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of voltage-gated calcium channel activity (GO:1901387)|proepicardium development (GO:0003342)|pulmonary myocardium development (GO:0003350)|Purkinje myocyte differentiation (GO:0003168)|regulation of cardiac muscle cell proliferation (GO:0060043)|regulation of cardiac muscle contraction (GO:0055117)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|sarcomere organization (GO:0045214)|septum secundum development (GO:0003285)|spleen development (GO:0048536)|thyroid gland development (GO:0030878)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|serum response element binding (GO:0010736)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.F292F(1)		breast(1)|central_nervous_system(1)|large_intestine(2)|lung(7)|prostate(1)	12	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			CGAAGTTCACGAAGTTGTTGT	0.677																																					p.F292F	Esophageal Squamous(72;810 1219 2387 13420 44943)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C876T	5						.						25.0	28.0	27.0					5																	172659671		2201	4298	6499	172592277	SO:0001819	synonymous_variant	1482	exon2			AB021133	CCDS4387.1, CCDS54949.1, CCDS54950.1	5q34	2014-09-17	2011-06-01	2002-10-04	ENSG00000183072	ENSG00000183072		"""Homeoboxes / ANTP class : NKL subclass"""	2488	protein-coding gene	gene with protein product	"""tinman paralog (Drosophila)"""	600584	"""cardiac-specific homeo box"", ""NK2 transcription factor related, locus 5 (Drosophila)"""	CSX, NKX2E		7665173, 8900537	Standard	NM_004387		Approved	CSX1, NKX2.5, NKX4-1	uc003mcm.2	P52952	OTTHUMG00000130522	ENST00000329198.4:c.876C>T	5.37:g.172659671G>A		Somatic		Capture	Illumina HiSeq	Phase_I	172592277	NM_004387	A8K3K0|B4DNB6|E9PBU6	Silent	SNP	ENST00000329198.4	37	CCDS4387.1																																																																																				NKX2-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252942.2		
IL20RA	53832	broad.mit.edu	37	6	137330002	137330003	+	Intron	INS	-	-	T	rs3041890|rs372659532|rs386408738		TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr6:137330002_137330003insT	ENST00000316649.5	-	5	815				IL20RA_ENST00000367748.1_Intron|IL20RA_ENST00000541547.1_Intron|IL20RA_ENST00000468393.1_Intron	NM_001278722.1|NM_014432.2	NP_001265651.1|NP_055247	Q9UHF4	I20RA_HUMAN	interleukin 20 receptor, alpha						cytokine-mediated signaling pathway (GO:0019221)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|regulation of bone resorption (GO:0045124)	integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000351)|OV - Ovarian serous cystadenocarcinoma(155;0.00459)		TCAGTATAAGCttttttttttt	0.366																																					.												.	.	0			.	6						.																																			137371696	SO:0001627	intron_variant	53832	.			AF184971	CCDS5181.1, CCDS64535.1, CCDS64536.1	6q23.3	2008-02-05			ENSG00000016402	ENSG00000016402		"""Interleukins and interleukin receptors"""	6003	protein-coding gene	gene with protein product		605620				10875937, 11163236	Standard	NM_001278724		Approved	ZCYTOR7, IL-20R1	uc003qhj.3	Q9UHF4	OTTHUMG00000015654	ENST00000316649.5:c.580-122->A	6.37:g.137330013_137330013dupT		Somatic		Capture	Illumina HiSeq	Phase_I	137371695	.	B4DLR5|F5H675|Q14CW2|Q6UWA9|Q96SH8	Splice_Site	INS	ENST00000316649.5	37	CCDS5181.1																																																																																				IL20RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042393.1	NM_014432	
PDE7B	27115	broad.mit.edu	37	6	136468575	136468575	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr6:136468575C>T	ENST00000308191.6	+	4	556	c.253C>T	c.(253-255)Ctt>Ttt	p.L85F	RP13-143G15.4_ENST00000417643.1_RNA|RP13-143G15.4_ENST00000585946.1_RNA|RP13-143G15.4_ENST00000591521.1_RNA	NM_018945.3	NP_061818.1	Q9NP56	PDE7B_HUMAN	phosphodiesterase 7B	85					cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)	p.L85F(1)		breast(1)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Colorectal(23;0.24)			OV - Ovarian serous cystadenocarcinoma(155;0.0136)|GBM - Glioblastoma multiforme(68;0.0147)	Caffeine(DB00201)|Dyphylline(DB00651)|Ketotifen(DB00920)	ATCAAGGCTGCTTCGTGGAAT	0.478																																					p.L85F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C253T	6						.						129.0	129.0	129.0					6																	136468575		2203	4300	6503	136510268	SO:0001583	missense	27115	exon4			AB038040	CCDS5175.1	6q23-q24	2008-03-18			ENSG00000171408	ENSG00000171408	3.1.4.17	"""Phosphodiesterases"""	8792	protein-coding gene	gene with protein product		604645				10618442	Standard	XM_005266931		Approved		uc003qgp.3	Q9NP56	OTTHUMG00000015641	ENST00000308191.6:c.253C>T	6.37:g.136468575C>T	ENSP00000310661:p.Leu85Phe	Somatic		Capture	Illumina HiSeq	Phase_I	136510268	NM_018945	Q5W154	Missense_Mutation	SNP	ENST00000308191.6	37	CCDS5175.1	.	.	.	.	.	.	.	.	.	.	C	17.38	3.373909	0.61624	.	.	ENSG00000171408	ENST00000308191;ENST00000367787	T	0.69561	-0.41	5.35	5.35	0.76521	.	0.626880	0.15634	N	0.252231	T	0.56171	0.1967	L	0.38531	1.155	0.80722	D	1	D;B	0.57899	0.981;0.011	P;B	0.52109	0.69;0.014	T	0.52290	-0.8595	10	0.09843	T	0.71	.	19.4352	0.94788	0.0:1.0:0.0:0.0	.	137;85	A1E5M1;Q9NP56	.;PDE7B_HUMAN	F	85;221	ENSP00000310661:L85F	ENSP00000310661:L85F	L	+	1	0	PDE7B	136510268	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.185000	0.42584	2.668000	0.90789	0.655000	0.94253	CTT		PDE7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042371.1		
SCGN	10590	broad.mit.edu	37	6	25691322	25691322	+	Silent	SNP	G	G	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr6:25691322G>T	ENST00000377961.2	+	10	840	c.672G>T	c.(670-672)ggG>ggT	p.G224G	SCGN_ENST00000334979.6_3'UTR	NM_006998.3	NP_008929.2	O76038	SEGN_HUMAN	secretagogin, EF-hand calcium binding protein	224	EF-hand 5. {ECO:0000255|PROSITE- ProRule:PRU00448}.					cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)	p.G224G(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	24						AAGTGGATGGGTTTGTCAAAG	0.403																																					p.G224G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G672T	6						.						157.0	148.0	151.0					6																	25691322		2203	4300	6503	25799301	SO:0001819	synonymous_variant	10590	exon10			BC000336	CCDS4561.1	6p22.3-p22.1	2013-01-10			ENSG00000079689	ENSG00000079689		"""EF-hand domain containing"""	16941	protein-coding gene	gene with protein product	"""calbindin-like"""	609202				10811645	Standard	NM_006998		Approved	SECRET, DJ501N12.8, SEGN, CALBL	uc003nfb.3	O76038	OTTHUMG00000014409	ENST00000377961.2:c.672G>T	6.37:g.25691322G>T		Somatic		Capture	Illumina HiSeq	Phase_I	25799301	NM_006998	A8K0B2|Q5VV44|Q96QV7|Q9UJF6	Silent	SNP	ENST00000377961.2	37	CCDS4561.1																																																																																				SCGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040067.1		
HLA-DRB1	3123	broad.mit.edu	37	6	32551948	32551948	+	Frame_Shift_Del	DEL	G	G	-	rs67476479|rs17886882		TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr6:32551948delG	ENST00000360004.5	-	2	413	c.308delC	c.(307-309)gcgfs	p.A103fs		NM_002124.3	NP_002115.2	Q30167	2B1A_HUMAN	major histocompatibility complex, class II, DR beta 1	103	Beta-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)		p.A103fs*26(2)		large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	10						GGTGTCCACCGCGGCCCGCGC	0.682										Multiple Myeloma(14;0.17)																											p.L103fs												.	.	2	Deletion - Frameshift(2)	ovary(1)|large_intestine(1)	c.308delT	6	GRCh37	CX045849	HLA-DRB1	X	rs17886882	.			272,799,3127		41,41,149,90,578,1200	26.0	27.0	26.0			-1.8	0.0	6	dbSNP_130	27	98,1359,6727		5,19,69,124,1092,2783	no	codingComplex	HLA-DRB1	NM_002124.3		46,60,218,214,1670,3983	A1A1,A1A2,A1R,A2A2,A2R,RR		17.803,25.5121,20.4167			32551948	370,2158,9854	2106	4192	6298	32659926	SO:0001589	frameshift_variant	3123	exon2			AJ297583	CCDS47409.1	6p21.3	2013-01-11			ENSG00000196126	ENSG00000196126		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4948	protein-coding gene	gene with protein product		142857		HLA-DR1B			Standard	NM_001243965		Approved		uc011eri.2	P01911	OTTHUMG00000031196	ENST00000360004.5:c.308delC	6.37:g.32551948delG	ENSP00000353099:p.Ala103fs	Somatic		Capture	Illumina HiSeq	Phase_I	32659926	NM_002124	P01914|Q9MYF5	Frame_Shift_Del	DEL	ENST00000360004.5	37	CCDS47409.1																																																																																				HLA-DRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076393.3	NM_002124	
HLA-DRB1	3123	broad.mit.edu	37	6	32551955	32551955	+	Frame_Shift_Del	DEL	G	G	-	rs9281873|rs17885222		TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr6:32551955delG	ENST00000360004.5	-	2	406	c.301delC	c.(301-303)cggfs	p.R101fs		NM_002124.3	NP_002115.2	Q30167	2B1A_HUMAN	major histocompatibility complex, class II, DR beta 1	101	Beta-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)		p.R101fs*28(1)		large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	10						ACCGCGGCCCGCGCCTGCTCC	0.682										Multiple Myeloma(14;0.17)																											p.T101fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.301delA	6						.						25.0	27.0	26.0					6																	32551955		2075	4203	6278	32659933	SO:0001589	frameshift_variant	3123	exon2			AJ297583	CCDS47409.1	6p21.3	2013-01-11			ENSG00000196126	ENSG00000196126		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4948	protein-coding gene	gene with protein product		142857		HLA-DR1B			Standard	NM_001243965		Approved		uc011eri.2	P01911	OTTHUMG00000031196	ENST00000360004.5:c.301delC	6.37:g.32551955delG	ENSP00000353099:p.Arg101fs	Somatic		Capture	Illumina HiSeq	Phase_I	32659933	NM_002124	P01914|Q9MYF5	Frame_Shift_Del	DEL	ENST00000360004.5	37	CCDS47409.1																																																																																				HLA-DRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076393.3	NM_002124	
UNC93A	54346	broad.mit.edu	37	6	167728838	167728838	+	Silent	SNP	G	G	A	rs148062483	byFrequency	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr6:167728838G>A	ENST00000230256.3	+	8	1447	c.1272G>A	c.(1270-1272)gcG>gcA	p.A424A	UNC93A_ENST00000366829.2_Silent_p.A382A	NM_018974.3	NP_061847.2	Q86WB7	UN93A_HUMAN	unc-93 homolog A (C. elegans)	424						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A424A(1)		breast(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	40		Breast(66;7.62e-05)|Ovarian(120;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		CCATGGTGGCGTATGGGCTTG	0.547													G|||	23	0.00459265	0.0174	0.0	5008	,	,		20022	0.0		0.0	False		,,,				2504	0.0				p.A382A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1146A	6						.	G	,	70,4336	63.5+/-100.7	0,70,2133	212.0	234.0	227.0		1146,1272	-7.5	0.0	6	dbSNP_134	227	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous	UNC93A	NM_001143947.1,NM_018974.3	,	0,72,6431	AA,AG,GG		0.0233,1.5887,0.5536	,	382/416,424/458	167728838	72,12934	2203	4300	6503	167648828	SO:0001819	synonymous_variant	54346	exon7			AJ508812	CCDS5300.1, CCDS47515.1	6q27	2014-05-16	2001-11-28		ENSG00000112494	ENSG00000112494			12570	protein-coding gene	gene with protein product		607995	"""unc93 (C.elegans) homolog A"""			12381271	Standard	NM_001143947		Approved	dJ366N23.2, dJ366N23.1	uc003qvq.3	Q86WB7	OTTHUMG00000016021	ENST00000230256.3:c.1272G>A	6.37:g.167728838G>A		Somatic		Capture	Illumina HiSeq	Phase_I	167648828	NM_001143947	B3KRP5|Q4QQJ4|Q5JZD6	Silent	SNP	ENST00000230256.3	37	CCDS5300.1																																																																																				UNC93A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043125.2	NM_018974	
BRAT1	221927	broad.mit.edu	37	7	2587026	2587026	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr7:2587026C>T	ENST00000340611.4	-	3	470	c.214G>A	c.(214-216)Gtc>Atc	p.V72I		NM_152743.3	NP_689956.2	Q6PJG6	BRAT1_HUMAN	BRCA1-associated ATM activator 1	72					response to ionizing radiation (GO:0010212)	membrane (GO:0016020)|nucleus (GO:0005634)		p.V72I(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	23						AAGGAGAGGACCCCAGAACTC	0.622																																					p.V72I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G214A	7						.						86.0	80.0	82.0					7																	2587026		2203	4300	6503	2553552	SO:0001583	missense	221927	exon3			BC015632	CCDS5334.1	7p22.3	2011-03-22	2011-02-28	2011-03-22	ENSG00000106009	ENSG00000106009			21701	protein-coding gene	gene with protein product	"""BRCA1-associated protein required for ATM activation protein 1"""	614506	"""chromosome 7 open reading frame 27"""	C7orf27, BAAT1		16452482	Standard	NM_152743		Approved	MGC22916	uc003smi.3	Q6PJG6	OTTHUMG00000119091	ENST00000340611.4:c.214G>A	7.37:g.2587026C>T	ENSP00000339637:p.Val72Ile	Somatic		Capture	Illumina HiSeq	Phase_I	2553552	NM_152743	A4D200|C9JY24|Q8IW85|Q8IZ43|Q8WVR8|Q96IV9|Q9H7J8|Q9UFA3	Missense_Mutation	SNP	ENST00000340611.4	37	CCDS5334.1	.	.	.	.	.	.	.	.	.	.	C	1.228	-0.624853	0.03636	.	.	ENSG00000106009	ENST00000340611	T	0.72394	-0.65	5.01	-0.781	0.10965	Armadillo-type fold (1);	0.292350	0.33753	N	0.004598	T	0.48150	0.1484	N	0.21373	0.66	0.21473	N	0.999677	B;B	0.16166	0.016;0.004	B;B	0.19148	0.024;0.012	T	0.32295	-0.9912	10	0.08179	T	0.78	-21.334	10.355	0.43958	0.0:0.49:0.0:0.51	.	72;72	Q6PJG6-2;Q6PJG6	.;BRAT1_HUMAN	I	72	ENSP00000339637:V72I	ENSP00000339637:V72I	V	-	1	0	BRAT1	2553552	0.071000	0.21146	0.123000	0.21794	0.009000	0.06853	0.241000	0.18065	-0.071000	0.12886	-0.142000	0.14014	GTC		BRAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239305.2	NM_152743	
DGKI	9162	broad.mit.edu	37	7	137206667	137206667	+	Silent	SNP	G	G	A			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr7:137206667G>A	ENST00000288490.5	-	21	2193	c.2193C>T	c.(2191-2193)atC>atT	p.I731I	DGKI_ENST00000446122.1_Silent_p.I731I|DGKI_ENST00000424189.2_Silent_p.I752I|DGKI_ENST00000453654.2_Silent_p.I431I	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	731					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)	p.I731I(1)		breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						CTTGTAAACTGATTTTGTTCA	0.458																																					p.I731I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2193T	7						.						115.0	98.0	104.0					7																	137206667		2203	4300	6503	136857207	SO:0001819	synonymous_variant	9162	exon21			AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.2193C>T	7.37:g.137206667G>A		Somatic		Capture	Illumina HiSeq	Phase_I	136857207	NM_004717	A4D1Q9|Q9NZ49	Silent	SNP	ENST00000288490.5	37	CCDS5845.1																																																																																				DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341286.3	NM_004717	
ATP6V1C1	528	broad.mit.edu	37	8	104080881	104080881	+	Splice_Site	SNP	C	C	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr8:104080881C>T	ENST00000395862.3	+	13	1214	c.1055C>T	c.(1054-1056)gCt>gTt	p.A352V	ATP6V1C1_ENST00000518857.1_Splice_Site_p.A277V|ATP6V1C1_ENST00000518738.1_Splice_Site_p.A352V|ATP6V1C1_ENST00000521514.1_Splice_Site_p.A277V	NM_001695.4	NP_001686.1	P21283	VATC1_HUMAN	ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1	352					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transporter activity (GO:0005215)	p.A352V(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|urinary_tract(1)	13	Lung NSC(17;0.000427)|all_lung(17;0.000533)		OV - Ovarian serous cystadenocarcinoma(57;3.57e-05)|STAD - Stomach adenocarcinoma(118;0.133)			TTTCCATAGGCTCCTATGGAT	0.328																																					p.A352V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1055T	8						.						71.0	71.0	71.0					8																	104080881		2203	4300	6503	104150057	SO:0001630	splice_region_variant	528	exon13			X69151	CCDS6296.1	8p22.3	2011-05-24	2006-01-13	2002-05-10	ENSG00000155097	ENSG00000155097	3.6.3.14	"""ATPases / V-type"""	856	protein-coding gene	gene with protein product		603097	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) 42kD"", ""ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C, isoform 1"""	ATP6D, ATP6C		8250920, 14580332	Standard	NM_001695		Approved	VATC, Vma5	uc003ykz.4	P21283	OTTHUMG00000164761	ENST00000395862.3:c.1054-1C>T	8.37:g.104080881C>T		Somatic		Capture	Illumina HiSeq	Phase_I	104150057	NM_001695		Missense_Mutation	SNP	ENST00000395862.3	37	CCDS6296.1	.	.	.	.	.	.	.	.	.	.	C	15.04	2.715397	0.48622	.	.	ENSG00000155097	ENST00000518857;ENST00000395862;ENST00000521514;ENST00000518738	T;T;T;T	0.45668	0.89;0.89;0.89;0.89	5.87	5.87	0.94306	.	0.139570	0.64402	D	0.000004	T	0.35364	0.0929	L	0.27053	0.805	0.80722	D	1	B	0.06786	0.001	B	0.12837	0.008	T	0.05550	-1.0878	10	0.27785	T	0.31	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	352	P21283	VATC1_HUMAN	V	277;352;277;352	ENSP00000428204:A277V;ENSP00000379203:A352V;ENSP00000430129:A277V;ENSP00000430282:A352V	ENSP00000379203:A352V	A	+	2	0	ATP6V1C1	104150057	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.006000	0.70724	2.941000	0.99782	0.655000	0.94253	GCT		ATP6V1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380101.1	NM_001695	Missense_Mutation
OXR1	55074	broad.mit.edu	37	8	107696576	107696576	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr8:107696576G>C	ENST00000442977.2	+	5	616	c.517G>C	c.(517-519)Gat>Cat	p.D173H	OXR1_ENST00000531443.1_Missense_Mutation_p.D172H|OXR1_ENST00000517566.2_Missense_Mutation_p.D172H|OXR1_ENST00000445937.1_Missense_Mutation_p.D172H|OXR1_ENST00000312046.6_Missense_Mutation_p.D165H|OXR1_ENST00000452423.2_5'UTR|OXR1_ENST00000497705.1_Missense_Mutation_p.D105H	NM_001198532.1	NP_001185461.1	Q8N573	OXR1_HUMAN	oxidation resistance 1	173					adult walking behavior (GO:0007628)|cellular response to hydroperoxide (GO:0071447)|negative regulation of neuron apoptotic process (GO:0043524)|response to oxidative stress (GO:0006979)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)	oxidoreductase activity (GO:0016491)	p.D84H(1)|p.D173H(1)		NS(2)|breast(2)|endometrium(2)|large_intestine(9)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)			GGCTGAATTTGATAAGACCAC	0.408																																					p.D165H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G493C	8						.						231.0	224.0	227.0					8																	107696576		2203	4300	6503	107765752	SO:0001583	missense	55074	exon4			AF309387	CCDS6304.2, CCDS47909.1, CCDS56547.1, CCDS56548.1, CCDS56549.1, CCDS56550.1	8q23	2013-03-14			ENSG00000164830	ENSG00000164830			15822	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 3"""	605609				11114193	Standard	NM_181354		Approved	TLDC3	uc011lht.2	Q8N573	OTTHUMG00000167682	ENST00000442977.2:c.517G>C	8.37:g.107696576G>C	ENSP00000405424:p.Asp173His	Somatic		Capture	Illumina HiSeq	Phase_I	107765752	NM_181354	A6NK11|A8KA34|B3KXL1|B7Z402|B7Z8N5|D3HIS6|Q3LIB5|Q6ZVK9|Q8N8V0|Q9H266|Q9NWC7	Missense_Mutation	SNP	ENST00000442977.2	37	CCDS56548.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.9|25.9	4.687827|4.687827	0.88639|0.88639	.|.	.|.	ENSG00000164830|ENSG00000164830	ENST00000445937;ENST00000531443;ENST00000517566;ENST00000442977;ENST00000497705;ENST00000312046|ENST00000517455	T;T;T;T;T;T|.	0.26223|.	2.56;2.56;2.56;2.56;1.75;2.58|.	5.55|5.55	5.55|5.55	0.83447|0.83447	.|.	0.215542|.	0.47852|.	D|.	0.000214|.	T|T	0.60170|0.60170	0.2248|0.2248	L|L	0.34521|0.34521	1.04|1.04	0.80722|0.80722	D|D	1|1	P;P;D;P|.	0.69078|.	0.951;0.863;0.997;0.915|.	P;B;D;P|.	0.64144|.	0.739;0.429;0.922;0.632|.	T|T	0.54091|0.54091	-0.8345|-0.8345	10|5	0.56958|.	D|.	0.05|.	-17.2209|-17.2209	19.1073|19.1073	0.93301|0.93301	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	165;173;105;172|.	Q8N573-2;Q8N573;Q8N573-3;Q8N573-5|.	.;OXR1_HUMAN;.;.|.	H|F	172;172;172;173;105;165|88	ENSP00000402918:D172H;ENSP00000431966:D172H;ENSP00000429205:D172H;ENSP00000405424:D173H;ENSP00000431014:D105H;ENSP00000311026:D165H|.	ENSP00000311026:D165H|.	D|L	+|+	1|3	0|2	OXR1|OXR1	107765752|107765752	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.605000|7.605000	0.82844|0.82844	2.611000|2.611000	0.88343|0.88343	0.650000|0.650000	0.86243|0.86243	GAT|TTG		OXR1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_181354	
PKHD1L1	93035	broad.mit.edu	37	8	110471911	110471911	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr8:110471911C>A	ENST00000378402.5	+	47	7196	c.7092C>A	c.(7090-7092)taC>taA	p.Y2364*		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	2364					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.Y2366*(1)		NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CACTAAATTACACACACTTAG	0.363										HNSCC(38;0.096)																											p.Y2364X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C7092A	8						.						70.0	68.0	68.0					8																	110471911		1879	4112	5991	110541087	SO:0001587	stop_gained	93035	exon47			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.7092C>A	8.37:g.110471911C>A	ENSP00000367655:p.Tyr2364*	Somatic		Capture	Illumina HiSeq	Phase_I	110541087	NM_177531	Q567P2|Q9UF27	Nonsense_Mutation	SNP	ENST00000378402.5	37	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	C	48	14.266342	0.99787	.	.	ENSG00000205038	ENST00000378402	.	.	.	5.44	3.38	0.38709	.	0.234431	0.36740	N	0.002431	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.6422	0.28300	0.0:0.751:0.0:0.249	.	.	.	.	X	2364	.	ENSP00000367655:Y2364X	Y	+	3	2	PKHD1L1	110541087	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.213000	0.32407	1.301000	0.44836	0.455000	0.32223	TAC		PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
TNFRSF10C	8794	broad.mit.edu	37	8	22974360	22974360	+	Missense_Mutation	SNP	C	C	A	rs12550828		TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr8:22974360C>A	ENST00000356864.3	+	5	1128	c.596C>A	c.(595-597)aCc>aAc	p.T199N	TNFRSF10C_ENST00000540813.1_Missense_Mutation_p.T97N	NM_003841.3	NP_003832	O14798	TR10C_HUMAN	tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain	199			T -> N (in dbSNP:rs12550828).		apoptotic process (GO:0006915)|signal transduction (GO:0007165)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)	p.T199N(3)		endometrium(1)|large_intestine(6)|lung(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	15		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0147)|COAD - Colon adenocarcinoma(73;0.0612)		GAGACAATGACCACCAGCCCG	0.627																																					p.T199N												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.C596A	8						.						63.0	81.0	75.0					8																	22974360		2203	4298	6501	23030305	SO:0001583	missense	8794	exon5			AF012536	CCDS6037.1	8p22-p21	2006-02-22			ENSG00000173535	ENSG00000173535		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11906	protein-coding gene	gene with protein product		603613				9314565, 9325248	Standard	NM_003841		Approved	DcR1, TRAILR3, LIT, TRID, CD263	uc003xcy.3	O14798	OTTHUMG00000097844	ENST00000356864.3:c.596C>A	8.37:g.22974360C>A	ENSP00000349324:p.Thr199Asn	Somatic		Capture	Illumina HiSeq	Phase_I	23030305	NM_003841	O14755|Q08AS6|Q6FH98|Q6UXM5	Missense_Mutation	SNP	ENST00000356864.3	37	CCDS6037.1	.	.	.	.	.	.	.	.	.	.	A	0.007	-1.942372	0.00479	.	.	ENSG00000173535	ENST00000356864;ENST00000540813;ENST00000544885	T;T	0.61510	0.1;0.69	.	.	.	.	60.732300	0.00622	N	0.000444	T	0.35364	0.0929	N	0.14661	0.345	0.09310	N	1	P	0.47604	0.898	B	0.42959	0.403	T	0.37842	-0.9688	9	0.13470	T	0.59	.	4.6548	0.12611	0.3618:0.6381:0.0:1.0E-4	rs12550828	199	O14798	TR10C_HUMAN	N	199;97;199	ENSP00000349324:T199N;ENSP00000437612:T97N	ENSP00000349324:T199N	T	+	2	0	TNFRSF10C	23030305	0.000000	0.05858	0.011000	0.14972	0.077000	0.17291	-1.773000	0.01786	-1.934000	0.01051	-1.966000	0.00469	ACC		TNFRSF10C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215134.3		
ASAP1	50807	broad.mit.edu	37	8	131073083	131073083	+	Silent	SNP	T	T	C			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr8:131073083T>C	ENST00000518721.1	-	28	3161	c.2934A>G	c.(2932-2934)tcA>tcG	p.S978S	ASAP1_ENST00000357668.1_Silent_p.S978S	NM_001247996.1|NM_018482.3	NP_001234925.1|NP_060952.2	Q9ULH1	ASAP1_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1	978	Pro-rich.				cilium morphogenesis (GO:0060271)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)	p.S978S(1)		breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(22)|ovary(6)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	68						GAGGTAAGTCTGAGAGTTGGG	0.582																																					p.S978S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A2934G	8						.						91.0	99.0	96.0					8																	131073083		2203	4300	6503	131142265	SO:0001819	synonymous_variant	50807	exon27			AB033075	CCDS6362.1, CCDS75788.1	8q24.1-q24.2	2013-01-11	2008-09-22	2008-09-22	ENSG00000153317	ENSG00000153317		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2720	protein-coding gene	gene with protein product	"""centaurin, beta 4"""	605953	"""development and differentiation enhancing factor 1"""	DDEF1		9819391	Standard	NM_018482		Approved	PAP, KIAA1249, ZG14P, CENTB4	uc003yta.2	Q9ULH1	OTTHUMG00000164772	ENST00000518721.1:c.2934A>G	8.37:g.131073083T>C		Somatic		Capture	Illumina HiSeq	Phase_I	131142265	NM_018482	B2RNV3	Silent	SNP	ENST00000518721.1	37	CCDS6362.1	.	.	.	.	.	.	.	.	.	.	T	10.04	1.240765	0.22711	.	.	ENSG00000153317	ENST00000524124;ENST00000519483	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	T	0.71350	0.3329	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.70691	-0.4802	4	.	.	.	.	15.0195	0.71617	0.0:0.0:0.0:1.0	.	.	.	.	G	799;335	.	.	R	-	1	2	ASAP1	131142265	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.876000	0.39588	2.137000	0.66172	0.459000	0.35465	AGA		ASAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380170.1	NM_018482	
ABCA1	19	broad.mit.edu	37	9	107593313	107593313	+	Silent	SNP	G	G	A			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr9:107593313G>A	ENST00000374736.3	-	14	2179	c.1785C>T	c.(1783-1785)taC>taT	p.Y595Y	ABCA1_ENST00000494467.1_5'Flank	NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	595					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)	p.Y595Y(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	CATCCTGCAAGTAGGCGAAGC	0.542																																					p.Y595Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1785T	9						.						142.0	122.0	128.0					9																	107593313		2203	4300	6503	106633134	SO:0001819	synonymous_variant	19	exon14			AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.1785C>T	9.37:g.107593313G>A		Somatic		Capture	Illumina HiSeq	Phase_I	106633134	NM_005502	Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Silent	SNP	ENST00000374736.3	37	CCDS6762.1																																																																																				ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	NM_005502	
SLC44A1	23446	broad.mit.edu	37	9	108125214	108125214	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr9:108125214C>T	ENST00000374720.3	+	9	1260	c.1013C>T	c.(1012-1014)cCc>cTc	p.P338L	SLC44A1_ENST00000374723.1_Missense_Mutation_p.P338L|SLC44A1_ENST00000374724.1_Missense_Mutation_p.P338L|SLC44A1_ENST00000343170.7_Missense_Mutation_p.P130L	NM_080546.3	NP_536856.2	Q8WWI5	CTL1_HUMAN	solute carrier family 44 (choline transporter), member 1	338					choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)	p.P338L(1)		breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	38					Choline(DB00122)	GTCTTCCAACCCTTCTGGACT	0.443																																					p.P338L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1013T	9						.						366.0	310.0	329.0					9																	108125214		2203	4300	6503	107165035	SO:0001583	missense	23446	exon9			AJ420812	CCDS6763.1, CCDS75868.1	9q31.2	2014-01-28	2013-07-17	2005-09-06	ENSG00000070214	ENSG00000070214		"""CD molecules"", ""Solute carriers"""	18798	protein-coding gene	gene with protein product		606105	"""CDW92 antigen"""	CDW92		11698453, 10677542	Standard	NM_080546		Approved	CDw92, CTL1, CHTL1, CD92	uc004bcn.3	Q8WWI5	OTTHUMG00000020421	ENST00000374720.3:c.1013C>T	9.37:g.108125214C>T	ENSP00000363852:p.Pro338Leu	Somatic		Capture	Illumina HiSeq	Phase_I	107165035	NM_080546	A6NLZ9|Q5VUB3|Q8WVB0|Q96KU3|Q9NY69	Missense_Mutation	SNP	ENST00000374720.3	37	CCDS6763.1	.	.	.	.	.	.	.	.	.	.	C	33	5.215637	0.95104	.	.	ENSG00000070214	ENST00000374723;ENST00000374720;ENST00000374724;ENST00000343170	T;T;T;T	0.28666	1.6;1.6;1.6;1.6	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.65709	0.2717	M	0.92649	3.33	0.80722	D	1	D;D;P	0.57899	0.981;0.981;0.811	D;D;B	0.63381	0.914;0.914;0.311	T	0.73209	-0.4055	10	0.87932	D	0	-13.0099	20.2638	0.98458	0.0:1.0:0.0:0.0	.	338;338;338	Q8WWI5-3;Q8WWI5-2;Q8WWI5	.;.;CTL1_HUMAN	L	338;338;338;130	ENSP00000363855:P338L;ENSP00000363852:P338L;ENSP00000363856:P338L;ENSP00000341856:P130L	ENSP00000341856:P130L	P	+	2	0	SLC44A1	107165035	1.000000	0.71417	0.999000	0.59377	0.972000	0.66771	7.387000	0.79785	2.868000	0.98415	0.637000	0.83480	CCC		SLC44A1-003	KNOWN	alternative_3_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053500.1	NM_080546	
CER1	9350	broad.mit.edu	37	9	14720330	14720330	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr9:14720330C>T	ENST00000380911.3	-	2	606	c.562G>A	c.(562-564)Ggg>Agg	p.G188R		NM_005454.2	NP_005445.1	O95813	CER1_HUMAN	cerberus 1, DAN family BMP antagonist	188	CTCK. {ECO:0000255|PROSITE- ProRule:PRU00039}.				anterior/posterior axis specification (GO:0009948)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|bone mineralization (GO:0030282)|cell migration involved in gastrulation (GO:0042074)|cellular response to BMP stimulus (GO:0071773)|determination of dorsal identity (GO:0048263)|gastrulation (GO:0007369)|growth plate cartilage chondrocyte proliferation (GO:0003419)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mesoderm development (GO:2000381)|nervous system development (GO:0007399)|sequestering of BMP in extracellular matrix (GO:0035582)|signal transduction involved in regulation of gene expression (GO:0023019)|ureteric bud development (GO:0001657)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	BMP binding (GO:0036122)|morphogen activity (GO:0016015)|protein homodimerization activity (GO:0042803)	p.G188R(1)		endometrium(2)|large_intestine(3)|lung(6)	11				GBM - Glioblastoma multiforme(50;3.16e-06)		CCGCATTTCCCAAAGCAAAGG	0.443																																					p.G188R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G562A	9						.						83.0	72.0	76.0					9																	14720330		2203	4300	6503	14710330	SO:0001583	missense	9350	exon2			AF090189	CCDS6476.1	9p23-p22	2013-02-26	2013-02-26		ENSG00000147869	ENSG00000147869			1862	protein-coding gene	gene with protein product		603777	"""cerberus 1 (Xenopus laevis) homolog (cysteine knot superfamily)"", ""cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)"""			10049596	Standard	NM_005454		Approved	DAND4	uc003zlj.3	O95813	OTTHUMG00000021022	ENST00000380911.3:c.562G>A	9.37:g.14720330C>T	ENSP00000370297:p.Gly188Arg	Somatic		Capture	Illumina HiSeq	Phase_I	14710330	NM_005454	Q6ISJ1|Q6ISJ6|Q6ISQ2|Q6ISS1	Missense_Mutation	SNP	ENST00000380911.3	37	CCDS6476.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.617416	0.87359	.	.	ENSG00000147869	ENST00000380911	T	0.72051	-0.62	5.52	5.52	0.82312	DAN (1);Cystine knot, C-terminal (2);	0.000000	0.64402	D	0.000003	D	0.87454	0.6181	M	0.88906	2.99	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89040	0.3448	10	0.87932	D	0	-27.3035	19.7926	0.96466	0.0:1.0:0.0:0.0	.	188	O95813	CER1_HUMAN	R	188	ENSP00000370297:G188R	ENSP00000370297:G188R	G	-	1	0	CER1	14710330	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	4.695000	0.61767	2.761000	0.94854	0.655000	0.94253	GGG		CER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055453.1	NM_005454	
LINGO2	158038	broad.mit.edu	37	9	27949697	27949697	+	Missense_Mutation	SNP	C	C	T	rs144743055	byFrequency	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr9:27949697C>T	ENST00000379992.2	-	6	1422	c.973G>A	c.(973-975)Gtg>Atg	p.V325M	LINGO2_ENST00000308675.3_Missense_Mutation_p.V325M	NM_152570.2	NP_689783.1	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	325						integral component of membrane (GO:0016021)		p.V325M(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	44	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		ACATTGAGCACGCGTAGGAAG	0.542																																					p.V325M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G973A	9						.						75.0	78.0	77.0					9																	27949697		2203	4300	6503	27939697	SO:0001583	missense	158038	exon7			AL353746	CCDS6524.1	9p21.2	2013-01-11	2007-02-01	2007-02-01	ENSG00000174482	ENSG00000174482		"""Immunoglobulin superfamily / I-set domain containing"""	21207	protein-coding gene	gene with protein product		609793	"""leucine rich repeat neuronal 6C"""	LRRN6C		14686891	Standard	NM_152570		Approved	LERN3	uc003zqu.2	Q7L985	OTTHUMG00000019721	ENST00000379992.2:c.973G>A	9.37:g.27949697C>T	ENSP00000369328:p.Val325Met	Somatic		Capture	Illumina HiSeq	Phase_I	27939697	NM_152570	A8K4K7|B2RPM5|Q6ZMD0	Missense_Mutation	SNP	ENST00000379992.2	37	CCDS6524.1	.	.	.	.	.	.	.	.	.	.	C	12.27	1.887604	0.33348	.	.	ENSG00000174482	ENST00000379992;ENST00000308675	T;T	0.60040	0.22;0.22	5.95	5.95	0.96441	.	0.064909	0.64402	D	0.000010	T	0.56277	0.1974	L	0.45744	1.44	0.54753	D	0.999988	D	0.56521	0.976	P	0.45913	0.497	T	0.54397	-0.8300	9	.	.	.	.	15.8273	0.78725	0.0:0.865:0.135:0.0	.	325	Q7L985	LIGO2_HUMAN	M	325	ENSP00000369328:V325M;ENSP00000310126:V325M	.	V	-	1	0	LINGO2	27939697	0.981000	0.34729	0.997000	0.53966	0.541000	0.35023	2.549000	0.45803	2.824000	0.97209	0.655000	0.94253	GTG		LINGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051978.2	NM_152570	
TMEM2	23670	broad.mit.edu	37	9	74324339	74324339	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr9:74324339C>T	ENST00000377044.4	-	17	3360	c.2821G>A	c.(2821-2823)Gag>Aag	p.E941K	TMEM2_ENST00000377066.5_Missense_Mutation_p.E878K	NM_001135820.1|NM_013390.2	NP_001129292.1|NP_037522.1	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2	941					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.E941K(1)		central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(15)|liver(1)|lung(19)|ovary(2)|prostate(5)|skin(1)|stomach(1)|urinary_tract(2)	56		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		CCATCCATCTCACAATCTTCA	0.443																																					p.E941K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2821A	9						.						157.0	130.0	139.0					9																	74324339		2203	4300	6503	73514159	SO:0001583	missense	23670	exon17				CCDS6638.1, CCDS47979.1	9q21.13	2011-07-19			ENSG00000135048	ENSG00000135048			11869	protein-coding gene	gene with protein product		605835					Standard	NM_013390		Approved		uc011lsa.1	Q9UHN6	OTTHUMG00000020000	ENST00000377044.4:c.2821G>A	9.37:g.74324339C>T	ENSP00000366243:p.Glu941Lys	Somatic		Capture	Illumina HiSeq	Phase_I	73514159	NM_013390	A6H8W9|B2RTQ6|Q5T838|Q5T839|Q5T840|Q5T841|Q8NBP6|Q9P2D5	Missense_Mutation	SNP	ENST00000377044.4	37	CCDS6638.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.280878	0.80692	.	.	ENSG00000135048	ENST00000377044;ENST00000377066;ENST00000377043	T;T;T	0.56941	0.43;0.43;0.43	5.68	4.79	0.61399	Pectin lyase fold/virulence factor (1);	0.237219	0.48286	N	0.000184	T	0.49966	0.1588	L	0.46157	1.445	0.80722	D	1	B;B	0.31730	0.228;0.337	B;B	0.35278	0.063;0.199	T	0.53429	-0.8440	10	0.66056	D	0.02	.	14.496	0.67688	0.0:0.9295:0.0:0.0705	.	941;878	Q9UHN6;Q9UHN6-2	TMEM2_HUMAN;.	K	941;878;42	ENSP00000366243:E941K;ENSP00000366266:E878K;ENSP00000366242:E42K	ENSP00000366242:E42K	E	-	1	0	TMEM2	73514159	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.690000	0.61731	1.415000	0.47037	0.563000	0.77884	GAG		TMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052618.2	NM_013390	
RABGAP1	23637	broad.mit.edu	37	9	125863973	125863973	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chr9:125863973G>T	ENST00000373647.4	+	25	3152	c.3018G>T	c.(3016-3018)caG>caT	p.Q1006H	RABGAP1_ENST00000373643.5_Missense_Mutation_p.Q345H	NM_012197.3	NP_036329.3	Q9Y3P9	RBGP1_HUMAN	RAB GTPase activating protein 1	1006					cell cycle (GO:0007049)|positive regulation of GTPase activity (GO:0043547)|regulation of GTP catabolic process (GO:0033124)	centrosome (GO:0005813)|cytosol (GO:0005829)|microtubule associated complex (GO:0005875)	DNA binding (GO:0003677)|GTPase activator activity (GO:0005096)|Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)|tubulin binding (GO:0015631)	p.Q934H(1)|p.Q1006H(1)		breast(3)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|prostate(4)|stomach(3)|upper_aerodigestive_tract(1)	41						TCAAGAACCAGCTGAGAGAAA	0.488																																					p.Q1006H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3018T	9						.						78.0	76.0	77.0					9																	125863973		2203	4300	6503	124903794	SO:0001583	missense	23637	exon25			AJ011679	CCDS6848.2	9q34.11	2013-07-09			ENSG00000011454	ENSG00000011454			17155	protein-coding gene	gene with protein product	"""rab6 GTPase activating protein (GAP and centrosome-associated)"", ""TBC1 domain family, member 11"""	615882				10202141	Standard	NM_012197		Approved	GAPCenA, TBC1D11	uc011lzh.2	Q9Y3P9	OTTHUMG00000020633	ENST00000373647.4:c.3018G>T	9.37:g.125863973G>T	ENSP00000362751:p.Gln1006His	Somatic		Capture	Illumina HiSeq	Phase_I	124903794	NM_012197	B9A6L2|Q05CW2|Q6ZMY1|Q9HA28|Q9P0E2|Q9UG67	Missense_Mutation	SNP	ENST00000373647.4	37	CCDS6848.2	.	.	.	.	.	.	.	.	.	.	G	12.97	2.097776	0.37048	.	.	ENSG00000011454	ENST00000373647;ENST00000373643	T;T	0.17370	3.26;2.28	5.49	3.64	0.41730	.	0.000000	0.85682	D	0.000000	T	0.16214	0.0390	L	0.52905	1.665	0.58432	D	0.999994	B	0.18013	0.025	B	0.14023	0.01	T	0.04041	-1.0982	10	0.34782	T	0.22	-22.096	9.9005	0.41344	0.2096:0.0:0.7903:0.0	.	1006	Q9Y3P9	RBGP1_HUMAN	H	1006;345	ENSP00000362751:Q1006H;ENSP00000362747:Q345H	ENSP00000362747:Q345H	Q	+	3	2	RABGAP1	124903794	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.630000	0.67805	1.568000	0.49683	-0.137000	0.14449	CAG		RABGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053976.3	NM_012197	
GYG2	8908	broad.mit.edu	37	X	2773087	2773087	+	Silent	SNP	G	G	A	rs372618531		TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chrX:2773087G>A	ENST00000381163.3	+	6	753	c.471G>A	c.(469-471)ccG>ccA	p.P157P	GYG2-AS1_ENST00000445107.1_RNA|GYG2_ENST00000338623.5_Silent_p.P157P|GYG2_ENST00000542787.1_Silent_p.P157P|GYG2_ENST00000381161.1_3'UTR|GYG2_ENST00000398806.3_Silent_p.P126P	NM_001079855.1|NM_001184702.1|NM_003918.2	NP_001073324.1|NP_001171631.1|NP_003909.2	O15488	GLYG2_HUMAN	glycogenin 2	157					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	glycogenin glucosyltransferase activity (GO:0008466)	p.P157P(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)	13		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CTGCGGCCCCGGACCCCGGAT	0.557																																					p.P157P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G471A	X						.	G	,,,,	1,3834		0,1,1631,571	101.0	89.0	93.0		378,378,471,,471	-6.9	0.0	X		93	0,6727		0,0,2428,1871	no	coding-synonymous,coding-synonymous,coding-synonymous,utr-5,coding-synonymous	GYG2	NM_001079855.1,NM_001184702.1,NM_001184703.1,NM_001184704.1,NM_003918.2	,,,,	0,1,4059,2442	AA,AG,GG,G		0.0,0.0261,0.0095	,,,,	126/471,126/470,157/431,,157/502	2773087	1,10561	2203	4299	6502	2783087	SO:0001819	synonymous_variant	8908	exon6			U94361	CCDS14121.1, CCDS48074.1	Xp22.3	2013-02-22			ENSG00000056998	ENSG00000056998	2.4.1.186	"""Glycosyltransferase family 8 domain containing"""	4700	protein-coding gene	gene with protein product	"""glycogenin glucosyltransferase"""	300198				9857012	Standard	NM_001079855		Approved	GN-2	uc004cqs.1	O15488	OTTHUMG00000021079	ENST00000381163.3:c.471G>A	X.37:g.2773087G>A		Somatic		Capture	Illumina HiSeq	Phase_I	2783087	NM_001184703	B7WNN6|O15485|O15486|O15487|O15489|O15490	Silent	SNP	ENST00000381163.3	37	CCDS14121.1																																																																																				GYG2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055645.1	NM_003918	
CNKSR2	22866	broad.mit.edu	37	X	21549997	21549997	+	Missense_Mutation	SNP	G	G	T	rs151168016		TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chrX:21549997G>T	ENST00000379510.3	+	11	1151	c.1115G>T	c.(1114-1116)tGt>tTt	p.C372F	CNKSR2_ENST00000425654.2_Missense_Mutation_p.C372F|CNKSR2_ENST00000485012.1_3'UTR|CNKSR2_ENST00000543067.1_Missense_Mutation_p.C323F|CNKSR2_ENST00000279451.4_Missense_Mutation_p.C372F	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	372	DUF1170.				regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)		p.C372F(1)		breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						AACCTTCCTTGTGAAGACCTC	0.388																																					p.C323F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G968T	X						.						76.0	73.0	74.0					X																	21549997		2202	4299	6501	21459918	SO:0001583	missense	22866	exon10			AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.1115G>T	X.37:g.21549997G>T	ENSP00000368824:p.Cys372Phe	Somatic		Capture	Illumina HiSeq	Phase_I	21459918	NM_001168649	B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	Missense_Mutation	SNP	ENST00000379510.3	37	CCDS14198.1	.	.	.	.	.	.	.	.	.	.	g	11.49	1.655516	0.29425	.	.	ENSG00000149970	ENST00000425654;ENST00000543067;ENST00000279451;ENST00000379510	T;T;T;T	0.19938	2.5;2.11;2.17;2.45	5.54	5.54	0.83059	Connector enhancer of kinase suppressor of ras 2 (1);	0.153158	0.64402	D	0.000012	T	0.24160	0.0585	L	0.39898	1.24	0.36861	D	0.888417	P;P;P	0.48294	0.908;0.584;0.457	P;B;B	0.47299	0.543;0.178;0.296	T	0.06588	-1.0818	10	0.10377	T	0.69	-1.6162	18.4882	0.90836	0.0:0.0:1.0:0.0	.	372;323;372	B7ZLJ1;B4DGR4;Q8WXI2	.;.;CNKR2_HUMAN	F	372;323;372;372	ENSP00000397906:C372F;ENSP00000444633:C323F;ENSP00000279451:C372F;ENSP00000368824:C372F	ENSP00000279451:C372F	C	+	2	0	CNKSR2	21459918	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.060000	0.57477	2.307000	0.77673	0.534000	0.68092	TGT		CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056019.1	NM_014927	
DDX53	168400	broad.mit.edu	37	X	23018421	23018421	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chrX:23018421C>G	ENST00000327968.5	+	1	335	c.247C>G	c.(247-249)Cag>Gag	p.Q83E	RP11-40F8.2_ENST00000455399.1_lincRNA	NM_182699.3	NP_874358.2	Q86TM3	DDX53_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 53	83	KH. {ECO:0000255|PROSITE- ProRule:PRU00117}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|RNA binding (GO:0003723)	p.Q83E(1)		breast(2)|endometrium(5)|kidney(4)|large_intestine(3)|lung(15)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	35						CACTAAAATACAGATCATAAA	0.348																																					p.Q83E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C247G	X						.						70.0	74.0	73.0					X																	23018421		2203	4300	6503	22928342	SO:0001583	missense	168400	exon1			AY039237	CCDS35214.1	Xp22.13	2009-03-25			ENSG00000184735	ENSG00000184735		"""DEAD-boxes"""	20083	protein-coding gene	gene with protein product	"""cancer associated gene"", ""cancer/testis antigen 26"""						Standard	NM_182699		Approved	CAGE, CT26	uc004daj.3	Q86TM3	OTTHUMG00000021248	ENST00000327968.5:c.247C>G	X.37:g.23018421C>G	ENSP00000368667:p.Gln83Glu	Somatic		Capture	Illumina HiSeq	Phase_I	22928342	NM_182699	Q0D2N2|Q6NVV4	Missense_Mutation	SNP	ENST00000327968.5	37	CCDS35214.1	.	.	.	.	.	.	.	.	.	.	C	13.16	2.154839	0.38021	.	.	ENSG00000184735	ENST00000327968	T	0.30182	1.54	4.3	0.399	0.16325	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.231991	0.34959	N	0.003555	T	0.30727	0.0774	M	0.69463	2.115	0.09310	N	1	P	0.36712	0.566	B	0.43990	0.438	T	0.15037	-1.0451	10	0.36615	T	0.2	-0.45	3.2175	0.06704	0.1879:0.4941:0.0:0.318	.	83	Q86TM3	DDX53_HUMAN	E	83	ENSP00000368667:Q83E	ENSP00000368667:Q83E	Q	+	1	0	DDX53	22928342	0.001000	0.12720	0.000000	0.03702	0.069000	0.16628	-0.316000	0.08071	-0.153000	0.11137	0.600000	0.82982	CAG		DDX53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056043.1	NM_182699	
CHRDL1	91851	broad.mit.edu	37	X	109919585	109919585	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3844-01A-01W-0995-10	TCGA-AA-3844-10A-01W-0995-10	g.chrX:109919585C>A	ENST00000372045.1	-	12	1358	c.1227G>T	c.(1225-1227)caG>caT	p.Q409H	CHRDL1_ENST00000394797.4_Missense_Mutation_p.Q415H|CHRDL1_ENST00000434224.1_Missense_Mutation_p.Q336H|CHRDL1_ENST00000482160.1_Missense_Mutation_p.Q337H|CHRDL1_ENST00000218054.4_Missense_Mutation_p.Q415H|CHRDL1_ENST00000372042.1_Missense_Mutation_p.Q417H|CHRDL1_ENST00000444321.2_Missense_Mutation_p.Q416H			Q9BU40	CRDL1_HUMAN	chordin-like 1	409					BMP signaling pathway (GO:0030509)|cell differentiation (GO:0030154)|compound eye development (GO:0048749)|eye development (GO:0001654)|negative regulation of BMP signaling pathway (GO:0030514)|nervous system development (GO:0007399)|ossification (GO:0001503)	extracellular region (GO:0005576)		p.Q415H(1)		endometrium(1)|large_intestine(12)|liver(1)|lung(15)|prostate(1)|skin(1)	31						AGATCTTCCACTGGCCTAAAA	0.453																																					p.Q417H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1251T	X						.						94.0	76.0	82.0					X																	109919585		2203	4300	6503	109806241	SO:0001583	missense	91851	exon12			AL049176	CCDS14553.1, CCDS48148.1, CCDS48149.1, CCDS48150.1, CCDS48148.2	Xq23	2014-01-31			ENSG00000101938	ENSG00000101938			29861	protein-coding gene	gene with protein product		300350	"""megalocornea 1 (X-linked)"""	MGC1		11441185, 11118896, 22284829	Standard	NM_001143981		Approved	NRLN1, CHL	uc004eow.3	Q9BU40	OTTHUMG00000022199	ENST00000372045.1:c.1227G>T	X.37:g.109919585C>A	ENSP00000361115:p.Gln409His	Somatic		Capture	Illumina HiSeq	Phase_I	109806241	NM_001143981	B1AKD0|B4DMP3|D3DUY6|E9PGS5|Q539E4|Q9Y3H7	Missense_Mutation	SNP	ENST00000372045.1	37		.	.	.	.	.	.	.	.	.	.	C	8.648	0.897641	0.17686	.	.	ENSG00000101938	ENST00000372045;ENST00000434224;ENST00000218054;ENST00000394797;ENST00000372042;ENST00000482160;ENST00000444321	T;T;T;T;T;T;T	0.30448	2.27;1.53;2.27;2.27;2.53;1.53;2.27	4.79	3.0	0.34707	.	0.253701	0.40469	N	0.001092	T	0.33498	0.0865	N	0.17082	0.46	0.41888	D	0.990353	D;P;P;P;P;D	0.61697	0.958;0.61;0.61;0.61;0.61;0.99	P;B;B;B;B;D	0.70487	0.535;0.191;0.191;0.191;0.191;0.969	T	0.05767	-1.0865	9	.	.	.	-8.095	10.3315	0.43825	0.0:0.83:0.0:0.17	.	337;416;396;409;417;336	B4DMP3;E9PGS5;Q59FB2;Q9BU40;D3DUY6;D3YTA8	.;.;.;CRDL1_HUMAN;.;.	H	409;336;415;415;417;337;416	ENSP00000361115:Q409H;ENSP00000389627:Q336H;ENSP00000218054:Q415H;ENSP00000378276:Q415H;ENSP00000361112:Q417H;ENSP00000418443:Q337H;ENSP00000399739:Q416H	.	Q	-	3	2	CHRDL1	109806241	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.084000	0.41625	1.096000	0.41439	0.600000	0.82982	CAG		CHRDL1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000057912.1	NM_145234	
