#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PTCHD3	374308	broad.mit.edu	37	10	27702213	27702213	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr10:27702213G>A	ENST00000438700.3	-	1	1084	c.967C>T	c.(967-969)Cgg>Tgg	p.R323W		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	323					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)	p.R323W(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						TACAGCAGCCGCATGGCTTTG	0.562																																					p.R323W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C967T	10						.						90.0	92.0	91.0					10																	27702213		2203	4300	6503	27742219	SO:0001583	missense	374308	exon1			AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.967C>T	10.37:g.27702213G>A	ENSP00000417658:p.Arg323Trp	Somatic		Capture	Illumina HiSeq	Phase_I	27742219	NM_001034842	I3L499|Q6ZU28	Missense_Mutation	SNP	ENST00000438700.3	37	CCDS31173.1	.	.	.	.	.	.	.	.	.	.	G	17.45	3.392059	0.62066	.	.	ENSG00000182077	ENST00000438700	D	0.86230	-2.09	3.98	-2.12	0.07165	.	0.359741	0.27442	N	0.019352	T	0.82135	0.4971	L	0.55834	1.745	0.09310	N	0.999994	P	0.46859	0.885	P	0.48598	0.583	T	0.73646	-0.3917	10	0.66056	D	0.02	-9.0966	1.9809	0.03426	0.1759:0.1015:0.3625:0.3601	.	323	Q3KNS1	PTHD3_HUMAN	W	323	ENSP00000417658:R323W	ENSP00000417658:R323W	R	-	1	2	PTCHD3	27742219	0.185000	0.23213	0.031000	0.17742	0.761000	0.43186	-0.894000	0.04123	-0.167000	0.10871	0.561000	0.74099	CGG		PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047325.3	XM_370541	
SAMD8	142891	broad.mit.edu	37	10	76910295	76910295	+	Silent	SNP	T	T	G			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr10:76910295T>G	ENST00000542569.1	+	2	112	c.9T>G	c.(7-9)ggT>ggG	p.G3G	SAMD8_ENST00000372690.3_Silent_p.G66G|SAMD8_ENST00000372687.4_Silent_p.G3G	NM_001174156.1|NM_144660.2	NP_001167627.1|NP_653261.1	Q96LT4	SAMD8_HUMAN	sterile alpha motif domain containing 8	3					ceramide biosynthetic process (GO:0046513)|regulation of ceramide biosynthetic process (GO:2000303)|sphingomyelin biosynthetic process (GO:0006686)	integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	transferase activity (GO:0016740)	p.G66G(1)|p.G3G(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)	12	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					AAATGGCAGGTCCTAATCAAC	0.418																																					p.G3G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T9G	10						.						80.0	77.0	78.0					10																	76910295		2203	4300	6503	76580301	SO:0001819	synonymous_variant	142891	exon2			AK057811	CCDS7347.1, CCDS53543.1	10q22.3	2013-01-10			ENSG00000156671	ENSG00000156671		"""Sterile alpha motif (SAM) domain containing"""	26320	protein-coding gene	gene with protein product		611575					Standard	NM_144660		Approved	FLJ25082	uc001jwx.2	Q96LT4	OTTHUMG00000018515	ENST00000542569.1:c.9T>G	10.37:g.76910295T>G		Somatic		Capture	Illumina HiSeq	Phase_I	76580301	NM_001174156	Q5JSC5|Q5JSC8|Q66K52	Silent	SNP	ENST00000542569.1	37	CCDS53543.1																																																																																				SAMD8-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_144660	
HPSE2	60495	broad.mit.edu	37	10	100219336	100219336	+	Nonsense_Mutation	SNP	G	G	A	rs369345201		TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr10:100219336G>A	ENST00000370552.3	-	12	1833	c.1774C>T	c.(1774-1776)Cga>Tga	p.R592*	HPSE2_ENST00000370546.1_3'UTR|HPSE2_ENST00000404542.1_Nonsense_Mutation_p.R480*|HPSE2_ENST00000370549.1_Nonsense_Mutation_p.R534*	NM_021828.4	NP_068600.4	Q8WWQ2	HPSE2_HUMAN	heparanase 2 (inactive)	592					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparan sulfate proteoglycan binding (GO:0043395)|heparanase activity (GO:0030305)	p.R592*(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	40				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		ATAGCTTATCGGTAGCGGCAG	0.572																																					p.R480X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1438T	10						.	G	stop/ARG,stop/ARG,,stop/ARG	1,4403	2.1+/-5.4	0,1,2201	71.0	68.0	69.0		1600,1438,,1774	4.4	1.0	10		69	0,8600		0,0,4300	no	stop-gained,stop-gained,utr-3,stop-gained	HPSE2	NM_001166244.1,NM_001166245.1,NM_001166246.1,NM_021828.4	,,,	0,1,6501	AA,AG,GG		0.0,0.0227,0.0077	,,,	534/535,480/481,,592/593	100219336	1,13003	2202	4300	6502	100209326	SO:0001587	stop_gained	60495	exon10			AF282885	CCDS7477.1, CCDS53567.1, CCDS53568.1	10q23-q24	2014-05-09	2014-05-09		ENSG00000172987	ENSG00000172987			18374	protein-coding gene	gene with protein product		613469	"""urofacial syndrome"", ""heparanase 2"""	UFS		11027606, 20605132, 9199567, 20576607	Standard	NM_021828		Approved	HPA2, HPR2	uc001kpn.2	Q8WWQ2	OTTHUMG00000018880	ENST00000370552.3:c.1774C>T	10.37:g.100219336G>A	ENSP00000359583:p.Arg592*	Somatic		Capture	Illumina HiSeq	Phase_I	100209326	NM_001166245	Q5VUH4|Q5VUH5|Q5VUH6|Q8WWQ1|Q9HB37|Q9HB38|Q9HB39	Nonsense_Mutation	SNP	ENST00000370552.3	37	CCDS7477.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.944073	0.73672	2.27E-4	0.0	ENSG00000172987	ENST00000370552;ENST00000370549;ENST00000404542	.	.	.	5.31	4.37	0.52481	.	0.000000	0.49305	D	0.000157	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.3073	15.3602	0.74469	0.0:0.0:0.8602:0.1398	.	.	.	.	X	592;534;480	.	ENSP00000359580:R534X	R	-	1	2	HPSE2	100209326	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	4.165000	0.58196	2.486000	0.83907	0.650000	0.86243	CGA		HPSE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049789.1	NM_021828	
YIF1A	10897	broad.mit.edu	37	11	66055345	66055346	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr11:66055345_66055346insA	ENST00000376901.4	-	3	469_470	c.285_286insT	c.(283-288)tttgctfs	p.A96fs	YIF1A_ENST00000359461.6_Frame_Shift_Ins_p.A96fs|YIF1A_ENST00000496746.1_5'Flank|YIF1A_ENST00000471387.2_Intron|YIF1A_ENST00000526497.1_5'Flank	NM_020470.2	NP_065203.2	O95070	YIF1A_HUMAN	Yip1 interacting factor homolog A (S. cerevisiae)	96					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|microtubule organizing center (GO:0005815)				endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)|stomach(1)	9						GTGTCCACAGCAAAAAAATACT	0.589																																					p.A96fs												.	.	0			c.286_287insT	11						.																																			65811922	SO:0001589	frameshift_variant	10897	exon3			AF004876	CCDS8132.1, CCDS73325.1	11q13	2009-01-05	2005-06-07	2005-06-07	ENSG00000174851	ENSG00000174851			16688	protein-coding gene	gene with protein product		611484	"""Yip1 interacting factor homolog (S. cerevisiae)"""	YIF1		8824393, 10970842, 18718466	Standard	NM_020470		Approved	YIF1P, 54TM, FinGER7	uc001ohk.4	O95070	OTTHUMG00000102079	ENST00000376901.4:c.286dupT	11.37:g.66055352_66055352dupA	ENSP00000366098:p.Ala96fs	None		Capture	Illumina HiSeq	Phase_I	65811921	NM_020470	A6NM00|Q96G83|Q9BVD0	Frame_Shift_Ins	INS	ENST00000376901.4	37	CCDS8132.1																																																																																				YIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219903.3	NM_020470	
CARD18	59082	broad.mit.edu	37	11	105009742	105009743	+	Missense_Mutation	DNP	GC	GC	TT			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	GC	GC					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr11:105009742_105009743GC>TT	ENST00000530950.1	-	2	69_70	c.70_71GC>AA	c.(70-72)GCc>AAc	p.A24N	CARD18_ENST00000532895.1_5'UTR|CARD18_ENST00000526823.1_5'UTR	NM_021571.3	NP_067546.1	P57730	CAR18_HUMAN	caspase recruitment domain family, member 18	24	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				inflammatory response (GO:0006954)|regulation of apoptotic process (GO:0042981)		cysteine-type endopeptidase inhibitor activity (GO:0004869)	p.A24>?(1)		central_nervous_system(1)|ovary(1)	2						ATCCAGCAAGGCATTTATTGTG	0.401																																					.												.	.	1	Complex(1)	large_intestine(1)	c.70_71AA	11						.																																			104514953	SO:0001583	missense	59082	exon2			AY358231	CCDS53705.1	11q22.3	2008-09-02				ENSG00000255501			28861	protein-coding gene	gene with protein product		605354				11051551	Standard	NM_021571		Approved	UNQ5804, ICEBERG, pseudo-ICE	uc021qpy.1	P57730		ENST00000530950.1:c.70_71delinsTT	11.37:g.105009742_105009743delinsTT	ENSP00000436691:p.Ala24Asn	Somatic		Capture	Illumina HiSeq	Phase_I	104514952	NM_021571	A2RRF8	Missense_Mutation	DNP	ENST00000530950.1	37	CCDS53705.1																																																																																				CARD18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388183.2	NM_021571	
GRIA4	2893	broad.mit.edu	37	11	105732825	105732825	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr11:105732825A>T	ENST00000530497.1	+	4	563	c.563A>T	c.(562-564)aAt>aTt	p.N188I	GRIA4_ENST00000282499.5_Missense_Mutation_p.N188I|GRIA4_ENST00000393125.2_Missense_Mutation_p.N188I|GRIA4_ENST00000393127.2_Missense_Mutation_p.N188I|GRIA4_ENST00000525187.1_Missense_Mutation_p.N188I|GRIA4_ENST00000428631.2_Missense_Mutation_p.N188I			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	188					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.N188I(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		TGTGTGGAAAATTTTAATGAT	0.358																																					p.N188I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A563T	11						.						87.0	86.0	86.0					11																	105732825		2202	4298	6500	105238035	SO:0001583	missense	2893	exon5			U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.563A>T	11.37:g.105732825A>T	ENSP00000435775:p.Asn188Ile	Somatic		Capture	Illumina HiSeq	Phase_I	105238035	NM_001077244	Q86XE8	Missense_Mutation	SNP	ENST00000530497.1	37	CCDS8333.1	.	.	.	.	.	.	.	.	.	.	A	17.67	3.447364	0.63178	.	.	ENSG00000152578	ENST00000393125;ENST00000282499;ENST00000393127;ENST00000428631;ENST00000530497;ENST00000525187	T;T;T;T;T;T	0.81078	-1.45;-1.45;-1.45;-1.45;-1.45;-1.45	5.31	5.31	0.75309	Extracellular ligand-binding receptor (1);	0.000000	0.64402	D	0.000009	D	0.83912	0.5357	L	0.61218	1.895	0.53688	D	0.999976	B;P;P;P	0.45078	0.142;0.64;0.85;0.686	B;P;P;P	0.50617	0.178;0.514;0.646;0.548	D	0.84056	0.0372	10	0.42905	T	0.14	.	15.2545	0.73573	1.0:0.0:0.0:0.0	.	188;188;218;188	P48058;G3V164;Q59GL7;Q86XE8	GRIA4_HUMAN;.;.;.	I	188	ENSP00000376833:N188I;ENSP00000282499:N188I;ENSP00000376835:N188I;ENSP00000415551:N188I;ENSP00000435775:N188I;ENSP00000432180:N188I	ENSP00000282499:N188I	N	+	2	0	GRIA4	105238035	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.768000	0.62293	2.004000	0.58718	0.455000	0.32223	AAT		GRIA4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388593.1		
ARNTL	406	broad.mit.edu	37	11	13380009	13380009	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr11:13380009C>T	ENST00000403290.1	+	8	605	c.250C>T	c.(250-252)Cgt>Tgt	p.R84C	ARNTL_ENST00000396441.3_Missense_Mutation_p.R84C|ARNTL_ENST00000389708.3_Missense_Mutation_p.R84C|ARNTL_ENST00000497429.1_3'UTR|ARNTL_ENST00000401424.1_Missense_Mutation_p.R41C|ARNTL_ENST00000361003.4_Missense_Mutation_p.R84C|ARNTL_ENST00000389707.4_Missense_Mutation_p.R84C|ARNTL_ENST00000403482.3_Missense_Mutation_p.R82C|ARNTL_ENST00000403510.3_Missense_Mutation_p.R41C			O00327	BMAL1_HUMAN	aryl hydrocarbon receptor nuclear translocator-like	84	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription, DNA-templated (GO:0045892)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein import into nucleus, translocation (GO:0000060)|regulation of cell cycle (GO:0051726)|regulation of cellular senescence (GO:2000772)|regulation of hair cycle (GO:0042634)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|regulation of type B pancreatic cell development (GO:2000074)|response to redox state (GO:0051775)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|nuclear body (GO:0016604)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor binding (GO:0017162)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|Hsp90 protein binding (GO:0051879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|signal transducer activity (GO:0004871)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.R84C(1)		breast(1)|endometrium(2)|large_intestine(11)|lung(5)|upper_aerodigestive_tract(1)	20				Epithelial(150;0.0243)		TGAAAAGCGGCGTCGGGATAA	0.348																																					p.R41C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C121T	11						.						135.0	144.0	141.0					11																	13380009		2200	4294	6494	13336585	SO:0001583	missense	406	exon8			D89722	CCDS31430.1, CCDS44543.1, CCDS73259.1	11p15	2013-05-21			ENSG00000133794	ENSG00000133794		"""Basic helix-loop-helix proteins"""	701	protein-coding gene	gene with protein product		602550				9144434, 9079689	Standard	XM_005252930		Approved	MOP3, JAP3, BMAL1, PASD3, bHLHe5	uc001mkp.3	O00327	OTTHUMG00000150623	ENST00000403290.1:c.250C>T	11.37:g.13380009C>T	ENSP00000384517:p.Arg84Cys	Somatic		Capture	Illumina HiSeq	Phase_I	13336585	NM_001030273	A2I2N6|A8K645|B5ME11|B7WPG7|D3DQW6|O00313|O00314|O00315|O00316|O00317|Q4G136|Q8IUT4|Q99631|Q99649	Missense_Mutation	SNP	ENST00000403290.1	37		.	.	.	.	.	.	.	.	.	.	C	33	5.231415	0.95207	.	.	ENSG00000133794	ENST00000396441;ENST00000533520;ENST00000529825;ENST00000389707;ENST00000401424;ENST00000529388;ENST00000530357;ENST00000403290;ENST00000361003;ENST00000389708;ENST00000403510;ENST00000482049;ENST00000339640;ENST00000403482	D;D;D;D;D;D;D;D;D;D;D;D;D	0.99722	-6.53;-6.53;-4.05;-6.53;-6.53;-6.53;-6.53;-6.53;-6.53;-6.53;-6.53;-6.53;-6.53	5.73	5.73	0.89815	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.99869	0.9938	H	0.98849	4.35	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.995;0.999;0.999;0.998;0.998;1.0	D	0.96579	0.9429	9	.	.	.	.	17.7463	0.88422	0.0:1.0:0.0:0.0	.	84;82;41;84;84;41	O00327-4;O00327-7;O00327-1;O00327;O00327-8;A2I2N6	.;.;.;BMAL1_HUMAN;.;.	C	84;84;41;84;41;84;41;84;84;84;41;41;40;82	ENSP00000379718:R84C;ENSP00000431488:R84C;ENSP00000434263:R41C;ENSP00000374357:R84C;ENSP00000385915:R41C;ENSP00000433571:R84C;ENSP00000436313:R41C;ENSP00000384517:R84C;ENSP00000354278:R84C;ENSP00000374358:R84C;ENSP00000385581:R41C;ENSP00000436721:R41C;ENSP00000385897:R82C	.	R	+	1	0	ARNTL	13336585	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.593000	0.61034	2.741000	0.93983	0.644000	0.83932	CGT		ARNTL-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000319173.1	NM_001178	
FAM111A	63901	broad.mit.edu	37	11	58920140	58920140	+	Silent	SNP	G	G	A			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr11:58920140G>A	ENST00000528737.1	+	5	3817	c.999G>A	c.(997-999)acG>acA	p.T333T	FAM111A_ENST00000533703.1_Silent_p.T333T|FAM111A_ENST00000420244.1_Silent_p.T333T|FAM111A_ENST00000361723.3_Silent_p.T333T|FAM111A_ENST00000531147.1_Silent_p.T333T			Q96PZ2	F111A_HUMAN	family with sequence similarity 111, member A	333					defense response to virus (GO:0051607)|DNA replication (GO:0006260)|negative regulation of viral genome replication (GO:0045071)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.T333T(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22		all_epithelial(135;0.139)				ATAGAACAACGTTTGGGAAAG	0.328																																					p.T333T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G999A	11						.						53.0	59.0	57.0					11																	58920140		2197	4291	6488	58676716	SO:0001819	synonymous_variant	63901	exon5			AK092953	CCDS7973.1	11q12.1	2014-03-13				ENSG00000166801			24725	protein-coding gene	gene with protein product		615292				11572484, 23996431, 23684011	Standard	NM_022074		Approved	FLJ22794, KIAA1895	uc001nnq.3	Q96PZ2		ENST00000528737.1:c.999G>A	11.37:g.58920140G>A		Somatic		Capture	Illumina HiSeq	Phase_I	58676716	NM_001142521	A8K5Y8|Q5RKS9|Q5XKM2|Q68DK9|Q6IPR7|Q9H5Y1	Silent	SNP	ENST00000528737.1	37	CCDS7973.1																																																																																				FAM111A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393975.1	NM_022074	
STX5	6811	broad.mit.edu	37	11	62591713	62591713	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr11:62591713G>A	ENST00000294179.3	-	10	986	c.833C>T	c.(832-834)tCg>tTg	p.S278L	STX5_ENST00000541317.1_Missense_Mutation_p.S182L|STX5_ENST00000394690.1_Missense_Mutation_p.S224L|STX5_ENST00000377897.4_Missense_Mutation_p.S278L	NM_001244666.1|NM_003164.4	NP_001231595.1|NP_003155.2	Q13190	STX5_HUMAN	syntaxin 5	278	t-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00202}.				ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)|vesicle fusion with Golgi apparatus (GO:0048280)|vesicle targeting (GO:0006903)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|SNARE complex (GO:0031201)	protein N-terminus binding (GO:0047485)|SNAP receptor activity (GO:0005484)	p.S278L(1)		breast(2)|endometrium(2)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	18						AACAATTGTCGACTCAATGTT	0.507																																					p.S278L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C833T	11						.						245.0	220.0	228.0					11																	62591713		2201	4299	6500	62348289	SO:0001583	missense	6811	exon10			U26648	CCDS8038.2, CCDS58140.1	11q12.3	2008-02-05	2006-04-25	2006-04-25	ENSG00000162236	ENSG00000162236			11440	protein-coding gene	gene with protein product		603189	"""syntaxin 5A"""	STX5A		9188044, 11959998	Standard	NM_003164		Approved	SED5	uc001nvh.3	Q13190	OTTHUMG00000143864	ENST00000294179.3:c.833C>T	11.37:g.62591713G>A	ENSP00000294179:p.Ser278Leu	Somatic		Capture	Illumina HiSeq	Phase_I	62348289	NM_003164	B2R8T2|F8W8Q9|Q5U0D4|Q7Z3T6|Q9BUG1	Missense_Mutation	SNP	ENST00000294179.3	37	CCDS8038.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.1|26.1	4.702356|4.702356	0.88924|0.88924	.|.	.|.	ENSG00000162236|ENSG00000162236	ENST00000431400|ENST00000377897;ENST00000294179;ENST00000394690;ENST00000541317	.|T;T;T;T	.|0.25414	.|1.8;1.8;1.8;1.8	5.35|5.35	5.35|5.35	0.76521|0.76521	.|t-SNARE (1);Syntaxin/epimorphin, conserved site (1);Target SNARE coiled-coil domain (3);	.|0.103680	.|0.64402	.|D	.|0.000003	.|T	.|0.62998	.|0.2474	H|H	0.95816|0.95816	3.725|3.725	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.67103	.|0.949;0.948	.|T	.|0.75156	.|-0.3417	.|10	.|0.72032	.|D	.|0.01	-0.3527|-0.3527	16.5607|16.5607	0.84565|0.84565	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|278;278	.|F8W8Q9;Q13190	.|.;STX5_HUMAN	X|L	133|278;278;224;182	.|ENSP00000367129:S278L;ENSP00000294179:S278L;ENSP00000378182:S224L;ENSP00000441428:S182L	.|ENSP00000294179:S278L	R|S	-|-	1|2	2|0	STX5|STX5	62348289|62348289	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.966000|0.966000	0.64601|0.64601	6.962000|6.962000	0.76048|0.76048	2.524000|2.524000	0.85096|0.85096	0.462000|0.462000	0.41574|0.41574	CGA|TCG		STX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290113.1	NM_003164	
NCAM1	4684	broad.mit.edu	37	11	113078648	113078648	+	Silent	SNP	C	C	T			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr11:113078648C>T	ENST00000533760.1	+	7	1085	c.486C>T	c.(484-486)aaC>aaT	p.N162N	NCAM1_ENST00000397957.4_3'UTR|NCAM1_ENST00000401611.2_Silent_p.N279N|NCAM1_ENST00000316851.7_Silent_p.N270N	NM_001242608.1	NP_001229537.1	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1	280	Ig-like C2-type 2.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)	p.N279N(2)|p.N270N(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		TGGATAAGAACGACGAGGCTG	0.532																																					p.R281X												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.C841T	11						.						70.0	70.0	70.0					11																	113078648		2048	4213	6261	112583858	SO:0001819	synonymous_variant	4684	exon7				CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000533760.1:c.486C>T	11.37:g.113078648C>T		Somatic		Capture	Illumina HiSeq	Phase_I	112583858	NM_001076682	A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	Silent	SNP	ENST00000533760.1	37																																																																																					NCAM1-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000394068.2	NM_000615	
KIF21A	55605	broad.mit.edu	37	12	39705348	39705348	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr12:39705348T>G	ENST00000361418.5	-	32	3982	c.3967A>C	c.(3967-3969)Atc>Ctc	p.I1323L	KIF21A_ENST00000541463.2_Missense_Mutation_p.I1270L|KIF21A_ENST00000544797.2_Missense_Mutation_p.I1286L|KIF21A_ENST00000395670.3_Missense_Mutation_p.I1324L|KIF21A_ENST00000547745.1_5'UTR|KIF21A_ENST00000361961.3_Missense_Mutation_p.I1310L			Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	1323					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.I1310L(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(41)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	86		Lung NSC(34;0.179)|all_lung(34;0.213)				AATGGGTTGATTATGCCCCTA	0.393																																					p.I1270L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3808C	12						.						98.0	93.0	95.0					12																	39705348		2203	4299	6502	37991615	SO:0001583	missense	55605	exon28			AK000059	CCDS31773.1, CCDS53774.1, CCDS53775.1, CCDS53776.1	12q12	2013-01-10						"""Kinesins"", ""WD repeat domain containing"""	19349	protein-coding gene	gene with protein product		608283	"""fibrosis of the extraocular muscles, congenital, 1"""	FEOM1		10225949	Standard	NM_017641		Approved	FLJ20052	uc001rly.3	Q7Z4S6	OTTHUMG00000169335	ENST00000361418.5:c.3967A>C	12.37:g.39705348T>G	ENSP00000354878:p.Ile1323Leu	Somatic		Capture	Illumina HiSeq	Phase_I	37991615	NM_001173465	A8MX28|B0I1R9|B9EGE4|F5H0C3|F5H219|Q2UVF1|Q6UKL9|Q7Z668|Q86WZ5|Q8IVZ8|Q9C0F5|Q9NXU4|Q9Y590	Missense_Mutation	SNP	ENST00000361418.5	37	CCDS53776.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	27.5|27.5	4.840384|4.840384	0.91117|0.91117	.|.	.|.	ENSG00000139116|ENSG00000139116	ENST00000361961;ENST00000395670;ENST00000341813;ENST00000545778;ENST00000551264;ENST00000544797;ENST00000361418;ENST00000541463|ENST00000552961	T;T;T;T;T;T|.	0.71579|.	-0.52;-0.53;0.29;-0.58;-0.42;-0.58|.	5.29|5.29	5.29|5.29	0.74685|0.74685	.|.	0.000000|.	0.52532|.	D|.	0.000068|.	T|.	0.74458|.	0.3719|.	M|M	0.74881|0.74881	2.28|2.28	0.48511|0.48511	D|D	0.999661|0.999661	D;D;D;D;D;D|.	0.71674|.	0.977;0.977;0.998;0.977;0.995;0.989|.	D;D;D;D;D;P|.	0.77557|.	0.949;0.949;0.977;0.949;0.99;0.752|.	T|.	0.75411|.	-0.3327|.	10|.	0.66056|.	D|.	0.02|.	.|.	15.2404|15.2404	0.73465|0.73465	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1286;1270;1323;1310;1276;310|.	F5H219;F5H0C3;Q7Z4S6;Q7Z4S6-2;Q7Z4S6-3;F5H0V8|.	.;.;KI21A_HUMAN;.;.;.|.	L|Y	1310;1324;1276;310;304;1286;1323;1270|623	ENSP00000354851:I1310L;ENSP00000379029:I1324L;ENSP00000448792:I304L;ENSP00000445606:I1286L;ENSP00000354878:I1323L;ENSP00000438075:I1270L|.	ENSP00000344501:I1276L|.	I|X	-|-	1|3	0|2	KIF21A|KIF21A	37991615|37991615	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	7.538000|7.538000	0.82048|0.82048	1.988000|1.988000	0.58038|0.58038	0.533000|0.533000	0.62120|0.62120	ATC|TAA		KIF21A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403581.1	NM_017641	
ARID2	196528	broad.mit.edu	37	12	46285858	46285858	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr12:46285858G>A	ENST00000334344.6	+	18	5298	c.5126G>A	c.(5125-5127)gGa>gAa	p.G1709E	ARID2_ENST00000422737.1_Missense_Mutation_p.G1560E|ARID2_ENST00000444670.1_Missense_Mutation_p.G1319E|ARID2_ENST00000479608.1_3'UTR|ARID2_ENST00000457135.1_Missense_Mutation_p.G317E	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1709					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G1709E(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		GGACAAGCAGGAAGTCAGAAG	0.398			"""N, S, F"""		hepatocellular carcinoma																																p.G1709E			Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5126A	12						.						97.0	89.0	91.0					12																	46285858		2203	4300	6503	44572125	SO:0001583	missense	196528	exon18				CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.5126G>A	12.37:g.46285858G>A	ENSP00000335044:p.Gly1709Glu	Somatic		Capture	Illumina HiSeq	Phase_I	44572125	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Missense_Mutation	SNP	ENST00000334344.6	37	CCDS31783.1	.	.	.	.	.	.	.	.	.	.	G	14.99	2.700210	0.48307	.	.	ENSG00000189079	ENST00000334344;ENST00000549153;ENST00000338636;ENST00000422737;ENST00000444670;ENST00000457135	T	0.33216	1.42	5.42	4.51	0.55191	.	0.418178	0.26133	N	0.026146	T	0.33818	0.0876	L	0.50333	1.59	0.40137	D	0.976787	B;B;B	0.25772	0.13;0.13;0.134	B;B;B	0.32624	0.095;0.149;0.064	T	0.25984	-1.0116	10	0.72032	D	0.01	-4.8468	14.4732	0.67531	0.0:0.1523:0.8477:0.0	.	1709;1319;1709	Q68CP9-3;F8W108;Q68CP9	.;.;ARID2_HUMAN	E	1709;826;826;1560;1319;317	ENSP00000335044:G1709E	ENSP00000335044:G1709E	G	+	2	0	ARID2	44572125	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.241000	0.65384	1.370000	0.46153	0.655000	0.94253	GGA		ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
TSFM	10102	broad.mit.edu	37	12	58180001	58180001	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr12:58180001A>G	ENST00000550559.1	+	3	302	c.287A>G	c.(286-288)aAg>aGg	p.K96R	TSFM_ENST00000454289.3_Missense_Mutation_p.K96R|RP11-571M6.15_ENST00000471530.1_3'UTR|TSFM_ENST00000497617.1_3'UTR|TSFM_ENST00000543727.1_Missense_Mutation_p.K96R|TSFM_ENST00000350762.5_Missense_Mutation_p.K56R|TSFM_ENST00000323833.8_Missense_Mutation_p.K96R|TSFM_ENST00000540550.1_Missense_Mutation_p.K96R|TSFM_ENST00000548851.1_Missense_Mutation_p.K96R|RP11-571M6.15_ENST00000553083.1_3'UTR					Ts translation elongation factor, mitochondrial									p.K96R(1)		endometrium(1)|kidney(1)|large_intestine(5)|prostate(1)	8	all_cancers(7;6.31e-80)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)					AAAGCTGCCAAGCTCCAAGGG	0.483																																					p.K96R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A287G	12						.						80.0	74.0	76.0					12																	58180001		2203	4300	6503	56466268	SO:0001583	missense	10102	exon3			L37936	CCDS8958.2, CCDS53809.1, CCDS53810.1, CCDS53811.1	12q14.1	2006-06-10			ENSG00000123297	ENSG00000123297			12367	protein-coding gene	gene with protein product		604723				7615523	Standard	NM_005726		Approved	EF-Tsmt, EF-TS	uc001sqh.3	P43897	OTTHUMG00000153042	ENST00000550559.1:c.287A>G	12.37:g.58180001A>G	ENSP00000448575:p.Lys96Arg	Somatic		Capture	Illumina HiSeq	Phase_I	56466268	NM_001172695		Missense_Mutation	SNP	ENST00000550559.1	37		.	.	.	.	.	.	.	.	.	.	A	23.1	4.380048	0.82682	.	.	ENSG00000257921;ENSG00000123297;ENSG00000123297;ENSG00000123297;ENSG00000123297;ENSG00000123297;ENSG00000123297;ENSG00000123297;ENSG00000123297;ENSG00000123297	ENST00000546504;ENST00000454289;ENST00000543727;ENST00000540550;ENST00000323833;ENST00000350762;ENST00000550559;ENST00000548851;ENST00000434359;ENST00000457189	.	.	.	5.29	4.09	0.47781	.	0.047074	0.85682	N	0.000000	T	0.78742	0.4331	M	0.92507	3.315	0.53005	D	0.999968	P;P;P;P	0.48764	0.862;0.915;0.617;0.838	B;P;B;P	0.56474	0.417;0.622;0.327;0.799	T	0.81123	-0.1076	9	0.62326	D	0.03	.	9.9158	0.41434	0.9139:0.0:0.0861:0.0	.	96;56;96;96	B4E391;F8W6R3;P43897;P43897-2	.;.;EFTS_HUMAN;.	R	115;96;96;96;96;56;96;96;46;46	.	ENSP00000449544:K115R	K	+	2	0	RP11-571M6.15;TSFM	56466268	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.187000	0.58344	0.947000	0.37659	0.533000	0.62120	AAG		TSFM-008	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000409343.1	NM_005726	
NR1H4	9971	broad.mit.edu	37	12	100904824	100904824	+	Silent	SNP	G	G	A			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr12:100904824G>A	ENST00000551379.1	+	2	406	c.378G>A	c.(376-378)gcG>gcA	p.A126A	NR1H4_ENST00000549996.1_Silent_p.A116A|NR1H4_ENST00000188403.7_Silent_p.A126A|NR1H4_ENST00000548884.1_Silent_p.A116A|NR1H4_ENST00000392986.3_Silent_p.A116A			Q96RI1	NR1H4_HUMAN	nuclear receptor subfamily 1, group H, member 4	126					bile acid metabolic process (GO:0008206)|cellular response to acid chemical (GO:0071229)|cellular response to organonitrogen compound (GO:0071417)|digestive tract development (GO:0048565)|gene expression (GO:0010467)|intracellular bile acid receptor signaling pathway (GO:0038185)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nitrogen catabolite activation of transcription from RNA polymerase II promoter (GO:0001080)|positive regulation of ammonia assimilation cycle (GO:2001250)|positive regulation of glutamate metabolic process (GO:2000213)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of carbohydrate metabolic process (GO:0006109)|regulation of cholesterol metabolic process (GO:0090181)|regulation of urea metabolic process (GO:0034255)|response to glucose (GO:0009749)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)	bile acid binding (GO:0032052)|bile acid receptor activity (GO:0038181)|chenodeoxycholic acid binding (GO:1902122)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor binding (GO:0016922)|peptide binding (GO:0042277)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|thyroid hormone receptor activity (GO:0004887)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.A116A(2)		NS(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	44					Chenodeoxycholic acid(DB06777)	GCATGGGCGCGTCAGCAGGGA	0.517																																					p.A116A												NR1H4,skin,NS,Substitution - coding silent,0 	.	2	Substitution - coding silent(2)	large_intestine(1)|skin(1)	c.G348A	12						.						101.0	105.0	104.0					12																	100904824		2203	4300	6503	99428955	SO:0001819	synonymous_variant	9971	exon4			U68233	CCDS9078.1, CCDS55873.1, CCDS55874.1, CCDS55875.1, CCDS55876.1	12q23.1	2013-01-16				ENSG00000012504		"""Nuclear hormone receptors"""	7967	protein-coding gene	gene with protein product		603826				7774010, 9223286	Standard	NM_001206977		Approved	FXR, RIP14, HRR1, HRR-1	uc001tht.2	Q96RI1	OTTHUMG00000170359	ENST00000551379.1:c.378G>A	12.37:g.100904824G>A		Somatic		Capture	Illumina HiSeq	Phase_I	99428955	NM_005123	A1L4K5|B7Z412|B7ZM06|F8VYG8|Q8NFP5|Q8NFP6|Q92943	Silent	SNP	ENST00000551379.1	37	CCDS55876.1																																																																																				NR1H4-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409140.1	NM_005123	
CHST11	50515	broad.mit.edu	37	12	105151191	105151191	+	Silent	SNP	C	C	T			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr12:105151191C>T	ENST00000303694.5	+	3	1108	c.669C>T	c.(667-669)aaC>aaT	p.N223N	CHST11_ENST00000549260.1_Silent_p.N218N	NM_018413.5	NP_060883.1	Q9NPF2	CHSTB_HUMAN	carbohydrate (chondroitin 4) sulfotransferase 11	223					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondrocyte development (GO:0002063)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|developmental growth (GO:0048589)|embryonic digit morphogenesis (GO:0042733)|embryonic viscerocranium morphogenesis (GO:0048703)|glycosaminoglycan metabolic process (GO:0030203)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|polysaccharide localization (GO:0033037)|post-anal tail morphogenesis (GO:0036342)|post-embryonic development (GO:0009791)|regulation of cell proliferation (GO:0042127)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	chondroitin 4-sulfotransferase activity (GO:0047756)|N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)|N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase activity (GO:0050659)	p.N223N(1)		breast(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(1)	18						AGCGGAAGAACGCCACCCAGG	0.567																																					p.N218N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C654T	12						.						126.0	107.0	114.0					12																	105151191		2203	4300	6503	103675321	SO:0001819	synonymous_variant	50515	exon3			AB042326	CCDS9099.1, CCDS55878.1	12q23.3	2008-02-05				ENSG00000171310	2.8.2.5	"""Sulfotransferases, membrane-bound"""	17422	protein-coding gene	gene with protein product		610128				10781601	Standard	NM_018413		Approved	C4ST1, C4St-1, C4ST, HSA269537	uc001tkz.3	Q9NPF2	OTTHUMG00000169803	ENST00000303694.5:c.669C>T	12.37:g.105151191C>T		Somatic		Capture	Illumina HiSeq	Phase_I	103675321	NM_001173982	A8K4F8|Q9NXY6|Q9NY36	Silent	SNP	ENST00000303694.5	37	CCDS9099.1																																																																																				CHST11-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000405960.2	NM_018413	
SACS	26278	broad.mit.edu	37	13	23913826	23913826	+	Missense_Mutation	SNP	C	C	T	rs561282342		TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr13:23913826C>T	ENST00000382292.3	-	9	4462	c.4189G>A	c.(4189-4191)Gaa>Aaa	p.E1397K	SACS_ENST00000382298.3_Missense_Mutation_p.E1397K|SACS_ENST00000402364.1_Missense_Mutation_p.E647K			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	1397					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)	p.E1250K(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		TAACAGCATTCGTGAATTGGC	0.388																																					p.E1397K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4189A	13						.						180.0	173.0	175.0					13																	23913826		2203	4300	6503	22811826	SO:0001583	missense	26278	exon10			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.4189G>A	13.37:g.23913826C>T	ENSP00000371729:p.Glu1397Lys	Somatic		Capture	Illumina HiSeq	Phase_I	22811826	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	37	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	C	14.31	2.498429	0.44455	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.93659	-3.26;-3.26;-3.26	6.06	5.22	0.72569	.	0.000000	0.85682	D	0.000000	D	0.87985	0.6316	L	0.38531	1.155	0.48135	D	0.999593	P	0.35551	0.509	B	0.20184	0.028	D	0.86791	0.1985	10	0.40728	T	0.16	.	15.3418	0.74303	0.0:0.9335:0.0:0.0665	.	1397	Q9NZJ4	SACS_HUMAN	K	1397;647;1397	ENSP00000371729:E1397K;ENSP00000385844:E647K;ENSP00000371735:E1397K	ENSP00000371729:E1397K	E	-	1	0	SACS	22811826	1.000000	0.71417	1.000000	0.80357	0.766000	0.43426	7.487000	0.81328	1.582000	0.49881	-0.142000	0.14014	GAA		SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
AMER2	219287	broad.mit.edu	37	13	25744590	25744590	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr13:25744590C>T	ENST00000515384.1	-	1	1835	c.1168G>A	c.(1168-1170)Gaa>Aaa	p.E390K	AMER2_ENST00000357816.2_Missense_Mutation_p.E271K|AMER2_ENST00000381853.3_Missense_Mutation_p.E271K|AMER2-AS1_ENST00000413501.1_lincRNA			Q8N7J2	AMER2_HUMAN	APC membrane recruitment protein 2	390					ectoderm development (GO:0007398)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.E271K(1)|p.E390K(1)									CCTGCCTCTTCCTCTTGGTCT	0.542																																					p.E390K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1168A	13						.						45.0	52.0	49.0					13																	25744590		2202	4300	6502	24642590	SO:0001583	missense	219287	exon1			AK055049	CCDS9312.1, CCDS53859.1	13q12.13	2013-10-11	2012-12-03	2012-12-03	ENSG00000165566	ENSG00000165566		"""-"""	26360	protein-coding gene	gene with protein product		614659	"""family with sequence similarity 123A"""	FAM123A		20843316	Standard	XM_005266279		Approved	FLJ25477	uc001uqb.3	Q8N7J2	OTTHUMG00000016602	ENST00000515384.1:c.1168G>A	13.37:g.25744590C>T	ENSP00000426528:p.Glu390Lys	Somatic		Capture	Illumina HiSeq	Phase_I	24642590	NM_152704	Q5RL80|Q5VX56|Q8N593|Q96NN5	Missense_Mutation	SNP	ENST00000515384.1	37	CCDS53859.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.219807	0.79464	.	.	ENSG00000165566	ENST00000357816;ENST00000381853;ENST00000515384	T;T;T	0.19669	2.13;2.13;2.13	4.2	4.2	0.49525	.	0.320352	0.32687	N	0.005767	T	0.27063	0.0663	L	0.40543	1.245	0.50039	D	0.999847	P;P	0.42078	0.77;0.728	P;B	0.47915	0.561;0.334	T	0.03374	-1.1043	10	0.51188	T	0.08	-11.9572	15.716	0.77670	0.0:1.0:0.0:0.0	.	390;271	Q8N7J2;Q8N7J2-2	F123A_HUMAN;.	K	271;271;390	ENSP00000350469:E271K;ENSP00000371277:E271K;ENSP00000426528:E390K	ENSP00000350469:E271K	E	-	1	0	FAM123A	24642590	1.000000	0.71417	0.997000	0.53966	0.979000	0.70002	5.384000	0.66225	2.167000	0.68274	0.561000	0.74099	GAA		AMER2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000370229.1	NM_152704	
UGGT2	55757	broad.mit.edu	37	13	96530095	96530095	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr13:96530095T>A	ENST00000376747.3	-	28	3314	c.3244A>T	c.(3244-3246)Aca>Tca	p.T1082S		NM_020121.3	NP_064506.3	Q9NYU1	UGGG2_HUMAN	UDP-glucose glycoprotein glucosyltransferase 2	1082					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-glucosylation (GO:0097359)	endoplasmic reticulum lumen (GO:0005788)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)	p.T1082S(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(17)|lung(20)|ovary(3)|pancreas(1)|prostate(4)|urinary_tract(2)	60						TATTCTGCTGTAACAGTTTTC	0.343																																					p.T1082S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3244T	13						.						146.0	143.0	144.0					13																	96530095		2203	4300	6503	95328096	SO:0001583	missense	55757	exon28			AF227906	CCDS9480.1	13q32.1	2009-07-23	2009-07-23	2009-07-23	ENSG00000102595	ENSG00000102595			15664	protein-coding gene	gene with protein product	"""UDP-glucose:glycoprotein glucosyltransferase 2"""	605898	"""UDP-glucose ceramide glucosyltransferase-like 2"""	UGCGL2		10694380	Standard	NM_020121		Approved	FLJ11485, HUGT2, FLJ10873, MGC150689, MGC87276, MGC117360	uc001vmt.3	Q9NYU1	OTTHUMG00000017230	ENST00000376747.3:c.3244A>T	13.37:g.96530095T>A	ENSP00000365938:p.Thr1082Ser	Somatic		Capture	Illumina HiSeq	Phase_I	95328096	NM_020121	A6NKL4|Q08AD0|Q5JQR8|Q8N5K0|Q9UFC4	Missense_Mutation	SNP	ENST00000376747.3	37	CCDS9480.1	.	.	.	.	.	.	.	.	.	.	T	3.165	-0.171223	0.06421	.	.	ENSG00000102595	ENST00000376747	T	0.30981	1.51	5.14	3.97	0.46021	.	0.485816	0.22185	N	0.063455	T	0.23611	0.0571	M	0.63428	1.95	0.09310	N	0.999993	B;B	0.32031	0.352;0.019	B;B	0.31101	0.124;0.026	T	0.21965	-1.0230	10	0.08179	T	0.78	-2.1893	5.2781	0.15661	0.1328:0.1505:0.0:0.7167	.	1082;1082	Q9NV86;Q9NYU1	.;UGGG2_HUMAN	S	1082	ENSP00000365938:T1082S	ENSP00000365938:T1082S	T	-	1	0	UGGT2	95328096	0.000000	0.05858	0.379000	0.26080	0.769000	0.43574	-0.102000	0.10956	0.813000	0.34350	0.383000	0.25322	ACA		UGGT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045507.1	NM_020121	
MIA2	117153	broad.mit.edu	37	14	39706192	39706192	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr14:39706192C>T	ENST00000280082.3	+	2	381	c.182C>T	c.(181-183)aCt>aTt	p.T61I	MIA2_ENST00000556784.1_Missense_Mutation_p.T61I|RP11-407N17.3_ENST00000553728.1_Missense_Mutation_p.T61I	NM_054024.3	NP_473365.3	Q96PC5	MIA2_HUMAN	melanoma inhibitory activity 2	61	SH3.				cholesterol homeostasis (GO:0042632)|triglyceride homeostasis (GO:0070328)	endoplasmic reticulum exit site (GO:0070971)|extracellular region (GO:0005576)		p.T61I(1)		NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	31	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0216)		CTGAACTTCACTAAGGGAGAA	0.358																																					p.T61I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C182T	14						.						84.0	79.0	81.0					14																	39706192		2203	4300	6503	38775943	SO:0001583	missense	117153	exon2			BC035981	CCDS9672.1	14q13.2	2007-05-01			ENSG00000150526	ENSG00000150526			18432	protein-coding gene	gene with protein product		608001				12586826	Standard	NM_054024		Approved	FLJ22404	uc001wux.3	Q96PC5	OTTHUMG00000028831	ENST00000280082.3:c.182C>T	14.37:g.39706192C>T	ENSP00000280082:p.Thr61Ile	Somatic		Capture	Illumina HiSeq	Phase_I	38775943	NM_054024	A1L4H0|Q9H6C1	Missense_Mutation	SNP	ENST00000280082.3	37	CCDS9672.1	.	.	.	.	.	.	.	.	.	.	C	19.17	3.775015	0.70107	.	.	ENSG00000150526;ENSG00000150526;ENSG00000150526;ENSG00000150526;ENSG00000258941	ENST00000557148;ENST00000555143;ENST00000280082;ENST00000556784;ENST00000553728	T;T;T;T;T	0.09350	2.99;2.99;2.99;2.99;2.99	5.26	2.16	0.27623	.	0.000000	0.39407	N	0.001379	T	0.16854	0.0405	L	0.34521	1.04	0.37740	D	0.925582	D	0.76494	0.999	D	0.71656	0.974	T	0.06232	-1.0838	9	.	.	.	-19.0008	8.1017	0.30861	0.5378:0.348:0.1142:0.0	.	61	Q96PC5-2	.	I	61	ENSP00000451883:T61I;ENSP00000451217:T61I;ENSP00000280082:T61I;ENSP00000451934:T61I;ENSP00000452252:T61I	.	T	+	2	0	MIA2;RP11-407N17.3	38775943	0.969000	0.33509	0.992000	0.48379	0.997000	0.91878	1.966000	0.40481	1.203000	0.43233	0.655000	0.94253	ACT		MIA2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276768.3	NM_054024	
KCNH5	27133	broad.mit.edu	37	14	63175163	63175163	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr14:63175163C>T	ENST00000322893.7	-	11	2298	c.2030G>A	c.(2029-2031)cGt>cAt	p.R677H	KCNH5_ENST00000420622.2_Silent_p.S611S	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	677					potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.R677H(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		ACTGATCTTACGAAAGATGAT	0.463																																					p.R677H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2030A	14						.						52.0	56.0	55.0					14																	63175163		2202	4300	6502	62244916	SO:0001583	missense	27133	exon11			U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.2030G>A	14.37:g.63175163C>T	ENSP00000321427:p.Arg677His	Somatic		Capture	Illumina HiSeq	Phase_I	62244916	NM_139318	C9JP98	Missense_Mutation	SNP	ENST00000322893.7	37	CCDS9756.1	.	.	.	.	.	.	.	.	.	.	C	19.10	3.762862	0.69763	.	.	ENSG00000140015	ENST00000322893	T	0.18174	2.23	5.72	5.72	0.89469	.	0.123346	0.51477	D	0.000082	T	0.46698	0.1406	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.39961	-0.9588	9	0.62326	D	0.03	.	19.8965	0.96963	0.0:1.0:0.0:0.0	.	677	Q8NCM2	KCNH5_HUMAN	H	677	ENSP00000321427:R677H	ENSP00000321427:R677H	R	-	2	0	KCNH5	62244916	1.000000	0.71417	0.995000	0.50966	0.604000	0.37047	7.818000	0.86416	2.717000	0.92951	0.655000	0.94253	CGT		KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411747.1	NM_139318	
MAP2K1	5604	broad.mit.edu	37	15	66727441	66727441	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr15:66727441T>C	ENST00000307102.5	+	2	688	c.157T>C	c.(157-159)Ttt>Ctt	p.F53L		NM_002755.3	NP_002746.1	Q02750	MP2K1_HUMAN	mitogen-activated protein kinase kinase 1	53			F -> S (in CFC3). {ECO:0000269|PubMed:16439621}.		activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular senescence (GO:0090398)|chemotaxis (GO:0006935)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|Golgi inheritance (GO:0048313)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|keratinocyte differentiation (GO:0030216)|labyrinthine layer development (GO:0060711)|MAPK cascade (GO:0000165)|melanosome transport (GO:0032402)|mitotic nuclear division (GO:0007067)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell proliferation (GO:0008285)|negative regulation of homotypic cell-cell adhesion (GO:0034111)|neurotrophin TRK receptor signaling pathway (GO:0048011)|placenta blood vessel development (GO:0060674)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|protein heterooligomerization (GO:0051291)|Ras protein signal transduction (GO:0007265)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of stress-activated MAPK cascade (GO:0032872)|regulation of vascular smooth muscle contraction (GO:0003056)|response to axon injury (GO:0048678)|response to glucocorticoid (GO:0051384)|response to oxidative stress (GO:0006979)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vesicle transport along microtubule (GO:0047496)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine phosphatase activity (GO:0004728)	p.F53L(2)|p.F53S(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(8)|urinary_tract(1)	20					Bosutinib(DB06616)|Trametinib(DB08911)	CCTTGAGGCCTTTCTTACCCA	0.547																																					p.F53L												.	.	3	Substitution - Missense(3)	lung(2)|large_intestine(1)	c.T157C	15						.						155.0	146.0	149.0					15																	66727441		2201	4299	6500	64514495	SO:0001583	missense	5604	exon2			L11284	CCDS10216.1	15q22.1-q22.33	2014-09-17			ENSG00000169032	ENSG00000169032	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6840	protein-coding gene	gene with protein product		176872		PRKMK1		9465908, 8388392	Standard	NM_002755		Approved	MEK1, MAPKK1	uc010bhq.3	Q02750	OTTHUMG00000133196	ENST00000307102.5:c.157T>C	15.37:g.66727441T>C	ENSP00000302486:p.Phe53Leu	Somatic		Capture	Illumina HiSeq	Phase_I	64514495	NM_002755		Missense_Mutation	SNP	ENST00000307102.5	37	CCDS10216.1	.	.	.	.	.	.	.	.	.	.	T	35	5.500444	0.96355	.	.	ENSG00000169032	ENST00000307102	D	0.93019	-3.15	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	D	0.95188	0.8440	M	0.76170	2.325	0.80722	D	1	D;D	0.61080	0.989;0.98	P;P	0.59115	0.852;0.805	D	0.93980	0.7257	10	0.26408	T	0.33	-14.6287	14.0473	0.64712	0.0:0.0:0.0:1.0	.	31;53	B4DFY5;Q02750	.;MP2K1_HUMAN	L	53	ENSP00000302486:F53L	ENSP00000302486:F53L	F	+	1	0	MAP2K1	64514495	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.924000	0.87555	1.911000	0.55334	0.383000	0.25322	TTT		MAP2K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256906.4		
RASGRF1	5923	broad.mit.edu	37	15	79382818	79382818	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr15:79382818T>C	ENST00000419573.3	-	1	297	c.23A>G	c.(22-24)aAt>aGt	p.N8S	RASGRF1_ENST00000558480.2_Missense_Mutation_p.N8S	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	8					activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.N8S(1)		breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						GTGGCCATCATTCAGCCGGAT	0.657																																					p.N8S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A23G	15						.						165.0	144.0	151.0					15																	79382818		2196	4293	6489	77169873	SO:0001583	missense	5923	exon1			M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.23A>G	15.37:g.79382818T>C	ENSP00000405963:p.Asn8Ser	Somatic		Capture	Illumina HiSeq	Phase_I	77169873	NM_002891	F8VPA5|H0YKF2|J3KQP9|Q16027	Missense_Mutation	SNP	ENST00000419573.3	37	CCDS10309.1	.	.	.	.	.	.	.	.	.	.	.	21.2	4.106491	0.77096	.	.	ENSG00000058335	ENST00000419573;ENST00000394741	T	0.63580	-0.05	3.96	3.96	0.45880	.	0.000000	0.64402	D	0.000001	T	0.71576	0.3356	L	0.55990	1.75	0.80722	D	1	D;D;D	0.67145	0.992;0.986;0.996	P;D;D	0.68621	0.872;0.91;0.959	T	0.73817	-0.3863	10	0.66056	D	0.02	.	10.8489	0.46759	0.0:0.0:0.0:1.0	.	8;8;8	Q8IUU5;Q13972;F8VPA5	.;RGRF1_HUMAN;.	S	8	ENSP00000405963:N8S	ENSP00000378224:N8S	N	-	2	0	RASGRF1	77169873	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.045000	0.76585	1.676000	0.50930	0.402000	0.26972	AAT		RASGRF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000291371.3	NM_002891	
ADAMTS17	170691	broad.mit.edu	37	15	100594144	100594144	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr15:100594144C>A	ENST00000268070.4	-	16	2358	c.2253G>T	c.(2251-2253)aaG>aaT	p.K751N		NM_139057.2	NP_620688.2	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 17	751	Spacer.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.K751N(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)	50	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		TGGCAGAGATCTTCTCCCACA	0.542																																					p.K751N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2253T	15						.						283.0	269.0	274.0					15																	100594144		2203	4300	6503	98411667	SO:0001583	missense	170691	exon16			AJ315735	CCDS10383.1	15q24	2014-01-28	2005-08-19		ENSG00000140470	ENSG00000140470		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17109	protein-coding gene	gene with protein product		607511	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 17"""			11867212	Standard	NM_139057		Approved	FLJ32769, FLJ16363	uc002bvv.1	Q8TE56	OTTHUMG00000149867	ENST00000268070.4:c.2253G>T	15.37:g.100594144C>A	ENSP00000268070:p.Lys751Asn	Somatic		Capture	Illumina HiSeq	Phase_I	98411667	NM_139057	Q2I7G4|Q6ZN75	Missense_Mutation	SNP	ENST00000268070.4	37	CCDS10383.1	.	.	.	.	.	.	.	.	.	.	C	18.16	3.563045	0.65538	.	.	ENSG00000140470	ENST00000268070	T	0.52526	0.66	5.9	2.62	0.31277	ADAM-TS Spacer 1 (1);	0.000000	0.85682	D	0.000000	T	0.51075	0.1653	L	0.37561	1.115	0.58432	D	0.999994	D	0.89917	1.0	D	0.87578	0.998	T	0.39502	-0.9611	10	0.21540	T	0.41	.	7.333	0.26594	0.0:0.5047:0.0:0.4953	.	751	Q8TE56	ATS17_HUMAN	N	751	ENSP00000268070:K751N	ENSP00000268070:K751N	K	-	3	2	ADAMTS17	98411667	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	2.398000	0.44486	0.265000	0.21872	0.655000	0.94253	AAG		ADAMTS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313595.1	NM_139057	
ADCY9	115	broad.mit.edu	37	16	4016923	4016923	+	Missense_Mutation	SNP	C	C	T	rs374135203		TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr16:4016923C>T	ENST00000294016.3	-	11	3453	c.2915G>A	c.(2914-2916)cGg>cAg	p.R972Q		NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	972					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)	p.R972Q(1)		breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						GGCGGGCCGCCGGAGGTCACG	0.587																																					p.R972Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2915A	16						.	C	GLN/ARG	1,4387		0,1,2193	46.0	54.0	51.0		2915	3.5	0.0	16		51	0,8596		0,0,4298	no	missense	ADCY9	NM_001116.3	43	0,1,6491	TT,TC,CC		0.0,0.0228,0.0077	benign	972/1354	4016923	1,12983	2194	4298	6492	3956924	SO:0001583	missense	115	exon11			AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.2915G>A	16.37:g.4016923C>T	ENSP00000294016:p.Arg972Gln	Somatic		Capture	Illumina HiSeq	Phase_I	3956924	NM_001116	A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Missense_Mutation	SNP	ENST00000294016.3	37	CCDS32382.1	.	.	.	.	.	.	.	.	.	.	C	1.798	-0.477917	0.04414	2.28E-4	0.0	ENSG00000162104	ENST00000294016	D	0.82711	-1.64	5.48	3.47	0.39725	.	0.612896	0.17415	N	0.175039	T	0.64560	0.2609	N	0.08118	0	0.09310	N	1	B	0.26318	0.146	B	0.17098	0.017	T	0.52449	-0.8574	10	0.24483	T	0.36	.	11.0854	0.48084	0.0:0.7901:0.0:0.2099	.	972	O60503	ADCY9_HUMAN	Q	972	ENSP00000294016:R972Q	ENSP00000294016:R972Q	R	-	2	0	ADCY9	3956924	0.000000	0.05858	0.006000	0.13384	0.248000	0.25809	0.232000	0.17891	1.429000	0.47314	0.561000	0.74099	CGG		ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438076.1		
MNT	4335	broad.mit.edu	37	17	2290344	2290344	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr17:2290344C>A	ENST00000174618.4	-	6	2005	c.1600G>T	c.(1600-1602)Ggc>Tgc	p.G534C	MNT_ENST00000575374.1_5'Flank|RP1-59D14.1_ENST00000571775.1_RNA	NM_020310.2	NP_064706.1	Q99583	MNT_HUMAN	MAX network transcriptional repressor	534					cell aging (GO:0007569)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of cell cycle (GO:0051726)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.G534C(1)		endometrium(4)|large_intestine(5)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	12				Colorectal(2;1.37e-05)|READ - Rectum adenocarcinoma(2;8.68e-05)		GGCCCCAGGCCGGCCGTGCCG	0.701																																					p.G534C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1600T	17						.						24.0	28.0	27.0					17																	2290344		2159	4226	6385	2237094	SO:0001583	missense	4335	exon6			Y13444	CCDS11018.1	17p13.3	2013-11-15	2013-11-15		ENSG00000070444	ENSG00000070444		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	7188	protein-coding gene	gene with protein product	"""myc antagonist"", ""Max-interacting protein"""	603039	"""MAX binding protein"", ""MNT, MAX dimerization protein"""			9598315	Standard	NM_020310		Approved	ROX, MXD6, MAD6, bHLHd3	uc002fur.3	Q99583	OTTHUMG00000090603	ENST00000174618.4:c.1600G>T	17.37:g.2290344C>A	ENSP00000174618:p.Gly534Cys	Somatic		Capture	Illumina HiSeq	Phase_I	2237094	NM_020310	A8K6D1|D3DTI7|Q1ED38	Missense_Mutation	SNP	ENST00000174618.4	37	CCDS11018.1	.	.	.	.	.	.	.	.	.	.	C	14.97	2.694864	0.48202	.	.	ENSG00000070444	ENST00000174618;ENST00000404961	D	0.81821	-1.54	4.91	2.87	0.33458	.	0.396547	0.17469	U	0.173160	T	0.61426	0.2346	N	0.08118	0	0.09310	N	0.999996	P	0.51653	0.947	P	0.44990	0.466	T	0.54390	-0.8301	10	0.44086	T	0.13	-15.8859	3.6865	0.08329	0.1776:0.5534:0.0:0.269	.	534	Q99583	MNT_HUMAN	C	534	ENSP00000174618:G534C	ENSP00000174618:G534C	G	-	1	0	MNT	2237094	0.146000	0.22672	0.647000	0.29507	0.814000	0.46013	0.918000	0.28678	0.464000	0.27142	0.591000	0.81541	GGC		MNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207158.1	NM_020310	
ZMYND15	84225	broad.mit.edu	37	17	4648544	4648544	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr17:4648544G>C	ENST00000433935.1	+	13	1988	c.1931G>C	c.(1930-1932)aGc>aCc	p.S644T	ZMYND15_ENST00000269289.6_Missense_Mutation_p.S605T|ZMYND15_ENST00000573751.2_Missense_Mutation_p.S652T|ZMYND15_ENST00000592813.1_Missense_Mutation_p.S605T	NM_001136046.2|NM_001267822.1	NP_001129518.1|NP_001254751.1	Q9H091	ZMY15_HUMAN	zinc finger, MYND-type containing 15	644					negative regulation of transcription, DNA-templated (GO:0045892)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.S605T(1)		endometrium(5)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)	18						ACCGAGAGCAGCGAGTACAGC	0.657																																					p.S605T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1814C	17						.						85.0	85.0	85.0					17																	4648544		2203	4300	6503	4595293	SO:0001583	missense	84225	exon12			AL136893	CCDS11053.1, CCDS45584.1, CCDS58506.1	17p13.3	2008-05-02			ENSG00000141497	ENSG00000141497		"""Zinc fingers, MYND-type"""	20997	protein-coding gene	gene with protein product		614312				11230166	Standard	NM_001136046		Approved	DKFZp434N127	uc002fyu.3	Q9H091	OTTHUMG00000090760	ENST00000433935.1:c.1931G>C	17.37:g.4648544G>C	ENSP00000391742:p.Ser644Thr	Somatic		Capture	Illumina HiSeq	Phase_I	4595293	NM_032265	B4DXY5|I3L296	Missense_Mutation	SNP	ENST00000433935.1	37	CCDS45584.1	.	.	.	.	.	.	.	.	.	.	G	18.67	3.674761	0.67928	.	.	ENSG00000141497	ENST00000433935;ENST00000269289	T;T	0.51071	0.79;0.72	4.7	4.7	0.59300	.	0.121339	0.38005	N	0.001853	T	0.39036	0.1063	N	0.02539	-0.55	0.31090	N	0.710967	D;D	0.65815	0.995;0.965	D;P	0.65684	0.937;0.885	T	0.42275	-0.9461	10	0.25106	T	0.35	-13.5958	13.0103	0.58727	0.0:0.0:1.0:0.0	.	644;605	B4DXY5;Q9H091	.;ZMY15_HUMAN	T	644;605	ENSP00000391742:S644T;ENSP00000269289:S605T	ENSP00000269289:S605T	S	+	2	0	ZMYND15	4595293	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.551000	0.67274	2.443000	0.82685	0.563000	0.77884	AGC		ZMYND15-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439580.1	NM_032265	
SOST	50964	broad.mit.edu	37	17	41836016	41836016	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr17:41836016C>A	ENST00000301691.2	-	1	140	c.94G>T	c.(94-96)Gat>Tat	p.D32Y		NM_025237.2	NP_079513.1	Q9BQB4	SOST_HUMAN	sclerostin	32					cellular response to parathyroid hormone stimulus (GO:0071374)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000054)|ossification (GO:0001503)|positive regulation of transcription, DNA-templated (GO:0045893)|response to mechanical stimulus (GO:0009612)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|transcription factor binding (GO:0008134)	p.D32Y(1)		large_intestine(2)|lung(3)|prostate(1)	6		Breast(137;0.00725)		UCEC - Uterine corpus endometrioid carcinoma (308;0.177)|BRCA - Breast invasive adenocarcinoma(366;0.0741)		TCCGTGGCATCATTCTTGAAC	0.627																																					p.D32Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G94T	17						.						90.0	81.0	84.0					17																	41836016		2203	4300	6503	39191542	SO:0001583	missense	50964	exon1			AF326736	CCDS11468.1	17q12-q21	2014-06-28	2010-04-28			ENSG00000167941			13771	protein-coding gene	gene with protein product		605740	"""sclerosteosis"""			11179006, 11181578	Standard	NM_025237		Approved	VBCH	uc002iec.1	Q9BQB4		ENST00000301691.2:c.94G>T	17.37:g.41836016C>A	ENSP00000301691:p.Asp32Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	39191542	NM_025237	Q495N9	Missense_Mutation	SNP	ENST00000301691.2	37	CCDS11468.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.136375	0.77662	.	.	ENSG00000167941	ENST00000301691	D	0.84442	-1.85	4.36	4.36	0.52297	.	0.000000	0.85682	D	0.000000	D	0.91047	0.7183	M	0.68317	2.08	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92164	0.5738	10	0.87932	D	0	-4.4389	15.2413	0.73471	0.0:1.0:0.0:0.0	.	32	Q9BQB4	SOST_HUMAN	Y	32	ENSP00000301691:D32Y	ENSP00000301691:D32Y	D	-	1	0	SOST	39191542	1.000000	0.71417	0.948000	0.38648	0.958000	0.62258	6.674000	0.74487	2.264000	0.75181	0.555000	0.69702	GAT		SOST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453502.1	NM_025237	
MED31	51003	broad.mit.edu	37	17	6547828	6547828	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr17:6547828A>T	ENST00000225728.3	-	4	460	c.355T>A	c.(355-357)Ttg>Atg	p.L119M	MED31_ENST00000574128.1_Missense_Mutation_p.L45M|MED31_ENST00000575197.1_3'UTR|TXNDC17_ENST00000250101.5_3'UTR	NM_016060.2	NP_057144.1	Q9Y3C7	MED31_HUMAN	mediator complex subunit 31	119					gene expression (GO:0010467)|limb development (GO:0060173)|negative regulation of fibroblast proliferation (GO:0048147)|protein complex assembly (GO:0006461)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.L119M(1)		cervix(1)|endometrium(1)|large_intestine(1)	3						TGCTCTGCCAAGGCTTGCTGA	0.418																																					p.L119M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T355A	17						.						142.0	138.0	139.0					17																	6547828		2203	4300	6503	6488552	SO:0001583	missense	51003	exon4			AF151883	CCDS11078.1	17p13.1	2007-07-30	2007-07-30		ENSG00000108590	ENSG00000108590			24260	protein-coding gene	gene with protein product			"""mediator of RNA polymerase II transcription, subunit 31 homolog (S. cerevisiae)"""			10810093	Standard	NM_016060		Approved	CGI-125, Soh1	uc002gdg.4	Q9Y3C7	OTTHUMG00000102051	ENST00000225728.3:c.355T>A	17.37:g.6547828A>T	ENSP00000225728:p.Leu119Met	Somatic		Capture	Illumina HiSeq	Phase_I	6488552	NM_016060	B2R4L9	Missense_Mutation	SNP	ENST00000225728.3	37	CCDS11078.1	.	.	.	.	.	.	.	.	.	.	A	19.72	3.879504	0.72294	.	.	ENSG00000108590	ENST00000225728	.	.	.	5.84	3.75	0.43078	.	0.000000	0.85682	D	0.000000	T	0.62624	0.2443	L	0.41236	1.265	0.58432	D	0.999999	D	0.58970	0.984	D	0.70487	0.969	T	0.57619	-0.7780	9	0.31617	T	0.26	-11.9569	8.6102	0.33797	0.1789:0.0:0.8211:0.0	.	119	Q9Y3C7	MED31_HUMAN	M	119	.	ENSP00000225728:L119M	L	-	1	2	MED31	6488552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.711000	0.68400	0.795000	0.33922	0.528000	0.53228	TTG		MED31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219852.1	NM_016060	
TP53	7157	broad.mit.edu	37	17	7579716	7579716	+	Frame_Shift_Del	DEL	G	G	-	rs397516438		TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr17:7579716delG	ENST00000269305.4	-	3	269	c.80delC	c.(79-81)cctfs	p.P27fs	TP53_ENST00000445888.2_Frame_Shift_Del_p.P27fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.P27fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.P27fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Frame_Shift_Del_p.P27fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.P27fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	27	Interaction with HRMT1L2.|Transcription activation (acidic).				apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.P27fs*17(4)|p.P27fs*50(1)|p.P13fs*18(1)|p.L26fs*11(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTTGTTTTCAGGAAGTCTGAA	0.617		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.P27fs	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	.	.	15	Whole gene deletion(8)|Deletion - Frameshift(7)	large_intestine(5)|bone(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	c.80delC	17						.						42.0	42.0	42.0					17																	7579716		2203	4300	6503	7520441	SO:0001589	frameshift_variant	7157	exon3	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.80delC	17.37:g.7579716delG	ENSP00000269305:p.Pro27fs	Somatic		Capture	Illumina HiSeq	Phase_I	7520441	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	37	CCDS11118.1																																																																																				TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
ABCA5	23461	broad.mit.edu	37	17	67270180	67270180	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr17:67270180A>C	ENST00000392676.3	-	20	2748	c.2684T>G	c.(2683-2685)cTt>cGt	p.L895R	ABCA5_ENST00000392677.2_Missense_Mutation_p.L895R|ABCA5_ENST00000588877.1_Missense_Mutation_p.L895R			Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 5	895					cholesterol efflux (GO:0033344)|high-density lipoprotein particle remodeling (GO:0034375)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|reverse cholesterol transport (GO:0043691)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.L895R(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(18)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	54	Breast(10;3.72e-11)				Tacrolimus(DB00864)	GTCTGGAACAAGTTTGATGGG	0.338																																					p.L895R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2684G	17						.						94.0	97.0	96.0					17																	67270180		2203	4300	6503	64781775	SO:0001583	missense	23461	exon20			U66672	CCDS11685.1	17q24.3	2012-03-14			ENSG00000154265	ENSG00000154265		"""ATP binding cassette transporters / subfamily A"""	35	protein-coding gene	gene with protein product		612503				8894702	Standard	NM_172232		Approved	EST90625	uc002jig.2	Q8WWZ7		ENST00000392676.3:c.2684T>G	17.37:g.67270180A>C	ENSP00000376443:p.Leu895Arg	Somatic		Capture	Illumina HiSeq	Phase_I	64781775	NM_172232	Q8IVJ2|Q96LJ1|Q96MS4|Q96PZ9|Q9NY14	Missense_Mutation	SNP	ENST00000392676.3	37	CCDS11685.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.256451	0.80246	.	.	ENSG00000154265	ENST00000392677;ENST00000392676	D;D	0.88896	-2.44;-2.44	5.62	5.62	0.85841	.	0.110355	0.40728	N	0.001023	D	0.93919	0.8054	M	0.79475	2.455	0.80722	D	1	D;D	0.67145	0.968;0.996	P;D	0.68765	0.608;0.96	D	0.93920	0.7205	9	.	.	.	.	15.7864	0.78306	1.0:0.0:0.0:0.0	.	895;895	Q8WWZ7-2;Q8WWZ7	.;ABCA5_HUMAN	R	895	ENSP00000376444:L895R;ENSP00000376443:L895R	.	L	-	2	0	ABCA5	64781775	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	6.152000	0.71812	2.267000	0.75376	0.477000	0.44152	CTT		ABCA5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450654.1	NM_018672	
MRPL4	51073	broad.mit.edu	37	19	10368918	10368918	+	Missense_Mutation	SNP	C	C	T	rs372085895		TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr19:10368918C>T	ENST00000253099.6	+	6	753	c.466C>T	c.(466-468)Cgg>Tgg	p.R156W	MRPL4_ENST00000588502.1_Missense_Mutation_p.R155W|MRPL4_ENST00000307422.5_Missense_Mutation_p.R156W|CTD-2369P2.5_ENST00000592893.1_RNA|MRPL4_ENST00000393733.2_Missense_Mutation_p.R156W|MRPL4_ENST00000590669.1_Missense_Mutation_p.R156W|CTD-2369P2.4_ENST00000587088.1_RNA	NM_015956.2|NM_146388.1	NP_057040.2|NP_666500.1	Q9BYD3	RM04_HUMAN	mitochondrial ribosomal protein L4	156					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.R156W(1)		breast(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	11		Renal(1328;0.0112)	OV - Ovarian serous cystadenocarcinoma(20;1.39e-09)|Epithelial(33;1.99e-06)|all cancers(31;4.81e-06)	Lung(535;0.00705)		CCATGGCCCCCGGGGCCCCAC	0.637																																					p.R156W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C466T	19						.	C	TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	43.0	44.0	43.0		466,466,466	5.3	1.0	19		43	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	MRPL4	NM_015956.2,NM_146387.1,NM_146388.1	101,101,101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	156/312,156/312,156/264	10368918	1,13005	2203	4300	6503	10229918	SO:0001583	missense	51073	exon6			AB049635	CCDS12230.1, CCDS42499.1	19p13.2	2012-11-14			ENSG00000105364	ENSG00000105364		"""Mitochondrial ribosomal proteins / large subunits"""	14276	protein-coding gene	gene with protein product		611823					Standard	NM_015956		Approved	CGI-28	uc002mnn.3	Q9BYD3	OTTHUMG00000180400	ENST00000253099.6:c.466C>T	19.37:g.10368918C>T	ENSP00000253099:p.Arg156Trp	Somatic		Capture	Illumina HiSeq	Phase_I	10229918	NM_146388	A6NNV7|Q9BW07|Q9H4N2|Q9Y317	Missense_Mutation	SNP	ENST00000253099.6	37	CCDS12230.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.702994	0.88924	0.0	1.16E-4	ENSG00000105364	ENST00000253099;ENST00000307422;ENST00000393733	.	.	.	5.32	5.32	0.75619	Ribosomal protein L4 domain (2);	0.000000	0.85682	D	0.000000	D	0.86389	0.5921	M	0.94021	3.485	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.89905	0.4047	9	0.87932	D	0	-40.8725	16.474	0.84127	0.0:1.0:0.0:0.0	.	156;156	Q9BYD3-2;Q9BYD3	.;RM04_HUMAN	W	156	.	ENSP00000253099:R156W	R	+	1	2	MRPL4	10229918	0.452000	0.25713	1.000000	0.80357	0.974000	0.67602	0.984000	0.29565	2.471000	0.83476	0.462000	0.41574	CGG		MRPL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451197.1		
NPHS1	4868	broad.mit.edu	37	19	36339161	36339161	+	Missense_Mutation	SNP	C	C	T	rs386833878		TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr19:36339161C>T	ENST00000378910.5	-	10	1308	c.1309G>A	c.(1309-1311)Gta>Ata	p.V437I	NPHS1_ENST00000353632.6_Missense_Mutation_p.V437I	NM_004646.3	NP_004637.1	O60500	NPHN_HUMAN	nephrosis 1, congenital, Finnish type (nephrin)	437					cell adhesion (GO:0007155)|excretion (GO:0007588)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell development (GO:0072015)|JNK cascade (GO:0007254)|myoblast fusion (GO:0007520)|positive regulation of actin filament polymerization (GO:0030838)|regulation of excretion (GO:0044062)|skeletal muscle tissue development (GO:0007519)	cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)	myosin binding (GO:0017022)	p.V437I(1)		NS(2)|breast(1)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(1)|lung(26)|ovary(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TCACATTTTACGTTCAGGATG	0.582																																					p.V437I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1309A	19	GRCh37	CI983172	NPHS1	I		.						101.0	102.0	102.0					19																	36339161		2203	4300	6503	41031001	SO:0001583	missense	4868	exon10				CCDS32996.1	19q12-q13.1	2014-09-17				ENSG00000161270		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7908	protein-coding gene	gene with protein product		602716				9915943, 9660941	Standard	NM_004646		Approved	CNF, NPHN	uc002oby.3	O60500		ENST00000378910.5:c.1309G>A	19.37:g.36339161C>T	ENSP00000368190:p.Val437Ile	Somatic		Capture	Illumina HiSeq	Phase_I	41031001	NM_004646	A6NDH2|C3RX61	Missense_Mutation	SNP	ENST00000378910.5	37	CCDS32996.1	.	.	.	.	.	.	.	.	.	.	C	9.866	1.197676	0.22037	.	.	ENSG00000161270	ENST00000378910;ENST00000353632	D;D	0.92595	-3.07;-3.07	4.71	2.59	0.31030	Immunoglobulin-like fold (1);	0.218004	0.37761	N	0.001960	D	0.94522	0.8236	M	0.63169	1.94	0.28449	N	0.916448	D	0.89917	1.0	D	0.83275	0.996	D	0.89891	0.4037	10	0.56958	D	0.05	-12.7482	13.0041	0.58694	0.0:0.9104:0.0:0.0896	.	437	O60500	NPHN_HUMAN	I	437	ENSP00000368190:V437I;ENSP00000343634:V437I	ENSP00000343634:V437I	V	-	1	0	NPHS1	41031001	0.724000	0.28038	0.831000	0.32960	0.027000	0.11550	1.459000	0.35234	0.609000	0.30018	-1.212000	0.01626	GTA		NPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452553.1		
LTBP4	8425	broad.mit.edu	37	19	41118050	41118050	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr19:41118050T>G	ENST00000308370.7	+	18	2452	c.2452T>G	c.(2452-2454)Tgc>Ggc	p.C818G	LTBP4_ENST00000204005.9_Missense_Mutation_p.C781G|LTBP4_ENST00000396819.3_Missense_Mutation_p.C751G|LTBP4_ENST00000602240.1_3'UTR|LTBP4_ENST00000545697.1_Missense_Mutation_p.C271G|LTBP4_ENST00000243562.9_5'Flank	NM_001042544.1	NP_001036009.1	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding protein 4	818	Cys-rich.				extracellular matrix organization (GO:0030198)|growth hormone secretion (GO:0030252)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|regulation of cell differentiation (GO:0045595)|regulation of cell growth (GO:0001558)|regulation of proteolysis (GO:0030162)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|integrin binding (GO:0005178)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.C818G(1)		central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CTCCTTCCAGTGCAGGACCTG	0.647																																					p.C751G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2251G	19						.						44.0	52.0	49.0					19																	41118050		2081	4206	6287	45809890	SO:0001583	missense	8425	exon15			Y13622	CCDS74368.1, CCDS74369.1, CCDS74370.1	19q13.1-q13.2	2011-10-20				ENSG00000090006		"""Latent transforming growth factor, beta binding proteins"""	6717	protein-coding gene	gene with protein product		604710				9660815, 9271198	Standard	NM_003573		Approved	LTBP-4, LTBP-4L, FLJ46318, FLJ90018	uc002ooh.1	Q8N2S1		ENST00000308370.7:c.2452T>G	19.37:g.41118050T>G	ENSP00000311905:p.Cys818Gly	Somatic		Capture	Illumina HiSeq	Phase_I	45809890	NM_001042545	O00508|O75412|O75413	Missense_Mutation	SNP	ENST00000308370.7	37		.	.	.	.	.	.	.	.	.	.	T	20.4	3.978402	0.74360	.	.	ENSG00000090006	ENST00000204005;ENST00000545697;ENST00000308370;ENST00000396819;ENST00000546155	D;D;D;D	0.99436	-5.9;-5.9;-5.9;-5.9	5.25	5.25	0.73442	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);	0.000000	0.41823	D	0.000820	D	0.99775	0.9907	H	0.99565	4.63	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;0.99;0.999;0.999	D;D;D;D;D	0.91635	0.999;0.998;0.972;0.993;0.993	D	0.96881	0.9646	10	0.87932	D	0	.	13.0925	0.59174	0.0:0.0:0.0:1.0	.	106;38;751;818;781	B7Z8L2;B3KXY6;E7EUU1;Q8N2S1;E7ENG9	.;.;.;LTBP4_HUMAN;.	G	781;271;818;751;106	ENSP00000204005:C781G;ENSP00000441054:C271G;ENSP00000311905:C818G;ENSP00000380031:C751G	ENSP00000204005:C781G	C	+	1	0	LTBP4	45809890	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	5.923000	0.70045	1.984000	0.57885	0.418000	0.28097	TGC		LTBP4-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_003573	
AKT1S1	84335	broad.mit.edu	37	19	50376402	50376402	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr19:50376402G>A	ENST00000391833.1	-	1	2140	c.151C>T	c.(151-153)Cga>Tga	p.R51*	AKT1S1_ENST00000391835.1_Nonsense_Mutation_p.R71*|AKT1S1_ENST00000391832.3_Nonsense_Mutation_p.R51*|AKT1S1_ENST00000391831.1_Nonsense_Mutation_p.R51*|AKT1S1_ENST00000344175.5_Nonsense_Mutation_p.R51*|AKT1S1_ENST00000391834.2_Nonsense_Mutation_p.R51*	NM_001278160.1	NP_001265089.1			AKT1 substrate 1 (proline-rich)									p.R51*(1)		kidney(1)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	5		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		GBM - Glioblastoma multiforme(134;0.0116)|OV - Ovarian serous cystadenocarcinoma(262;0.0132)		AGGGCTCCTCGACCATGGGCA	0.751																																					p.R51X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C151T	19						.						9.0	8.0	8.0					19																	50376402		2038	3939	5977	55068214	SO:0001587	stop_gained	84335	exon2			BC022241	CCDS12784.1, CCDS59410.1	19q13.33	2008-02-05			ENSG00000204673	ENSG00000204673			28426	protein-coding gene	gene with protein product	"""proline-rich Akt substrate, 40 kDa"""	610221				12524439	Standard	NM_032375		Approved	PRAS40, MGC2865, Lobe	uc031rmg.1	Q96B36	OTTHUMG00000150246	ENST00000391833.1:c.151C>T	19.37:g.50376402G>A	ENSP00000375709:p.Arg51*	Somatic		Capture	Illumina HiSeq	Phase_I	55068214	NM_001098632		Nonsense_Mutation	SNP	ENST00000391833.1	37	CCDS12784.1	.	.	.	.	.	.	.	.	.	.	G	46	12.195464	0.99645	.	.	ENSG00000204673	ENST00000391833;ENST00000344175;ENST00000391832;ENST00000391834;ENST00000391835;ENST00000391831;ENST00000391830	.	.	.	4.91	4.91	0.64330	.	0.313608	0.30742	N	0.008972	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.0751	10.7961	0.46461	0.0:0.0:0.8105:0.1895	.	.	.	.	X	51;51;51;51;71;51;51	.	ENSP00000341698:R51X	R	-	1	2	AKT1S1	55068214	0.266000	0.24112	0.754000	0.31244	0.199000	0.23934	0.539000	0.23175	2.288000	0.76882	0.491000	0.48974	CGA		AKT1S1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317073.1	NM_032375	
ZNF121	7675	broad.mit.edu	37	19	9677403	9677403	+	Missense_Mutation	SNP	G	G	T	rs75367556		TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr19:9677403G>T	ENST00000586602.1	-	6	802	c.386C>A	c.(385-387)aCa>aAa	p.T129K	ZNF121_ENST00000320451.6_Missense_Mutation_p.T129K			P58317	ZN121_HUMAN	zinc finger protein 121	129					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T129K(1)		breast(3)|kidney(4)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	24						AGCATGGCTTGTGGAGTAAGT	0.373																																					p.T129K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C386A	19						.						89.0	76.0	80.0					19																	9677403		2203	4300	6503	9538403	SO:0001583	missense	7675	exon4			M99593	CCDS32902.1	19p13.2	2013-01-08	2006-08-22			ENSG00000197961		"""Zinc fingers, C2H2-type"""	12904	protein-coding gene	gene with protein product		194628	"""zinc finger protein 121 (clone ZHC32)"""	D19S204		8468057	Standard	NM_001008727		Approved	ZHC32, ZNF20	uc010xkp.1	P58317		ENST00000586602.1:c.386C>A	19.37:g.9677403G>T	ENSP00000468643:p.Thr129Lys	Somatic		Capture	Illumina HiSeq	Phase_I	9538403	NM_001008727		Missense_Mutation	SNP	ENST00000586602.1	37		.	.	.	.	.	.	.	.	.	.	G	11.51	1.659541	0.29515	.	.	ENSG00000197961	ENST00000538300;ENST00000320451	T	0.15256	2.44	1.3	0.218	0.15270	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.14013	0.0339	N	0.10916	0.065	0.09310	N	1	P	0.47604	0.898	P	0.53035	0.716	T	0.20505	-1.0273	9	0.62326	D	0.03	.	6.6292	0.22847	0.0:0.0:0.7156:0.2844	.	129	P58317	ZN121_HUMAN	K	129	ENSP00000326967:T129K	ENSP00000326967:T129K	T	-	2	0	ZNF121	9538403	0.006000	0.16342	0.003000	0.11579	0.079000	0.17450	1.518000	0.35877	0.130000	0.18549	-0.325000	0.08501	ACA		ZNF121-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000449910.1	NM_001008727	
LILRB4	11006	broad.mit.edu	37	19	55177295	55177295	+	Missense_Mutation	SNP	G	G	A	rs371595706		TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr19:55177295G>A	ENST00000391736.1	+	9	1102	c.787G>A	c.(787-789)Ggg>Agg	p.G263R	LILRB4_ENST00000391733.3_Missense_Mutation_p.G263R|LILRB4_ENST00000391734.3_Missense_Mutation_p.G263R|LILRB4_ENST00000270452.2_Missense_Mutation_p.G263R|LILRB4_ENST00000430952.2_Missense_Mutation_p.G263R	NM_001278426.2|NM_001278428.2|NM_001278429.2|NM_001278430.2	NP_001265355.1|NP_001265357.1|NP_001265358.1|NP_001265359.1	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4	263					immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)	p.G263R(1)		breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(20)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	39				GBM - Glioblastoma multiforme(193;0.035)		GGTACTGATCGGGGTCTTGGT	0.532													G|||	1	0.000199681	0.0	0.0	5008	,	,		18123	0.0		0.001	False		,,,				2504	0.0				p.G263R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G787A	19						.	G	ARG/GLY,ARG/GLY	0,4406		0,0,2203	293.0	156.0	202.0		787,787	1.9	0.0	19		202	3,8597	3.0+/-9.4	0,3,4297	no	missense,missense	LILRB4	NM_001081438.1,NM_006847.3	125,125	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	benign,benign	263/448,263/449	55177295	3,13003	2203	4300	6503	59869107	SO:0001583	missense	11006	exon7			U82979	CCDS12902.1, CCDS42618.1	19q13.4	2013-01-11				ENSG00000186818		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6608	protein-coding gene	gene with protein product		604821				9151699, 9079806	Standard	XM_005277050		Approved	LIR-5, ILT3, HM18, LIR5, CD85k	uc002qgp.3	Q8NHJ6		ENST00000391736.1:c.787G>A	19.37:g.55177295G>A	ENSP00000375616:p.Gly263Arg	Somatic		Capture	Illumina HiSeq	Phase_I	59869107	NM_006847	A8MVL8|O15468|O75021|Q6FGQ9|Q8N1C7|Q8NHL5	Missense_Mutation	SNP	ENST00000391736.1	37	CCDS12902.1	.	.	.	.	.	.	.	.	.	.	G	13.32	2.203048	0.38905	0.0	3.49E-4	ENSG00000186818	ENST00000391736;ENST00000270452;ENST00000430952;ENST00000391734;ENST00000391733;ENST00000434286	T;T;T;T;T;T	0.00522	7.06;7.06;7.06;6.93;7.08;6.84	1.86	1.86	0.25419	.	.	.	.	.	T	0.00815	0.0027	L	0.39898	1.24	0.09310	N	1	B;D;D;D;D	0.76494	0.193;0.999;0.992;0.999;0.994	B;P;P;P;P	0.62298	0.014;0.9;0.75;0.863;0.749	T	0.59069	-0.7523	9	0.49607	T	0.09	.	7.224	0.26005	0.0:0.0:1.0:0.0	.	263;262;263;263;263	A8MUE1;C9JST2;Q8NHJ6-3;Q8NHJ6-2;Q8NHJ6	.;.;.;.;LIRB4_HUMAN	R	263;263;263;263;263;262	ENSP00000375616:G263R;ENSP00000270452:G263R;ENSP00000408995:G263R;ENSP00000375614:G263R;ENSP00000375613:G263R;ENSP00000401962:G262R	ENSP00000270452:G263R	G	+	1	0	LILRB4	59869107	0.007000	0.16637	0.005000	0.12908	0.070000	0.16714	0.710000	0.25748	1.351000	0.45789	0.407000	0.27541	GGG		LILRB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000141127.3		
MTOR	2475	broad.mit.edu	37	1	11293510	11293510	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr1:11293510T>A	ENST00000361445.4	-	15	2442	c.2366A>T	c.(2365-2367)gAt>gTt	p.D789V		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	789					cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.D789V(1)		breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	TGGGTTTGGATCAGGGTCTGG	0.388																																					p.D789V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2366T	1						.						109.0	101.0	104.0					1																	11293510		2203	4300	6503	11216097	SO:0001583	missense	2475	exon15			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.2366A>T	1.37:g.11293510T>A	ENSP00000354558:p.Asp789Val	Somatic		Capture	Illumina HiSeq	Phase_I	11216097	NM_004958	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	37	CCDS127.1	.	.	.	.	.	.	.	.	.	.	T	17.22	3.334344	0.60853	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	T	0.72051	-0.62	5.84	5.84	0.93424	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.63733	0.2536	L	0.42245	1.32	0.80722	D	1	B	0.29432	0.244	B	0.21917	0.037	T	0.64980	-0.6279	10	0.87932	D	0	-8.6105	14.7818	0.69772	0.0:0.0:0.0:1.0	.	789	P42345	MTOR_HUMAN	V	789	ENSP00000354558:D789V	ENSP00000354558:D789V	D	-	2	0	MTOR	11216097	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.832000	0.62759	2.232000	0.73038	0.533000	0.62120	GAT		MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	NM_004958	
VAV3	10451	broad.mit.edu	37	1	108231023	108231023	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr1:108231023C>T	ENST00000370056.4	-	18	1985	c.1711G>A	c.(1711-1713)Ggg>Agg	p.G571R	VAV3_ENST00000371846.4_Missense_Mutation_p.G506R|VAV3_ENST00000544443.1_5'UTR|VAV3_ENST00000343258.4_5'UTR|VAV3_ENST00000415432.2_Missense_Mutation_p.G11R|VAV3_ENST00000527011.1_Missense_Mutation_p.G571R	NM_006113.4	NP_006104.4	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor	571	Sufficient for interaction with ROS1.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of signal transduction (GO:0009967)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|vesicle fusion (GO:0006906)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|SH3/SH2 adaptor activity (GO:0005070)	p.G571R(1)		NS(2)|breast(5)|endometrium(4)|kidney(2)|large_intestine(14)|lung(20)|ovary(6)|prostate(3)|stomach(1)|urinary_tract(1)	58		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		TTGAGTGTCCCTTGTTCTGAA	0.348																																					p.G571R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1711A	1						.						155.0	143.0	147.0					1																	108231023		2202	4298	6500	108032546	SO:0001583	missense	10451	exon18			AF118886	CCDS785.1, CCDS44181.1	1p13.3	2013-02-14	2007-07-25		ENSG00000134215	ENSG00000134215		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12659	protein-coding gene	gene with protein product		605541	"""vav 3 oncogene"""				Standard	NM_001079874		Approved		uc001dvk.1	Q9UKW4	OTTHUMG00000010995	ENST00000370056.4:c.1711G>A	1.37:g.108231023C>T	ENSP00000359073:p.Gly571Arg	Somatic		Capture	Illumina HiSeq	Phase_I	108032546	NM_006113	B1AMM0|B1APV5|B4E232|B7ZLR1|E9PQ97|O60498|O95230|Q9Y5X8	Missense_Mutation	SNP	ENST00000370056.4	37	CCDS785.1	.	.	.	.	.	.	.	.	.	.	C	15.20	2.763887	0.49574	.	.	ENSG00000134215	ENST00000370056;ENST00000527011;ENST00000415432;ENST00000371846	T;T;T;T	0.78595	0.18;0.18;1.76;-1.19	5.92	5.92	0.95590	.	0.297779	0.32970	N	0.005435	T	0.60508	0.2274	L	0.46157	1.445	0.44042	D	0.996779	B;B;B;B;B	0.16802	0.0;0.0;0.001;0.003;0.019	B;B;B;B;B	0.14023	0.0;0.001;0.002;0.006;0.01	T	0.57201	-0.7852	10	0.17832	T	0.49	.	17.0598	0.86544	0.0:1.0:0.0:0.0	.	571;571;506;571;11	B7ZLR1;E9PQ97;B4DHL6;Q9UKW4;Q9UKW4-3	.;.;.;VAV3_HUMAN;.	R	571;571;11;506	ENSP00000359073:G571R;ENSP00000432540:G571R;ENSP00000394897:G11R;ENSP00000360912:G506R	ENSP00000359073:G571R	G	-	1	0	VAV3	108032546	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.412000	0.59787	2.794000	0.96219	0.650000	0.86243	GGG		VAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030242.2	NM_006113	
TDRKH	11022	broad.mit.edu	37	1	151742726	151742726	+	IGR	SNP	C	C	T	rs148149745	byFrequency	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr1:151742726C>T	ENST00000368827.6	-	0	2318				OAZ3_ENST00000453029.2_Silent_p.N154N|RP11-98D18.3_ENST00000512280.1_RNA|OAZ3_ENST00000479764.1_Missense_Mutation_p.T4M|OAZ3_ENST00000321531.5_Silent_p.N141N|OAZ3_ENST00000315067.8_Silent_p.N141N|OAZ3_ENST00000400999.1_Missense_Mutation_p.T4M	NM_006862.3	NP_006853.2	Q9Y2W6	TDRKH_HUMAN	tudor and KH domain containing						cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	mitochondrion (GO:0005739)|pi-body (GO:0071546)|piP-body (GO:0071547)	RNA binding (GO:0003723)	p.N185N(1)		breast(5)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			ATGATCGGAACGACAGAGGTG	0.473																																					p.R187X												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C559T	1						.						298.0	301.0	300.0					1																	151742726		1965	4163	6128	150009350	SO:0001628	intergenic_variant	51686	exon4			AF227192	CCDS41394.1, CCDS41395.1	1q21	2013-01-23	2003-11-07		ENSG00000182134	ENSG00000182134		"""Tudor domain containing"""	11713	protein-coding gene	gene with protein product		609501	"""tudor and KH domain containing"""			10767542	Standard	NM_001083964		Approved	TDRD2	uc001eza.4	Q9Y2W6	OTTHUMG00000013062		1.37:g.151742726C>T		Somatic		Capture	Illumina HiSeq	Phase_I	150009350	NM_016178	D3DV24|Q5SZR3|Q5SZR5|Q8N582|Q9NYV5	Nonsense_Mutation	SNP	ENST00000368827.6	37	CCDS41394.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	12.43|12.43	1.935739|1.935739	0.34189|0.34189	.|.	.|.	ENSG00000143450|ENSG00000143450	ENST00000453029|ENST00000400999	.|.	.|.	.|.	5.43|5.43	-5.24|-5.24	0.02789|0.02789	.|.	.|.	.|.	.|.	.|.	.|T	.|0.37404	.|0.1002	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.53464	.|-0.8435	.|5	.|0.87932	.|D	.|0	-1.7362|-1.7362	2.6382|2.6382	0.04964|0.04964	0.1008:0.3342:0.1804:0.3846|0.1008:0.3342:0.1804:0.3846	.|.	.|.	.|.	.|.	X|M	111|4	.|.	.|ENSP00000383784:T4M	R|T	+|+	1|2	2|0	OAZ3|OAZ3	150009350|150009350	0.138000|0.138000	0.22547|0.22547	0.280000|0.280000	0.24747|0.24747	0.801000|0.801000	0.45260|0.45260	-0.980000|-0.980000	0.03770|0.03770	-1.099000|-1.099000	0.03034|0.03034	-1.088000|-1.088000	0.02184|0.02184	CGA|ACG		TDRKH-002	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000036645.3	NM_006862	
NTRK1	4914	broad.mit.edu	37	1	156849792	156849792	+	Splice_Site	SNP	T	T	G	rs199905593		TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr1:156849792T>G	ENST00000524377.1	+	16	2089	c.2048T>G	c.(2047-2049)gTg>gGg	p.V683G	NTRK1_ENST00000358660.3_Splice_Site_p.V680G|NTRK1_ENST00000392302.2_Splice_Site_p.V647G|NTRK1_ENST00000368196.3_Splice_Site_p.V677G	NM_002529.3	NP_002520.2	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	683	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|axon guidance (GO:0007411)|axonogenesis involved in innervation (GO:0060385)|B cell differentiation (GO:0030183)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to nicotine (GO:0071316)|circadian rhythm (GO:0007623)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|developmental programmed cell death (GO:0010623)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory nerve development (GO:0021553)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to hydrostatic pressure (GO:0051599)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|Sertoli cell development (GO:0060009)|small GTPase mediated signal transduction (GO:0007264)|sympathetic nervous system development (GO:0048485)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome (GO:0005769)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.V683G(1)|p.V647G(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(35)|ovary(8)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	74	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Amitriptyline(DB00321)|Imatinib(DB00619)|Regorafenib(DB08896)	CCGTGGCAGGTGGGAGGCCGC	0.612			T	"""TPM3, TPR, TFG"""	papillary thyroid					TSP Lung(10;0.080)																											p.V677G			Dom	yes		1	1q21-q22	4914	"""neurotrophic tyrosine kinase, receptor, type 1"""		E	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T2030G	1						.						41.0	43.0	43.0					1																	156849792		2201	4299	6500	155116416	SO:0001630	splice_region_variant	4914	exon15			Y09028	CCDS1161.1, CCDS30890.1, CCDS30891.1	1q21-q22	2014-09-17			ENSG00000198400	ENSG00000198400	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8031	protein-coding gene	gene with protein product	"""high affinity nerve growth factor receptor"""	191315				2869410	Standard	NM_001007792		Approved	TRK, TRKA, MTC	uc001fqh.1	P04629	OTTHUMG00000041304	ENST00000524377.1:c.2047-1T>G	1.37:g.156849792T>G		Somatic		Capture	Illumina HiSeq	Phase_I	155116416	NM_001012331	B2R6T5|B7ZM34|P08119|Q15655|Q15656|Q5D056|Q5VZS2|Q7Z5C3|Q9UIU7	Missense_Mutation	SNP	ENST00000524377.1	37	CCDS1161.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.286928	0.80803	.	.	ENSG00000198400	ENST00000392302;ENST00000368196;ENST00000524377;ENST00000358660	D;D;D;D	0.83075	-1.68;-1.68;-1.68;-1.68	4.13	4.13	0.48395	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.50627	D	0.000115	D	0.83321	0.5229	L	0.39898	1.24	0.80722	D	1	D;D;D;D	0.89917	1.0;0.991;0.961;0.998	D;P;P;D	0.97110	1.0;0.813;0.489;0.94	D	0.85814	0.1381	10	0.72032	D	0.01	.	12.4091	0.55457	0.0:0.0:0.0:1.0	.	680;677;683;647	A8K3Z4;P04629-2;P04629;A6NF12	.;.;NTRK1_HUMAN;.	G	647;677;683;680	ENSP00000376120:V647G;ENSP00000357179:V677G;ENSP00000431418:V683G;ENSP00000351486:V680G	ENSP00000351486:V680G	V	+	2	0	NTRK1	155116416	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	7.382000	0.79729	1.869000	0.54173	0.459000	0.35465	GTG		NTRK1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392279.1	NM_002529	Missense_Mutation
ARHGAP30	257106	broad.mit.edu	37	1	161021490	161021490	+	Missense_Mutation	SNP	A	A	C	rs201591076		TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr1:161021490A>C	ENST00000368013.3	-	10	1354	c.1034T>G	c.(1033-1035)gTg>gGg	p.V345G	ARHGAP30_ENST00000368016.3_Missense_Mutation_p.V345G|ARHGAP30_ENST00000368015.1_Missense_Mutation_p.V168G	NM_001025598.1|NM_181720.2	NP_001020769.1|NP_859071.2	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30	345					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)	p.V345G(4)		breast(2)|cervix(3)|endometrium(4)|kidney(2)|large_intestine(4)|lung(6)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			GCTGGGCCCCACCAGCCCCTC	0.582																																					p.V345G												.	.	4	Substitution - Missense(4)	large_intestine(2)|prostate(2)	c.T1034G	1						.						12.0	12.0	12.0					1																	161021490		2085	4128	6213	159288114	SO:0001583	missense	257106	exon10			AL832852	CCDS1215.1, CCDS30918.1, CCDS72958.1	1q23.3	2011-06-29			ENSG00000186517	ENSG00000186517		"""Rho GTPase activating proteins"""	27414	protein-coding gene	gene with protein product		614264					Standard	NM_001287602		Approved	FLJ00267	uc001fxl.3	Q7Z6I6	OTTHUMG00000031477	ENST00000368013.3:c.1034T>G	1.37:g.161021490A>C	ENSP00000356992:p.Val345Gly	Somatic		Capture	Illumina HiSeq	Phase_I	159288114	NM_181720	Q5SY52|Q5SY53|Q5SY54|Q6ZML6|Q7Z3J8|Q86XI7	Missense_Mutation	SNP	ENST00000368013.3	37	CCDS30918.1	.	.	.	.	.	.	.	.	.	.	A	6.909	0.537267	0.13188	.	.	ENSG00000186517	ENST00000368016;ENST00000368013;ENST00000368017;ENST00000368015	T;T;T	0.32272	3.0;2.99;1.46	4.4	-3.1	0.05315	.	1.722310	0.03272	N	0.184900	T	0.04543	0.0124	N	0.14661	0.345	0.09310	N	0.999998	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.25117	-1.0141	10	0.30854	T	0.27	.	0.8588	0.01188	0.276:0.336:0.2239:0.1642	.	345;345	Q7Z6I6;Q7Z6I6-2	RHG30_HUMAN;.	G	345;345;197;168	ENSP00000356995:V345G;ENSP00000356992:V345G;ENSP00000356994:V168G	ENSP00000356992:V345G	V	-	2	0	ARHGAP30	159288114	0.000000	0.05858	0.022000	0.16811	0.920000	0.55202	-0.377000	0.07456	-0.138000	0.11434	0.529000	0.55759	GTG		ARHGAP30-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077090.2	NM_181720	
ASPM	259266	broad.mit.edu	37	1	197097791	197097791	+	Missense_Mutation	SNP	C	C	T	rs199871272	byFrequency	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr1:197097791C>T	ENST00000367409.4	-	10	3021	c.2765G>A	c.(2764-2766)aGt>aAt	p.S922N	ASPM_ENST00000367408.1_Missense_Mutation_p.S172N|ASPM_ENST00000294732.7_Missense_Mutation_p.S922N	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	922	CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						GATTTCTTTACTAGCCTATAA	0.318																																					p.S922N												.	.	0			c.G2765A	1						.						23.0	24.0	24.0					1																	197097791		2203	4299	6502	195364414	SO:0001583	missense	259266	exon10			AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.2765G>A	1.37:g.197097791C>T	ENSP00000356379:p.Ser922Asn	None		Capture	Illumina HiSeq	Phase_I	195364414	NM_018136	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	37	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.077850	0.76528	.	.	ENSG00000066279	ENST00000367409;ENST00000294732;ENST00000367408	T;T;T	0.58652	0.32;0.32;0.32	5.77	5.77	0.91146	Calponin homology domain (3);	0.000000	0.85682	D	0.000000	D	0.82379	0.5024	M	0.90870	3.155	0.48762	D	0.999703	D;D	0.89917	1.0;1.0	D;D	0.79784	0.96;0.993	D	0.85154	0.0988	10	0.87932	D	0	.	20.3627	0.98863	0.0:1.0:0.0:0.0	.	922;922	Q4G1H1;Q8IZT6	.;ASPM_HUMAN	N	922;922;172	ENSP00000356379:S922N;ENSP00000294732:S922N;ENSP00000356378:S172N	ENSP00000294732:S922N	S	-	2	0	ASPM	195364414	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	3.545000	0.53648	2.885000	0.99019	0.655000	0.94253	AGT		ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136	
EIF4G3	8672	broad.mit.edu	37	1	21268153	21268153	+	Silent	SNP	C	C	T			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr1:21268153C>T	ENST00000264211.8	-	8	1520	c.1326G>A	c.(1324-1326)ccG>ccA	p.P442P	EIF4G3_ENST00000400422.1_Silent_p.P442P|EIF4G3_ENST00000374933.3_5'Flank|EIF4G3_ENST00000374935.3_Intron|EIF4G3_ENST00000356916.3_Silent_p.P453P|EIF4G3_ENST00000602326.1_Silent_p.P448P|EIF4G3_ENST00000544689.1_5'Flank|EIF4G3_ENST00000536266.1_Silent_p.P46P|EIF4G3_ENST00000374927.4_Silent_p.P442P|EIF4G3_ENST00000374937.3_Silent_p.P448P	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3	442					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)	p.P442P(1)|p.P448P(1)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		TGGCAGCACTCGGAGAACTAA	0.493																																					p.P442P												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1326A	1						.						150.0	145.0	147.0					1																	21268153		2203	4300	6503	21140740	SO:0001819	synonymous_variant	8672	exon9			AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.1326G>A	1.37:g.21268153C>T		Somatic		Capture	Illumina HiSeq	Phase_I	21140740	NM_003760	B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	Silent	SNP	ENST00000264211.8	37	CCDS214.1																																																																																				EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000007467.3	NM_003760	
ARID1A	8289	broad.mit.edu	37	1	27057853	27057853	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr1:27057853C>T	ENST00000324856.7	+	3	1932	c.1561C>T	c.(1561-1563)Cag>Tag	p.Q521*	ARID1A_ENST00000457599.2_Nonsense_Mutation_p.Q521*|ARID1A_ENST00000374152.2_Nonsense_Mutation_p.Q138*	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	521					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.Q521*(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		ATACTCCCAGCAGCCATCCCA	0.637			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.Q521X			Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1561T	1						.						255.0	241.0	246.0					1																	27057853		2203	4300	6503	26930440	SO:0001587	stop_gained	8289	exon3			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.1561C>T	1.37:g.27057853C>T	ENSP00000320485:p.Gln521*	Somatic		Capture	Illumina HiSeq	Phase_I	26930440	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	ENST00000324856.7	37	CCDS285.1	.	.	.	.	.	.	.	.	.	.	C	18.66	3.670763	0.67814	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152	.	.	.	5.44	5.44	0.79542	.	0.274240	0.35903	N	0.002915	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	-6.0605	14.9862	0.71351	0.0:0.858:0.142:0.0	.	.	.	.	X	521;521;138	.	ENSP00000320485:Q521X	Q	+	1	0	ARID1A	26930440	1.000000	0.71417	1.000000	0.80357	0.476000	0.33039	5.558000	0.67319	2.824000	0.97209	0.655000	0.94253	CAG		ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
GRIK3	2899	broad.mit.edu	37	1	37271750	37271750	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr1:37271750C>T	ENST00000373091.3	-	14	2285	c.2269G>A	c.(2269-2271)Ggg>Agg	p.G757R	GRIK3_ENST00000373093.4_Missense_Mutation_p.G757R	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	757					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)	p.G757R(1)		breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				ATGAGGCCCCCGATCTGGGTG	0.667																																					p.G757R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2269A	1						.						177.0	123.0	141.0					1																	37271750		2203	4300	6503	37044337	SO:0001583	missense	2899	exon14			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.2269G>A	1.37:g.37271750C>T	ENSP00000362183:p.Gly757Arg	Somatic		Capture	Illumina HiSeq	Phase_I	37044337	NM_000831	A9Z1Z8|B1AMS6|Q13004|Q16136	Missense_Mutation	SNP	ENST00000373091.3	37	CCDS416.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.434613	0.83885	.	.	ENSG00000163873	ENST00000373091;ENST00000373093	T;T	0.15017	2.46;2.46	5.31	4.4	0.53042	Ionotropic glutamate receptor (2);	0.059910	0.64402	N	0.000003	T	0.51839	0.1698	M	0.93763	3.455	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.65709	-0.6102	10	0.87932	D	0	.	13.8859	0.63708	0.0:0.9262:0.0:0.0738	.	757;757	A9Z1Z8;Q13003	.;GRIK3_HUMAN	R	757	ENSP00000362183:G757R;ENSP00000362185:G757R	ENSP00000362183:G757R	G	-	1	0	GRIK3	37044337	1.000000	0.71417	0.997000	0.53966	0.767000	0.43475	7.757000	0.85209	1.245000	0.43885	0.549000	0.68633	GGG		GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012053.1	NM_000831	
KDM4A	9682	broad.mit.edu	37	1	44157962	44157964	+	In_Frame_Del	DEL	GCA	GCA	-			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	GCA	GCA	GCA	GCA	GCA	GCA	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr1:44157962_44157964delGCA	ENST00000372396.3	+	16	2489_2491	c.2355_2357delGCA	c.(2353-2358)ctgcag>ctg	p.Q786del		NM_014663.2	NP_055478.2	O75164	KDM4A_HUMAN	lysine (K)-specific demethylase 4A	786					cardiac muscle hypertrophy in response to stress (GO:0014898)|histone demethylation (GO:0016577)|histone H3-K36 demethylation (GO:0070544)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|methylated histone binding (GO:0035064)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(13)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	37						GAGGGGCCCTGCAGAGAGCAAAT	0.478																																					p.785_786del												.	.	0			c.2355_2357del	1						.																																			43930551	SO:0001651	inframe_deletion	9682	exon16			AB014577	CCDS491.1	1p34.1	2013-01-23	2009-04-06	2009-04-06	ENSG00000066135	ENSG00000066135		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	22978	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 3A"", ""tudor domain containing 14A"""	609764	"""jumonji domain containing 2"", ""jumonji domain containing 2A"""	JMJD2, JMJD2A		9734811, 15138608	Standard	XM_005271354		Approved	KIAA0677, JHDM3A, TDRD14A	uc001cjx.3	O75164	OTTHUMG00000007560	ENST00000372396.3:c.2355_2357delGCA	1.37:g.44157962_44157964delGCA	ENSP00000361473:p.Gln786del	None		Capture	Illumina HiSeq	Phase_I	43930549	NM_014663	Q5VVB1	In_Frame_Del	DEL	ENST00000372396.3	37	CCDS491.1																																																																																				KDM4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019960.1	NM_014663	
RPE65	6121	broad.mit.edu	37	1	68897203	68897203	+	Silent	SNP	G	G	A	rs139640666	byFrequency	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr1:68897203G>A	ENST00000262340.5	-	11	1247	c.1194C>T	c.(1192-1194)gaC>gaT	p.D398D		NM_000329.2	NP_000320.1	Q16518	RPE65_HUMAN	retinal pigment epithelium-specific protein 65kDa	398					cellular response to electrical stimulus (GO:0071257)|detection of light stimulus involved in visual perception (GO:0050908)|insulin receptor signaling pathway (GO:0008286)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin gene expression (GO:0007468)|retina homeostasis (GO:0001895)|retina morphogenesis in camera-type eye (GO:0060042)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|visual perception (GO:0007601)|vitamin A metabolic process (GO:0006776)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	all-trans-retinyl-ester hydrolase, 11-cis retinol forming activity (GO:0052885)|all-trans-retinyl-palmitate hydrolase, 11-cis retinol forming activity (GO:0052884)|metal ion binding (GO:0046872)|retinal isomerase activity (GO:0004744)	p.D398D(1)		central_nervous_system(1)|kidney(3)|large_intestine(12)|lung(15)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	35						AGATAGTCTCGTCACTGCACA	0.473													G|||	2	0.000399361	0.0008	0.0	5008	,	,		18311	0.0		0.0	False		,,,				2504	0.001				p.D398D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1194T	1						.						57.0	61.0	59.0					1																	68897203		2203	4300	6503	68669791	SO:0001819	synonymous_variant	6121	exon11			U18991	CCDS643.1	1p31	2014-05-13	2002-08-29		ENSG00000116745	ENSG00000116745	3.1.1.64		10294	protein-coding gene	gene with protein product	"""retinol isomerase"", ""all-trans-retinyl-palmitate hydrolase"", ""retinoid isomerohydrolase"", ""BCO family, member 3"""	180069	"""retinal pigment epithelium-specific protein (65kD)"""	RP20		8340400	Standard	XM_006710811		Approved	LCA2, rd12, BCO3	uc001dei.1	Q16518	OTTHUMG00000009208	ENST00000262340.5:c.1194C>T	1.37:g.68897203G>A		Somatic		Capture	Illumina HiSeq	Phase_I	68669791	NM_000329	A8K1L0|Q5T9U3	Silent	SNP	ENST00000262340.5	37	CCDS643.1																																																																																				RPE65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025509.1	NM_000329	
PPP1R12B	4660	broad.mit.edu	37	1	202396302	202396302	+	Missense_Mutation	SNP	G	G	A	rs569635559		TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr1:202396302G>A	ENST00000608999.1	+	5	989	c.836G>A	c.(835-837)cGa>cAa	p.R279Q	PPP1R12B_ENST00000336894.4_Missense_Mutation_p.R279Q|PPP1R12B_ENST00000356764.2_Missense_Mutation_p.R279Q|PPP1R12B_ENST00000480184.1_Missense_Mutation_p.R279Q	NM_001197131.1|NM_002481.3	NP_001184060.1|NP_002472.2	O60237	MYPT2_HUMAN	protein phosphatase 1, regulatory subunit 12B	279					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of catalytic activity (GO:0043085)|regulation of muscle contraction (GO:0006937)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	enzyme activator activity (GO:0008047)	p.R279Q(1)		central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(17)|ovary(4)|skin(3)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(75;0.166)			ATGGATATTCGAAATAAACTG	0.473													G|||	1	0.000199681	0.0	0.0	5008	,	,		19130	0.001		0.0	False		,,,				2504	0.0				p.R279Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G836A	1						.						89.0	84.0	86.0					1																	202396302		2203	4300	6503	200662925	SO:0001583	missense	4660	exon5			AB003062	CCDS1426.1, CCDS44294.1, CCDS44295.1, CCDS53458.1, CCDS53459.1, CCDS73005.1	1q32.1	2013-01-10	2011-10-04	2001-08-10	ENSG00000077157	ENSG00000077157		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7619	protein-coding gene	gene with protein product	"""myosin phosphatase regulatory subunit"", ""myosin phosphatase, target subunit 2"""	603768	"""protein phosphatase 1, regulatory (inhibitor) subunit 12B"""	MYPT2		9570949	Standard	NM_002481		Approved	MGC87886, MGC131980, PP1bp55	uc001gya.2	O60237	OTTHUMG00000041393	ENST00000608999.1:c.836G>A	1.37:g.202396302G>A	ENSP00000476755:p.Arg279Gln	Somatic		Capture	Illumina HiSeq	Phase_I	200662925	NM_001167857	A8MYF5|B7ZMN6|Q2TAI8|Q5T506|Q5VUK2|Q8N179|Q9HCB7|Q9HCB8	Missense_Mutation	SNP	ENST00000608999.1	37	CCDS1426.1	.	.	.	.	.	.	.	.	.	.	G	13.61	2.288716	0.40494	.	.	ENSG00000077157	ENST00000406302;ENST00000336894;ENST00000480184;ENST00000356764	T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26	4.99	4.99	0.66335	Ankyrin repeat-containing domain (3);	0.000000	0.53938	D	0.000044	T	0.67202	0.2868	L	0.41236	1.265	0.80722	D	1	B;P;D;D	0.64830	0.041;0.922;0.986;0.994	B;P;P;P	0.56916	0.045;0.505;0.643;0.809	T	0.61402	-0.7070	10	0.13108	T	0.6	.	13.2621	0.60111	0.0:0.0:0.8412:0.1588	.	279;279;279;279	O60237-2;O60237;F8W8M3;Q2TAI8	.;MYPT2_HUMAN;.;.	Q	279	ENSP00000384496:R279Q;ENSP00000337897:R279Q;ENSP00000417159:R279Q;ENSP00000349206:R279Q	ENSP00000337897:R279Q	R	+	2	0	PPP1R12B	200662925	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	7.203000	0.77864	2.321000	0.78463	0.467000	0.42956	CGA		PPP1R12B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000099166.3	NM_032105	
C20orf141	128653	broad.mit.edu	37	20	2796351	2796351	+	Missense_Mutation	SNP	C	C	T	rs181014957		TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr20:2796351C>T	ENST00000380589.4	+	2	602	c.428C>T	c.(427-429)cCg>cTg	p.P143L	TMEM239_ENST00000380585.1_5'Flank|TMEM239_ENST00000380593.4_Intron|TMEM239_ENST00000361033.1_5'Flank|C20orf141_ENST00000603872.1_Missense_Mutation_p.P143L|TMEM239_ENST00000554164.1_Intron	NM_080739.2	NP_542777.1	Q9NUB4	CT141_HUMAN	chromosome 20 open reading frame 141	143	Leu-rich.					integral component of membrane (GO:0016021)		p.P143L(1)		endometrium(4)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	10						GGGCTGGGCCCGCTCCTGAGA	0.617													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18866	0.0		0.0	False		,,,				2504	0.0				p.P143L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C428T	20						.						79.0	77.0	78.0					20																	2796351		2203	4300	6503	2744351	SO:0001583	missense	128653	exon2				CCDS13034.1	20p13	2012-10-30			ENSG00000258713	ENSG00000258713			16134	protein-coding gene	gene with protein product							Standard	NM_001256538		Approved	dJ860F19.4	uc002wgw.3	Q9NUB4	OTTHUMG00000031707	ENST00000380589.4:c.428C>T	20.37:g.2796351C>T	ENSP00000369963:p.Pro143Leu	Somatic		Capture	Illumina HiSeq	Phase_I	2744351	NM_080739		Missense_Mutation	SNP	ENST00000380589.4	37	CCDS13034.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	0.052	-1.246885	0.01481	.	.	ENSG00000258713	ENST00000380589	.	.	.	4.43	1.91	0.25777	.	.	.	.	.	T	0.08044	0.0201	N	0.01576	-0.805	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.36890	-0.9729	8	0.02654	T	1	1.427	3.4581	0.07523	0.1961:0.11:0.0:0.6939	.	143	Q9NUB4	CT141_HUMAN	L	143	.	ENSP00000369963:P143L	P	+	2	0	AL035460.3	2744351	0.692000	0.27719	0.012000	0.15200	0.026000	0.11368	1.253000	0.32886	0.218000	0.20820	-0.290000	0.09829	CCG		C20orf141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077644.2	NM_080739	
DSCAM	1826	broad.mit.edu	37	21	41710034	41710034	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr21:41710034C>T	ENST00000400454.1	-	8	2254	c.1777G>A	c.(1777-1779)Gtg>Atg	p.V593M		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	593					cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.V593M(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				TTACCTTTCACGGTCACGTGG	0.507																																					p.V593M	Melanoma(134;970 1778 1785 21664 32388)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1777A	21						.						137.0	137.0	137.0					21																	41710034		2074	4206	6280	40631904	SO:0001583	missense	1826	exon8			AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.1777G>A	21.37:g.41710034C>T	ENSP00000383303:p.Val593Met	Somatic		Capture	Illumina HiSeq	Phase_I	40631904	NM_001389	O60468	Missense_Mutation	SNP	ENST00000400454.1	37	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.453682	0.84209	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.79141	-1.24;-1.24	5.27	5.27	0.74061	Immunoglobulin I-set (1);	0.000000	0.85682	D	0.000000	D	0.92515	0.7623	H	0.97440	4.005	0.58432	D	0.999999	D	0.89917	1.0	D	0.69307	0.963	D	0.94927	0.8079	10	0.87932	D	0	.	19.2329	0.93847	0.0:1.0:0.0:0.0	.	593	O60469	DSCAM_HUMAN	M	593;345	ENSP00000383303:V593M;ENSP00000385342:V345M	ENSP00000383303:V593M	V	-	1	0	DSCAM	40631904	1.000000	0.71417	0.951000	0.38953	0.913000	0.54294	7.607000	0.82883	2.617000	0.88574	0.655000	0.94253	GTG		DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
KRTAP10-6	386674	broad.mit.edu	37	21	46011764	46011764	+	Missense_Mutation	SNP	G	G	A	rs199511488	byFrequency	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr21:46011764G>A	ENST00000400368.1	-	1	622	c.602C>T	c.(601-603)aCc>aTc	p.T201I	TSPEAR_ENST00000323084.4_Intron	NM_198688.2	NP_941961.2	P60371	KR106_HUMAN	keratin associated protein 10-6	201	29 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(6)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23						GCAGGAGCTGGTGCAGCCTGA	0.657													.|||	6	0.00119808	0.0	0.0029	5008	,	,		24873	0.0		0.004	False		,,,				2504	0.0				p.T201I												.	.	0			c.C602T	21						.						74.0	101.0	92.0					21																	46011764		2203	4298	6501	44836192	SO:0001583	missense	386674	exon1			AB076353	CCDS42959.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000188155	ENSG00000188155		"""Keratin associated proteins"""	20523	protein-coding gene	gene with protein product			"""keratin associated protein 18-6"""	KRTAP18-6			Standard	NM_198688		Approved	KRTAP18.6, KAP18.6, KAP10.6	uc002zfm.3	P60371	OTTHUMG00000057634	ENST00000400368.1:c.602C>T	21.37:g.46011764G>A	ENSP00000383219:p.Thr201Ile	None		Capture	Illumina HiSeq	Phase_I	44836192	NM_198688		Missense_Mutation	SNP	ENST00000400368.1	37	CCDS42959.1	.	.	.	.	.	.	.	.	.	.	-	7.623	0.677161	0.14841	.	.	ENSG00000188155	ENST00000400368	T	0.00792	5.69	0.986	0.986	0.19784	.	.	.	.	.	T	0.01287	0.0042	M	0.88031	2.925	0.09310	N	0.999999	P	0.52061	0.95	B	0.36134	0.218	T	0.47209	-0.9135	9	0.34782	T	0.22	.	5.2363	0.15448	0.0:0.0:1.0:0.0	.	201	P60371	KR106_HUMAN	I	201	ENSP00000383219:T201I	ENSP00000383219:T201I	T	-	2	0	KRTAP10-6	44836192	0.048000	0.20356	0.051000	0.19133	0.276000	0.26787	0.180000	0.16860	0.460000	0.27045	0.194000	0.17425	ACC		KRTAP10-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128037.1	NM_198688	
CELSR1	9620	broad.mit.edu	37	22	46790111	46790111	+	Silent	SNP	T	T	G			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr22:46790111T>G	ENST00000262738.3	-	14	5891	c.5892A>C	c.(5890-5892)ggA>ggC	p.G1964G		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	1964	EGF-like 7; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)	p.G1964G(1)		breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		AGTGGCAGGGTCCACAGACGG	0.582																																					p.G1964G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A5892C	22						.						65.0	50.0	55.0					22																	46790111		2203	4300	6503	45168775	SO:0001819	synonymous_variant	9620	exon14			AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.5892A>C	22.37:g.46790111T>G		Somatic		Capture	Illumina HiSeq	Phase_I	45168775	NM_014246	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Silent	SNP	ENST00000262738.3	37	CCDS14076.1																																																																																				CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1	NM_014246	
FAM49A	81553	broad.mit.edu	37	2	16742331	16742331	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr2:16742331T>G	ENST00000381323.3	-	9	857	c.637A>C	c.(637-639)Act>Cct	p.T213P	FAM49A_ENST00000406434.1_Missense_Mutation_p.T213P|FAM49A_ENST00000355549.2_Missense_Mutation_p.T213P	NM_030797.3	NP_110424.1	Q9H0Q0	FA49A_HUMAN	family with sequence similarity 49, member A	213						intracellular (GO:0005622)		p.T213P(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|skin(3)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(172;0.0734)|all_hematologic(175;0.088)		GBM - Glioblastoma multiforme(3;0.00969)			ATTGGCAGAGTTTTGTTCTAA	0.418																																					p.T213P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A637C	2						.						231.0	215.0	220.0					2																	16742331		2203	4300	6503	16605812	SO:0001583	missense	81553	exon9			AK001942	CCDS1688.1	2p24.3	2008-02-05			ENSG00000197872	ENSG00000197872			25373	protein-coding gene	gene with protein product							Standard	NM_030797		Approved	DKFZP566A1524, FLJ11080	uc002rck.2	Q9H0Q0	OTTHUMG00000090615	ENST00000381323.3:c.637A>C	2.37:g.16742331T>G	ENSP00000370724:p.Thr213Pro	Somatic		Capture	Illumina HiSeq	Phase_I	16605812	NM_030797	B3KNZ1|Q53QW2	Missense_Mutation	SNP	ENST00000381323.3	37	CCDS1688.1	.	.	.	.	.	.	.	.	.	.	T	19.14	3.769277	0.69992	.	.	ENSG00000197872	ENST00000381323;ENST00000406434;ENST00000355549	T;T;T	0.46063	0.88;0.88;0.88	5.38	5.38	0.77491	.	0.088520	0.85682	D	0.000000	T	0.36717	0.0977	L	0.38175	1.15	0.80722	D	1	P	0.35527	0.507	B	0.37480	0.251	T	0.15178	-1.0446	10	0.34782	T	0.22	-24.8193	14.8874	0.70579	0.0:0.0:0.0:1.0	.	213	Q9H0Q0	FA49A_HUMAN	P	213	ENSP00000370724:T213P;ENSP00000384771:T213P;ENSP00000347744:T213P	ENSP00000347744:T213P	T	-	1	0	FAM49A	16605812	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.006000	0.63978	2.178000	0.69098	0.533000	0.62120	ACT		FAM49A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207203.2	NM_030797	
TTN	7273	broad.mit.edu	37	2	179407413	179407413	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr2:179407413C>A	ENST00000591111.1	-	298	92469	c.92245G>T	c.(92245-92247)Gaa>Taa	p.E30749*	TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000460472.2_Nonsense_Mutation_p.E23325*|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Nonsense_Mutation_p.E32390*|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342992.6_Nonsense_Mutation_p.E29822*|TTN-AS1_ENST00000586452.1_RNA|RP11-65L3.4_ENST00000604692.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Nonsense_Mutation_p.E23517*|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Nonsense_Mutation_p.E23450*			Q8WZ42	TITIN_HUMAN	titin	30749	Ig-like 138.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.E23325*(1)|p.E23517*(1)|p.E29820*(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTAATGGTTTCTGAAGTAGTT	0.338																																					p.Q23324H												.	.	3	Substitution - Nonsense(3)	large_intestine(3)	c.G69972T	2						.						221.0	218.0	219.0					2																	179407413		1863	4099	5962	179115659	SO:0001587	stop_gained	7273	exon176			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.92245G>T	2.37:g.179407413C>A	ENSP00000465570:p.Glu30749*	Somatic		Capture	Illumina HiSeq	Phase_I	179115659	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	68	106.467998	0.99998	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	.	.	.	5.55	5.55	0.83447	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.5145	0.95157	0.0:1.0:0.0:0.0	.	.	.	.	X	29822;23325;23517;23450;23322	.	ENSP00000340554:E23517X	E	-	1	0	TTN	179115659	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	7.818000	0.86416	2.618000	0.88619	0.655000	0.94253	GAA		TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
ERBB4	2066	broad.mit.edu	37	2	212248519	212248519	+	Silent	SNP	G	G	T			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr2:212248519G>T	ENST00000342788.4	-	28	4058	c.3748C>A	c.(3748-3750)Cgg>Agg	p.R1250R	ERBB4_ENST00000436443.1_Silent_p.R1234R|ERBB4_ENST00000402597.1_Silent_p.R1240R	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	1250					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.R1250R(1)		NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	AGGGTGCTCCGAGGTGGCAGG	0.498										TSP Lung(8;0.080)																											p.R1250R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3748A	2						.						188.0	174.0	179.0					2																	212248519		2203	4300	6503	211956764	SO:0001819	synonymous_variant	2066	exon28			L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.3748C>A	2.37:g.212248519G>T		Somatic		Capture	Illumina HiSeq	Phase_I	211956764	NM_005235	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Silent	SNP	ENST00000342788.4	37	CCDS2394.1																																																																																				ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599	
USP34	9736	broad.mit.edu	37	2	61436054	61436054	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr2:61436054C>T	ENST00000398571.2	-	70	8975	c.8899G>A	c.(8899-8901)Gga>Aga	p.G2967R	USP34_ENST00000472689.1_5'UTR	NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	2967					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.G2967R(1)		autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			AGAATCAATCCTCGATTAAAT	0.303																																					p.G2967R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G8899A	2						.						89.0	87.0	88.0					2																	61436054		1812	4059	5871	61289558	SO:0001583	missense	9736	exon70			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.8899G>A	2.37:g.61436054C>T	ENSP00000381577:p.Gly2967Arg	Somatic		Capture	Illumina HiSeq	Phase_I	61289558	NM_014709	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	ENST00000398571.2	37	CCDS42686.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.5|27.5	4.837388|4.837388	0.91117|0.91117	.|.	.|.	ENSG00000115464|ENSG00000115464	ENST00000263989;ENST00000398571|ENST00000411912	T|T	0.64260|0.28454	-0.09|1.61	6.06|6.06	6.06|6.06	0.98353|0.98353	Armadillo-type fold (1);|.	0.047723|.	0.85682|.	D|.	0.000000|.	T|T	0.44201|0.44201	0.1282|0.1282	L|L	0.61218|0.61218	1.895|1.895	0.80722|0.80722	D|D	1|1	D|.	0.54047|.	0.964|.	P|.	0.51101|.	0.659|.	T|T	0.11616|0.11616	-1.0580|-1.0580	10|7	0.87932|0.07175	D|T	0|0.84	.|.	20.6397|20.6397	0.99537|0.99537	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	2967|.	Q70CQ2|.	UBP34_HUMAN|.	R|K	2815;2967|726	ENSP00000381577:G2967R|ENSP00000398960:R726K	ENSP00000263989:G2815R|ENSP00000398960:R726K	G|R	-|-	1|2	0|0	USP34|USP34	61289558|61289558	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.623000|0.623000	0.37688|0.37688	7.146000|7.146000	0.77373|0.77373	2.880000|2.880000	0.98712|0.98712	0.650000|0.650000	0.86243|0.86243	GGA|AGG		USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4		
CXCR1	3577	broad.mit.edu	37	2	219029890	219029890	+	Silent	SNP	T	T	C			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr2:219029890T>C	ENST00000295683.2	-	2	165	c.45A>G	c.(43-45)ctA>ctG	p.L15L		NM_000634.2	NP_000625.1	P25024	CXCR1_HUMAN	chemokine (C-X-C motif) receptor 1	15					cell surface receptor signaling pathway (GO:0007166)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|interleukin-8-mediated signaling pathway (GO:0038112)|receptor internalization (GO:0031623)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|interleukin-8 binding (GO:0019959)|interleukin-8 receptor activity (GO:0004918)	p.L15L(1)		endometrium(1)|large_intestine(2)|lung(7)|prostate(3)	13					Ketoprofen(DB01009)	CAGTGAAATTTAGATCATCAA	0.418																																					p.L15L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A45G	2						.						165.0	158.0	161.0					2																	219029890		2203	4300	6503	218738135	SO:0001819	synonymous_variant	3577	exon2			U11870	CCDS2409.1	2q35	2012-08-08	2009-11-25	2009-11-25	ENSG00000163464	ENSG00000163464		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"", ""Interleukins and interleukin receptors"""	6026	protein-coding gene	gene with protein product		146929	"""interleukin 8 receptor, alpha"""	CMKAR1, IL8RA		1303245, 1427896	Standard	NM_000634		Approved	CKR-1, CDw128a, CD181	uc002vhc.3	P25024	OTTHUMG00000133108	ENST00000295683.2:c.45A>G	2.37:g.219029890T>C		Somatic		Capture	Illumina HiSeq	Phase_I	218738135	NM_000634	B2R6Q3|Q2YEF8|Q2YEG4|Q2YEG5|Q2YEG7|Q2YEG8|Q53R18|Q6IN95|Q8N6T6|Q9P2T8|Q9P2T9|Q9P2U0|Q9P2U1|Q9P2U2	Silent	SNP	ENST00000295683.2	37	CCDS2409.1																																																																																				CXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256773.2	NM_000634	
IQSEC1	9922	broad.mit.edu	37	3	12983257	12983257	+	Silent	SNP	G	G	A			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr3:12983257G>A	ENST00000273221.4	-	2	390	c.174C>T	c.(172-174)taC>taT	p.Y58Y	IQSEC1_ENST00000473088.1_5'UTR	NM_014869.5	NP_055684.3	Q6DN90	IQEC1_HUMAN	IQ motif and Sec7 domain 1	58					actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.Y58Y(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						ACGTGTGCTCGTAGTGATCCG	0.692																																					p.Y58Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C174T	3						.						23.0	25.0	24.0					3																	12983257		2202	4300	6502	12958257	SO:0001819	synonymous_variant	9922	exon2			BC010267	CCDS33703.1, CCDS74902.1	3p25.2	2011-09-23			ENSG00000144711	ENSG00000144711			29112	protein-coding gene	gene with protein product	"""brefeldin A-resistant ARF-GEF2"""	610166				9872452, 8619474	Standard	NM_001134382		Approved	KIAA0763, GEP100, BRAG2, ARF-GEP100	uc011auw.2	Q6DN90	OTTHUMG00000155398	ENST00000273221.4:c.174C>T	3.37:g.12983257G>A		Somatic		Capture	Illumina HiSeq	Phase_I	12958257	NM_014869	O94863|Q96D85	De_novo_Start_OutOfFrame	SNP	ENST00000273221.4	37	CCDS33703.1	.	.	.	.	.	.	.	.	.	.	G	9.290	1.050382	0.19827	.	.	ENSG00000144711	ENST00000450726	.	.	.	4.48	3.61	0.41365	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.4794	0.55833	0.0811:0.0:0.9188:0.0	.	.	.	.	X	59	.	.	R	-	1	2	IQSEC1	12958257	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	3.671000	0.54576	1.103000	0.41568	-0.136000	0.14681	CGA		IQSEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339865.2	NM_014869	
ZNF80	7634	broad.mit.edu	37	3	113955340	113955340	+	Silent	SNP	G	G	A			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr3:113955340G>A	ENST00000482457.2	-	1	1085	c.582C>T	c.(580-582)tgC>tgT	p.C194C	RP11-553L6.2_ENST00000481773.1_RNA|RP11-553L6.2_ENST00000493033.1_RNA	NM_007136.3	NP_009067.2	P51504	ZNF80_HUMAN	zinc finger protein 80	194					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C194C(2)		NS(1)|endometrium(1)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|urinary_tract(2)	32		Lung NSC(201;0.0233)|all_neural(597;0.0837)				AGGTCTTCCCGCACTCACTGC	0.473																																					p.C194C	GBM(23;986 1114 21716)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C582T	3						.						109.0	115.0	113.0					3																	113955340		2203	4300	6503	115438030	SO:0001819	synonymous_variant	7634	exon1			X65233	CCDS2979.1	3q13.31	2013-01-08	2006-05-12		ENSG00000174255	ENSG00000174255		"""Zinc fingers, C2H2-type"""	13155	protein-coding gene	gene with protein product		194553	"""zinc finger protein 80 (pT17)"""			8478004	Standard	NM_007136		Approved	pT17	uc010hqo.3	P51504	OTTHUMG00000159332	ENST00000482457.2:c.582C>T	3.37:g.113955340G>A		Somatic		Capture	Illumina HiSeq	Phase_I	115438030	NM_007136	Q6NSW4|Q6NT14	Silent	SNP	ENST00000482457.2	37	CCDS2979.1																																																																																				ZNF80-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354696.2	NM_007136	
PLXND1	23129	broad.mit.edu	37	3	129279267	129279267	+	Missense_Mutation	SNP	G	G	A	rs569800532		TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr3:129279267G>A	ENST00000324093.4	-	31	5217	c.5039C>T	c.(5038-5040)aCg>aTg	p.T1680M	PLXND1_ENST00000393239.1_Missense_Mutation_p.T1680M	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	1680					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)	p.T1680M(1)	PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						CAGCTCGTCCGTAGGCAGCAC	0.647																																					p.T1680M	Ovarian(97;366 1484 3738 22084 39045)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5039T	3						.						52.0	44.0	47.0					3																	129279267		2203	4300	6503	130761957	SO:0001583	missense	23129	exon31			AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.5039C>T	3.37:g.129279267G>A	ENSP00000317128:p.Thr1680Met	Somatic		Capture	Illumina HiSeq	Phase_I	130761957	NM_015103	A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Missense_Mutation	SNP	ENST00000324093.4	37	CCDS33854.1	.	.	.	.	.	.	.	.	.	.	G	13.08	2.130825	0.37630	.	.	ENSG00000004399	ENST00000324093;ENST00000393239	T;T	0.12255	2.7;2.7	4.85	4.85	0.62838	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.268174	0.34067	N	0.004296	T	0.28764	0.0713	L	0.37561	1.115	0.48696	D	0.999692	P;D	0.89917	0.95;1.0	B;D	0.69307	0.398;0.963	T	0.03193	-1.1062	10	0.72032	D	0.01	.	17.9837	0.89150	0.0:0.0:1.0:0.0	.	275;1680	B4DRU3;Q9Y4D7	.;PLXD1_HUMAN	M	1680	ENSP00000317128:T1680M;ENSP00000376931:T1680M	ENSP00000317128:T1680M	T	-	2	0	PLXND1	130761957	1.000000	0.71417	0.992000	0.48379	0.073000	0.16967	5.498000	0.66931	2.244000	0.73946	0.462000	0.41574	ACG		PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356132.4	NM_015103	
ERICH6	131831	broad.mit.edu	37	3	150398688	150398688	+	Silent	SNP	C	C	T			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr3:150398688C>T	ENST00000295910.6	-	8	964	c.912G>A	c.(910-912)ctG>ctA	p.L304L	FAM194A_ENST00000491361.1_Silent_p.L158L	NM_152394.3	NP_689607.2												p.L304L(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						TATAGTCAATCAGATTTTGGA	0.413																																					p.L304L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G912A	3						.						109.0	108.0	108.0					3																	150398688		2203	4300	6503	151881378	SO:0001819	synonymous_variant	131831	exon8																														ENST00000295910.6:c.912G>A	3.37:g.150398688C>T		Somatic		Capture	Illumina HiSeq	Phase_I	151881378	NM_152394		Silent	SNP	ENST00000295910.6	37	CCDS3151.2																																																																																				FAM194A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257666.1		
LRRC3B	116135	broad.mit.edu	37	3	26751472	26751472	+	Silent	SNP	C	C	T			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr3:26751472C>T	ENST00000396641.2	+	2	901	c.309C>T	c.(307-309)atC>atT	p.I103I	AC114877.3_ENST00000446601.1_lincRNA|LRRC3B_ENST00000417744.1_Silent_p.I103I|LRRC3B_ENST00000456208.2_Silent_p.I103I	NM_052953.2	NP_443185.1	Q96PB8	LRC3B_HUMAN	leucine rich repeat containing 3B	103						integral component of membrane (GO:0016021)		p.I103I(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|pancreas(2)|prostate(1)|skin(4)	21						TTGAGTTTATCGATGAGCATG	0.418																																					p.I103I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C309T	3						.						65.0	62.0	63.0					3																	26751472		2203	4300	6503	26726476	SO:0001819	synonymous_variant	116135	exon2			AF396933	CCDS2644.1	3p24	2004-07-12			ENSG00000179796	ENSG00000179796			28105	protein-coding gene	gene with protein product							Standard	NM_052953		Approved	LRP15	uc003cdp.3	Q96PB8	OTTHUMG00000130572	ENST00000396641.2:c.309C>T	3.37:g.26751472C>T		Somatic		Capture	Illumina HiSeq	Phase_I	26726476	NM_052953	Q5M8T0	Silent	SNP	ENST00000396641.2	37	CCDS2644.1																																																																																				LRRC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252997.2	NM_052953	
XIRP1	165904	broad.mit.edu	37	3	39228269	39228269	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr3:39228269C>T	ENST00000340369.3	-	2	2896	c.2668G>A	c.(2668-2670)Gtg>Atg	p.V890M	XIRP1_ENST00000396251.1_Missense_Mutation_p.V890M|XIRP1_ENST00000421646.1_Intron	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	890					cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)	p.V890M(1)		breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		GTCCTTGCCACGGAGGTCCCA	0.612																																					p.V890M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2668A	3						.						30.0	28.0	29.0					3																	39228269		2203	4300	6503	39203273	SO:0001583	missense	165904	exon2			AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.2668G>A	3.37:g.39228269C>T	ENSP00000343140:p.Val890Met	Somatic		Capture	Illumina HiSeq	Phase_I	39203273	NM_194293	A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Missense_Mutation	SNP	ENST00000340369.3	37	CCDS2683.1	.	.	.	.	.	.	.	.	.	.	C	1.318	-0.600250	0.03744	.	.	ENSG00000168334	ENST00000396251;ENST00000340369	T;T	0.05199	3.48;3.87	4.89	1.95	0.26073	.	1.306450	0.04875	N	0.446697	T	0.04861	0.0131	N	0.19112	0.55	0.09310	N	1	B;B	0.22480	0.015;0.07	B;B	0.15870	0.007;0.014	T	0.41858	-0.9485	10	0.40728	T	0.16	.	3.9979	0.09566	0.1612:0.5482:0.0:0.2905	.	890;890	Q702N8;Q702N8-2	XIRP1_HUMAN;.	M	890	ENSP00000379550:V890M;ENSP00000343140:V890M	ENSP00000343140:V890M	V	-	1	0	XIRP1	39203273	0.000000	0.05858	0.001000	0.08648	0.140000	0.21249	-0.305000	0.08188	0.164000	0.19529	-0.119000	0.15052	GTG		XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254065.1	XM_093522	
MYRIP	25924	broad.mit.edu	37	3	40231828	40231828	+	Silent	SNP	G	G	A	rs139075612	byFrequency	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr3:40231828G>A	ENST00000302541.6	+	10	1881	c.1539G>A	c.(1537-1539)ccG>ccA	p.P513P	MYRIP_ENST00000396217.3_Silent_p.P424P|MYRIP_ENST00000444716.1_Silent_p.P513P|MYRIP_ENST00000539167.1_Silent_p.P326P|MYRIP_ENST00000459828.1_3'UTR|MYRIP_ENST00000425621.1_Silent_p.P513P	NM_001284423.1|NM_001284426.1|NM_015460.2	NP_001271352.1|NP_001271355.1|NP_056275.2	Q8NFW9	MYRIP_HUMAN	myosin VIIA and Rab interacting protein	513	Actin-binding.|Myosin-binding.				intracellular protein transport (GO:0006886)|positive regulation of insulin secretion (GO:0032024)	actin cytoskeleton (GO:0015629)|dense core granule (GO:0031045)|exocyst (GO:0000145)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|synapse (GO:0045202)	zinc ion binding (GO:0008270)	p.P513P(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(2)|lung(10)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)		GCAGCGAGCCGGAGGAGGCCC	0.647																																					p.P513P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1539A	3						.	G		0,4406		0,0,2203	45.0	52.0	50.0		1539	-11.9	0.0	3	dbSNP_134	50	6,8594	5.0+/-18.6	0,6,4294	no	coding-synonymous	MYRIP	NM_015460.2		0,6,6497	AA,AG,GG		0.0698,0.0,0.0461		513/860	40231828	6,13000	2203	4300	6503	40206832	SO:0001819	synonymous_variant	25924	exon10			AF396687	CCDS2689.1, CCDS68390.1, CCDS68391.1, CCDS68392.1	3p21.33	2010-08-20			ENSG00000170011	ENSG00000170011		"""A-kinase anchor proteins"""	19156	protein-coding gene	gene with protein product	"""synaptotagmin-like protein homologue lacking C2 domains-c"", ""rab effector MYRIP"", ""Slp homologue lacking C2 domains"""	611790				11964381, 12221080	Standard	NM_001284425		Approved	DKFZp586F1018, exophilin-8, MyRIP, SLAC2-C, SLAC2C	uc003cka.3	Q8NFW9	OTTHUMG00000131392	ENST00000302541.6:c.1539G>A	3.37:g.40231828G>A		Somatic		Capture	Illumina HiSeq	Phase_I	40206832	NM_015460	B3KWM3|B3KWW4|B7Z2H1|B7Z9V3|G3XAI8|Q32M41|Q32M42|Q569F7|Q8IUF5|Q9Y3V4	Silent	SNP	ENST00000302541.6	37	CCDS2689.1																																																																																				MYRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254181.2	NM_015460	
AADACL2	344752	broad.mit.edu	37	3	151475126	151475126	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr3:151475126C>T	ENST00000356517.3	+	5	1059	c.950C>T	c.(949-951)gCa>gTa	p.A317V	RP11-454C18.2_ENST00000483843.2_RNA|RP11-454C18.2_ENST00000475855.1_RNA	NM_207365.3	NP_997248.2	Q6P093	ADCL2_HUMAN	arylacetamide deacetylase-like 2	317						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	carboxylic ester hydrolase activity (GO:0052689)	p.A295V(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(4)|liver(1)|lung(13)|skin(2)	24			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			GACAGCAGAGCATTACCCTTG	0.363																																					p.A317V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C950T	3						.						150.0	147.0	148.0					3																	151475126		2203	4299	6502	152957816	SO:0001583	missense	344752	exon5			BC065724	CCDS3161.2	3q25.1	2010-12-14			ENSG00000197953	ENSG00000197953			24427	protein-coding gene	gene with protein product							Standard	NM_207365		Approved	MGC72001	uc003ezc.3	Q6P093	OTTHUMG00000155914	ENST00000356517.3:c.950C>T	3.37:g.151475126C>T	ENSP00000348911:p.Ala317Val	Somatic		Capture	Illumina HiSeq	Phase_I	152957816	NM_207365	Q5HYJ4	Missense_Mutation	SNP	ENST00000356517.3	37	CCDS3161.2	.	.	.	.	.	.	.	.	.	.	C	12.26	1.883225	0.33255	.	.	ENSG00000197953	ENST00000356517	T	0.58358	0.34	5.01	-0.776	0.10984	Alpha/beta hydrolase fold-3 (1);	0.508245	0.21810	N	0.068789	T	0.42471	0.1204	L	0.41415	1.275	0.20403	N	0.999905	B	0.33919	0.432	B	0.40940	0.344	T	0.39860	-0.9593	10	0.13470	T	0.59	-24.9582	11.4312	0.50041	0.0:0.8672:0.0:0.1328	.	317	Q6P093	ADCL2_HUMAN	V	317	ENSP00000348911:A317V	ENSP00000348911:A317V	A	+	2	0	AADACL2	152957816	0.891000	0.30450	0.000000	0.03702	0.012000	0.07955	1.687000	0.37680	-0.384000	0.07845	-0.229000	0.12294	GCA		AADACL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342288.3	NM_207365	
GABRA2	2555	broad.mit.edu	37	4	46390663	46390663	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr4:46390663C>A	ENST00000510861.1	-	2	234	c.61G>T	c.(61-63)Gac>Tac	p.D21Y	GABRA2_ENST00000509716.1_5'UTR|GABRA2_ENST00000514090.1_Missense_Mutation_p.D21Y|GABRA2_ENST00000540012.1_5'UTR|GABRA2_ENST00000507069.1_Missense_Mutation_p.D21Y|RP11-436F23.1_ENST00000502455.1_RNA|GABRA2_ENST00000515082.1_Missense_Mutation_p.D21Y|GABRA2_ENST00000507460.1_Missense_Mutation_p.D21Y|GABRA2_ENST00000381620.4_Missense_Mutation_p.D21Y|GABRA2_ENST00000356504.1_Missense_Mutation_p.D21Y			P47869	GBRA2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 2	21					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|neurotransmitter transport (GO:0006836)|regulation of neurotransmitter levels (GO:0001505)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of synaptic vesicle membrane (GO:0030285)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.D21Y(2)		NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	56					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	CTGGCAGGGTCCCACACCAAG	0.373																																					p.D21Y												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G61T	4						.						142.0	143.0	142.0					4																	46390663		2203	4300	6503	46085420	SO:0001583	missense	2555	exon2				CCDS3471.1	4p12	2012-06-22			ENSG00000151834	ENSG00000151834		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4076	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 2"""	137140					Standard	NM_000807		Approved		uc010igc.2	P47869	OTTHUMG00000044266	ENST00000510861.1:c.61G>T	4.37:g.46390663C>A	ENSP00000421828:p.Asp21Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	46085420	NM_000807	A8K0U7|B7Z1H8|Q59G14	Missense_Mutation	SNP	ENST00000510861.1	37	CCDS3471.1	.	.	.	.	.	.	.	.	.	.	C	3.201	-0.163687	0.06502	.	.	ENSG00000151834	ENST00000510861;ENST00000514090;ENST00000381620;ENST00000356504;ENST00000507069;ENST00000515082;ENST00000503806;ENST00000506961;ENST00000507460	T;T;T;T;T;T;T;T	0.80909	-1.25;-1.25;-1.25;-1.25;-1.35;-1.43;-1.07;-1.07	5.0	2.29	0.28610	.	2.308210	0.01427	N	0.014582	T	0.73521	0.3597	N	0.14661	0.345	0.80722	D	1	P;B;B	0.45827	0.867;0.289;0.191	P;B;B	0.48141	0.568;0.089;0.041	T	0.65948	-0.6044	10	0.54805	T	0.06	.	4.5104	0.11908	0.0:0.5465:0.1785:0.275	.	21;21;21	D6RAA9;G5E9Z6;P47869	.;.;GBRA2_HUMAN	Y	21	ENSP00000421828:D21Y;ENSP00000421300:D21Y;ENSP00000371033:D21Y;ENSP00000348897:D21Y;ENSP00000427603:D21Y;ENSP00000423840:D21Y;ENSP00000424362:D21Y;ENSP00000424093:D21Y	ENSP00000348897:D21Y	D	-	1	0	GABRA2	46085420	0.954000	0.32549	0.977000	0.42913	0.963000	0.63663	0.325000	0.19628	0.775000	0.33450	0.561000	0.74099	GAC		GABRA2-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360848.2		
SYNPO2	171024	broad.mit.edu	37	4	119951128	119951128	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr4:119951128C>T	ENST00000429713.2	+	4	1380	c.1198C>T	c.(1198-1200)Cga>Tga	p.R400*	SYNPO2_ENST00000434046.2_Nonsense_Mutation_p.R400*|SYNPO2_ENST00000448416.2_Intron|SYNPO2_ENST00000307142.4_Nonsense_Mutation_p.R400*	NM_001128933.1	NP_001122405.1	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	400	Poly-Arg.					actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)	p.R400*(1)		breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						GTTTAAGAAGCGACGTCGGAG	0.502																																					p.R400X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1198T	4						.						142.0	141.0	141.0					4																	119951128		2203	4300	6503	120170576	SO:0001587	stop_gained	171024	exon4			AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000429713.2:c.1198C>T	4.37:g.119951128C>T	ENSP00000395143:p.Arg400*	Somatic		Capture	Illumina HiSeq	Phase_I	120170576	NM_133477	B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Nonsense_Mutation	SNP	ENST00000429713.2	37	CCDS47129.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.541774|5.541774	0.96474|0.96474	.|.	.|.	ENSG00000172403|ENSG00000172403	ENST00000504178|ENST00000307142;ENST00000429713;ENST00000434046	.|.	.|.	.|.	5.79|5.79	3.0|3.0	0.34707|0.34707	.|.	.|0.000000	.|0.64402	.|D	.|0.000011	T|.	0.41442|.	0.1159|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.21042|.	-1.0257|.	4|.	.|0.02654	.|T	.|1	-9.9746|-9.9746	14.777|14.777	0.69738|0.69738	0.5378:0.4622:0.0:0.0|0.5378:0.4622:0.0:0.0	.|.	.|.	.|.	.|.	V|X	351|400	.|.	.|ENSP00000306015:R400X	A|R	+|+	2|1	0|2	SYNPO2|SYNPO2	120170576|120170576	1.000000|1.000000	0.71417|0.71417	0.934000|0.934000	0.37439|0.37439	0.521000|0.521000	0.34408|0.34408	3.280000|3.280000	0.51677|0.51677	0.289000|0.289000	0.22422|0.22422	0.563000|0.563000	0.77884|0.77884	GCG|CGA		SYNPO2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364020.1		
FER	2241	broad.mit.edu	37	5	108207859	108207859	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr5:108207859T>A	ENST00000281092.4	+	8	1253	c.869T>A	c.(868-870)cTt>cAt	p.L290H	FER_ENST00000536402.1_Missense_Mutation_p.L290H|FER_ENST00000438717.2_Missense_Mutation_p.L115H	NM_005246.2	NP_005237.2	P16591	FER_HUMAN	fer (fps/fes related) tyrosine kinase	290	Important for interaction with membranes containing phosphoinositides.				actin cytoskeleton reorganization (GO:0031532)|cell proliferation (GO:0008283)|cell-cell adhesion mediated by cadherin (GO:0044331)|cellular response to insulin stimulus (GO:0032869)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to reactive oxygen species (GO:0034614)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|diapedesis (GO:0050904)|extracellular matrix-cell signaling (GO:0035426)|Fc-epsilon receptor signaling pathway (GO:0038095)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular signal transduction (GO:0035556)|Kit signaling pathway (GO:0038109)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of mast cell activation involved in immune response (GO:0033007)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|regulation of fibroblast migration (GO:0010762)|regulation of lamellipodium assembly (GO:0010591)|regulation of protein phosphorylation (GO:0001932)|response to lipopolysaccharide (GO:0032496)|response to platelet-derived growth factor (GO:0036119)|substrate adhesion-dependent cell spreading (GO:0034446)|tyrosine phosphorylation of Stat3 protein (GO:0042503)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|nucleus (GO:0005634)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|lipid binding (GO:0008289)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)	p.L290H(1)		NS(2)|biliary_tract(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(12)|ovary(1)|skin(2)|stomach(1)|urinary_tract(2)	32		all_cancers(142;2.86e-06)|all_epithelial(76;9.81e-08)|Prostate(80;0.00972)|Lung NSC(167;0.039)|Ovarian(225;0.0448)|all_lung(232;0.0496)|Colorectal(57;0.0986)|Breast(839;0.152)		OV - Ovarian serous cystadenocarcinoma(64;6.77e-10)|Epithelial(69;4.13e-08)|COAD - Colon adenocarcinoma(37;0.0174)		AATGAAAATCTTCAGGCAAAT	0.299																																					p.L290H	Colon(146;1051 1799 9836 27344 47401)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T869A	5						.						64.0	65.0	65.0					5																	108207859		2200	4296	6496	108235758	SO:0001583	missense	2241	exon8			J03358	CCDS4098.1	5q21	2013-02-14	2008-02-07		ENSG00000151422	ENSG00000151422	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""SH2 domain containing"""	3655	protein-coding gene	gene with protein product	"""phosphoprotein NCP94"", ""protein phosphatase 1, regulatory subunit 74"""	176942					Standard	NM_005246		Approved	TYK3, PPP1R74	uc003kop.1	P16591	OTTHUMG00000128751	ENST00000281092.4:c.869T>A	5.37:g.108207859T>A	ENSP00000281092:p.Leu290His	Somatic		Capture	Illumina HiSeq	Phase_I	108235758	NM_005246	B2RCR4|B4DSQ2|H2FLB8	Missense_Mutation	SNP	ENST00000281092.4	37	CCDS4098.1	.	.	.	.	.	.	.	.	.	.	T	24.4	4.528909	0.85706	.	.	ENSG00000151422	ENST00000281092;ENST00000536402;ENST00000438717	T;T;D	0.83250	-1.44;0.69;-1.7	5.85	5.85	0.93711	.	0.105732	0.64402	D	0.000003	D	0.90964	0.7159	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	D	0.92014	0.5620	10	0.87932	D	0	-12.2945	16.2416	0.82411	0.0:0.0:0.0:1.0	.	290	P16591	FER_HUMAN	H	290;290;115	ENSP00000281092:L290H;ENSP00000442627:L290H;ENSP00000394297:L115H	ENSP00000281092:L290H	L	+	2	0	FER	108235758	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.554000	0.82212	2.229000	0.72834	0.533000	0.62120	CTT		FER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250664.1	NM_005246	
TAS2R1	50834	broad.mit.edu	37	5	9629977	9629977	+	Silent	SNP	A	A	T			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr5:9629977A>T	ENST00000382492.2	-	1	486	c.168T>A	c.(166-168)atT>atA	p.I56I	CTD-2001E22.1_ENST00000504182.2_RNA	NM_019599.2	NP_062545.1	Q9NYW7	TA2R1_HUMAN	taste receptor, type 2, member 1	56					chemosensory behavior (GO:0007635)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)	p.I56I(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(19)|ovary(3)|prostate(1)|skin(1)|stomach(1)	39						ACTGCAGAAAAATTCTAGAAA	0.373																																					p.I56I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T168A	5						.						46.0	49.0	48.0					5																	9629977		2202	4300	6502	9682977	SO:0001819	synonymous_variant	50834	exon1			AF227129	CCDS3876.1	5p15	2012-08-22			ENSG00000169777	ENSG00000169777		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14909	protein-coding gene	gene with protein product		604796				10761934, 10766242	Standard	NM_019599		Approved	T2R1, TRB7	uc003jem.1	Q9NYW7	OTTHUMG00000090500	ENST00000382492.2:c.168T>A	5.37:g.9629977A>T		Somatic		Capture	Illumina HiSeq	Phase_I	9682977	NM_019599	Q646G8	Silent	SNP	ENST00000382492.2	37	CCDS3876.1																																																																																				TAS2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206988.2		
PDZD2	23037	broad.mit.edu	37	5	32074220	32074220	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr5:32074220G>A	ENST00000438447.1	+	18	3396	c.3008G>A	c.(3007-3009)cGt>cAt	p.R1003H	PDZD2_ENST00000282493.3_Missense_Mutation_p.R1003H			O15018	PDZD2_HUMAN	PDZ domain containing 2	1003					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)		p.R1003H(1)		NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						GACCCGAGGCGTGTCTCAATT	0.577																																					p.R1003H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3008A	5						.						50.0	51.0	51.0					5																	32074220		2203	4300	6503	32109977	SO:0001583	missense	23037	exon17			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.3008G>A	5.37:g.32074220G>A	ENSP00000402033:p.Arg1003His	Somatic		Capture	Illumina HiSeq	Phase_I	32109977	NM_178140	Q9BXD4	Missense_Mutation	SNP	ENST00000438447.1	37	CCDS34137.1	.	.	.	.	.	.	.	.	.	.	G	11.83	1.755748	0.31046	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.05447	3.44;3.44	5.67	-11.3	0.00108	.	1.527560	0.03736	N	0.254198	T	0.01730	0.0055	N	0.02539	-0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.39035	-0.9633	10	0.15499	T	0.54	.	3.4213	0.07395	0.1282:0.4344:0.22:0.2174	.	829;1003	B4E3P2;O15018	.;PDZD2_HUMAN	H	1003;805;1003	ENSP00000402033:R1003H;ENSP00000282493:R1003H	ENSP00000282493:R1003H	R	+	2	0	PDZD2	32109977	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.047000	0.00306	-2.500000	0.00511	-0.471000	0.05019	CGT		PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1		
RANBP3L	202151	broad.mit.edu	37	5	36249774	36249777	+	Frame_Shift_Del	DEL	CTGT	CTGT	-			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	CTGT	CTGT	CTGT	-	CTGT	CTGT	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr5:36249774_36249777delCTGT	ENST00000296604.3	-	14	1862_1865	c.1377_1380delACAG	c.(1375-1380)agacagfs	p.RQ459fs	RANBP3L_ENST00000502994.1_Frame_Shift_Del_p.RQ484fs	NM_145000.3	NP_659437.3	Q86VV4	RNB3L_HUMAN	RAN binding protein 3-like	459					intracellular transport (GO:0046907)			p.R459fs*>6(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|urinary_tract(1)	16	all_lung(31;4.52e-05)		Epithelial(62;0.0543)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.149)|Colorectal(62;0.202)			AGGCAACCGACTGTCTGTGAGTCC	0.319																																					p.459_460del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1377_1380del	5						.																																			36285534	SO:0001589	frameshift_variant	202151	exon14			BC047660	CCDS3918.1, CCDS54843.1	5p13.2	2008-02-05			ENSG00000164188	ENSG00000164188			26353	protein-coding gene	gene with protein product						12477932	Standard	NM_145000		Approved	FLJ25422	uc011cow.2	Q86VV4	OTTHUMG00000131110	ENST00000296604.3:c.1377_1380delACAG	5.37:g.36249778_36249781delCTGT	ENSP00000296604:p.Arg459fs	Somatic		Capture	Illumina HiSeq	Phase_I	36285531	NM_145000	B7Z866|E9PGP9|Q96LK2	Frame_Shift_Del	DEL	ENST00000296604.3	37	CCDS3918.1																																																																																				RANBP3L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253773.2	NM_145000	
FAT2	2196	broad.mit.edu	37	5	150920134	150920134	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr5:150920134A>C	ENST00000261800.5	-	10	9045	c.9033T>G	c.(9031-9033)tgT>tgG	p.C3011W		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	3011	Cadherin 26. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.C3011W(1)		NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCACCTGTGAACACTGTGGGC	0.542																																					p.C3011W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T9033G	5						.						72.0	62.0	65.0					5																	150920134		2203	4300	6503	150900327	SO:0001583	missense	2196	exon10			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.9033T>G	5.37:g.150920134A>C	ENSP00000261800:p.Cys3011Trp	Somatic		Capture	Illumina HiSeq	Phase_I	150900327	NM_001447	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	37	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	G	16.72	3.201608	0.58234	.	.	ENSG00000086570	ENST00000261800	T	0.01745	4.66	4.94	4.07	0.47477	Cadherin (2);Cadherin-like (1);	0.000000	0.64402	D	0.000002	T	0.08313	0.0207	M	0.76574	2.34	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.01596	-1.1316	10	0.51188	T	0.08	.	8.708	0.34367	0.3031:0.0:0.6969:0.0	.	3011	Q9NYQ8	FAT2_HUMAN	W	3011	ENSP00000261800:C3011W	ENSP00000261800:C3011W	C	-	3	2	FAT2	150900327	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	2.157000	0.42320	0.505000	0.28104	-0.355000	0.07637	TGT		FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
PTPRK	5796	broad.mit.edu	37	6	128404913	128404913	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr6:128404913A>C	ENST00000368215.3	-	9	1521	c.1522T>G	c.(1522-1524)Ttc>Gtc	p.F508V	RP11-103C16.2_ENST00000417390.1_RNA|PTPRK_ENST00000368226.4_Missense_Mutation_p.F508V|PTPRK_ENST00000532331.1_Missense_Mutation_p.F508V|PTPRK_ENST00000368227.3_Missense_Mutation_p.F508V|PTPRK_ENST00000368210.3_Missense_Mutation_p.F508V|PTPRK_ENST00000524481.1_5'UTR|PTPRK_ENST00000368207.3_Missense_Mutation_p.F508V|PTPRK_ENST00000368213.5_Missense_Mutation_p.F508V			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	508	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.F508V(1)	PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		CAGTTCAAGAAGATCTTATTT	0.353																																					p.F508V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1522G	6						.						108.0	108.0	108.0					6																	128404913		2203	4298	6501	128446606	SO:0001583	missense	5796	exon9			L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.1522T>G	6.37:g.128404913A>C	ENSP00000357198:p.Phe508Val	Somatic		Capture	Illumina HiSeq	Phase_I	128446606	NM_002844	B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	Missense_Mutation	SNP	ENST00000368215.3	37		.	.	.	.	.	.	.	.	.	.	A	20.5	3.998228	0.74818	.	.	ENSG00000152894	ENST00000368226;ENST00000368227;ENST00000532331;ENST00000368213;ENST00000368210;ENST00000368215;ENST00000368207;ENST00000427676	T;T;T;T;T;T;T	0.54675	0.56;0.56;0.56;0.56;0.56;0.56;0.56	6.02	6.02	0.97574	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.233917	0.44902	D	0.000413	T	0.40398	0.1115	L	0.33624	1.015	0.46028	D	0.99882	B;P;B;B;B;B	0.44241	0.158;0.829;0.428;0.032;0.092;0.075	B;P;B;B;B;B	0.46917	0.158;0.531;0.321;0.044;0.113;0.069	T	0.35773	-0.9775	10	0.46703	T	0.11	.	16.5494	0.84464	1.0:0.0:0.0:0.0	.	508;508;508;365;508;508	B4DHC3;B7ZMG0;Q15262-3;F5GWP2;Q15262;Q15262-2	.;.;.;.;PTPRK_HUMAN;.	V	508;508;508;508;508;508;508;365	ENSP00000357209:F508V;ENSP00000357210:F508V;ENSP00000432973:F508V;ENSP00000357196:F508V;ENSP00000357193:F508V;ENSP00000357198:F508V;ENSP00000357190:F508V	ENSP00000357190:F508V	F	-	1	0	PTPRK	128446606	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.183000	0.58317	2.299000	0.77371	0.528000	0.53228	TTC		PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000042163.1		
MTFR2	113115	broad.mit.edu	37	6	136565955	136565955	+	Missense_Mutation	SNP	C	C	T	rs200368436	byFrequency	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr6:136565955C>T	ENST00000420702.1	-	3	505	c.116G>A	c.(115-117)cGt>cAt	p.R39H	MTFR2_ENST00000445767.2_5'Flank|MTFR2_ENST00000451457.2_Missense_Mutation_p.R39H	NM_001099286.1	NP_001092756.1	Q6P444	MTFR2_HUMAN	mitochondrial fission regulator 2	39					aerobic respiration (GO:0009060)|mitochondrial fission (GO:0000266)|mitochondrion organization (GO:0007005)	mitochondrion (GO:0005739)		p.R39H(1)									CCCAATAATACGAACAATACT	0.318																																					p.R39H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G116A	6						.						130.0	131.0	130.0					6																	136565955		2203	4300	6503	136607648	SO:0001583	missense	113115	exon3			BC011716	CCDS5176.1	6q23.2	2012-11-30	2012-11-29	2012-11-29	ENSG00000146410	ENSG00000146410			21115	protein-coding gene	gene with protein product			"""DUF729 domain containing 1"", ""family with sequence similarity 54, member A"""	DUFD1, FAM54A			Standard	NM_138419		Approved		uc003qgt.1	Q6P444	OTTHUMG00000015643	ENST00000420702.1:c.116G>A	6.37:g.136565955C>T	ENSP00000395232:p.Arg39His	Somatic		Capture	Illumina HiSeq	Phase_I	136607648	NM_138419	A8K8D8|E1P585|Q5JWR7|Q6ZUE8|Q7L3U6|Q9BZ39	Missense_Mutation	SNP	ENST00000420702.1	37	CCDS5176.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.487976	0.84854	.	.	ENSG00000146410	ENST00000451457;ENST00000420702	T;T	0.73681	-0.77;-0.77	5.14	5.14	0.70334	.	0.119969	0.53938	D	0.000043	D	0.85822	0.5786	M	0.87547	2.89	0.54753	D	0.999986	D	0.89917	1.0	D	0.97110	1.0	D	0.88332	0.2969	10	0.87932	D	0	-18.9966	15.5236	0.75885	0.0:1.0:0.0:0.0	.	39	Q6P444	FA54A_HUMAN	H	39	ENSP00000407010:R39H;ENSP00000395232:R39H	ENSP00000395232:R39H	R	-	2	0	FAM54A	136607648	0.999000	0.42202	0.987000	0.45799	0.962000	0.63368	4.652000	0.61454	2.412000	0.81896	0.655000	0.94253	CGT		MTFR2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042378.2	NM_138419	
BCLAF1	9774	broad.mit.edu	37	6	136582442	136582442	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr6:136582442T>G	ENST00000531224.1	-	12	2970	c.2718A>C	c.(2716-2718)gaA>gaC	p.E906D	BCLAF1_ENST00000353331.4_Missense_Mutation_p.E855D|BCLAF1_ENST00000527759.1_Missense_Mutation_p.E904D|BCLAF1_ENST00000527536.1_Missense_Mutation_p.E857D|BCLAF1_ENST00000530767.1_Missense_Mutation_p.E733D|BCLAF1_ENST00000392348.2_Missense_Mutation_p.E855D|BCLAF1_ENST00000031135.9_Missense_Mutation_p.E124D|BCLAF1_ENST00000529917.1_5'UTR	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	906					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.E906D(1)		haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		CTTCATTATTTTCCATGGTCT	0.373																																					p.E906D	Colon(142;1534 1789 5427 7063 28491)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2718C	6						.						215.0	215.0	215.0					6																	136582442		2203	4300	6503	136624135	SO:0001583	missense	9774	exon12			AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.2718A>C	6.37:g.136582442T>G	ENSP00000435210:p.Glu906Asp	Somatic		Capture	Illumina HiSeq	Phase_I	136624135	NM_014739	A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	ENST00000531224.1	37	CCDS5177.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.808|9.808	1.182438|1.182438	0.21870|0.21870	.|.	.|.	ENSG00000029363|ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000530767;ENST00000527759;ENST00000031135;ENST00000392348|ENST00000534762	T;T;T;T;T;T;T|.	0.50277|.	4.15;4.15;4.15;2.28;4.15;0.75;4.15|.	5.71|5.71	0.468|0.468	0.16732|0.16732	.|.	0.282823|.	0.29972|.	N|.	0.010727|.	T|T	0.14056|0.14056	0.0340|0.0340	N|N	0.25890|0.25890	0.77|0.77	0.34630|0.34630	D|D	0.719574|0.719574	B;B;B;B;B|.	0.18863|.	0.0;0.031;0.0;0.0;0.0|.	B;B;B;B;B|.	0.16722|.	0.001;0.016;0.001;0.001;0.002|.	T|T	0.11792|0.11792	-1.0573|-1.0573	10|5	0.21540|.	T|.	0.41|.	-2.0255|-2.0255	1.949|1.949	0.03363|0.03363	0.1254:0.2009:0.1294:0.5442|0.1254:0.2009:0.1294:0.5442	.|.	904;185;855;906;733|.	Q9NYF8-2;B7Z8J9;Q9NYF8-3;Q9NYF8;Q9NYF8-4|.	.;.;.;BCLF1_HUMAN;.|.	D|Q	906;855;857;733;904;124;855|173	ENSP00000435210:E906D;ENSP00000229446:E855D;ENSP00000435441:E857D;ENSP00000436501:E733D;ENSP00000434826:E904D;ENSP00000031135:E124D;ENSP00000376159:E855D|.	ENSP00000031135:E124D|.	E|K	-|-	3|1	2|0	BCLAF1|BCLAF1	136624135|136624135	0.798000|0.798000	0.28890|0.28890	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	-0.355000|-0.355000	0.07671|0.07671	0.068000|0.068000	0.16574|0.16574	0.533000|0.533000	0.62120|0.62120	GAA|AAA		BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739	
SLC17A4	10050	broad.mit.edu	37	6	25769234	25769234	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr6:25769234G>A	ENST00000377905.4	+	3	232	c.113G>A	c.(112-114)gGg>gAg	p.G38E	SLC17A4_ENST00000397076.2_5'UTR|SLC17A4_ENST00000439485.2_Missense_Mutation_p.G38E	NM_005495.2	NP_005486.1	Q9Y2C5	S17A4_HUMAN	solute carrier family 17, member 4	38					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)	p.G38E(1)		breast(4)|endometrium(1)|kidney(4)|large_intestine(3)|lung(21)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						GTCCGACATGGGCTGGCCCTC	0.453																																					p.G38E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G113A	6						.						103.0	93.0	96.0					6																	25769234		2203	4300	6503	25877213	SO:0001583	missense	10050	exon3			AB020527	CCDS4564.1, CCDS75411.1	6p22.2	2013-07-18	2013-07-18		ENSG00000146039	ENSG00000146039		"""Solute carriers"""	10932	protein-coding gene	gene with protein product		604216	"""solute carrier family 17 (sodium phosphate), member 4"""			10319585	Standard	NM_005495		Approved	KIAA2138	uc003nfe.3	Q9Y2C5	OTTHUMG00000014410	ENST00000377905.4:c.113G>A	6.37:g.25769234G>A	ENSP00000367137:p.Gly38Glu	Somatic		Capture	Illumina HiSeq	Phase_I	25877213	NM_005495	B4DDV9|E7EPE8|E7EU17|Q32MB7|Q32MB8	Missense_Mutation	SNP	ENST00000377905.4	37	CCDS4564.1	.	.	.	.	.	.	.	.	.	.	G	14.76	2.632064	0.46944	.	.	ENSG00000146039	ENST00000377905;ENST00000439485	T;T	0.75589	0.31;-0.95	5.32	3.38	0.38709	Major facilitator superfamily domain, general substrate transporter (1);	0.795058	0.10971	N	0.613801	T	0.59238	0.2179	N	0.08118	0	0.22112	N	0.999358	D;P	0.89917	1.0;0.63	D;B	0.91635	0.999;0.358	T	0.56721	-0.7932	10	0.31617	T	0.26	.	11.1257	0.48317	0.0:0.0:0.671:0.329	.	38;38	E7EPE8;Q9Y2C5	.;S17A4_HUMAN	E	38	ENSP00000367137:G38E;ENSP00000391345:G38E	ENSP00000367137:G38E	G	+	2	0	SLC17A4	25877213	0.977000	0.34250	0.034000	0.17996	0.523000	0.34469	4.136000	0.58004	1.318000	0.45170	0.563000	0.77884	GGG		SLC17A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040068.1		
ABT1	29777	broad.mit.edu	37	6	26598593	26598593	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr6:26598593G>A	ENST00000274849.1	+	3	570	c.539G>A	c.(538-540)cGt>cAt	p.R180H		NM_013375.3	NP_037507.1	Q9ULW3	ABT1_HUMAN	activator of basal transcription 1	180					regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord motor neuron differentiation (GO:0021522)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)	p.R180H(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|urinary_tract(1)	11						CAAGCCAAGCGTGAGACCGAC	0.607																																					p.R180H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G539A	6						.						71.0	70.0	70.0					6																	26598593		2203	4300	6503	26706572	SO:0001583	missense	29777	exon3			AB027258	CCDS4616.1	6p21.31	2008-07-07			ENSG00000146109	ENSG00000146109			17369	protein-coding gene	gene with protein product						10648625	Standard	NM_013375		Approved		uc003nii.3	Q9ULW3	OTTHUMG00000016319	ENST00000274849.1:c.539G>A	6.37:g.26598593G>A	ENSP00000274849:p.Arg180His	Somatic		Capture	Illumina HiSeq	Phase_I	26706572	NM_013375		Missense_Mutation	SNP	ENST00000274849.1	37	CCDS4616.1	.	.	.	.	.	.	.	.	.	.	G	18.27	3.587952	0.66105	.	.	ENSG00000146109	ENST00000274849	.	.	.	5.53	4.66	0.58398	.	0.048092	0.85682	D	0.000000	T	0.31327	0.0793	L	0.56199	1.76	0.48236	D	0.999611	P	0.43412	0.806	B	0.35655	0.207	T	0.30327	-0.9982	9	0.52906	T	0.07	-23.7332	12.4513	0.55679	0.082:0.0:0.918:0.0	.	180	Q9ULW3	ABT1_HUMAN	H	180	.	ENSP00000274849:R180H	R	+	2	0	ABT1	26706572	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	3.861000	0.56002	1.483000	0.48342	0.563000	0.77884	CGT		ABT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043698.1		
OR10C1	442194	broad.mit.edu	37	6	29408010	29408010	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr6:29408010C>T	ENST00000444197.2	+	1	928	c.218C>T	c.(217-219)aCg>aTg	p.T73M	OR11A1_ENST00000377149.1_Intron	NM_013941.3	NP_039229.3	Q96KK4	O10C1_HUMAN	olfactory receptor, family 10, subfamily C, member 1 (gene/pseudogene)	73						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T73M(1)		NS(1)|breast(2)|kidney(1)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						ATTGGCTATACGTCTGTCACG	0.557																																					p.T73M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C218T	6						.						170.0	149.0	157.0					6																	29408010		1511	2709	4220	29515989	SO:0001583	missense	442194	exon1				CCDS34364.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000206474	ENSG00000206474		"""GPCR / Class A : Olfactory receptors"""	8165	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily C, member 2"", ""olfactory receptor, family 10, subfamily C, member 1"""	OR10C2			Standard	NM_013941		Approved	hs6M1-17, OR10C1P	uc011dlp.2	Q96KK4	OTTHUMG00000031207	ENST00000444197.2:c.218C>T	6.37:g.29408010C>T	ENSP00000419119:p.Thr73Met	Somatic		Capture	Illumina HiSeq	Phase_I	29515989	NM_013941	Q5SUN7|Q96R18	Missense_Mutation	SNP	ENST00000444197.2	37	CCDS34364.1	.	.	.	.	.	.	.	.	.	.	C	4.168	0.029729	0.08101	.	.	ENSG00000206474	ENST00000444197	T	0.00444	7.4	3.48	3.48	0.39840	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40302	N	0.001133	T	0.00271	0.0008	M	0.89478	3.035	0.09310	N	1	P	0.42827	0.791	B	0.40375	0.327	T	0.27434	-1.0074	10	0.66056	D	0.02	.	10.4251	0.44373	0.0:0.8977:0.0:0.1023	.	73	Q96KK4	O10C1_HUMAN	M	73	ENSP00000419119:T73M	ENSP00000419119:T73M	T	+	2	0	OR10C1	29515989	0.000000	0.05858	0.023000	0.16930	0.004000	0.04260	-0.004000	0.12878	1.942000	0.56320	0.423000	0.28283	ACG		OR10C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076415.2		
MUC21	394263	broad.mit.edu	37	6	30954469	30954469	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr6:30954469A>C	ENST00000376296.3	+	2	758	c.517A>C	c.(517-519)Acc>Ccc	p.T173P	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	173	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T173P(1)		NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						GTCCAGCACAACCTCCAGTGG	0.607																																					p.T173P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A517C	6						.						141.0	134.0	137.0					6																	30954469		2203	4299	6502	31062448	SO:0001583	missense	394263	exon2			AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.517A>C	6.37:g.30954469A>C	ENSP00000365473:p.Thr173Pro	Somatic		Capture	Illumina HiSeq	Phase_I	31062448	NM_001010909	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Missense_Mutation	SNP	ENST00000376296.3	37	CCDS34388.1	.	.	.	.	.	.	.	.	.	.	a	5.302	0.241043	0.10077	.	.	ENSG00000204544	ENST00000450707;ENST00000376296	T	0.11385	2.78	3.72	-7.43	0.01383	.	.	.	.	.	T	0.01454	0.0047	L	0.29908	0.895	0.09310	N	1	B	0.17038	0.02	B	0.17098	0.017	T	0.45687	-0.9244	8	.	.	.	2.7587	2.8881	0.05668	0.188:0.1262:0.4378:0.2479	.	173	Q5SSG8	MUC21_HUMAN	P	173	ENSP00000365473:T173P	.	T	+	1	0	MUC21	31062448	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.829000	0.00744	-1.373000	0.02134	-2.437000	0.00212	ACC		MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
GPANK1	7918	broad.mit.edu	37	6	31631720	31631720	+	Missense_Mutation	SNP	T	T	C	rs201945052		TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr6:31631720T>C	ENST00000375906.1	-	3	1220	c.536A>G	c.(535-537)gAt>gGt	p.D179G	GPANK1_ENST00000375893.2_Missense_Mutation_p.D179G|GPANK1_ENST00000375896.4_Missense_Mutation_p.D179G|CSNK2B-LY6G5B-1181_ENST00000375880.2_5'Flank|CSNK2B_ENST00000375882.2_5'Flank|CSNK2B_ENST00000375885.4_5'Flank|Y_RNA_ENST00000364337.1_RNA|GPANK1_ENST00000375895.2_Missense_Mutation_p.D179G|GPANK1_ENST00000375900.4_Missense_Mutation_p.D179G|CSNK2B_ENST00000375866.2_5'Flank|CSNK2B_ENST00000375865.2_5'Flank	NM_001199237.1	NP_001186166.1	O95872	GPAN1_HUMAN	G patch domain and ankyrin repeats 1	179							nucleic acid binding (GO:0003676)	p.D179G(1)		central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(7)	12						CTGAGCCGCATCCCTGCCACT	0.647																																					p.D179G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A536G	6						.						45.0	48.0	47.0					6																	31631720		2203	4300	6503	31739699	SO:0001583	missense	7918	exon3				CCDS4711.1	6p21.3	2013-01-28	2010-11-24	2010-11-24	ENSG00000204438	ENSG00000204438		"""Ankyrin repeat domain containing"", ""G patch domain containing"""	13920	protein-coding gene	gene with protein product	"""G patch domain containing 10"", ""ankyrin repeat domain 59"""	142610	"""HLA-B associated transcript 4"""	BAT4		2911734, 2813433	Standard	NM_001199237		Approved	G5, D6S54E, GPATCH10, ANKRD59	uc021yuu.1	O95872	OTTHUMG00000031174	ENST00000375906.1:c.536A>G	6.37:g.31631720T>C	ENSP00000365071:p.Asp179Gly	Somatic		Capture	Illumina HiSeq	Phase_I	31739699	NM_001199237	A6NG25|B0UXA2|Q5SQ49	Missense_Mutation	SNP	ENST00000375906.1	37	CCDS4711.1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.461481	0.84317	.	.	ENSG00000204438	ENST00000375906;ENST00000375896;ENST00000375893;ENST00000375895;ENST00000375900;ENST00000440842	T;T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12;-0.12	5.25	5.25	0.73442	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.59622	0.2207	L	0.27053	0.805	0.58432	D	0.999999	D	0.89917	1.0	D	0.78314	0.991	T	0.67348	-0.5693	10	0.66056	D	0.02	-8.8413	13.1062	0.59249	0.0:0.0:0.0:1.0	.	179	O95872	GPAN1_HUMAN	G	179	ENSP00000365071:D179G;ENSP00000365060:D179G;ENSP00000365057:D179G;ENSP00000365059:D179G;ENSP00000365065:D179G	ENSP00000365057:D179G	D	-	2	0	GPANK1	31739699	1.000000	0.71417	1.000000	0.80357	0.709000	0.40893	6.516000	0.73755	1.980000	0.57719	0.459000	0.35465	GAT		GPANK1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000144445.2	NM_033177	
CFB	629	broad.mit.edu	37	6	31916622	31916622	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr6:31916622C>T	ENST00000425368.2	+	8	1565	c.1052C>T	c.(1051-1053)tCa>tTa	p.S351L	CFB_ENST00000477310.1_Missense_Mutation_p.S702L|CFB_ENST00000456570.1_Missense_Mutation_p.S853L|CFB_ENST00000556679.1_Missense_Mutation_p.S853L|CFB_ENST00000497841.1_3'UTR	NM_001710.5	NP_001701.2	P00751	CFAB_HUMAN	complement factor B	351	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	complement binding (GO:0001848)|serine-type endopeptidase activity (GO:0004252)	p.S351L(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(10)|pancreas(1)|skin(1)|urinary_tract(1)	21						AAGTTGAAGTCAGGGACTAAC	0.542																																					p.S351L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1052T	6						.						120.0	108.0	113.0					6																	31916622		1510	2708	4218	32024601	SO:0001583	missense	629	exon8			L15702	CCDS4729.1	6p21.33	2014-09-17	2006-02-10	2006-02-10	ENSG00000243649	ENSG00000243649	3.4.21.47	"""Complement system"""	1037	protein-coding gene	gene with protein product		138470	"""B-factor, properdin"""	BFD, BF			Standard	NM_001710		Approved	H2-Bf	uc011dor.2	P00751	OTTHUMG00000031198	ENST00000425368.2:c.1052C>T	6.37:g.31916622C>T	ENSP00000416561:p.Ser351Leu	Somatic		Capture	Illumina HiSeq	Phase_I	32024601	NM_001710	B0QZQ6|O15006|Q29944|Q53F89|Q5JP67|Q5ST50|Q96HX6|Q9BTF5|Q9BX92	Missense_Mutation	SNP	ENST00000425368.2	37	CCDS4729.1	.	.	.	.	.	.	.	.	.	.	C	15.68	2.906466	0.52333	.	.	ENSG00000243649;ENSG00000243649;ENSG00000244255;ENSG00000244255	ENST00000556679;ENST00000425368;ENST00000456570;ENST00000477310	T;T;T;T	0.79033	-1.23;-1.23;-1.23;-1.23	5.63	3.82	0.43975	von Willebrand factor, type A (3);	2.193060	0.01830	N	0.034645	T	0.52338	0.1728	L	0.29908	0.895	0.26705	N	0.971091	P;B;P	0.39862	0.692;0.098;0.477	B;B;B	0.35413	0.202;0.038;0.042	T	0.50423	-0.8830	10	0.52906	T	0.07	1.346	10.3176	0.43747	0.0:0.7891:0.1362:0.0747	.	853;351;351	B4E1Z4;P00751;P00751-2	.;CFAB_HUMAN;.	L	853;351;853;702	ENSP00000451848:S853L;ENSP00000416561:S351L;ENSP00000410815:S853L;ENSP00000418996:S702L	ENSP00000416561:S351L	S	+	2	0	CFB;XXbac-BPG116M5.17	32024601	0.014000	0.17966	0.113000	0.21522	0.857000	0.48899	1.155000	0.31700	0.716000	0.32124	0.313000	0.20887	TCA		CFB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076395.3	NM_001710	
IP6K3	117283	broad.mit.edu	37	6	33693313	33693313	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr6:33693313C>T	ENST00000293756.4	-	5	996	c.670G>A	c.(670-672)Ggc>Agc	p.G224S	IP6K3_ENST00000451316.1_Missense_Mutation_p.G224S	NM_054111.4	NP_473452.2	Q96PC2	IP6K3_HUMAN	inositol hexakisphosphate kinase 3	224					inositol phosphate biosynthetic process (GO:0032958)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol metabolic process (GO:0046488)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol hexakisphosphate 6-kinase activity (GO:0000831)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)	p.G224S(1)		skin(1)	1						GCATCATCGCCGTGCTGCCGG	0.572																																					p.G224S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G670A	6						.						84.0	73.0	77.0					6																	33693313		2203	4300	6503	33801291	SO:0001583	missense	117283	exon5			AF393812	CCDS34435.1	6p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000161896	ENSG00000161896			17269	protein-coding gene	gene with protein product		606993	"""inositol hexaphosphate kinase 3"""	IHPK3		11502751	Standard	NM_054111		Approved	INSP6K3	uc003ofb.2	Q96PC2	OTTHUMG00000014531	ENST00000293756.4:c.670G>A	6.37:g.33693313C>T	ENSP00000293756:p.Gly224Ser	Somatic		Capture	Illumina HiSeq	Phase_I	33801291	NM_054111	Q96MQ9	Missense_Mutation	SNP	ENST00000293756.4	37	CCDS34435.1	.	.	.	.	.	.	.	.	.	.	C	33	5.253674	0.95336	.	.	ENSG00000161896	ENST00000451316;ENST00000293756	T;T	0.17213	2.29;2.29	5.53	5.53	0.82687	.	0.166539	0.42964	D	0.000638	T	0.42585	0.1209	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.46665	-0.9175	10	0.66056	D	0.02	-43.7131	19.4303	0.94760	0.0:1.0:0.0:0.0	.	224	Q96PC2	IP6K3_HUMAN	S	224	ENSP00000398861:G224S;ENSP00000293756:G224S	ENSP00000293756:G224S	G	-	1	0	IP6K3	33801291	1.000000	0.71417	0.960000	0.40013	0.595000	0.36748	7.782000	0.85680	2.595000	0.87683	0.655000	0.94253	GGC		IP6K3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040203.1	NM_054111	
PRSS35	167681	broad.mit.edu	37	6	84234218	84234218	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr6:84234218G>A	ENST00000369700.3	+	2	1235	c.1058G>A	c.(1057-1059)cGt>cAt	p.R353H	PRSS35_ENST00000536636.1_Missense_Mutation_p.R353H	NM_153362.2	NP_699193.2	Q8N3Z0	PRS35_HUMAN	protease, serine, 35	353	Peptidase S1.					extracellular region (GO:0005576)|mitochondrion (GO:0005739)	serine-type endopeptidase activity (GO:0004252)	p.R353H(1)		breast(2)|endometrium(2)|large_intestine(12)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	32		all_cancers(76;0.000113)|Acute lymphoblastic leukemia(125;1.09e-08)|all_hematologic(105;3.12e-05)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0768)		GTCTATCTGCGTCTGAAAGAT	0.512																																					p.R353H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1058A	6						.						85.0	85.0	85.0					6																	84234218		2203	4300	6503	84290937	SO:0001583	missense	167681	exon3			BC037170	CCDS4999.1	6q14.2	2010-05-12	2004-07-09	2004-07-09	ENSG00000146250	ENSG00000146250		"""Serine peptidases / Serine peptidases"""	21387	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 158"""	C6orf158			Standard	NM_153362		Approved	MGC46520, dJ223E3.1	uc003pjz.3	Q8N3Z0	OTTHUMG00000015113	ENST00000369700.3:c.1058G>A	6.37:g.84234218G>A	ENSP00000358714:p.Arg353His	Somatic		Capture	Illumina HiSeq	Phase_I	84290937	NM_001170423	A8K7B3|Q9BQP6	Missense_Mutation	SNP	ENST00000369700.3	37	CCDS4999.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.968301	0.92855	.	.	ENSG00000146250	ENST00000536636;ENST00000369700	T;T	0.52526	0.66;0.66	5.91	5.91	0.95273	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (1);	0.169199	0.48767	D	0.000165	T	0.67896	0.2942	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.69840	-0.5036	10	0.87932	D	0	-12.7826	20.2946	0.98546	0.0:0.0:1.0:0.0	.	353	Q8N3Z0	PRS35_HUMAN	H	353	ENSP00000440870:R353H;ENSP00000358714:R353H	ENSP00000358714:R353H	R	+	2	0	PRSS35	84290937	1.000000	0.71417	1.000000	0.80357	0.709000	0.40893	9.476000	0.97823	2.804000	0.96469	0.462000	0.41574	CGT		PRSS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041352.1	NM_153362	
TIAM2	26230	broad.mit.edu	37	6	155469427	155469427	+	Missense_Mutation	SNP	G	G	A	rs181691607	byFrequency	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr6:155469427G>A	ENST00000461783.3	+	9	3260	c.1987G>A	c.(1987-1989)Gtg>Atg	p.V663M	TIAM2_ENST00000456144.1_Missense_Mutation_p.V663M|TIAM2_ENST00000528391.2_5'Flank|TIAM2_ENST00000367174.2_Missense_Mutation_p.V15M|TIAM2_ENST00000456877.2_5'Flank|TIAM2_ENST00000318981.5_Missense_Mutation_p.V663M|TIAM2_ENST00000360366.4_Missense_Mutation_p.V663M|TIAM2_ENST00000529824.2_Missense_Mutation_p.V663M			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	663					apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.V663M(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		GCAGCTGTCCGTGGTGAGCGA	0.498													G|||	2	0.000399361	0.0	0.0029	5008	,	,		20040	0.0		0.0	False		,,,				2504	0.0				p.V663M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1987A	6						.	G	MET/VAL	0,4406		0,0,2203	92.0	82.0	85.0		1987	3.5	0.9	6		85	3,8597	3.0+/-9.4	0,3,4297	yes	missense	TIAM2	NM_012454.3	21	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	benign	663/1702	155469427	3,13003	2203	4300	6503	155511119	SO:0001583	missense	26230	exon6				CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.1987G>A	6.37:g.155469427G>A	ENSP00000437188:p.Val663Met	Somatic		Capture	Illumina HiSeq	Phase_I	155511119	NM_012454	B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Missense_Mutation	SNP	ENST00000461783.3	37	CCDS34558.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	8.541	0.873301	0.17322	0.0	3.49E-4	ENSG00000146426	ENST00000461783;ENST00000528928;ENST00000528535;ENST00000456144;ENST00000318981;ENST00000367174;ENST00000360366;ENST00000529824	T;T;T;T;T;T;T	0.07327	3.35;3.25;3.31;3.35;3.2;3.38;3.31	5.35	3.52	0.40303	.	0.238541	0.35235	N	0.003349	T	0.07052	0.0179	M	0.64404	1.975	0.23287	N	0.997977	P;D;P	0.62365	0.949;0.991;0.916	P;P;B	0.57846	0.61;0.828;0.233	T	0.21621	-1.0240	10	0.51188	T	0.08	.	3.4245	0.07405	0.1843:0.1311:0.5505:0.1341	.	663;663;663	Q8IVF5-2;Q8IVF5-5;Q8IVF5	.;.;TIAM2_HUMAN	M	663;909;663;663;663;15;663;663	ENSP00000437188:V663M;ENSP00000434901:V663M;ENSP00000407746:V663M;ENSP00000327315:V663M;ENSP00000356142:V15M;ENSP00000353528:V663M;ENSP00000433348:V663M	ENSP00000327315:V663M	V	+	1	0	TIAM2	155511119	0.989000	0.36119	0.949000	0.38748	0.241000	0.25554	2.231000	0.43009	0.238000	0.21222	-1.119000	0.02030	GTG		TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000387980.2	NM_012454	
VGF	7425	broad.mit.edu	37	7	100806737	100806737	+	Missense_Mutation	SNP	T	T	G	rs542255224		TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr7:100806737T>G	ENST00000249330.2	-	2	1627	c.1388A>C	c.(1387-1389)cAc>cCc	p.H463P	VGF_ENST00000445482.2_Missense_Mutation_p.H463P	NM_003378.3	NP_003369.2	O15240	VGF_HUMAN	VGF nerve growth factor inducible	463					defense response to bacterium (GO:0042742)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|insulin secretion (GO:0030073)|ovarian follicle development (GO:0001541)|response to cAMP (GO:0051591)|response to cold (GO:0009409)|response to dietary excess (GO:0002021)|response to insulin (GO:0032868)|sexual reproduction (GO:0019953)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)		p.H463P(1)		cervix(1)|large_intestine(1)|lung(4)|prostate(2)|skin(1)	9	Lung NSC(181;0.168)|all_lung(186;0.215)					CGCTGGCAGGTGGAGTTTGGT	0.662																																					p.H463P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1388C	7						.						63.0	65.0	64.0					7																	100806737		2203	4300	6503	100593457	SO:0001583	missense	7425	exon2			Y12661	CCDS5712.1	7q22	2008-07-18			ENSG00000128564	ENSG00000128564			12684	protein-coding gene	gene with protein product	"""neuro-endocrine specific protein VGF"""	602186				9344675	Standard	NM_003378		Approved		uc003uxx.4	O15240	OTTHUMG00000157109	ENST00000249330.2:c.1388A>C	7.37:g.100806737T>G	ENSP00000249330:p.His463Pro	Somatic		Capture	Illumina HiSeq	Phase_I	100593457	NM_003378	Q9UDW8	Missense_Mutation	SNP	ENST00000249330.2	37	CCDS5712.1	.	.	.	.	.	.	.	.	.	.	T	16.16	3.044368	0.55110	.	.	ENSG00000128564	ENST00000249330;ENST00000445482	.	.	.	4.43	4.43	0.53597	.	0.000000	0.51477	U	0.000098	T	0.39572	0.1083	N	0.24115	0.695	0.44562	D	0.997522	P	0.40332	0.713	B	0.40375	0.327	T	0.40365	-0.9567	9	0.66056	D	0.02	-9.2208	10.0656	0.42301	0.0:0.0:0.0:1.0	.	463	O15240	VGF_HUMAN	P	463	.	ENSP00000249330:H463P	H	-	2	0	VGF	100593457	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.398000	0.52579	1.653000	0.50694	0.454000	0.30748	CAC		VGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347462.1	NM_003378	
CPA1	1357	broad.mit.edu	37	7	130025129	130025129	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr7:130025129G>T	ENST00000011292.3	+	8	1080	c.930G>T	c.(928-930)caG>caT	p.Q310H	CPA1_ENST00000484324.1_Missense_Mutation_p.Q222H	NM_001868.2	NP_001859.1	P15085	CBPA1_HUMAN	carboxypeptidase A1 (pancreatic)	310					proteolysis (GO:0006508)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.Q310H(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)	21	Melanoma(18;0.0435)					GCTACTCCCAGCTCCTCATGT	0.537																																					p.Q310H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G930T	7						.						177.0	159.0	165.0					7																	130025129		2203	4300	6503	129812365	SO:0001583	missense	1357	exon8				CCDS5820.1	7q32	2012-02-10			ENSG00000091704	ENSG00000091704	3.4.17.1		2296	protein-coding gene	gene with protein product	"""pancreatic carboxypeptidase A"""	114850		CPA			Standard	NM_001868		Approved		uc003vpx.3	P15085	OTTHUMG00000157826	ENST00000011292.3:c.930G>T	7.37:g.130025129G>T	ENSP00000011292:p.Gln310His	Somatic		Capture	Illumina HiSeq	Phase_I	129812365	NM_001868	A4D1M1|Q53XU0|Q9BS67|Q9UCF2	Missense_Mutation	SNP	ENST00000011292.3	37	CCDS5820.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.394432	0.83011	.	.	ENSG00000091704	ENST00000011292;ENST00000476062;ENST00000484324	T;T;T	0.03889	3.77;3.77;3.77	5.68	4.78	0.61160	Peptidase M14, carboxypeptidase A (4);	0.000000	0.85682	D	0.000000	T	0.36635	0.0974	H	0.98525	4.255	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.57069	-0.7874	10	0.87932	D	0	.	14.6788	0.69001	0.0734:0.0:0.9265:0.0	.	310;222	P15085;C9JUF9	CBPA1_HUMAN;.	H	310;222;222	ENSP00000011292:Q310H;ENSP00000419408:Q222H;ENSP00000419497:Q222H	ENSP00000011292:Q310H	Q	+	3	2	CPA1	129812365	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.401000	0.66326	2.838000	0.97847	0.655000	0.94253	CAG		CPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349736.2	NM_001868	
C7orf55-LUC7L2	100996928	broad.mit.edu	37	7	139107012	139107012	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr7:139107012C>T	ENST00000354926.4	+	10	1459	c.1105C>T	c.(1105-1107)Cgg>Tgg	p.R369W	C7orf55-LUC7L2_ENST00000482860.1_3'UTR|LUC7L2_ENST00000541515.3_Missense_Mutation_p.R435W|C7orf55-LUC7L2_ENST00000541170.3_Missense_Mutation_p.R366W|C7orf55-LUC7L2_ENST00000263545.6_Missense_Mutation_p.R368W	NM_001270643.1|NM_016019.4	NP_001257572.1|NP_057103.2			C7orf55-LUC7L2 readthrough									p.R369W(1)									AGATAAGAAGCGGTCCTATGA	0.468																																					p.R369W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1105T	7						.						128.0	130.0	129.0					7																	139107012		1934	4138	6072	138757552	SO:0001583	missense	51631	exon10				CCDS59084.1	7q34	2013-02-14			ENSG00000146963	ENSG00000146963			44671	other	readthrough							Standard	NM_001244584		Approved		uc011kqt.3		OTTHUMG00000151717	ENST00000354926.4:c.1105C>T	7.37:g.139107012C>T	ENSP00000347005:p.Arg369Trp	Somatic		Capture	Illumina HiSeq	Phase_I	138757552	NM_016019		Missense_Mutation	SNP	ENST00000354926.4	37	CCDS43656.1	.	.	.	.	.	.	.	.	.	.	C	15.67	2.903447	0.52333	.	.	ENSG00000146963	ENST00000541170;ENST00000541515;ENST00000545899;ENST00000354926;ENST00000263545	T;T;T;T	0.31769	3.26;1.48;3.26;3.26	6.03	5.13	0.70059	.	0.286415	0.39909	N	0.001236	T	0.40932	0.1137	N	0.19112	0.55	0.49483	D	0.999796	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.76575	0.973;0.973;0.988;0.973	T	0.47420	-0.9119	9	0.39692	T	0.17	-7.9717	16.1517	0.81626	0.1438:0.8562:0.0:0.0	.	435;366;368;369	B7Z4Q3;B7Z500;Q9Y383-2;Q9Y383	.;.;.;LC7L2_HUMAN	W	366;435;369;369;368	ENSP00000441604:R366W;ENSP00000440222:R435W;ENSP00000347005:R369W;ENSP00000263545:R368W	ENSP00000263545:R368W	R	+	1	2	LUC7L2	138757552	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	2.833000	0.48159	1.493000	0.48517	0.557000	0.71058	CGG		C7orf55-LUC7L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323618.2		
PRSS1	5644	broad.mit.edu	37	7	142459866	142459866	+	Missense_Mutation	SNP	G	G	A	rs386718744		TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr7:142459866G>A	ENST00000311737.7	+	3	448	c.442G>A	c.(442-444)Gcg>Acg	p.A148T	PRSS1_ENST00000486171.1_Missense_Mutation_p.A162T	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	148	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)	p.A148T(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	GGGCAACACTGCGAGCTCTGG	0.577																																					p.A148T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G442A	7						.						67.0	69.0	68.0					7																	142459866		2203	4300	6503	142139440	SO:0001583	missense	5644	exon3			M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.442G>A	7.37:g.142459866G>A	ENSP00000308720:p.Ala148Thr	Somatic		Capture	Illumina HiSeq	Phase_I	142139440	NM_002769	A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Missense_Mutation	SNP	ENST00000311737.7	37	CCDS5872.1	.	.	.	.	.	.	.	.	.	.	G	3.663	-0.069201	0.07228	.	.	ENSG00000204983	ENST00000486171;ENST00000311737;ENST00000529243;ENST00000492062	D;D;D	0.88818	-2.43;-2.43;-2.43	3.28	-0.219	0.13135	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.368349	0.27971	N	0.017113	T	0.73140	0.3549	N	0.12569	0.235	0.20975	N	0.999816	B;B	0.15719	0.014;0.004	B;B	0.23419	0.046;0.028	T	0.57963	-0.7720	10	0.18710	T	0.47	.	5.0834	0.14668	0.0:0.4638:0.3285:0.2077	.	162;148	E7EQ64;P07477	.;TRY1_HUMAN	T	162;148;138;98	ENSP00000417854:A162T;ENSP00000308720:A148T;ENSP00000419912:A98T	ENSP00000308720:A148T	A	+	1	0	PRSS1	142139440	0.002000	0.14202	0.963000	0.40424	0.006000	0.05464	-0.136000	0.10405	0.172000	0.19760	-0.669000	0.03829	GCG		PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352538.2		
ARHGEF5	7984	broad.mit.edu	37	7	144062428	144062428	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr7:144062428T>C	ENST00000056217.5	+	2	2840	c.2666T>C	c.(2665-2667)cTc>cCc	p.L889P	ARHGEF5_ENST00000471847.2_5'Flank	NM_005435.3	NP_005426.2	Q12774	ARHG5_HUMAN	Rho guanine nucleotide exchange factor (GEF) 5	889					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)|myeloid dendritic cell chemotaxis (GO:0002408)|positive regulation of podosome assembly (GO:0071803)|regulation of Rho GTPase activity (GO:0032319)		GTP binding (GO:0005525)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.L889P(1)		breast(1)|endometrium(6)|kidney(8)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Melanoma(164;0.14)					ACAGTCCCCCTCCCTGCCTCT	0.597																																					p.L889P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2666C	7						.						12.0	14.0	13.0					7																	144062428		2011	4057	6068	143693361	SO:0001583	missense	7984	exon2			U02082	CCDS34771.1	7q35	2012-09-20			ENSG00000050327	ENSG00000050327		"""Rho guanine nucleotide exchange factors"""	13209	protein-coding gene	gene with protein product	"""transforming immortalized mammary oncogene"", ""guanine nucleotide regulatory protein TIM"""	600888				8134109, 7656213	Standard	NM_005435		Approved	TIM, TIM1, GEF5, P60	uc003wel.3	Q12774	OTTHUMG00000158004	ENST00000056217.5:c.2666T>C	7.37:g.144062428T>C	ENSP00000056217:p.Leu889Pro	Somatic		Capture	Illumina HiSeq	Phase_I	143693361	NM_005435	A6NNJ2|Q6ZML7	Missense_Mutation	SNP	ENST00000056217.5	37	CCDS34771.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	2.316|2.316	-0.356672|-0.356672	0.05138|0.05138	.|.	.|.	ENSG00000050327|ENSG00000050327	ENST00000056217|ENST00000474817	T|.	0.73258|.	-0.73|.	4.27|4.27	0.112|0.112	0.14623|0.14623	.|.	2.098540|.	0.02646|.	N|.	0.105844|.	T|T	0.14917|0.14917	0.0360|0.0360	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B|.	0.15141|.	0.012|.	B|.	0.12156|.	0.007|.	T|T	0.26395|0.26395	-1.0104|-1.0104	10|5	0.56958|.	D|.	0.05|.	0.8266|0.8266	4.3608|4.3608	0.11201|0.11201	0.0:0.4146:0.3639:0.2214|0.0:0.4146:0.3639:0.2214	.|.	889|.	Q12774|.	ARHG5_HUMAN|.	P|P	889|143	ENSP00000056217:L889P|.	ENSP00000056217:L889P|.	L|S	+|+	2|1	0|0	ARHGEF5|ARHGEF5	143693361|143693361	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.005000|0.005000	0.04900|0.04900	0.330000|0.330000	0.19715|0.19715	-0.170000|-0.170000	0.10816|0.10816	-0.375000|-0.375000	0.07067|0.07067	CTC|TCC		ARHGEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349981.1	NM_005435	
COL1A2	1278	broad.mit.edu	37	7	94054936	94054936	+	Silent	SNP	C	C	T			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr7:94054936C>T	ENST00000297268.6	+	43	3267	c.2796C>T	c.(2794-2796)aaC>aaT	p.N932N		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	932					blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)	p.N932N(1)	COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	ACCCTGGGAACGATGGTCCCC	0.488										HNSCC(75;0.22)																											p.N932N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2796T	7						.						98.0	88.0	91.0					7																	94054936		2203	4300	6503	93892872	SO:0001819	synonymous_variant	1278	exon43			Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.2796C>T	7.37:g.94054936C>T		Somatic		Capture	Illumina HiSeq	Phase_I	93892872	NM_000089	P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Silent	SNP	ENST00000297268.6	37	CCDS34682.1																																																																																				COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2	NM_000089	
NCAPG2	54892	broad.mit.edu	37	7	158445020	158445020	+	Missense_Mutation	SNP	G	G	A	rs377006246		TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr7:158445020G>A	ENST00000409423.1	-	24	3071	c.2899C>T	c.(2899-2901)Cgg>Tgg	p.R967W	NCAPG2_ENST00000541468.1_Missense_Mutation_p.R468W|NCAPG2_ENST00000275830.10_Missense_Mutation_p.R759W|NCAPG2_ENST00000449727.2_Missense_Mutation_p.R967W|NCAPG2_ENST00000356309.3_Missense_Mutation_p.R967W|NCAPG2_ENST00000409339.3_Missense_Mutation_p.R967W	NM_001281932.1	NP_001268861.1	Q86XI2	CNDG2_HUMAN	non-SMC condensin II complex, subunit G2	967					chromosome condensation (GO:0030261)|inner cell mass cell proliferation (GO:0001833)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)	p.R967W(1)		NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	39	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)		CTGAAGCTCCGTGCAATACAT	0.488																																					p.R967W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2899T	7						.		TRP/ARG	0,3808		0,0,1904	184.0	180.0	182.0		2899	-5.6	0.0	7		182	1,8243		0,1,4121	no	missense	NCAPG2	NM_017760.5	101	0,1,6025	AA,AG,GG		0.0121,0.0,0.0083	benign	967/1144	158445020	1,12051	1904	4122	6026	158137781	SO:0001583	missense	54892	exon23			BC043404	CCDS43686.1, CCDS64816.1	7q36.3	2006-09-04	2006-09-04	2006-09-04	ENSG00000146918	ENSG00000146918			21904	protein-coding gene	gene with protein product		608532	"""leucine zipper protein 5"""	LUZP5		14532007	Standard	NM_001281933		Approved	FLJ20311, MTB, CAP-G2, hCAP-G2	uc003wnv.1	Q86XI2	OTTHUMG00000151438	ENST00000409423.1:c.2899C>T	7.37:g.158445020G>A	ENSP00000386569:p.Arg967Trp	Somatic		Capture	Illumina HiSeq	Phase_I	158137781	NM_017760	A4D228|Q7Z3J9|Q8WUG8|Q9BRX6|Q9H8S2|Q9H9K6	Missense_Mutation	SNP	ENST00000409423.1	37	CCDS43686.1	.	.	.	.	.	.	.	.	.	.	G	7.825	0.718580	0.15372	0.0	1.21E-4	ENSG00000146918	ENST00000541468;ENST00000356309;ENST00000409423;ENST00000275830;ENST00000409339;ENST00000545393;ENST00000449727	T;T;T;T;T;T	0.34072	1.38;1.39;1.39;1.4;1.38;1.38	5.73	-5.64	0.02466	.	0.979449	0.08410	N	0.950118	T	0.15478	0.0373	N	0.05383	-0.06	0.09310	N	1	B;B;B;B	0.17268	0.021;0.008;0.001;0.005	B;B;B;B	0.09377	0.004;0.002;0.0;0.002	T	0.24048	-1.0171	10	0.37606	T	0.19	0.0017	7.6326	0.28249	0.3853:0.0:0.4477:0.167	.	967;410;759;967	Q86XI2-2;B4DHE5;E7EUH9;Q86XI2	.;.;.;CNDG2_HUMAN	W	468;967;967;759;967;410;967	ENSP00000442337:R468W;ENSP00000348657:R967W;ENSP00000386569:R967W;ENSP00000275830:R759W;ENSP00000387007:R967W;ENSP00000388326:R967W	ENSP00000275830:R759W	R	-	1	2	NCAPG2	158137781	0.000000	0.05858	0.002000	0.10522	0.347000	0.29111	-0.175000	0.09825	-1.033000	0.03299	-0.140000	0.14226	CGG		NCAPG2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327111.1	NM_017760	
SAMD12	401474	broad.mit.edu	37	8	119452177	119452177	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr8:119452177T>A	ENST00000314727.4	-	3	352	c.216A>T	c.(214-216)aaA>aaT	p.K72N	SAMD12_ENST00000409003.4_Missense_Mutation_p.K72N	NM_207506.2	NP_997389.2	Q8N8I0	SAM12_HUMAN	sterile alpha motif domain containing 12	72								p.K72N(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(2)	9	all_cancers(13;3.91e-25)|Lung NSC(37;1.13e-07)|Ovarian(258;0.0249)		STAD - Stomach adenocarcinoma(47;0.00391)			GAGCCACCGGTTTAGATAGCT	0.433																																					p.K72N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A216T	8						.						125.0	112.0	117.0					8																	119452177		2203	4300	6503	119521358	SO:0001583	missense	401474	exon3			AK096777	CCDS6325.1, CCDS47913.1	8q24.12	2013-01-10			ENSG00000177570	ENSG00000177570		"""Sterile alpha motif (SAM) domain containing"""	31750	protein-coding gene	gene with protein product							Standard	NM_207506		Approved	FLJ39458	uc003yom.2	Q8N8I0	OTTHUMG00000059817	ENST00000314727.4:c.216A>T	8.37:g.119452177T>A	ENSP00000314173:p.Lys72Asn	Somatic		Capture	Illumina HiSeq	Phase_I	119521358	NM_001101676	Q0P502	Missense_Mutation	SNP	ENST00000314727.4	37	CCDS6325.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	19.83|19.83|19.83	3.899532|3.899532|3.899532	0.72754|0.72754|0.72754	.|.|.	.|.|.	ENSG00000177570|ENSG00000177570|ENSG00000177570	ENST00000409003;ENST00000524796;ENST00000314727;ENST00000526328|ENST00000526765|ENST00000453675	T;T;T;T|.|.	0.31769|.|.	1.48;1.48;1.48;1.48|.|.	5.68|5.68|5.68	2.01|2.01|2.01	0.26516|0.26516|0.26516	Sterile alpha motif/pointed domain (2);|.|.	0.000000|.|.	0.85682|.|.	D|.|.	0.000000|.|.	T|T|T	0.42063|0.42063|0.42063	0.1186|0.1186|0.1186	L|L|L	0.27053|0.27053|0.27053	0.805|0.805|0.805	0.40461|0.40461|0.40461	D|D|D	0.980248|0.980248|0.980248	D;D|.|.	0.89917|.|.	0.998;1.0|.|.	D;D|.|.	0.74023|.|.	0.981;0.982|.|.	T|T|T	0.12192|0.12192|0.12192	-1.0557|-1.0557|-1.0557	9|5|5	.|.|.	.|.|.	.|.|.	-17.8281|-17.8281|-17.8281	9.4546|9.4546|9.4546	0.38747|0.38747|0.38747	0.0:0.3513:0.0:0.6487|0.0:0.3513:0.0:0.6487|0.0:0.3513:0.0:0.6487	.|.|.	72;72|.|.	B8ZZB7;Q8N8I0|.|.	.;SAM12_HUMAN|.|.	N|I|S	72;64;72;72|87|69	ENSP00000387133:K72N;ENSP00000435927:K64N;ENSP00000314173:K72N;ENSP00000431360:K72N|.|.	.|.|.	K|N|T	-|-|-	3|2|1	2|0|0	SAMD12|SAMD12|SAMD12	119521358|119521358|119521358	0.990000|0.990000|0.990000	0.36364|0.36364|0.36364	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.979000|0.979000|0.979000	0.70002|0.70002|0.70002	0.181000|0.181000|0.181000	0.16880|0.16880|0.16880	0.111000|0.111000|0.111000	0.17947|0.17947|0.17947	0.459000|0.459000|0.459000	0.35465|0.35465|0.35465	AAA|AAC|ACC		SAMD12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132989.3	NM_207506	
CSMD1	64478	broad.mit.edu	37	8	2820120	2820120	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr8:2820120G>A	ENST00000520002.1	-	62	10054	c.9499C>T	c.(9499-9501)Ctt>Ttt	p.L3167F	CSMD1_ENST00000537824.1_Missense_Mutation_p.L3166F|CSMD1_ENST00000602723.1_Missense_Mutation_p.L2990F|CSMD1_ENST00000400186.3_Missense_Mutation_p.L2990F|CSMD1_ENST00000602557.1_Missense_Mutation_p.L3167F|CSMD1_ENST00000542608.1_Missense_Mutation_p.L2989F			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	3167	Sushi 26. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.L3166F(1)|p.L2895F(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TTCCCACTAAGTCGCCCTTCT	0.507																																					p.T3166I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C9497T	8						.						47.0	47.0	47.0					8																	2820120		1903	4122	6025	2807527	SO:0001583	missense	64478	exon61					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.9499C>T	8.37:g.2820120G>A	ENSP00000430733:p.Leu3167Phe	Somatic		Capture	Illumina HiSeq	Phase_I	2807527	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	3.930|3.930	-0.016387|-0.016387	0.07681|0.07681	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608|ENST00000335551	T;T;T;T|.	0.67523|.	-0.27;-0.27;-0.27;-0.27|.	5.6|5.6	1.04|1.04	0.20106|0.20106	Complement control module (2);Sushi/SCR/CCP (3);|.	0.218561|.	0.28538|.	U|.	0.014984|.	T|T	0.33818|0.33818	0.0876|0.0876	L|L	0.38953|0.38953	1.18|1.18	0.09310|0.09310	N|N	0.999993|0.999993	B;B;P|.	0.40230|.	0.175;0.046;0.708|.	B;B;B|.	0.44224|.	0.149;0.094;0.444|.	T|T	0.26360|0.26360	-1.0105|-1.0105	10|5	0.10111|.	T|.	0.7|.	.|.	7.2962|7.2962	0.26395|0.26395	0.0623:0.0951:0.5238:0.3188|0.0623:0.0951:0.5238:0.3188	.|.	3167;3167;2989|.	E5RIG2;Q96PZ7;F5H2I8|.	.;CSMD1_HUMAN;.|.	F|I	2990;3167;3028;3166;2989|2583	ENSP00000383047:L2990F;ENSP00000430733:L3167F;ENSP00000441462:L3166F;ENSP00000446243:L2989F|.	ENSP00000320445:L3028F|.	L|T	-|-	1|2	0|0	CSMD1|CSMD1	2807527|2807527	0.174000|0.174000	0.23070|0.23070	0.001000|0.001000	0.08648|0.08648	0.043000|0.043000	0.13939|0.13939	1.091000|1.091000	0.30915|0.30915	0.262000|0.262000	0.21774|0.21774	-0.169000|-0.169000	0.13324|0.13324	CTT|ACT		CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
TACC1	6867	broad.mit.edu	37	8	38646224	38646224	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr8:38646224C>T	ENST00000317827.4	+	2	543	c.164C>T	c.(163-165)tCg>tTg	p.S55L	TACC1_ENST00000379931.3_Missense_Mutation_p.S55L|TACC1_ENST00000348567.4_Intron|TACC1_ENST00000518415.1_Missense_Mutation_p.S10L|TACC1_ENST00000519416.1_5'UTR|TACC1_ENST00000443286.2_Missense_Mutation_p.S71L|TACC1_ENST00000330691.6_Intron|TACC1_ENST00000520340.1_Missense_Mutation_p.S19L|TACC1_ENST00000276520.8_Intron|TACC1_ENST00000520615.1_5'UTR|TACC1_ENST00000520973.1_5'UTR|TACC1_ENST00000522752.1_Intron	NM_006283.2	NP_006274.2	O75410	TACC1_HUMAN	transforming, acidic coiled-coil containing protein 1	55	Interaction with LSM7 and SNRPG.				cell cycle (GO:0007049)|cell division (GO:0051301)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)		p.S55L(2)		breast(4)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|skin(3)	17		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.065)	LUSC - Lung squamous cell carcinoma(45;1.7e-09)|COAD - Colon adenocarcinoma(9;0.235)			CTTGGCAGCTCGGATTCTGAA	0.463																																					p.S55L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C164T	8						.						65.0	63.0	64.0					8																	38646224		2203	4300	6503	38765381	SO:0001583	missense	6867	exon2			AF049910	CCDS6109.1, CCDS47845.1, CCDS55224.1	8p11	2012-12-20			ENSG00000147526	ENSG00000147526			11522	protein-coding gene	gene with protein product		605301					Standard	NM_006283		Approved		uc010lwp.3	O75410	OTTHUMG00000164018	ENST00000317827.4:c.164C>T	8.37:g.38646224C>T	ENSP00000321703:p.Ser55Leu	Somatic		Capture	Illumina HiSeq	Phase_I	38765381	NM_006283	B2RBD9|D3DSX6|Q6Y687|Q86YG7|Q8IUJ2|Q8IUJ3|Q8IUJ4|Q8IZG2|Q8NEY7|Q9UPP9	Missense_Mutation	SNP	ENST00000317827.4	37	CCDS6109.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.760448	0.89932	.	.	ENSG00000147526	ENST00000443286;ENST00000518415;ENST00000522904;ENST00000524354;ENST00000317827;ENST00000379931	T;T;T;T;T	0.29142	1.68;1.67;1.58;1.78;1.78	5.45	5.45	0.79879	.	0.000000	0.64402	D	0.000010	T	0.56202	0.1969	M	0.69823	2.125	0.53005	D	0.999967	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.994;0.994;0.947	T	0.58668	-0.7596	10	0.72032	D	0.01	-4.4068	17.048	0.86510	0.0:1.0:0.0:0.0	.	71;55;10	B4E302;O75410;O75410-7	.;TACC1_HUMAN;.	L	71;10;27;55;55;55	ENSP00000393647:S71L;ENSP00000428706:S10L;ENSP00000430355:S27L;ENSP00000321703:S55L;ENSP00000369263:S55L	ENSP00000321703:S55L	S	+	2	0	TACC1	38765381	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.035000	0.64158	2.552000	0.86080	0.655000	0.94253	TCG		TACC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376768.1	NM_006283	
GML	2765	broad.mit.edu	37	8	143922570	143922570	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr8:143922570T>C	ENST00000220940.1	+	3	200	c.110T>C	c.(109-111)aTa>aCa	p.I37T		NM_002066.2	NP_002057.1	Q99445	GML_HUMAN	glycosylphosphatidylinositol anchored molecule like	37	UPAR/Ly6.				apoptotic process (GO:0006915)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|negative regulation of cell proliferation (GO:0008285)	anchored component of membrane (GO:0031225)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)		p.I37T(1)		NS(1)|central_nervous_system(2)|endometrium(1)|large_intestine(6)|lung(8)	18	all_cancers(97;4.26e-11)|all_epithelial(106;1.85e-08)|Lung NSC(106;0.000274)|all_lung(105;0.000755)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					TGTGCGGTCATAAATGACTTC	0.458																																					p.I37T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T110C	8						.						208.0	167.0	181.0					8																	143922570		2203	4300	6503	143919572	SO:0001583	missense	2765	exon3			D84290	CCDS6391.1	8q24.3	2014-05-14	2012-11-02						4375	protein-coding gene	gene with protein product		602370	"""GPI anchored molecule like protein"", ""glycosylphosphatidylinositol anchored molecule like protein"""			8934543, 9169150	Standard	NM_002066		Approved	LY6DL	uc003yxg.3	Q99445		ENST00000220940.1:c.110T>C	8.37:g.143922570T>C	ENSP00000220940:p.Ile37Thr	Somatic		Capture	Illumina HiSeq	Phase_I	143919572	NM_002066	A0AVF6|O00686|O00731	Missense_Mutation	SNP	ENST00000220940.1	37	CCDS6391.1	.	.	.	.	.	.	.	.	.	.	N	4.160	0.028099	0.08054	.	.	ENSG00000104499	ENST00000522728;ENST00000220940	T;T	0.21361	2.01;2.01	3.43	-4.42	0.03579	Ly-6 antigen / uPA receptor -like (1);CD59 antigen, conserved site (1);	0.179128	0.27600	N	0.018660	T	0.08223	0.0205	L	0.29908	0.895	0.09310	N	1	B	0.25312	0.123	B	0.19666	0.026	T	0.29671	-1.0004	10	0.14656	T	0.56	-3.7417	1.2058	0.01894	0.4715:0.105:0.1607:0.2628	.	37	Q99445	GML_HUMAN	T	37	ENSP00000430799:I37T;ENSP00000220940:I37T	ENSP00000220940:I37T	I	+	2	0	GML	143919572	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.825000	0.04433	-0.870000	0.04047	-0.341000	0.08007	ATA		GML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379659.1	NM_002066	
NPDC1	56654	broad.mit.edu	37	9	139937407	139937408	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr9:139937407_139937408insT	ENST00000371601.4	-	2	443_444	c.230_231insA	c.(229-231)ctcfs	p.L77fs	NPDC1_ENST00000371600.3_Frame_Shift_Ins_p.L155fs|NPDC1_ENST00000488145.1_5'UTR	NM_015392.3	NP_056207.3	Q9NQX5	NPDC1_HUMAN	neural proliferation, differentiation and control, 1	77						integral component of membrane (GO:0016021)		p.C78fs*21(1)		NS(1)|large_intestine(1)|lung(1)|prostate(1)|urinary_tract(1)	5	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0821)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.96e-05)|Epithelial(140;0.000486)		TGGGCACACAGAGCCCTTGCTG	0.653																																					p.L77fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.231_232insA	9						.																																			139057229	SO:0001589	frameshift_variant	56654	exon2			AF285836	CCDS7024.1	9q34.3	2008-07-21			ENSG00000107281	ENSG00000107281			7899	protein-coding gene	gene with protein product		605798				11245976	Standard	NM_015392		Approved	DKFZp586J0523, CAB-, CAB1	uc004ckt.2	Q9NQX5	OTTHUMG00000020956	ENST00000371601.4:c.230_231insA	9.37:g.139937407_139937408insT	ENSP00000360660:p.Leu77fs	Somatic		Capture	Illumina HiSeq	Phase_I	139057228	NM_015392	Q5SPY8|Q9BTD6|Q9BXT3|Q9NQS2|Q9Y434	Frame_Shift_Ins	INS	ENST00000371601.4	37	CCDS7024.1																																																																																				NPDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055182.1	NM_015392	
OR13D1	286365	broad.mit.edu	37	9	107457527	107457527	+	Silent	SNP	G	G	A	rs148110858		TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr9:107457527G>A	ENST00000318763.5	+	1	868	c.825G>A	c.(823-825)gcG>gcA	p.A275A		NM_001004484.1	NP_001004484.1	Q8NGV5	O13D1_HUMAN	olfactory receptor, family 13, subfamily D, member 1	275						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A275A(1)		large_intestine(4)|lung(10)|ovary(1)|prostate(2)|skin(2)	19						CCTGTTCAGCGCACTCGATTG	0.388																																					p.A275A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G825A	9						.	G		0,4406		0,0,2203	175.0	169.0	171.0		825	-4.8	0.0	9	dbSNP_134	171	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	OR13D1	NM_001004484.1		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		275/347	107457527	1,13005	2203	4300	6503	106497348	SO:0001819	synonymous_variant	286365	exon1				CCDS35094.1	9q31.1	2013-09-24			ENSG00000179055	ENSG00000179055		"""GPCR / Class A : Olfactory receptors"""	14695	protein-coding gene	gene with protein product							Standard	NM_001004484		Approved		uc011lvs.2	Q8NGV5	OTTHUMG00000020412	ENST00000318763.5:c.825G>A	9.37:g.107457527G>A		Somatic		Capture	Illumina HiSeq	Phase_I	106497348	NM_001004484	B9EIS1|Q6IFL1	Silent	SNP	ENST00000318763.5	37	CCDS35094.1																																																																																				OR13D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053483.1		
AKNA	80709	broad.mit.edu	37	9	117110115	117110115	+	Missense_Mutation	SNP	T	T	G	rs200970909	byFrequency	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr9:117110115T>G	ENST00000307564.4	-	16	3448	c.3287A>C	c.(3286-3288)cAc>cCc	p.H1096P	AKNA_ENST00000492875.1_5'Flank|AKNA_ENST00000374075.5_Missense_Mutation_p.H1015P|AKNA_ENST00000223791.3_Missense_Mutation_p.H556P|AKNA_ENST00000374079.4_Missense_Mutation_p.H41P|AKNA_ENST00000374088.3_Missense_Mutation_p.H1096P	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	1096					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						GAGTGGCTGGTGCAGGCTGTC	0.667													T|||	732	0.146166	0.0166	0.1484	5008	,	,		13441	0.2669		0.2177	False		,,,				2504	0.1217				p.H1096P												.	.	0			c.A3287C	9						.						15.0	13.0	14.0					9																	117110115		2104	4146	6250	116149936	SO:0001583	missense	80709	exon16			AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.3287A>C	9.37:g.117110115T>G	ENSP00000303769:p.His1096Pro	None		Capture	Illumina HiSeq	Phase_I	116149936	NM_030767	Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	Missense_Mutation	SNP	ENST00000307564.4	37	CCDS6805.1	.	.	.	.	.	.	.	.	.	.	T	15.80	2.939315	0.52972	.	.	ENSG00000106948	ENST00000307564;ENST00000374079;ENST00000320310;ENST00000374088;ENST00000223791;ENST00000374075	T;T;T;T;T	0.18810	2.68;2.19;2.68;2.46;2.68	5.44	1.69	0.24217	.	0.369253	0.23674	N	0.045684	T	0.22781	0.0550	L	0.42245	1.32	0.29941	N	0.821025	D;D	0.61697	0.99;0.987	P;P	0.55391	0.758;0.775	T	0.11891	-1.0569	10	0.62326	D	0.03	-12.6768	1.671	0.02811	0.1676:0.0943:0.1742:0.564	.	1096;1015	Q7Z591;Q7Z591-2	AKNA_HUMAN;.	P	1096;41;108;1096;556;1015	ENSP00000303769:H1096P;ENSP00000363192:H41P;ENSP00000363201:H1096P;ENSP00000223791:H556P;ENSP00000363188:H1015P	ENSP00000223791:H556P	H	-	2	0	AKNA	116149936	0.854000	0.29725	0.996000	0.52242	0.804000	0.45430	0.998000	0.29744	1.009000	0.39289	0.533000	0.62120	CAC		AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053767.2	NM_030767	
ADAMTSL1	92949	broad.mit.edu	37	9	18574215	18574215	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr9:18574215C>T	ENST00000380548.4	+	4	764	c.425C>T	c.(424-426)aCg>aTg	p.T142M	ADAMTSL1_ENST00000276935.6_Missense_Mutation_p.T142M|ADAMTSL1_ENST00000380566.4_Missense_Mutation_p.T142M|ADAMTSL1_ENST00000380570.4_Missense_Mutation_p.T142M|ADAMTSL1_ENST00000327883.7_Missense_Mutation_p.T142M|MIR3152_ENST00000579801.1_RNA|ADAMTSL1_ENST00000431052.2_Missense_Mutation_p.T142M	NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	142						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.T142M(2)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		TTAGATGGTACGCGTTGCTAT	0.438																																					p.T142M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C425T	9						.						232.0	192.0	206.0					9																	18574215		2203	4300	6503	18564215	SO:0001583	missense	92949	exon4			AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.425C>T	9.37:g.18574215C>T	ENSP00000369921:p.Thr142Met	Somatic		Capture	Illumina HiSeq	Phase_I	18564215	NM_052866	A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Missense_Mutation	SNP	ENST00000380548.4	37	CCDS47954.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.932351	0.92389	.	.	ENSG00000178031	ENST00000380548;ENST00000327883;ENST00000431052;ENST00000380570;ENST00000380566;ENST00000276935	T;T;T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11;-1.11;-1.11	5.55	5.55	0.83447	.	.	.	.	.	D	0.91898	0.7435	H	0.94462	3.54	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.93691	0.7007	9	0.87932	D	0	.	19.5044	0.95110	0.0:1.0:0.0:0.0	.	142;142	Q8N6G6;Q8N6G6-2	ATL1_HUMAN;.	M	142	ENSP00000369921:T142M;ENSP00000327887:T142M;ENSP00000401157:T142M;ENSP00000369944:T142M;ENSP00000369940:T142M;ENSP00000276935:T142M	ENSP00000276935:T142M	T	+	2	0	ADAMTSL1	18564215	1.000000	0.71417	0.923000	0.36655	0.993000	0.82548	7.770000	0.85390	2.620000	0.88729	0.643000	0.83706	ACG		ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401206.1		
NUTM2F	54754	broad.mit.edu	37	9	97082793	97082793	+	Missense_Mutation	SNP	C	C	G	rs577940402		TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr9:97082793C>G	ENST00000253262.4	-	5	1085	c.1065G>C	c.(1063-1065)aaG>aaC	p.K355N	NUTM2F_ENST00000341207.4_Missense_Mutation_p.K355N|NUTM2F_ENST00000335456.7_Missense_Mutation_p.K355N	NM_017561.1	NP_060031.1	A1L443	NTM2F_HUMAN	NUT family member 2F	355	Pro-rich.							p.K236N(5)									GCAGGTGGGCCTTGGTCTCCG	0.706													.|||	1	0.000199681	0.0	0.0	5008	,	,		14002	0.0		0.0	False		,,,				2504	0.001				p.K355N												.	.	5	Substitution - Missense(5)	large_intestine(5)	c.G1065C	9						.						17.0	24.0	21.0					9																	97082793		1985	4123	6108	96122614	SO:0001583	missense	54754	exon5				CCDS47994.1	9q22.32	2013-05-02	2013-03-14	2013-05-02	ENSG00000130950	ENSG00000130950			23450	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member F"""	FAM22F			Standard	NM_017561		Approved	DKFZp434I1117		A1L443	OTTHUMG00000020260	ENST00000253262.4:c.1065G>C	9.37:g.97082793C>G	ENSP00000253262:p.Lys355Asn	Somatic		Capture	Illumina HiSeq	Phase_I	96122614	NM_017561	B6ZDF0|Q5SR58|Q5SR59|Q9UFB1	Missense_Mutation	SNP	ENST00000253262.4	37	CCDS47994.1	.	.	.	.	.	.	.	.	.	.	.	10.88	1.475748	0.26511	.	.	ENSG00000130950	ENST00000335456;ENST00000253262;ENST00000341207	T;T;T	0.24151	1.87;2.67;2.67	0.1	0.1	0.14510	.	.	.	.	.	T	0.30070	0.0753	N	0.24115	0.695	0.09310	N	1	D	0.57899	0.981	D	0.69824	0.966	T	0.14062	-1.0486	9	0.62326	D	0.03	.	5.97	0.19346	0.0:0.9994:0.0:6.0E-4	.	355	A1L443	FA22F_HUMAN	N	355	ENSP00000335067:K355N;ENSP00000253262:K355N;ENSP00000343865:K355N	ENSP00000253262:K355N	K	-	3	2	FAM22F	96122614	0.001000	0.12720	0.113000	0.21522	0.093000	0.18481	0.349000	0.20055	0.170000	0.19704	0.173000	0.16961	AAG		NUTM2F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053173.2	NM_017561	
DAB2IP	153090	broad.mit.edu	37	9	124521253	124521253	+	Missense_Mutation	SNP	G	G	A	rs368193656		TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chr9:124521253G>A	ENST00000408936.3	+	5	775	c.593G>A	c.(592-594)cGg>cAg	p.R198Q	DAB2IP_ENST00000309989.1_Missense_Mutation_p.R74Q|DAB2IP_ENST00000259371.2_Missense_Mutation_p.R170Q			Q5VWQ8	DAB2P_HUMAN	DAB2 interacting protein	198	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|angiogenesis (GO:0001525)|cell cycle (GO:0007049)|cell motility involved in cerebral cortex radial glia guided migration (GO:0021814)|cellular protein catabolic process (GO:0044257)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|layer formation in cerebral cortex (GO:0021819)|negative regulation of angiogenesis (GO:0016525)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of GTPase activity (GO:0034260)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphatidylinositol 3-kinase activity (GO:0043553)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of Ras GTPase activity (GO:0034261)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuron projection morphogenesis (GO:0048812)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of dendrite development (GO:1900006)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of synapse maturation (GO:0090129)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of ARF GTPase activity (GO:0032312)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein complex assembly (GO:0043254)|response to unfolded protein (GO:0006986)|transformed cell apoptotic process (GO:0006927)|tube formation (GO:0035148)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	axon (GO:0030424)|cerebellar mossy fiber (GO:0044300)|climbing fiber (GO:0044301)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|neuronal cell body (GO:0043025)|neuronal cell body membrane (GO:0032809)|parallel fiber (GO:1990032)|plasma membrane (GO:0005886)	14-3-3 protein binding (GO:0071889)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|mitogen-activated protein kinase kinase binding (GO:0031434)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase 2A binding (GO:0051721)|Ras GTPase activator activity (GO:0005099)|SH3 domain binding (GO:0017124)|signaling adaptor activity (GO:0035591)|vascular endothelial growth factor receptor 2 binding (GO:0043184)	p.R74Q(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(8)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	27						GAGAACCTCCGGCGAGCGGTG	0.567																																					p.R170Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G509A	9						.	G	GLN/ARG,GLN/ARG	3,4403	6.2+/-15.9	0,3,2200	87.0	76.0	80.0		509,221	4.9	1.0	9		80	0,8600		0,0,4300	no	missense,missense	DAB2IP	NM_032552.2,NM_138709.1	43,43	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	possibly-damaging,possibly-damaging	170/1133,74/1066	124521253	3,13003	2203	4300	6503	123561074	SO:0001583	missense	153090	exon5			AF367051	CCDS6832.1, CCDS6833.2	9q33.1-q33.3	2008-07-21			ENSG00000136848	ENSG00000136848			17294	protein-coding gene	gene with protein product	"""nGAP-like protein"", ""DOC-2/DAB2 interactive protein"", ""ASK-interacting protein"", ""ASK1-interacting protein 1"""	609205				11944990, 11812785	Standard	XM_005251721		Approved	AF9Q34, DIP1/2, KIAA1743, AIP1	uc004bln.3	Q5VWQ8	OTTHUMG00000020595	ENST00000408936.3:c.593G>A	9.37:g.124521253G>A	ENSP00000386183:p.Arg198Gln	Somatic		Capture	Illumina HiSeq	Phase_I	123561074	NM_032552	A6H8V2|A6NHI9|B0QZB1|G3XA90|Q8TDL2|Q96SE1|Q9C0C0	Missense_Mutation	SNP	ENST00000408936.3	37		.	.	.	.	.	.	.	.	.	.	G	26.1	4.702231	0.88924	6.81E-4	0.0	ENSG00000136848	ENST00000394340;ENST00000436835;ENST00000259371;ENST00000408936;ENST00000373782;ENST00000309989	D;D;D;D;D;D	0.93307	-3.2;-3.2;-3.2;-3.2;-3.2;-3.2	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	D	0.88232	0.6381	L	0.37850	1.14	0.80722	D	1	P	0.41643	0.758	B	0.33392	0.163	D	0.87476	0.2417	10	0.25106	T	0.35	.	17.4451	0.87575	0.0:0.0:1.0:0.0	.	170	G3XA90	.	Q	170;74;170;198;107;74	ENSP00000377872:R170Q;ENSP00000409327:R74Q;ENSP00000259371:R170Q;ENSP00000386183:R198Q;ENSP00000362887:R107Q;ENSP00000310827:R74Q	ENSP00000259371:R170Q	R	+	2	0	DAB2IP	123561074	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	6.792000	0.75125	2.414000	0.81942	0.462000	0.41574	CGG		DAB2IP-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000317857.1	NM_032552	
HTR2C	3358	broad.mit.edu	37	X	114082670	114082670	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chrX:114082670C>T	ENST00000276198.1	+	5	1182	c.454C>T	c.(454-456)Cgg>Tgg	p.R152W	HTR2C_ENST00000371950.3_Splice_Site_p.R152W|HTR2C_ENST00000371951.1_Missense_Mutation_p.R152W	NM_000868.2	NP_000859.1	P28335	5HT2C_HUMAN	5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled	152					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|cGMP biosynthetic process (GO:0006182)|feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|regulation of appetite (GO:0032098)|regulation of corticotropin-releasing hormone secretion (GO:0043397)|regulation of neurological system process (GO:0031644)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|Gq/11-coupled serotonin receptor activity (GO:0001587)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.R152W(2)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50					Agomelatine(DB06594)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Doxepin(DB01142)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Lorcaserin(DB04871)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	ATCGCTGGATCGGTATGTAGC	0.428																																					p.R152W												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C454T	X						.						180.0	150.0	160.0					X																	114082670		2203	4300	6503	113988926	SO:0001583	missense	3358	exon5				CCDS14564.1, CCDS59174.1	Xq23	2013-12-19	2012-02-03		ENSG00000147246	ENSG00000147246		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5295	protein-coding gene	gene with protein product		312861	"""5-hydroxytryptamine (serotonin) receptor 2C"""	HTR1C		7895773	Standard	NM_000868		Approved	5-HT2C, 5HTR2C	uc004epu.1	P28335	OTTHUMG00000022226	ENST00000276198.1:c.454C>T	X.37:g.114082670C>T	ENSP00000276198:p.Arg152Trp	Somatic		Capture	Illumina HiSeq	Phase_I	113988926	NM_000868	B1AMW4|Q5VUF8|Q9NP28	Missense_Mutation	SNP	ENST00000276198.1	37	CCDS14564.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.709825	0.89018	.	.	ENSG00000147246	ENST00000276198;ENST00000371951;ENST00000371950	D;D;D	0.97186	-4.28;-4.28;-4.28	4.41	4.41	0.53225	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000001	D	0.99137	0.9702	H	0.99312	4.51	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98638	1.0674	10	0.87932	D	0	.	13.6001	0.62013	0.0:1.0:0.0:0.0	.	152;152	B1AMW4;P28335	.;5HT2C_HUMAN	W	152	ENSP00000276198:R152W;ENSP00000361019:R152W;ENSP00000361018:R152W	ENSP00000276198:R152W	R	+	1	2	HTR2C	113988926	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.686000	0.84128	1.771000	0.52183	0.544000	0.68410	CGG		HTR2C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057962.1	NM_000868	
ACRC	93953	broad.mit.edu	37	X	70823980	70823980	+	Missense_Mutation	SNP	T	T	C	rs199853865		TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chrX:70823980T>C	ENST00000373695.1	+	7	1390	c.853T>C	c.(853-855)Tcc>Ccc	p.S285P	ACRC_ENST00000373696.3_Missense_Mutation_p.S285P			Q96QF7	ACRC_HUMAN	acidic repeat containing	285	Asp/Ser-rich.					nucleus (GO:0005634)		p.S285P(1)		autonomic_ganglia(1)|breast(1)|endometrium(15)|kidney(4)|large_intestine(4)|lung(20)|ovary(5)|prostate(1)|skin(2)|stomach(1)	54	Renal(35;0.156)					TTCGGAAGCTTCCGACGACAG	0.542																																					p.S285P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T853C	X						.						111.0	107.0	109.0					X																	70823980		2203	4300	6503	70740705	SO:0001583	missense	93953	exon8			AJ311392	CCDS35326.1	Xq13.1	2010-08-05			ENSG00000147174	ENSG00000147174			15805	protein-coding gene	gene with protein product		300369					Standard	NM_052957		Approved		uc004eae.2	Q96QF7	OTTHUMG00000033327	ENST00000373695.1:c.853T>C	X.37:g.70823980T>C	ENSP00000362799:p.Ser285Pro	Somatic		Capture	Illumina HiSeq	Phase_I	70740705	NM_052957	B9EG62	Missense_Mutation	SNP	ENST00000373695.1	37	CCDS35326.1	.	.	.	.	.	.	.	.	.	.	C	0	-2.795474	0.00076	.	.	ENSG00000147174	ENST00000373696;ENST00000373695	T;T	0.29917	1.55;1.55	0.14	-0.28	0.12886	.	.	.	.	.	T	0.13157	0.0319	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.22695	-1.0209	9	0.30078	T	0.28	.	4.6957	0.12802	0.0:0.6866:0.0:0.3134	.	285	Q96QF7	ACRC_HUMAN	P	285	ENSP00000362800:S285P;ENSP00000362799:S285P	ENSP00000362799:S285P	S	+	1	0	ACRC	70740705	0.000000	0.05858	0.003000	0.11579	0.003000	0.03518	-2.107000	0.01337	-1.694000	0.01425	-1.727000	0.00703	TCC		ACRC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081856.1		
KIAA1210	57481	broad.mit.edu	37	X	118222472	118222472	+	Silent	SNP	C	C	T			TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3867-01A-01W-0995-10	TCGA-AA-3867-10A-01W-0995-10	g.chrX:118222472C>T	ENST00000402510.2	-	11	2720	c.2721G>A	c.(2719-2721)caG>caA	p.Q907Q		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	907								p.Q731Q(1)|p.Q907Q(1)		breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						AAGGCAGCTGCTGCATAAAAT	0.473																																					p.Q907Q												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G2721A	X						.						50.0	46.0	47.0					X																	118222472		1928	4128	6056	118106500	SO:0001819	synonymous_variant	57481	exon11			AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.2721G>A	X.37:g.118222472C>T		Somatic		Capture	Illumina HiSeq	Phase_I	118106500	NM_020721	B7ZCI8|Q5JPN4	Silent	SNP	ENST00000402510.2	37	CCDS48156.1	.	.	.	.	.	.	.	.	.	.	C	1.662	-0.511141	0.04231	.	.	ENSG00000248857	ENST00000440399	.	.	.	4.47	1.77	0.24775	.	.	.	.	.	T	0.31167	0.0788	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.22661	-1.0210	4	.	.	.	.	5.7633	0.18213	0.0:0.6523:0.0:0.3477	.	.	.	.	T	314	.	.	A	-	1	0	KIAA1210	118106500	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.362000	0.20284	0.246000	0.21394	0.600000	0.82982	GCA		KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371251.2	NM_020721	
