#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SH3PXD2A	9644	broad.mit.edu	37	10	105362228	105362228	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr10:105362228C>T	ENST00000369774.4	-	15	3023	c.2747G>A	c.(2746-2748)gGc>gAc	p.G916D	SH3PXD2A_ENST00000538130.1_Missense_Mutation_p.G751D|SH3PXD2A_ENST00000427662.2_Intron|SH3PXD2A_ENST00000355946.2_Missense_Mutation_p.G888D|SH3PXD2A_ENST00000540321.1_Missense_Mutation_p.G783D|SH3PXD2A_ENST00000315994.6_5'UTR			Q5TCZ1	SPD2A_HUMAN	SH3 and PX domains 2A	916					superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol binding (GO:0035091)	p.G888D(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(18)|ovary(1)|skin(1)|urinary_tract(1)	38		Colorectal(252;0.0815)|Breast(234;0.131)		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)		GTTCTGCCTGCCCTTGGCGGG	0.612																																					p.G888D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2663A	10						.						120.0	113.0	115.0					10																	105362228		2203	4300	6503	105352218	SO:0001583	missense	9644	exon14			AB007878	CCDS31278.1	10q25.1	2006-02-13	2006-02-13	2006-02-13	ENSG00000107957	ENSG00000107957			23664	protein-coding gene	gene with protein product	"""five SH3 domains"""		"""SH3 multiple domains 1"""	SH3MD1		9687503	Standard	XM_005270297		Approved	FISH, KIAA0418	uc001kxj.1	Q5TCZ1	OTTHUMG00000018997	ENST00000369774.4:c.2747G>A	10.37:g.105362228C>T	ENSP00000358789:p.Gly916Asp	Somatic		Capture	Illumina HiSeq	Phase_I	105352218	NM_014631	D3DR98|O43302|Q5TCZ2|Q5TDQ8	Missense_Mutation	SNP	ENST00000369774.4	37		.	.	.	.	.	.	.	.	.	.	C	0.003	-2.554836	0.00138	.	.	ENSG00000107957	ENST00000369774;ENST00000355946;ENST00000315994;ENST00000536035;ENST00000540321;ENST00000538130	T;T;T;T	0.29142	1.58;1.58;1.58;1.58	4.77	1.61	0.23674	Src homology-3 domain (1);	0.584721	0.19338	N	0.116718	T	0.12860	0.0312	N	0.14661	0.345	0.09310	N	1	B;B;B;B	0.17667	0.013;0.0;0.0;0.023	B;B;B;B	0.18561	0.01;0.0;0.0;0.022	T	0.17561	-1.0365	10	0.19147	T	0.46	-15.568	1.6899	0.02849	0.133:0.4075:0.1479:0.3115	.	916;765;761;888	Q5TCZ1;B7Z9L8;B7Z3B0;Q5TCZ1-3	SPD2A_HUMAN;.;.;.	D	916;888;723;831;783;751	ENSP00000358789:G916D;ENSP00000348215:G888D;ENSP00000443663:G783D;ENSP00000441514:G751D	ENSP00000318135:G723D	G	-	2	0	SH3PXD2A	105352218	0.005000	0.15991	0.607000	0.28956	0.027000	0.11550	-0.061000	0.11693	0.463000	0.27118	-0.263000	0.10527	GGC		SH3PXD2A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050178.1	NM_014631	
NRAP	4892	broad.mit.edu	37	10	115413785	115413785	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr10:115413785C>T	ENST00000359988.3	-	5	704	c.460G>A	c.(460-462)Ggt>Agt	p.G154S	NRAP_ENST00000360478.3_Missense_Mutation_p.G154S|NRAP_ENST00000369358.4_Missense_Mutation_p.G154S|NRAP_ENST00000369360.3_Missense_Mutation_p.G154S	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2			nebulin-related anchoring protein									p.G154S(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(18)|lung(39)|ovary(6)|prostate(3)|skin(1)|stomach(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		CTTACCTCACCAAGAGACTTT	0.448																																					p.G154S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G460A	10						.						192.0	193.0	193.0					10																	115413785		2203	4300	6503	115403775	SO:0001583	missense	4892	exon5				CCDS7578.1, CCDS7579.1, CCDS73199.1	10q24-q26	2008-08-01			ENSG00000197893	ENSG00000197893			7988	protein-coding gene	gene with protein product		602873				12789664, 10320340	Standard	NM_006175		Approved		uc001lal.4	Q86VF7	OTTHUMG00000019072	ENST00000359988.3:c.460G>A	10.37:g.115413785C>T	ENSP00000353078:p.Gly154Ser	Somatic		Capture	Illumina HiSeq	Phase_I	115403775	NM_198060		Missense_Mutation	SNP	ENST00000359988.3	37	CCDS7579.1	.	.	.	.	.	.	.	.	.	.	C	7.098	0.573539	0.13623	.	.	ENSG00000197893	ENST00000369358;ENST00000369360;ENST00000359988;ENST00000360478	T;T;T;T	0.12569	2.88;2.9;2.74;2.67	5.96	3.88	0.44766	.	0.238428	0.47455	D	0.000237	T	0.03564	0.0102	N	0.02247	-0.625	0.27571	N	0.94989	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.06405	0.002;0.002;0.002	T	0.41998	-0.9477	10	0.02654	T	1	.	4.1217	0.10108	0.0:0.5959:0.253:0.151	.	154;154;154	A0AVL2;Q86VF7-4;Q86VF7	.;.;NRAP_HUMAN	S	154	ENSP00000358365:G154S;ENSP00000358367:G154S;ENSP00000353078:G154S;ENSP00000353666:G154S	ENSP00000353078:G154S	G	-	1	0	NRAP	115403775	0.071000	0.21146	0.988000	0.46212	0.992000	0.81027	0.389000	0.20751	1.505000	0.48720	0.655000	0.94253	GGT		NRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050425.2	NM_006175	
CCDC172	374355	broad.mit.edu	37	10	118101711	118101711	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr10:118101711G>A	ENST00000333254.3	+	5	697	c.446G>A	c.(445-447)aGt>aAt	p.S149N	CCDC172_ENST00000497093.1_3'UTR	NM_198515.2	NP_940917.1	P0C7W6	CC172_HUMAN	coiled-coil domain containing 172	149								p.S149N(1)									ATGTTGAAAAGTGGTATGAAT	0.249																																					p.S149N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G446A	10						.						45.0	48.0	47.0					10																	118101711		2196	4259	6455	118091701	SO:0001583	missense	374355	exon5			BC044830	CCDS31291.1	10q26.11-q26.12	2012-05-31	2012-05-31	2012-05-31	ENSG00000182645	ENSG00000182645			30524	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 96"""	C10orf96		12477932	Standard	NM_198515		Approved	MGC35062	uc001lck.3	P0C7W6	OTTHUMG00000019098	ENST00000333254.3:c.446G>A	10.37:g.118101711G>A	ENSP00000329860:p.Ser149Asn	Somatic		Capture	Illumina HiSeq	Phase_I	118091701	NM_198515		Missense_Mutation	SNP	ENST00000333254.3	37	CCDS31291.1	.	.	.	.	.	.	.	.	.	.	G	1.777	-0.482868	0.04383	.	.	ENSG00000182645	ENST00000333254;ENST00000423072	.	.	.	5.41	-4.08	0.03963	.	1.106020	0.06611	N	0.755573	T	0.14313	0.0346	N	0.11927	0.2	0.18873	N	0.999989	B	0.02656	0.0	B	0.04013	0.001	T	0.29397	-1.0013	9	0.05959	T	0.93	-16.9424	4.7667	0.13135	0.3825:0.0:0.2352:0.3823	.	149	P0C7W6	CJ096_HUMAN	N	149	.	ENSP00000329860:S149N	S	+	2	0	C10orf96	118091701	0.004000	0.15560	0.370000	0.25965	0.849000	0.48306	-0.013000	0.12678	-0.695000	0.05105	-0.274000	0.10170	AGT		CCDC172-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050516.2	NM_198515	
ITGA8	8516	broad.mit.edu	37	10	15628600	15628600	+	Silent	SNP	C	C	T	rs145199076		TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr10:15628600C>T	ENST00000378076.3	-	23	2708	c.2355G>A	c.(2353-2355)gcG>gcA	p.A785A		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	785					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)	p.A785A(1)		NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						TTTCCACCTGCGCTACAGCAG	0.363													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19480	0.0		0.0	False		,,,				2504	0.0				p.A785A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2355A	10						.						144.0	126.0	132.0					10																	15628600		2203	4300	6503	15668606	SO:0001819	synonymous_variant	8516	exon23			L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.2355G>A	10.37:g.15628600C>T		Somatic		Capture	Illumina HiSeq	Phase_I	15668606	NM_003638	B0YJ31|Q5VX94	Silent	SNP	ENST00000378076.3	37	CCDS31155.1																																																																																				ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046987.1	NM_003638	
MTPAP	55149	broad.mit.edu	37	10	30625772	30625772	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr10:30625772A>C	ENST00000263063.4	-	4	783	c.740T>G	c.(739-741)tTt>tGt	p.F247C	MTPAP_ENST00000358107.4_Missense_Mutation_p.F377C|MTPAP_ENST00000488290.1_5'UTR	NM_018109.3	NP_060579.3	Q9NVV4	PAPD1_HUMAN	mitochondrial poly(A) polymerase	247					cell death (GO:0008219)|histone mRNA catabolic process (GO:0071044)|mRNA polyadenylation (GO:0006378)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)|protein homodimerization activity (GO:0042803)|UTP binding (GO:0002134)	p.F247C(1)|p.F377C(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						TAGATCCAAAAACATGTCCAA	0.393																																					p.F247C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T740G	10						.						228.0	242.0	237.0					10																	30625772		2203	4300	6503	30665778	SO:0001583	missense	55149	exon4			AL122121	CCDS7165.1	10p12.1	2014-01-30	2009-01-12	2009-01-12	ENSG00000107951	ENSG00000107951			25532	protein-coding gene	gene with protein product	"""TUTase1"""	613669	"""PAP associated domain containing 1"""	PAPD1		12239557, 15769737, 15547249	Standard	NM_018109		Approved	FLJ10486, mtPAP, SPAX4	uc001iva.4	Q9NVV4	OTTHUMG00000017895	ENST00000263063.4:c.740T>G	10.37:g.30625772A>C	ENSP00000263063:p.Phe247Cys	Somatic		Capture	Illumina HiSeq	Phase_I	30665778	NM_018109	D3DRX0|Q659E3|Q6P7E5|Q9HA74	Missense_Mutation	SNP	ENST00000263063.4	37	CCDS7165.1	.	.	.	.	.	.	.	.	.	.	A	18.33	3.600556	0.66332	.	.	ENSG00000107951	ENST00000358107;ENST00000263063;ENST00000417581	T;T;T	0.38722	1.12;1.12;1.12	5.64	5.64	0.86602	.	0.050571	0.85682	D	0.000000	T	0.47507	0.1449	L	0.28504	0.86	0.51482	D	0.999923	D;P	0.89917	1.0;0.629	D;B	0.72075	0.976;0.269	T	0.34700	-0.9818	10	0.02654	T	1	-25.8043	15.8581	0.79000	1.0:0.0:0.0:0.0	.	377;247	Q9NVV4-2;Q9NVV4	.;PAPD1_HUMAN	C	377;247;182	ENSP00000350820:F377C;ENSP00000263063:F247C;ENSP00000404392:F182C	ENSP00000263063:F247C	F	-	2	0	MTPAP	30665778	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	8.754000	0.91642	2.152000	0.67230	0.528000	0.53228	TTT		MTPAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047426.2	NM_018109	
PPP3CB	5532	broad.mit.edu	37	10	75227328	75227328	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr10:75227328G>A	ENST00000360663.5	-	9	1202	c.1091C>T	c.(1090-1092)cCg>cTg	p.P364L	PPP3CB_ENST00000394822.2_Missense_Mutation_p.P382L|PPP3CB_ENST00000394828.2_Missense_Mutation_p.P364L|PPP3CB_ENST00000545874.1_Missense_Mutation_p.P278L|PPP3CB_ENST00000544628.1_5'Flank|PPP3CB_ENST00000342558.3_Missense_Mutation_p.P364L|PPP3CB_ENST00000394829.2_Missense_Mutation_p.P364L|PPP3CB_ENST00000495897.1_5'UTR			P16298	PP2BB_HUMAN	protein phosphatase 3, catalytic subunit, beta isozyme	364					axon extension (GO:0048675)|calcium ion-dependent exocytosis (GO:0017156)|cellular response to drug (GO:0035690)|dephosphorylation (GO:0016311)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|innate immune response (GO:0045087)|learning (GO:0007612)|locomotion involved in locomotory behavior (GO:0031987)|memory (GO:0007613)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of transcription, DNA-templated (GO:0045893)|protein dephosphorylation (GO:0006470)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of synaptic plasticity (GO:0048167)|response to cytokine (GO:0034097)|signal transduction (GO:0007165)|social behavior (GO:0035176)|T cell activation (GO:0042110)|T cell differentiation (GO:0030217)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)	calcineurin complex (GO:0005955)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein phosphatase activity (GO:0033192)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|protein dimerization activity (GO:0046983)|protein phosphatase 2B binding (GO:0030346)|protein serine/threonine phosphatase activity (GO:0004722)	p.P27L(1)|p.P364L(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(7)|skin(1)|urinary_tract(1)	22	Prostate(51;0.0119)					TCCAACAAACGGTAAAGACCA	0.294																																					p.P364L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1091T	10						.						58.0	55.0	56.0					10																	75227328		2201	4297	6498	74897334	SO:0001583	missense	5532	exon9			M29551	CCDS7328.1, CCDS44436.1, CCDS44437.1	10q22.2	2010-03-17	2010-03-05		ENSG00000107758	ENSG00000107758	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9315	protein-coding gene	gene with protein product	"""calcineurin A beta"", ""protein phosphatase 2B, catalytic subunit, beta isoform"""	114106	"""protein phosphatase 3 (formerly 2B), catalytic subunit, beta isoform (calcineurin A beta)"", ""protein phosphatase 3 (formerly 2B), catalytic subunit, beta isoform"""	CALNB		1659808, 2558868	Standard	XM_005269944		Approved	CALNA2, CNA2, PP2Bbeta	uc001juf.3	P16298	OTTHUMG00000018472	ENST00000360663.5:c.1091C>T	10.37:g.75227328G>A	ENSP00000353881:p.Pro364Leu	Somatic		Capture	Illumina HiSeq	Phase_I	74897334	NM_001142353	P16299|Q5F2F9|Q8N1F0|Q8N3W4	Missense_Mutation	SNP	ENST00000360663.5	37	CCDS7328.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.918431	0.92249	.	.	ENSG00000107758	ENST00000360663;ENST00000394829;ENST00000394828;ENST00000394823;ENST00000430762;ENST00000342558;ENST00000545874;ENST00000394822	T;T;T;T;T;T	0.07021	3.23;3.23;3.23;3.23;3.23;3.23	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.37705	0.1013	M	0.87097	2.86	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.998;1.0	D;D;D;P;D	0.73380	0.913;0.955;0.98;0.709;0.968	T	0.15665	-1.0429	10	0.87932	D	0	.	20.6397	0.99537	0.0:0.0:1.0:0.0	.	382;278;364;364;364	P16298-2;F5H0F8;P16298-3;Q8N1F0;P16298	.;.;.;.;PP2BB_HUMAN	L	364;364;364;27;17;364;278;382	ENSP00000353881:P364L;ENSP00000378306:P364L;ENSP00000378305:P364L;ENSP00000343147:P364L;ENSP00000439876:P278L;ENSP00000378299:P382L	ENSP00000343147:P364L	P	-	2	0	PPP3CB	74897334	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.835000	0.99442	2.880000	0.98712	0.650000	0.86243	CCG		PPP3CB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048669.1	NM_021132	
SLC16A12	387700	broad.mit.edu	37	10	91195896	91195896	+	Silent	SNP	C	C	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr10:91195896C>A	ENST00000341233.4	-	7	1509	c.1119G>T	c.(1117-1119)ggG>ggT	p.G373G	SLC16A12_ENST00000371790.4_Silent_p.G403G	NM_213606.3	NP_998771.3	Q6ZSM3	MOT12_HUMAN	solute carrier family 16, member 12	373						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)	p.G373G(1)		central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(4)|skin(1)|stomach(1)	14						AAGAGGTGGTCCCCACTATCT	0.502																																					p.G403G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1209T	10						.						130.0	103.0	112.0					10																	91195896		2203	4300	6503	91185876	SO:0001819	synonymous_variant	387700	exon7				CCDS7404.1, CCDS7404.2	10q23.32	2013-07-18	2013-07-18		ENSG00000152779	ENSG00000152779		"""Solute carriers"""	23094	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 12"""	611910	"""solute carrier family 16 (monocarboxylic acid transporters), member 12"", ""solute carrier family 16, member 12 (monocarboxylic acid transporter 12)"""				Standard	NM_213606		Approved	MCT12	uc001kgm.3	Q6ZSM3	OTTHUMG00000018714	ENST00000341233.4:c.1119G>T	10.37:g.91195896C>A		Somatic		Capture	Illumina HiSeq	Phase_I	91185876	NM_213606	Q5M9M9|Q5T7J2|Q6ZV76	Silent	SNP	ENST00000341233.4	37																																																																																					SLC16A12-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_213606	
ADAM12	8038	broad.mit.edu	37	10	127782640	127782640	+	Silent	SNP	G	G	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr10:127782640G>A	ENST00000368679.4	-	11	1377	c.1068C>T	c.(1066-1068)ttC>ttT	p.F356F	ADAM12_ENST00000368676.4_Silent_p.F356F	NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12	356	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)	p.F356F(3)		biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		GATTCATCCCGAAATTGTGGC	0.502																																					p.F356F												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.C1068T	10						.						148.0	128.0	135.0					10																	127782640		2203	4300	6503	127772630	SO:0001819	synonymous_variant	8038	exon11			AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.1068C>T	10.37:g.127782640G>A		Somatic		Capture	Illumina HiSeq	Phase_I	127772630	NM_021641	O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Silent	SNP	ENST00000368679.4	37	CCDS7653.1																																																																																				ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050961.1		
SYT8	90019	broad.mit.edu	37	11	1858194	1858194	+	Silent	SNP	C	C	T	rs149017446	byFrequency	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr11:1858194C>T	ENST00000381968.3	+	8	968	c.840C>T	c.(838-840)taC>taT	p.Y280Y	SYT8_ENST00000341958.3_Silent_p.Y266Y|TNNI2_ENST00000252898.7_5'Flank|SYT8_ENST00000535046.1_3'UTR|TNNI2_ENST00000381906.1_5'Flank|TNNI2_ENST00000381911.1_5'Flank	NM_138567.3	NP_612634	Q8NBV8	SYT8_HUMAN	synaptotagmin VIII	280	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				acrosome reaction (GO:0007340)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	transporter activity (GO:0005215)	p.Y280Y(1)		breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CAGAGCCCTACGTGAAGGTCC	0.617													C|||	9	0.00179712	0.0068	0.0	5008	,	,		19072	0.0		0.0	False		,,,				2504	0.0				p.Y280Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C840T	11						.	C		29,4375	35.2+/-66.4	0,29,2173	67.0	77.0	74.0		840	-2.6	0.7	11	dbSNP_134	74	1,8597		0,1,4298	no	coding-synonymous	SYT8	NM_138567.3		0,30,6471	TT,TC,CC		0.0116,0.6585,0.2307		280/402	1858194	30,12972	2202	4299	6501	1814770	SO:0001819	synonymous_variant	90019	exon8			AL137708	CCDS7726.2	11p15.5	2013-01-21			ENSG00000149043	ENSG00000149043		"""Synaptotagmins"""	19264	protein-coding gene	gene with protein product		607719				7791877	Standard	XM_005253216		Approved	DKFZp434K0322	uc001lue.1	Q8NBV8	OTTHUMG00000009026	ENST00000381968.3:c.840C>T	11.37:g.1858194C>T		Somatic		Capture	Illumina HiSeq	Phase_I	1814770	NM_138567	A6NFJ4|Q9NSV9	Silent	SNP	ENST00000381968.3	37	CCDS7726.2	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	c	2.242	-0.373590	0.05034	0.006585	1.16E-4	ENSG00000149043	ENST00000381978	.	.	.	3.17	-2.56	0.06268	.	.	.	.	.	T	0.44159	0.1280	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43861	-0.9365	4	.	.	.	.	8.451	0.32871	0.0:0.2194:0.0:0.7806	.	.	.	.	C	279	.	.	R	+	1	0	SYT8	1814770	0.127000	0.22367	0.719000	0.30619	0.313000	0.28021	-0.632000	0.05489	-0.504000	0.06577	-0.339000	0.08088	CGT		SYT8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025013.4		
SMPD1	6609	broad.mit.edu	37	11	6412984	6412984	+	Missense_Mutation	SNP	G	G	A	rs141387770		TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr11:6412984G>A	ENST00000342245.4	+	2	857	c.689G>A	c.(688-690)cGc>cAc	p.R230H	SMPD1_ENST00000533196.1_Intron|SMPD1_ENST00000527275.1_Missense_Mutation_p.R229H|SMPD1_ENST00000356761.2_Missense_Mutation_p.R230H|SMPD1_ENST00000299397.3_Missense_Mutation_p.R230H	NM_000543.4|NM_001007593.2	NP_000534.3|NP_001007594.2	P17405	ASM_HUMAN	sphingomyelin phosphodiesterase 1, acid lysosomal	228					cell death (GO:0008219)|ceramide biosynthetic process (GO:0046513)|glycosphingolipid metabolic process (GO:0006687)|negative regulation of MAP kinase activity (GO:0043407)|nervous system development (GO:0007399)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein dephosphorylation (GO:0035307)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)|sphingomyelin metabolic process (GO:0006684)|termination of signal transduction (GO:0023021)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lamellar body (GO:0042599)|lysosomal lumen (GO:0043202)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)	p.R230H(2)		breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(3)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)	Amlodipine(DB00381)|Chlorpromazine(DB00477)|Desipramine(DB01151)	CTGTGCTGCCGCCGGGGTTCT	0.657													G|||	1	0.000199681	0.0008	0.0	5008	,	,		9953	0.0		0.0	False		,,,				2504	0.0				p.R229H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G686A	11	GRCh37	CM051643	SMPD1	M	rs141387770	.	G	HIS/ARG,HIS/ARG	8,4394	14.3+/-33.2	0,8,2193	37.0	41.0	40.0		689,686	5.2	1.0	11	dbSNP_134	40	0,8592		0,0,4296	yes	missense,missense	SMPD1	NM_000543.4,NM_001007593.2	29,29	0,8,6489	AA,AG,GG		0.0,0.1817,0.0616	probably-damaging,probably-damaging	230/632,229/631	6412984	8,12986	2201	4296	6497	6369560	SO:0001583	missense	6609	exon2			AB209775	CCDS31409.1, CCDS44531.1, CCDS31409.2	11p15.4-p15.1	2010-04-28	2008-02-04		ENSG00000166311	ENSG00000166311	3.1.4.12		11120	protein-coding gene	gene with protein product	"""acid sphingomyelinase"""	607608				1711683	Standard	NM_000543		Approved	ASM	uc001mcw.3	P17405	OTTHUMG00000165453	ENST00000342245.4:c.689G>A	11.37:g.6412984G>A	ENSP00000340409:p.Arg230His	Somatic		Capture	Illumina HiSeq	Phase_I	6369560	NM_001007593	A8K8M3|E9PKS3|P17406|Q13811|Q16837|Q16841	Missense_Mutation	SNP	ENST00000342245.4	37	CCDS44531.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	24.6	4.554201	0.86231	0.001817	0.0	ENSG00000166311	ENST00000299397;ENST00000356761;ENST00000342245;ENST00000527275	D;D;D;D	0.94758	-3.51;-3.51;-3.51;-3.51	5.15	5.15	0.70609	Metallophosphoesterase domain (1);	0.066033	0.64402	D	0.000010	D	0.96700	0.8923	M	0.68728	2.09	0.80722	D	1	D;D;D	0.89917	1.0;0.998;0.983	D;D;P	0.72075	0.976;0.964;0.749	D	0.97280	0.9917	10	0.87932	D	0	-25.552	17.191	0.86879	0.0:0.0:1.0:0.0	.	229;230;228	E9PKS3;G3XAB5;P17405	.;.;ASM_HUMAN	H	230;230;230;229	ENSP00000299397:R230H;ENSP00000349203:R230H;ENSP00000340409:R230H;ENSP00000435350:R229H	ENSP00000299397:R230H	R	+	2	0	SMPD1	6369560	1.000000	0.71417	0.985000	0.45067	0.685000	0.39939	7.333000	0.79214	2.396000	0.81511	0.655000	0.94253	CGC		SMPD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384205.1	NM_000543	
MAPK8IP1	9479	broad.mit.edu	37	11	45924508	45924508	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr11:45924508G>A	ENST00000241014.2	+	5	1360	c.1190G>A	c.(1189-1191)cGg>cAg	p.R397Q	MAPK8IP1_ENST00000395629.2_Missense_Mutation_p.R387Q|RP11-618K13.2_ENST00000533218.1_RNA	NM_005456.3	NP_005447.1	Q9UQF2	JIP1_HUMAN	mitogen-activated protein kinase 8 interacting protein 1	397	Interaction with MAP3K7.				JUN phosphorylation (GO:0007258)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|positive regulation of signal transduction (GO:0009967)|regulation of JNK cascade (GO:0046328)|regulation of transcription, DNA-templated (GO:0006355)|vesicle-mediated transport (GO:0016192)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic growth cone (GO:0044294)|dentate gyrus mossy fiber (GO:0044302)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)|protein kinase inhibitor activity (GO:0004860)	p.R397Q(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(2)	24				GBM - Glioblastoma multiforme(35;0.231)		GTGAGCCTGCGGCCGTGCTTC	0.602																																					p.R397Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1190A	11						.						48.0	38.0	41.0					11																	45924508		2203	4298	6501	45881084	SO:0001583	missense	9479	exon5				CCDS7916.1	11p11.2	2009-07-24			ENSG00000121653	ENSG00000121653			6882	protein-coding gene	gene with protein product		604641		PRKM8IP		9235893, 9442013	Standard	NM_005456		Approved	IB1, JIP-1, JIP1	uc001nbr.3	Q9UQF2	OTTHUMG00000134324	ENST00000241014.2:c.1190G>A	11.37:g.45924508G>A	ENSP00000241014:p.Arg397Gln	Somatic		Capture	Illumina HiSeq	Phase_I	45881084	NM_005456	D3DQP4|O43407	Missense_Mutation	SNP	ENST00000241014.2	37	CCDS7916.1	.	.	.	.	.	.	.	.	.	.	G	16.21	3.059233	0.55325	.	.	ENSG00000121653	ENST00000241014;ENST00000395629	T;T	0.21932	1.98;1.98	4.69	4.69	0.59074	Src homology-3 domain (1);	0.056992	0.64402	D	0.000004	T	0.12689	0.0308	N	0.24115	0.695	0.41388	D	0.987593	B	0.34313	0.448	B	0.29440	0.102	T	0.05632	-1.0873	10	0.54805	T	0.06	-28.0162	8.9468	0.35764	0.1356:0.0:0.8644:0.0	.	397	Q9UQF2	JIP1_HUMAN	Q	397;387	ENSP00000241014:R397Q;ENSP00000378991:R387Q	ENSP00000241014:R397Q	R	+	2	0	MAPK8IP1	45881084	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	1.730000	0.38125	2.448000	0.82819	0.561000	0.74099	CGG		MAPK8IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259405.1	NM_005456	
PLEKHA5	54477	broad.mit.edu	37	12	19418768	19418768	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr12:19418768G>A	ENST00000299275.6	+	8	701	c.695G>A	c.(694-696)cGc>cAc	p.R232H	PLEKHA5_ENST00000510738.2_3'UTR|PLEKHA5_ENST00000429027.2_Missense_Mutation_p.R232H|PLEKHA5_ENST00000317589.4_Missense_Mutation_p.R232H|PLEKHA5_ENST00000359180.3_Missense_Mutation_p.R232H|PLEKHA5_ENST00000355397.3_Missense_Mutation_p.R232H|PLEKHA5_ENST00000309364.4_Missense_Mutation_p.R232H|PLEKHA5_ENST00000539256.1_5'UTR|PLEKHA5_ENST00000424268.1_Missense_Mutation_p.R124H|PLEKHA5_ENST00000543806.1_Missense_Mutation_p.R124H|PLEKHA5_ENST00000538714.1_Missense_Mutation_p.R232H	NM_019012.5	NP_061885.2	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A member 5	232	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				reproductive system development (GO:0061458)	cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)	p.R232H(2)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					CACATTAATCGCAAATATGCT	0.323																																					p.R232H	Pancreas(196;329 2193 11246 14234 19524)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G695A	12						.						117.0	115.0	116.0					12																	19418768		2203	4298	6501	19310035	SO:0001583	missense	54477	exon8			AF302150	CCDS8682.1, CCDS44840.1, CCDS44840.2, CCDS55809.1, CCDS58213.1, CCDS58214.1	12p12	2013-01-10			ENSG00000052126	ENSG00000052126		"""Pleckstrin homology (PH) domain containing"""	30036	protein-coding gene	gene with protein product		607770				11214970, 11001876	Standard	NM_001143821		Approved	PEPP2, KIAA1686, FLJ10667	uc031qgo.1	Q9HAU0	OTTHUMG00000167921	ENST00000299275.6:c.695G>A	12.37:g.19418768G>A	ENSP00000299275:p.Arg232His	Somatic		Capture	Illumina HiSeq	Phase_I	19310035	NM_019012	A0JP03|B4DGS1|E9PHQ3|F5H0I0|Q6NSF8|Q86ST7|Q8N3K6|Q96DY9|Q9BVR4|Q9C0H7|Q9H924|Q9NVK8	Missense_Mutation	SNP	ENST00000299275.6	37	CCDS8682.1	.	.	.	.	.	.	.	.	.	.	G	34	5.345179	0.95807	.	.	ENSG00000052126	ENST00000317589;ENST00000355397;ENST00000359180;ENST00000542828;ENST00000309364;ENST00000412219;ENST00000429027;ENST00000299275;ENST00000538714;ENST00000424268;ENST00000543806;ENST00000536974	T;T;T;T;T;T;T;T;T;T	0.14022	2.54;2.54;2.54;2.54;2.54;2.54;2.54;2.54;2.54;2.54	5.63	5.63	0.86233	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.39462	0.1079	M	0.66560	2.04	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.988;1.0;1.0	D;D;D;D;D;D	0.83275	0.996;0.99;0.99;0.916;0.994;0.993	T	0.10222	-1.0639	10	0.87932	D	0	-13.2091	19.6667	0.95895	0.0:0.0:1.0:0.0	.	232;124;124;232;232;232	Q9HAU0-4;F5H0I0;E7EME8;B4DHK5;Q9HAU0;Q9HAU0-2	.;.;.;.;PKHA5_HUMAN;.	H	232;232;232;232;232;232;232;232;232;124;124;124	ENSP00000325155:R232H;ENSP00000347560:R232H;ENSP00000352104:R232H;ENSP00000311239:R232H;ENSP00000404296:R232H;ENSP00000299275:R232H;ENSP00000439673:R232H;ENSP00000400411:R124H;ENSP00000439837:R124H;ENSP00000440371:R124H	ENSP00000299275:R232H	R	+	2	0	PLEKHA5	19310035	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.385000	0.79763	2.632000	0.89209	0.650000	0.86243	CGC		PLEKHA5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397013.1	NM_019012	
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000311936.3_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000556131.1_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12V	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0 	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35T	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	12.37:g.25398284C>A	ENSP00000256078:p.Gly12Val	Somatic		Capture	Illumina HiSeq	Phase_I	25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
MMP19	4327	broad.mit.edu	37	12	56235018	56235018	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr12:56235018G>T	ENST00000322569.4	-	3	267	c.176C>A	c.(175-177)gCt>gAt	p.A59D	MMP19_ENST00000547487.1_5'UTR|MMP19_ENST00000394182.1_5'Flank|MMP19_ENST00000409200.3_Missense_Mutation_p.A59D|MMP19_ENST00000548629.1_Missense_Mutation_p.A59D	NM_002429.4	NP_002420.1	Q99542	MMP19_HUMAN	matrix metallopeptidase 19	59					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|luteolysis (GO:0001554)|ovarian follicle development (GO:0001541)|ovulation from ovarian follicle (GO:0001542)|proteolysis (GO:0006508)|response to cAMP (GO:0051591)|response to hormone (GO:0009725)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.A59D(1)		endometrium(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(2)|skin(2)	26					Marimastat(DB00786)	TTCCTGAAAAGCTCTGAAGGA	0.532																																					p.A59D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C176A	12						.						50.0	50.0	50.0					12																	56235018		2203	4300	6503	54521285	SO:0001583	missense	4327	exon3			X92521	CCDS8895.1, CCDS61146.1	12q14	2005-08-08	2005-08-08			ENSG00000123342			7165	protein-coding gene	gene with protein product		601807	"""matrix metalloproteinase 19"""	MMP18		9232430	Standard	NM_002429		Approved	RASI-1	uc001sib.4	Q99542	OTTHUMG00000170216	ENST00000322569.4:c.176C>A	12.37:g.56235018G>T	ENSP00000313437:p.Ala59Asp	Somatic		Capture	Illumina HiSeq	Phase_I	54521285	NM_002429	B4E030|O15278|O95606|Q99580	Missense_Mutation	SNP	ENST00000322569.4	37	CCDS8895.1	.	.	.	.	.	.	.	.	.	.	G	11.28	1.591483	0.28357	.	.	ENSG00000123342	ENST00000322569;ENST00000548629;ENST00000409200	T;T;T	0.37752	1.18;1.18;1.18	5.89	4.97	0.65823	Peptidoglycan binding-like (2);Metallopeptidase, catalytic domain (1);	0.623383	0.17670	N	0.166015	T	0.33206	0.0855	L	0.39020	1.185	0.80722	D	1	D;P	0.54047	0.964;0.812	P;B	0.47251	0.542;0.328	T	0.02797	-1.1109	10	0.29301	T	0.29	.	10.3827	0.44121	0.0976:0.0:0.9024:0.0	.	59;59	B4E030;Q99542	.;MMP19_HUMAN	D	59	ENSP00000313437:A59D;ENSP00000446979:A59D;ENSP00000386625:A59D	ENSP00000313437:A59D	A	-	2	0	MMP19	54521285	0.995000	0.38212	1.000000	0.80357	0.986000	0.74619	2.565000	0.45939	1.400000	0.46741	0.655000	0.94253	GCT		MMP19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408023.1	NM_002429	
HVCN1	84329	broad.mit.edu	37	12	111088020	111088020	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr12:111088020G>T	ENST00000356742.5	-	6	1462	c.709C>A	c.(709-711)Caa>Aaa	p.Q237K	HVCN1_ENST00000439744.2_Missense_Mutation_p.Q217K|HVCN1_ENST00000242607.8_Missense_Mutation_p.Q237K|HVCN1_ENST00000548312.1_Missense_Mutation_p.Q237K			Q96D96	HVCN1_HUMAN	hydrogen voltage-gated channel 1	237					cellular response to pH (GO:0071467)|cellular response to zinc ion (GO:0071294)|multicellular organism reproduction (GO:0032504)|proton transport (GO:0015992)|response to pH (GO:0009268)|response to zinc ion (GO:0010043)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	voltage-gated cation channel activity (GO:0022843)|voltage-gated proton channel activity (GO:0030171)	p.Q237K(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	19						GCGGCCAATTGTACATTCATC	0.453																																					p.Q237K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C709A	12						.						201.0	174.0	183.0					12																	111088020		2203	4300	6503	109572403	SO:0001583	missense	84329	exon7			BC007277	CCDS31900.1, CCDS58278.1	12q24.11	2011-12-09	2006-03-24	2006-03-24	ENSG00000122986	ENSG00000122986		"""Voltage-gated ion channels / Hydrogen voltage-gated channel"""	28240	protein-coding gene	gene with protein product	"""voltage sensor domain-only protein"""	611227				20961760, 16556803, 18356202, 22020278	Standard	NM_032369		Approved	MGC15619, Hv1, VSOP	uc001trs.2	Q96D96		ENST00000356742.5:c.709C>A	12.37:g.111088020G>T	ENSP00000349181:p.Gln237Lys	Somatic		Capture	Illumina HiSeq	Phase_I	109572403	NM_032369	A8MQ37|B4DEB3|F8WCH5|Q6UW11|Q96IS5	Missense_Mutation	SNP	ENST00000356742.5	37	CCDS31900.1	.	.	.	.	.	.	.	.	.	.	G	11.32	1.603895	0.28534	.	.	ENSG00000122986	ENST00000548312;ENST00000242607;ENST00000356742;ENST00000439744	T;T;T;T	0.43688	0.94;0.94;0.94;0.97	6.17	6.17	0.99709	.	0.333064	0.36519	N	0.002549	T	0.31420	0.0796	N	0.17082	0.46	0.24342	N	0.994958	B;P	0.35155	0.024;0.487	B;B	0.39503	0.01;0.301	T	0.23440	-1.0188	10	0.21540	T	0.41	-26.3815	14.6383	0.68704	0.0:0.0:0.8548:0.1452	.	237;237	Q96D96;Q96D96-3	HVCN1_HUMAN;.	K	237;237;237;217	ENSP00000449601:Q237K;ENSP00000242607:Q237K;ENSP00000349181:Q237K;ENSP00000412052:Q217K	ENSP00000242607:Q237K	Q	-	1	0	HVCN1	109572403	0.998000	0.40836	0.192000	0.23308	0.621000	0.37620	3.544000	0.53640	2.941000	0.99782	0.655000	0.94253	CAA		HVCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404653.1	NM_032369	
THSD1	55901	broad.mit.edu	37	13	52951816	52951816	+	Silent	SNP	C	C	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr13:52951816C>T	ENST00000258613.4	-	5	2467	c.2289G>A	c.(2287-2289)ccG>ccA	p.P763P	THSD1_ENST00000544466.1_Silent_p.P384P|THSD1_ENST00000349258.4_Silent_p.P710P	NM_018676.3	NP_061146.1	Q9NS62	THSD1_HUMAN	thrombospondin, type I, domain containing 1	763					hematopoietic progenitor cell differentiation (GO:0002244)	cell periphery (GO:0071944)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)		p.P763P(1)		breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Breast(56;0.000207)|Lung NSC(96;0.00145)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.8e-08)		GACTGGGGGACGGTCCCCGAC	0.552																																					p.P763P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2289A	13						.						125.0	131.0	129.0					13																	52951816		2203	4300	6503	51849817	SO:0001819	synonymous_variant	55901	exon5			AK096289	CCDS9432.1, CCDS9433.1	13q14.13	2010-04-20	2004-03-11		ENSG00000136114	ENSG00000136114			17754	protein-coding gene	gene with protein product			"""thrombospondin, type I, domain 1"""				Standard	NM_018676		Approved	TMTSP	uc001vgo.3	Q9NS62	OTTHUMG00000016963	ENST00000258613.4:c.2289G>A	13.37:g.52951816C>T		Somatic		Capture	Illumina HiSeq	Phase_I	51849817	NM_018676	A2A3J3|B2RCF5|Q6P3U1|Q6UXZ2	Silent	SNP	ENST00000258613.4	37	CCDS9432.1																																																																																				THSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045058.3		
NID2	22795	broad.mit.edu	37	14	52534612	52534612	+	Nonsense_Mutation	SNP	G	G	C			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr14:52534612G>C	ENST00000216286.5	-	2	497	c.498C>G	c.(496-498)taC>taG	p.Y166*	NID2_ENST00000541773.1_Nonsense_Mutation_p.Y113*	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)	166	NIDO. {ECO:0000255|PROSITE- ProRule:PRU00570}.				basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)	p.Y166*(1)		NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					TGACCTCCTCGTAAGCGCCTA	0.642																																					p.Y166X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C498G	14						.						75.0	92.0	86.0					14																	52534612		2164	4253	6417	51604362	SO:0001587	stop_gained	22795	exon2			AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.498C>G	14.37:g.52534612G>C	ENSP00000216286:p.Tyr166*	Somatic		Capture	Illumina HiSeq	Phase_I	51604362	NM_007361	A8K6I7|B4DU19|O43710	Nonsense_Mutation	SNP	ENST00000216286.5	37	CCDS9706.1	.	.	.	.	.	.	.	.	.	.	G	36	5.674472	0.96764	.	.	ENSG00000087303	ENST00000216286;ENST00000541773;ENST00000395707	.	.	.	5.43	-2.28	0.06826	.	0.170296	0.53938	D	0.000054	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.9696	0.53055	0.498:0.0:0.502:0.0	.	.	.	.	X	166;113;168	.	ENSP00000216286:Y166X	Y	-	3	2	NID2	51604362	0.630000	0.27155	0.970000	0.41538	0.873000	0.50193	-0.163000	0.09997	-0.287000	0.09064	-0.253000	0.11424	TAC		NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276888.1		
CCDC175	729665	broad.mit.edu	37	14	59970710	59970710	+	IGR	SNP	A	A	G			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr14:59970710A>G	ENST00000537690.2	-	0	2616				JKAMP_ENST00000425728.2_Missense_Mutation_p.T280A|JKAMP_ENST00000554271.1_Missense_Mutation_p.T300A|JKAMP_ENST00000356057.5_Missense_Mutation_p.T294A|RP11-701B16.2_ENST00000554253.1_RNA|JKAMP_ENST00000261247.9_Missense_Mutation_p.T286A	NM_001164399.1	NP_001157871.1	P0C221	CC175_HUMAN	coiled-coil domain containing 175									p.T294A(1)									TTTGGTACCTACACCAGCCCT	0.433																																					p.T280A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A838G	14						.						129.0	120.0	123.0					14																	59970710		1833	4084	5917	59040463	SO:0001628	intergenic_variant	51528	exon7				CCDS53898.1	14q23.1	2012-09-24	2012-09-24	2012-09-24	ENSG00000151838	ENSG00000151838			19847	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 38"""	C14orf38			Standard	NM_001164399		Approved		uc021rtw.1	P0C221			14.37:g.59970710A>G		Somatic		Capture	Illumina HiSeq	Phase_I	59040463	NM_001098625	G3V5J7	Missense_Mutation	SNP	ENST00000537690.2	37	CCDS53898.1	.	.	.	.	.	.	.	.	.	.	A	9.424	1.083876	0.20309	.	.	ENSG00000050130	ENST00000261247;ENST00000425728;ENST00000554271;ENST00000356057	.	.	.	5.84	3.45	0.39498	.	0.147660	0.64402	N	0.000015	T	0.14917	0.0360	N	0.01352	-0.895	0.41428	D	0.98784	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.001;0.0;0.0;0.0;0.0	T	0.05225	-1.0898	9	0.11182	T	0.66	-37.7747	4.6947	0.12797	0.5643:0.0:0.4357:0.0	.	301;300;280;294;286	Q9P055;G3V2M4;Q9P055-3;Q9P055-5;Q9P055-4	JKAMP_HUMAN;.;.;.;.	A	286;280;300;294	.	ENSP00000261247:T286A	T	+	1	0	JKAMP	59040463	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	4.617000	0.61204	1.004000	0.39156	0.533000	0.62120	ACA		CCDC175-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471273.1	NM_001164399	
SNAPC1	6617	broad.mit.edu	37	14	62249083	62249083	+	Missense_Mutation	SNP	C	C	A	rs140945950	byFrequency	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr14:62249083C>A	ENST00000216294.4	+	8	1048	c.944C>A	c.(943-945)cCa>cAa	p.P315Q		NM_003082.3	NP_003073.1	Q16533	SNPC1_HUMAN	small nuclear RNA activating complex, polypeptide 1, 43kDa	315					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)	p.P315Q(1)		endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)	13				OV - Ovarian serous cystadenocarcinoma(108;0.0639)|BRCA - Breast invasive adenocarcinoma(234;0.186)		AGATTGAAACCAGCAGGAAGG	0.383																																					p.P315Q	NSCLC(27;223 907 37180 39193 46568)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C944A	14						.						86.0	86.0	86.0					14																	62249083		2203	4300	6503	61318836	SO:0001583	missense	6617	exon8			Z47542	CCDS9755.1	14q22	2008-08-11	2002-08-29		ENSG00000023608	ENSG00000023608			11134	protein-coding gene	gene with protein product		600591	"""small nuclear RNA activating complex, polypeptide 1, 43kD"""			9644240	Standard	NM_003082		Approved	SNAP43, PTFgamma	uc001xft.3	Q16533	OTTHUMG00000140343	ENST00000216294.4:c.944C>A	14.37:g.62249083C>A	ENSP00000216294:p.Pro315Gln	Somatic		Capture	Illumina HiSeq	Phase_I	61318836	NM_003082		Missense_Mutation	SNP	ENST00000216294.4	37	CCDS9755.1	.	.	.	.	.	.	.	.	.	.	C	12.81	2.050360	0.36181	.	.	ENSG00000023608	ENST00000216294	.	.	.	6.17	5.28	0.74379	.	1.232110	0.05070	N	0.481475	T	0.45637	0.1352	L	0.36672	1.1	0.31087	N	0.711307	B	0.34103	0.437	B	0.35470	0.203	T	0.39800	-0.9596	9	0.25106	T	0.35	.	14.5246	0.67878	0.2669:0.7331:0.0:0.0	.	315	Q16533	SNPC1_HUMAN	Q	315	.	ENSP00000216294:P315Q	P	+	2	0	SNAPC1	61318836	0.002000	0.14202	0.467000	0.27180	0.087000	0.18053	0.528000	0.23002	1.602000	0.50124	0.655000	0.94253	CCA		SNAPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276976.2	NM_003082	
VIPAS39	63894	broad.mit.edu	37	14	77901679	77901679	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr14:77901679G>A	ENST00000553888.1	-	14	1480	c.970C>T	c.(970-972)Cgc>Tgc	p.R324C	VIPAS39_ENST00000327028.4_Missense_Mutation_p.R311C|VIPAS39_ENST00000343765.2_Missense_Mutation_p.R324C|VIPAS39_ENST00000557658.1_Missense_Mutation_p.R324C|VIPAS39_ENST00000448935.2_Missense_Mutation_p.R275C|VIPAS39_ENST00000556412.1_Missense_Mutation_p.R350C	NM_001193314.1|NM_001193317.1|NM_022067.3	NP_001180243.1|NP_001180246.1|NP_071350.2	Q9H9C1	SPE39_HUMAN	VPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog	324					cell differentiation (GO:0030154)|endosome to lysosome transport (GO:0008333)|intracellular protein transport (GO:0006886)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|late endosome (GO:0005770)|recycling endosome (GO:0055037)		p.R324C(1)									GAGGCTTTGCGGGGGTGCTTT	0.453																																					p.R324C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C970T	14						.						163.0	151.0	155.0					14																	77901679		2203	4300	6503	76971432	SO:0001583	missense	63894	exon15			AK022925	CCDS9862.1, CCDS53905.1	14q24.3-q31	2013-08-14	2012-07-24	2012-07-24	ENSG00000151445	ENSG00000151445			20347	protein-coding gene	gene with protein product	"""VPS33B interacting protein, apical-basolateral polarity regulator"""	613401	"""chromosome 14 open reading frame 133"""	C14orf133		20190753, 19109425, 22753090, 23002115, 23918659	Standard	NM_022067		Approved	VIPAR, VPS16B, SPE-39, SPE39, hSPE-39	uc001xtu.2	Q9H9C1		ENST00000553888.1:c.970C>T	14.37:g.77901679G>A	ENSP00000452181:p.Arg324Cys	Somatic		Capture	Illumina HiSeq	Phase_I	76971432	NM_022067	B4DPI6|O95434|Q9H7E1|Q9H9I9	Missense_Mutation	SNP	ENST00000553888.1	37	CCDS9862.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.976470	0.74360	.	.	ENSG00000151445	ENST00000343765;ENST00000553888;ENST00000327028;ENST00000557658;ENST00000448935;ENST00000556412	T;T;T;T;T;T	0.49720	0.77;0.77;0.77;0.77;0.77;0.77	5.49	5.49	0.81192	.	0.089458	0.85682	D	0.000000	T	0.63165	0.2488	L	0.53249	1.67	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.72075	0.963;0.976	T	0.64812	-0.6319	10	0.72032	D	0.01	-11.6447	13.8671	0.63594	0.0:0.0:0.8471:0.1529	.	275;324	B4DPI6;Q9H9C1	.;VIPAR_HUMAN	C	324;324;311;324;275;350	ENSP00000339122:R324C;ENSP00000452181:R324C;ENSP00000313098:R311C;ENSP00000452191:R324C;ENSP00000404815:R275C;ENSP00000451857:R350C	ENSP00000313098:R311C	R	-	1	0	VIPAR	76971432	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.390000	0.59646	2.579000	0.87056	0.643000	0.83706	CGC		VIPAS39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414008.1	NM_022067	
MYEF2	50804	broad.mit.edu	37	15	48450978	48450978	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr15:48450978C>A	ENST00000324324.7	-	7	1138	c.859G>T	c.(859-861)Gtt>Ttt	p.V287F	MYEF2_ENST00000267836.6_Missense_Mutation_p.V287F|MYEF2_ENST00000557868.1_5'UTR	NM_016132.3	NP_057216	Q9P2K5	MYEF2_HUMAN	myelin expression factor 2	287	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				myotube differentiation (GO:0014902)|neuron differentiation (GO:0030182)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.V287F(1)		endometrium(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31		all_lung(180;0.00217)		all cancers(107;3.73e-10)|GBM - Glioblastoma multiforme(94;7.81e-07)		ATTGCTTGAACTGCTTCAATT	0.413																																					p.V287F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G859T	15						.						239.0	209.0	219.0					15																	48450978		2198	4297	6495	46238270	SO:0001583	missense	50804	exon7			AB037762	CCDS32230.1, CCDS73722.1	15q15.1	2013-07-16				ENSG00000104177		"""RNA binding motif (RRM) containing"""	17940	protein-coding gene	gene with protein product						10718198, 2601707	Standard	XM_005254422		Approved	MEF-2, FLJ11213, KIAA1341, HsT18564	uc001zwi.4	Q9P2K5		ENST00000324324.7:c.859G>T	15.37:g.48450978C>A	ENSP00000316950:p.Val287Phe	Somatic		Capture	Illumina HiSeq	Phase_I	46238270	NM_016132	A7MCZ9|C9J921|C9K0J4|Q6NUM5|Q7L388|Q7Z4B7|Q9H922|Q9NUQ1	Missense_Mutation	SNP	ENST00000324324.7	37	CCDS32230.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.088406	0.76756	.	.	ENSG00000104177	ENST00000324324;ENST00000267836	T;T	0.16196	2.36;2.36	5.78	5.78	0.91487	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.43299	0.1241	M	0.62266	1.93	0.80722	D	1	D;D	0.76494	0.999;0.996	D;D	0.83275	0.991;0.996	T	0.18209	-1.0344	10	0.87932	D	0	-13.5678	19.9991	0.97403	0.0:1.0:0.0:0.0	.	287;287	Q9P2K5-2;Q9P2K5	.;MYEF2_HUMAN	F	287	ENSP00000316950:V287F;ENSP00000267836:V287F	ENSP00000267836:V287F	V	-	1	0	MYEF2	46238270	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.999000	0.70665	2.724000	0.93272	0.655000	0.94253	GTT		MYEF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000416909.2	NM_016132	
MYO9A	4649	broad.mit.edu	37	15	72193640	72193640	+	Silent	SNP	C	C	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr15:72193640C>T	ENST00000356056.5	-	23	3514	c.3042G>A	c.(3040-3042)ctG>ctA	p.L1014L	MYO9A_ENST00000566885.1_Silent_p.L634L|MYO9A_ENST00000563542.1_5'UTR|MYO9A_ENST00000444904.1_Silent_p.L995L|MYO9A_ENST00000424560.1_Silent_p.L1014L|MYO9A_ENST00000564571.1_Silent_p.L1014L	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	1014	Myosin motor.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)	p.L1014L(1)		NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						CTTGGTGAAGCAGATCTTGTA	0.433																																					p.L1014L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3042A	15						.						107.0	91.0	97.0					15																	72193640		2199	4297	6496	69980694	SO:0001819	synonymous_variant	4649	exon23			AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.3042G>A	15.37:g.72193640C>T		Somatic		Capture	Illumina HiSeq	Phase_I	69980694	NM_006901	B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Silent	SNP	ENST00000356056.5	37	CCDS10239.1																																																																																				MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257308.1	NM_006901	
ACAN	176	broad.mit.edu	37	15	89392915	89392915	+	Missense_Mutation	SNP	C	C	T	rs141628105	byFrequency	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr15:89392915C>T	ENST00000561243.1	+	9	1979	c.1979C>T	c.(1978-1980)aCg>aTg	p.T660M	ACAN_ENST00000352105.7_Missense_Mutation_p.T660M|ACAN_ENST00000558207.1_Missense_Mutation_p.T660M|ACAN_ENST00000559004.1_Missense_Mutation_p.T660M|ACAN_ENST00000439576.2_Missense_Mutation_p.T660M			P16112	PGCA_HUMAN	aggrecan	659	G2-B'.|Link 4. {ECO:0000255|PROSITE- ProRule:PRU00323}.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)	p.T660M(1)		NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			CCTAACCAGACGGGCCTCCCA	0.647													C|||	2	0.000399361	0.0	0.0	5008	,	,		17000	0.002		0.0	False		,,,				2504	0.0				p.T660M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1979T	15						.						35.0	41.0	39.0					15																	89392915		2020	4164	6184	87193919	SO:0001583	missense	176	exon10			M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.1979C>T	15.37:g.89392915C>T	ENSP00000453342:p.Thr660Met	Somatic		Capture	Illumina HiSeq	Phase_I	87193919	NM_001135	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	ENST00000561243.1	37	CCDS53970.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	C	20.8	4.046494	0.75846	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	T;T	0.03330	4.22;3.97	5.22	5.22	0.72569	.	0.000000	0.33553	N	0.004786	T	0.23451	0.0567	M	0.87617	2.895	0.58432	D	0.999994	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.01416	-1.1360	10	0.87932	D	0	-11.3408	18.1299	0.89598	0.0:1.0:0.0:0.0	.	660;660;660	E7ENV9;E7EX88;Q6PID9	.;.;.	M	660	ENSP00000387356:T660M;ENSP00000341615:T660M	ENSP00000268134:T660M	T	+	2	0	ACAN	87193919	1.000000	0.71417	0.960000	0.40013	0.955000	0.61496	7.701000	0.84566	2.590000	0.87494	0.655000	0.94253	ACG		ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2	NM_001135	
MAN2A2	4122	broad.mit.edu	37	15	91456599	91456599	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr15:91456599G>T	ENST00000559717.1	+	18	3140	c.2681G>T	c.(2680-2682)aGc>aTc	p.S894I	MAN2A2_ENST00000430376.2_Missense_Mutation_p.S84I|MAN2A2_ENST00000431652.2_Missense_Mutation_p.S402I|MAN2A2_ENST00000360468.3_Missense_Mutation_p.S894I			P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	894					cellular protein metabolic process (GO:0044267)|mannose metabolic process (GO:0006013)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)	p.S894I(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			GACATCGACAGCCAGGGTATC	0.572																																					p.S894I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2681T	15						.						115.0	100.0	105.0					15																	91456599		2198	4298	6496	89257603	SO:0001583	missense	4122	exon17			L28821	CCDS32332.1	15q25	2011-06-30			ENSG00000196547	ENSG00000196547			6825	protein-coding gene	gene with protein product		600988				8524845	Standard	NM_006122		Approved	MANA2X, HsT19662	uc002bqc.3	P49641		ENST00000559717.1:c.2681G>T	15.37:g.91456599G>T	ENSP00000452948:p.Ser894Ile	Somatic		Capture	Illumina HiSeq	Phase_I	89257603	NM_006122	A6NH12|A8K1E8|Q13754	Missense_Mutation	SNP	ENST00000559717.1	37	CCDS32332.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.572220	0.86542	.	.	ENSG00000196547	ENST00000360468;ENST00000431652;ENST00000430376	D;D;D	0.86164	-2.08;-2.08;-2.08	4.97	4.97	0.65823	Glycosyl hydrolases 38, C-terminal (1);Glycoside hydrolase-type carbohydrate-binding (1);	0.195724	0.64402	D	0.000008	D	0.94082	0.8103	M	0.88241	2.94	0.80722	D	1	P;P;P	0.51449	0.861;0.945;0.871	P;P;P	0.61940	0.896;0.882;0.816	D	0.94998	0.8140	10	0.87932	D	0	-36.5524	18.0864	0.89458	0.0:0.0:1.0:0.0	.	402;522;894	B4DEU9;B4DIK4;P49641	.;.;MA2A2_HUMAN	I	894;402;84	ENSP00000353655:S894I;ENSP00000388221:S402I;ENSP00000394372:S84I	ENSP00000353655:S894I	S	+	2	0	MAN2A2	89257603	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	6.517000	0.73759	2.593000	0.87608	0.555000	0.69702	AGC		MAN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418246.5	NM_006122	
IL17C	27189	broad.mit.edu	37	16	88705521	88705522	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr16:88705521_88705522insC	ENST00000244241.4	+	2	188_189	c.139_140insC	c.(139-141)gccfs	p.A47fs		NM_013278.3	NP_037410.1	Q9P0M4	IL17C_HUMAN	interleukin 17C	47					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|inflammatory response (GO:0006954)|neutrophil differentiation (GO:0030223)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)	p.H50fs*68(1)		large_intestine(1)|lung(1)	2				BRCA - Breast invasive adenocarcinoma(80;0.0477)		CCTCGGCCAGGCCCCCCCACAC	0.688																																					p.A47fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.139_140insC	16						.																																			87233023	SO:0001589	frameshift_variant	27189	exon2			AF152099	CCDS42217.1	16q24	2011-07-14			ENSG00000124391	ENSG00000124391		"""Interleukins and interleukin receptors"""	5983	protein-coding gene	gene with protein product		604628				10639155	Standard	NM_013278		Approved	IL-17C, CX2, IL-21, MGC126884, MGC138401	uc002fla.3	Q9P0M4		ENST00000244241.4:c.146dupC	16.37:g.88705528_88705528dupC	ENSP00000244241:p.Ala47fs	Somatic		Capture	Illumina HiSeq	Phase_I	87233022	NM_013278	Q3MIG8|Q9HC75	Frame_Shift_Ins	INS	ENST00000244241.4	37	CCDS42217.1																																																																																				IL17C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422575.1	NM_013278	
GPR139	124274	broad.mit.edu	37	16	20043437	20043437	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr16:20043437C>T	ENST00000570682.1	-	2	982	c.682G>A	c.(682-684)Gcc>Acc	p.A228T		NM_001002911.2	NP_001002911.1	Q6DWJ6	GP139_HUMAN	G protein-coupled receptor 139	228					G-protein coupled receptor signaling pathway (GO:0007186)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)	p.A228T(1)		autonomic_ganglia(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	30						AACAAGATGGCGGTGGTCTTC	0.527																																					p.A228T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G682A	16						.						83.0	88.0	86.0					16																	20043437		2203	4300	6503	19950938	SO:0001583	missense	124274	exon2			AY255545	CCDS32398.1	16p13.11	2012-08-21						"""GPCR / Class A : Orphans"""	19995	protein-coding gene	gene with protein product						12679517	Standard	XM_005255114		Approved	PGR3	uc002dgu.1	Q6DWJ6		ENST00000570682.1:c.682G>A	16.37:g.20043437C>T	ENSP00000458791:p.Ala228Thr	Somatic		Capture	Illumina HiSeq	Phase_I	19950938	NM_001002911	A8K5R9|Q86SP2|Q8TDU8	Missense_Mutation	SNP	ENST00000570682.1	37	CCDS32398.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.630864	0.87660	.	.	ENSG00000180269	ENST00000326571	.	.	.	5.62	5.62	0.85841	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.75361	0.3839	L	0.47190	1.495	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.76305	-0.3008	9	0.66056	D	0.02	-41.5487	18.6361	0.91379	0.0:1.0:0.0:0.0	.	228	Q6DWJ6	GP139_HUMAN	T	228	.	ENSP00000370779:A228T	A	-	1	0	GPR139	19950938	1.000000	0.71417	0.989000	0.46669	0.976000	0.68499	7.484000	0.81180	2.637000	0.89404	0.655000	0.94253	GCC		GPR139-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438522.1	NM_001002911	
PALB2	79728	broad.mit.edu	37	16	23641062	23641062	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr16:23641062C>A	ENST00000261584.4	-	5	2565	c.2413G>T	c.(2413-2415)Gtc>Ttc	p.V805F		NM_024675.3	NP_078951.2	Q86YC2	PALB2_HUMAN	partner and localizer of BRCA2	805	Required for interaction with POLH and POLH DNA synthesis stimulation.				DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|inner cell mass cell proliferation (GO:0001833)|mesoderm development (GO:0007498)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|post-anal tail morphogenesis (GO:0036342)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.V805F(1)		breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(3)	55				GBM - Glioblastoma multiforme(48;0.0167)		CCTGGCGGGACAGAGTCACAG	0.483			"""F, N, Mis"""			"""Wilms tumor, medulloblastoma, AML ,breast"""		Involved in tolerance or repair of DNA crosslinks																													p.V805F		yes	Rec		"""Fanconi anaemia N, breast cancer susceptibility """	16	16p12.1	79728	partner and localizer of BRCA2		"""L, O, E"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2413T	16						.						134.0	108.0	117.0					16																	23641062		2197	4300	6497	23548563	SO:0001583	missense	79728	exon5				CCDS32406.1	16p12.1	2014-09-17				ENSG00000083093		"""Fanconi anemia, complementation groups"""	26144	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group N"""	610355				16793542, 17200672	Standard	NM_024675		Approved	FLJ21816, FANCN	uc002dlx.1	Q86YC2		ENST00000261584.4:c.2413G>T	16.37:g.23641062C>A	ENSP00000261584:p.Val805Phe	Somatic		Capture	Illumina HiSeq	Phase_I	23548563	NM_024675	A6NIE1|Q8N7Y6|Q8ND31|Q9H6W1	Missense_Mutation	SNP	ENST00000261584.4	37	CCDS32406.1	.	.	.	.	.	.	.	.	.	.	C	7.123	0.578370	0.13686	.	.	ENSG00000083093	ENST00000261584	T	0.15256	2.44	6.17	4.21	0.49690	.	0.563608	0.18532	N	0.138470	T	0.12178	0.0296	N	0.22421	0.69	0.09310	N	1	B	0.21225	0.053	B	0.26770	0.073	T	0.20605	-1.0270	10	0.33141	T	0.24	-2.0185	9.6944	0.40147	0.0:0.838:0.0:0.162	.	805	Q86YC2	PALB2_HUMAN	F	805	ENSP00000261584:V805F	ENSP00000261584:V805F	V	-	1	0	PALB2	23548563	0.001000	0.12720	0.007000	0.13788	0.037000	0.13140	0.850000	0.27737	1.616000	0.50265	0.655000	0.94253	GTC		PALB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435287.2	NM_024675	
ITGAM	3684	broad.mit.edu	37	16	31336305	31336305	+	Silent	SNP	T	T	C			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr16:31336305T>C	ENST00000287497.8	+	19	2391	c.2316T>C	c.(2314-2316)aaT>aaC	p.N772N	ITGAM_ENST00000544665.3_Silent_p.N773N			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)	772					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)	p.N772N(1)		endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						ATTGTGGCAATGACAACATCT	0.383																																					p.N772N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2316C	16						.						76.0	71.0	72.0					16																	31336305		1894	4122	6016	31243806	SO:0001819	synonymous_variant	3684	exon19			J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		ENST00000287497.8:c.2316T>C	16.37:g.31336305T>C		Somatic		Capture	Illumina HiSeq	Phase_I	31243806	NM_000632	Q4VAK0|Q4VAK1|Q4VAK2	Silent	SNP	ENST00000287497.8	37	CCDS45470.1																																																																																				ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432816.1	NM_000632	
ITGAD	3681	broad.mit.edu	37	16	31435467	31435467	+	Silent	SNP	G	G	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr16:31435467G>A	ENST00000389202.2	+	28	3253	c.3204G>A	c.(3202-3204)acG>acA	p.T1068T		NM_005353.2	NP_005344.2	Q13349	ITAD_HUMAN	integrin, alpha D	1068					activated T cell proliferation (GO:0050798)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)	cell surface (GO:0009986)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)	p.T1068T(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(43)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						CTGAAATTACGTTCGACACAT	0.552																																					p.T1068T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3204A	16						.						113.0	96.0	102.0					16																	31435467		2197	4300	6497	31342968	SO:0001819	synonymous_variant	3681	exon28			U40274	CCDS32438.1	16p13.1-p11	2010-03-23				ENSG00000156886		"""CD molecules"", ""Integrins"""	6146	protein-coding gene	gene with protein product		602453				8666289, 9598326	Standard	NM_005353		Approved	CD11d, ADB2	uc002ebv.1	Q13349		ENST00000389202.2:c.3204G>A	16.37:g.31435467G>A		Somatic		Capture	Illumina HiSeq	Phase_I	31342968	NM_005353	Q15575|Q15576	Silent	SNP	ENST00000389202.2	37	CCDS32438.1																																																																																				ITGAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432836.1	NM_005353	
SHCBP1	79801	broad.mit.edu	37	16	46651641	46651641	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr16:46651641C>T	ENST00000303383.3	-	3	558	c.292G>A	c.(292-294)Gta>Ata	p.V98I	SHCBP1_ENST00000564272.1_5'Flank	NM_024745.4	NP_079021	Q8NEM2	SHCBP_HUMAN	SHC SH2-domain binding protein 1	98					fibroblast growth factor receptor signaling pathway (GO:0008543)|regulation of neural precursor cell proliferation (GO:2000177)			p.V98I(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_cancers(37;0.00404)|all_epithelial(9;0.00527)|all_lung(18;0.0413)|Lung NSC(13;0.213)				AATTCCTGTACCTCAGAGGCC	0.448																																					p.V98I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G292A	16						.						97.0	89.0	92.0					16																	46651641		2203	4300	6503	45209142	SO:0001583	missense	79801	exon3			AK055931	CCDS10720.1	16q11	2008-02-05			ENSG00000171241	ENSG00000171241			29547	protein-coding gene	gene with protein product		611027				10086341	Standard	NM_024745		Approved	FLJ22009	uc002eec.4	Q8NEM2	OTTHUMG00000132540	ENST00000303383.3:c.292G>A	16.37:g.46651641C>T	ENSP00000306473:p.Val98Ile	Somatic		Capture	Illumina HiSeq	Phase_I	45209142	NM_024745	Q96N60|Q9BVS0|Q9H6P6	Missense_Mutation	SNP	ENST00000303383.3	37	CCDS10720.1	.	.	.	.	.	.	.	.	.	.	.	19.45	3.830485	0.71258	.	.	ENSG00000171241	ENST00000303383	T	0.29397	1.57	3.44	2.47	0.30058	.	0.000000	0.85682	D	0.000000	T	0.45216	0.1331	L	0.50333	1.59	0.58432	D	0.999998	D	0.76494	0.999	D	0.76071	0.987	T	0.27971	-1.0058	10	0.45353	T	0.12	-12.6793	10.9008	0.47051	0.0:0.9049:0.0:0.0951	.	98	Q8NEM2	SHCBP_HUMAN	I	98	ENSP00000306473:V98I	ENSP00000306473:V98I	V	-	1	0	SHCBP1	45209142	1.000000	0.71417	0.618000	0.29105	0.978000	0.69477	6.624000	0.74243	0.772000	0.33382	0.591000	0.81541	GTA		SHCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255740.1	NM_024745	
RANBP10	57610	broad.mit.edu	37	16	67763358	67763358	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr16:67763358C>T	ENST00000317506.3	-	10	1292	c.1177G>A	c.(1177-1179)Gtc>Atc	p.V393I	RANBP10_ENST00000536251.1_Missense_Mutation_p.V164I|RANBP10_ENST00000448631.2_Missense_Mutation_p.V337I|RANBP10_ENST00000411657.2_Missense_Mutation_p.V276I|RANBP10_ENST00000602677.1_Missense_Mutation_p.V393I	NM_020850.1	NP_065901.1	Q6VN20	RBP10_HUMAN	RAN binding protein 10	393	Ser-rich.				microtubule cytoskeleton organization (GO:0000226)	cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)	Ran guanyl-nucleotide exchange factor activity (GO:0005087)	p.V393I(1)|p.V393F(1)		endometrium(5)|kidney(2)|large_intestine(3)|lung(10)|ovary(2)|skin(1)	23		Acute lymphoblastic leukemia(13;4.34e-06)|all_hematologic(13;0.000643)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00522)|Epithelial(162;0.025)|all cancers(182;0.157)		GTGGACGCGACGCCATTGCTA	0.567																																					p.V393I												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G1177A	16						.						271.0	298.0	289.0					16																	67763358		2198	4300	6498	66320859	SO:0001583	missense	57610	exon10			AB040897	CCDS32469.1	16q22	2008-02-05				ENSG00000141084			29285	protein-coding gene	gene with protein product		614031				14684163	Standard	NM_020850		Approved	KIAA1464	uc002eud.3	Q6VN20		ENST00000317506.3:c.1177G>A	16.37:g.67763358C>T	ENSP00000316589:p.Val393Ile	Somatic		Capture	Illumina HiSeq	Phase_I	66320859	NM_020850	A4FTY2|B4DID0|B4DQH9|E7EW27|Q9P264	Missense_Mutation	SNP	ENST00000317506.3	37	CCDS32469.1	.	.	.	.	.	.	.	.	.	.	C	5.051	0.195131	0.09599	.	.	ENSG00000141084	ENST00000317506;ENST00000448631;ENST00000536251;ENST00000411657	.	.	.	5.55	-8.33	0.00992	.	0.671903	0.15187	N	0.275768	T	0.19565	0.0470	N	0.26130	0.795	0.22954	N	0.998515	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.12837	0.003;0.002;0.008	T	0.32745	-0.9895	9	0.09843	T	0.71	-14.9435	9.8305	0.40939	0.0:0.2983:0.1021:0.5996	.	276;337;393	B4DID0;B4DQH9;Q6VN20	.;.;RBP10_HUMAN	I	393;337;164;276	.	ENSP00000316589:V393I	V	-	1	0	RANBP10	66320859	0.001000	0.12720	0.000000	0.03702	0.075000	0.17131	0.015000	0.13355	-1.649000	0.01508	-1.012000	0.02466	GTC		RANBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467896.1	NM_020850	
TERF2	7014	broad.mit.edu	37	16	69400949	69400949	+	Silent	SNP	G	G	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr16:69400949G>A	ENST00000254942.3	-	7	1117	c.1101C>T	c.(1099-1101)gcC>gcT	p.A367A	TERF2_ENST00000603068.1_Silent_p.A325A|TERF2_ENST00000569611.2_5'Flank	NM_005652.3	NP_005643.2	Q15554	TERF2_HUMAN	telomeric repeat binding factor 2	367					age-dependent telomere shortening (GO:0001309)|cell cycle (GO:0007049)|cellular senescence (GO:0090398)|in utero embryonic development (GO:0001701)|negative regulation of telomere maintenance (GO:0032205)|negative regulation of telomere maintenance via semi-conservative replication (GO:0032214)|positive regulation of telomere maintenance (GO:0032206)|protection from non-homologous end joining at telomere (GO:0031848)|protein localization to chromosome, telomeric region (GO:0070198)|telomere capping (GO:0016233)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)|telomere maintenance via telomere shortening (GO:0010834)|telomeric loop formation (GO:0031627)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|male germ cell nucleus (GO:0001673)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|double-stranded telomeric DNA binding (GO:0003691)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|telomeric DNA binding (GO:0042162)	p.A325A(1)		NS(2)|breast(1)|large_intestine(3)|lung(1)	7		Ovarian(137;0.101)				TGTTTTTGAGGGCTGGTGATG	0.522																																					p.A325A	Ovarian(13;63 524 30420 31710 34037)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C975T	16						.						89.0	90.0	90.0					16																	69400949		2198	4300	6498	67958450	SO:0001819	synonymous_variant	7014	exon7				CCDS10879.1, CCDS10879.2	16q22.1	2008-02-05			ENSG00000132604	ENSG00000132604			11729	protein-coding gene	gene with protein product		602027		TRBF2		9326950, 10226653	Standard	NM_005652		Approved	TRF2	uc002exd.4	Q15554	OTTHUMG00000137566	ENST00000254942.3:c.1101C>T	16.37:g.69400949G>A		Somatic		Capture	Illumina HiSeq	Phase_I	67958450	NM_005652		Silent	SNP	ENST00000254942.3	37																																																																																					TERF2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000268944.2		
NFAT5	10725	broad.mit.edu	37	16	69725795	69725795	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr16:69725795C>G	ENST00000354436.2	+	12	2331	c.2013C>G	c.(2011-2013)aaC>aaG	p.N671K	NFAT5_ENST00000393742.2_Missense_Mutation_p.N595K|NFAT5_ENST00000349945.1_Missense_Mutation_p.N595K|NFAT5_ENST00000432919.1_Missense_Mutation_p.N689K|NFAT5_ENST00000566899.1_Missense_Mutation_p.N595K|NFAT5_ENST00000567239.1_Missense_Mutation_p.N688K	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	671					cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.N595K(1)|p.N689K(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						AGGCATACAACCCAGAGACCC	0.463																																					p.N595K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1785G	16						.						98.0	94.0	95.0					16																	69725795		2198	4300	6498	68283296	SO:0001583	missense	10725	exon14			AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.2013C>G	16.37:g.69725795C>G	ENSP00000346420:p.Asn671Lys	Somatic		Capture	Illumina HiSeq	Phase_I	68283296	NM_138714	A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	Missense_Mutation	SNP	ENST00000354436.2	37	CCDS10881.1	.	.	.	.	.	.	.	.	.	.	C	14.74	2.625835	0.46840	.	.	ENSG00000102908	ENST00000432919;ENST00000426654;ENST00000349945;ENST00000354436;ENST00000393742	T;T;T;T	0.44881	0.92;0.91;0.92;0.91	6.08	0.907	0.19321	.	0.202582	0.51477	D	0.000088	T	0.32823	0.0842	L	0.51422	1.61	0.35722	D	0.817215	B;B;B	0.21905	0.062;0.062;0.044	B;B;B	0.21708	0.036;0.036;0.024	T	0.30650	-0.9971	10	0.16896	T	0.51	-0.2278	11.1403	0.48398	0.0:0.5707:0.0:0.4293	.	688;671;689	A2RRB4;O94916;E9PHR7	.;NFAT5_HUMAN;.	K	689;688;595;671;595	ENSP00000396538:N689K;ENSP00000338806:N595K;ENSP00000346420:N671K;ENSP00000377343:N595K	ENSP00000338806:N595K	N	+	3	2	NFAT5	68283296	0.532000	0.26346	0.995000	0.50966	0.926000	0.56050	0.248000	0.18198	-0.028000	0.13850	0.655000	0.94253	AAC		NFAT5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268952.2	NM_138714	
FUK	197258	broad.mit.edu	37	16	70505102	70505102	+	Silent	SNP	C	C	T	rs373786386		TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr16:70505102C>T	ENST00000288078.6	+	13	1420	c.1188C>T	c.(1186-1188)ggC>ggT	p.G396G	FUK_ENST00000571514.1_5'UTR|FUK_ENST00000378912.2_Silent_p.G428G	NM_145059.2	NP_659496.2	Q8N0W3	FUK_HUMAN	fucokinase	396						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|fucokinase activity (GO:0050201)	p.G396G(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(11)|ovary(2)|prostate(2)	23		Ovarian(137;0.0694)				TTCACATAGGCGCTGGCTGCT	0.677													c|||	1	0.000199681	0.0008	0.0	5008	,	,		17880	0.0		0.0	False		,,,				2504	0.0				p.G396G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1188T	16						.	T		0,4114		0,0,2057	17.0	21.0	20.0		1188	-3.9	0.0	16		20	1,8373		0,1,4186	no	coding-synonymous	FUK	NM_145059.2		0,1,6243	TT,TC,CC		0.0119,0.0,0.0080		396/1085	70505102	1,12487	2057	4187	6244	69062603	SO:0001819	synonymous_variant	197258	exon13				CCDS10891.2	16q22.1	2008-02-05			ENSG00000157353	ENSG00000157353	2.7.1.52		29500	protein-coding gene	gene with protein product	"""L-fucose kinase"""	608675				12056818	Standard	XM_006721161		Approved	FLJ39408	uc002eyy.3	Q8N0W3	OTTHUMG00000074085	ENST00000288078.6:c.1188C>T	16.37:g.70505102C>T		Somatic		Capture	Illumina HiSeq	Phase_I	69062603	NM_145059	Q5PSM3|Q5XKL6|Q6ZRA0|Q96MT9	Silent	SNP	ENST00000288078.6	37	CCDS10891.2																																																																																				FUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157291.2	NM_145059	
HYDIN	54768	broad.mit.edu	37	16	70894622	70894622	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr16:70894622G>T	ENST00000393567.2	-	70	12110	c.11960C>A	c.(11959-11961)aCc>aAc	p.T3987N		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	3987					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.T3986N(1)|p.T3938N(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GCCCACAGTGGTGAACTCAAT	0.493																																					p.T3986N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C11957A	16						.						1.0	1.0	1.0					16																	70894622		438	981	1419	69452123	SO:0001583	missense	54768	exon70			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.11960C>A	16.37:g.70894622G>T	ENSP00000377197:p.Thr3987Asn	Somatic		Capture	Illumina HiSeq	Phase_I	69452123	NM_032821	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	G	9.016	0.983722	0.18889	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.00824	5.65	5.69	-0.194	0.13240	.	0.229752	0.21345	U	0.076061	T	0.01029	0.0034	L	0.52364	1.645	0.18873	N	0.999983	B	0.02656	0.0	B	0.09377	0.004	T	0.47674	-0.9099	10	0.17832	T	0.49	.	8.746	0.34587	0.1204:0.0:0.5751:0.3045	.	3986	F8WD23	.	N	3987;3986	ENSP00000377197:T3987N	ENSP00000313052:T3986N	T	-	2	0	HYDIN	69452123	0.940000	0.31905	0.974000	0.42286	0.373000	0.29922	1.774000	0.38573	-0.148000	0.11234	-1.478000	0.00992	ACC		HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
MARVELD3	91862	broad.mit.edu	37	16	71674857	71674857	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr16:71674857G>A	ENST00000299952.4	+	3	1203	c.1160G>A	c.(1159-1161)cGc>cAc	p.R387H	MARVELD3_ENST00000561682.1_Intron|PHLPP2_ENST00000540628.1_3'UTR|MARVELD3_ENST00000565261.1_3'UTR	NM_001017967.3|NM_001271329.1	NP_001017967.2|NP_001258258.1	Q96A59	MALD3_HUMAN	MARVEL domain containing 3	390					cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|tight junction (GO:0005923)		p.R387H(1)		NS(1)|endometrium(3)|large_intestine(5)|lung(6)|skin(2)	17		Ovarian(137;0.125)				GAACAGAAGCGCTACAAAGGC	0.562																																					p.R387H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1160A	16						.						53.0	43.0	47.0					16																	71674857		2198	4299	6497	70232358	SO:0001583	missense	91862	exon3			BC013376	CCDS10904.1, CCDS32478.1, CCDS59270.1	16q22.2	2008-02-05	2004-07-12	2004-07-14	ENSG00000140832	ENSG00000140832			30525	protein-coding gene	gene with protein product		614094	"""MARVEL (membrane-associating) domain containing 3"""	MRVLDC3			Standard	NM_001017967		Approved		uc002fat.4	Q96A59	OTTHUMG00000137591	ENST00000299952.4:c.1160G>A	16.37:g.71674857G>A	ENSP00000299952:p.Arg387His	Somatic		Capture	Illumina HiSeq	Phase_I	70232358	NM_001017967	A8K820|H3BQM5|Q96MJ4	Missense_Mutation	SNP	ENST00000299952.4	37	CCDS32478.1	.	.	.	.	.	.	.	.	.	.	G	12.96	2.095788	0.36952	.	.	ENSG00000140832	ENST00000299952	T	0.46451	0.87	5.66	-11.3	0.00108	.	0.900837	0.09967	N	0.732654	T	0.15998	0.0385	.	.	.	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.06041	-1.0849	9	0.27082	T	0.32	-5.3809	2.3448	0.04269	0.2154:0.0888:0.3443:0.3515	.	387	Q96A59-2	.	H	387	ENSP00000299952:R387H	ENSP00000299952:R387H	R	+	2	0	MARVELD3	70232358	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-0.488000	0.06497	-2.146000	0.00800	-1.348000	0.01239	CGC		MARVELD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268990.1	NM_052858	
GRIN2A	2903	broad.mit.edu	37	16	9857858	9857858	+	Silent	SNP	G	G	A	rs369551956		TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr16:9857858G>A	ENST00000396573.2	-	14	3852	c.3543C>T	c.(3541-3543)aaC>aaT	p.N1181N	GRIN2A_ENST00000562109.1_Silent_p.N1181N|GRIN2A_ENST00000396575.2_Silent_p.N1181N|GRIN2A_ENST00000404927.2_Silent_p.N1181N|GRIN2A_ENST00000535259.1_Silent_p.N1024N|GRIN2A_ENST00000330684.3_Silent_p.N1181N	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	1181					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.N1181N(2)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TATACTGGTCGTTGTTGGAAA	0.552																																					p.N1181N												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.C3543T	16						.	G	,,	0,4394		0,0,2197	242.0	236.0	238.0		3543,3543,3543	-10.6	0.4	16		238	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	GRIN2A	NM_000833.3,NM_001134407.1,NM_001134408.1	,,	0,1,6496	AA,AG,GG		0.0116,0.0,0.0077	,,	1181/1465,1181/1465,1181/1282	9857858	1,12993	2197	4300	6497	9765359	SO:0001819	synonymous_variant	2903	exon13				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.3543C>T	16.37:g.9857858G>A		Somatic		Capture	Illumina HiSeq	Phase_I	9765359	NM_001134408	O00669|Q17RZ6	Silent	SNP	ENST00000396573.2	37	CCDS10539.1																																																																																				GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		
WWOX	51741	broad.mit.edu	37	16	79245644	79245644	+	Missense_Mutation	SNP	C	C	T	rs200815431		TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr16:79245644C>T	ENST00000566780.1	+	9	1562	c.1196C>T	c.(1195-1197)gCg>gTg	p.A399V	WWOX_ENST00000539474.2_Missense_Mutation_p.R209C|WWOX_ENST00000402655.2_Silent_p.G183G|RP11-679B19.2_ENST00000569677.1_lincRNA|WWOX_ENST00000406884.2_Missense_Mutation_p.A219V	NM_016373.2	NP_057457.1	Q9NZC7	WWOX_HUMAN	WW domain containing oxidoreductase	399	Interaction with MAPT. {ECO:0000250}.				cellular response to transforming growth factor beta stimulus (GO:0071560)|extrinsic apoptotic signaling pathway (GO:0097191)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of Wnt signaling pathway (GO:0030178)|osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system morphogenesis (GO:0048705)|steroid metabolic process (GO:0008202)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	coenzyme binding (GO:0050662)|cofactor binding (GO:0048037)|enzyme binding (GO:0019899)|oxidoreductase activity (GO:0016491)|protein dimerization activity (GO:0046983)	p.G240G(1)|p.A399V(1)		large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	7		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)		ACCCTGTGGGCGCTCAGCGAG	0.632													c|||	1	0.000199681	0.0008	0.0	5008	,	,		15977	0.0		0.0	False		,,,				2504	0.0				p.A399V												.	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(2)	c.C1196T	16						.	T	VAL/ALA	4,3978		0,4,1987	44.0	48.0	47.0		1196	-5.9	0.0	16		47	0,8314		0,0,4157	yes	missense	WWOX	NM_016373.2	64	0,4,6144	TT,TC,CC		0.0,0.1005,0.0325	benign	399/415	79245644	4,12292	1991	4157	6148	77803145	SO:0001583	missense	51741	exon9			AF187015	CCDS42196.1, CCDS42197.1	16q23.3-q24.1	2012-08-15	2002-01-14		ENSG00000186153	ENSG00000186153	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	12799	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 41C, member 1"""	605131	"""WW domain-containing oxidoreductase"""			10786676, 10861292, 19027726	Standard	XR_243411		Approved	FOR, WOX1, SDR41C1	uc002ffk.3	Q9NZC7	OTTHUMG00000176851	ENST00000566780.1:c.1196C>T	16.37:g.79245644C>T	ENSP00000457230:p.Ala399Val	Somatic		Capture	Illumina HiSeq	Phase_I	77803145	NM_016373	A8K323|Q5MYT5|Q96KM3|Q96RF2|Q9BTT8|Q9NPC9|Q9NRF4|Q9NRF5|Q9NRF6|Q9NRK1|Q9NZC5	Missense_Mutation	SNP	ENST00000566780.1	37	CCDS42196.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	12.21|12.21	1.868502|1.868502	0.32977|0.32977	0.001005|0.001005	0.0|0.0	ENSG00000186153|ENSG00000186153	ENST00000408984;ENST00000406884|ENST00000539474	T|T	0.65178|0.39592	-0.14|1.07	5.67|5.67	-5.94|-5.94	0.02247|0.02247	NAD(P)-binding domain (1);|.	1.384840|.	0.05032|.	N|.	0.474784|.	T|T	0.37376|0.37376	0.1001|0.1001	L|L	0.45051|0.45051	1.395|1.395	0.48830|0.48830	D|D	0.999714|0.999714	B;B|.	0.23891|.	0.0;0.093|.	B;B|.	0.15870|.	0.001;0.014|.	T|T	0.52815|0.52815	-0.8525|-0.8525	10|7	0.62326|0.87932	D|D	0.03|0	.|.	7.0081|7.0081	0.24848|0.24848	0.5631:0.1541:0.0:0.2828|0.5631:0.1541:0.0:0.2828	.|.	219;399|.	Q9NZC7-5;Q9NZC7|.	.;WWOX_HUMAN|.	V|C	399;219|209	ENSP00000384495:A219V|ENSP00000445210:R209C	ENSP00000384495:A219V|ENSP00000445210:R209C	A|R	+|+	2|1	0|0	WWOX|WWOX	77803145|77803145	0.742000|0.742000	0.28228|0.28228	0.011000|0.011000	0.14972|0.14972	0.186000|0.186000	0.23388|0.23388	1.461000|1.461000	0.35255|0.35255	-0.750000|-0.750000	0.04740|0.04740	-0.213000|-0.213000	0.12676|0.12676	GCG|CGC		WWOX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434328.1		
MYO15A	51168	broad.mit.edu	37	17	18023041	18023041	+	Silent	SNP	C	C	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr17:18023041C>T	ENST00000205890.5	+	2	1265	c.927C>T	c.(925-927)taC>taT	p.Y309Y		NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	309					inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.Y309Y(1)		breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					GCTACGGCTACGACGATTACG	0.607																																					p.Y309Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C927T	17						.						45.0	52.0	50.0					17																	18023041		1914	4110	6024	17963766	SO:0001819	synonymous_variant	51168	exon2			AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.927C>T	17.37:g.18023041C>T		Somatic		Capture	Illumina HiSeq	Phase_I	17963766	NM_016239	B4DFC7	Silent	SNP	ENST00000205890.5	37	CCDS42271.1																																																																																				MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132048.1	NM_016239	
KRTAP17-1	83902	broad.mit.edu	37	17	39471698	39471698	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr17:39471698C>T	ENST00000334202.3	-	1	249	c.205G>A	c.(205-207)Gga>Aga	p.G69R		NM_031964.1	NP_114170.1	Q9BYP8	KR171_HUMAN	keratin associated protein 17-1	69						intermediate filament (GO:0005882)		p.G69R(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	2		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			ccgcagcctccgcagcctcca	0.687																																					p.G69R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G205A	17						.						23.0	34.0	30.0					17																	39471698		2197	4288	6485	36725224	SO:0001583	missense	83902	exon1			AJ406952	CCDS11387.1	17q21.2	2013-06-20			ENSG00000186860	ENSG00000186860		"""Keratin associated proteins"""	18917	protein-coding gene	gene with protein product							Standard	NM_031964		Approved	KAP17.1	uc002hwj.3	Q9BYP8	OTTHUMG00000133433	ENST00000334202.3:c.205G>A	17.37:g.39471698C>T	ENSP00000333993:p.Gly69Arg	Somatic		Capture	Illumina HiSeq	Phase_I	36725224	NM_031964		Missense_Mutation	SNP	ENST00000334202.3	37	CCDS11387.1	.	.	.	.	.	.	.	.	.	.	C	0.175	-1.068187	0.01934	.	.	ENSG00000186860	ENST00000334202	.	.	.	2.32	-1.23	0.09465	.	.	.	.	.	T	0.14614	0.0353	N	0.19112	0.55	0.09310	N	1	P	0.39601	0.68	B	0.28849	0.095	T	0.14144	-1.0483	8	0.87932	D	0	-1.4787	7.1957	0.25851	0.4474:0.5526:0.0:0.0	.	69	Q9BYP8	KR171_HUMAN	R	69	.	ENSP00000333993:G69R	G	-	1	0	KRTAP17-1	36725224	0.190000	0.23276	0.015000	0.15790	0.029000	0.11900	2.610000	0.46325	0.012000	0.14892	0.467000	0.42956	GGA		KRTAP17-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257296.1		
NT5C3B	115024	broad.mit.edu	37	17	39981862	39981862	+	Silent	SNP	C	C	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr17:39981862C>A	ENST00000435506.2	-	9	885	c.816G>T	c.(814-816)ctG>ctT	p.L272L	NT5C3B_ENST00000269534.8_Silent_p.L264L|NT5C3B_ENST00000521789.1_Silent_p.L172L			Q969T7	5NT3B_HUMAN	5'-nucleotidase, cytosolic IIIB	272					nucleotide metabolic process (GO:0009117)	cytoplasm (GO:0005737)	5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)	p.L264L(1)									CGTCCTTCTCCAGCACGATGT	0.637																																					p.L272L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G816T	17						.						115.0	107.0	110.0					17																	39981862		2203	4300	6503	37235388	SO:0001819	synonymous_variant	115024	exon9				CCDS11410.1, CCDS11410.2	17q21.2	2013-01-31	2013-01-31	2013-01-31	ENSG00000141698	ENSG00000141698	3.1.3.5		28300	protein-coding gene	gene with protein product			"""5'-nucleotidase, cytosolic III-like"""	NT5C3L		23223233	Standard	NM_052935		Approved	MGC20781	uc021txo.1	Q969T7	OTTHUMG00000133499	ENST00000435506.2:c.816G>T	17.37:g.39981862C>A		Somatic		Capture	Illumina HiSeq	Phase_I	37235388	NM_052935	A8MWB9|C9JKC4|Q7L3B7	Silent	SNP	ENST00000435506.2	37	CCDS11410.2																																																																																				NT5C3B-008	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257430.2	NM_052935	
USP43	124739	broad.mit.edu	37	17	9559771	9559771	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr17:9559771G>A	ENST00000285199.7	+	2	652	c.556G>A	c.(556-558)Gcc>Acc	p.A186T	USP43_ENST00000570475.1_Missense_Mutation_p.A186T|USP43_ENST00000570827.2_3'UTR	NM_001267576.1|NM_153210.4	NP_001254505.1|NP_694942.3	Q70EL4	UBP43_HUMAN	ubiquitin specific peptidase 43	186	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)	p.A187T(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	26						CCAGCACGACGCCCTGGAATT	0.517																																					p.A186T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G556A	17						.						79.0	77.0	78.0					17																	9559771		1873	4106	5979	9500496	SO:0001583	missense	124739	exon2			AK055188	CCDS45610.1, CCDS58516.1	17p12	2005-08-08	2005-08-08			ENSG00000154914		"""Ubiquitin-specific peptidases"""	20072	protein-coding gene	gene with protein product			"""ubiquitin specific protease 43"""			12838346	Standard	NM_153210		Approved	FLJ30626	uc010cod.4	Q70EL4		ENST00000285199.7:c.556G>A	17.37:g.9559771G>A	ENSP00000285199:p.Ala186Thr	Somatic		Capture	Illumina HiSeq	Phase_I	9500496	NM_153210	A6NDT9|B7ZLT9|B7ZVX5|Q8N2C5|Q96DQ6	Missense_Mutation	SNP	ENST00000285199.7	37	CCDS45610.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.679002	0.88542	.	.	ENSG00000154914	ENST00000285199	T	0.05513	3.43	4.04	4.04	0.47022	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.24699	0.0599	M	0.78223	2.4	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.972;0.995	T	0.00920	-1.1514	10	0.66056	D	0.02	-25.5823	14.507	0.67761	0.0:0.0:1.0:0.0	.	186;186	B7ZVX5;Q70EL4	.;UBP43_HUMAN	T	186	ENSP00000285199:A186T	ENSP00000285199:A186T	A	+	1	0	USP43	9500496	1.000000	0.71417	0.967000	0.41034	0.792000	0.44763	8.175000	0.89684	2.548000	0.85928	0.585000	0.79938	GCC		USP43-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439855.3	NM_153210	
CHAD	1101	broad.mit.edu	37	17	48542766	48542766	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr17:48542766T>A	ENST00000508540.1	-	3	1125	c.973A>T	c.(973-975)Acc>Tcc	p.T325S	CHAD_ENST00000258969.4_Missense_Mutation_p.T325S|ACSF2_ENST00000502667.1_Intron|ACSF2_ENST00000300441.4_Intron|ACSF2_ENST00000504392.1_Intron|ACSF2_ENST00000541920.1_Intron|ACSF2_ENST00000427954.2_Intron	NM_001267.2	NP_001258.2	O15335	CHAD_HUMAN	chondroadherin	325	LRRCT.				bone development (GO:0060348)|cartilage condensation (GO:0001502)|negative regulation of bone trabecula formation (GO:1900155)	proteinaceous extracellular matrix (GO:0005578)		p.T325S(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(2)|ovary(2)	15	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			GAGGCACAGGTGGCATCTGGG	0.627																																					p.T325S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A973T	17						.						52.0	44.0	47.0					17																	48542766		2203	4300	6503	45897765	SO:0001583	missense	1101	exon3			U96767	CCDS11568.1	17q21.33	2008-02-05			ENSG00000136457	ENSG00000136457		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	1909	protein-coding gene	gene with protein product	"""chondroadherin proteoglycan"""	602178				9344663	Standard	NM_001267		Approved	SLRR4A	uc010dbr.3	O15335	OTTHUMG00000162129	ENST00000508540.1:c.973A>T	17.37:g.48542766T>A	ENSP00000423812:p.Thr325Ser	Somatic		Capture	Illumina HiSeq	Phase_I	45897765	NM_001267	A8K812|Q6GTU0|Q96RJ5	Missense_Mutation	SNP	ENST00000508540.1	37	CCDS11568.1	.	.	.	.	.	.	.	.	.	.	T	15.44	2.833212	0.50951	.	.	ENSG00000136457	ENST00000508540;ENST00000258969	T;T	0.58652	0.32;0.32	5.12	5.12	0.69794	Cysteine-rich flanking region, C-terminal (1);	0.174644	0.50627	D	0.000113	T	0.52354	0.1729	M	0.66939	2.045	0.41757	D	0.989698	B	0.14438	0.01	B	0.09377	0.004	T	0.49799	-0.8901	10	0.23302	T	0.38	.	10.2069	0.43118	0.0:0.0778:0.0:0.9222	.	325	O15335	CHAD_HUMAN	S	325	ENSP00000423812:T325S;ENSP00000258969:T325S	ENSP00000258969:T325S	T	-	1	0	CHAD	45897765	0.830000	0.29337	1.000000	0.80357	0.982000	0.71751	1.167000	0.31847	1.929000	0.55896	0.533000	0.62120	ACC		CHAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367447.3	NM_001267	
TCEB3B	51224	broad.mit.edu	37	18	44559471	44559471	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr18:44559471G>A	ENST00000332567.4	-	1	2517	c.2165C>T	c.(2164-2166)gCg>gTg	p.A722V	KATNAL2_ENST00000245121.5_Intron|KATNAL2_ENST00000592005.1_Intron|KATNAL2_ENST00000356157.7_Intron	NM_016427.2	NP_057511.2	Q8IYF1	ELOA2_HUMAN	transcription elongation factor B polypeptide 3B (elongin A2)	722					regulation of DNA-templated transcription, elongation (GO:0032784)|transcription from RNA polymerase II promoter (GO:0006366)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.A722V(1)		breast(1)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|lung(24)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						GGCCGCGGGCGCCGCGTGCTC	0.617																																					p.A722V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2165T	18						.						46.0	52.0	50.0					18																	44559471		2202	4299	6501	42813469	SO:0001583	missense	51224	exon1			BC036022	CCDS11932.1	18q21.1	2009-08-04			ENSG00000206181	ENSG00000206181			30771	protein-coding gene	gene with protein product	"""transcription elongation factor (SIII) elongin A2"", ""elongin A2"""	609522				7660129, 8244996	Standard	NM_016427		Approved	HsT832, TCEB3L	uc002lcr.1	Q8IYF1	OTTHUMG00000132649	ENST00000332567.4:c.2165C>T	18.37:g.44559471G>A	ENSP00000331302:p.Ala722Val	Somatic		Capture	Illumina HiSeq	Phase_I	42813469	NM_016427	Q9P2V9	Missense_Mutation	SNP	ENST00000332567.4	37	CCDS11932.1	.	.	.	.	.	.	.	.	.	.	G	4.441	0.081610	0.08533	.	.	ENSG00000206181	ENST00000332567	T	0.07800	3.16	1.86	-3.72	0.04411	.	12.295500	0.00960	U	0.003086	T	0.05502	0.0145	L	0.27053	0.805	0.09310	N	1	P	0.34587	0.458	B	0.20184	0.028	T	0.17806	-1.0357	10	0.41790	T	0.15	-4.9544	6.0304	0.19677	0.6733:0.0:0.1874:0.1394	.	722	Q8IYF1	ELOA2_HUMAN	V	722	ENSP00000331302:A722V	ENSP00000331302:A722V	A	-	2	0	TCEB3B	42813469	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.952000	0.01528	-2.909000	0.00309	-2.223000	0.00295	GCG		TCEB3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255900.1	NM_016427	
DCC	1630	broad.mit.edu	37	18	50278721	50278721	+	Missense_Mutation	SNP	G	G	A	rs367734161		TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr18:50278721G>A	ENST00000442544.2	+	2	1005	c.389G>A	c.(388-390)cGg>cAg	p.R130Q	DCC_ENST00000412726.1_5'UTR	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	130	Ig-like C2-type 1.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)	p.R130Q(1)		NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		ATTATTAGTCGGACAGCAAAA	0.423																																					p.R130Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G389A	18						.	G	GLN/ARG	0,4406		0,0,2203	108.0	101.0	103.0		389	5.1	1.0	18		103	1,8599	1.2+/-3.3	0,1,4299	no	missense	DCC	NM_005215.3	43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	130/1448	50278721	1,13005	2203	4300	6503	48532719	SO:0001583	missense	1630	exon2			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.389G>A	18.37:g.50278721G>A	ENSP00000389140:p.Arg130Gln	Somatic		Capture	Illumina HiSeq	Phase_I	48532719	NM_005215		Missense_Mutation	SNP	ENST00000442544.2	37	CCDS11952.1	.	.	.	.	.	.	.	.	.	.	G	16.54	3.152478	0.57259	0.0	1.16E-4	ENSG00000187323	ENST00000442544;ENST00000304775	T	0.12879	2.64	5.06	5.06	0.68205	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000005	T	0.39226	0.1070	M	0.75777	2.31	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.27262	-1.0079	10	0.72032	D	0.01	.	17.2004	0.86904	0.0:0.0:1.0:0.0	.	130	P43146	DCC_HUMAN	Q	130;63	ENSP00000389140:R130Q	ENSP00000304146:R63Q	R	+	2	0	DCC	48532719	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	9.457000	0.97630	2.354000	0.79902	0.655000	0.94253	CGG		DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255996.3	NM_005215	
GRP	2922	broad.mit.edu	37	18	56892729	56892729	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr18:56892729T>G	ENST00000256857.2	+	2	243	c.145T>G	c.(145-147)Tta>Gta	p.L49V	GRP_ENST00000420468.2_Missense_Mutation_p.L49V|GRP_ENST00000529320.2_Missense_Mutation_p.L49V	NM_001012512.1|NM_002091.3	NP_001012530.1|NP_002082.2	P07492	GRP_HUMAN	gastrin-releasing peptide	49					neuropeptide signaling pathway (GO:0007218)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	neuropeptide hormone activity (GO:0005184)|receptor binding (GO:0005102)	p.L49V(1)		large_intestine(1)|lung(3)	4		Colorectal(73;0.0946)				TACAGGGCACTTAATGGGGAA	0.398																																					p.L49V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T145G	18						.						71.0	76.0	74.0					18																	56892729		2203	4300	6503	55043709	SO:0001583	missense	2922	exon2				CCDS11971.1, CCDS45877.1, CCDS45878.1	18q21.1-q21.32	2013-02-26			ENSG00000134443	ENSG00000134443		"""Endogenous ligands"""	4605	protein-coding gene	gene with protein product	"""bombesin"", ""neuromedin C"", ""prepro-GRP"""	137260					Standard	NM_002091		Approved		uc002lhv.3	P07492	OTTHUMG00000132760	ENST00000256857.2:c.145T>G	18.37:g.56892729T>G	ENSP00000256857:p.Leu49Val	Somatic		Capture	Illumina HiSeq	Phase_I	55043709	NM_002091	P07491|P81553|Q14454|Q53YA0|Q9BSY7	Missense_Mutation	SNP	ENST00000256857.2	37	CCDS11971.1	.	.	.	.	.	.	.	.	.	.	T	17.74	3.464654	0.63513	.	.	ENSG00000134443	ENST00000256857;ENST00000529320;ENST00000420468	T;T;T	0.49139	0.79;0.83;0.81	5.34	0.293	0.15742	.	0.000000	0.47852	D	0.000219	T	0.61540	0.2355	M	0.75264	2.295	0.34874	D	0.743858	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.72625	0.963;0.978;0.963	T	0.67945	-0.5539	10	0.87932	D	0	-5.9503	7.9022	0.29742	0.0:0.36:0.0:0.64	.	49;49;49	P07492-3;P07492;P07492-2	.;GRP_HUMAN;.	V	49	ENSP00000256857:L49V;ENSP00000434101:L49V;ENSP00000389696:L49V	ENSP00000256857:L49V	L	+	1	2	GRP	55043709	0.891000	0.30450	0.945000	0.38365	0.954000	0.61252	0.057000	0.14279	0.039000	0.15632	0.533000	0.62120	TTA		GRP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256131.2	NM_002091	
ZNF536	9745	broad.mit.edu	37	19	31040061	31040061	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr19:31040061G>A	ENST00000355537.3	+	4	3682	c.3535G>A	c.(3535-3537)Gat>Aat	p.D1179N		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	1179					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)	p.D1179N(1)		NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					GGAGAACAACGATGAAGAGGA	0.557																																					p.D1179N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3535A	19						.						71.0	72.0	71.0					19																	31040061		2203	4300	6503	35731901	SO:0001583	missense	9745	exon4				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.3535G>A	19.37:g.31040061G>A	ENSP00000347730:p.Asp1179Asn	Somatic		Capture	Illumina HiSeq	Phase_I	35731901	NM_014717	A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	G	16.03	3.006014	0.54361	.	.	ENSG00000198597	ENST00000355537	T	0.09163	3.01	5.38	5.38	0.77491	.	0.737094	0.13728	N	0.366865	T	0.08088	0.0202	N	0.08118	0	0.46416	D	0.999036	B;B	0.33748	0.423;0.005	B;B	0.30105	0.111;0.003	T	0.44544	-0.9321	10	0.72032	D	0.01	-5.9494	19.1262	0.93386	0.0:0.0:1.0:0.0	.	1179;1179	A7E228;O15090	.;ZN536_HUMAN	N	1179	ENSP00000347730:D1179N	ENSP00000347730:D1179N	D	+	1	0	ZNF536	35731901	1.000000	0.71417	0.736000	0.30914	0.812000	0.45895	5.940000	0.70187	2.506000	0.84524	0.655000	0.94253	GAT		ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717	
KIAA0355	9710	broad.mit.edu	37	19	34832720	34832720	+	Silent	SNP	G	G	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr19:34832720G>T	ENST00000299505.6	+	10	2754	c.1881G>T	c.(1879-1881)ctG>ctT	p.L627L		NM_014686.3	NP_055501.2	O15063	K0355_HUMAN	KIAA0355	627								p.L627L(1)		breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	41	Esophageal squamous(110;0.162)					AGAACTTCCTGCATGGAGATG	0.473																																					p.L627L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1881T	19						.						63.0	59.0	60.0					19																	34832720		2203	4300	6503	39524560	SO:0001819	synonymous_variant	9710	exon10				CCDS12436.1	19q13.12	2012-11-29			ENSG00000166398	ENSG00000166398			29016	protein-coding gene	gene with protein product						9205841	Standard	NM_014686		Approved		uc002nvd.4	O15063	OTTHUMG00000180505	ENST00000299505.6:c.1881G>T	19.37:g.34832720G>T		Somatic		Capture	Illumina HiSeq	Phase_I	39524560	NM_014686	Q2M3W4	Silent	SNP	ENST00000299505.6	37	CCDS12436.1																																																																																				KIAA0355-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451678.4	NM_014686	
SHKBP1	92799	broad.mit.edu	37	19	41096696	41096696	+	Missense_Mutation	SNP	C	C	T	rs141834970	byFrequency	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr19:41096696C>T	ENST00000291842.5	+	17	1878	c.1829C>T	c.(1828-1830)cCg>cTg	p.P610L	SHKBP1_ENST00000600733.1_Missense_Mutation_p.P585L|LTBP4_ENST00000204005.9_5'Flank|LTBP4_ENST00000545697.1_5'Flank	NM_138392.3	NP_612401.2	Q8TBC3	SHKB1_HUMAN	SH3KBP1 binding protein 1	610					protein homooligomerization (GO:0051260)			p.P610L(1)		breast(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(3)|urinary_tract(1)	29			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CTGGCCCCGCCGGCTCCTTCA	0.657													C|||	7	0.00139776	0.0053	0.0	5008	,	,		15650	0.0		0.0	False		,,,				2504	0.0				p.P610L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1829T	19						.	C	LEU/PRO	18,4388	25.3+/-52.1	1,16,2186	49.0	60.0	56.0		1829	-1.5	0.0	19	dbSNP_134	56	0,8600		0,0,4300	yes	missense	SHKBP1	NM_138392.3	98	1,16,6486	TT,TC,CC		0.0,0.4085,0.1384	benign	610/708	41096696	18,12988	2203	4300	6503	45788536	SO:0001583	missense	92799	exon17			AF258553	CCDS12560.1	19q13.2	2013-01-10				ENSG00000160410		"""WD repeat domain containing"""	19214	protein-coding gene	gene with protein product						11152963	Standard	NM_138392		Approved	PP203, Sb1	uc002oob.3	Q8TBC3		ENST00000291842.5:c.1829C>T	19.37:g.41096696C>T	ENSP00000291842:p.Pro610Leu	Somatic		Capture	Illumina HiSeq	Phase_I	45788536	NM_138392	Q8N2I6|Q8WY93|Q96IB8	Missense_Mutation	SNP	ENST00000291842.5	37	CCDS12560.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	C	1.810	-0.474974	0.04414	0.004085	0.0	ENSG00000160410	ENST00000291842;ENST00000446701	T	0.41065	1.01	4.82	-1.49	0.08718	.	1.002840	0.08045	N	0.995687	T	0.16938	0.0407	N	0.02539	-0.55	0.09310	N	0.999999	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.001;0.0;0.0;0.0;0.0	T	0.20042	-1.0287	10	0.48119	T	0.1	-14.4185	5.8627	0.18757	0.1564:0.5272:0.0:0.3164	.	488;390;447;610;610	B4DLI0;B4DUW2;B3KVX8;B2R6W9;Q8TBC3	.;.;.;.;SHKB1_HUMAN	L	610;390	ENSP00000291842:P610L	ENSP00000291842:P610L	P	+	2	0	SHKBP1	45788536	0.849000	0.29639	0.006000	0.13384	0.002000	0.02628	0.312000	0.19397	-0.210000	0.10140	-0.258000	0.10820	CCG		SHKBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462613.2	NM_138392	
CLASRP	11129	broad.mit.edu	37	19	45571279	45571279	+	Missense_Mutation	SNP	A	A	C	rs574020137		TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr19:45571279A>C	ENST00000221455.3	+	15	1772	c.1674A>C	c.(1672-1674)gaA>gaC	p.E558D	CLASRP_ENST00000544944.2_Missense_Mutation_p.E558D|CLASRP_ENST00000391953.4_Missense_Mutation_p.E496D	NM_007056.2	NP_008987	Q8N2M8	CLASR_HUMAN	CLK4-associating serine/arginine rich protein	558	Arg-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|pancreas(2)|prostate(1)	16						CCAGGACCGAACCTGCCGCTG	0.622																																					p.E558D												.	.	0			c.A1674C	19						.						31.0	34.0	33.0					19																	45571279		2203	4300	6503	50263119	SO:0001583	missense	11129	exon15			AF042800	CCDS12652.2, CCDS62710.1	19q13.3	2010-09-21	2010-09-21	2010-09-21	ENSG00000104859	ENSG00000104859			17731	protein-coding gene	gene with protein product	"""Clk4 associating SR-related protein"""		"""splicing factor, arginine/serine-rich 16"""	SFRS16		12169693	Standard	NM_007056		Approved	SWAP2, CLASP	uc002pak.3	Q8N2M8	OTTHUMG00000150189	ENST00000221455.3:c.1674A>C	19.37:g.45571279A>C	ENSP00000221455:p.Glu558Asp	None		Capture	Illumina HiSeq	Phase_I	50263119	NM_007056	B4DDT8|F8WAG9|O96026|Q6UW71|Q96DX2	Missense_Mutation	SNP	ENST00000221455.3	37	CCDS12652.2	.	.	.	.	.	.	.	.	.	.	A	13.31	2.198627	0.38806	.	.	ENSG00000104859	ENST00000221455;ENST00000391952;ENST00000391953;ENST00000544944	T;T;T;T	0.32272	1.98;1.46;1.98;1.51	5.07	-0.378	0.12497	.	0.202899	0.24128	U	0.041287	T	0.14184	0.0343	N	0.16478	0.41	0.34307	D	0.684953	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.15321	-1.0441	10	0.23891	T	0.37	-14.5092	6.2117	0.20633	0.4761:0.1478:0.3761:0.0	.	496;558;558	F8WAG9;F5H0Q6;Q8N2M8	.;.;CLASR_HUMAN	D	558;558;496;558	ENSP00000221455:E558D;ENSP00000375814:E558D;ENSP00000375815:E496D;ENSP00000438702:E558D	ENSP00000221455:E558D	E	+	3	2	CLASRP	50263119	0.023000	0.18921	0.999000	0.59377	0.986000	0.74619	-0.890000	0.04140	-0.026000	0.13895	0.260000	0.18958	GAA		CLASRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316749.1	NM_007056	
ZNF766	90321	broad.mit.edu	37	19	52794361	52794361	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr19:52794361C>A	ENST00000439461.1	+	4	1360	c.1317C>A	c.(1315-1317)taC>taA	p.Y439*	ZNF766_ENST00000593612.1_Nonsense_Mutation_p.Y454*|CTD-2525I3.5_ENST00000594865.1_RNA|ZNF766_ENST00000599581.1_3'UTR|ZNF766_ENST00000359102.4_Nonsense_Mutation_p.Y454*	NM_001010851.2	NP_001010851.1	Q5HY98	ZN766_HUMAN	zinc finger protein 766	439					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Y439*(1)		breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	17				GBM - Glioblastoma multiforme(134;0.00236)|OV - Ovarian serous cystadenocarcinoma(262;0.00871)		AGAAACCTTACAAATGCCATG	0.418																																					p.Y439X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1317A	19						.						119.0	126.0	124.0					19																	52794361		2203	4300	6503	57486173	SO:0001587	stop_gained	90321	exon4			AK024074	CCDS46163.1	19q13.33	2013-01-08				ENSG00000196214		"""Zinc fingers, C2H2-type"", ""-"""	28063	protein-coding gene	gene with protein product							Standard	XM_006723458		Approved		uc002pyr.1	Q5HY98		ENST00000439461.1:c.1317C>A	19.37:g.52794361C>A	ENSP00000409652:p.Tyr439*	Somatic		Capture	Illumina HiSeq	Phase_I	57486173	NM_001010851	B2RNE0|Q7Z326	Nonsense_Mutation	SNP	ENST00000439461.1	37	CCDS46163.1	.	.	.	.	.	.	.	.	.	.	C	19.14	3.768873	0.69878	.	.	ENSG00000196214	ENST00000439461;ENST00000359102	.	.	.	2.32	0.107	0.14544	.	.	.	.	.	.	.	.	.	.	.	0.31715	N	0.638981	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.9522	0.09374	0.0:0.5179:0.2053:0.2768	.	.	.	.	X	439;454	.	ENSP00000352005:Y454X	Y	+	3	2	ZNF766	57486173	0.000000	0.05858	0.305000	0.25099	0.089000	0.18198	-0.910000	0.04054	0.296000	0.22592	0.603000	0.83216	TAC		ZNF766-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462764.1	NM_001010851	
MUC16	94025	broad.mit.edu	37	19	9069078	9069078	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr19:9069078G>T	ENST00000397910.4	-	3	18571	c.18368C>A	c.(18367-18369)gCt>gAt	p.A6123D		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	6125	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.A6123D(2)|p.A1756D(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTGAGCAGAAGCTGGCATGAA	0.488																																					p.A6123D												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.C18368A	19						.						58.0	61.0	60.0					19																	9069078		2058	4204	6262	8930078	SO:0001583	missense	94025	exon3			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.18368C>A	19.37:g.9069078G>T	ENSP00000381008:p.Ala6123Asp	Somatic		Capture	Illumina HiSeq	Phase_I	8930078	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	0.076	-1.192941	0.01607	.	.	ENSG00000181143	ENST00000397910	T	0.02812	4.15	1.48	-2.96	0.05547	.	.	.	.	.	T	0.01254	0.0041	N	0.03608	-0.345	.	.	.	B	0.20052	0.041	B	0.11329	0.006	T	0.46373	-0.9196	8	0.87932	D	0	.	0.813	0.01097	0.1633:0.2313:0.3272:0.2782	.	6123	B5ME49	.	D	6123	ENSP00000381008:A6123D	ENSP00000381008:A6123D	A	-	2	0	MUC16	8930078	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.243000	0.02905	-2.936000	0.00299	-0.856000	0.03024	GCT		MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ZNF772	400720	broad.mit.edu	37	19	57984998	57984998	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr19:57984998G>T	ENST00000343280.4	-	5	1374	c.1114C>A	c.(1114-1116)Cat>Aat	p.H372N	ZNF772_ENST00000356584.3_Missense_Mutation_p.H331N|ZNF772_ENST00000425074.3_3'UTR|ZNF772_ENST00000600175.1_Intron|ZNF772_ENST00000427512.2_Missense_Mutation_p.H260N|AC004076.9_ENST00000415705.3_Intron|ZNF772_ENST00000601768.1_Intron|AC004076.9_ENST00000596831.1_Intron	NM_001024596.2	NP_001019767.1	Q68DY9	ZN772_HUMAN	zinc finger protein 772	372					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H372N(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(3)	9		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)|Lung(386;0.174)		TCTCCAGTATGGATACTCTCA	0.428																																					p.H372N	Melanoma(5;289 436 14293 15924 30817)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1114A	19						.						126.0	117.0	120.0					19																	57984998		2203	4300	6503	62676810	SO:0001583	missense	400720	exon5			BX647068	CCDS33133.1, CCDS46210.1	19q13.43	2013-01-08				ENSG00000197128		"""Zinc fingers, C2H2-type"", ""-"""	33106	protein-coding gene	gene with protein product							Standard	NM_001024596		Approved	DKFZp686I1569	uc002qot.3	Q68DY9		ENST00000343280.4:c.1114C>A	19.37:g.57984998G>T	ENSP00000341165:p.His372Asn	Somatic		Capture	Illumina HiSeq	Phase_I	62676810	NM_001024596	A6NJK9|B4DH56|B4DYS0	Missense_Mutation	SNP	ENST00000343280.4	37	CCDS33133.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.011413	0.75046	.	.	ENSG00000197128	ENST00000343280;ENST00000427512;ENST00000356584;ENST00000291809	T;T;T	0.67345	-0.26;-0.26;-0.26	3.96	3.96	0.45880	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.86087	0.5849	H	0.95260	3.645	0.80722	D	1	D;D;D	0.89917	1.0;0.989;0.996	D;D;D	0.87578	0.998;0.99;0.993	D	0.90124	0.4201	9	0.87932	D	0	.	13.5431	0.61686	0.0:0.0:1.0:0.0	.	260;331;372	Q68DY9-2;A6NJK9;Q68DY9	.;.;ZN772_HUMAN	N	372;260;331;297	ENSP00000341165:H372N;ENSP00000395967:H260N;ENSP00000348992:H331N	ENSP00000291809:H297N	H	-	1	0	ZNF772	62676810	1.000000	0.71417	0.885000	0.34714	0.951000	0.60555	6.500000	0.73687	2.036000	0.60181	0.305000	0.20034	CAT		ZNF772-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397447.1	NM_001024596	
SF3B4	10262	broad.mit.edu	37	1	149895561	149895562	+	Frame_Shift_Ins	INS	-	-	G	rs387907187|rs387907186		TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr1:149895561_149895562insG	ENST00000271628.8	-	6	1731_1732	c.1147_1148insC	c.(1147-1149)catfs	p.H383fs		NM_005850.4	NP_005841.1	Q15427	SF3B4_HUMAN	splicing factor 3b, subunit 4, 49kDa	383					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.H383fs*>43(1)|p.H383fs*>42(1)		endometrium(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(1)	17	Breast(34;0.0009)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			AGTGTATCCATGGGGGGGCATC	0.624																																					p.H383fs												.	.	2	Deletion - Frameshift(1)|Insertion - Frameshift(1)	large_intestine(2)	c.1148_1149insC	1						.			12,4250		0,12,2119						4.5	1.0			21	13,8231		0,13,4109	no	frameshift	SF3B4	NM_005850.4		0,25,6228	A1A1,A1R,RR		0.1577,0.2816,0.1999				25,12481				148162186	SO:0001589	frameshift_variant	10262	exon6			L35013	CCDS72900.1	1q21.2	2013-02-12	2002-08-29		ENSG00000143368	ENSG00000143368		"""RNA binding motif (RRM) containing"""	10771	protein-coding gene	gene with protein product		605593	"""splicing factor 3b, subunit 4, 49kD"""			7958871	Standard	NM_005850		Approved	SAP49, SF3b49, Hsh49	uc001etk.2	Q15427	OTTHUMG00000012208	ENST00000271628.8:c.1148dupC	1.37:g.149895568_149895568dupG	ENSP00000271628:p.His383fs	Somatic		Capture	Illumina HiSeq	Phase_I	148162185	NM_005850	Q5SZ63	Frame_Shift_Ins	INS	ENST00000271628.8	37	CCDS941.1																																																																																				SF3B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033753.1	NM_005850	
MTOR	2475	broad.mit.edu	37	1	11300434	11300434	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr1:11300434G>A	ENST00000361445.4	-	11	1788	c.1712C>T	c.(1711-1713)aCg>aTg	p.T571M		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	571	Interaction with NBN.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.T571M(1)		breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	AGGGAGGGTCGTGAGGCCAGG	0.582																																					p.T571M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1712T	1						.						110.0	105.0	106.0					1																	11300434		2203	4300	6503	11223021	SO:0001583	missense	2475	exon11			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.1712C>T	1.37:g.11300434G>A	ENSP00000354558:p.Thr571Met	Somatic		Capture	Illumina HiSeq	Phase_I	11223021	NM_004958	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	37	CCDS127.1	.	.	.	.	.	.	.	.	.	.	G	16.08	3.021054	0.54576	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	T	0.30448	1.53	5.73	3.82	0.43975	Armadillo-like helical (1);Armadillo-type fold (1);	0.168592	0.52532	N	0.000061	T	0.20251	0.0487	L	0.46157	1.445	0.80722	D	1	P	0.39862	0.692	B	0.19391	0.025	T	0.03184	-1.1063	10	0.44086	T	0.13	-7.0003	10.0555	0.42241	0.0704:0.0:0.7814:0.1482	.	571	P42345	MTOR_HUMAN	M	571	ENSP00000354558:T571M	ENSP00000354558:T571M	T	-	2	0	MTOR	11223021	1.000000	0.71417	0.673000	0.29887	0.962000	0.63368	7.542000	0.82095	0.722000	0.32252	0.650000	0.86243	ACG		MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	NM_004958	
GNAT2	2780	broad.mit.edu	37	1	110153098	110153098	+	Silent	SNP	G	G	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr1:110153098G>T	ENST00000351050.3	-	2	336	c.150C>A	c.(148-150)gtC>gtA	p.V50V		NM_005272.3	NP_005263.1	P19087	GNAT2_HUMAN	guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2	50					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|detection of light stimulus involved in visual perception (GO:0050908)|G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction (GO:0007602)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|response to light intensity (GO:0009642)|retinal cone cell development (GO:0046549)|visual perception (GO:0007601)	heterotrimeric G-protein complex (GO:0005834)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled photoreceptor activity (GO:0008020)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)	p.V50V(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)	14		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.0422)|Colorectal(144;0.108)|Epithelial(280;0.125)|all cancers(265;0.129)|LUSC - Lung squamous cell carcinoma(189;0.227)		TCATCTGTTTGACGATGGTGC	0.483																																					p.V50V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C150A	1						.						248.0	193.0	212.0					1																	110153098		2203	4300	6503	109954621	SO:0001819	synonymous_variant	2780	exon2			BC000233	CCDS803.1	1p13	2013-01-08			ENSG00000134183	ENSG00000134183			4394	protein-coding gene	gene with protein product		139340				8406495	Standard	NM_005272		Approved	ACHM4	uc001dya.3	P19087	OTTHUMG00000011639	ENST00000351050.3:c.150C>A	1.37:g.110153098G>T		Somatic		Capture	Illumina HiSeq	Phase_I	109954621	NM_005272		Silent	SNP	ENST00000351050.3	37	CCDS803.1																																																																																				GNAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032181.1	NM_005272	
SPAG17	200162	broad.mit.edu	37	1	118584625	118584625	+	Missense_Mutation	SNP	C	C	T	rs200995274		TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr1:118584625C>T	ENST00000336338.5	-	21	2920	c.2855G>A	c.(2854-2856)cGc>cAc	p.R952H		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	952						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)		p.R952H(1)		NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		TTCCCTTAAGCGCTCCTCTTC	0.368																																					p.R952H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2855A	1						.						217.0	210.0	212.0					1																	118584625		2203	4300	6503	118386148	SO:0001583	missense	200162	exon21				CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.2855G>A	1.37:g.118584625C>T	ENSP00000337804:p.Arg952His	Somatic		Capture	Illumina HiSeq	Phase_I	118386148	NM_206996	Q8NAZ1|Q9NT21	Missense_Mutation	SNP	ENST00000336338.5	37	CCDS899.1	.	.	.	.	.	.	.	.	.	.	C	19.30	3.801914	0.70682	.	.	ENSG00000155761	ENST00000336338	T	0.30714	1.52	5.36	5.36	0.76844	.	0.407810	0.27151	N	0.020682	T	0.42245	0.1194	L	0.53249	1.67	0.29502	N	0.854834	D	0.89917	1.0	D	0.91635	0.999	T	0.23154	-1.0196	10	0.56958	D	0.05	.	17.2317	0.86985	0.0:1.0:0.0:0.0	.	952	Q6Q759	SPG17_HUMAN	H	952	ENSP00000337804:R952H	ENSP00000337804:R952H	R	-	2	0	SPAG17	118386148	0.242000	0.23868	0.240000	0.24138	0.559000	0.35586	1.299000	0.33424	2.671000	0.90904	0.650000	0.86243	CGC		SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033723.1	NM_206996	
FLG	2312	broad.mit.edu	37	1	152280141	152280141	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr1:152280141C>G	ENST00000368799.1	-	3	7256	c.7221G>C	c.(7219-7221)agG>agC	p.R2407S	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2407	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.R2407S(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AACGTCCAGACCTTCCTGCTG	0.587									Ichthyosis																												p.R2407S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G7221C	1						.						131.0	128.0	129.0					1																	152280141		2203	4297	6500	150546765	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.7221G>C	1.37:g.152280141C>G	ENSP00000357789:p.Arg2407Ser	Somatic		Capture	Illumina HiSeq	Phase_I	150546765	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	C	3.444	-0.113433	0.06881	.	.	ENSG00000143631	ENST00000368799;ENST00000271820	T	0.01304	5.03	3.35	-6.7	0.01766	.	.	.	.	.	T	0.00271	0.0008	L	0.41824	1.3	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.50701	-0.8797	9	0.07175	T	0.84	.	1.9498	0.03364	0.1844:0.1426:0.408:0.2651	.	2407	P20930	FILA_HUMAN	S	2407;317	ENSP00000357789:R2407S	ENSP00000271820:R317S	R	-	3	2	FLG	150546765	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-4.226000	0.00270	-2.567000	0.00470	-0.345000	0.07892	AGG		FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
CD84	8832	broad.mit.edu	37	1	160535347	160535347	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr1:160535347T>A	ENST00000311224.4	-	2	301	c.235A>T	c.(235-237)Aga>Tga	p.R79*	RP11-528G1.2_ENST00000446952.1_RNA|CD84_ENST00000368051.3_Nonsense_Mutation_p.R79*|CD84_ENST00000368054.3_Nonsense_Mutation_p.R79*|CD84_ENST00000534968.1_Intron|CD84_ENST00000368048.3_Nonsense_Mutation_p.R79*|CD84_ENST00000368047.3_5'UTR	NM_001184879.1	NP_001171808.1	Q9UIB8	SLAF5_HUMAN	CD84 molecule	79	Ig-like V-type.				blood coagulation (GO:0007596)|defense response (GO:0006952)|homophilic cell adhesion (GO:0007156)|leukocyte migration (GO:0050900)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.R79*(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(1)	24	all_cancers(52;3.62e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			TAATAATTTCTGTGGGTCACA	0.428																																					p.R79X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.A235T	1						.						235.0	212.0	220.0					1																	160535347		2203	4300	6503	158801971	SO:0001587	stop_gained	8832	exon2			AF054816	CCDS1206.1, CCDS53395.1, CCDS53396.1, CCDS53397.1	1q24	2013-01-11	2006-03-31		ENSG00000066294	ENSG00000066294		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1704	protein-coding gene	gene with protein product		604513	"""CD84 antigen (leukocyte antigen)"", ""CD84 molecule """			9310491	Standard	NM_003874		Approved	SLAMF5, hCD84, mCD84	uc001fwh.4	Q9UIB8	OTTHUMG00000022788	ENST00000311224.4:c.235A>T	1.37:g.160535347T>A	ENSP00000312367:p.Arg79*	Somatic		Capture	Illumina HiSeq	Phase_I	158801971	NM_001184881	B2R8T1|B7Z3R8|O15430|O95266|O95660|Q5H9R1|Q6FHA8|Q8WLP1|Q8WWI8|Q9UF04|Q9UIB6|Q9UIB7|Q9UIT7	Nonsense_Mutation	SNP	ENST00000311224.4	37	CCDS53396.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.040323	0.75732	.	.	ENSG00000066294	ENST00000368054;ENST00000368048;ENST00000311224;ENST00000368051;ENST00000360056;ENST00000368047	.	.	.	5.11	-2.06	0.07298	.	1.327790	0.04284	N	0.344286	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	0.3397	6.9059	0.24309	0.0:0.2985:0.4573:0.2442	.	.	.	.	X	79	.	ENSP00000312367:R79X	R	-	1	2	CD84	158801971	0.261000	0.24063	0.019000	0.16419	0.331000	0.28603	0.126000	0.15769	-0.220000	0.09988	0.482000	0.46254	AGA		CD84-003	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059092.1	NM_003874	
DUSP27	92235	broad.mit.edu	37	1	167088577	167088577	+	Missense_Mutation	SNP	G	G	A	rs34315885|rs150600224		TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr1:167088577G>A	ENST00000361200.2	+	5	695	c.529G>A	c.(529-531)Gaa>Aaa	p.E177K	DUSP27_ENST00000271385.5_Missense_Mutation_p.E177K|DUSP27_ENST00000443333.1_Missense_Mutation_p.E177K			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	177					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.E177K(2)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						CACTGGCCCCGAATTCTACAC	0.562																																					p.E177K												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G529A	1						.	G	LYS/GLU	1,4405	2.1+/-5.4	0,1,2202	123.0	112.0	116.0		529	4.2	0.7	1	dbSNP_134	116	0,8600		0,0,4300	no	missense	DUSP27	NM_001080426.1	56	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	177/1159	167088577	1,13005	2203	4300	6503	165355201	SO:0001583	missense	92235	exon4			AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.529G>A	1.37:g.167088577G>A	ENSP00000354483:p.Glu177Lys	Somatic		Capture	Illumina HiSeq	Phase_I	165355201	NM_001080426	A0AUM4|Q9C074	Missense_Mutation	SNP	ENST00000361200.2	37	CCDS30932.1	.	.	.	.	.	.	.	.	.	.	G	15.48	2.845383	0.51164	2.27E-4	0.0	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	T;T;T	0.60672	0.17;0.17;0.17	5.18	4.23	0.50019	Dual specificity phosphatase, catalytic domain (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.435114	0.25771	N	0.028410	T	0.23451	0.0567	L	0.28400	0.85	0.23132	N	0.998246	P	0.46220	0.874	B	0.37508	0.252	T	0.03008	-1.1083	10	0.37606	T	0.19	-8.3702	10.6579	0.45686	0.0737:0.1331:0.7932:0.0	.	177	Q5VZP5	DUS27_HUMAN	K	177	ENSP00000354483:E177K;ENSP00000271385:E177K;ENSP00000404874:E177K	ENSP00000271385:E177K	E	+	1	0	DUSP27	165355201	0.019000	0.18553	0.678000	0.29963	0.988000	0.76386	1.618000	0.36954	1.107000	0.41642	0.591000	0.81541	GAA		DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1	NM_001080426	
F5	2153	broad.mit.edu	37	1	169492541	169492541	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr1:169492541G>A	ENST00000367797.3	-	21	6143	c.5942C>T	c.(5941-5943)gCc>gTc	p.A1981V	F5_ENST00000367796.3_Missense_Mutation_p.A1986V	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	1981	F5/8 type C 1. {ECO:0000255|PROSITE- ProRule:PRU00081}.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)	p.A1981V(1)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	GTAGTGTTTGGCACCTTGGGT	0.448																																					p.A1981V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5942T	1						.						276.0	228.0	244.0					1																	169492541		2203	4300	6503	167759165	SO:0001583	missense	2153	exon21			M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.5942C>T	1.37:g.169492541G>A	ENSP00000356771:p.Ala1981Val	Somatic		Capture	Illumina HiSeq	Phase_I	167759165	NM_000130	A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	ENST00000367797.3	37	CCDS1281.1	.	.	.	.	.	.	.	.	.	.	G	33	5.266533	0.95399	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	D;D	0.98264	-4.83;-4.83	5.66	5.66	0.87406	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	D	0.98801	0.9596	M	0.70903	2.155	0.42380	D	0.992484	D	0.89917	1.0	D	0.79784	0.993	D	0.99888	1.1128	9	0.87932	D	0	-21.1385	19.76	0.96311	0.0:0.0:1.0:0.0	.	1981	P12259	FA5_HUMAN	V	1981;1986	ENSP00000356771:A1981V;ENSP00000356770:A1986V	ENSP00000356770:A1986V	A	-	2	0	F5	167759165	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.139000	0.94554	2.666000	0.90696	0.655000	0.94253	GCC		F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083712.1	NM_000130	
FMO3	2328	broad.mit.edu	37	1	171080017	171080017	+	Missense_Mutation	SNP	G	G	A	rs201271626	byFrequency	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr1:171080017G>A	ENST00000367755.4	+	6	817	c.706G>A	c.(706-708)Gtc>Atc	p.V236I	FMO3_ENST00000538429.1_Missense_Mutation_p.V173I|FMO3_ENST00000542847.1_Missense_Mutation_p.V216I|FMO3_ENST00000392085.2_Missense_Mutation_p.V236I	NM_001002294.2	NP_001002294.1	P31513	FMO3_HUMAN	flavin containing monooxygenase 3	236					drug metabolic process (GO:0017144)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	amino acid binding (GO:0016597)|flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)|trimethylamine monooxygenase activity (GO:0034899)	p.V236I(1)		endometrium(1)|kidney(1)|large_intestine(12)|lung(12)|skin(1)|stomach(2)|urinary_tract(2)	31	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Almotriptan(DB00918)|Cimetidine(DB00501)|Clozapine(DB00363)|Dapsone(DB00250)|Dasatinib(DB01254)|Olanzapine(DB00334)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	CATGCTGCTCGTCACTCGATT	0.463													G|||	11	0.00219649	0.0	0.0	5008	,	,		18814	0.0		0.0	False		,,,				2504	0.0112				p.V236I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G706A	1						.						227.0	196.0	206.0					1																	171080017		2203	4300	6503	169346641	SO:0001583	missense	2328	exon6			BC032016	CCDS1292.1	1q24.3	2013-10-01			ENSG00000007933	ENSG00000007933	2.6.1.16		3771	protein-coding gene	gene with protein product		136132				8486388, 9417913	Standard	NM_001002294		Approved		uc001ghh.3	P31513	OTTHUMG00000035505	ENST00000367755.4:c.706G>A	1.37:g.171080017G>A	ENSP00000356729:p.Val236Ile	Somatic		Capture	Illumina HiSeq	Phase_I	169346641	NM_001002294	B2R816|Q14854|Q8N5N5	Missense_Mutation	SNP	ENST00000367755.4	37	CCDS1292.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	0.023	-1.405681	0.01155	.	.	ENSG00000007933	ENST00000367755;ENST00000392085;ENST00000542847;ENST00000538429	T;T;T;T	0.53423	0.62;0.62;0.62;0.62	4.99	-9.97	0.00440	.	0.592222	0.18325	N	0.144673	T	0.04407	0.0121	N	0.03608	-0.345	0.09310	N	1	B;B;B	0.11235	0.004;0.0;0.0	B;B;B	0.09377	0.004;0.001;0.001	T	0.09422	-1.0675	10	0.20519	T	0.43	-2.0143	8.4713	0.32986	0.2201:0.0827:0.5444:0.1528	.	173;216;236	F5H261;F5GZZ8;P31513	.;.;FMO3_HUMAN	I	236;236;216;173	ENSP00000356729:V236I;ENSP00000375935:V236I;ENSP00000444073:V216I;ENSP00000439500:V173I	ENSP00000356729:V236I	V	+	1	0	FMO3	169346641	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-1.449000	0.02392	-3.508000	0.00150	-1.929000	0.00512	GTC		FMO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086219.1	NM_006894	
TNN	63923	broad.mit.edu	37	1	175066771	175066771	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr1:175066771C>A	ENST00000239462.4	+	8	1920	c.1807C>A	c.(1807-1809)Cag>Aag	p.Q603K		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	603	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)		p.Q603K(1)		NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		TGTCTGGGCCCAGAAGGGGGA	0.547																																					p.Q603K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1807A	1						.						79.0	72.0	74.0					1																	175066771		2203	4300	6503	173333394	SO:0001583	missense	63923	exon8			AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.1807C>A	1.37:g.175066771C>A	ENSP00000239462:p.Gln603Lys	Somatic		Capture	Illumina HiSeq	Phase_I	173333394	NM_022093	B9EGP3|Q5R360	Missense_Mutation	SNP	ENST00000239462.4	37	CCDS30943.1	.	.	.	.	.	.	.	.	.	.	C	13.44	2.237611	0.39598	.	.	ENSG00000120332	ENST00000239462	T	0.57273	0.41	5.63	-4.14	0.03892	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.916370	0.09315	N	0.819070	T	0.51753	0.1693	L	0.60845	1.875	0.09310	N	1	B	0.12013	0.005	B	0.20955	0.032	T	0.51965	-0.8638	10	0.54805	T	0.06	.	20.0964	0.97849	0.0781:0.1335:0.7883:0.0	.	603	Q9UQP3	TENN_HUMAN	K	603	ENSP00000239462:Q603K	ENSP00000239462:Q603K	Q	+	1	0	TNN	173333394	0.006000	0.16342	0.640000	0.29408	0.922000	0.55478	-0.004000	0.12878	-0.568000	0.06038	-0.211000	0.12701	CAG		TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527	
BRINP2	57795	broad.mit.edu	37	1	177249705	177249705	+	Missense_Mutation	SNP	G	G	A	rs377625274		TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr1:177249705G>A	ENST00000361539.4	+	8	1705	c.1393G>A	c.(1393-1395)Gcg>Acg	p.A465T	BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	465					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)		p.A465T(1)|p.A465S(1)									CGAAGGGCCCGCGTGTGCCCA	0.647																																					p.A465T												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G1393A	1						.	G	THR/ALA	0,4406		0,0,2203	34.0	33.0	33.0		1393	5.2	0.2	1		33	1,8599	1.2+/-3.3	0,1,4299	no	missense	FAM5B	NM_021165.2	58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	465/784	177249705	1,13005	2203	4300	6503	175516328	SO:0001583	missense	57795	exon8				CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.1393G>A	1.37:g.177249705G>A	ENSP00000354481:p.Ala465Thr	Somatic		Capture	Illumina HiSeq	Phase_I	175516328	NM_021165	O95560|Q6ZWC1|Q7LCZ9|Q8N360	Missense_Mutation	SNP	ENST00000361539.4	37	CCDS1320.1	.	.	.	.	.	.	.	.	.	.	G	7.229	0.599031	0.13939	0.0	1.16E-4	ENSG00000198797	ENST00000536589;ENST00000361539	T	0.43688	0.94	5.21	5.21	0.72293	Epidermal growth factor-like (1);	0.128827	0.53938	D	0.000049	T	0.42291	0.1196	M	0.65975	2.015	0.40404	D	0.979673	B;P	0.44006	0.046;0.824	B;B	0.35470	0.009;0.203	T	0.50898	-0.8773	10	0.44086	T	0.13	-14.2314	18.3523	0.90342	0.0:0.0:1.0:0.0	.	360;465	Q9C0B6-2;Q9C0B6	.;FAM5B_HUMAN	T	218;465	ENSP00000354481:A465T	ENSP00000354481:A465T	A	+	1	0	FAM5B	175516328	0.996000	0.38824	0.209000	0.23619	0.054000	0.15201	5.404000	0.66344	2.427000	0.82271	0.313000	0.20887	GCG		BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084599.1	NM_021165	
CACNA1E	777	broad.mit.edu	37	1	181765842	181765842	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr1:181765842C>T	ENST00000367573.2	+	47	6247	c.6247C>T	c.(6247-6249)Cgg>Tgg	p.R2083W	CACNA1E_ENST00000358338.5_Missense_Mutation_p.R1972W|CACNA1E_ENST00000367567.4_Missense_Mutation_p.R1647W|CACNA1E_ENST00000367570.1_Missense_Mutation_p.R2040W|CACNA1E_ENST00000357570.5_Missense_Mutation_p.R2034W|CACNA1E_ENST00000360108.3_Missense_Mutation_p.R2064W|CACNA1E_ENST00000526775.1_Missense_Mutation_p.R2021W	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	2083					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.R2040W(1)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						GGGCAGGGAGCGGGGACGATC	0.552																																					p.R2040W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C6118T	1						.						49.0	51.0	50.0					1																	181765842		1970	4162	6132	180032465	SO:0001583	missense	777	exon46			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.6247C>T	1.37:g.181765842C>T	ENSP00000356545:p.Arg2083Trp	Somatic		Capture	Illumina HiSeq	Phase_I	180032465	NM_000721	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	37	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.968776	0.74131	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.99150	-5.32;-5.3;-4.72;-5.29;-5.49;-4.71;-4.72	5.91	2.8	0.32819	.	0.833018	0.11016	N	0.608905	D	0.98814	0.9600	L	0.43152	1.355	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.96995	0.9725	10	0.87932	D	0	.	14.3964	0.67013	0.396:0.604:0.0:0.0	.	2021;2040	Q15878-2;Q15878-3	.;.	W	2040;2021;2034;1972;1647;2064;2083	ENSP00000356542:R2040W;ENSP00000434814:R2021W;ENSP00000350183:R2034W;ENSP00000351101:R1972W;ENSP00000356539:R1647W;ENSP00000353222:R2064W;ENSP00000356545:R2083W	ENSP00000350183:R2034W	R	+	1	2	CACNA1E	180032465	0.970000	0.33590	1.000000	0.80357	0.961000	0.63080	0.085000	0.14912	0.784000	0.33661	-0.152000	0.13540	CGG		CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
SIPA1L2	57568	broad.mit.edu	37	1	232600963	232600963	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr1:232600963T>C	ENST00000366630.1	-	8	2801	c.2443A>G	c.(2443-2445)Aac>Gac	p.N815D	SIPA1L2_ENST00000308942.4_5'Flank|SIPA1L2_ENST00000262861.4_Missense_Mutation_p.N815D			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	815					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)	p.N815D(1)		NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				GTGACAAAGTTCTCCGCCAGA	0.478																																					p.N815D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2443G	1						.						114.0	112.0	113.0					1																	232600963		1968	4167	6135	230667586	SO:0001583	missense	57568	exon7			AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.2443A>G	1.37:g.232600963T>C	ENSP00000355589:p.Asn815Asp	Somatic		Capture	Illumina HiSeq	Phase_I	230667586	NM_020808	Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Missense_Mutation	SNP	ENST00000366630.1	37	CCDS41474.1	.	.	.	.	.	.	.	.	.	.	T	17.90	3.502862	0.64298	.	.	ENSG00000116991	ENST00000366630;ENST00000262861	D;D	0.93859	-3.3;-3.3	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.95137	0.8424	M	0.65498	2.005	0.53688	D	0.999978	P	0.51351	0.944	P	0.55455	0.776	D	0.94990	0.8133	10	0.51188	T	0.08	-48.2483	16.143	0.81539	0.0:0.0:0.0:1.0	.	815	Q9P2F8	SI1L2_HUMAN	D	815	ENSP00000355589:N815D;ENSP00000262861:N815D	ENSP00000262861:N815D	N	-	1	0	SIPA1L2	230667586	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	8.040000	0.89188	2.206000	0.71126	0.528000	0.53228	AAC		SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092318.1	XM_045839	
KANK4	163782	broad.mit.edu	37	1	62739708	62739708	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr1:62739708C>A	ENST00000371153.4	-	3	1446	c.1068G>T	c.(1066-1068)ttG>ttT	p.L356F	KANK4_ENST00000354381.3_Intron|KANK4_ENST00000371150.1_5'Flank	NM_181712.4	NP_859063.3	Q5T7N3	KANK4_HUMAN	KN motif and ankyrin repeat domains 4	356						cytoplasm (GO:0005737)		p.L356F(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(49)|ovary(3)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	81						TTCTTCCAGACAACTCTCCCT	0.557																																					p.L356F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1068T	1						.						89.0	84.0	86.0					1																	62739708		2203	4300	6503	62512296	SO:0001583	missense	163782	exon3			AK096259	CCDS620.1	1p31.3	2013-10-11	2008-01-29	2008-01-29	ENSG00000132854	ENSG00000132854		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	27263	protein-coding gene	gene with protein product		614612	"""ankyrin repeat domain 38"""	ANKRD38		17996375, 19554261	Standard	NM_181712		Approved	KIAA0172	uc001dah.4	Q5T7N3	OTTHUMG00000008971	ENST00000371153.4:c.1068G>T	1.37:g.62739708C>A	ENSP00000360195:p.Leu356Phe	Somatic		Capture	Illumina HiSeq	Phase_I	62512296	NM_181712	B1ALP7|Q6P9A0|Q86T71|Q86VE6|Q8NAX3	Missense_Mutation	SNP	ENST00000371153.4	37	CCDS620.1	.	.	.	.	.	.	.	.	.	.	C	10.78	1.448282	0.26074	.	.	ENSG00000132854	ENST00000371153	T	0.68479	-0.33	5.58	3.67	0.42095	.	0.000000	0.31697	N	0.007209	T	0.61540	0.2355	L	0.54323	1.7	0.28879	N	0.894512	P	0.47106	0.89	P	0.46076	0.503	T	0.58284	-0.7663	10	0.42905	T	0.14	-8.6564	6.2328	0.20744	0.1469:0.6932:0.0:0.1598	.	356	Q5T7N3	KANK4_HUMAN	F	356	ENSP00000360195:L356F	ENSP00000360195:L356F	L	-	3	2	KANK4	62512296	0.000000	0.05858	0.168000	0.22838	0.071000	0.16799	0.129000	0.15830	0.672000	0.31204	0.491000	0.48974	TTG		KANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024877.1	NM_181712	
CLCA2	9635	broad.mit.edu	37	1	86890005	86890005	+	Silent	SNP	A	A	G			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr1:86890005A>G	ENST00000370565.4	+	1	237	c.75A>G	c.(73-75)gaA>gaG	p.E25E		NM_006536.5	NP_006527.1	Q9UQC9	CLCA2_HUMAN	chloride channel accessory 2	25					cell adhesion (GO:0007155)|transport (GO:0006810)	cell junction (GO:0030054)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)|ligand-gated ion channel activity (GO:0015276)	p.E25E(1)		NS(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	42		Lung NSC(277;0.238)		all cancers(265;0.0233)|Epithelial(280;0.0452)		TAAGTTCAGAACTCCCATTCC	0.458																																					p.E25E	Melanoma(157;1000 1898 5363 5664 48018)|Ovarian(88;135 1366 2838 28875 34642)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A75G	1						.						122.0	110.0	114.0					1																	86890005		2203	4300	6503	86662593	SO:0001819	synonymous_variant	9635	exon1				CCDS708.1	1p22.3	2012-02-26	2009-01-29		ENSG00000137975	ENSG00000137975			2016	protein-coding gene	gene with protein product		604003	"""chloride channel, calcium activated, family member 2"", ""chloride channel regulator 2"""				Standard	NM_006536		Approved	CLCRG2	uc001dlr.4	Q9UQC9	OTTHUMG00000010256	ENST00000370565.4:c.75A>G	1.37:g.86890005A>G		Somatic		Capture	Illumina HiSeq	Phase_I	86662593	NM_006536	A8K2T3|Q9Y6N2	Silent	SNP	ENST00000370565.4	37	CCDS708.1																																																																																				CLCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028284.1	NM_006536	
SLC35F3	148641	broad.mit.edu	37	1	234452357	234452357	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr1:234452357G>A	ENST00000366617.3	+	4	859	c.631G>A	c.(631-633)Gcc>Acc	p.A211T	SLC35F3_ENST00000366618.3_Missense_Mutation_p.A280T			Q8IY50	S35F3_HUMAN	solute carrier family 35, member F3	211					thiamine transport (GO:0015888)	integral component of membrane (GO:0016021)		p.A280T(2)		breast(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|urinary_tract(1)	32	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)			GATTGTGGCCGCCATCCTCGC	0.582																																					p.A280T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G838A	1						.						290.0	288.0	289.0					1																	234452357		2203	4300	6503	232518980	SO:0001583	missense	148641	exon5				CCDS1600.1, CCDS73050.1	1q42.3	2013-05-22			ENSG00000183780	ENSG00000183780		"""Solute carriers"""	23616	protein-coding gene	gene with protein product							Standard	XM_005273070		Approved	FLJ37712	uc001hvy.1	Q8IY50	OTTHUMG00000037929	ENST00000366617.3:c.631G>A	1.37:g.234452357G>A	ENSP00000355576:p.Ala211Thr	Somatic		Capture	Illumina HiSeq	Phase_I	232518980	NM_173508	Q5TDD6|Q8N9C9	Missense_Mutation	SNP	ENST00000366617.3	37		.	.	.	.	.	.	.	.	.	.	G	36	5.647260	0.96714	.	.	ENSG00000183780	ENST00000366618;ENST00000366617	T;T	0.63096	-0.02;-0.02	5.73	5.73	0.89815	Drug/metabolite transporter (1);	0.000000	0.85682	D	0.000000	T	0.72938	0.3523	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.74166	-0.3753	10	0.62326	D	0.03	-24.8442	19.8785	0.96886	0.0:0.0:1.0:0.0	.	211;280	Q8IY50;Q8IY50-2	S35F3_HUMAN;.	T	280;211	ENSP00000355577:A280T;ENSP00000355576:A211T	ENSP00000355576:A211T	A	+	1	0	SLC35F3	232518980	1.000000	0.71417	0.985000	0.45067	0.908000	0.53690	9.860000	0.99555	2.695000	0.91970	0.655000	0.94253	GCC		SLC35F3-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000128322.1	NM_173508	
TASP1	55617	broad.mit.edu	37	20	13398140	13398140	+	Silent	SNP	C	C	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr20:13398140C>T	ENST00000337743.4	-	13	1245	c.1125G>A	c.(1123-1125)gaG>gaA	p.E375E	TASP1_ENST00000480436.1_5'UTR|TASP1_ENST00000539805.1_3'UTR	NM_017714.2	NP_060184.2	Q9H6P5	TASP1_HUMAN	taspase, threonine aspartase, 1	375					positive regulation of transcription, DNA-templated (GO:0045893)		threonine-type endopeptidase activity (GO:0004298)	p.E375E(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(11)|liver(1)|lung(11)|stomach(2)|urinary_tract(2)	31						CACACATGCTCTCCGTCGTGT	0.423																																					p.E375E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1125A	20						.						156.0	122.0	133.0					20																	13398140		2203	4300	6503	13346140	SO:0001819	synonymous_variant	55617	exon13			AK000219	CCDS13116.1	20p12	2005-10-15	2005-10-15	2005-10-15	ENSG00000089123	ENSG00000089123	3.4.25.-		15859	protein-coding gene	gene with protein product		608270	"""chromosome 20 open reading frame 13"""	C20orf13		14636557	Standard	XR_430268		Approved	FLJ20212, dJ585I14.2	uc002woi.3	Q9H6P5	OTTHUMG00000031904	ENST00000337743.4:c.1125G>A	20.37:g.13398140C>T		Somatic		Capture	Illumina HiSeq	Phase_I	13346140	NM_017714	B7Z690|B7Z963|Q5TDU9|Q9BQN0|Q9NQ08|Q9NTS6|Q9NXJ2	Silent	SNP	ENST00000337743.4	37	CCDS13116.1																																																																																				TASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078041.2	NM_017714	
KIZ-AS1	101929591	broad.mit.edu	37	20	21142671	21142671	+	RNA	SNP	C	C	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr20:21142671C>A	ENST00000591761.1	-	0	5142				PLK1S1_ENST00000457464.1_RNA|RP5-872K7.7_ENST00000425746.2_RNA																							CTTTTCAATTCCTGACCCACA	0.443																																					p.P86T												.	.	0			c.C256A	20						.						71.0	69.0	70.0					20																	21142671		1950	4153	6103	21090671			55857	exon4																															20.37:g.21142671C>A		Somatic		Capture	Illumina HiSeq	Phase_I	21090671	NM_001163022		Missense_Mutation	SNP	ENST00000591761.1	37																																																																																					RP4-777D9.2-002	KNOWN	basic	antisense	antisense	OTTHUMT00000078258.2		
THBD	7056	broad.mit.edu	37	20	23029138	23029138	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr20:23029138G>A	ENST00000377103.2	-	1	1240	c.1004C>T	c.(1003-1005)cCg>cTg	p.P335L		NM_000361.2	NP_000352.1	P07204	TRBM_HUMAN	thrombomodulin	335	EGF-like 3; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				blood coagulation (GO:0007596)|female pregnancy (GO:0007565)|leukocyte migration (GO:0050900)|negative regulation of blood coagulation (GO:0030195)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of platelet activation (GO:0010544)|response to cAMP (GO:0051591)|response to lipopolysaccharide (GO:0032496)|response to X-ray (GO:0010165)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.P335L(1)		endometrium(2)|large_intestine(3)|ovary(1)|skin(1)	7	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)				Drotrecogin alfa(DB00055)|Ibuprofen(DB01050)	CTGCGGACACGGACTGGGCTC	0.657																																					p.P335L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1004T	20						.						41.0	36.0	38.0					20																	23029138		2203	4300	6503	22977138	SO:0001583	missense	7056	exon1				CCDS13148.1	20p11.21	2014-09-17			ENSG00000178726	ENSG00000178726		"""CD molecules"""	11784	protein-coding gene	gene with protein product		188040					Standard	NM_000361		Approved	CD141	uc002wss.3	P07204	OTTHUMG00000032053	ENST00000377103.2:c.1004C>T	20.37:g.23029138G>A	ENSP00000366307:p.Pro335Leu	Somatic		Capture	Illumina HiSeq	Phase_I	22977138	NM_000361	Q8IV29|Q9UC32	Missense_Mutation	SNP	ENST00000377103.2	37	CCDS13148.1	.	.	.	.	.	.	.	.	.	.	G	2.293	-0.361927	0.05103	.	.	ENSG00000178726	ENST00000377103;ENST00000503590	D	0.87256	-2.23	4.84	-3.85	0.04243	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.967191	0.08504	N	0.935923	T	0.75831	0.3903	N	0.20766	0.605	0.22684	N	0.998852	B	0.17268	0.021	B	0.15052	0.012	T	0.56469	-0.7974	10	0.18276	T	0.48	-10.5383	13.357	0.60633	0.6582:0.0:0.3418:0.0	.	335	P07204	TRBM_HUMAN	L	335;317	ENSP00000366307:P335L	ENSP00000366307:P335L	P	-	2	0	THBD	22977138	0.000000	0.05858	0.001000	0.08648	0.013000	0.08279	-0.365000	0.07573	-1.247000	0.02507	-0.254000	0.11334	CCG		THBD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078307.2		
BPIFA3	128861	broad.mit.edu	37	20	31812986	31812986	+	Missense_Mutation	SNP	C	C	T	rs138661121	byFrequency	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr20:31812986C>T	ENST00000375454.3	+	4	679	c.469C>T	c.(469-471)Cgg>Tgg	p.R157W	BPIFA3_ENST00000490499.1_3'UTR|BPIFA3_ENST00000375452.3_Missense_Mutation_p.R121W	NM_178466.3	NP_848561.2	Q9BQP9	BPIA3_HUMAN	BPI fold containing family A, member 3	157						extracellular region (GO:0005576)	lipid binding (GO:0008289)	p.R157W(1)									CGAGTTTGGCCGGAGGGATCT	0.542																																					p.R157W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C469T	20						.	C	TRP/ARG,TRP/ARG	2,4404	4.2+/-10.8	0,2,2201	200.0	195.0	197.0		361,469	1.5	1.0	20	dbSNP_134	197	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense	BPIFA3	NM_001042439.1,NM_178466.3	101,101	0,4,6499	TT,TC,CC		0.0233,0.0454,0.0308	probably-damaging,probably-damaging	121/219,157/255	31812986	4,13002	2203	4300	6503	31276647	SO:0001583	missense	128861	exon4				CCDS13216.2, CCDS42865.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000131059	ENSG00000131059		"""BPI fold containing"""	16204	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 71"""	C20orf71		11971875, 21787333	Standard	XR_244132		Approved	bA49G10.4, SPLUNC3	uc002wyr.3	Q9BQP9	OTTHUMG00000032245	ENST00000375454.3:c.469C>T	20.37:g.31812986C>T	ENSP00000364603:p.Arg157Trp	Somatic		Capture	Illumina HiSeq	Phase_I	31276647	NM_178466	Q5JWG8|Q6NZ38	Missense_Mutation	SNP	ENST00000375454.3	37	CCDS13216.2	.	.	.	.	.	.	.	.	.	.	C	13.61	2.287664	0.40494	4.54E-4	2.33E-4	ENSG00000131059	ENST00000375454;ENST00000375452	T;T	0.08008	3.14;3.14	3.49	1.48	0.22813	.	0.000000	0.40640	N	0.001050	T	0.12050	0.0293	L	0.32530	0.975	0.29976	N	0.81815	D;D	0.69078	0.996;0.997	P;P	0.57620	0.73;0.824	T	0.03157	-1.1066	10	0.87932	D	0	-21.8512	8.3016	0.32017	0.4302:0.5698:0.0:0.0	.	121;157	Q9BQP9-2;Q9BQP9	.;BPIA3_HUMAN	W	157;121	ENSP00000364603:R157W;ENSP00000364601:R121W	ENSP00000364601:R121W	R	+	1	2	BPIFA3	31276647	1.000000	0.71417	1.000000	0.80357	0.294000	0.27393	1.655000	0.37345	0.427000	0.26145	-0.372000	0.07161	CGG		BPIFA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078672.1	NM_178466	
TSHZ2	128553	broad.mit.edu	37	20	51870953	51870953	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr20:51870953C>T	ENST00000371497.5	+	2	1843	c.956C>T	c.(955-957)cCg>cTg	p.P319L	RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000329613.6_Missense_Mutation_p.P316L|TSHZ2_ENST00000603338.2_Missense_Mutation_p.P316L	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	319					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P319L(1)		NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			ATGGTCACCCCGGCTAAGAAA	0.453																																					p.P319L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C956T	20						.						72.0	78.0	76.0					20																	51870953		2203	4300	6503	51304360	SO:0001583	missense	128553	exon2			AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.956C>T	20.37:g.51870953C>T	ENSP00000360552:p.Pro319Leu	Somatic		Capture	Illumina HiSeq	Phase_I	51304360	NM_173485	B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	SNP	ENST00000371497.5	37	CCDS33490.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.444395	0.83993	.	.	ENSG00000182463	ENST00000371497;ENST00000329613	T;T	0.14144	2.53;2.53	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.33962	0.0881	L	0.47716	1.5	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.00415	-1.1753	10	0.46703	T	0.11	-3.4814	20.0431	0.97598	0.0:1.0:0.0:0.0	.	319	Q9NRE2	TSH2_HUMAN	L	319;316	ENSP00000360552:P319L;ENSP00000333114:P316L	ENSP00000333114:P316L	P	+	2	0	TSHZ2	51304360	1.000000	0.71417	0.905000	0.35620	0.796000	0.44982	5.651000	0.67951	2.732000	0.93576	0.643000	0.83706	CCG		TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	NM_173485	
BAGE2	85319	broad.mit.edu	37	21	11097587	11097587	+	RNA	SNP	A	A	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr21:11097587A>T	ENST00000470054.1	-	0	282							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		agctcaccacaggggactcct	0.537																																					p.P25P												.	.	0			c.T75A	21						.						64.0	83.0	76.0					21																	11097587		1426	2584	4010	10119458			85319	exon2			AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11097587A>T		Somatic		Capture	Illumina HiSeq	Phase_I	10119458	NM_001187	A8K925|Q08ER0	Silent	SNP	ENST00000470054.1	37																																																																																					BAGE2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000157417.3	NM_182482	
SON	6651	broad.mit.edu	37	21	34927506	34927506	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr21:34927506G>A	ENST00000356577.4	+	3	6444	c.5969G>A	c.(5968-5970)cGt>cAt	p.R1990H	SON_ENST00000290239.6_Missense_Mutation_p.R1990H|SON_ENST00000381692.2_Intron|SON_ENST00000381679.4_Missense_Mutation_p.R1990H|SON_ENST00000300278.4_Missense_Mutation_p.R1990H	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	1990	2 X 19 AA repeats of P-S-R-R-R-R-S-R-S-V- V-R-R-R-S-F-S-I-S.|7 X 7 AA repeats of P-S-R-R-S-R-[TS].				cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.R1990H(2)		breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						acccctagccgtcggagccgc	0.692																																					p.R1990H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G5969A	21						.						35.0	37.0	37.0					21																	34927506		2200	4300	6500	33849376	SO:0001583	missense	6651	exon3			AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.5969G>A	21.37:g.34927506G>A	ENSP00000348984:p.Arg1990His	Somatic		Capture	Illumina HiSeq	Phase_I	33849376	NM_032195	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	ENST00000356577.4	37	CCDS13629.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.05|13.05	2.122634|2.122634	0.37436|0.37436	.|.	.|.	ENSG00000159140|ENSG00000159140	ENST00000356577;ENST00000290239;ENST00000300278;ENST00000381679;ENST00000421541|ENST00000436227	T;T;T;T|.	0.69806|.	-0.43;-0.43;-0.43;2.18|.	3.97|3.97	3.97|3.97	0.46021|0.46021	.|.	0.135299|.	0.34362|.	N|.	0.004026|.	T|T	0.37705|0.37705	0.1013|0.1013	N|N	0.08118|0.08118	0|0	0.41159|0.41159	D|D	0.986087|0.986087	D;D;D;D;D|.	0.89917|.	1.0;0.999;0.999;0.999;0.999|.	D;D;D;D;D|.	0.85130|.	0.997;0.987;0.994;0.994;0.994|.	T|T	0.22347|0.22347	-1.0219|-1.0219	10|5	0.52906|.	T|.	0.07|.	.|.	14.4355|14.4355	0.67277|0.67277	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1990;1990;1671;1990;1990|.	P18583-10;P18583;P18583-2;P18583-3;P18583-6|.	.;SON_HUMAN;.;.;.|.	H|I	1990;1990;1990;1990;51|985	ENSP00000348984:R1990H;ENSP00000290239:R1990H;ENSP00000300278:R1990H;ENSP00000371095:R1990H|.	ENSP00000290239:R1990H|.	R|V	+|+	2|1	0|0	SON|SON	33849376|33849376	0.955000|0.955000	0.32602|0.32602	0.690000|0.690000	0.30148|0.30148	0.675000|0.675000	0.39556|0.39556	0.000000|0.000000	0.12993|0.12993	2.551000|2.551000	0.86045|0.86045	0.650000|0.650000	0.86243|0.86243	CGT|GTC		SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927	
ERG	2078	broad.mit.edu	37	21	39755447	39755447	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr21:39755447C>T	ENST00000417133.2	-	12	1524	c.1339G>A	c.(1339-1341)Gtg>Atg	p.V447M	ERG_ENST00000453032.2_Missense_Mutation_p.V348M|ERG_ENST00000288319.7_Missense_Mutation_p.V440M|ERG_ENST00000442448.1_Missense_Mutation_p.V423M|ERG_ENST00000398911.1_Missense_Mutation_p.V423M|ERG_ENST00000398905.1_Missense_Mutation_p.V416M|ERG_ENST00000398897.1_Missense_Mutation_p.V324M|ERG_ENST00000398919.2_Missense_Mutation_p.V447M|ERG_ENST00000398907.1_Missense_Mutation_p.V417M|ERG_ENST00000398910.1_Missense_Mutation_p.V424M	NM_001136154.1|NM_001243432.1	NP_001129626.1|NP_001230361.1	Q12809	KCNH2_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog	0					cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)	p.V447M(1)	EWSR1/ERG(178)|NDRG1/ERG(5)|TMPRSS2/ERG(3582)|FUS/ERG(167)|SLC45A3/ERG(50)	lung(2)|ovary(1)|skin(1)	4		Prostate(19;3.6e-06)			Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	GAAGATGTCACGGGGAGGGCT	0.552			T	"""EWSR1, TMPRSS2, ELF4, FUS, HERPUD1, NDRG1"""	"""Ewing sarcoma, prostate, AML"""																																p.V447M	Esophageal Squamous(130;336 1700 3010 3083 40589)		Dom	yes		21	21q22.3	2078	v-ets erythroblastosis virus E26 oncogene like (avian)		"""M, E, L"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1339A	21						.						38.0	41.0	40.0					21																	39755447		2203	4300	6503	38677317	SO:0001583	missense	2078	exon12				CCDS13657.1, CCDS13658.1, CCDS46648.1, CCDS46649.1, CCDS58789.1	21q22.3	2013-07-09	2013-07-09		ENSG00000157554	ENSG00000157554			3446	protein-coding gene	gene with protein product	"""v-ets avian erythroblastosis virus E26 oncogene related"", ""transcriptional regulator ERG (transforming protein ERG)"", ""v-ets erythroblastosis virus E26 oncogene like"", ""TMPRSS2-ERG prostate cancer specific"""	165080	"""v-ets avian erythroblastosis virus E26 oncogene related"""			3274086	Standard	NM_001136154		Approved	erg-3, p55	uc002yxa.3	P11308	OTTHUMG00000090767	ENST00000417133.2:c.1339G>A	21.37:g.39755447C>T	ENSP00000414150:p.Val447Met	Somatic		Capture	Illumina HiSeq	Phase_I	38677317	NM_001136154	A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Missense_Mutation	SNP	ENST00000417133.2	37	CCDS46648.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.148736	0.78001	.	.	ENSG00000157554	ENST00000398905;ENST00000398907;ENST00000288319;ENST00000398897;ENST00000398911;ENST00000417133;ENST00000398910;ENST00000442448;ENST00000453032;ENST00000398919	T;T;T;T;T;T;T;T;T;T	0.55930	0.49;0.49;0.49;0.49;0.49;0.49;0.49;0.49;0.49;0.49	5.36	5.36	0.76844	.	0.059720	0.64402	D	0.000003	T	0.73753	0.3627	M	0.74258	2.255	0.80722	D	1	P;D;D;P	0.89917	0.895;1.0;1.0;0.878	P;D;D;B	0.76575	0.534;0.963;0.988;0.397	T	0.76096	-0.3084	10	0.62326	D	0.03	.	19.1122	0.93321	0.0:1.0:0.0:0.0	.	447;416;423;440	P11308;B5MDW0;P11308-1;P11308-4	ERG_HUMAN;.;.;.	M	416;417;440;324;423;447;424;423;348;447	ENSP00000381877:V416M;ENSP00000381879:V417M;ENSP00000288319:V440M;ENSP00000381871:V324M;ENSP00000381882:V423M;ENSP00000414150:V447M;ENSP00000381881:V424M;ENSP00000394694:V423M;ENSP00000396268:V348M;ENSP00000381891:V447M	ENSP00000288319:V440M	V	-	1	0	ERG	38677317	1.000000	0.71417	0.142000	0.22268	0.951000	0.60555	7.818000	0.86416	2.496000	0.84212	0.563000	0.77884	GTG		ERG-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207532.2	NM_182918	
SNTG2	54221	broad.mit.edu	37	2	1204809	1204809	+	Silent	SNP	G	G	A	rs201438117	byFrequency	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr2:1204809G>A	ENST00000308624.5	+	9	741	c.612G>A	c.(610-612)tcG>tcA	p.S204S	SNTG2_ENST00000407292.1_Silent_p.S77S|SNTG2_ENST00000467759.1_3'UTR	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	204					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)	p.S204S(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		CACCTTCCTCGCCCATAGCTA	0.582													G|||	2	0.000399361	0.0015	0.0	5008	,	,		17598	0.0		0.0	False		,,,				2504	0.0				p.S204S												.	.	2	Substitution - coding silent(2)	large_intestine(1)|pancreas(1)	c.G612A	2						.	G		8,4140		0,8,2066	78.0	85.0	83.0		612	2.1	1.0	2		83	1,8439		0,1,4219	no	coding-synonymous	SNTG2	NM_018968.3		0,9,6285	AA,AG,GG		0.0118,0.1929,0.0715		204/540	1204809	9,12579	2074	4220	6294	1194809	SO:0001819	synonymous_variant	54221	exon9			AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.612G>A	2.37:g.1204809G>A		Somatic		Capture	Illumina HiSeq	Phase_I	1194809	NM_018968	Q05AH5	Silent	SNP	ENST00000308624.5	37	CCDS46220.1																																																																																				SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322454.1	NM_018968	
KCNF1	3754	broad.mit.edu	37	2	11052695	11052695	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr2:11052695G>A	ENST00000295082.1	+	1	633	c.143G>A	c.(142-144)cGg>cAg	p.R48Q		NM_002236.4	NP_002227.2	Q9H3M0	KCNF1_HUMAN	potassium voltage-gated channel, subfamily F, member 1	48					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)	p.R48Q(1)		NS(1)|endometrium(2)|large_intestine(2)|lung(10)|ovary(2)|skin(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.128)		CCTGAGACCCGGCTGGCGGAG	0.627																																					p.R48Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G143A	2						.						23.0	26.0	25.0					2																	11052695		2203	4298	6501	10970146	SO:0001583	missense	3754	exon1			AF033382	CCDS1676.1	2p25	2011-07-05			ENSG00000162975	ENSG00000162975		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6246	protein-coding gene	gene with protein product		603787		KCNF		9434767, 16382104	Standard	NM_002236		Approved	Kv5.1, kH1, IK8	uc002rax.3	Q9H3M0	OTTHUMG00000119054	ENST00000295082.1:c.143G>A	2.37:g.11052695G>A	ENSP00000295082:p.Arg48Gln	Somatic		Capture	Illumina HiSeq	Phase_I	10970146	NM_002236	O43527|Q585L3	Missense_Mutation	SNP	ENST00000295082.1	37	CCDS1676.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.392692	0.83011	.	.	ENSG00000162975	ENST00000295082	D	0.94650	-3.48	5.07	5.07	0.68467	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	D	0.98046	0.9356	M	0.93283	3.4	0.52099	D	0.999947	D	0.89917	1.0	D	0.87578	0.998	D	0.98808	1.0742	10	0.62326	D	0.03	.	18.8206	0.92096	0.0:0.0:1.0:0.0	.	48	Q9H3M0	KCNF1_HUMAN	Q	48	ENSP00000295082:R48Q	ENSP00000295082:R48Q	R	+	2	0	KCNF1	10970146	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	7.823000	0.86660	2.509000	0.84616	0.563000	0.77884	CGG		KCNF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239265.1	NM_002236	
CD302	9936	broad.mit.edu	37	2	160628424	160628424	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr2:160628424A>G	ENST00000259053.4	-	6	680	c.637T>C	c.(637-639)Tat>Cat	p.Y213H	CD302_ENST00000429078.2_Missense_Mutation_p.Y155H|LY75_ENST00000554112.1_Missense_Mutation_p.Y1854H|CD302_ENST00000480212.1_5'UTR|LY75-CD302_ENST00000505052.1_Missense_Mutation_p.Y1798H|LY75_ENST00000553424.1_Missense_Mutation_p.Y1798H|LY75-CD302_ENST00000504764.1_Missense_Mutation_p.Y1854H	NM_001198764.1|NM_014880.4	NP_001185693.1|NP_055695.2	Q8IX05	CD302_HUMAN	CD302 molecule	213					phagocytosis (GO:0006909)	cell cortex (GO:0005938)|filopodium (GO:0030175)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)	p.Y213H(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|prostate(1)|skin(1)	11						TCTTCATTATAAGGTGATTGG	0.358																																					p.Y1798H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T5392C	2						.						95.0	95.0	95.0					2																	160628424		2203	4300	6503	160336670	SO:0001583	missense	4065	exon38			AY314007	CCDS33308.1, CCDS56139.1, CCDS74595.1	2q24.2	2011-08-30	2006-03-28		ENSG00000241399	ENSG00000241399		"""CD molecules"", ""C-type lectin domain containing"""	30843	protein-coding gene	gene with protein product	"""C-type lectin domain family 13, member A"""	612246	"""CD302 antigen"""			7584026, 7584028	Standard	NM_014880		Approved	DCL-1, KIAA0022, BIMLEC, CLEC13A		Q8IX05	OTTHUMG00000154080	ENST00000259053.4:c.637T>C	2.37:g.160628424A>G	ENSP00000259053:p.Tyr213His	Somatic		Capture	Illumina HiSeq	Phase_I	160336670	NM_001198760	A8K5G4|B4E2T9|Q15009	Missense_Mutation	SNP	ENST00000259053.4	37	CCDS33308.1	.	.	.	.	.	.	.	.	.	.	A	13.61	2.289424	0.40494	.	.	ENSG00000241399;ENSG00000241399;ENSG00000054219;ENSG00000054219;ENSG00000248672;ENSG00000248672	ENST00000259053;ENST00000429078;ENST00000554112;ENST00000553424;ENST00000504764;ENST00000505052	T;T;T;T;T;T	0.19532	3.26;2.14;2.97;2.98;2.97;2.98	5.44	4.29	0.51040	.	0.268407	0.30168	N	0.010242	T	0.22975	0.0555	L	0.32530	0.975	0.21933	N	0.99947	D;D;B;D	0.62365	0.991;0.974;0.01;0.965	P;P;B;P	0.59056	0.851;0.748;0.015;0.664	T	0.09443	-1.0674	10	0.16896	T	0.51	-18.5284	4.9397	0.13960	0.7507:0.0:0.0871:0.1622	.	155;1798;1854;213	B4E2T9;O60449-3;O60449-2;Q8IX05	.;.;.;CD302_HUMAN	H	213;155;1854;1798;1854;1798	ENSP00000259053:Y213H;ENSP00000394301:Y155H;ENSP00000451511:Y1854H;ENSP00000451446:Y1798H;ENSP00000423463:Y1854H;ENSP00000421035:Y1798H	ENSP00000259053:Y213H	Y	-	1	0	LY75;CD302;LY75-CD302	160336670	0.994000	0.37717	0.917000	0.36280	0.147000	0.21601	2.397000	0.44477	0.914000	0.36822	-0.334000	0.08254	TAT		CD302-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333760.1	NM_014880	
SCN1A	6323	broad.mit.edu	37	2	166848283	166848283	+	Silent	SNP	C	C	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr2:166848283C>T	ENST00000303395.4	-	26	5501	c.5502G>A	c.(5500-5502)gcG>gcA	p.A1834A	AC010127.3_ENST00000595647.1_RNA|AC010127.3_ENST00000597623.1_RNA|SCN1A_ENST00000375405.3_Silent_p.A1823A|SCN1A_ENST00000409050.1_Silent_p.A1806A|SCN1A_ENST00000423058.2_Silent_p.A1834A			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1834					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)	p.A1823A(1)		NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GCGGTTCAAGCGCAGCTGCAA	0.458																																					p.A1806A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G5418A	2						.						100.0	103.0	102.0					2																	166848283		2203	4300	6503	166556529	SO:0001819	synonymous_variant	6323	exon26			AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.5502G>A	2.37:g.166848283C>T		Somatic		Capture	Illumina HiSeq	Phase_I	166556529	NM_001165964	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Silent	SNP	ENST00000303395.4	37	CCDS54413.1																																																																																				SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920	
MYT1L	23040	broad.mit.edu	37	2	1926132	1926132	+	Missense_Mutation	SNP	G	G	A	rs376914980		TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr2:1926132G>A	ENST00000399161.2	-	10	2156	c.1409C>T	c.(1408-1410)cCg>cTg	p.P470L	MYT1L_ENST00000428368.2_Missense_Mutation_p.P470L	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	470					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.P470L(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		AAGTTGTCTCGGAGACTGGTC	0.483																																					p.P470L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1409T	2						.	G	LEU/PRO	0,3914		0,0,1957	161.0	154.0	156.0		1409	5.9	0.8	2		156	1,8297		0,1,4148	no	missense	MYT1L	NM_015025.2	98	0,1,6105	AA,AG,GG		0.0121,0.0,0.0082	possibly-damaging	470/1185	1926132	1,12211	1957	4149	6106	1905139	SO:0001583	missense	23040	exon10			AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.1409C>T	2.37:g.1926132G>A	ENSP00000382114:p.Pro470Leu	Somatic		Capture	Illumina HiSeq	Phase_I	1905139	NM_015025	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	ENST00000399161.2	37		.	.	.	.	.	.	.	.	.	.	G	2.386	-0.340914	0.05243	0.0	1.21E-4	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	T;T	0.43688	0.96;0.94	5.91	5.91	0.95273	.	0.105572	0.64402	D	0.000004	T	0.21427	0.0516	L	0.29908	0.895	0.58432	D	0.999997	P;P	0.44659	0.84;0.625	B;B	0.27500	0.036;0.08	T	0.24119	-1.0169	10	0.02654	T	1	-17.7358	13.4865	0.61369	0.0711:0.0:0.9289:0.0	.	470;470	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	L	470;418;470	ENSP00000382114:P470L;ENSP00000396103:P470L	ENSP00000295067:P418L	P	-	2	0	MYT1L	1905139	1.000000	0.71417	0.833000	0.33012	0.012000	0.07955	6.435000	0.73412	2.801000	0.96364	0.655000	0.94253	CCG		MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025	
TTN	7273	broad.mit.edu	37	2	179542574	179542574	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr2:179542574T>A	ENST00000591111.1	-	144	33338	c.33114A>T	c.(33112-33114)gaA>gaT	p.E11038D	TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.E11355D|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E10111D|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000589830.1_RNA			Q8WZ42	TITIN_HUMAN	titin	10178	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.E10111D(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAACAATTTCTTCTTCAAATA	0.413																																					p.E10111D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A30333T	2						.						87.0	86.0	86.0					2																	179542574		1837	4083	5920	179250819	SO:0001583	missense	7273	exon143			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.33114A>T	2.37:g.179542574T>A	ENSP00000465570:p.Glu11038Asp	Somatic		Capture	Illumina HiSeq	Phase_I	179250819	NM_133378	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	12.49	1.954913	0.34471	.	.	ENSG00000155657	ENST00000342992	T	0.67523	-0.27	5.2	4.06	0.47325	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.58308	0.2113	.	.	.	0.80722	D	1	B	0.15141	0.012	B	0.11329	0.006	T	0.60934	-0.7164	8	0.87932	D	0	.	11.6284	0.51160	0.0:0.0729:0.0:0.9271	.	11038	Q8WZ42	TITIN_HUMAN	D	10111	ENSP00000343764:E10111D	ENSP00000343764:E10111D	E	-	3	2	TTN	179250819	0.183000	0.23186	1.000000	0.80357	0.387000	0.30353	0.331000	0.19733	2.320000	0.78422	0.528000	0.53228	GAA		TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
HECW2	57520	broad.mit.edu	37	2	197122584	197122584	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr2:197122584G>A	ENST00000260983.3	-	18	3564	c.3382C>T	c.(3382-3384)Cgc>Tgc	p.R1128C	HECW2_ENST00000409111.1_Missense_Mutation_p.R772C|AC020571.3_ENST00000605907.1_RNA|AC020571.3_ENST00000430904.1_RNA|AC020571.3_ENST00000433933.1_RNA	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	1128					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.R1128C(1)		biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						CTTGAAAGGCGCACCAATCCT	0.413																																					p.R1128C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3382T	2						.						135.0	112.0	120.0					2																	197122584		2203	4300	6503	196830829	SO:0001583	missense	57520	exon18			AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.3382C>T	2.37:g.197122584G>A	ENSP00000260983:p.Arg1128Cys	Somatic		Capture	Illumina HiSeq	Phase_I	196830829	NM_020760	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	ENST00000260983.3	37	CCDS33354.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.586416	0.86851	.	.	ENSG00000138411	ENST00000409111;ENST00000260983	D;D	0.84223	-1.82;-1.82	5.55	5.55	0.83447	.	0.113524	0.64402	D	0.000010	D	0.90594	0.7051	M	0.71036	2.16	0.80722	D	1	D	0.89917	1.0	P	0.60117	0.869	D	0.91003	0.4844	10	0.72032	D	0.01	.	16.5241	0.84326	0.0:0.0:1.0:0.0	.	1128	Q9P2P5	HECW2_HUMAN	C	772;1128	ENSP00000386775:R772C;ENSP00000260983:R1128C	ENSP00000260983:R1128C	R	-	1	0	HECW2	196830829	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	4.604000	0.61112	2.890000	0.99128	0.585000	0.79938	CGC		HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3	NM_020760	
PAX3	5077	broad.mit.edu	37	2	223066812	223066812	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr2:223066812G>A	ENST00000350526.4	-	8	1407	c.1271C>T	c.(1270-1272)aCg>aTg	p.T424M	PAX3_ENST00000344493.4_Intron|PAX3_ENST00000336840.6_Intron|PAX3_ENST00000392069.2_Missense_Mutation_p.T424M|PAX3_ENST00000392070.2_Missense_Mutation_p.T424M|PAX3_ENST00000464706.1_5'UTR|PAX3_ENST00000409551.3_Missense_Mutation_p.T423M	NM_181457.3	NP_852122.1	P23760	PAX3_HUMAN	paired box 3	424					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|developmental pigmentation (GO:0048066)|heart development (GO:0007507)|mammary gland specification (GO:0060594)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|neuron fate commitment (GO:0048663)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of somitogenesis (GO:0014807)|sensory perception of sound (GO:0007605)|spinal cord association neuron differentiation (GO:0021527)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T424M(2)	PAX3/NCOA2(4)|PAX3/NCOA1(8)|PAX3/FOXO1(749)	NS(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(13)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	38		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGCCGACACCGTGGTGGTAGG	0.577			T	"""FOXO1A, NCOA1"""	alveolar rhabdomyosarcoma		Waardenburg syndrome; craniofacial-deafness-hand syndrome																														p.T423M			Dom	yes		2	2q35	5077	paired box gene 3	yes	M	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1268T	2						.						95.0	86.0	89.0					2																	223066812		2203	4300	6503	222775056	SO:0001583	missense	5077	exon8				CCDS2449.1, CCDS2450.1, CCDS2451.1, CCDS42825.1, CCDS2448.1, CCDS42826.1, CCDS46522.1, CCDS46523.1	2q36.1	2011-06-20	2007-07-12		ENSG00000135903	ENSG00000135903		"""Paired boxes"", ""Homeoboxes / PRD class"""	8617	protein-coding gene	gene with protein product		606597	"""Waardenburg syndrome 1"", ""paired box gene 3 (Waardenburg syndrome 1)"""	WS1		1347149	Standard	NM_181461		Approved	HUP2	uc002vmt.2	P23760	OTTHUMG00000133157	ENST00000350526.4:c.1271C>T	2.37:g.223066812G>A	ENSP00000343052:p.Thr424Met	Somatic		Capture	Illumina HiSeq	Phase_I	222775056	NM_001127366	G5E9C1|Q16448|Q494Z3|Q494Z4|Q53T90|Q6GSJ9|Q86UQ2|Q86UQ3	Missense_Mutation	SNP	ENST00000350526.4	37	CCDS42826.1	.	.	.	.	.	.	.	.	.	.	G	17.42	3.385618	0.61956	.	.	ENSG00000135903	ENST00000392069;ENST00000350526;ENST00000392070;ENST00000409551;ENST00000464706	D;D;D;D	0.94280	-3.38;-3.39;-3.36;-3.37	5.81	5.81	0.92471	.	0.000000	0.52532	D	0.000068	D	0.89406	0.6706	N	0.22421	0.69	0.80722	D	1	P;P;P	0.52577	0.863;0.606;0.954	B;B;B	0.41571	0.302;0.09;0.36	D	0.89552	0.3800	10	0.44086	T	0.13	.	20.0784	0.97758	0.0:0.0:1.0:0.0	.	424;423;424	P23760;Q494Z4;G5E9C1	PAX3_HUMAN;.;.	M	424;424;424;423;141	ENSP00000375921:T424M;ENSP00000343052:T424M;ENSP00000375922:T424M;ENSP00000386750:T423M	ENSP00000343052:T424M	T	-	2	0	PAX3	222775056	1.000000	0.71417	0.998000	0.56505	0.971000	0.66376	6.635000	0.74295	2.736000	0.93811	0.655000	0.94253	ACG		PAX3-006	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328670.1		
FAM124B	79843	broad.mit.edu	37	2	225265963	225265963	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr2:225265963C>T	ENST00000409685.3	-	1	788	c.523G>A	c.(523-525)Gtg>Atg	p.V175M	FAM124B_ENST00000389874.3_Missense_Mutation_p.V175M|FAM124B_ENST00000243806.2_Missense_Mutation_p.V175M	NM_001122779.1	NP_001116251.1	Q9H5Z6	F124B_HUMAN	family with sequence similarity 124B	175								p.V175M(2)		endometrium(2)|large_intestine(2)|lung(7)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	16		Renal(207;0.0112)|all_lung(227;0.0126)|Lung NSC(271;0.0161)|all_hematologic(139;0.138)		Epithelial(121;4.4e-10)|all cancers(144;2.02e-07)|Lung(261;0.00766)|LUSC - Lung squamous cell carcinoma(224;0.00825)		GCATAGAGCACGAAGAAACAA	0.498																																					p.V175M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G523A	2						.						80.0	74.0	76.0					2																	225265963		2203	4300	6503	224974207	SO:0001583	missense	79843	exon1			AK075126	CCDS2461.1, CCDS46527.1	2q36.2	2008-02-05			ENSG00000124019	ENSG00000124019			26224	protein-coding gene	gene with protein product						12477932	Standard	NM_001122779		Approved	FLJ22746	uc002vnx.3	Q9H5Z6	OTTHUMG00000133168	ENST00000409685.3:c.523G>A	2.37:g.225265963C>T	ENSP00000386895:p.Val175Met	Somatic		Capture	Illumina HiSeq	Phase_I	224974207	NM_001122779	A6NNC7|Q8NBZ4|Q8TAV7	Missense_Mutation	SNP	ENST00000409685.3	37	CCDS46527.1	.	.	.	.	.	.	.	.	.	.	C	14.54	2.566583	0.45694	.	.	ENSG00000124019	ENST00000389874;ENST00000409685;ENST00000243806	T;T;T	0.49720	0.77;0.77;0.77	5.64	4.77	0.60923	.	0.230727	0.44483	D	0.000448	T	0.67627	0.2913	M	0.77820	2.39	0.33336	D	0.569296	D;P	0.89917	1.0;0.951	D;B	0.63597	0.916;0.326	T	0.79315	-0.1854	10	0.52906	T	0.07	-9.1635	16.177	0.81858	0.1345:0.8655:0.0:0.0	.	175;175	Q9H5Z6;Q9H5Z6-2	F124B_HUMAN;.	M	175	ENSP00000374524:V175M;ENSP00000386895:V175M;ENSP00000243806:V175M	ENSP00000243806:V175M	V	-	1	0	FAM124B	224974207	0.041000	0.20044	0.977000	0.42913	0.175000	0.22909	1.625000	0.37029	1.397000	0.46682	-0.122000	0.15005	GTG		FAM124B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330873.1	NM_024785	
OXSR1	9943	broad.mit.edu	37	3	38232257	38232257	+	Silent	SNP	T	T	C			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr3:38232257T>C	ENST00000446845.1	+	3	591	c.219T>C	c.(217-219)ccT>ccC	p.P73P	OXSR1_ENST00000311806.3_Silent_p.P73P					oxidative stress responsive 1									p.P73P(1)		skin(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		GCCATCATCCTAATATTGTAT	0.353																																					p.P73P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T219C	3						.						110.0	99.0	103.0					3																	38232257		2203	4300	6503	38207261	SO:0001819	synonymous_variant	9943	exon3			AB017642	CCDS2675.1	3p22.2	2013-05-17	2013-05-17	2004-11-26	ENSG00000172939	ENSG00000172939			8508	protein-coding gene	gene with protein product		604046	"""oxidative-stress responsive 1"""	OSR1		10083736	Standard	XM_005265638		Approved	KIAA1101	uc003chy.3	O95747	OTTHUMG00000131084	ENST00000446845.1:c.219T>C	3.37:g.38232257T>C		Somatic		Capture	Illumina HiSeq	Phase_I	38207261	NM_005109		Silent	SNP	ENST00000446845.1	37																																																																																					OXSR1-004	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000342708.1	NM_005109	
LRIG1	26018	broad.mit.edu	37	3	66512865	66512865	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr3:66512865T>G	ENST00000273261.3	-	2	811	c.287A>C	c.(286-288)gAa>gCa	p.E96A	LRIG1_ENST00000383703.3_Missense_Mutation_p.E96A	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	96					innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)		p.E96A(1)		NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		GACTCACACTTCCTGTAGGTT	0.478																																					p.E96A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A287C	3						.						87.0	82.0	84.0					3																	66512865		2203	4300	6503	66595555	SO:0001583	missense	26018	exon2			AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.287A>C	3.37:g.66512865T>G	ENSP00000273261:p.Glu96Ala	Somatic		Capture	Illumina HiSeq	Phase_I	66595555	NM_015541	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	.	.	.	.	.	.	.	.	.	.	T	18.24	3.580169	0.65992	.	.	ENSG00000144749	ENST00000273261;ENST00000383703;ENST00000383702	T;T	0.58652	0.32;0.32	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.71525	0.3350	M	0.62154	1.92	0.49582	D	0.9998	P;D	0.59767	0.902;0.986	B;D	0.65323	0.419;0.934	T	0.72802	-0.4183	10	0.51188	T	0.08	.	14.645	0.68754	0.0:0.0:0.0:1.0	.	96;96	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	A	96;96;23	ENSP00000273261:E96A;ENSP00000373208:E96A	ENSP00000273261:E96A	E	-	2	0	LRIG1	66595555	1.000000	0.71417	1.000000	0.80357	0.455000	0.32408	5.494000	0.66905	2.197000	0.70478	0.460000	0.39030	GAA		LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
VGLL3	389136	broad.mit.edu	37	3	87018005	87018005	+	Silent	SNP	G	G	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr3:87018005G>A	ENST00000398399.2	-	3	1035	c.672C>T	c.(670-672)gaC>gaT	p.D224D	VGLL3_ENST00000383698.3_Silent_p.D224D	NM_016206.2	NP_057290.2			vestigial-like family member 3									p.D224D(2)		NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(11)	19	all_cancers(8;0.109)|Lung SC(3;0.184)	Lung NSC(201;0.0777)		LUSC - Lung squamous cell carcinoma(29;0.00241)|Lung(72;0.00712)		GCATGTACACGTCATGCATAT	0.602																																					p.D224D												.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.C672T	3						.						96.0	97.0	97.0					3																	87018005		2181	4282	6463	87100695	SO:0001819	synonymous_variant	389136	exon3			AF099505	CCDS43110.1	3p12.1	2014-03-03	2014-03-03		ENSG00000206538	ENSG00000206538			24327	protein-coding gene	gene with protein product		609980	"""vestigial like 3 (Drosophila)"""			12376544	Standard	NM_016206		Approved	VGL-3	uc003dqn.3	A8MV65	OTTHUMG00000158984	ENST00000398399.2:c.672C>T	3.37:g.87018005G>A		Somatic		Capture	Illumina HiSeq	Phase_I	87100695	NM_016206		Silent	SNP	ENST00000398399.2	37	CCDS43110.1	.	.	.	.	.	.	.	.	.	.	G	7.557	0.663861	0.14710	.	.	ENSG00000206538	ENST00000494229	.	.	.	5.81	-9.57	0.00562	.	.	.	.	.	T	0.65354	0.2683	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.74833	-0.3530	4	.	.	.	-9.4549	19.3942	0.94598	0.8233:0.0:0.1767:0.0	.	.	.	.	C	158	.	.	R	-	1	0	VGLL3	87100695	0.522000	0.26266	0.448000	0.26945	0.989000	0.77384	-0.083000	0.11286	-2.189000	0.00758	-0.409000	0.06214	CGT		VGLL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352805.1	NM_016206	
KIAA1524	57650	broad.mit.edu	37	3	108300986	108300986	+	Missense_Mutation	SNP	C	C	G	rs143117925		TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr3:108300986C>G	ENST00000295746.8	-	4	497	c.421G>C	c.(421-423)Gat>Cat	p.D141H	KIAA1524_ENST00000491772.1_5'UTR|KIAA1524_ENST00000487834.1_5'UTR	NM_020890.2	NP_065941.2	Q8TCG1	CIP2A_HUMAN	KIAA1524	141					positive regulation of neural precursor cell proliferation (GO:2000179)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.D141H(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(21)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						ATTAATTCATCTATATTGGCA	0.259																																					p.D141H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G421C	3						.						71.0	84.0	80.0					3																	108300986		2192	4278	6470	109783676	SO:0001583	missense	57650	exon4			AB040957	CCDS33812.1	3q13.13	2014-01-14			ENSG00000163507	ENSG00000163507			29302	protein-coding gene	gene with protein product	"""cancerous inhibitor of protein phosphatase 2A"""	610643				10819331, 24214971	Standard	NM_020890		Approved	CIP2A	uc003dxb.4	Q8TCG1	OTTHUMG00000159233	ENST00000295746.8:c.421G>C	3.37:g.108300986C>G	ENSP00000295746:p.Asp141His	Somatic		Capture	Illumina HiSeq	Phase_I	109783676	NM_020890	A1L4J7|B9EGC3|Q6P4G6|Q8WVP8|Q96PI2|Q9H9C6|Q9P204	Missense_Mutation	SNP	ENST00000295746.8	37	CCDS33812.1	.	.	.	.	.	.	.	.	.	.	C	15.69	2.908368	0.52333	.	.	ENSG00000163507	ENST00000295746	T	0.35421	1.31	5.52	2.74	0.32292	Armadillo-type fold (1);	0.244310	0.47852	D	0.000208	T	0.25791	0.0628	L	0.34521	1.04	0.40491	D	0.980547	B	0.16166	0.016	B	0.09377	0.004	T	0.07520	-1.0768	10	0.42905	T	0.14	-9.3496	10.1685	0.42895	0.0:0.786:0.0:0.214	.	141	Q8TCG1	CIP2A_HUMAN	H	141	ENSP00000295746:D141H	ENSP00000295746:D141H	D	-	1	0	KIAA1524	109783676	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.854000	0.39368	0.817000	0.34445	0.650000	0.86243	GAT		KIAA1524-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353975.2	NM_020890	
SEC24B	10427	broad.mit.edu	37	4	110415851	110415851	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr4:110415851T>C	ENST00000265175.5	+	6	1382	c.1327T>C	c.(1327-1329)Tca>Cca	p.S443P	SEC24B_ENST00000504968.2_Missense_Mutation_p.S474P|SEC24B_ENST00000399100.2_Missense_Mutation_p.S408P	NM_006323.2	NP_006314.2	O95487	SC24B_HUMAN	SEC24 family member B	443					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|aorta morphogenesis (GO:0035909)|auditory receptor cell stereocilium organization (GO:0060088)|cellular protein metabolic process (GO:0044267)|cochlear nucleus development (GO:0021747)|COPII vesicle coating (GO:0048208)|coronary artery morphogenesis (GO:0060982)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|lung lobe morphogenesis (GO:0060463)|membrane organization (GO:0061024)|neural tube closure (GO:0001843)|outflow tract morphogenesis (GO:0003151)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|pulmonary artery morphogenesis (GO:0061156)|regulation of cargo loading into COPII-coated vesicle (GO:1901301)|regulation of establishment of planar polarity involved in neural tube closure (GO:0090178)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|membrane (GO:0016020)	transporter activity (GO:0005215)|zinc ion binding (GO:0008270)	p.S408P(1)|p.S443P(1)		breast(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.03e-05)		AGCTCCAGCTTCAGCTCCAGC	0.502																																					p.S443P												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T1327C	4						.						102.0	110.0	107.0					4																	110415851		2161	4294	6455	110635300	SO:0001583	missense	10427	exon6			AJ131245	CCDS43260.1, CCDS47124.1, CCDS75179.1	4q25	2013-10-21	2013-10-21		ENSG00000138802	ENSG00000138802			10704	protein-coding gene	gene with protein product		607184	"""SEC24 (S. cerevisiae) related gene family, member B"", ""SEC24 family, member B (S. cerevisiae)"""			10075675, 10329445	Standard	XM_005262688		Approved		uc003hzk.3	O95487	OTTHUMG00000161372	ENST00000265175.5:c.1327T>C	4.37:g.110415851T>C	ENSP00000265175:p.Ser443Pro	Somatic		Capture	Illumina HiSeq	Phase_I	110635300	NM_006323	B7ZKM8|B7ZKN4|Q0VG08	Missense_Mutation	SNP	ENST00000265175.5	37	CCDS47124.1	.	.	.	.	.	.	.	.	.	.	T	0	-2.707777	0.00096	.	.	ENSG00000138802	ENST00000504968;ENST00000399100;ENST00000265175	T;T;T	0.79033	-1.05;-1.21;-1.23	1.45	-2.9	0.05648	.	6.086710	0.00883	N	0.002146	T	0.54013	0.1832	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.27594	0.0;0.0;0.182;0.0;0.0	B;B;B;B;B	0.14023	0.0;0.0;0.01;0.0;0.0	T	0.41998	-0.9477	10	0.23302	T	0.38	-0.0921	3.8946	0.09133	0.0:0.3163:0.3829:0.3008	.	358;42;474;408;443	B4DTM6;B4E2E1;B7ZKM8;O95487-2;O95487	.;.;.;.;SC24B_HUMAN	P	474;408;443	ENSP00000428564:S474P;ENSP00000382051:S408P;ENSP00000265175:S443P	ENSP00000265175:S443P	S	+	1	0	SEC24B	110635300	0.255000	0.24002	0.002000	0.10522	0.049000	0.14656	-0.108000	0.10857	-1.975000	0.00997	-1.237000	0.01550	TCA		SEC24B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364693.2		
GAB1	2549	broad.mit.edu	37	4	144336813	144336813	+	Missense_Mutation	SNP	G	G	T	rs374885566		TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr4:144336813G>T	ENST00000262994.4	+	2	558	c.256G>T	c.(256-258)Gat>Tat	p.D86Y	GAB1_ENST00000505913.1_5'UTR|GAB1_ENST00000262995.4_Missense_Mutation_p.D86Y	NM_002039.3	NP_002030.2	Q13480	GAB1_HUMAN	GRB2-associated binding protein 1	86	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				activation of JUN kinase activity (GO:0007257)|cell proliferation (GO:0008283)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis development (GO:0008544)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|interleukin-6-mediated signaling pathway (GO:0070102)|labyrinthine layer development (GO:0060711)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|regulation of cell migration (GO:0030334)|response to oxidative stress (GO:0006979)	cytosol (GO:0005829)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)	p.D86Y(1)		breast(3)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	30	all_hematologic(180;0.158)					CTACATTTTTGATATCAACAC	0.358																																					p.D86Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G256T	4						.	G	TYR/ASP,TYR/ASP	0,4406		0,0,2203	97.0	95.0	95.0		256,256	6.1	1.0	4		95	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	GAB1	NM_002039.3,NM_207123.2	160,160	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	86/695,86/725	144336813	1,13005	2203	4300	6503	144556263	SO:0001583	missense	2549	exon2			U43885	CCDS3759.1, CCDS3760.1	4q31.1	2013-01-10			ENSG00000109458	ENSG00000109458		"""Pleckstrin homology (PH) domain containing"""	4066	protein-coding gene	gene with protein product		604439				8596638	Standard	NM_207123		Approved		uc003ijd.3	Q13480	OTTHUMG00000161432	ENST00000262994.4:c.256G>T	4.37:g.144336813G>T	ENSP00000262994:p.Asp86Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	144556263	NM_207123	A8K152|Q4W5G2|Q6P1W2	Missense_Mutation	SNP	ENST00000262994.4	37	CCDS3759.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.645519	0.87859	0.0	1.16E-4	ENSG00000109458	ENST00000262995;ENST00000262994;ENST00000514639;ENST00000509992	T;T;T;T	0.75477	-0.94;-0.94;-0.94;-0.94	6.07	6.07	0.98685	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.043789	0.85682	N	0.000000	D	0.87993	0.6318	M	0.79805	2.47	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87991	0.2749	10	0.87932	D	0	-19.9316	20.6593	0.99626	0.0:0.0:1.0:0.0	.	86;86	Q13480;Q13480-2	GAB1_HUMAN;.	Y	86;86;86;65	ENSP00000262995:D86Y;ENSP00000262994:D86Y;ENSP00000427435:D86Y;ENSP00000425921:D65Y	ENSP00000262994:D86Y	D	+	1	0	GAB1	144556263	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.771000	0.98977	2.885000	0.99019	0.655000	0.94253	GAT		GAB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364998.1	NM_002039	
KCNIP4	80333	broad.mit.edu	37	4	20736356	20736356	+	Silent	SNP	A	A	G			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr4:20736356A>G	ENST00000382152.2	-	6	599	c.432T>C	c.(430-432)gaT>gaC	p.D144D	KCNIP4_ENST00000359001.5_Silent_p.D82D|KCNIP4_ENST00000447367.2_Silent_p.D110D|KCNIP4_ENST00000382149.4_5'UTR|KCNIP4_ENST00000382148.3_Silent_p.D119D|KCNIP4_ENST00000382150.4_Silent_p.D123D|KCNIP4_ENST00000509207.1_Silent_p.D82D|PACRGL_ENST00000507634.1_Intron	NM_025221.5	NP_079497.2	Q6PIL6	KCIP4_HUMAN	Kv channel interacting protein 4	144	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.					dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)	p.D110D(1)|p.D123D(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13		Breast(46;0.134)				CTTTGATGAAATCCTGAAAAG	0.308																																					p.D82D												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T246C	4						.						85.0	90.0	88.0					4																	20736356		2203	4300	6503	20345454	SO:0001819	synonymous_variant	80333	exon5			AF453244	CCDS3428.1, CCDS43215.1, CCDS43216.1, CCDS43217.1, CCDS47035.1	4p15.32	2013-01-10			ENSG00000185774	ENSG00000185774		"""EF-hand domain containing"""	30083	protein-coding gene	gene with protein product		608182				11805342, 11847232	Standard	XM_005248190		Approved	CALP, KCHIP4, MGC44947	uc003gqh.1	Q6PIL6	OTTHUMG00000128557	ENST00000382152.2:c.432T>C	4.37:g.20736356A>G		Somatic		Capture	Illumina HiSeq	Phase_I	20345454	NM_001035004	Q3YAB8|Q3YAB9|Q3YAC0|Q3YAC1|Q3YAC2|Q4W5G8|Q8NEU0|Q9BWT2|Q9H294|Q9H2A4	Silent	SNP	ENST00000382152.2	37	CCDS43216.1																																																																																				KCNIP4-004	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000360407.3	NM_025221	
ENAM	10117	broad.mit.edu	37	4	71508245	71508245	+	Missense_Mutation	SNP	C	C	T	rs529994198		TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr4:71508245C>T	ENST00000396073.3	+	9	1383	c.1102C>T	c.(1102-1104)Cgt>Tgt	p.R368C	ENAM_ENST00000472903.1_Intron	NM_031889.2	NP_114095.2	Q9NRM1	ENAM_HUMAN	enamelin	368					amelogenesis (GO:0097186)|biomineral tissue development (GO:0031214)	proteinaceous extracellular matrix (GO:0005578)		p.R368C(1)		haematopoietic_and_lymphoid_tissue(1)|ovary(3)|upper_aerodigestive_tract(2)	6			Lung(101;0.235)			TGCTTGGGAACGTAAACAAGT	0.433													G|||	1	0.000199681	0.0	0.0	5008	,	,		18187	0.001		0.0	False		,,,				2504	0.0				p.R368C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1102T	4						.						106.0	110.0	109.0					4																	71508245		2203	4300	6503	71727109	SO:0001583	missense	10117	exon9			AF125373	CCDS3544.2	4q13.3	2008-02-05			ENSG00000132464	ENSG00000132464			3344	protein-coding gene	gene with protein product		606585	"""amelogenesis imperfecta 2, hypocalcification (autosomal dominant)"""	AIH2		11978766	Standard	NM_031889		Approved		uc011caw.1	Q9NRM1	OTTHUMG00000129914	ENST00000396073.3:c.1102C>T	4.37:g.71508245C>T	ENSP00000379383:p.Arg368Cys	Somatic		Capture	Illumina HiSeq	Phase_I	71727109	NM_031889	Q17RI5|Q9H3D1	Missense_Mutation	SNP	ENST00000396073.3	37	CCDS3544.2	.	.	.	.	.	.	.	.	.	.	G	17.56	3.420883	0.62622	.	.	ENSG00000132464	ENST00000396073	T	0.30182	1.54	5.8	-6.09	0.02145	.	1.115670	0.06635	N	0.760050	T	0.22936	0.0554	N	0.22421	0.69	0.09310	N	1	P	0.52170	0.951	P	0.47162	0.54	T	0.39722	-0.9600	10	0.72032	D	0.01	4.5361	8.6354	0.33945	0.2122:0.2174:0.5704:0.0	.	368	Q9NRM1	ENAM_HUMAN	C	368	ENSP00000379383:R368C	ENSP00000379383:R368C	R	+	1	0	ENAM	71727109	0.898000	0.30612	0.043000	0.18650	0.004000	0.04260	0.167000	0.16602	-1.647000	0.01511	-1.315000	0.01301	CGT		ENAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252166.3	NM_031889	
CCDC158	339965	broad.mit.edu	37	4	77288486	77288486	+	Silent	SNP	T	T	C			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr4:77288486T>C	ENST00000388914.3	-	11	1943	c.1791A>G	c.(1789-1791)aaA>aaG	p.K597K		NM_001042784.1	NP_001036249.1	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	597								p.K597K(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(1)	56						CATTAATTTCTTTCTCCAGTT	0.413																																					p.K597K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1791G	4						.						110.0	105.0	107.0					4																	77288486		1863	4098	5961	77507510	SO:0001819	synonymous_variant	339965	exon11			BC035224	CCDS43242.1	4q21.1	2009-04-06			ENSG00000163749	ENSG00000163749			26374	protein-coding gene	gene with protein product						12477932	Standard	NM_001042784		Approved	FLJ25770	uc003hkb.4	Q5M9N0	OTTHUMG00000160916	ENST00000388914.3:c.1791A>G	4.37:g.77288486T>C		Somatic		Capture	Illumina HiSeq	Phase_I	77507510	NM_001042784	Q8IYQ1|Q8N7D4|Q8N7E3	Silent	SNP	ENST00000388914.3	37	CCDS43242.1																																																																																				CCDC158-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362694.2	NM_001042784	
LRAT	9227	broad.mit.edu	37	4	155665684	155665684	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr4:155665684G>A	ENST00000336356.3	+	2	459	c.206G>A	c.(205-207)cGt>cAt	p.R69H	LRAT_ENST00000507827.1_Missense_Mutation_p.R69H	NM_004744.3	NP_004735.2	O95237	LRAT_HUMAN	lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase)	69					phototransduction, visible light (GO:0007603)|retinoic acid metabolic process (GO:0042573)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|visual perception (GO:0007601)|vitamin A metabolic process (GO:0006776)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|perinuclear region of cytoplasm (GO:0048471)|rough endoplasmic reticulum (GO:0005791)	phosphatidylcholine-retinol O-acyltransferase activity (GO:0047173)|retinoic acid binding (GO:0001972)|retinol binding (GO:0019841)|transferase activity, transferring acyl groups (GO:0016746)	p.R69H(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)	16	all_hematologic(180;0.215)	Renal(120;0.0458)			Vitamin A(DB00162)	GGAGACAACCGTGTTGCCCAC	0.572																																					p.R69H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G206A	4						.						93.0	89.0	90.0					4																	155665684		2203	4300	6503	155885134	SO:0001583	missense	9227	exon2			AF071510	CCDS3789.1	4q32.1	2014-01-28			ENSG00000121207	ENSG00000121207	2.3.1.135		6685	protein-coding gene	gene with protein product		604863				9920938	Standard	XM_006714412		Approved	LCA14	uc003ion.1	O95237	OTTHUMG00000161418	ENST00000336356.3:c.206G>A	4.37:g.155665684G>A	ENSP00000337224:p.Arg69His	Somatic		Capture	Illumina HiSeq	Phase_I	155885134	NM_004744	A8K983|Q8N716	Missense_Mutation	SNP	ENST00000336356.3	37	CCDS3789.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.029100	0.75504	.	.	ENSG00000121207	ENST00000502525;ENST00000507827;ENST00000336356	T;T	0.22539	1.95;1.95	4.87	2.98	0.34508	.	0.260810	0.32503	N	0.006006	T	0.43567	0.1253	M	0.89287	3.02	0.44492	D	0.997431	D	0.76494	0.999	D	0.63488	0.915	T	0.45396	-0.9264	10	0.22109	T	0.4	-0.3691	9.119	0.36775	0.2513:0.0:0.7487:0.0	.	69	O95237	LRAT_HUMAN	H	69	ENSP00000426761:R69H;ENSP00000337224:R69H	ENSP00000337224:R69H	R	+	2	0	LRAT	155885134	0.991000	0.36638	0.994000	0.49952	0.950000	0.60333	2.198000	0.42705	1.266000	0.44231	0.655000	0.94253	CGT		LRAT-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365246.1	NM_004744	
PCDHB16	57717	broad.mit.edu	37	5	140564291	140564291	+	Silent	SNP	G	G	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr5:140564291G>A	ENST00000361016.2	+	1	3312	c.2157G>A	c.(2155-2157)gcG>gcA	p.A719A		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	719					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A719A(1)		breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGAGCAGGGCGGCCTCGGTGG	0.662																																					p.A719A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2157A	5						.						64.0	75.0	71.0					5																	140564291		2200	4298	6498	140544475	SO:0001819	synonymous_variant	57717	exon1			AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.2157G>A	5.37:g.140564291G>A		Somatic		Capture	Illumina HiSeq	Phase_I	140544475	NM_020957	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Silent	SNP	ENST00000361016.2	37	CCDS4251.1																																																																																				PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957	
PCDHB13	56123	broad.mit.edu	37	5	140595222	140595222	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr5:140595222C>G	ENST00000341948.4	+	1	1714	c.1527C>G	c.(1525-1527)gaC>gaG	p.D509E		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	509	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D509E(1)		NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCAACGCGGACAACGGCCACC	0.672																																					p.D509E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1527G	5						.						110.0	115.0	113.0					5																	140595222		2203	4300	6503	140575406	SO:0001583	missense	56123	exon1			AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.1527C>G	5.37:g.140595222C>G	ENSP00000345491:p.Asp509Glu	Somatic		Capture	Illumina HiSeq	Phase_I	140575406	NM_018933	A8K9V6	Missense_Mutation	SNP	ENST00000341948.4	37	CCDS4255.1	.	.	.	.	.	.	.	.	.	.	N	13.62	2.290790	0.40494	.	.	ENSG00000187372	ENST00000341948;ENST00000430318	T	0.50548	0.74	3.42	3.42	0.39159	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.43612	0.1255	N	0.11313	0.125	0.31360	N	0.681438	P	0.52061	0.95	D	0.64410	0.925	T	0.45056	-0.9287	9	0.54805	T	0.06	.	6.5795	0.22585	0.259:0.576:0.165:0.0	.	509	Q9Y5F0	PCDBD_HUMAN	E	509	ENSP00000345491:D509E	ENSP00000345491:D509E	D	+	3	2	PCDHB13	140575406	0.002000	0.14202	0.075000	0.20258	0.005000	0.04900	-1.537000	0.02206	1.644000	0.50603	0.449000	0.29647	GAC		PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251810.1	NM_018933	
PCDHGB4	8641	broad.mit.edu	37	5	140769357	140769357	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr5:140769357G>A	ENST00000519479.1	+	1	1906	c.1906G>A	c.(1906-1908)Gtc>Atc	p.V636I	PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_003736.2|NM_018925.2|NM_032098.1	NP_003727.1|NP_061748.1|NP_115269.1	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4	636	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V636I(1)		endometrium(9)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(2)	37			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGGGACGCCGTCCGCCAGCG	0.692																																					p.V636I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1906A	5						.						42.0	46.0	44.0					5																	140769357		2113	4217	6330	140749541	SO:0001583	missense	8641	exon1			AF152520	CCDS54928.1, CCDS75337.1	5q31	2010-01-26				ENSG00000253953		"""Cadherins / Protocadherins : Clustered"""	8711	other	protocadherin	"""fibroblast cadherin FIB2"", ""cadherin 20"""	603058				10380929	Standard	NM_003736		Approved	FIB2, CDH20, PCDH-GAMMA-B4		Q9UN71		ENST00000519479.1:c.1906G>A	5.37:g.140769357G>A	ENSP00000428288:p.Val636Ile	Somatic		Capture	Illumina HiSeq	Phase_I	140749541	NM_032098	O15099|Q2M267|Q9UN64	Missense_Mutation	SNP	ENST00000519479.1	37	CCDS54928.1	.	.	.	.	.	.	.	.	.	.	.	5.454	0.268819	0.10349	.	.	ENSG00000253953	ENST00000519479	T	0.51325	0.71	5.05	0.293	0.15742	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.31918	0.0812	L	0.38531	1.155	0.09310	N	1	B;B	0.32425	0.32;0.371	B;B	0.33568	0.103;0.166	T	0.20371	-1.0277	9	0.20519	T	0.43	.	5.0658	0.14582	0.0763:0.0981:0.4026:0.423	.	636;636	Q9UN71-2;Q9UN71	.;PCDGG_HUMAN	I	636	ENSP00000428288:V636I	ENSP00000428288:V636I	V	+	1	0	PCDHGB4	140749541	0.000000	0.05858	0.429000	0.26710	0.023000	0.10783	-0.190000	0.09615	0.222000	0.20900	0.563000	0.77884	GTC		PCDHGB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374745.1	NM_003736	
PCDHGC5	56097	broad.mit.edu	37	5	140869389	140869389	+	Silent	SNP	G	G	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr5:140869389G>T	ENST00000252087.1	+	1	582	c.582G>T	c.(580-582)ctG>ctT	p.L194L	PCDHGB1_ENST00000523390.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGC4_ENST00000306593.1_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018929.2|NM_032403.2|NM_032407.1	NP_061752.1|NP_115779.1|NP_115783.1	Q9Y5F6	PCDGM_HUMAN	protocadherin gamma subfamily C, 5	194	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L194L(2)		breast(2)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(4)|lung(10)|ovary(4)|prostate(1)|urinary_tract(2)	35			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCCAGAGCTGGTGCTAGAGC	0.552																																					p.L194L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G582T	5						.						51.0	55.0	54.0					5																	140869389		2203	4300	6503	140849573	SO:0001819	synonymous_variant	56097	exon1			AF152526	CCDS4263.1, CCDS75350.1	5q31	2010-01-26			ENSG00000240764	ENSG00000240764		"""Cadherins / Protocadherins : Clustered"""	8718	other	protocadherin		606306				10380929	Standard	NM_018929		Approved	PCDH-GAMMA-C5	uc003lla.2	Q9Y5F6	OTTHUMG00000129624	ENST00000252087.1:c.582G>T	5.37:g.140869389G>T		Somatic		Capture	Illumina HiSeq	Phase_I	140849573	NM_018929	Q9Y5C2	Silent	SNP	ENST00000252087.1	37	CCDS4263.1																																																																																				PCDHGC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251819.1	NM_018929	
CCNG1	900	broad.mit.edu	37	5	162866419	162866419	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr5:162866419G>A	ENST00000340828.2	+	2	381	c.157G>A	c.(157-159)Gac>Aac	p.D53N	CCNG1_ENST00000510664.1_Intron|RP11-541P9.3_ENST00000503504.1_RNA|CCNG1_ENST00000504553.1_5'Flank|CCNG1_ENST00000393929.1_Missense_Mutation_p.D53N|CCNG1_ENST00000512163.1_Intron|CCNG1_ENST00000511683.2_Intron|RP11-541P9.3_ENST00000458002.2_RNA	NM_004060.3	NP_004051.1	P51959	CCNG1_HUMAN	cyclin G1	53					brain development (GO:0007420)|cell growth (GO:0016049)|mitotic G2 DNA damage checkpoint (GO:0007095)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to organonitrogen compound (GO:0010243)|syncytium formation (GO:0006949)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)		p.D53N(1)		autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|prostate(2)	12	Renal(175;0.000281)	Medulloblastoma(196;0.00853)|all_neural(177;0.0408)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0597)|OV - Ovarian serous cystadenocarcinoma(192;0.107)|Epithelial(171;0.164)		AAGACTAAGGGACTTTGAAGT	0.418																																					p.D53N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G157A	5						.						126.0	120.0	122.0					5																	162866419		2203	4300	6503	162798997	SO:0001583	missense	900	exon2			D78341	CCDS4360.1	5q32-q34	2010-11-15			ENSG00000113328	ENSG00000113328			1592	protein-coding gene	gene with protein product		601578		CCNG		8954786, 8806701	Standard	NM_004060		Approved		uc003lzb.3	P51959	OTTHUMG00000130380	ENST00000340828.2:c.157G>A	5.37:g.162866419G>A	ENSP00000344635:p.Asp53Asn	Somatic		Capture	Illumina HiSeq	Phase_I	162798997	NM_004060	B2R7B2|B4DLW7|D3DQK7|Q15757|Q96L32	Missense_Mutation	SNP	ENST00000340828.2	37	CCDS4360.1	.	.	.	.	.	.	.	.	.	.	G	15.42	2.828551	0.50845	.	.	ENSG00000113328	ENST00000393929;ENST00000340828;ENST00000510097;ENST00000511490	T;T;T;T	0.11385	2.78;2.78;2.78;2.78	5.01	5.01	0.66863	Cyclin, N-terminal (1);Cyclin-like (2);	0.043813	0.85682	D	0.000000	T	0.12518	0.0304	L	0.42581	1.335	0.80722	D	1	B	0.25351	0.124	B	0.25759	0.063	T	0.09314	-1.0680	10	0.25751	T	0.34	-11.858	18.3492	0.90331	0.0:0.0:1.0:0.0	.	53	P51959	CCNG1_HUMAN	N	53	ENSP00000377506:D53N;ENSP00000344635:D53N;ENSP00000423791:D53N;ENSP00000421132:D53N	ENSP00000344635:D53N	D	+	1	0	CCNG1	162798997	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.478000	0.81082	2.332000	0.79248	0.467000	0.42956	GAC		CCNG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252750.3	NM_004060	
CPEB4	80315	broad.mit.edu	37	5	173317698	173317698	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr5:173317698T>C	ENST00000265085.5	+	1	2416	c.962T>C	c.(961-963)cTg>cCg	p.L321P	CPEB4_ENST00000517880.1_5'Flank|CPEB4_ENST00000334035.5_Missense_Mutation_p.L321P|CPEB4_ENST00000519835.1_Missense_Mutation_p.L321P|CPEB4_ENST00000520867.1_Missense_Mutation_p.L321P|CPEB4_ENST00000522336.1_5'Flank	NM_030627.2	NP_085130.2	Q17RY0	CPEB4_HUMAN	cytoplasmic polyadenylation element binding protein 4	321					cellular response to amino acid stimulus (GO:0071230)|cellular response to decreased oxygen levels (GO:0036294)|cellular response to glucose starvation (GO:0042149)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|response to ischemia (GO:0002931)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.L321P(1)		NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	20	Renal(175;0.000159)|Lung NSC(126;0.0128)|all_lung(126;0.0202)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			CGCAGAGGGCTGAATGGTGGA	0.562																																					p.L321P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T962C	5						.						68.0	69.0	69.0					5																	173317698		2203	4300	6503	173250304	SO:0001583	missense	80315	exon1			BX538213	CCDS4390.1	5q21	2013-02-12			ENSG00000113742	ENSG00000113742		"""RNA binding motif (RRM) containing"""	21747	protein-coding gene	gene with protein product		610607				11214970, 12672660	Standard	NM_030627		Approved	KIAA1673	uc003mcs.4	Q17RY0	OTTHUMG00000130541	ENST00000265085.5:c.962T>C	5.37:g.173317698T>C	ENSP00000265085:p.Leu321Pro	Somatic		Capture	Illumina HiSeq	Phase_I	173250304	NM_030627	B7ZLQ7|Q7Z310|Q8N405|Q9C0J0	Missense_Mutation	SNP	ENST00000265085.5	37	CCDS4390.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.98|16.98	3.271457|3.271457	0.59649|0.59649	.|.	.|.	ENSG00000113742|ENSG00000113742	ENST00000265085;ENST00000520867;ENST00000334035;ENST00000519835|ENST00000519152	T;T;T;T|.	0.49720|.	0.82;0.78;0.8;0.77|.	5.33|5.33	5.33|5.33	0.75918|0.75918	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.61060|.	0.2317|.	L|L	0.44542|0.44542	1.39|1.39	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.65815|.	0.985;0.991;0.995;0.985|.	P;P;P;P|.	0.61592|.	0.781;0.891;0.806;0.781|.	T|.	0.58393|.	-0.7644|.	10|.	0.33141|.	T|.	0.24|.	-7.8019|-7.8019	15.295|15.295	0.73898|0.73898	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	321;321;321;321|.	B7ZLQ8;Q17RY0-2;E5RJM0;Q17RY0|.	.;.;.;CPEB4_HUMAN|.	P|R	321|7	ENSP00000265085:L321P;ENSP00000429092:L321P;ENSP00000334533:L321P;ENSP00000429048:L321P|.	ENSP00000265085:L321P|.	L|X	+|+	2|1	0|0	CPEB4|CPEB4	173250304|173250304	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	5.046000|5.046000	0.64226|0.64226	2.019000|2.019000	0.59389|0.59389	0.455000|0.455000	0.32223|0.32223	CTG|TGA		CPEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252964.2	NM_030627	
ADAMTS16	170690	broad.mit.edu	37	5	5209265	5209265	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr5:5209265C>A	ENST00000274181.7	+	10	1649	c.1511C>A	c.(1510-1512)cCt>cAt	p.P504H	ADAMTS16_ENST00000511368.1_Missense_Mutation_p.P504H	NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	504	Disintegrin.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.P504H(2)		breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						TACAAGTATCCTGAGAAATTG	0.463																																					p.P504H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1511A	5						.						147.0	144.0	145.0					5																	5209265		1902	4138	6040	5262265	SO:0001583	missense	170690	exon10			AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.1511C>A	5.37:g.5209265C>A	ENSP00000274181:p.Pro504His	Somatic		Capture	Illumina HiSeq	Phase_I	5262265	NM_139056	C6G490|Q8IVE2	Missense_Mutation	SNP	ENST00000274181.7	37	CCDS43299.1	.	.	.	.	.	.	.	.	.	.	C	18.38	3.611106	0.66558	.	.	ENSG00000145536	ENST00000274181;ENST00000511368;ENST00000536857	T;T	0.11385	2.78;2.78	5.9	5.9	0.94986	Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.39809	0.1092	M	0.84219	2.685	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.996	T	0.18335	-1.0340	10	0.87932	D	0	.	19.0504	0.93041	0.0:1.0:0.0:0.0	.	504;504;504	Q8TE57;Q8TE57-2;Q2XQZ0	ATS16_HUMAN;.;.	H	504	ENSP00000274181:P504H;ENSP00000421631:P504H	ENSP00000274181:P504H	P	+	2	0	ADAMTS16	5262265	1.000000	0.71417	0.881000	0.34555	0.222000	0.24845	6.856000	0.75450	2.788000	0.95919	0.650000	0.86243	CCT		ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056	
RICTOR	253260	broad.mit.edu	37	5	38968110	38968110	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr5:38968110T>C	ENST00000357387.3	-	12	1025	c.995A>G	c.(994-996)tAt>tGt	p.Y332C	RICTOR_ENST00000296782.5_Missense_Mutation_p.Y332C	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2									p.Y332C(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					AAATATATCATAAAGCACTTC	0.308																																					p.Y332C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A995G	5						.						100.0	97.0	98.0					5																	38968110		2203	4299	6502	39003867	SO:0001583	missense	253260	exon12				CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.995A>G	5.37:g.38968110T>C	ENSP00000349959:p.Tyr332Cys	Somatic		Capture	Illumina HiSeq	Phase_I	39003867	NM_152756		Missense_Mutation	SNP	ENST00000357387.3	37	CCDS34148.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.296006	0.81025	.	.	ENSG00000164327	ENST00000357387;ENST00000296782	T;T	0.64438	-0.1;-0.1	5.49	5.49	0.81192	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.75606	0.3872	L	0.54323	1.7	0.80722	D	1	P;D	0.89917	0.928;1.0	P;D	0.85130	0.642;0.997	T	0.78221	-0.2288	10	0.87932	D	0	-15.0702	15.5946	0.76569	0.0:0.0:0.0:1.0	.	332;332	Q6R327;Q6R327-3	RICTR_HUMAN;.	C	332	ENSP00000349959:Y332C;ENSP00000296782:Y332C	ENSP00000296782:Y332C	Y	-	2	0	RICTOR	39003867	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.297000	0.78799	2.083000	0.62718	0.533000	0.62120	TAT		RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366985.1	NM_152756	
TMEM171	134285	broad.mit.edu	37	5	72419519	72419519	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr5:72419519C>T	ENST00000454765.2	+	2	792	c.319C>T	c.(319-321)Cgc>Tgc	p.R107C	TMEM171_ENST00000287773.5_Missense_Mutation_p.R107C			Q8WVE6	TM171_HUMAN	transmembrane protein 171	107						integral component of membrane (GO:0016021)		p.R107C(1)		endometrium(5)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|stomach(1)	15		Lung NSC(167;0.0378)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;1.87e-54)|Lung(70;0.115)		TGGAGAGAGCCGCCAGTTTGC	0.602																																					p.R107C	NSCLC(112;638 2280 27369 30736)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C319T	5						.						85.0	89.0	87.0					5																	72419519		2203	4300	6503	72455275	SO:0001583	missense	134285	exon2			BC018083	CCDS4017.1, CCDS54869.1	5q13.2	2008-02-05			ENSG00000157111	ENSG00000157111			27031	protein-coding gene	gene with protein product						12477932	Standard	NM_173490		Approved	PRP2	uc003kcm.2	Q8WVE6	OTTHUMG00000131269	ENST00000454765.2:c.319C>T	5.37:g.72419519C>T	ENSP00000415030:p.Arg107Cys	Somatic		Capture	Illumina HiSeq	Phase_I	72455275	NM_173490	Q8N0S1|Q8TDT7	Missense_Mutation	SNP	ENST00000454765.2	37	CCDS4017.1	.	.	.	.	.	.	.	.	.	.	C	16.71	3.199044	0.58126	.	.	ENSG00000157111	ENST00000454765;ENST00000287773	T;T	0.26223	1.75;1.75	5.35	5.35	0.76521	.	0.078054	0.53938	D	0.000041	T	0.15478	0.0373	N	0.24115	0.695	0.54753	D	0.999982	P;P	0.47034	0.889;0.889	B;B	0.37692	0.256;0.256	T	0.02226	-1.1192	10	0.36615	T	0.2	-19.4858	10.2472	0.43347	0.0:0.8783:0.0:0.1217	.	107;107	Q8WVE6-2;Q8WVE6	.;TM171_HUMAN	C	107	ENSP00000415030:R107C;ENSP00000287773:R107C	ENSP00000287773:R107C	R	+	1	0	TMEM171	72455275	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	2.429000	0.44758	2.512000	0.84698	0.462000	0.41574	CGC		TMEM171-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254037.2	NM_173490	
THBS4	7060	broad.mit.edu	37	5	79368129	79368129	+	Silent	SNP	A	A	G			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr5:79368129A>G	ENST00000350881.2	+	14	1939	c.1749A>G	c.(1747-1749)ccA>ccG	p.P583P	THBS4_ENST00000511733.1_Silent_p.P492P|CTD-2201I18.1_ENST00000514042.1_RNA|CTD-2201I18.1_ENST00000503007.1_RNA	NM_003248.4	NP_003239.2	P35443	TSP4_HUMAN	thrombospondin 4	583					behavioral response to pain (GO:0048266)|endothelial cell-cell adhesion (GO:0071603)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|positive regulation of cell division (GO:0051781)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of tissue remodeling (GO:0034103)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)|tissue remodeling (GO:0048771)	basement membrane (GO:0005604)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)|integrin binding (GO:0005178)	p.P583P(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|stomach(3)	34		Lung NSC(167;0.00328)|all_lung(232;0.00355)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;6.3e-45)|Epithelial(54;1.77e-39)|all cancers(79;3.2e-34)		ACAACTGCCCAAAATTTCCCA	0.483																																					p.P583P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1749G	5						.						252.0	254.0	253.0					5																	79368129		2203	4300	6503	79403885	SO:0001819	synonymous_variant	7060	exon14				CCDS4049.1	5q13	2008-05-15			ENSG00000113296	ENSG00000113296			11788	protein-coding gene	gene with protein product		600715				7852353	Standard	NM_003248		Approved		uc021yaw.1	P35443	OTTHUMG00000108173	ENST00000350881.2:c.1749A>G	5.37:g.79368129A>G		Somatic		Capture	Illumina HiSeq	Phase_I	79403885	NM_003248	B2R909|Q86TG2	Silent	SNP	ENST00000350881.2	37	CCDS4049.1																																																																																				THBS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226977.1		
APC	324	broad.mit.edu	37	5	112175484	112175484	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr5:112175484delG	ENST00000457016.1	+	16	4573	c.4193delG	c.(4192-4194)agtfs	p.S1398fs	APC_ENST00000257430.4_Frame_Shift_Del_p.S1398fs|APC_ENST00000508376.2_Frame_Shift_Del_p.S1398fs|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	1398	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R1399fs*9(9)|p.S1398fs*10(2)|p.S1398N(1)|p.S1398fs*17(1)|p.Y1376fs*41(1)|p.?(1)|p.K1192fs*3(1)|p.S1398T(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AGTTTTGAGAGTCGTTCGATT	0.478		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.S1380fs	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,oesophagus,NS,Substitution - Missense,0 	.	17	Deletion - Frameshift(14)|Substitution - Missense(2)|Unknown(1)	large_intestine(13)|stomach(1)|oesophagus(1)|soft_tissue(1)|skin(1)	c.4139delG	5						.						108.0	101.0	103.0					5																	112175484		2202	4300	6502	112203383	SO:0001589	frameshift_variant	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4193delG	5.37:g.112175484delG	ENSP00000413133:p.Ser1398fs	Somatic		Capture	Illumina HiSeq	Phase_I	112203383	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Del	DEL	ENST00000457016.1	37	CCDS4107.1																																																																																				APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
ZNF454	285676	broad.mit.edu	37	5	178392636	178392636	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr5:178392636C>A	ENST00000320129.3	+	5	1534	c.1231C>A	c.(1231-1233)Cct>Act	p.P411T	ZNF454_ENST00000519564.1_Missense_Mutation_p.P411T	NM_001178090.1|NM_182594.2	NP_001171561.1|NP_872400.2	Q8N9F8	ZN454_HUMAN	zinc finger protein 454	411					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P411T(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(11)|lung(18)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	46	all_cancers(89;0.000904)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.225)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.234)		TGGAGAGAAACCTTACAGATG	0.408																																					p.P411T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1231A	5						.						70.0	71.0	71.0					5																	178392636		2203	4300	6503	178325242	SO:0001583	missense	285676	exon5			AK094763	CCDS4441.1	5q35.3	2013-01-08			ENSG00000178187	ENSG00000178187		"""Zinc fingers, C2H2-type"", ""-"""	21200	protein-coding gene	gene with protein product							Standard	NM_182594		Approved	FLJ37444	uc021yjc.1	Q8N9F8	OTTHUMG00000130891	ENST00000320129.3:c.1231C>A	5.37:g.178392636C>A	ENSP00000326249:p.Pro411Thr	Somatic		Capture	Illumina HiSeq	Phase_I	178325242	NM_182594	Q2M1P2|Q2M323	Missense_Mutation	SNP	ENST00000320129.3	37	CCDS4441.1	.	.	.	.	.	.	.	.	.	.	C	14.26	2.482972	0.44147	.	.	ENSG00000178187	ENST00000320129;ENST00000519564	T;T	0.16897	2.31;2.31	4.25	4.25	0.50352	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.40818	N	0.001013	T	0.39462	0.1079	M	0.67700	2.07	0.41707	D	0.989433	D	0.71674	0.998	D	0.76071	0.987	T	0.31668	-0.9935	10	0.87932	D	0	-10.3233	14.5222	0.67859	0.0:1.0:0.0:0.0	.	411	Q8N9F8	ZN454_HUMAN	T	411	ENSP00000326249:P411T;ENSP00000430354:P411T	ENSP00000326249:P411T	P	+	1	0	ZNF454	178325242	.	.	0.990000	0.47175	0.209000	0.24338	.	.	2.367000	0.80283	0.650000	0.86243	CCT		ZNF454-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253476.2	XM_209718	
GTPBP2	54676	broad.mit.edu	37	6	43596785	43596786	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr6:43596785_43596786insC	ENST00000307126.5	-	1	113_114	c.114_115insG	c.(112-117)gggccafs	p.P39fs	GTPBP2_ENST00000476510.1_5'Flank|GTPBP2_ENST00000307114.7_5'Flank|MAD2L1BP_ENST00000451025.2_5'Flank	NM_019096.3	NP_061969.3			GTP binding protein 2									p.P39fs*26(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(3)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(18;9.36e-06)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000501)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0826)|OV - Ovarian serous cystadenocarcinoma(102;0.167)			TTTCCCTTTGGCCCCCCGCAGC	0.683																																					p.P39fs	GBM(116;405 1620 28302 32150 44768)											.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.115_116insG	6						.																																			43704764	SO:0001589	frameshift_variant	54676	exon1			AB024574	CCDS4903.1, CCDS69124.1	6p21	2008-07-28			ENSG00000172432	ENSG00000172432			4670	protein-coding gene	gene with protein product		607434				10833435, 11054535	Standard	NM_019096		Approved		uc003ovs.3	Q9BX10	OTTHUMG00000014744	ENST00000307126.5:c.115dupG	6.37:g.43596791_43596791dupC	ENSP00000303997:p.Pro39fs	Somatic		Capture	Illumina HiSeq	Phase_I	43704763	NM_019096		Frame_Shift_Ins	INS	ENST00000307126.5	37	CCDS4903.1																																																																																				GTPBP2-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040679.1		
SEC63	11231	broad.mit.edu	37	6	108243001	108243001	+	Splice_Site	SNP	G	G	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr6:108243001G>A	ENST00000369002.4	-	4	631	c.452C>T	c.(451-453)gCt>gTt	p.A151V		NM_007214.4	NP_009145.1	Q9UGP8	SEC63_HUMAN	SEC63 homolog (S. cerevisiae)	151	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				liver development (GO:0001889)|multicellular organismal aging (GO:0010259)|nitrogen compound metabolic process (GO:0006807)|posttranslational protein targeting to membrane (GO:0006620)|posttranslational protein targeting to membrane, translocation (GO:0031204)|protein targeting to membrane (GO:0006612)|renal system development (GO:0072001)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)	p.A151V(1)		endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(87;5.35e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0294)		BRCA - Breast invasive adenocarcinoma(108;0.0079)|Epithelial(106;0.0356)|all cancers(137;0.0525)|OV - Ovarian serous cystadenocarcinoma(136;0.054)		TGATACTTACGCAGCATAAGC	0.398																																					p.A151V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C452T	6						.						186.0	166.0	173.0					6																	108243001		2203	4300	6503	108349694	SO:0001630	splice_region_variant	11231	exon4			BC048287	CCDS5061.1	6q21	2011-09-05	2006-09-12		ENSG00000025796	ENSG00000025796		"""Heat shock proteins / DNAJ (HSP40)"""	21082	protein-coding gene	gene with protein product		608648	"""SEC63-like (S. cerevisiae)"""			10219736, 10543453	Standard	NM_007214		Approved	SEC63L, PRO2507, ERdj2, DNAJC23	uc003psc.4	Q9UGP8	OTTHUMG00000015316	ENST00000369002.4:c.452+1C>T	6.37:g.108243001G>A		Somatic		Capture	Illumina HiSeq	Phase_I	108349694	NM_007214	O95380|Q5THN4|Q86VS9|Q8IWL0|Q9NTE0	Missense_Mutation	SNP	ENST00000369002.4	37	CCDS5061.1	.	.	.	.	.	.	.	.	.	.	G	33	5.204395	0.95033	.	.	ENSG00000025796	ENST00000369002;ENST00000423697;ENST00000429168	T;T	0.23552	1.9;1.9	5.46	5.46	0.80206	Heat shock protein DnaJ, N-terminal (5);	0.000000	0.85682	D	0.000000	T	0.10594	0.0259	N	0.01352	-0.895	0.80722	D	1	P;D	0.61080	0.93;0.989	P;P	0.57324	0.771;0.818	T	0.44757	-0.9307	9	.	.	.	-10.3474	17.4917	0.87705	0.0:0.0:1.0:0.0	.	151;151	Q9UGP8;B3KQF0	SEC63_HUMAN;.	V	151;11;95	ENSP00000357998:A151V;ENSP00000403144:A95V	.	A	-	2	0	SEC63	108349694	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.046000	0.93817	2.556000	0.86216	0.650000	0.86243	GCT		SEC63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041705.4	NM_007214	Missense_Mutation
SYNE1	23345	broad.mit.edu	37	6	152642380	152642380	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr6:152642380C>T	ENST00000367255.5	-	84	16830	c.16229G>A	c.(16228-16230)cGa>cAa	p.R5410Q	SYNE1_ENST00000423061.1_Missense_Mutation_p.R5339Q|SYNE1_ENST00000356820.4_5'Flank|SYNE1_ENST00000448038.1_Missense_Mutation_p.R5339Q|SYNE1_ENST00000341594.5_Missense_Mutation_p.R5083Q|SYNE1_ENST00000265368.4_Missense_Mutation_p.R5410Q	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5410					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.R5410Q(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TACCTGATCTCGGATCTTTAG	0.393										HNSCC(10;0.0054)																											p.R5339Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G16016A	6						.						64.0	62.0	63.0					6																	152642380		2203	4300	6503	152684073	SO:0001583	missense	23345	exon83			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.16229G>A	6.37:g.152642380C>T	ENSP00000356224:p.Arg5410Gln	Somatic		Capture	Illumina HiSeq	Phase_I	152684073	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	C	7.497	0.651922	0.14516	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.51574	0.79;0.79;0.7;0.79;0.89	5.47	3.14	0.36123	.	0.457769	0.20380	N	0.093468	T	0.07369	0.0186	N	0.02539	-0.55	0.40241	D	0.977963	B;B;B;B	0.06786	0.001;0.0;0.0;0.001	B;B;B;B	0.06405	0.002;0.0;0.0;0.001	T	0.19943	-1.0290	10	0.12766	T	0.61	.	8.3836	0.32486	0.0:0.1711:0.0:0.8289	.	5410;5410;5410;5339	Q8NF91-7;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	Q	5410;5339;5410;5339;5083	ENSP00000356224:R5410Q;ENSP00000396024:R5339Q;ENSP00000265368:R5410Q;ENSP00000390975:R5339Q;ENSP00000341887:R5083Q	ENSP00000265368:R5410Q	R	-	2	0	SYNE1	152684073	1.000000	0.71417	0.012000	0.15200	0.052000	0.14988	3.492000	0.53259	0.970000	0.38263	0.655000	0.94253	CGA		SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
FAM50B	26240	broad.mit.edu	37	6	3850630	3850630	+	Silent	SNP	G	G	A	rs148492374	byFrequency	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr6:3850630G>A	ENST00000380274.1	+	1	1011	c.585G>A	c.(583-585)tcG>tcA	p.S195S	FAM50B_ENST00000380272.3_Silent_p.S195S			Q9Y247	FA50B_HUMAN	family with sequence similarity 50, member B	195						nucleus (GO:0005634)		p.S195S(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|pancreas(1)|prostate(3)|urinary_tract(3)	17	Ovarian(93;0.0925)	all_hematologic(90;0.108)				GGGACGGCTCGGGCCACCGGC	0.662																																					p.S195S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G585A	6						.						44.0	45.0	44.0					6																	3850630		2202	4300	6502	3795629	SO:0001819	synonymous_variant	26240	exon2			Y18504	CCDS4487.1	6p25.2	2008-05-15			ENSG00000145945	ENSG00000145945			18789	protein-coding gene	gene with protein product		614686				10534398	Standard	NM_012135		Approved	D6S2654E, X5L	uc003mvu.3	Q9Y247	OTTHUMG00000014147	ENST00000380274.1:c.585G>A	6.37:g.3850630G>A		Somatic		Capture	Illumina HiSeq	Phase_I	3795629	NM_012135	Q5T2L6	Silent	SNP	ENST00000380274.1	37	CCDS4487.1																																																																																				FAM50B-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039693.1	NM_012135	
IER3	8870	broad.mit.edu	37	6	30709956	30709956	+	IGR	SNP	G	G	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr6:30709956G>A	ENST00000259874.5	-	0	1244				FLOT1_ENST00000456573.2_Missense_Mutation_p.T4I|FLOT1_ENST00000470643.1_5'UTR|FLOT1_ENST00000376389.3_Missense_Mutation_p.T4I|XXbac-BPG252P9.10_ENST00000607333.1_RNA	NM_003897.3	NP_003888.2	P46695	IEX1_HUMAN	immediate early response 3						anatomical structure morphogenesis (GO:0009653)|apoptotic process (GO:0006915)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glycolytic process (GO:0045820)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)|negative regulation of systemic arterial blood pressure (GO:0003085)|positive regulation of protein catabolic process (GO:0045732)|regulation of DNA repair (GO:0006282)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of response to DNA damage stimulus (GO:2001020)|response to protozoan (GO:0001562)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.T4I(1)		NS(1)	1						TGGGCCACAAGTGAAAAACAT	0.602																																					p.T4I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C11T	6						.						166.0	156.0	160.0					6																	30709956		1511	2709	4220	30817935	SO:0001628	intergenic_variant	10211	exon2			AF083421	CCDS4689.1	6p21.3	2010-02-17			ENSG00000137331	ENSG00000137331			5392	protein-coding gene	gene with protein product		602996				8603392, 9703517	Standard	NM_003897		Approved	IEX-1, DIF-2, PRG1, IEX-1L	uc003nrn.3	P46695	OTTHUMG00000031265		6.37:g.30709956G>A		Somatic		Capture	Illumina HiSeq	Phase_I	30817935	NM_005803	Q5SU30|Q92691|Q93044	Missense_Mutation	SNP	ENST00000259874.5	37	CCDS4689.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.61|19.61	3.859708|3.859708	0.71834|0.71834	.|.	.|.	ENSG00000137312|ENSG00000137312	ENST00000418160|ENST00000376389;ENST00000456573;ENST00000438162;ENST00000445853;ENST00000416018;ENST00000454845	.|T;T;T;T;T;T	.|0.49432	.|0.78;0.78;0.78;0.78;0.78;0.78	4.94|4.94	4.94|4.94	0.65067|0.65067	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.35998|0.35998	0.0951|0.0951	L|L	0.47078|0.47078	1.49|1.49	0.80722|0.80722	D|D	1|1	.|B;B	.|0.31227	.|0.175;0.314	.|B;B	.|0.37731	.|0.099;0.257	T|T	0.38478|0.38478	-0.9659|-0.9659	6|10	0.59425|0.54805	D|T	0.04|0.06	.|.	16.0104|16.0104	0.80399|0.80399	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|4;4	.|B4DVY7;O75955	.|.;FLOT1_HUMAN	F|I	53|4	.|ENSP00000365569:T4I;ENSP00000394375:T4I;ENSP00000400615:T4I;ENSP00000398834:T4I;ENSP00000412058:T4I;ENSP00000391341:T4I	ENSP00000404300:L53F|ENSP00000365569:T4I	L|T	-|-	1|2	0|0	FLOT1|FLOT1	30817935|30817935	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.773000|0.773000	0.43773|0.43773	6.332000|6.332000	0.72934|0.72934	2.435000|2.435000	0.82474|0.82474	0.462000|0.462000	0.41574|0.41574	CTT|ACT		IER3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076578.2		
KCNK5	8645	broad.mit.edu	37	6	39196818	39196818	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr6:39196818C>T	ENST00000359534.3	-	1	408	c.70G>A	c.(70-72)Gaa>Aaa	p.E24K		NM_003740.3	NP_003731.1	O95279	KCNK5_HUMAN	potassium channel, subfamily K, member 5	24					excretion (GO:0007588)|potassium ion transport (GO:0006813)	integral component of plasma membrane (GO:0005887)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)	p.E24K(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(4)|skin(3)	19						TCCAGCACTTCGAAGATCGCC	0.617																																					p.E24K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G70A	6						.						94.0	98.0	97.0					6																	39196818		2203	4300	6503	39304796	SO:0001583	missense	8645	exon1			AF084830	CCDS4841.1	6p21	2012-03-07			ENSG00000164626	ENSG00000164626		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6280	protein-coding gene	gene with protein product		603493				9812978, 16382106	Standard	XM_005249456		Approved	K2p5.1, TASK-2	uc003oon.3	O95279	OTTHUMG00000014642	ENST00000359534.3:c.70G>A	6.37:g.39196818C>T	ENSP00000352527:p.Glu24Lys	Somatic		Capture	Illumina HiSeq	Phase_I	39304796	NM_003740	B2RAQ6|B5TJL2|Q5VV76	Missense_Mutation	SNP	ENST00000359534.3	37	CCDS4841.1	.	.	.	.	.	.	.	.	.	.	C	17.61	3.432693	0.62844	.	.	ENSG00000164626	ENST00000359534	T	0.23147	1.92	4.9	4.02	0.46733	.	0.054636	0.64402	D	0.000001	T	0.05273	0.0140	N	0.13098	0.295	0.48830	D	0.999714	B	0.27166	0.17	B	0.20767	0.031	T	0.15009	-1.0452	10	0.10377	T	0.69	.	13.6034	0.62033	0.0:0.7032:0.2968:0.0	.	24	O95279	KCNK5_HUMAN	K	24	ENSP00000352527:E24K	ENSP00000352527:E24K	E	-	1	0	KCNK5	39304796	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.540000	0.67205	1.286000	0.44565	0.511000	0.50034	GAA		KCNK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040449.1	NM_003740	
TNFRSF21	27242	broad.mit.edu	37	6	47221125	47221125	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr6:47221125G>A	ENST00000296861.2	-	4	1769	c.1376C>T	c.(1375-1377)gCc>gTc	p.A459V		NM_014452.3	NP_055267.1	O75509	TNR21_HUMAN	tumor necrosis factor receptor superfamily, member 21	459	Death. {ECO:0000255|PROSITE- ProRule:PRU00064}.				adaptive immune response (GO:0002250)|apoptotic process (GO:0006915)|B cell apoptotic process (GO:0001783)|cellular lipid metabolic process (GO:0044255)|cellular response to tumor necrosis factor (GO:0071356)|humoral immune response (GO:0006959)|myelination (GO:0042552)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of myelination (GO:0031642)|negative regulation of T cell proliferation (GO:0042130)|neuron apoptotic process (GO:0051402)|oligodendrocyte apoptotic process (GO:0097252)|regulation of oligodendrocyte differentiation (GO:0048713)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)		p.A459V(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(7)|pancreas(1)|skin(2)	21			Lung(136;0.189)			AGCTGCGTAGGCCCGCTCGTG	0.597																																					p.A459V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1376T	6						.						75.0	66.0	69.0					6																	47221125		2203	4300	6503	47329084	SO:0001583	missense	27242	exon4			AF068868	CCDS4921.1	6p21.1	2011-08-11			ENSG00000146072	ENSG00000146072		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	13469	protein-coding gene	gene with protein product	"""death receptor 6"""	605732				9714541	Standard	NM_014452		Approved	DR6, CD358	uc003oyv.3	O75509	OTTHUMG00000014796	ENST00000296861.2:c.1376C>T	6.37:g.47221125G>A	ENSP00000296861:p.Ala459Val	Somatic		Capture	Illumina HiSeq	Phase_I	47329084	NM_014452	B2RDI9|Q0D2P5|Q96D86	Missense_Mutation	SNP	ENST00000296861.2	37	CCDS4921.1	.	.	.	.	.	.	.	.	.	.	G	35	5.559708	0.96514	.	.	ENSG00000146072	ENST00000296861;ENST00000419206	D	0.85411	-1.98	6.16	6.16	0.99307	Death (3);DEATH-like (2);	0.091628	0.85682	D	0.000000	T	0.80670	0.4667	N	0.19112	0.55	0.80722	D	1	P	0.48834	0.916	P	0.50405	0.64	D	0.83416	0.0030	10	0.87932	D	0	.	20.4702	0.99162	0.0:0.0:1.0:0.0	.	459	O75509	TNR21_HUMAN	V	459;148	ENSP00000296861:A459V	ENSP00000296861:A459V	A	-	2	0	TNFRSF21	47329084	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.614000	0.98353	2.937000	0.99478	0.650000	0.86243	GCC		TNFRSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040814.1	NM_014452	
BACH2	60468	broad.mit.edu	37	6	90660341	90660341	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr6:90660341C>T	ENST00000257749.4	-	7	2191	c.1484G>A	c.(1483-1485)cGg>cAg	p.R495Q	RP3-512E2.2_ENST00000413986.1_RNA|RP3-512E2.2_ENST00000445838.1_RNA|BACH2_ENST00000343122.3_Missense_Mutation_p.R495Q|BACH2_ENST00000537989.1_Missense_Mutation_p.R495Q	NM_021813.2	NP_068585.1	Q9BYV9	BACH2_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 2	495						cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)	p.R495Q(2)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	45		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)		GGTGTTGGGCCGCATCCTTCC	0.642																																					p.R495Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1484A	6						.						49.0	58.0	55.0					6																	90660341		2203	4300	6503	90717062	SO:0001583	missense	60468	exon7			AL121787	CCDS5026.1	6q15	2013-01-10			ENSG00000112182	ENSG00000112182		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	14078	protein-coding gene	gene with protein product		605394				10949928, 12829606	Standard	NM_001170794		Approved	BTBD25	uc003pnw.3	Q9BYV9	OTTHUMG00000015216	ENST00000257749.4:c.1484G>A	6.37:g.90660341C>T	ENSP00000257749:p.Arg495Gln	Somatic		Capture	Illumina HiSeq	Phase_I	90717062	NM_021813	E1P518|Q59H70|Q5T793|Q9NTS5	Missense_Mutation	SNP	ENST00000257749.4	37	CCDS5026.1	.	.	.	.	.	.	.	.	.	.	C	19.32	3.805616	0.70682	.	.	ENSG00000112182	ENST00000257749;ENST00000537989;ENST00000343122	T;T;T	0.43294	0.95;0.95;0.95	5.21	5.21	0.72293	.	0.052557	0.85682	D	0.000000	T	0.33990	0.0882	L	0.29908	0.895	0.51012	D	0.999902	D	0.76494	0.999	P	0.61275	0.886	T	0.07158	-1.0787	10	0.07030	T	0.85	-26.5095	18.7663	0.91874	0.0:1.0:0.0:0.0	.	495	Q9BYV9	BACH2_HUMAN	Q	495	ENSP00000257749:R495Q;ENSP00000437473:R495Q;ENSP00000345642:R495Q	ENSP00000257749:R495Q	R	-	2	0	BACH2	90717062	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.291000	0.78721	2.428000	0.82296	0.557000	0.71058	CGG		BACH2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041522.2	NM_021813	
PACRG	135138	broad.mit.edu	37	6	163483286	163483286	+	Silent	SNP	C	C	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr6:163483286C>T	ENST00000337019.3	+	4	620	c.396C>T	c.(394-396)caC>caT	p.H132H	PACRG_ENST00000366888.2_Silent_p.H132H|PACRG_ENST00000366889.2_Silent_p.H132H	NM_152410.2	NP_689623.2	Q96M98	PACRG_HUMAN	PARK2 co-regulated	132					spermatid development (GO:0007286)	cell body (GO:0044297)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sperm midpiece (GO:0097225)		p.H132H(1)		endometrium(2)|large_intestine(6)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Breast(66;2.41e-05)|Ovarian(120;0.0245)|Prostate(117;0.0273)|all_neural(5;0.0416)|Glioma(2;0.203)		OV - Ovarian serous cystadenocarcinoma(33;4.31e-19)|GBM - Glioblastoma multiforme(2;7.42e-11)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)|KIRC - Kidney renal clear cell carcinoma(3;0.205)|Kidney(3;0.242)		AAGGAATCCACGACATGCTGG	0.428																																					p.H132H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C396T	6						.						98.0	93.0	94.0					6																	163483286		2203	4300	6503	163403276	SO:0001819	synonymous_variant	135138	exon4			AK057286	CCDS5284.1, CCDS43524.1	6q26	2004-07-01			ENSG00000112530	ENSG00000112530			19152	protein-coding gene	gene with protein product		608427				12547187	Standard	NM_001080378		Approved	PARK2CRG, FLJ32724, Glup, HAK005771	uc003qua.3	Q96M98	OTTHUMG00000016116	ENST00000337019.3:c.396C>T	6.37:g.163483286C>T		Somatic		Capture	Illumina HiSeq	Phase_I	163403276	NM_001080378	E1P5B5|Q6IMB8|Q8IZM1|Q8NHP5|Q9H1V9	Silent	SNP	ENST00000337019.3	37	CCDS5284.1	.	.	.	.	.	.	.	.	.	.	C	9.078	0.998700	0.19121	.	.	ENSG00000112530	ENST00000534958	.	.	.	4.85	2.84	0.33178	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-24.1333	5.2185	0.15356	0.0:0.2751:0.0:0.7249	.	.	.	.	X	48	.	.	R	+	1	2	PACRG	163403276	0.962000	0.33011	1.000000	0.80357	0.999000	0.98932	0.062000	0.14389	0.498000	0.27948	0.609000	0.83330	CGA		PACRG-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000400424.1	NM_152410	
ATXN7L1	222255	broad.mit.edu	37	7	105516945	105516945	+	Silent	SNP	C	C	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr7:105516945C>T	ENST00000419735.3	-	1	105	c.60G>A	c.(58-60)ggG>ggA	p.G20G	ATXN7L1_ENST00000478915.1_5'Flank|ATXN7L1_ENST00000318724.4_Silent_p.G20G	NM_020725.1	NP_065776.1	Q9ULK2	AT7L1_HUMAN	ataxin 7-like 1	20								p.G20G(2)		endometrium(1)|large_intestine(4)|lung(5)	10						GTTGCTTTTTCCCTGTTCCTT	0.577																																					p.G20G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G60A	7						.						101.0	89.0	93.0					7																	105516945		2203	4300	6503	105304181	SO:0001819	synonymous_variant	222255	exon1			AB033044	CCDS34727.1, CCDS47682.1, CCDS47683.1	7q22.1	2007-11-13			ENSG00000146776	ENSG00000146776			22210	protein-coding gene	gene with protein product			"""ataxin 7-like 4"""	ATXN7L4		15115762	Standard	NM_152749		Approved	KIAA1218, MGC33190	uc003vde.2	Q9ULK2	OTTHUMG00000157521	ENST00000419735.3:c.60G>A	7.37:g.105516945C>T		Somatic		Capture	Illumina HiSeq	Phase_I	105304181	NM_020725	A4D0Q2|B4DTS1|Q8N2T0	Silent	SNP	ENST00000419735.3	37	CCDS47682.1																																																																																				ATXN7L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349037.2		
FLNC	2318	broad.mit.edu	37	7	128478755	128478755	+	Missense_Mutation	SNP	C	C	T	rs374847180		TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr7:128478755C>T	ENST00000325888.8	+	8	1570	c.1309C>T	c.(1309-1311)Cgc>Tgc	p.R437C	FLNC_ENST00000346177.6_Missense_Mutation_p.R437C	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	437					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)	p.R437C(1)		biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						CAGCACGTTCCGCTGCACATA	0.652																																					p.R437C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1309T	7						.	C	CYS/ARG,CYS/ARG	0,4290		0,0,2145	84.0	95.0	91.0		1309,1309	3.1	1.0	7		91	2,8468		0,2,4233	no	missense,missense	FLNC	NM_001127487.1,NM_001458.4	180,180	0,2,6378	TT,TC,CC		0.0236,0.0,0.0157	probably-damaging,probably-damaging	437/2693,437/2726	128478755	2,12758	2145	4235	6380	128265991	SO:0001583	missense	2318	exon8			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.1309C>T	7.37:g.128478755C>T	ENSP00000327145:p.Arg437Cys	Somatic		Capture	Illumina HiSeq	Phase_I	128265991	NM_001458	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	ENST00000325888.8	37	CCDS43644.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.317324	0.81469	0.0	2.36E-4	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.85171	-1.95;-1.95	4.9	3.1	0.35709	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.118972	0.64402	D	0.000020	D	0.92331	0.7567	M	0.91717	3.235	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	P;D	0.67900	0.891;0.954	D	0.91990	0.5602	10	0.87932	D	0	.	9.7608	0.40530	0.0:0.8313:0.0:0.1687	.	437;437	Q14315-2;Q14315	.;FLNC_HUMAN	C	437	ENSP00000327145:R437C;ENSP00000344002:R437C	ENSP00000327145:R437C	R	+	1	0	FLNC	128265991	1.000000	0.71417	0.999000	0.59377	0.966000	0.64601	7.587000	0.82613	0.656000	0.30886	0.561000	0.74099	CGC		FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3		
EXOC4	60412	broad.mit.edu	37	7	133314836	133314836	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr7:133314836A>G	ENST00000253861.4	+	10	1485	c.1456A>G	c.(1456-1458)Aaa>Gaa	p.K486E	EXOC4_ENST00000539845.1_Missense_Mutation_p.K385E|EXOC4_ENST00000545148.1_Missense_Mutation_p.K96E|EXOC4_ENST00000460346.1_3'UTR	NM_021807.3	NP_068579.3	Q96A65	EXOC4_HUMAN	exocyst complex component 4	486					cellular protein metabolic process (GO:0044267)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)	p.K486E(1)		NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(16)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	50		Esophageal squamous(399;0.129)				TGGAGGAACAAAATTTGTCTG	0.348																																					p.K486E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1456G	7						.						131.0	126.0	128.0					7																	133314836		2203	4300	6503	132965376	SO:0001583	missense	60412	exon10			AL831989	CCDS5829.1, CCDS43648.1	7q31	2013-01-22	2005-11-01	2005-11-01	ENSG00000131558	ENSG00000131558			30389	protein-coding gene	gene with protein product		608185	"""SEC8-like 1 (S. cerevisiae)"""	SEC8L1		11214970, 12687004	Standard	XM_005250523		Approved	KIAA1699, MGC27170, SEC8, Sec8p	uc003vrk.3	Q96A65	OTTHUMG00000155259	ENST00000253861.4:c.1456A>G	7.37:g.133314836A>G	ENSP00000253861:p.Lys486Glu	Somatic		Capture	Illumina HiSeq	Phase_I	132965376	NM_021807	E9PED2|Q541U8|Q9C0G4|Q9H9K0|Q9P102	Missense_Mutation	SNP	ENST00000253861.4	37	CCDS5829.1	.	.	.	.	.	.	.	.	.	.	A	16.14	3.039806	0.55003	.	.	ENSG00000131558	ENST00000253861;ENST00000546185;ENST00000539845;ENST00000545148	.	.	.	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.40040	0.1101	L	0.46157	1.445	0.80722	D	1	B;P;B	0.35226	0.158;0.491;0.094	B;B;B	0.29862	0.084;0.108;0.016	T	0.29305	-1.0016	9	0.07813	T	0.8	.	12.1193	0.53883	0.857:0.143:0.0:0.0	.	18;96;486	B7Z689;F5GZT1;Q96A65	.;.;EXOC4_HUMAN	E	486;105;385;96	.	ENSP00000253861:K486E	K	+	1	0	EXOC4	132965376	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.539000	0.73856	2.308000	0.77769	0.533000	0.62120	AAA		EXOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339182.1	NM_021807	
AKR1B10	57016	broad.mit.edu	37	7	134221874	134221874	+	Silent	SNP	G	G	A	rs568011657		TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr7:134221874G>A	ENST00000359579.4	+	6	944	c.624G>A	c.(622-624)acG>acA	p.T208T		NM_020299.4	NP_064695.3	O60218	AK1BA_HUMAN	aldo-keto reductase family 1, member B10 (aldose reductase)	208					cellular aldehyde metabolic process (GO:0006081)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|farnesol catabolic process (GO:0016488)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|steroid metabolic process (GO:0008202)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	aldo-keto reductase (NADP) activity (GO:0004033)|geranylgeranyl reductase activity (GO:0045550)|indanol dehydrogenase activity (GO:0047718)|retinal dehydrogenase activity (GO:0001758)	p.T208T(2)		NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(9)|skin(5)	20						TCACCGTTACGGCCTACAGCC	0.483													g|||	1	0.000199681	0.0	0.0	5008	,	,		16791	0.0		0.0	False		,,,				2504	0.001				p.T208T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G624A	7						.						15.0	24.0	21.0					7																	134221874		2145	4279	6424	133872414	SO:0001819	synonymous_variant	57016	exon6			AF052577	CCDS5832.1	7q33	2010-04-08			ENSG00000198074	ENSG00000198074		"""Aldo-keto reductases"""	382	protein-coding gene	gene with protein product	"""aldose reductase-like 1"", ""aldo-keto reductase family 1, member B11 (aldose reductase-like)"", ""aldose reductase-like peptide"", ""aldose reductase-related protein"", ""small intestine reductase"""	604707		AKR1B11		9765596, 9565553	Standard	NM_020299		Approved	AKR1B12, ARL-1, HIS, ARL1, HSI, ALDRLn	uc003vrr.3	O60218	OTTHUMG00000155356	ENST00000359579.4:c.624G>A	7.37:g.134221874G>A		Somatic		Capture	Illumina HiSeq	Phase_I	133872414	NM_020299	A4D1P1|O75890|Q6FHF3|Q8IWZ1	Silent	SNP	ENST00000359579.4	37	CCDS5832.1																																																																																				AKR1B10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339615.1	NM_020299	
DNAH11	8701	broad.mit.edu	37	7	21747335	21747335	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr7:21747335C>T	ENST00000409508.3	+	40	6596	c.6565C>T	c.(6565-6567)Cga>Tga	p.R2189*	DNAH11_ENST00000328843.6_Nonsense_Mutation_p.R2196*	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2196	AAA 2. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R2196*(2)		NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						AACACTGAACCGAACATATGT	0.378									Kartagener syndrome																												p.P2196L												.	.	2	Substitution - Nonsense(2)	large_intestine(1)|endometrium(1)	c.C6587T	7						.						68.0	63.0	65.0					7																	21747335		1833	4086	5919	21713860	SO:0001587	stop_gained	8701	exon40	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.6565C>T	7.37:g.21747335C>T	ENSP00000475939:p.Arg2189*	Somatic		Capture	Illumina HiSeq	Phase_I	21713860	NM_003777	Q9UJ82	Nonsense_Mutation	SNP	ENST00000409508.3	37		.	.	.	.	.	.	.	.	.	.	C	48	14.529178	0.99799	.	.	ENSG00000105877	ENST00000328843	.	.	.	5.87	3.98	0.46160	.	0.331528	0.30547	N	0.009383	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	.	14.0561	0.64769	0.5282:0.4718:0.0:0.0	.	.	.	.	X	2196	.	ENSP00000330671:R2196X	R	+	1	2	DNAH11	21713860	0.983000	0.35010	0.998000	0.56505	0.957000	0.61999	1.046000	0.30354	0.854000	0.35336	0.655000	0.94253	CGA		DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777	
GCK	2645	broad.mit.edu	37	7	44189378	44189378	+	Silent	SNP	G	G	A	rs142952813	byFrequency	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr7:44189378G>A	ENST00000403799.3	-	6	1129	c.660C>T	c.(658-660)tgC>tgT	p.C220C	GCK_ENST00000437084.1_Silent_p.C203C|GCK_ENST00000395796.3_Silent_p.C219C|GCK_ENST00000345378.2_Silent_p.C221C	NM_000162.3	NP_000153.1	P35557	HXK4_HUMAN	glucokinase (hexokinase 4)	220	Hexokinase type-2.				calcium ion import (GO:0070509)|carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|cellular response to glucose starvation (GO:0042149)|cellular response to insulin stimulus (GO:0032869)|cellular response to leptin stimulus (GO:0044320)|detection of glucose (GO:0051594)|endocrine pancreas development (GO:0031018)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glycogen biosynthetic process (GO:0005978)|glycolytic process (GO:0006096)|hexose transport (GO:0008645)|NADP metabolic process (GO:0006739)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of gluconeogenesis (GO:0045721)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of insulin secretion (GO:0032024)|positive regulation of phosphorylation (GO:0042327)|regulation of glucose transport (GO:0010827)|regulation of glycolytic process (GO:0006110)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transport (GO:0043266)|second-messenger-mediated signaling (GO:0019932)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|secretory granule (GO:0030141)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|glucokinase activity (GO:0004340)|glucose binding (GO:0005536)|magnesium ion binding (GO:0000287)	p.C221C(1)		central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(17)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	37						TGCCGACCTCGCACTGATGGT	0.572													G|||	13	0.00259585	0.0091	0.0014	5008	,	,		19438	0.0		0.0	False		,,,				2504	0.0				p.C220C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C660T	7	GRCh37	CM020443	GCK	M	rs142952813	.	G	,,	16,4390	23.3+/-48.9	0,16,2187	151.0	125.0	134.0		660,663,657	2.5	1.0	7	dbSNP_134	134	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	GCK	NM_000162.3,NM_033507.1,NM_033508.1	,,	0,16,6487	AA,AG,GG		0.0,0.3631,0.123	,,	220/466,221/467,219/465	44189378	16,12990	2203	4300	6503	44155903	SO:0001819	synonymous_variant	2645	exon6			AF041014	CCDS5479.1, CCDS5480.1, CCDS5481.1	7p15.3-p15.1	2008-02-07	2008-02-07		ENSG00000106633	ENSG00000106633	2.7.1.2, 2.7.1.1		4195	protein-coding gene	gene with protein product		138079	"""maturity onset diabetes of the young 2"""	MODY2		1740341, 1502186	Standard	NM_033507		Approved	HK4	uc003tkk.1	P35557	OTTHUMG00000022903	ENST00000403799.3:c.660C>T	7.37:g.44189378G>A		Somatic		Capture	Illumina HiSeq	Phase_I	44155903	NM_000162	A4D2J2|A4D2J3|Q05810	Silent	SNP	ENST00000403799.3	37	CCDS5479.1																																																																																				GCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251069.2		
SEMA3E	9723	broad.mit.edu	37	7	82997217	82997217	+	Silent	SNP	C	C	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr7:82997217C>T	ENST00000307792.3	-	17	2480	c.2013G>A	c.(2011-2013)gaG>gaA	p.E671E	SEMA3E_ENST00000427262.1_Silent_p.E611E	NM_012431.2	NP_036563.1	O15041	SEM3E_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E	671					axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell-matrix adhesion (GO:0001953)|patterning of blood vessels (GO:0001569)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell shape (GO:0008360)|semaphorin-plexin signaling pathway (GO:0071526)|sprouting angiogenesis (GO:0002040)|synapse organization (GO:0050808)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	receptor activity (GO:0004872)	p.E671E(1)		breast(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(19)|ovary(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	51		Medulloblastoma(109;0.109)				CTTCCACTACCTCCAAGGTGA	0.473																																					p.E671E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2013A	7						.						132.0	114.0	120.0					7																	82997217		2203	4300	6503	82835153	SO:0001819	synonymous_variant	9723	exon17			AB002329	CCDS34674.1, CCDS55121.1	7q21.11	2013-01-11			ENSG00000170381	ENSG00000170381		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10727	protein-coding gene	gene with protein product	"""M-sema H"""	608166		SEMAH		9205841, 9515811	Standard	NM_012431		Approved	M-SemaK, KIAA0331, coll-5	uc003uhy.2	O15041	OTTHUMG00000154693	ENST00000307792.3:c.2013G>A	7.37:g.82997217C>T		Somatic		Capture	Illumina HiSeq	Phase_I	82835153	NM_012431	B4E1P1|Q75M94|Q75M97	Silent	SNP	ENST00000307792.3	37	CCDS34674.1																																																																																				SEMA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336606.1	NM_012431	
UBN2	254048	broad.mit.edu	37	7	138946196	138946196	+	Silent	SNP	C	C	T	rs371716160		TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr7:138946196C>T	ENST00000473989.3	+	6	1104	c.1104C>T	c.(1102-1104)gaC>gaT	p.D368D	UBN2_ENST00000288561.8_Silent_p.D285D	NM_173569.3	NP_775840.3	Q6ZU65	UBN2_HUMAN	ubinuclein 2	368						extracellular space (GO:0005615)|nucleus (GO:0005634)		p.D285D(2)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	42						TGGGGAATGACGTCCCGGACT	0.483																																					p.D368D												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1104T	7						.	C		0,3790		0,0,1895	83.0	82.0	82.0		1104	-12.2	0.0	7		82	1,8223		0,1,4111	no	coding-synonymous	UBN2	NM_173569.3		0,1,6006	TT,TC,CC		0.0122,0.0,0.0083		368/1348	138946196	1,12013	1895	4112	6007	138596736	SO:0001819	synonymous_variant	254048	exon6			AK098644	CCDS43655.1, CCDS43655.2	7q34	2008-12-08			ENSG00000157741	ENSG00000157741			21931	protein-coding gene	gene with protein product		613841				19029251	Standard	NM_173569		Approved	FLJ25778, KIAA2030	uc011kqr.2	Q6ZU65	OTTHUMG00000157623	ENST00000473989.3:c.1104C>T	7.37:g.138946196C>T		Somatic		Capture	Illumina HiSeq	Phase_I	138596736	NM_173569	A4D1S2|Q2YDY4|Q6P1K0|Q86XN9|Q8N7D1	Silent	SNP	ENST00000473989.3	37	CCDS43655.2	.	.	.	.	.	.	.	.	.	.	C	0.362	-0.938861	0.02340	0.0	1.22E-4	ENSG00000157741	ENST00000483726	.	.	.	6.08	-12.2	0.00006	.	.	.	.	.	T	0.39937	0.1097	.	.	.	0.45129	D	0.998146	.	.	.	.	.	.	T	0.49331	-0.8951	4	.	.	.	-6.5709	5.5729	0.17206	0.1582:0.4179:0.0749:0.3489	.	.	.	.	M	137	.	.	T	+	2	0	UBN2	138596736	0.000000	0.05858	0.022000	0.16811	0.217000	0.24651	-0.818000	0.04467	-2.078000	0.00872	-1.152000	0.01820	ACG		UBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349272.3	NM_173569	
KIF13B	23303	broad.mit.edu	37	8	28980143	28980143	+	Missense_Mutation	SNP	T	T	G	rs370420261		TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr8:28980143T>G	ENST00000524189.1	-	29	3538	c.3500A>C	c.(3499-3501)gAg>gCg	p.E1167A	CTD-2647L4.1_ENST00000523661.1_RNA	NM_015254.3	NP_056069.2	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	1167					metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein targeting (GO:0006605)|regulation of axonogenesis (GO:0050770)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	axon (GO:0030424)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)	p.E1167A(1)		endometrium(6)|kidney(1)|lung(20)|urinary_tract(1)	28		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		AATGTGTGTCTCCATCCCAGG	0.438																																					p.E1167A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3500C	8						.						85.0	79.0	81.0					8																	28980143		1913	4133	6046	29036062	SO:0001583	missense	23303	exon29			AB014539	CCDS55217.1	8p21	2008-07-30				ENSG00000197892		"""Kinesins"""	14405	protein-coding gene	gene with protein product		607350				9734811, 10859302, 16864656	Standard	NM_015254		Approved	GAKIN, KIAA0639	uc003xhh.4	Q9NQT8		ENST00000524189.1:c.3500A>C	8.37:g.28980143T>G	ENSP00000427900:p.Glu1167Ala	Somatic		Capture	Illumina HiSeq	Phase_I	29036062	NM_015254	B4DGY5|B5MC45|F8VPJ2|O75134|Q9BYJ6	Missense_Mutation	SNP	ENST00000524189.1	37	CCDS55217.1	.	.	.	.	.	.	.	.	.	.	T	26.2	4.715230	0.89112	.	.	ENSG00000197892	ENST00000524189	D	0.88975	-2.45	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	D	0.93756	0.8004	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94436	0.7654	10	0.87932	D	0	.	15.3683	0.74541	0.0:0.0:0.0:1.0	.	1167	F8VPJ2	.	A	1167	ENSP00000427900:E1167A	ENSP00000427900:E1167A	E	-	2	0	KIF13B	29036062	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.461000	0.80834	2.206000	0.71126	0.528000	0.53228	GAG		KIF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376878.1		
NRG1	3084	broad.mit.edu	37	8	32621347	32621347	+	Silent	SNP	G	G	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr8:32621347G>A	ENST00000405005.3	+	12	1350	c.1350G>A	c.(1348-1350)tcG>tcA	p.S450S	NRG1_ENST00000341377.5_3'UTR|NRG1_ENST00000521670.1_3'UTR|NRG1_ENST00000338921.4_Silent_p.S458S|NRG1_ENST00000539990.1_Silent_p.S293S|NRG1_ENST00000519301.1_Silent_p.S400S|RP11-1002K11.1_ENST00000607314.1_lincRNA|NRG1_ENST00000287842.3_Silent_p.S447S|NRG1_ENST00000287845.5_Silent_p.S421S|NRG1_ENST00000356819.4_Silent_p.S455S			Q02297	NRG1_HUMAN	neuregulin 1	450					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)	p.S455S(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		CGCCCCCTTCGGAAATGTCTC	0.562																																					p.G389R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1165A	8						.						107.0	104.0	105.0					8																	32621347		2203	4300	6503	32740889	SO:0001819	synonymous_variant	3084	exon10			L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.1350G>A	8.37:g.32621347G>A		Somatic		Capture	Illumina HiSeq	Phase_I	32740889	NM_001160001	A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Silent	SNP	ENST00000405005.3	37	CCDS6085.1																																																																																				NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472504.1		
DKK4	27121	broad.mit.edu	37	8	42231709	42231709	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr8:42231709T>C	ENST00000220812.2	-	4	770	c.584A>G	c.(583-585)gAc>gGc	p.D195G		NM_014420.2	NP_055235.1	Q9UBT3	DKK4_HUMAN	dickkopf WNT signaling pathway inhibitor 4	195	DKK-type Cys-2.				multicellular organismal development (GO:0007275)|negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)		p.D195G(1)		NS(1)|endometrium(1)|large_intestine(7)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	14	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;2.58e-12)|Lung NSC(13;4.24e-11)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.1)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;3.48e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00523)|Lung(22;0.00597)|LUSC - Lung squamous cell carcinoma(45;0.024)			AGGGCCACAGTCGCAACGCTG	0.458																																					p.D195G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A584G	8						.						91.0	90.0	90.0					8																	42231709		2203	4300	6503	42350866	SO:0001583	missense	27121	exon4			AF177397	CCDS6130.1	8p11.2-p11.1	2013-05-15	2013-05-15		ENSG00000104371	ENSG00000104371			2894	protein-coding gene	gene with protein product		605417	"""dickkopf (Xenopus laevis) homolog 4"", ""dickkopf homolog 4 (Xenopus laevis)"""			10570958, 11701963	Standard	NM_014420		Approved		uc003xpb.3	Q9UBT3	OTTHUMG00000164167	ENST00000220812.2:c.584A>G	8.37:g.42231709T>C	ENSP00000220812:p.Asp195Gly	Somatic		Capture	Illumina HiSeq	Phase_I	42350866	NM_014420	Q3KNX0|Q9Y4C3	Missense_Mutation	SNP	ENST00000220812.2	37	CCDS6130.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.488829	0.84962	.	.	ENSG00000104371	ENST00000220812	D	0.84070	-1.8	6.03	6.03	0.97812	Prokineticin domain (2);	0.088809	0.48767	D	0.000162	D	0.88662	0.6497	M	0.65498	2.005	0.49582	D	0.999802	D	0.76494	0.999	D	0.71184	0.972	D	0.85827	0.1389	10	0.17369	T	0.5	-10.5336	14.5176	0.67830	0.0:0.0:0.0:1.0	.	195	Q9UBT3	DKK4_HUMAN	G	195	ENSP00000220812:D195G	ENSP00000220812:D195G	D	-	2	0	DKK4	42350866	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	7.656000	0.83736	2.302000	0.77476	0.533000	0.62120	GAC		DKK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377563.1		
CA3	761	broad.mit.edu	37	8	86354416	86354416	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr8:86354416C>T	ENST00000285381.2	+	3	430	c.347C>T	c.(346-348)gCg>gTg	p.A116V	RP11-317J10.2_ENST00000517697.1_RNA|RP11-317J10.2_ENST00000521761.1_RNA	NM_005181.3	NP_005172.1	P07451	CAH3_HUMAN	carbonic anhydrase III, muscle specific	116					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|response to ethanol (GO:0045471)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	carbonate dehydratase activity (GO:0004089)|nickel cation binding (GO:0016151)|zinc ion binding (GO:0008270)	p.A116V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23					Acetazolamide(DB00819)|Zonisamide(DB00909)	AAGTATGCAGCGGAGGTAAGA	0.483																																					p.A116V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C347T	8						.						107.0	102.0	104.0					8																	86354416		2203	4300	6503	86541668	SO:0001583	missense	761	exon3			AJ006473	CCDS6238.1	8q21.2	2012-10-02					4.2.1.1	"""Carbonic anhydrases"""	1374	protein-coding gene	gene with protein product		114750				6221502	Standard	NM_005181		Approved	Car3, CAIII	uc003ydj.3	P07451		ENST00000285381.2:c.347C>T	8.37:g.86354416C>T	ENSP00000285381:p.Ala116Val	Somatic		Capture	Illumina HiSeq	Phase_I	86541668	NM_005181	B2R867|B3KUC8|O60842	Missense_Mutation	SNP	ENST00000285381.2	37	CCDS6238.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.013202	0.75161	.	.	ENSG00000164879	ENST00000285381;ENST00000426378	T	0.44881	0.91	5.96	5.96	0.96718	Carbonic anhydrase, alpha-class, conserved site (1);Carbonic anhydrase, alpha-class, catalytic domain (4);	0.193052	0.53938	D	0.000048	T	0.63803	0.2542	M	0.81614	2.55	0.42033	D	0.991039	D	0.89917	1.0	P	0.61940	0.896	T	0.65606	-0.6127	9	.	.	.	-22.7218	15.0363	0.71751	0.0:0.7486:0.2513:0.0	.	116	P07451	CAH3_HUMAN	V	116;100	ENSP00000285381:A116V	.	A	+	2	0	CA3	86541668	0.113000	0.22115	0.880000	0.34516	0.469000	0.32828	0.642000	0.24735	2.832000	0.97577	0.655000	0.94253	GCG		CA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381090.1	NM_005181	
OR13C3	138803	broad.mit.edu	37	9	107298518	107298518	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr9:107298518C>A	ENST00000374781.2	-	1	619	c.577G>T	c.(577-579)Gcc>Tcc	p.A193S		NM_001001961.1	NP_001001961.1	Q8NGS6	O13C3_HUMAN	olfactory receptor, family 13, subfamily C, member 3	193						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A193S(1)		endometrium(2)|large_intestine(7)|lung(7)|pancreas(1)|prostate(1)|skin(1)	19						AGTCTCATGGCAAGTAATGTT	0.438																																					p.A193S	GBM(86;1248 1274 14222 15028 46219)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G577T	9						.						135.0	135.0	135.0					9																	107298518		2203	4300	6503	106338339	SO:0001583	missense	138803	exon1				CCDS35089.1	9q31.1	2013-09-24			ENSG00000204246	ENSG00000204246		"""GPCR / Class A : Olfactory receptors"""	14704	protein-coding gene	gene with protein product							Standard	NM_001001961		Approved		uc004bcb.1	Q8NGS6	OTTHUMG00000020406	ENST00000374781.2:c.577G>T	9.37:g.107298518C>A	ENSP00000363913:p.Ala193Ser	Somatic		Capture	Illumina HiSeq	Phase_I	106338339	NM_001001961	Q5VVG1|Q6IF52	Missense_Mutation	SNP	ENST00000374781.2	37	CCDS35089.1	.	.	.	.	.	.	.	.	.	.	C	10.60	1.395819	0.25205	.	.	ENSG00000204246	ENST00000374781	T	0.00099	8.73	4.45	3.56	0.40772	GPCR, rhodopsin-like superfamily (1);	0.152770	0.30142	N	0.010314	T	0.00210	0.0006	M	0.78801	2.425	0.09310	N	0.999997	P	0.46912	0.886	P	0.44673	0.457	T	0.31475	-0.9942	10	0.87932	D	0	.	5.7732	0.18265	0.1951:0.7076:0.0:0.0973	.	193	Q8NGS6	O13C3_HUMAN	S	193	ENSP00000363913:A193S	ENSP00000363913:A193S	A	-	1	0	OR13C3	106338339	0.000000	0.05858	0.997000	0.53966	0.185000	0.23345	0.118000	0.15605	1.234000	0.43709	-0.189000	0.12847	GCC		OR13C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053477.2		
ABCA1	19	broad.mit.edu	37	9	107566931	107566931	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr9:107566931G>A	ENST00000374736.3	-	32	4929	c.4535C>T	c.(4534-4536)aCg>aTg	p.T1512M		NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	1512					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)	p.T1512M(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	CTGCACATACGTCTTCACCAG	0.398																																					p.T1512M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4535T	9						.						222.0	205.0	211.0					9																	107566931		2203	4300	6503	106606752	SO:0001583	missense	19	exon32			AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.4535C>T	9.37:g.107566931G>A	ENSP00000363868:p.Thr1512Met	Somatic		Capture	Illumina HiSeq	Phase_I	106606752	NM_005502	Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	ENST00000374736.3	37	CCDS6762.1	.	.	.	.	.	.	.	.	.	.	G	31	5.085397	0.94100	.	.	ENSG00000165029	ENST00000374736	D	0.96136	-3.92	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	D	0.98359	0.9455	M	0.90977	3.165	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98559	1.0640	10	0.87932	D	0	.	20.5827	0.99408	0.0:0.0:1.0:0.0	.	1512	O95477	ABCA1_HUMAN	M	1512	ENSP00000363868:T1512M	ENSP00000363868:T1512M	T	-	2	0	ABCA1	106606752	1.000000	0.71417	0.975000	0.42487	0.952000	0.60782	9.869000	0.99810	2.941000	0.99782	0.655000	0.94253	ACG		ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	NM_005502	
TNFSF15	9966	broad.mit.edu	37	9	117552892	117552892	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr9:117552892T>G	ENST00000374045.4	-	4	709	c.596A>C	c.(595-597)aAg>aCg	p.K199T	TNFSF15_ENST00000374044.1_Missense_Mutation_p.K122T|AL390240.1_ENST00000408807.1_RNA	NM_001204344.1|NM_005118.3	NP_001191273.1|NP_005109.2	O95150	TNF15_HUMAN	tumor necrosis factor (ligand) superfamily, member 15	199					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|cytokine metabolic process (GO:0042107)|immune response (GO:0006955)|positive regulation of cytokine secretion (GO:0050715)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.K199T(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|skin(1)	11						GCATACAGACTTGGTCCCCAT	0.537																																					p.K199T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A596C	9						.						195.0	155.0	168.0					9																	117552892		2203	4300	6503	116592713	SO:0001583	missense	9966	exon4			AF039390	CCDS6809.1	9q32	2008-07-21			ENSG00000181634	ENSG00000181634		"""Tumor necrosis factor (ligand) superfamily"""	11931	protein-coding gene	gene with protein product	"""vascular endothelial cell growth inhibitor"", ""TNF superfamily ligand TL1A"", ""TNF ligand-related molecule 1"", ""vascular endothelial growth inhibitor-192A"""	604052				9434163	Standard	NM_005118		Approved	TL1, VEGI, TL1A, VEGI192A, MGC129934, MGC129935	uc004bjh.3	O95150	OTTHUMG00000021011	ENST00000374045.4:c.596A>C	9.37:g.117552892T>G	ENSP00000363157:p.Lys199Thr	Somatic		Capture	Illumina HiSeq	Phase_I	116592713	NM_005118	Q3SX69|Q5VJK8|Q5VWH1|Q8NFE9	Missense_Mutation	SNP	ENST00000374045.4	37	CCDS6809.1	.	.	.	.	.	.	.	.	.	.	T	16.90	3.250694	0.59212	.	.	ENSG00000181634	ENST00000374045;ENST00000374044	D;D	0.94931	-3.56;-3.56	6.03	6.03	0.97812	Tumour necrosis factor (3);Tumour necrosis factor-like (2);	0.000000	0.85682	D	0.000000	D	0.96528	0.8867	M	0.68593	2.085	0.52501	D	0.999951	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.96735	0.9542	10	0.72032	D	0.01	-39.0996	12.9984	0.58662	0.0:0.0:0.1344:0.8656	.	199;140	O95150;O95150-2	TNF15_HUMAN;.	T	199;122	ENSP00000363157:K199T;ENSP00000363156:K122T	ENSP00000363156:K122T	K	-	2	0	TNFSF15	116592713	1.000000	0.71417	1.000000	0.80357	0.422000	0.31414	4.165000	0.58196	2.308000	0.77769	0.533000	0.62120	AAG		TNFSF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055424.2	NM_005118	
CA9	768	broad.mit.edu	37	9	35679190	35679190	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr9:35679190A>G	ENST00000378357.4	+	7	1020	c.916A>G	c.(916-918)Act>Gct	p.T306A	CA9_ENST00000493245.1_3'UTR	NM_001216.2	NP_001207.2	Q16790	CAH9_HUMAN	carbonic anhydrase IX	306	Catalytic.				bicarbonate transport (GO:0015701)|cellular response to hypoxia (GO:0071456)|morphogenesis of an epithelium (GO:0002009)|one-carbon metabolic process (GO:0006730)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to drug (GO:0042493)|response to testosterone (GO:0033574)|secretion (GO:0046903)|small molecule metabolic process (GO:0044281)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)	p.T306A(1)		kidney(1)|large_intestine(3)|lung(5)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	17	all_epithelial(49;0.217)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)		Benzthiazide(DB00562)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Zonisamide(DB00909)	AGGCTCAGAGACTCAGGTCCC	0.537																																					p.T306A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A916G	9						.						217.0	214.0	215.0					9																	35679190		2203	4300	6503	35669190	SO:0001583	missense	768	exon7			X66839	CCDS6585.1	9p13.3	2012-08-21			ENSG00000107159	ENSG00000107159		"""Carbonic anhydrases"""	1383	protein-coding gene	gene with protein product	"""carbonic dehydratase"", ""RCC-associated protein G250"""	603179				8661007, 9787087	Standard	NM_001216		Approved	MN, CAIX	uc003zxo.4	Q16790	OTTHUMG00000021029	ENST00000378357.4:c.916A>G	9.37:g.35679190A>G	ENSP00000367608:p.Thr306Ala	Somatic		Capture	Illumina HiSeq	Phase_I	35669190	NM_001216	Q5T4R1	Missense_Mutation	SNP	ENST00000378357.4	37	CCDS6585.1	.	.	.	.	.	.	.	.	.	.	A	12.55	1.971586	0.34754	.	.	ENSG00000107159	ENST00000378357;ENST00000544074	T	0.52983	0.64	5.37	5.37	0.77165	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.085297	0.47093	D	0.000252	T	0.33673	0.0871	N	0.21282	0.65	0.33980	D	0.647883	B;P	0.35780	0.058;0.52	B;B	0.37833	0.067;0.259	T	0.45131	-0.9282	10	0.15952	T	0.53	.	12.0445	0.53473	1.0:0.0:0.0:0.0	.	306;306	F5H404;Q16790	.;CAH9_HUMAN	A	306	ENSP00000367608:T306A	ENSP00000367608:T306A	T	+	1	0	CA9	35669190	0.979000	0.34478	0.962000	0.40283	0.535000	0.34838	2.272000	0.43373	2.152000	0.67230	0.383000	0.25322	ACT		CA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055479.1	NM_001216	
SLC25A51	92014	broad.mit.edu	37	9	37888383	37888383	+	Silent	SNP	G	G	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr9:37888383G>A	ENST00000377716.2	-	3	908	c.165C>T	c.(163-165)ctC>ctT	p.L55L	RP11-613M10.9_ENST00000540557.1_Intron|SLC25A51_ENST00000496760.1_Intron|SLC25A51_ENST00000242275.6_Silent_p.L55L|SLC25A51_ENST00000380590.3_Silent_p.L55L			Q9H1U9	S2551_HUMAN	solute carrier family 25, member 51	55					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)		p.L55L(1)									GTTGTCGAAAGAGGACCTTCT	0.443																																					p.L55L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C165T	9						.						115.0	105.0	109.0					9																	37888383		2203	4300	6503	37878383	SO:0001819	synonymous_variant	92014	exon3			BC008500	CCDS6614.1	9p13.3-p12	2013-05-22	2012-03-29	2012-03-29	ENSG00000122696	ENSG00000122696		"""Solute carriers"""	23323	protein-coding gene	gene with protein product			"""mitochondrial carrier triple repeat 1"""	MCART1		12477932	Standard	NM_033412		Approved	MGC14836, CG7943	uc004aav.2	Q9H1U9	OTTHUMG00000019935	ENST00000377716.2:c.165C>T	9.37:g.37888383G>A		Somatic		Capture	Illumina HiSeq	Phase_I	37878383	NM_033412		Silent	SNP	ENST00000377716.2	37	CCDS6614.1																																																																																				SLC25A51-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313746.1	NM_033412	
PKN3	29941	broad.mit.edu	37	9	131469598	131469598	+	Missense_Mutation	SNP	G	G	A	rs201793972		TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr9:131469598G>A	ENST00000291906.4	+	6	1142	c.749G>A	c.(748-750)cGc>cAc	p.R250H	RN7SL560P_ENST00000577943.1_RNA	NM_013355.3	NP_037487.2	Q6P5Z2	PKN3_HUMAN	protein kinase N3	250					epithelial cell migration (GO:0010631)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)	p.R250H(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24						CACCCTTTGCGCAGCAGAGTG	0.637																																					p.R250H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G749A	9						.	G	HIS/ARG	0,4406		0,0,2203	36.0	37.0	37.0		749	3.8	0.1	9		37	2,8598	2.2+/-6.3	0,2,4298	yes	missense	PKN3	NM_013355.3	29	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	possibly-damaging	250/890	131469598	2,13004	2203	4300	6503	130509419	SO:0001583	missense	29941	exon6			AB019692	CCDS6908.1	9q34.13	2008-02-05			ENSG00000160447	ENSG00000160447			17999	protein-coding gene	gene with protein product		610714				10441506	Standard	NM_013355		Approved	PKNbeta	uc004bvw.3	Q6P5Z2	OTTHUMG00000020757	ENST00000291906.4:c.749G>A	9.37:g.131469598G>A	ENSP00000291906:p.Arg250His	Somatic		Capture	Illumina HiSeq	Phase_I	130509419	NM_013355	Q9UM03	Missense_Mutation	SNP	ENST00000291906.4	37	CCDS6908.1	.	.	.	.	.	.	.	.	.	.	G	7.263	0.605586	0.14002	0.0	2.33E-4	ENSG00000160447	ENST00000291906	T	0.68479	-0.33	5.67	3.85	0.44370	.	.	.	.	.	T	0.60209	0.2251	M	0.65975	2.015	0.35970	D	0.835245	B;B	0.26775	0.159;0.044	B;B	0.22386	0.039;0.027	T	0.61282	-0.7094	9	0.37606	T	0.19	.	7.6724	0.28465	0.2541:0.0:0.7459:0.0	.	250;250	Q05BU1;Q6P5Z2	.;PKN3_HUMAN	H	250	ENSP00000291906:R250H	ENSP00000291906:R250H	R	+	2	0	PKN3	130509419	0.965000	0.33210	0.113000	0.21522	0.258000	0.26162	2.736000	0.47385	0.765000	0.33221	0.561000	0.74099	CGC		PKN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054487.1	NM_013355	
SDCCAG3	10807	broad.mit.edu	37	9	139302015	139302016	+	Splice_Site	DEL	TA	TA	-	rs551235795|rs36076555|rs546938088	byFrequency	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	TA	TA					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chr9:139302015_139302016delTA	ENST00000357365.3	-	5	532		c.e5-2		SDCCAG3_ENST00000461693.1_5'Flank|SDCCAG3_ENST00000371725.3_Splice_Site|SDCCAG3_ENST00000298537.7_Splice_Site	NM_001039707.1	NP_001034796.1	Q96C92	SDCG3_HUMAN	serologically defined colon cancer antigen 3							cytoplasm (GO:0005737)		p.?(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|large_intestine(1)|lung(9)	16		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;8.18e-06)|Epithelial(140;9.31e-06)		CGAGGCTTCCTaaaaaaaaaaa	0.500																																					.												.	.	1	Unknown(1)	large_intestine(1)	.	9						.																																			138421837	SO:0001630	splice_region_variant	10807	.			AF039688	CCDS6999.2, CCDS43903.1, CCDS43904.1	9q34.3	2010-10-27			ENSG00000165689	ENSG00000165689			10667	protein-coding gene	gene with protein product						9610721	Standard	XM_005266050		Approved	NY-CO-3	uc004chi.3	Q96C92	OTTHUMG00000020928	ENST00000357365.3:c.403-2TA>-	9.37:g.139302015_139302016delTA		Somatic		Capture	Illumina HiSeq	Phase_I	138421836	.	A6NCP1|O60525|Q5SXN1|Q5SXN2|Q5SXN3|Q5SXN4|Q5SXN8|Q6V704|Q9NVY5	Splice_Site	DEL	ENST00000357365.3	37	CCDS43904.1																																																																																				SDCCAG3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055060.2	NM_006643	Intron
BEX5	340542	broad.mit.edu	37	X	101408940	101408940	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chrX:101408940G>A	ENST00000543160.1	-	3	599	c.298C>T	c.(298-300)Cac>Tac	p.H100Y	BEX5_ENST00000484837.1_5'Flank|BEX5_ENST00000333643.3_Missense_Mutation_p.H100Y	NM_001159560.1	NP_001153032.1	Q5H9J7	BEX5_HUMAN	brain expressed, X-linked 5	100						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.H100Y(1)		large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	4						TGATCATGGTGAGGAGGGTCC	0.418																																					p.H100Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C298T	X						.						244.0	186.0	206.0					X																	101408940		2203	4300	6503	101295596	SO:0001583	missense	340542	exon3			BC042818	CCDS35350.1	Xq22.1	2014-03-21	2008-11-04	2007-08-24	ENSG00000184515	ENSG00000184515			27990	protein-coding gene	gene with protein product		300693	"""NGFRAP1-like 1"", ""BEX family member 5"""	NGFRAP1L1		16221301	Standard	NM_001012978		Approved		uc004eir.3	Q5H9J7	OTTHUMG00000022049	ENST00000543160.1:c.298C>T	X.37:g.101408940G>A	ENSP00000446054:p.His100Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	101295596	NM_001159560	Q569J0|Q56A74	Missense_Mutation	SNP	ENST00000543160.1	37	CCDS35350.1	.	.	.	.	.	.	.	.	.	.	G	12.09	1.834688	0.32421	.	.	ENSG00000184515	ENST00000543160;ENST00000333643	T;T	0.13901	2.55;2.55	4.0	4.0	0.46444	.	0.220455	0.23245	N	0.050314	T	0.21145	0.0509	M	0.64170	1.965	0.23879	N	0.996581	B	0.30104	0.268	B	0.41619	0.361	T	0.09357	-1.0678	10	0.46703	T	0.11	.	10.6123	0.45429	0.0:0.0:1.0:0.0	.	100	Q5H9J7	BEX5_HUMAN	Y	100	ENSP00000446054:H100Y;ENSP00000328030:H100Y	ENSP00000328030:H100Y	H	-	1	0	BEX5	101295596	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	1.398000	0.34554	2.265000	0.75225	0.544000	0.68410	CAC		BEX5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057607.1	XM_291335	
SLC25A43	203427	broad.mit.edu	37	X	118540508	118540508	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chrX:118540508A>G	ENST00000217909.7	+	2	705	c.361A>G	c.(361-363)Acc>Gcc	p.T121A	SLC25A43_ENST00000488158.1_3'UTR|SLC25A43_ENST00000336249.7_Missense_Mutation_p.T121A	NM_145305.2	NP_660348.2	Q8WUT9	S2543_HUMAN	solute carrier family 25, member 43	121					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)		p.T121A(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|skin(1)	9						CATGGTTTCCACCATTGTAAC	0.488																																					p.T121A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A361G	X						.						103.0	91.0	95.0					X																	118540508		2203	4300	6503	118424536	SO:0001583	missense	203427	exon2			BC019584	CCDS14577.1	Xq24	2013-05-22			ENSG00000077713	ENSG00000077713		"""Solute carriers"""	30557	protein-coding gene	gene with protein product		300641				16949250	Standard	NM_145305		Approved		uc004erd.3	Q8WUT9	OTTHUMG00000022272	ENST00000217909.7:c.361A>G	X.37:g.118540508A>G	ENSP00000217909:p.Thr121Ala	Somatic		Capture	Illumina HiSeq	Phase_I	118424536	NM_145305	O75854|Q8N9L5	Missense_Mutation	SNP	ENST00000217909.7	37	CCDS14577.1	.	.	.	.	.	.	.	.	.	.	A	10.59	1.392227	0.25118	.	.	ENSG00000077713	ENST00000217909;ENST00000336249;ENST00000326714	T;T	0.77098	-1.07;-1.07	4.9	4.9	0.64082	Mitochondrial carrier domain (2);	0.119454	0.64402	D	0.000015	T	0.55465	0.1922	N	0.04636	-0.2	0.38275	D	0.94227	P;B	0.37207	0.587;0.34	B;B	0.38225	0.268;0.129	T	0.59862	-0.7374	10	0.33141	T	0.24	.	7.7459	0.28869	0.9045:0.0:0.0955:0.0	.	121;121	B4E1P8;Q8WUT9	.;S2543_HUMAN	A	121;121;69	ENSP00000217909:T121A;ENSP00000338628:T121A	ENSP00000217909:T121A	T	+	1	0	SLC25A43	118424536	1.000000	0.71417	0.985000	0.45067	0.917000	0.54804	5.132000	0.64758	1.619000	0.50296	0.237000	0.17872	ACC		SLC25A43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058028.1	NM_145305	
RHOXF2	84528	broad.mit.edu	37	X	119293304	119293304	+	Missense_Mutation	SNP	C	C	T	rs370729029		TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chrX:119293304C>T	ENST00000371388.3	+	2	653	c.463C>T	c.(463-465)Cgc>Tgc	p.R155C		NM_032498.1	NP_115887.1	Q9BQY4	RHXF2_HUMAN	Rhox homeobox family, member 2	155					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.R155C(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(1)|skin(2)	8						CATTTTCCAACGCGAGCAGTT	0.657																																					p.R155C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C463T	X						.	T	CYS/ARG	1,3827		0,1,1629,568	38.0	38.0	38.0		463	-1.0	0.0	X		38	0,6722		0,0,2426,1870	no	missense	RHOXF2	NM_032498.1	180	0,1,4055,2438	TT,TC,CC,C		0.0,0.0261,0.0095	benign	155/289	119293304	1,10549	2198	4296	6494	119177332	SO:0001583	missense	727940	exon2				CCDS14594.1	Xq24	2012-12-20			ENSG00000131721	ENSG00000131721		"""Homeoboxes / PRD class"""	30011	protein-coding gene	gene with protein product	"""cancer/testis antigen 107"""	300447				12490318	Standard	NM_032498		Approved	THG1, PEPP-2, PEPP2, CT107		Q9BQY4	OTTHUMG00000022296	ENST00000371388.3:c.463C>T	X.37:g.119293304C>T	ENSP00000360441:p.Arg155Cys	Somatic		Capture	Illumina HiSeq	Phase_I	119177332	NM_032498	Q9BR00	Missense_Mutation	SNP	ENST00000371388.3	37	CCDS14594.1	.	.	.	.	.	.	.	.	.	.	c	8.307	0.821192	0.16678	2.61E-4	0.0	ENSG00000131721	ENST00000371388	D	0.96365	-3.99	2.07	-1.0	0.10196	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	.	.	.	.	D	0.96040	0.8710	L	0.58302	1.8	0.09310	N	1	D	0.89917	1.0	D	0.68353	0.957	D	0.88611	0.3156	9	0.46703	T	0.11	0.2847	2.8747	0.05627	0.0:0.4245:0.2397:0.3358	.	155	Q9BQY4	RHXF2_HUMAN	C	155	ENSP00000360441:R155C	ENSP00000360441:R155C	R	+	1	0	RHOXF2	119177332	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.550000	0.06034	-0.412000	0.07519	-0.405000	0.06341	CGC		RHOXF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411977.1	NM_032498	
THOC2	57187	broad.mit.edu	37	X	122747961	122747961	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chrX:122747961C>G	ENST00000245838.8	-	34	4422	c.4391G>C	c.(4390-4392)aGg>aCg	p.R1464T	THOC2_ENST00000497887.1_5'UTR|THOC2_ENST00000491737.1_Missense_Mutation_p.R1349T|THOC2_ENST00000355725.4_Missense_Mutation_p.R1464T	NM_001081550.1	NP_001075019.1	Q8NI27	THOC2_HUMAN	THO complex 2	1464	Lys-rich.				mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)	p.R1385T(1)|p.R1464T(1)		breast(2)|endometrium(13)|kidney(4)|large_intestine(11)|lung(26)|ovary(3)|skin(1)|upper_aerodigestive_tract(3)	63						GGATCTTTCCCTTGACTTGTC	0.353																																					p.R1464T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G4391C	X						.						137.0	117.0	123.0					X																	122747961		1835	4073	5908	122575642	SO:0001583	missense	57187	exon34			AF441770	CCDS43988.1	Xq25-q26.3	2013-02-11	2004-08-09		ENSG00000125676	ENSG00000125676		"""THO complex subunits"""	19073	protein-coding gene	gene with protein product		300395	"""chromosome X open reading frame 3"""	CXorf3		11979277	Standard	NM_001081550		Approved	THO2, dJ506G2.1	uc004etu.3	Q8NI27	OTTHUMG00000022334	ENST00000245838.8:c.4391G>C	X.37:g.122747961C>G	ENSP00000245838:p.Arg1464Thr	Somatic		Capture	Illumina HiSeq	Phase_I	122575642	NM_001081550	A6NM50|Q5JZ12|Q6IN92|Q9H8I6	Missense_Mutation	SNP	ENST00000245838.8	37	CCDS43988.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.27|16.27	3.076514|3.076514	0.55753|0.55753	.|.	.|.	ENSG00000125676|ENSG00000125676	ENST00000448128;ENST00000441692|ENST00000245838;ENST00000355725;ENST00000416618;ENST00000491737	.|.	.|.	.|.	6.06|6.06	6.06|6.06	0.98353|0.98353	.|.	.|0.211412	.|0.40469	.|N	.|0.001085	T|T	0.51210|0.51210	0.1661|0.1661	L|L	0.29908|0.29908	0.895|0.895	0.51012|0.51012	D|D	0.999902|0.999902	.|P	.|0.43094	.|0.799	.|B	.|0.40901	.|0.343	T|T	0.50406|0.50406	-0.8832|-0.8832	5|9	.|0.41790	.|T	.|0.15	-12.7597|-12.7597	19.5104|19.5104	0.95139|0.95139	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1464	.|Q8NI27	.|THOC2_HUMAN	R|T	60;259|1464;1464;53;1349	.|.	.|ENSP00000245838:R1464T	G|R	-|-	1|2	0|0	THOC2|THOC2	122575642|122575642	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.645000|4.645000	0.61404|0.61404	2.562000|2.562000	0.86427|0.86427	0.600000|0.600000	0.82982|0.82982	GGG|AGG		THOC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058153.3		
BCORL1	63035	broad.mit.edu	37	X	129149172	129149172	+	Silent	SNP	G	G	A	rs138691600	byFrequency	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chrX:129149172G>A	ENST00000218147.7	+	4	2621	c.2424G>A	c.(2422-2424)acG>acA	p.T808T	BCORL1_ENST00000303743.5_Silent_p.T808T|BCORL1_ENST00000540052.1_Silent_p.T808T|BCORL1_ENST00000359304.2_Silent_p.T808T			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	808					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.T808T(1)		breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						GGAAACCCACGGGGCCGGCAA	0.587													g|||	1	0.000264901	0.0	0.0	3775	,	,		13008	0.001		0.0	False		,,,				2504	0.0				p.T808T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2424A	X						.			4,3831		0,4,1628,571	48.0	52.0	50.0		2424	-10.1	0.2	X	dbSNP_134	50	1,6727		0,1,2427,1872	no	coding-synonymous	BCORL1	NM_021946.4		0,5,4055,2443	AA,AG,GG,G		0.0149,0.1043,0.0473		808/1712	129149172	5,10558	2203	4300	6503	128976853	SO:0001819	synonymous_variant	63035	exon3			AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.2424G>A	X.37:g.129149172G>A		Somatic		Capture	Illumina HiSeq	Phase_I	128976853	NM_021946	B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Silent	SNP	ENST00000218147.7	37	CCDS14616.1	.	.	.	.	.	.	.	.	.	.	g	3.461	-0.109973	0.06924	0.001043	1.49E-4	ENSG00000085185	ENST00000441294	.	.	.	5.05	-10.1	0.00402	.	.	.	.	.	T	0.25344	0.0616	.	.	.	0.34683	D	0.724941	.	.	.	.	.	.	T	0.25117	-1.0141	4	.	.	.	-0.8613	1.0064	0.01488	0.4458:0.1733:0.2075:0.1733	.	.	.	.	R	244	.	.	G	+	1	0	BCORL1	128976853	0.009000	0.17119	0.221000	0.23827	0.990000	0.78478	-1.000000	0.03693	-1.750000	0.01328	0.431000	0.28591	GGG		BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058223.1	NM_021946	
FAM127C	441518	broad.mit.edu	37	X	134156395	134156395	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chrX:134156395G>A	ENST00000391440.1	-	1	164	c.95C>T	c.(94-96)aCg>aTg	p.T32M		NM_001078173.1	NP_001071641.1	Q17RB0	F127C_HUMAN	family with sequence similarity 127, member C	32								p.T32M(1)		breast(1)|endometrium(2)|large_intestine(1)|lung(2)	6	Acute lymphoblastic leukemia(192;0.000127)					GCCATCAAACGTCTCGGGAAA	0.642																																					p.T32M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C95T	X						.						86.0	92.0	90.0					X																	134156395		2068	4180	6248	133984061	SO:0001583	missense	441518	exon1			BC048268	CCDS43996.1	Xq26.3	2014-05-16			ENSG00000212747	ENSG00000212747			33156	protein-coding gene	gene with protein product						9403077, 15716091	Standard	NM_001078173		Approved	MAR8B, CXX1c	uc004eyc.1	Q17RB0	OTTHUMG00000022464	ENST00000391440.1:c.95C>T	X.37:g.134156395G>A	ENSP00000375268:p.Thr32Met	Somatic		Capture	Illumina HiSeq	Phase_I	133984061	NM_001078173		Missense_Mutation	SNP	ENST00000391440.1	37	CCDS43996.1	.	.	.	.	.	.	.	.	.	.	g	5.201	0.222557	0.09863	.	.	ENSG00000212747	ENST00000391440	T	0.31510	1.49	2.35	-0.533	0.11887	.	0.732309	0.10625	U	0.652887	T	0.19765	0.0475	L	0.44542	1.39	0.22185	N	0.999302	P	0.35793	0.521	B	0.30401	0.115	T	0.13710	-1.0499	10	0.33940	T	0.23	.	4.9884	0.14202	0.553:0.0:0.447:0.0	.	32	Q17RB0	F127C_HUMAN	M	32	ENSP00000375268:T32M	ENSP00000375268:T32M	T	-	2	0	FAM127C	133984061	0.999000	0.42202	0.865000	0.33974	0.062000	0.15995	0.464000	0.21988	-0.284000	0.09102	-0.494000	0.04653	ACG		FAM127C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058389.2	NM_001078173	
ZIC3	7547	broad.mit.edu	37	X	136649341	136649341	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chrX:136649341G>A	ENST00000287538.5	+	1	1041	c.491G>A	c.(490-492)gGg>gAg	p.G164E	RP1-137H15.2_ENST00000442841.1_RNA|ZIC3_ENST00000370606.3_Missense_Mutation_p.G164E	NM_003413.3	NP_003404.1	O60481	ZIC3_HUMAN	Zic family member 3	164					anterior/posterior pattern specification (GO:0009952)|cell differentiation (GO:0030154)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of left/right asymmetry in nervous system (GO:0035545)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|heart looping (GO:0001947)|lung development (GO:0030324)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G164E(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|soft_tissue(2)|urinary_tract(1)	37	Acute lymphoblastic leukemia(192;0.000127)					CTGTTTCCCGGGCTGCATGAG	0.706																																					p.G164E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G491A	X						.						22.0	25.0	24.0					X																	136649341		2156	4205	6361	136477007	SO:0001583	missense	7547	exon1			AF028706	CCDS14663.1	Xq24-q27.1	2013-01-08	2011-05-19		ENSG00000156925	ENSG00000156925		"""Zinc fingers, C2H2-type"""	12874	protein-coding gene	gene with protein product		300265	"""heterotaxy 1"", ""Zic family member 3 (odd-paired homolog, Drosophila)"""	HTX1		8298651, 7747776	Standard	NM_003413		Approved	HTX, ZNF203	uc004fak.3	O60481	OTTHUMG00000022525	ENST00000287538.5:c.491G>A	X.37:g.136649341G>A	ENSP00000287538:p.Gly164Glu	Somatic		Capture	Illumina HiSeq	Phase_I	136477007	NM_003413	B2CNW4|Q14DE5|Q5JY75	Missense_Mutation	SNP	ENST00000287538.5	37	CCDS14663.1	.	.	.	.	.	.	.	.	.	.	g	20.3	3.967465	0.74131	.	.	ENSG00000156925	ENST00000287538;ENST00000370606	D;D	0.90069	-2.61;-2.61	4.68	4.68	0.58851	.	0.000000	0.85682	D	0.000000	D	0.93861	0.8036	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94651	0.7839	10	0.87932	D	0	.	15.2367	0.73436	0.0:0.0:1.0:0.0	.	164	O60481	ZIC3_HUMAN	E	164	ENSP00000287538:G164E;ENSP00000359638:G164E	ENSP00000287538:G164E	G	+	2	0	ZIC3	136477007	1.000000	0.71417	0.998000	0.56505	0.885000	0.51271	9.234000	0.95347	2.155000	0.67459	0.597000	0.82753	GGG		ZIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058526.1		
RPS6KA3	6197	broad.mit.edu	37	X	20213249	20213249	+	Missense_Mutation	SNP	G	G	A	rs122454127		TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chrX:20213249G>A	ENST00000379565.3	-	5	547	c.340C>T	c.(340-342)Cgg>Tgg	p.R114W	RPS6KA3_ENST00000540702.1_Missense_Mutation_p.R86W|RPS6KA3_ENST00000544447.1_Missense_Mutation_p.R86W|RPS6KA3_ENST00000379548.4_Missense_Mutation_p.R85W	NM_004586.2	NP_004577.1	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 3	114	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.		R -> W (in CLS). {ECO:0000269|PubMed:10094187}.		axon guidance (GO:0007411)|cell cycle (GO:0007049)|central nervous system development (GO:0007417)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.R114W(1)		breast(4)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(14)|lung(7)|ovary(1)|stomach(1)	41					Acetylsalicylic acid(DB00945)	ATTTTTGTCCGAACTCGGTCT	0.348																																					p.R114W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C340T	X	GRCh37	CM992428	RPS6KA3	M	rs122454127	.						175.0	134.0	148.0					X																	20213249		2203	4300	6503	20123170	SO:0001583	missense	6197	exon5			U08316	CCDS14197.1	Xp22.2-p22.1	2013-06-03	2002-08-29		ENSG00000177189	ENSG00000177189			10432	protein-coding gene	gene with protein product		300075	"""ribosomal protein S6 kinase, 90kD, polypeptide 3"", ""mental retardation, X-linked 19"", ""Coffin-Lowry syndrome"""	MRX19, CLS		8141249, 11896450, 16879200	Standard	XM_005274573		Approved	RSK, RSK2, HU-3	uc004czu.3	P51812	OTTHUMG00000021231	ENST00000379565.3:c.340C>T	X.37:g.20213249G>A	ENSP00000368884:p.Arg114Trp	Somatic		Capture	Illumina HiSeq	Phase_I	20123170	NM_004586	B2R9V4|Q4VAP3|Q59H26|Q5JPK8|Q7Z3Z7	Missense_Mutation	SNP	ENST00000379565.3	37	CCDS14197.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.156830	0.78114	.	.	ENSG00000177189	ENST00000379565;ENST00000544447;ENST00000379548;ENST00000540702;ENST00000457145;ENST00000438357	T;T;T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23;-0.23;-0.23	6.08	6.08	0.98989	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.80071	0.4556	M	0.67953	2.075	0.80722	A	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.80764	0.969;0.99;0.992;0.994	D	0.83586	0.0120	9	0.87932	D	0	.	14.3571	0.66745	0.0:0.0:0.8523:0.1477	.	86;85;86;114	B4DG22;F5GYC4;B7ZB17;P51812	.;.;.;KS6A3_HUMAN	W	114;86;85;86;85;86	ENSP00000368884:R114W;ENSP00000440220:R86W;ENSP00000368865:R85W;ENSP00000444837:R86W;ENSP00000407655:R85W;ENSP00000388512:R86W	ENSP00000368865:R85W	R	-	1	2	RPS6KA3	20123170	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.212000	0.42835	2.562000	0.86427	0.600000	0.82982	CGG		RPS6KA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056011.3	NM_004586	
DCAF8L1	139425	broad.mit.edu	37	X	27998645	27998645	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chrX:27998645T>A	ENST00000441525.1	-	1	921	c.807A>T	c.(805-807)gaA>gaT	p.E269D		NM_001017930.1	NP_001017930.1	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	269								p.E269D(1)		NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(24)|ovary(3)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	56						CATTAATTAGTTCTGCTACCC	0.493																																					p.E269D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A807T	X						.						91.0	79.0	83.0					X																	27998645		2202	4300	6502	27908566	SO:0001583	missense	139425	exon1				CCDS35222.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17	ENSG00000226372	ENSG00000226372		"""WD repeat domain containing"""	31810	protein-coding gene	gene with protein product			"""WD repeat domain 42B"""	WDR42B			Standard	NM_001017930		Approved		uc004dbx.1	A6NGE4	OTTHUMG00000021312	ENST00000441525.1:c.807A>T	X.37:g.27998645T>A	ENSP00000405222:p.Glu269Asp	Somatic		Capture	Illumina HiSeq	Phase_I	27908566	NM_001017930	B3KXX1	Missense_Mutation	SNP	ENST00000441525.1	37	CCDS35222.1	.	.	.	.	.	.	.	.	.	.	T	9.527	1.109827	0.20714	.	.	ENSG00000226372	ENST00000441525	T	0.75367	-0.93	0.842	-0.423	0.12325	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.122849	0.52532	D	0.000066	T	0.48943	0.1528	L	0.28274	0.84	0.34966	D	0.752637	B	0.20780	0.048	B	0.22753	0.041	T	0.46190	-0.9209	10	0.02654	T	1	-0.9607	3.966	0.09431	0.0:0.2753:0.0:0.7247	.	269	A6NGE4	DC8L1_HUMAN	D	269	ENSP00000405222:E269D	ENSP00000405222:E269D	E	-	3	2	DCAF8L1	27908566	0.996000	0.38824	0.006000	0.13384	0.142000	0.21351	0.076000	0.14712	-0.206000	0.10203	0.235000	0.17854	GAA		DCAF8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056150.2	XM_066690	
FAM47B	170062	broad.mit.edu	37	X	34962025	34962025	+	Silent	SNP	C	C	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chrX:34962025C>T	ENST00000329357.5	+	1	1113	c.1077C>T	c.(1075-1077)gaC>gaT	p.D359D		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	359								p.D359D(1)		breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						AGCTGGAAGACGCACGGGCTC	0.537																																					p.D359D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1077T	X						.						44.0	42.0	43.0					X																	34962025		2202	4300	6502	34871946	SO:0001819	synonymous_variant	170062	exon1			BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.1077C>T	X.37:g.34962025C>T		Somatic		Capture	Illumina HiSeq	Phase_I	34871946	NM_152631	Q5JQN5|Q6PIG3	Silent	SNP	ENST00000329357.5	37	CCDS14236.1																																																																																				FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056211.1	NM_152631	
HUWE1	10075	broad.mit.edu	37	X	53566740	53566740	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chrX:53566740T>A	ENST00000342160.3	-	74	11967	c.11510A>T	c.(11509-11511)aAg>aTg	p.K3837M	HUWE1_ENST00000262854.6_Missense_Mutation_p.K3837M			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	3837					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.K3727M(1)		NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						TCTTTCTTCCTTTTCCTTCTC	0.512																																					p.K3837M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A11510T	X						.						77.0	61.0	66.0					X																	53566740		2203	4300	6503	53583465	SO:0001583	missense	10075	exon75			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.11510A>T	X.37:g.53566740T>A	ENSP00000340648:p.Lys3837Met	Somatic		Capture	Illumina HiSeq	Phase_I	53583465	NM_031407	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	37	CCDS35301.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.76|12.76	2.033944|2.033944	0.35893|0.35893	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000342160;ENST00000262854|ENST00000427052;ENST00000426907	T;T|.	0.38401|.	1.14;1.14|.	5.44|5.44	5.44|5.44	0.79542|0.79542	.|.	0.274568|0.274568	0.21571|0.21571	U|U	0.072410|0.072410	T|T	0.23133|0.23133	0.0559|0.0559	N|N	0.03608|0.03608	-0.345|-0.345	0.30770|0.30770	N|N	0.743109|0.743109	P;B;P|.	0.49253|.	0.921;0.41;0.681|.	B;B;P|.	0.45138|.	0.378;0.28;0.471|.	T|T	0.20806|0.20806	-1.0264|-1.0264	10|6	0.62326|.	D|.	0.03|.	.|.	13.4881|13.4881	0.61377|0.61377	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	659;3837;3821|.	Q5H935;Q7Z6Z7;Q7Z6Z7-2|.	.;HUWE1_HUMAN;.|.	M|N	3837|2870;659	ENSP00000340648:K3837M;ENSP00000262854:K3837M|.	ENSP00000262854:K3837M|.	K|K	-|-	2|3	0|2	HUWE1|HUWE1	53583465|53583465	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.909000|0.909000	0.53808|0.53808	3.411000|3.411000	0.52672|0.52672	1.828000|1.828000	0.53243|0.53243	0.486000|0.486000	0.48141|0.48141	AAG|AAA		HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	
MED12	9968	broad.mit.edu	37	X	70354693	70354693	+	Silent	SNP	T	T	C			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chrX:70354693T>C	ENST00000374080.3	+	35	4890	c.4858T>C	c.(4858-4860)Ttg>Ctg	p.L1620L	MED12_ENST00000333646.6_Silent_p.L1620L|MED12_ENST00000374102.1_Silent_p.L1620L			Q93074	MED12_HUMAN	mediator complex subunit 12	1620	Interaction with CTNNB1 and GLI3.				androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.L1620L(2)		breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					GGCGAAGAAGTTGCAGGTAAG	0.532			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																														p.L1620L			Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T4858C	X						.						60.0	54.0	56.0					X																	70354693		2086	4203	6289	70271418	SO:0001819	synonymous_variant	9968	exon35			U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.4858T>C	X.37:g.70354693T>C		Somatic		Capture	Illumina HiSeq	Phase_I	70271418	NM_005120	O15410|O75557|Q9UHV6|Q9UND7	Silent	SNP	ENST00000374080.3	37	CCDS43970.1																																																																																				MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057105.1	NM_005120	
PCDH19	57526	broad.mit.edu	37	X	99661801	99661801	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chrX:99661801C>T	ENST00000373034.4	-	1	3470	c.1795G>A	c.(1795-1797)Gaa>Aaa	p.E599K	PCDH19_ENST00000420881.2_Missense_Mutation_p.E599K|PCDH19_ENST00000255531.7_Missense_Mutation_p.E599K	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	599	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E100K(2)|p.E599K(2)		breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						CGGCCATTTTCGCCCTCATCG	0.567																																					p.E599K												.	.	4	Substitution - Missense(4)	large_intestine(2)|endometrium(2)	c.G1795A	X						.						79.0	74.0	76.0					X																	99661801		2063	4172	6235	99548457	SO:0001583	missense	57526	exon1			AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.1795G>A	X.37:g.99661801C>T	ENSP00000362125:p.Glu599Lys	Somatic		Capture	Illumina HiSeq	Phase_I	99548457	NM_001105243	B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Missense_Mutation	SNP	ENST00000373034.4	37	CCDS55462.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.114673	0.77210	.	.	ENSG00000165194	ENST00000420881;ENST00000373034;ENST00000255531	T;T;T	0.51574	0.7;0.7;0.7	5.84	5.84	0.93424	Cadherin (4);Cadherin-like (1);	0.046633	0.85682	D	0.000000	T	0.66107	0.2756	L	0.58510	1.815	0.80722	D	1	D;D;D	0.69078	0.993;0.997;0.997	P;D;D	0.67231	0.823;0.916;0.95	T	0.65709	-0.6102	10	0.52906	T	0.07	.	19.0738	0.93151	0.0:1.0:0.0:0.0	.	599;599;599	Q8TAB3;Q8TAB3-2;E9PAM6	PCD19_HUMAN;.;.	K	599	ENSP00000400327:E599K;ENSP00000362125:E599K;ENSP00000255531:E599K	ENSP00000255531:E599K	E	-	1	0	PCDH19	99548457	1.000000	0.71417	0.922000	0.36590	0.928000	0.56348	7.818000	0.86416	2.454000	0.82982	0.513000	0.50165	GAA		PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057479.2	NM_020766	
MAMLD1	10046	broad.mit.edu	37	X	149613800	149613800	+	Missense_Mutation	SNP	T	T	A	rs200035082		TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3854-01A-01W-0900-09	TCGA-AA-3854-10A-01W-0900-09	g.chrX:149613800T>A	ENST00000370401.2	+	2	328	c.18T>A	c.(16-18)agT>agA	p.S6R	MAMLD1_ENST00000426613.2_Missense_Mutation_p.S6R|MAMLD1_ENST00000468306.1_Intron|MAMLD1_ENST00000432680.2_Missense_Mutation_p.S6R|MAMLD1_ENST00000262858.5_Missense_Mutation_p.S6R			Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	6					male gonad development (GO:0008584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.S6R(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)	37	Acute lymphoblastic leukemia(192;6.56e-05)					ACTGGAAAAGTCGGCTTGTAA	0.498																																					p.S6R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T18A	X						.						75.0	71.0	72.0					X																	149613800		1878	4108	5986	149364458	SO:0001583	missense	10046	exon1			U46023	CCDS14693.2, CCDS55525.1, CCDS55526.1	Xq28	2008-02-05	2008-01-03	2008-01-03	ENSG00000013619	ENSG00000013619			2568	protein-coding gene	gene with protein product		300120	"""chromosome X open reading frame 6"""	CXorf6		9169146, 17086185, 18162467	Standard	NM_001177465		Approved	CG1, F18	uc011mxu.2	Q13495	OTTHUMG00000024157	ENST00000370401.2:c.18T>A	X.37:g.149613800T>A	ENSP00000359428:p.Ser6Arg	Somatic		Capture	Illumina HiSeq	Phase_I	149364458	NM_001177466	B2RCQ4|B4DG93|B9EGA5	Missense_Mutation	SNP	ENST00000370401.2	37	CCDS14693.2	.	.	.	.	.	.	.	.	.	.	T	18.80	3.701071	0.68501	.	.	ENSG00000013619	ENST00000370401;ENST00000432680;ENST00000358892;ENST00000262858;ENST00000426613	T;T;T;T	0.68765	0.07;-0.35;0.07;0.05	5.31	1.95	0.26073	.	.	.	.	.	T	0.61451	0.2348	L	0.51422	1.61	0.53005	D	0.999961	P;P;P	0.52061	0.703;0.904;0.95	B;P;P	0.49887	0.323;0.571;0.625	T	0.64761	-0.6331	9	0.87932	D	0	-3.306	2.9202	0.05766	0.3204:0.1149:0.0:0.5647	.	6;6;6	Q13495-4;Q13495-3;Q13495	.;.;MAMD1_HUMAN	R	6	ENSP00000359428:S6R;ENSP00000414517:S6R;ENSP00000262858:S6R;ENSP00000397438:S6R	ENSP00000262858:S6R	S	+	3	2	MAMLD1	149364458	0.999000	0.42202	1.000000	0.80357	0.992000	0.81027	1.692000	0.37731	1.762000	0.52044	0.417000	0.27973	AGT		MAMLD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060844.2	NM_005491	
