#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MYO3A	53904	broad.mit.edu	37	10	26286168	26286168	+	Silent	SNP	A	A	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr10:26286168A>T	ENST00000265944.5	+	6	655	c.489A>T	c.(487-489)ggA>ggT	p.G163G	MYO3A_ENST00000376302.1_Silent_p.G163G|MYO3A_ENST00000543632.1_Silent_p.G163G|MYO3A_ENST00000376301.1_Silent_p.G163G	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	163	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.G163G(1)		NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						CGGAAGGTGGAGTGAAACTAG	0.328																																					p.G163G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A489T	10						.						81.0	73.0	76.0					10																	26286168		2203	4295	6498	26326174	SO:0001819	synonymous_variant	53904	exon6			AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.489A>T	10.37:g.26286168A>T		Somatic		Capture	Illumina HiSeq	Phase_I	26326174	NM_017433	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Silent	SNP	ENST00000265944.5	37	CCDS7148.1																																																																																				MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433	
EGR2	1959	broad.mit.edu	37	10	64573521	64573521	+	Silent	SNP	G	G	T	rs371616981		TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr10:64573521G>T	ENST00000242480.3	-	2	1202	c.877C>A	c.(877-879)Cgg>Agg	p.R293R	EGR2_ENST00000411732.1_Silent_p.R243R|EGR2_ENST00000493899.2_5'Flank|EGR2_ENST00000439032.1_Silent_p.R293R	NM_000399.3|NM_001136177.1	NP_000390.2|NP_001129649.1	P11161	EGR2_HUMAN	early growth response 2	293					brain development (GO:0007420)|brain segmentation (GO:0035284)|cell death (GO:0008219)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|facial nerve structural organization (GO:0021612)|fat cell differentiation (GO:0045444)|learning or memory (GO:0007611)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein export from nucleus (GO:0006611)|protein sumoylation (GO:0016925)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of ossification (GO:0030278)|response to insulin (GO:0032868)|rhombomere 3 formation (GO:0021660)|rhombomere 5 formation (GO:0021666)|rhythmic behavior (GO:0007622)|Schwann cell differentiation (GO:0014037)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)	p.R293R(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	36	Prostate(12;0.0297)|all_hematologic(501;0.228)					CCAGGCAGCCGGGGTCCCTCG	0.672																																					p.R293R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C877A	10						.						11.0	14.0	13.0					10																	64573521		2060	4120	6180	64243527	SO:0001819	synonymous_variant	1959	exon2			BC035625	CCDS7267.1, CCDS44409.1	10q21.1	2014-09-17	2009-04-23		ENSG00000122877	ENSG00000122877		"""Zinc fingers, C2H2-type"""	3239	protein-coding gene	gene with protein product	"""Krox-20 homolog, Drosophila"""	129010	"""early growth response 2 (Krox-20 homolog, Drosophila)"""	KROX20			Standard	NM_000399		Approved		uc001jmi.3	P11161	OTTHUMG00000018308	ENST00000242480.3:c.877C>A	10.37:g.64573521G>T		Somatic		Capture	Illumina HiSeq	Phase_I	64243527	NM_000399	B2R724|B3KRD7|Q68CZ5|Q8IV26|Q9UNA6	Silent	SNP	ENST00000242480.3	37	CCDS7267.1																																																																																				EGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048245.2	NM_000399	
TSPAN15	23555	broad.mit.edu	37	10	71265965	71265965	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr10:71265965C>T	ENST00000373290.2	+	7	826	c.704C>T	c.(703-705)gCg>gTg	p.A235V	TSPAN15_ENST00000459981.1_3'UTR	NM_012339.3	NP_036471.1	O95858	TSN15_HUMAN	tetraspanin 15	235					establishment of protein localization to plasma membrane (GO:0090002)|protein maturation (GO:0051604)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	enzyme binding (GO:0019899)	p.A235V(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)	9						ACCATCATGGCGGGCATCCTC	0.582																																					p.A235V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C704T	10						.						126.0	96.0	106.0					10																	71265965		2203	4300	6503	70935971	SO:0001583	missense	23555	exon7			AY358934	CCDS7294.1	10q22.1	2013-02-14	2005-03-21	2005-03-21	ENSG00000099282	ENSG00000099282		"""Tetraspanins"""	23298	protein-coding gene	gene with protein product		613140	"""transmembrane 4 superfamily member 15"""	TM4SF15		11739647, 10719184	Standard	NM_012339		Approved	NET-7	uc001jpo.1	O95858	OTTHUMG00000018381	ENST00000373290.2:c.704C>T	10.37:g.71265965C>T	ENSP00000362387:p.Ala235Val	Somatic		Capture	Illumina HiSeq	Phase_I	70935971	NM_012339	Q6UW79	Missense_Mutation	SNP	ENST00000373290.2	37	CCDS7294.1	.	.	.	.	.	.	.	.	.	.	C	18.21	3.572827	0.65765	.	.	ENSG00000099282	ENST00000373290;ENST00000452130	T;T	0.80304	-1.36;-1.36	5.45	5.45	0.79879	.	0.045604	0.85682	D	0.000000	D	0.82495	0.5049	M	0.80847	2.515	0.80722	D	1	P	0.47962	0.903	B	0.40901	0.343	D	0.85317	0.1082	10	0.52906	T	0.07	-30.9115	18.0422	0.89322	0.0:1.0:0.0:0.0	.	235	O95858	TSN15_HUMAN	V	235;144	ENSP00000362387:A235V;ENSP00000404528:A144V	ENSP00000362387:A235V	A	+	2	0	TSPAN15	70935971	0.998000	0.40836	0.990000	0.47175	0.870000	0.49936	3.808000	0.55598	2.554000	0.86153	0.591000	0.81541	GCG		TSPAN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048444.1	NM_012339	
CPN1	1369	broad.mit.edu	37	10	101823429	101823429	+	Silent	SNP	G	G	A	rs149621307		TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr10:101823429G>A	ENST00000370418.3	-	5	1064	c.813C>T	c.(811-813)tgC>tgT	p.C271C		NM_001308.2	NP_001299.1	P15169	CBPN_HUMAN	carboxypeptidase N, polypeptide 1	271	Catalytic.				response to glucocorticoid (GO:0051384)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.C271C(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	33		Colorectal(252;0.234)		Epithelial(162;4.77e-10)|all cancers(201;3.82e-08)		AGTAATCTCCGCAGTTCCAAC	0.502																																					p.C271C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C813T	10						.	A		0,4406		0,0,2203	119.0	108.0	112.0		813	2.0	1.0	10	dbSNP_134	112	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CPN1	NM_001308.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		271/459	101823429	1,13005	2203	4300	6503	101813419	SO:0001819	synonymous_variant	1369	exon5			X14329	CCDS7486.1	10q24.2	2012-02-10	2007-02-23		ENSG00000120054	ENSG00000120054	3.4.17.3		2312	protein-coding gene	gene with protein product	"""anaphylatoxin inactivator"", ""arginine carboxypeptidase"", ""carboxypeptidase K"", ""kininase I"", ""lysine carboxypeptidase"""	603103	"""carboxypeptidase N, polypeptide 1, 50kD"""			9628828, 2912725	Standard	NM_001308		Approved		uc001kql.2	P15169	OTTHUMG00000018896	ENST00000370418.3:c.813C>T	10.37:g.101823429G>A		Somatic		Capture	Illumina HiSeq	Phase_I	101813419	NM_001308	B1AP59	Silent	SNP	ENST00000370418.3	37	CCDS7486.1																																																																																				CPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049828.1	NM_001308	
CD6	923	broad.mit.edu	37	11	60785442	60785443	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr11:60785442_60785443insC	ENST00000313421.7	+	11	1980_1981	c.1794_1795insC	c.(1795-1797)cccfs	p.P599fs	CD6_ENST00000346437.4_Frame_Shift_Ins_p.P526fs|CD6_ENST00000344028.5_Frame_Shift_Ins_p.P567fs|CD6_ENST00000352009.5_Frame_Shift_Ins_p.P567fs|CD6_ENST00000452451.2_Frame_Shift_Ins_p.P558fs	NM_006725.4	NP_006716.3	P30203	CD6_HUMAN	CD6 molecule	599					cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	scavenger receptor activity (GO:0005044)	p.N601fs*18(2)		endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)	18						TCCTGGAGCAGCCCCCAAACTT	0.584																																					p.Q598fs	Pancreas(169;904 2017 4767 38890 42505)											.	.	2	Insertion - Frameshift(2)	large_intestine(2)	c.1794_1795insC	11						.																																			60542019	SO:0001589	frameshift_variant	923	exon11				CCDS7999.1, CCDS58137.1, CCDS58138.1	11q12.2	2006-03-28	2006-03-28		ENSG00000013725	ENSG00000013725		"""CD molecules"""	1691	protein-coding gene	gene with protein product		186720	"""CD6 antigen"""			9013954	Standard	NM_006725		Approved	Tp120	uc001nqq.3	P30203	OTTHUMG00000167823	ENST00000313421.7:c.1799dupC	11.37:g.60785447_60785447dupC	ENSP00000323280:p.Pro599fs	Somatic		Capture	Illumina HiSeq	Phase_I	60542018	NM_006725	A4KAD4|A4KAD5|Q9UMF2|Q9Y4K7|Q9Y4K8|Q9Y4K9|Q9Y4L0	Frame_Shift_Ins	INS	ENST00000313421.7	37	CCDS7999.1																																																																																				CD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396449.1	NM_006725	
MUC6	4588	broad.mit.edu	37	11	1017974	1017974	+	Missense_Mutation	SNP	C	C	G	rs200353019		TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr11:1017974C>G	ENST00000421673.2	-	31	4877	c.4827G>C	c.(4825-4827)caG>caC	p.Q1609H		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1609	Approximate repeats.|Pro-rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)	p.Q1609H(2)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GAAGTGTGGTCTGAGGGTGTG	0.547																																					p.Q1609H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G4827C	11						.						473.0	441.0	452.0					11																	1017974		2186	4282	6468	1007974	SO:0001583	missense	4588	exon31			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.4827G>C	11.37:g.1017974C>G	ENSP00000406861:p.Gln1609His	Somatic		Capture	Illumina HiSeq	Phase_I	1007974	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	C	5.277	0.236564	0.10023	.	.	ENSG00000184956	ENST00000421673	T	0.35421	1.31	2.39	0.333	0.15943	.	.	.	.	.	T	0.26702	0.0653	L	0.52011	1.625	0.09310	N	1	B	0.25486	0.127	B	0.27715	0.082	T	0.28681	-1.0036	9	0.22109	T	0.4	.	3.4702	0.07565	0.0:0.5042:0.2173:0.2785	.	1609	Q6W4X9	MUC6_HUMAN	H	1609	ENSP00000406861:Q1609H	ENSP00000406861:Q1609H	Q	-	3	2	MUC6	1007974	0.000000	0.05858	0.003000	0.11579	0.027000	0.11550	-2.394000	0.01054	-0.057000	0.13199	-0.710000	0.03640	CAG		MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
DDI1	414301	broad.mit.edu	37	11	103908146	103908146	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr11:103908146G>A	ENST00000302259.3	+	1	839	c.596G>A	c.(595-597)cGt>cAt	p.R199H	PDGFD_ENST00000393158.2_Intron|PDGFD_ENST00000302251.5_Intron	NM_001001711.2	NP_001001711.1	Q8WTU0	DDI1_HUMAN	DNA-damage inducible 1 homolog 1 (S. cerevisiae)	199							aspartic-type endopeptidase activity (GO:0004190)	p.R199H(2)		central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(12)|liver(2)|lung(21)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)		GAGAGGCTTCGTCTCTACACA	0.512																																					p.R199H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G596A	11						.						63.0	69.0	67.0					11																	103908146		2202	4299	6501	103413356	SO:0001583	missense	414301	exon1				CCDS31660.1	11q22.3	2010-05-04	2010-05-04			ENSG00000170967			18961	protein-coding gene	gene with protein product			"""DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae)"""				Standard	NM_001001711		Approved	FLJ36017	uc001phr.2	Q8WTU0		ENST00000302259.3:c.596G>A	11.37:g.103908146G>A	ENSP00000302805:p.Arg199His	Somatic		Capture	Illumina HiSeq	Phase_I	103413356	NM_001001711	Q7Z4U6|Q8WTS3	Missense_Mutation	SNP	ENST00000302259.3	37	CCDS31660.1	.	.	.	.	.	.	.	.	.	.	G	11.20	1.567941	0.28003	.	.	ENSG00000170967	ENST00000302259	T	0.25912	1.77	5.02	1.08	0.20341	.	0.178859	0.47455	N	0.000226	T	0.46483	0.1395	M	0.84326	2.69	0.09310	N	1	D	0.89917	1.0	D	0.65874	0.939	T	0.28713	-1.0035	10	0.59425	D	0.04	-26.6368	9.0062	0.36113	0.3252:0.0:0.6748:0.0	.	199	Q8WTU0	DDI1_HUMAN	H	199	ENSP00000302805:R199H	ENSP00000302805:R199H	R	+	2	0	DDI1	103413356	0.854000	0.29725	0.011000	0.14972	0.008000	0.06430	2.439000	0.44846	0.403000	0.25479	-0.122000	0.15005	CGT		DDI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387326.1	NM_001001711	
CADM1	23705	broad.mit.edu	37	11	115085387	115085387	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr11:115085387C>T	ENST00000452722.3	-	7	955	c.935G>A	c.(934-936)cGc>cAc	p.R312H	CADM1_ENST00000536727.1_Missense_Mutation_p.R312H|CADM1_ENST00000331581.6_Missense_Mutation_p.R312H|CADM1_ENST00000542447.2_Missense_Mutation_p.R312H|CADM1_ENST00000537058.1_Missense_Mutation_p.R312H|CADM1_ENST00000537140.1_5'UTR	NM_014333.3	NP_055148.3			cell adhesion molecule 1									p.R312H(1)		cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(9)|ovary(2)|skin(1)	32	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		AGCTTCACAGCGGTATGTACC	0.433																																					p.R312H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G935A	11						.						255.0	224.0	234.0					11																	115085387		2201	4296	6497	114590597	SO:0001583	missense	23705	exon7			AB017563	CCDS8373.1, CCDS53711.1, CCDS73397.1, CCDS73398.1, CCDS73399.1	11q23.2	2013-01-29	2007-02-07	2007-02-07	ENSG00000182985	ENSG00000182985		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5951	protein-coding gene	gene with protein product	"""nectin-like 2"""	605686	"""tumor suppressor in lung cancer 1"", ""immunoglobulin superfamily, member 4"""	TSLC1, IGSF4		10610705	Standard	NM_014333		Approved	NECL2, ST17, BL2, SYNCAM, IGSF4A, Necl-2, SYNCAM1, RA175	uc001ppi.4	Q9BY67	OTTHUMG00000168202	ENST00000452722.3:c.935G>A	11.37:g.115085387C>T	ENSP00000395359:p.Arg312His	Somatic		Capture	Illumina HiSeq	Phase_I	114590597	NM_014333		Missense_Mutation	SNP	ENST00000452722.3	37	CCDS8373.1	.	.	.	.	.	.	.	.	.	.	C	31	5.064844	0.93898	.	.	ENSG00000182985	ENST00000542447;ENST00000452722;ENST00000537058;ENST00000536727;ENST00000404468;ENST00000331581	T;T;T;T;T	0.16196	2.36;2.36;2.36;2.36;2.36	5.4	5.4	0.78164	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.37679	0.1012	L	0.46819	1.47	0.80722	D	1	D;D;D;P;D	0.89917	1.0;1.0;1.0;0.902;1.0	D;D;D;P;D	0.91635	0.999;0.999;0.999;0.479;0.995	T	0.02484	-1.1152	10	0.45353	T	0.12	.	19.1902	0.93663	0.0:1.0:0.0:0.0	.	312;312;313;312;312	Q9BY67-2;F5H0J4;A4FVB5;Q9BY67;A0A4Z1	.;.;.;CADM1_HUMAN;.	H	312;312;312;312;271;312	ENSP00000439176:R312H;ENSP00000395359:R312H;ENSP00000439817:R312H;ENSP00000440322:R312H;ENSP00000329797:R312H	ENSP00000329797:R312H	R	-	2	0	CADM1	114590597	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.456000	0.80751	2.543000	0.85770	0.655000	0.94253	CGC		CADM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398753.2	NM_014333	
BCL9L	283149	broad.mit.edu	37	11	118772353	118772353	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr11:118772353C>T	ENST00000334801.3	-	6	3063	c.2099G>A	c.(2098-2100)aGt>aAt	p.S700N	BCL9L_ENST00000526143.1_5'UTR	NM_182557.2	NP_872363.1	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	700	Met-rich.				canonical Wnt signaling pathway (GO:0060070)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell morphogenesis (GO:0022604)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|transcription coactivator activity (GO:0003713)	p.S700N(2)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	56	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		TCCCATGCCACTGCCTGCCAT	0.652																																					p.S700N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2099A	11						.						47.0	47.0	47.0					11																	118772353		2199	4295	6494	118277563	SO:0001583	missense	283149	exon6			AB094091	CCDS8403.1	11q23.3	2012-06-06				ENSG00000186174			23688	protein-coding gene	gene with protein product		609004				12964048	Standard	NM_182557		Approved	DLNB11	uc001pug.3	Q86UU0		ENST00000334801.3:c.2099G>A	11.37:g.118772353C>T	ENSP00000335320:p.Ser700Asn	Somatic		Capture	Illumina HiSeq	Phase_I	118277563	NM_182557	A1A4C1|Q67FY1|Q6ZWJ0|Q6ZWK2	Missense_Mutation	SNP	ENST00000334801.3	37	CCDS8403.1	.	.	.	.	.	.	.	.	.	.	C	3.346	-0.133488	0.06711	.	.	ENSG00000186174	ENST00000334801;ENST00000526143;ENST00000392849;ENST00000431085	T	0.76448	-1.02	4.67	2.57	0.30868	.	0.467804	0.17785	N	0.162085	T	0.41282	0.1152	N	0.00926	-1.1	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.33471	-0.9867	10	0.11794	T	0.64	3.004	3.8624	0.09002	0.0:0.5848:0.2522:0.163	.	695;700	Q86UU0-2;Q86UU0	.;BCL9L_HUMAN	N	700;663;700;700	ENSP00000335320:S700N	ENSP00000335320:S700N	S	-	2	0	BCL9L	118277563	0.000000	0.05858	0.017000	0.16124	0.778000	0.44026	0.605000	0.24179	1.142000	0.42291	0.313000	0.20887	AGT		BCL9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389653.1	NM_182557	
CDHR5	53841	broad.mit.edu	37	11	618767	618767	+	Missense_Mutation	SNP	C	C	T	rs139590704	byFrequency	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr11:618767C>T	ENST00000358353.3	-	14	2114	c.1792G>A	c.(1792-1794)Ggt>Agt	p.G598S	CDHR5_ENST00000397542.2_Missense_Mutation_p.G598S|IRF7_ENST00000397574.2_5'Flank|CDHR5_ENST00000349570.7_Intron|IRF7_ENST00000397570.1_5'Flank|IRF7_ENST00000330243.5_5'Flank|IRF7_ENST00000397562.3_5'Flank			Q9HBB8	CDHR5_HUMAN	cadherin-related family member 5	598	4 X 31 AA approximate tandem repeats.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)	p.G598S(1)		NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(2)	23						GTGCCCCCACCGGGTGTGGCT	0.672													c|||	6	0.00119808	0.003	0.0	5008	,	,		16914	0.001		0.0	False		,,,				2504	0.001				p.G598S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1792A	11						.						105.0	114.0	111.0					11																	618767		2202	4300	6502	608767	SO:0001583	missense	53841	exon13			AF258675	CCDS7707.1, CCDS7708.1	11p15.5	2011-07-01	2010-01-25	2010-01-25	ENSG00000099834	ENSG00000099834		"""Cadherins / Cadherin-related"""	7521	protein-coding gene	gene with protein product		606839	"""mucin and cadherin-like"", ""mucin-like protocadherin"""	MUCDHL, MUPCDH		11031102, 10801787	Standard	NM_021924		Approved	FLJ20219, MU-PCDH	uc001lqj.3	Q9HBB8	OTTHUMG00000132018	ENST00000358353.3:c.1792G>A	11.37:g.618767C>T	ENSP00000351118:p.Gly598Ser	Somatic		Capture	Illumina HiSeq	Phase_I	608767	NM_021924	C9J7X1|Q9H746|Q9HAU3|Q9HBB5|Q9HBB6|Q9HBB7|Q9NX86|Q9NXI9	Missense_Mutation	SNP	ENST00000358353.3	37	CCDS7707.1	.	.	.	.	.	.	.	.	.	.	c	5.563	0.288767	0.10513	.	.	ENSG00000099834	ENST00000397542;ENST00000358353	T;T	0.38887	1.11;1.11	2.7	-3.84	0.04256	.	.	.	.	.	T	0.14356	0.0347	N	0.11201	0.11	0.09310	N	1	B;B	0.19445	0.036;0.036	B;B	0.12156	0.007;0.007	T	0.30297	-0.9983	9	0.05351	T	0.99	-3.3143	2.7147	0.05184	0.3345:0.2613:0.0:0.4042	.	592;598	Q9HBB8-4;Q9HBB8	.;CDHR5_HUMAN	S	598	ENSP00000380676:G598S;ENSP00000351118:G598S	ENSP00000351118:G598S	G	-	1	0	CDHR5	608767	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-1.750000	0.01822	-0.483000	0.06772	-0.379000	0.06801	GGT		CDHR5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255023.2	NM_021924	
OR51F2	119694	broad.mit.edu	37	11	4842946	4842946	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr11:4842946T>C	ENST00000322110.5	+	1	396	c.331T>C	c.(331-333)Tgc>Cgc	p.C111R	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004753.1	NP_001004753.1	Q8NH61	O51F2_HUMAN	olfactory receptor, family 51, subfamily F, member 2	111						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C111R(1)		breast(2)|endometrium(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		CCTAAATGCCTGCATTGCCCA	0.478																																					p.C111R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T331C	11						.						171.0	153.0	159.0					11																	4842946		2201	4298	6499	4799522	SO:0001583	missense	119694	exon1			BK004281	CCDS31361.1	11p15.4	2012-08-09			ENSG00000176925	ENSG00000176925		"""GPCR / Class A : Olfactory receptors"""	15197	protein-coding gene	gene with protein product							Standard	NM_001004753		Approved		uc010qyn.2	Q8NH61	OTTHUMG00000066508	ENST00000322110.5:c.331T>C	11.37:g.4842946T>C	ENSP00000323952:p.Cys111Arg	Somatic		Capture	Illumina HiSeq	Phase_I	4799522	NM_001004753	Q6IFI1	Missense_Mutation	SNP	ENST00000322110.5	37	CCDS31361.1	.	.	.	.	.	.	.	.	.	.	T	14.17	2.454699	0.43634	.	.	ENSG00000176925	ENST00000322110	T	0.63580	-0.05	4.43	4.43	0.53597	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44902	U	0.000418	D	0.86314	0.5903	H	0.98466	4.24	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90955	0.4808	10	0.87932	D	0	.	12.924	0.58249	0.0:0.0:0.0:1.0	.	111	Q8NH61	O51F2_HUMAN	R	111	ENSP00000323952:C111R	ENSP00000323952:C111R	C	+	1	0	OR51F2	4799522	1.000000	0.71417	0.852000	0.33557	0.258000	0.26162	7.670000	0.83925	1.991000	0.58162	0.459000	0.35465	TGC		OR51F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142181.1	NM_001004753	
OR5B17	219965	broad.mit.edu	37	11	58126185	58126185	+	Missense_Mutation	SNP	G	G	A	rs142474037		TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr11:58126185G>A	ENST00000357377.3	-	1	357	c.358C>T	c.(358-360)Cgc>Tgc	p.R120C		NM_001005489.1	NP_001005489.1	Q8NGF7	OR5BH_HUMAN	olfactory receptor, family 5, subfamily B, member 17	120						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R120C(1)		NS(1)|autonomic_ganglia(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				GCTGCGTAGCGGTCATAGGCC	0.473																																					p.R120C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C358T	11						.	G	CYS/ARG	1,4401	2.1+/-5.4	0,1,2200	124.0	111.0	115.0		358	2.7	0.8	11	dbSNP_134	115	2,8588	2.2+/-6.3	0,2,4293	yes	missense	OR5B17	NM_001005489.1	180	0,3,6493	AA,AG,GG		0.0233,0.0227,0.0231	benign	120/315	58126185	3,12989	2201	4295	6496	57882761	SO:0001583	missense	219965	exon1			AB065849	CCDS31548.1	11q12.1	2012-08-09			ENSG00000197786	ENSG00000197786		"""GPCR / Class A : Olfactory receptors"""	15267	protein-coding gene	gene with protein product				OR5B20P			Standard	NM_001005489		Approved		uc010rke.2	Q8NGF7	OTTHUMG00000167465	ENST00000357377.3:c.358C>T	11.37:g.58126185G>A	ENSP00000349945:p.Arg120Cys	Somatic		Capture	Illumina HiSeq	Phase_I	57882761	NM_001005489	Q6IEX1	Missense_Mutation	SNP	ENST00000357377.3	37	CCDS31548.1	.	.	.	.	.	.	.	.	.	.	g	11.97	1.797199	0.31777	2.27E-4	2.33E-4	ENSG00000197786	ENST00000357377	T	0.77358	-1.09	3.6	2.67	0.31697	GPCR, rhodopsin-like superfamily (1);	0.208574	0.24033	N	0.042165	T	0.77212	0.4097	M	0.86268	2.805	0.31811	N	0.627163	P	0.34412	0.453	B	0.32928	0.155	T	0.79843	-0.1632	10	0.72032	D	0.01	-0.7041	9.8508	0.41055	0.1056:0.0:0.8944:0.0	.	120	Q8NGF7	OR5BH_HUMAN	C	120	ENSP00000349945:R120C	ENSP00000349945:R120C	R	-	1	0	OR5B17	57882761	0.018000	0.18449	0.811000	0.32455	0.649000	0.38597	1.672000	0.37523	0.717000	0.32145	0.461000	0.40582	CGC		OR5B17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394708.2	NM_001005489	
FADS2	9415	broad.mit.edu	37	11	61607903	61607903	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr11:61607903A>T	ENST00000278840.4	+	3	1046	c.416A>T	c.(415-417)cAc>cTc	p.H139L	FADS2_ENST00000522056.1_Missense_Mutation_p.H108L|FADS2_ENST00000521849.1_Missense_Mutation_p.H139L|FADS2_ENST00000257261.6_Missense_Mutation_p.H117L	NM_004265.2	NP_004256.1	O95864	FADS2_HUMAN	fatty acid desaturase 2	139					alpha-linolenic acid metabolic process (GO:0036109)|linoleic acid metabolic process (GO:0043651)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|stearoyl-CoA 9-desaturase activity (GO:0004768)	p.H139L(1)		breast(2)|kidney(2)|large_intestine(4)|liver(1)|lung(2)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	20					Alpha-Linolenic Acid(DB00132)	CTCCTGGCCCACATCATCGCC	0.537																																					p.H139L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A416T	11						.						236.0	214.0	221.0					11																	61607903		2202	4299	6501	61364479	SO:0001583	missense	9415	exon3			AF084559	CCDS8012.1, CCDS60807.1, CCDS60808.1	11q12.2	2013-01-25			ENSG00000134824	ENSG00000134824	1.14.19.3	"""Fatty acid desaturases"""	3575	protein-coding gene	gene with protein product	"""delta-6-desaturase"""	606149		LLCDL2			Standard	NM_004265		Approved	FADSD6, D6D, TU13, DES6, SLL0262	uc001nsl.1	O95864	OTTHUMG00000163794	ENST00000278840.4:c.416A>T	11.37:g.61607903A>T	ENSP00000278840:p.His139Leu	Somatic		Capture	Illumina HiSeq	Phase_I	61364479	NM_004265	A8K2M6|B7Z634|Q6MZQ7|Q96H07|Q96SV8|Q9H3G3|Q9Y3X4	Missense_Mutation	SNP	ENST00000278840.4	37	CCDS8012.1	.	.	.	.	.	.	.	.	.	.	A	18.65	3.669652	0.67814	.	.	ENSG00000134824	ENST00000257261;ENST00000522056;ENST00000518606;ENST00000278840;ENST00000517312;ENST00000521849	T;T;T;T;T;T	0.34859	2.02;2.03;1.56;2.04;1.34;2.04	4.65	4.65	0.58169	.	0.000000	0.56097	D	0.000028	T	0.54983	0.1892	M	0.87456	2.885	0.80722	D	1	P;P;P;P	0.48998	0.918;0.772;0.833;0.721	P;P;P;P	0.55871	0.558;0.461;0.786;0.559	T	0.59643	-0.7416	10	0.10111	T	0.7	-13.0841	13.8944	0.63761	1.0:0.0:0.0:0.0	.	108;139;139;117	B7Z634;O95864;O95864-3;O95864-2	.;FADS2_HUMAN;.;.	L	117;108;17;139;17;139	ENSP00000257261:H117L;ENSP00000429500:H108L;ENSP00000430054:H17L;ENSP00000278840:H139L;ENSP00000430225:H17L;ENSP00000431091:H139L	ENSP00000257261:H117L	H	+	2	0	FADS2	61364479	1.000000	0.71417	0.432000	0.26747	0.842000	0.47809	8.202000	0.89737	1.954000	0.56735	0.358000	0.22013	CAC		FADS2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375586.2	NM_004265	
HEPACAM	220296	broad.mit.edu	37	11	124794706	124794706	+	Silent	SNP	G	G	A	rs531436968		TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr11:124794706G>A	ENST00000298251.4	-	2	750	c.345C>T	c.(343-345)gcC>gcT	p.A115A		NM_152722.4	NP_689935.2			hepatic and glial cell adhesion molecule									p.A115A(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|pancreas(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.54e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0308)		TGCCCTCATCGGCCAGCTGCA	0.567																																					p.A115A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C345T	11						.						156.0	145.0	149.0					11																	124794706		2201	4299	6500	124299916	SO:0001819	synonymous_variant	220296	exon2			AK098396	CCDS8456.1	11q24.2	2013-01-29	2011-02-11		ENSG00000165478	ENSG00000165478		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26361	protein-coding gene	gene with protein product	"""glial cell adhesion molecule"""	611642	"""hepatocyte cell adhesion molecule"""			15885354, 15917256	Standard	NM_152722		Approved	FLJ25530, hepaCAM, GLIALCAM	uc001qbk.3	Q14CZ8	OTTHUMG00000165938	ENST00000298251.4:c.345C>T	11.37:g.124794706G>A		Somatic		Capture	Illumina HiSeq	Phase_I	124299916	NM_152722		Silent	SNP	ENST00000298251.4	37	CCDS8456.1																																																																																				HEPACAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387125.1	NM_152722	
C12orf42	374470	broad.mit.edu	37	12	103696140	103696140	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr12:103696140C>T	ENST00000378113.2	-	6	1054	c.829G>A	c.(829-831)Gcg>Acg	p.A277T	C12orf42_ENST00000548883.1_Missense_Mutation_p.A277T|C12orf42_ENST00000315192.8_Intron|C12orf42_ENST00000548048.1_Missense_Mutation_p.A210T	NM_001099336.1	NP_001092806.1	Q96LP6	CL042_HUMAN	chromosome 12 open reading frame 42	277								p.A277T(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)	22						ATGGCAACCGCGCCTTTTCCG	0.667																																					p.A277T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G829A	12						.						48.0	56.0	53.0					12																	103696140		2027	4207	6234	102220270	SO:0001583	missense	374470	exon6			AK058052	CCDS44963.1	12q23.2	2012-05-30			ENSG00000179088	ENSG00000179088			24729	protein-coding gene	gene with protein product							Standard	NM_001099336		Approved	FLJ25323	uc001tjt.2	Q96LP6	OTTHUMG00000169988	ENST00000378113.2:c.829G>A	12.37:g.103696140C>T	ENSP00000367353:p.Ala277Thr	Somatic		Capture	Illumina HiSeq	Phase_I	102220270	NM_001099336	Q49A64|Q4G0S2	Missense_Mutation	SNP	ENST00000378113.2	37	CCDS44963.1	.	.	.	.	.	.	.	.	.	.	C	17.17	3.322367	0.60634	.	.	ENSG00000179088	ENST00000548883;ENST00000548048;ENST00000378113	T;T;T	0.59083	0.29;0.29;0.29	3.76	-4.73	0.03259	.	1.332720	0.05501	N	0.558362	T	0.28732	0.0712	N	0.20986	0.625	0.09310	N	1	P	0.42961	0.795	B	0.30572	0.117	T	0.24584	-1.0156	10	0.15952	T	0.53	2.1697	3.0067	0.06031	0.0915:0.2846:0.3389:0.2851	.	277	Q96LP6	CL042_HUMAN	T	277;210;277	ENSP00000447908:A277T;ENSP00000449362:A210T;ENSP00000367353:A277T	ENSP00000367353:A277T	A	-	1	0	C12orf42	102220270	0.000000	0.05858	0.000000	0.03702	0.209000	0.24338	-4.097000	0.00296	-1.158000	0.02811	-0.305000	0.09177	GCG		C12orf42-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406754.1	NM_198521	
ZCCHC8	55596	broad.mit.edu	37	12	122958601	122958601	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr12:122958601G>A	ENST00000336229.4	-	14	1697	c.1567C>T	c.(1567-1569)Cag>Tag	p.Q523*	ZCCHC8_ENST00000543897.1_Nonsense_Mutation_p.Q285*|ZCCHC8_ENST00000536306.1_Nonsense_Mutation_p.Q285*|ZCCHC8_ENST00000538116.1_Nonsense_Mutation_p.Q134*	NM_017612.3	NP_060082.2	Q6NZY4	ZCHC8_HUMAN	zinc finger, CCHC domain containing 8	523					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.Q523*(1)		endometrium(4)|kidney(2)|large_intestine(8)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	23	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.25e-05)|Epithelial(86;0.000113)|BRCA - Breast invasive adenocarcinoma(302;0.202)		CGCCTCTGCTGTTCTTCAAGT	0.572																																					p.Q523X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1567T	12						.						110.0	118.0	115.0					12																	122958601		2162	4280	6442	121524554	SO:0001587	stop_gained	55596	exon14			BC017704		12q24.31	2014-04-14				ENSG00000033030		"""Zinc fingers, CCHC domain containing"""	25265	protein-coding gene	gene with protein product						12477932	Standard	XM_005253581		Approved	DKFZp434E2220	uc001ucn.3	Q6NZY4		ENST00000336229.4:c.1567C>T	12.37:g.122958601G>A	ENSP00000337313:p.Gln523*	Somatic		Capture	Illumina HiSeq	Phase_I	121524554	NM_017612	Q7L2P6|Q8N2K5|Q96SK7|Q9NSS2|Q9NSS3	Nonsense_Mutation	SNP	ENST00000336229.4	37		.	.	.	.	.	.	.	.	.	.	G	47	13.074094	0.99717	.	.	ENSG00000033030	ENST00000536306;ENST00000543897;ENST00000336229;ENST00000538116;ENST00000542892	.	.	.	5.96	5.96	0.96718	.	0.155181	0.64402	D	0.000015	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	-14.8438	15.1614	0.72788	0.0:0.0:0.8589:0.1411	.	.	.	.	X	285;285;523;134;134	.	ENSP00000337313:Q523X	Q	-	1	0	ZCCHC8	121524554	1.000000	0.71417	0.990000	0.47175	0.990000	0.78478	6.749000	0.74883	2.833000	0.97629	0.650000	0.86243	CAG		ZCCHC8-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_017612	
SLCO1B7	338821	broad.mit.edu	37	12	21168672	21168672	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr12:21168672T>C	ENST00000421593.2	+	1	43	c.43T>C	c.(43-45)Tcc>Ccc	p.S15P	LST3_ENST00000540229.1_Intron|SLCO1B7_ENST00000554957.1_Intron|SLCO1B3_ENST00000553473.1_Intron|LST3_ENST00000381541.3_Intron	NM_001009562.4	NP_001009562.3	G3V0H7	SO1B7_HUMAN	solute carrier organic anion transporter family, member 1B7 (non-functional)	15						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.S15P(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(25)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	46						ATTTGAGATATCCTCTTCTCT	0.313																																					p.S15P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T43C	12						.						80.0	80.0	80.0					12																	21168672		2149	4285	6434	21059939	SO:0001583	missense	338821	exon1			AF401642	CCDS44843.1	12p12.3	2013-05-22			ENSG00000205754	ENSG00000205754		"""Solute carriers"""	32934	protein-coding gene	gene with protein product							Standard	NM_001009562		Approved	LST3, SLC21A21		G3V0H7	OTTHUMG00000169045	ENST00000421593.2:c.43T>C	12.37:g.21168672T>C	ENSP00000394168:p.Ser15Pro	Somatic		Capture	Illumina HiSeq	Phase_I	21059939	NM_001009562	Q71QF0	Missense_Mutation	SNP	ENST00000421593.2	37	CCDS44843.1	.	.	.	.	.	.	.	.	.	.	.	0.003	-2.418667	0.00188	.	.	ENSG00000205754	ENST00000421593	D	0.84589	-1.87	2.68	-1.86	0.07760	.	0.613533	0.18029	N	0.153991	T	0.58736	0.2143	N	0.10629	0.01	0.80722	D	1	B	0.06786	0.001	B	0.16722	0.016	T	0.52616	-0.8552	10	0.02654	T	1	.	3.1633	0.06527	0.4025:0.2319:0.0:0.3656	.	15	G3V0H7	.	P	15	ENSP00000394168:S15P	ENSP00000394168:S15P	S	+	1	0	SLCO1B7	21059939	0.000000	0.05858	0.925000	0.36789	0.203000	0.24098	-2.237000	0.01200	-0.108000	0.12066	0.334000	0.21626	TCC		SLCO1B7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402066.1	NM_001009562	
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12D	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0 	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35A	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	12.37:g.25398284C>T	ENSP00000256078:p.Gly12Asp	Somatic		Capture	Illumina HiSeq	Phase_I	25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
OR6C74	254783	broad.mit.edu	37	12	55641794	55641794	+	Silent	SNP	C	C	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr12:55641794C>T	ENST00000343870.4	+	1	813	c.723C>T	c.(721-723)tcC>tcT	p.S241S		NM_001005490.1	NP_001005490.1	A6NCV1	O6C74_HUMAN	olfactory receptor, family 6, subfamily C, member 74	241						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S241S(1)		central_nervous_system(1)|large_intestine(3)|lung(7)|prostate(1)	12						CATGTTCTTCCCACATGGTGG	0.383																																					p.S241S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C723T	12						.						87.0	88.0	87.0					12																	55641794		2203	4300	6503	53928061	SO:0001819	synonymous_variant	254783	exon1				CCDS31816.1	12q13.13	2012-08-09			ENSG00000197706	ENSG00000197706		"""GPCR / Class A : Olfactory receptors"""	31303	protein-coding gene	gene with protein product							Standard	NM_001005490		Approved		uc010spg.2	A6NCV1	OTTHUMG00000165162	ENST00000343870.4:c.723C>T	12.37:g.55641794C>T		Somatic		Capture	Illumina HiSeq	Phase_I	53928061	NM_001005490		Silent	SNP	ENST00000343870.4	37	CCDS31816.1																																																																																				OR6C74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382312.1		
CNPY2	10330	broad.mit.edu	37	12	56712897	56712897	+	5'Flank	SNP	C	C	G			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr12:56712897C>G	ENST00000273308.4	-	0	0				PAN2_ENST00000425394.2_Silent_p.L1117L|PAN2_ENST00000549090.1_Intron|PAN2_ENST00000548043.1_Silent_p.L1117L|PAN2_ENST00000440411.3_Silent_p.L1113L|CNPY2_ENST00000551720.1_5'Flank|PAN2_ENST00000257931.5_Silent_p.L1116L	NM_014255.5	NP_055070.1	Q9Y2B0	CNPY2_HUMAN	canopy FGF signaling regulator 2						negative regulation of gene expression (GO:0010629)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|regulation of low-density lipoprotein particle clearance (GO:0010988)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)		p.L1113L(1)		large_intestine(2)|lung(2)	4						CAAGGAATCGCAGGGAAATCA	0.463																																					p.L1116L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3348C	12						.						105.0	96.0	99.0					12																	56712897		2203	4300	6503	54999164	SO:0001631	upstream_gene_variant	9924	exon24			AB015631	CCDS8914.1	12q15	2013-07-23	2013-07-23	2007-10-22		ENSG00000257727			13529	protein-coding gene	gene with protein product		605861	"""transmembrane protein 4"", ""canopy 2 homolog (zebrafish)"""	TMEM4		10072769, 15905959	Standard	NM_001190991		Approved	HP10390, ZSIG9, Cnpy2	uc001sku.2	Q9Y2B0	OTTHUMG00000170330		12.37:g.56712897C>G	Exception_encountered	Somatic		Capture	Illumina HiSeq	Phase_I	54999164	NM_001166279	B2R7B9|Q9UHE9	Silent	SNP	ENST00000273308.4	37	CCDS8914.1																																																																																				CNPY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408546.1	NM_014255	
UHRF1BP1L	23074	broad.mit.edu	37	12	100492202	100492202	+	Silent	SNP	G	G	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr12:100492202G>T	ENST00000279907.7	-	5	668	c.456C>A	c.(454-456)atC>atA	p.I152I	UHRF1BP1L_ENST00000356828.3_Silent_p.I152I	NM_015054.1	NP_055869.1	A0JNW5	UH1BL_HUMAN	UHRF1 binding protein 1-like	152								p.I152I(2)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(21)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	50						TTACACTATAGATCCGAAGCT	0.348																																					p.I152I												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C456A	12						.						111.0	108.0	109.0					12																	100492202		2203	4300	6503	99016333	SO:0001819	synonymous_variant	23074	exon5				CCDS31882.1, CCDS31883.1	12q23.1	2011-04-15	2008-08-15		ENSG00000111647	ENSG00000111647			29102	protein-coding gene	gene with protein product							Standard	XM_005268737		Approved	KIAA0701	uc001tgq.3	A0JNW5	OTTHUMG00000170195	ENST00000279907.7:c.456C>A	12.37:g.100492202G>T		Somatic		Capture	Illumina HiSeq	Phase_I	99016333	NM_001006947	A0PJE5|O75183|Q8NDL1|Q96C30|Q9BTS5|Q9H0F1	Silent	SNP	ENST00000279907.7	37	CCDS31882.1																																																																																				UHRF1BP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407875.1	NM_001006947	
DNAH10	196385	broad.mit.edu	37	12	124359925	124359925	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr12:124359925C>T	ENST00000409039.3	+	46	7757	c.7732C>T	c.(7732-7734)Cgc>Tgc	p.R2578C		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2578	AAA 3. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R1170C(1)|p.R2578C(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TGGAGGAGGCCGCAATGAAGT	0.438																																					p.R2578C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C7732T	12						.						107.0	101.0	103.0					12																	124359925		1933	4142	6075	122925878	SO:0001583	missense	196385	exon46			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.7732C>T	12.37:g.124359925C>T	ENSP00000386770:p.Arg2578Cys	Somatic		Capture	Illumina HiSeq	Phase_I	122925878	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	37	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	C	18.19	3.569258	0.65765	.	.	ENSG00000197653	ENST00000409039	T	0.35789	1.29	5.41	5.41	0.78517	ATPase, AAA+ type, core (1);	0.000000	0.64402	U	0.000001	T	0.78984	0.4370	H	0.99535	4.615	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.88359	0.2986	10	0.87932	D	0	.	19.6104	0.95604	0.0:1.0:0.0:0.0	.	2578	Q8IVF4	DYH10_HUMAN	C	2578	ENSP00000386770:R2578C	ENSP00000386770:R2578C	R	+	1	0	DNAH10	122925878	1.000000	0.71417	1.000000	0.80357	0.367000	0.29736	2.858000	0.48356	2.702000	0.92279	0.558000	0.71614	CGC		DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
SGCG	6445	broad.mit.edu	37	13	23824817	23824817	+	Missense_Mutation	SNP	C	C	T	rs191040430	byFrequency	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr13:23824817C>T	ENST00000218867.3	+	4	470	c.346C>T	c.(346-348)Cgc>Tgc	p.R116C	SGCG_ENST00000545013.1_Missense_Mutation_p.R116C|SGCG_ENST00000537476.1_Missense_Mutation_p.R116C	NM_000231.2	NP_000222	Q13326	SGCG_HUMAN	sarcoglycan, gamma (35kDa dystrophin-associated glycoprotein)	116			R -> H (in dbSNP:rs17314986). {ECO:0000269|PubMed:8900232}.		muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)		p.R116C(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		all_cancers(29;4.34e-23)|all_epithelial(30;4.4e-19)|all_lung(29;2.45e-18)|Lung SC(185;0.0228)|Breast(139;0.188)		all cancers(112;0.00255)|Epithelial(112;0.0129)|OV - Ovarian serous cystadenocarcinoma(117;0.0365)|Lung(94;0.205)		TGTAAATGCGCGCAACTCAGA	0.403													C|||	2	0.000399361	0.0008	0.0	5008	,	,		15855	0.001		0.0	False		,,,				2504	0.0				p.R116C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C346T	13						.						114.0	96.0	102.0					13																	23824817		2203	4300	6503	22722817	SO:0001583	missense	6445	exon4			U34976	CCDS9299.1	13q12-q13	2014-09-17	2002-08-29		ENSG00000102683	ENSG00000102683			10809	protein-coding gene	gene with protein product	"""Maghrebian myopathy (autosomal recessive)"", ""35kD dystrophin-associated glycoprotein"", ""limb girdle muscular dystrophy 2C (Duchenne-like muscular dystrophy, autosomal recessive)"", ""gamma sarcoglycan"""	608896	"""sarcoglycan, gamma (35kD dystrophin-associated glycoprotein)"""	DMDA1, MAM, LGMD2C		8968757	Standard	NM_000231		Approved	SCARMD2, DAGA4, SCG3, DMDA, TYPE, A4, MGC130048	uc001uom.2	Q13326	OTTHUMG00000016563	ENST00000218867.3:c.346C>T	13.37:g.23824817C>T	ENSP00000218867:p.Arg116Cys	Somatic		Capture	Illumina HiSeq	Phase_I	22722817	NM_000231	Q32M32|Q5T9J6	Missense_Mutation	SNP	ENST00000218867.3	37	CCDS9299.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	7.463	0.645100	0.14451	.	.	ENSG00000102683	ENST00000218867;ENST00000537476;ENST00000545013	D;D;D	0.95918	-3.85;-3.85;-3.85	5.22	4.38	0.52667	.	0.048036	0.85682	N	0.000000	D	0.93733	0.7997	M	0.72576	2.205	0.42043	D	0.991087	B	0.26258	0.145	B	0.26614	0.071	D	0.91646	0.5331	10	0.54805	T	0.06	-3.0208	9.8085	0.40808	0.0:0.9044:0.0:0.0956	.	116	Q13326	SGCG_HUMAN	C	116	ENSP00000218867:R116C;ENSP00000444100:R116C;ENSP00000442232:R116C	ENSP00000218867:R116C	R	+	1	0	SGCG	22722817	0.874000	0.30092	0.136000	0.22124	0.002000	0.02628	2.645000	0.46621	1.211000	0.43351	0.655000	0.94253	CGC		SGCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044151.1	NM_000231	
OR11H6	122748	broad.mit.edu	37	14	20692488	20692488	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr14:20692488G>T	ENST00000315519.2	+	1	698	c.620G>T	c.(619-621)tGc>tTc	p.C207F		NM_001004480.1	NP_001004480.1	Q8NGC7	O11H6_HUMAN	olfactory receptor, family 11, subfamily H, member 6	207						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C207F(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(13)|ovary(2)|prostate(1)|skin(2)	29	all_cancers(95;0.00108)		Epithelial(56;1.75e-06)|all cancers(55;1.22e-05)	GBM - Glioblastoma multiforme(265;0.0143)		GCACTGGCCTGCATCTCTGCT	0.493																																					p.C207F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G620T	14						.						121.0	112.0	115.0					14																	20692488		2203	4300	6503	19762328	SO:0001583	missense	122748	exon1				CCDS32033.1	14q11.2	2013-09-24			ENSG00000176219	ENSG00000176219		"""GPCR / Class A : Olfactory receptors"""	15349	protein-coding gene	gene with protein product							Standard	NM_001004480		Approved		uc010tlc.2	Q8NGC7	OTTHUMG00000170850	ENST00000315519.2:c.620G>T	14.37:g.20692488G>T	ENSP00000319071:p.Cys207Phe	Somatic		Capture	Illumina HiSeq	Phase_I	19762328	NM_001004480	Q6IF08	Missense_Mutation	SNP	ENST00000315519.2	37	CCDS32033.1	.	.	.	.	.	.	.	.	.	.	G	16.90	3.248943	0.59103	.	.	ENSG00000176219	ENST00000315519	T	0.00460	7.27	5.0	5.0	0.66597	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000024	T	0.02455	0.0075	H	0.97635	4.045	0.46725	D	0.999172	D	0.89917	1.0	D	0.87578	0.998	T	0.00129	-1.2016	10	0.87932	D	0	.	9.2608	0.37612	0.0963:0.0:0.9037:0.0	.	207	Q8NGC7	O11H6_HUMAN	F	207	ENSP00000319071:C207F	ENSP00000319071:C207F	C	+	2	0	OR11H6	19762328	1.000000	0.71417	0.929000	0.37066	0.992000	0.81027	6.997000	0.76270	2.592000	0.87571	0.471000	0.43371	TGC		OR11H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410676.1		
TM9SF1	10548	broad.mit.edu	37	14	24658670	24658670	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr14:24658670G>A	ENST00000261789.4	-	6	2130	c.1772C>T	c.(1771-1773)tCt>tTt	p.S591F	RP11-468E2.2_ENST00000561419.1_Missense_Mutation_p.L128F|TM9SF1_ENST00000524835.1_Missense_Mutation_p.S504F|IPO4_ENST00000354464.6_5'Flank|TM9SF1_ENST00000530611.1_Missense_Mutation_p.S800F|TM9SF1_ENST00000528669.1_Missense_Mutation_p.S574F|TM9SF1_ENST00000556387.1_Missense_Mutation_p.S800F	NM_006405.5	NP_006396.2	O15321	TM9S1_HUMAN	transmembrane 9 superfamily member 1	591					autophagy (GO:0006914)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)		p.S591F(1)		NS(1)|breast(4)|endometrium(3)|large_intestine(11)|lung(4)|ovary(1)	24				GBM - Glioblastoma multiforme(265;0.0183)		CTTTAGGGAAGAAAAAAAGGA	0.448																																					p.S591F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1772T	14						.						101.0	105.0	104.0					14																	24658670		2203	4300	6503	23728510	SO:0001583	missense	10548	exon6			U94831	CCDS9617.1, CCDS41934.1, CCDS73623.1	14q11.2	2005-10-11			ENSG00000100926	ENSG00000100926			11864	protein-coding gene	gene with protein product						9332367	Standard	NM_006405		Approved	MP70, HMP70	uc010tob.1	O15321	OTTHUMG00000029322	ENST00000261789.4:c.1772C>T	14.37:g.24658670G>A	ENSP00000261789:p.Ser591Phe	Somatic		Capture	Illumina HiSeq	Phase_I	23728510	NM_006405	D3DS65|Q86SZ6|Q96FI8	Missense_Mutation	SNP	ENST00000261789.4	37	CCDS9617.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.315949	0.81469	.	.	ENSG00000100926;ENSG00000100926;ENSG00000100926;ENSG00000100926;ENSG00000254692	ENST00000261789;ENST00000528669;ENST00000556387;ENST00000524835;ENST00000530611	T;T;T;T;T	0.50001	1.35;1.36;0.76;0.77;0.76	6.17	5.28	0.74379	.	0.242276	0.40640	N	0.001058	T	0.59432	0.2193	M	0.66506	2.035	0.42468	D	0.992819	P	0.42248	0.774	P	0.49708	0.62	T	0.64659	-0.6355	10	0.87932	D	0	-8.361	15.6108	0.76716	0.0:0.1375:0.8625:0.0	.	591	O15321	TM9S1_HUMAN	F	591;574;800;504;800	ENSP00000261789:S591F;ENSP00000432997:S574F;ENSP00000451949:S800F;ENSP00000434387:S504F;ENSP00000433967:S800F	ENSP00000433967:S800F	S	-	2	0	TM9SF1;RP11-468E2.1	23728510	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.387000	0.73191	1.601000	0.50113	0.655000	0.94253	TCT		TM9SF1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000073136.2	NM_006405	
SYNE2	23224	broad.mit.edu	37	14	64416699	64416699	+	Silent	SNP	T	T	C			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr14:64416699T>C	ENST00000344113.4	+	7	777	c.565T>C	c.(565-567)Ttg>Ctg	p.L189L	SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000358025.3_Silent_p.L189L|SYNE2_ENST00000341472.5_Silent_p.L189L|SYNE2_ENST00000554584.1_Silent_p.L189L|SYNE2_ENST00000356081.3_Silent_p.L189L	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	189	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)	p.L189L(1)		NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		GGCCCTTCTTTTGTGGGCTCA	0.493																																					p.L189L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T565C	14						.						140.0	139.0	140.0					14																	64416699		2020	4191	6211	63486452	SO:0001819	synonymous_variant	23224	exon7			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.565T>C	14.37:g.64416699T>C		Somatic		Capture	Illumina HiSeq	Phase_I	63486452	NM_015180	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Silent	SNP	ENST00000344113.4	37	CCDS41963.1																																																																																				SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
SYNE2	23224	broad.mit.edu	37	14	64516548	64516548	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr14:64516548G>T	ENST00000344113.4	+	47	7809	c.7597G>T	c.(7597-7599)Gaa>Taa	p.E2533*	SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000358025.3_Nonsense_Mutation_p.E2533*|SYNE2_ENST00000554584.1_Nonsense_Mutation_p.E2566*	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2533					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)	p.E2533*(1)		NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TGCTGCAGTTGAATCTTCAAT	0.363																																					p.E2533X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G7597T	14						.						64.0	63.0	63.0					14																	64516548		1848	4087	5935	63586301	SO:0001587	stop_gained	23224	exon47			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.7597G>T	14.37:g.64516548G>T	ENSP00000341781:p.Glu2533*	Somatic		Capture	Illumina HiSeq	Phase_I	63586301	NM_015180	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Nonsense_Mutation	SNP	ENST00000344113.4	37	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	G	44	11.122446	0.99518	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	.	.	.	5.68	3.57	0.40892	.	0.310016	0.27664	N	0.018379	.	.	.	.	.	.	0.22096	N	0.999361	.	.	.	.	.	.	.	.	.	.	0.17832	T	0.49	.	6.6017	0.22705	0.118:0.4783:0.4037:0.0	.	.	.	.	X	2533;2533;2566;2566	.	ENSP00000261678:E2566X	E	+	1	0	SYNE2	63586301	0.739000	0.28196	0.011000	0.14972	0.007000	0.05969	1.961000	0.40432	1.378000	0.46305	0.585000	0.79938	GAA		SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
SMEK1	55671	broad.mit.edu	37	14	91925110	91925110	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr14:91925110T>A	ENST00000554943.1	-	15	2610	c.2495A>T	c.(2494-2496)gAt>gTt	p.D832V	SMEK1_ENST00000337238.4_Missense_Mutation_p.D819V|SMEK1_ENST00000555718.1_5'Flank|SMEK1_ENST00000554684.1_Missense_Mutation_p.D819V|SMEK1_ENST00000428424.2_Missense_Mutation_p.D593V|SMEK1_ENST00000555462.1_Missense_Mutation_p.D593V			Q6IN85	P4R3A_HUMAN	SMEK homolog 1, suppressor of mek1 (Dictyostelium)	832					positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)		p.D832V(1)		NS(1)|endometrium(1)|kidney(1)|liver(1)|lung(1)|stomach(1)	6		all_cancers(154;0.0691)|all_epithelial(191;0.219)		COAD - Colon adenocarcinoma(157;0.221)		TTATTATGAATCAAATTTTGC	0.428																																					p.D819V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2456T	14						.						173.0	147.0	156.0					14																	91925110		2203	4300	6503	90994863	SO:0001583	missense	55671	exon16			AK000714	CCDS9895.1, CCDS61532.1	14q32.12	2008-09-15	2006-10-12	2006-10-12		ENSG00000100796			20219	protein-coding gene	gene with protein product		610351	"""KIAA2010"""	KIAA2010		16085932, 18487071	Standard	XM_005267842		Approved	FLJ20707, MSTP033, FLFL1, smk-1, smk1	uc001xzm.3	Q6IN85		ENST00000554943.1:c.2495A>T	14.37:g.91925110T>A	ENSP00000450883:p.Asp832Val	Somatic		Capture	Illumina HiSeq	Phase_I	90994863	NM_032560	Q69YK6|Q86U23|Q86YI7|Q8IVG1|Q9H3F1|Q9H7U8|Q9NV01|Q9NWP1	Missense_Mutation	SNP	ENST00000554943.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.49|12.49	1.954123|1.954123	0.34471|0.34471	.|.	.|.	ENSG00000100796|ENSG00000100796	ENST00000554684;ENST00000337238;ENST00000428424;ENST00000554943;ENST00000555462|ENST00000447823	T;T;T|.	0.43688|.	0.94;0.94;0.95|.	5.71|5.71	5.71|5.71	0.89125|0.89125	.|.	0.140991|.	0.64402|.	D|.	0.000004|.	T|T	0.39963|0.39963	0.1098|0.1098	N|N	0.08118|0.08118	0|0	0.47245|0.47245	D|D	0.999365|0.999365	B;B;B|.	0.16603|.	0.018;0.01;0.018|.	B;B;B|.	0.24701|.	0.021;0.055;0.026|.	T|T	0.48305|0.48305	-0.9047|-0.9047	10|6	0.45353|0.87932	T|D	0.12|0	-1.7581|-1.7581	10.3473|10.3473	0.43913|0.43913	0.0:0.0731:0.0:0.9269|0.0:0.0731:0.0:0.9269	.|.	593;832;819|.	Q6IN85-4;Q6IN85;Q6IN85-2|.	.;P4R3A_HUMAN;.|.	V|F	819;819;593;832;593|25	ENSP00000450864:D819V;ENSP00000337125:D819V;ENSP00000450883:D832V|.	ENSP00000337125:D819V|ENSP00000413412:I25F	D|I	-|-	2|1	0|0	SMEK1|SMEK1	90994863|90994863	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	4.946000|4.946000	0.63576|0.63576	2.165000|2.165000	0.68154|0.68154	0.533000|0.533000	0.62120|0.62120	GAT|ATT		SMEK1-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000411665.1	NM_032560	
PPP4R4	57718	broad.mit.edu	37	14	94700906	94700906	+	Nonsense_Mutation	SNP	C	C	T	rs565522571		TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr14:94700906C>T	ENST00000304338.3	+	7	785	c.631C>T	c.(631-633)Cga>Tga	p.R211*		NM_058237.1	NP_478144.1	Q6NUP7	PP4R4_HUMAN	protein phosphatase 4, regulatory subunit 4	211					negative regulation of phosphoprotein phosphatase activity (GO:0032515)|regulation of protein serine/threonine phosphatase activity (GO:0080163)	cytoplasm (GO:0005737)|protein serine/threonine phosphatase complex (GO:0008287)	protein phosphatase regulator activity (GO:0019888)	p.R211*(1)		NS(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(15)|lung(10)|skin(7)|upper_aerodigestive_tract(2)	40						CAGCATTAAGCGAGAAATACT	0.353																																					p.R211X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C631T	14						.						111.0	104.0	106.0					14																	94700906		2203	4300	6503	93770659	SO:0001587	stop_gained	57718	exon7			AB046842, BC068491	CCDS9921.1, CCDS9922.1	14q32.2	2014-07-18	2008-09-16	2008-09-16	ENSG00000119698	ENSG00000119698		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	23788	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 14"""		"""KIAA1622"""	KIAA1622		18715871	Standard	NM_020958		Approved	PP4R4, CFAP14	uc001ycs.1	Q6NUP7		ENST00000304338.3:c.631C>T	14.37:g.94700906C>T	ENSP00000305924:p.Arg211*	Somatic		Capture	Illumina HiSeq	Phase_I	93770659	NM_058237	Q9BUF8|Q9HCF0	Nonsense_Mutation	SNP	ENST00000304338.3	37	CCDS9921.1	.	.	.	.	.	.	.	.	.	.	C	35	5.420954	0.96111	.	.	ENSG00000119698	ENST00000304338	.	.	.	5.54	4.41	0.53225	.	0.176436	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07482	T	0.82	-23.2935	12.8763	0.57991	0.8578:0.1422:0.0:0.0	.	.	.	.	X	211	.	ENSP00000305924:R211X	R	+	1	2	PPP4R4	93770659	1.000000	0.71417	1.000000	0.80357	0.787000	0.44495	6.412000	0.73303	1.033000	0.39918	-0.262000	0.10625	CGA		PPP4R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413056.1	NM_058237	
HERC1	8925	broad.mit.edu	37	15	63937787	63937787	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr15:63937787C>G	ENST00000443617.2	-	56	11060	c.10973G>C	c.(10972-10974)gGa>gCa	p.G3658A		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	3658					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.G3658A(2)		NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						GCACCAGCATCCCGAAATAGA	0.453																																					p.G3658A												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G10973C	15						.						75.0	74.0	74.0					15																	63937787		1954	4165	6119	61724840	SO:0001583	missense	8925	exon56			U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.10973G>C	15.37:g.63937787C>G	ENSP00000390158:p.Gly3658Ala	Somatic		Capture	Illumina HiSeq	Phase_I	61724840	NM_003922	Q8IW65	Missense_Mutation	SNP	ENST00000443617.2	37	CCDS45277.1	.	.	.	.	.	.	.	.	.	.	C	12.80	2.046084	0.36085	.	.	ENSG00000103657	ENST00000443617	T	0.68624	-0.34	6.02	6.02	0.97574	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.148147	0.43579	D	0.000545	T	0.49457	0.1558	N	0.08118	0	0.42041	D	0.99107	P	0.34522	0.455	B	0.27076	0.076	T	0.55717	-0.8097	10	0.62326	D	0.03	.	20.547	0.99278	0.0:1.0:0.0:0.0	.	3658	Q15751	HERC1_HUMAN	A	3658	ENSP00000390158:G3658A	ENSP00000390158:G3658A	G	-	2	0	HERC1	61724840	0.982000	0.34865	0.999000	0.59377	0.259000	0.26198	3.204000	0.51082	2.850000	0.98022	0.650000	0.86243	GGA		HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922	
RLBP1	6017	broad.mit.edu	37	15	89761829	89761829	+	Silent	SNP	C	C	T	rs371167491		TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr15:89761829C>T	ENST00000268125.5	-	4	547	c.108G>A	c.(106-108)ccG>ccA	p.P36P		NM_000326.4	NP_000317.1	P12271	RLBP1_HUMAN	retinaldehyde binding protein 1	36					phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|visual perception (GO:0007601)|vitamin A metabolic process (GO:0006776)	cell body (GO:0044297)|cytosol (GO:0005829)	11-cis retinal binding (GO:0005502)|retinol binding (GO:0019841)|transporter activity (GO:0005215)	p.P36P(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(1)|prostate(1)|skin(1)	18	Lung NSC(78;0.0472)|all_lung(78;0.089)				Vitamin A(DB00162)	GCTGGCTGCACGGGCCAAAGA	0.612																																					p.P36P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G108A	15						.	C		0,4400		0,0,2200	69.0	63.0	65.0		108	-2.2	0.0	15		65	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	RLBP1	NM_000326.4		0,1,6498	TT,TC,CC		0.0116,0.0,0.0077		36/318	89761829	1,12997	2200	4299	6499	87562833	SO:0001819	synonymous_variant	6017	exon4			BC004199	CCDS32324.1	15q26.1	2007-07-16	2001-11-28			ENSG00000140522			10024	protein-coding gene	gene with protein product		180090	"""retinaldehyde-binding protein 1"""			1733864, 9326942	Standard	NM_000326		Approved	CRALBP	uc002bnl.3	P12271		ENST00000268125.5:c.108G>A	15.37:g.89761829C>T		Somatic		Capture	Illumina HiSeq	Phase_I	87562833	NM_000326	B2R667	Silent	SNP	ENST00000268125.5	37	CCDS32324.1																																																																																				RLBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421135.1	NM_000326	
ZNF106	64397	broad.mit.edu	37	15	42743263	42743264	+	Frame_Shift_Del	DEL	AG	AG	-	rs199577747		TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	AG	AG					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr15:42743263_42743264delAG	ENST00000263805.4	-	2	1463_1464	c.1137_1138delCT	c.(1135-1140)ctctttfs	p.F380fs	ZNF106_ENST00000565380.1_Intron|ZNF106_ENST00000565611.1_Intron	NM_001284306.1|NM_001284307.1|NM_022473.1	NP_001271235.1|NP_001271236.1|NP_071918.1	Q9H2Y7	ZN106_HUMAN	zinc finger protein 106	380					insulin receptor signaling pathway (GO:0008286)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.F380fs*1(1)									CTAAAATCAAAGAGAGGTTTCT	0.416																																					p.379_380del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1137_1138del	15						.																																			40530556	SO:0001589	frameshift_variant	64397	exon2			AF205632	CCDS32208.1, CCDS61602.1, CCDS61603.1	15q15.1	2012-11-27	2012-11-27		ENSG00000103994	ENSG00000103994		"""Zinc fingers, C2H2-type"""	12886	protein-coding gene	gene with protein product	"""SH3-domain binding protein 3"""		"""zinc finger protein 106 homolog (mouse)"""	ZFP106			Standard	XM_005254591		Approved	ZNF474, SH3BP3	uc001zpw.3	Q9H2Y7	OTTHUMG00000173244	ENST00000263805.4:c.1137_1138delCT	15.37:g.42743267_42743268delAG	ENSP00000263805:p.Phe380fs	Somatic		Capture	Illumina HiSeq	Phase_I	40530555	NM_022473	B4DZ40|E9PE29|Q6NSD9|Q6PEK1|Q86T43|Q86T45|Q86T50|Q86T58|Q86TA9|Q96M37|Q9H7B8	Frame_Shift_Del	DEL	ENST00000263805.4	37	CCDS32208.1																																																																																				ZNF106-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422587.1	NM_022473	
FANCI	55215	broad.mit.edu	37	15	89824997	89824997	+	Splice_Site	SNP	C	C	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr15:89824997C>A	ENST00000310775.7	+	16	1600	c.1514C>A	c.(1513-1515)cCc>cAc	p.P505H	FANCI_ENST00000300027.8_Splice_Site_p.P505H	NM_001113378.1	NP_001106849.1	Q9NVI1	FANCI_HUMAN	Fanconi anemia, complementation group I	505					cell cycle (GO:0007049)|DNA repair (GO:0006281)|positive regulation of protein ubiquitination (GO:0031398)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA polymerase binding (GO:0070182)	p.P505H(1)		breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	Lung NSC(78;0.0472)|all_lung(78;0.089)					CTTTTTCAGCCCCTTCTCAAA	0.388								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.P505H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1514A	15						.						199.0	174.0	182.0					15																	89824997		2200	4299	6499	87626001	SO:0001630	splice_region_variant	55215	exon16	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	BC004277	CCDS10349.2, CCDS45346.1	15q26.1	2014-09-17	2007-05-03	2007-05-03	ENSG00000140525	ENSG00000140525		"""Fanconi anemia, complementation groups"""	25568	protein-coding gene	gene with protein product		611360	"""KIAA1794"""	KIAA1794		14630800, 17460694, 17412408	Standard	NM_001113378		Approved	FLJ10719	uc010bnp.1	Q9NVI1	OTTHUMG00000132993	ENST00000310775.7:c.1513-1C>A	15.37:g.89824997C>A		Somatic		Capture	Illumina HiSeq	Phase_I	87626001	NM_018193	A4ZVE4|A5YMH4|A6NJZ0|Q96JN1|Q96ST0|Q9BT96	Missense_Mutation	SNP	ENST00000310775.7	37	CCDS45346.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.379024	0.82682	.	.	ENSG00000140525	ENST00000300027;ENST00000310775;ENST00000447611	D;D;D	0.84516	-1.86;-1.86;-1.86	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	D	0.92519	0.7624	M	0.77103	2.36	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.92281	0.5833	10	0.54805	T	0.06	-16.0837	18.2587	0.90026	0.0:1.0:0.0:0.0	.	505;505;505	Q9NVI1;Q9NVI1-2;Q9NVI1-1	FANCI_HUMAN;.;.	H	505	ENSP00000300027:P505H;ENSP00000310842:P505H;ENSP00000413249:P505H	ENSP00000300027:P505H	P	+	2	0	FANCI	87626001	1.000000	0.71417	0.970000	0.41538	0.797000	0.45037	7.350000	0.79385	2.746000	0.94184	0.655000	0.94253	CCC		FANCI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421140.1	NM_018193	Missense_Mutation
NRN1L	123904	broad.mit.edu	37	16	67919977	67919978	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr16:67919977_67919978insC	ENST00000339176.3	+	3	412_413	c.313_314insC	c.(313-315)gccfs	p.A105fs	CTC-479C5.10_ENST00000572067.1_lincRNA|NRN1L_ENST00000576147.1_Frame_Shift_Ins_p.P32fs	NM_198443.1	NP_940845.1	Q496H8	NRN1L_HUMAN	neuritin 1-like	105					nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.R107fs*4(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)	7		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00415)|Epithelial(162;0.0182)|all cancers(182;0.119)		AGCTCGCCAGGCCCCCCGTCCG	0.619																																					p.A105fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.313_314insC	16						.																																			66477479	SO:0001589	frameshift_variant	123904	exon3			AY358782	CCDS10850.1	16q22.1	2008-02-05			ENSG00000188038	ENSG00000188038			29811	protein-coding gene	gene with protein product						12975309	Standard	NM_198443		Approved	UNQ2446, MRCC2446	uc002euu.3	Q496H8	OTTHUMG00000137541	ENST00000339176.3:c.319dupC	16.37:g.67919983_67919983dupC	ENSP00000342411:p.Ala105fs	Somatic		Capture	Illumina HiSeq	Phase_I	66477478	NM_198443	Q6UWH7	Frame_Shift_Ins	INS	ENST00000339176.3	37	CCDS10850.1																																																																																				NRN1L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268872.2	NM_198443	
GTF3C1	2975	broad.mit.edu	37	16	27492404	27492404	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr16:27492404C>T	ENST00000356183.4	-	27	4207	c.4192G>A	c.(4192-4194)Gcc>Acc	p.A1398T	GTF3C1_ENST00000561623.1_Missense_Mutation_p.A1398T	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	1398					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)	p.A1398T(1)		breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						GCTTACCTGGCGAACAGCTCC	0.507																																					p.A1398T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4192A	16						.						99.0	90.0	93.0					16																	27492404		2197	4300	6497	27399905	SO:0001583	missense	2975	exon27			U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.4192G>A	16.37:g.27492404C>T	ENSP00000348510:p.Ala1398Thr	Somatic		Capture	Illumina HiSeq	Phase_I	27399905	NM_001520	B2RP21|Q12838|Q6DKN9|Q9Y4W9	Missense_Mutation	SNP	ENST00000356183.4	37	CCDS32414.1	.	.	.	.	.	.	.	.	.	.	C	16.68	3.190704	0.58017	.	.	ENSG00000077235	ENST00000356183;ENST00000388971	T	0.23147	1.92	5.64	3.3	0.37823	.	0.375050	0.26738	N	0.022747	T	0.25306	0.0615	M	0.68317	2.08	0.30968	N	0.722845	P;P	0.52170	0.87;0.951	B;P	0.44477	0.184;0.451	T	0.15292	-1.0442	10	0.17369	T	0.5	.	7.5862	0.27993	0.1256:0.675:0.1226:0.0768	.	1398;1398	Q12789;Q12789-3	TF3C1_HUMAN;.	T	1398;1394	ENSP00000348510:A1398T	ENSP00000348510:A1398T	A	-	1	0	GTF3C1	27399905	0.934000	0.31675	1.000000	0.80357	0.991000	0.79684	0.017000	0.13399	1.338000	0.45544	0.655000	0.94253	GCC		GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433856.1	NM_001520	
ITGAM	3684	broad.mit.edu	37	16	31308955	31308955	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr16:31308955G>A	ENST00000287497.8	+	13	1552	c.1477G>A	c.(1477-1479)Gtg>Atg	p.V493M	ITGAM_ENST00000544665.3_Missense_Mutation_p.V493M			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)	493					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)	p.V493M(1)		endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						CCAGGTGTCCGTGTGCCCCTT	0.687																																					p.V493M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1477A	16						.						50.0	55.0	54.0					16																	31308955		2185	4285	6470	31216456	SO:0001583	missense	3684	exon13			J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		ENST00000287497.8:c.1477G>A	16.37:g.31308955G>A	ENSP00000287497:p.Val493Met	Somatic		Capture	Illumina HiSeq	Phase_I	31216456	NM_000632	Q4VAK0|Q4VAK1|Q4VAK2	Missense_Mutation	SNP	ENST00000287497.8	37	CCDS45470.1	.	.	.	.	.	.	.	.	.	.	G	15.07	2.724377	0.48728	.	.	ENSG00000169896	ENST00000544665;ENST00000287497	T;T	0.75589	-0.95;-0.95	4.0	1.95	0.26073	.	.	.	.	.	T	0.70780	0.3263	M	0.77616	2.38	0.32316	N	0.563006	P;P	0.49358	0.923;0.923	B;B	0.41894	0.369;0.369	T	0.75513	-0.3291	9	0.66056	D	0.02	.	5.368	0.16125	0.2663:0.0:0.7337:0.0	.	493;493	Q4VAK1;P11215	.;ITAM_HUMAN	M	493	ENSP00000441691:V493M;ENSP00000287497:V493M	ENSP00000287497:V493M	V	+	1	0	ITGAM	31216456	0.268000	0.24133	0.905000	0.35620	0.860000	0.49131	0.437000	0.21543	0.946000	0.37632	0.655000	0.94253	GTG		ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432816.1	NM_000632	
AATF	26574	broad.mit.edu	37	17	35310580	35310580	+	Silent	SNP	C	C	T	rs544972942		TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr17:35310580C>T	ENST00000225402.5	+	3	929	c.678C>T	c.(676-678)gcC>gcT	p.A226A		NM_012138.3	NP_036270.1	Q9NY61	AATF_HUMAN	apoptosis antagonizing transcription factor	226					apoptotic signaling pathway (GO:0097190)|cell adhesion (GO:0007155)|cellular response to DNA damage stimulus (GO:0006974)|embryonic cleavage (GO:0040016)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of apoptotic process (GO:0043066)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of superoxide anion generation (GO:0032929)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mitotic cell cycle (GO:0007346)|ribosome biogenesis (GO:0042254)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	leucine zipper domain binding (GO:0043522)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A226A(1)		cervix(2)|endometrium(1)|large_intestine(4)|lung(7)|ovary(2)|skin(2)	18		Breast(25;0.00607)				AAGGAAGAGCCGTGAAGAACC	0.418																																					p.A226A	NSCLC(49;901 1159 19183 41572 46244)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C678T	17						.						223.0	232.0	229.0					17																	35310580		2203	4300	6503	32384693	SO:0001819	synonymous_variant	26574	exon3			AF083208	CCDS32632.1	17q12	2014-05-06			ENSG00000108270	ENSG00000275700			19235	protein-coding gene	gene with protein product		608463				11027528, 10783144	Standard	NM_012138		Approved	DED, CHE-1, CHE1, BFR2	uc002hni.3	Q9NY61	OTTHUMG00000188458	ENST00000225402.5:c.678C>T	17.37:g.35310580C>T		Somatic		Capture	Illumina HiSeq	Phase_I	32384693	NM_012138	A6NCJ6|B3KQ26|Q9P0A4|Q9UNX5	Silent	SNP	ENST00000225402.5	37	CCDS32632.1																																																																																				AATF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451543.1	NM_012138	
DVL2	1856	broad.mit.edu	37	17	7132719	7132719	+	Silent	SNP	G	G	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr17:7132719G>A	ENST00000005340.5	-	7	1077	c.795C>T	c.(793-795)atC>atT	p.I265I	DVL2_ENST00000574642.1_5'UTR|DVL2_ENST00000575458.1_Silent_p.I259I	NM_004422.2	NP_004413.1	O14641	DVL2_HUMAN	dishevelled segment polarity protein 2	265					canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration in hindbrain (GO:0021535)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|convergent extension involved in neural plate elongation (GO:0022007)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|hippo signaling (GO:0035329)|neural tube closure (GO:0001843)|non-canonical Wnt signaling pathway (GO:0035567)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|segment specification (GO:0007379)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|clathrin-coated endocytic vesicle (GO:0045334)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|identical protein binding (GO:0042802)	p.I265I(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(7)|skin(1)	25						TGACTGTGATGATATTGAGAG	0.577																																					p.I265I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C795T	17						.						157.0	146.0	150.0					17																	7132719		2203	4300	6503	7073443	SO:0001819	synonymous_variant	1856	exon7			BC014844	CCDS11091.1	17p13.1	2013-05-22	2013-05-22		ENSG00000004975	ENSG00000004975		"""Dishevelled homologs"""	3086	protein-coding gene	gene with protein product		602151	"""dishevelled 2 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 2 (Drosophila)"""			8662242	Standard	NM_004422		Approved		uc002gez.1	O14641	OTTHUMG00000102155	ENST00000005340.5:c.795C>T	17.37:g.7132719G>A		Somatic		Capture	Illumina HiSeq	Phase_I	7073443	NM_004422	D3DTN3|Q53XM0	Silent	SNP	ENST00000005340.5	37	CCDS11091.1																																																																																				DVL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219999.2	NM_004422	
ADAM11	4185	broad.mit.edu	37	17	42849695	42849695	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr17:42849695G>A	ENST00000200557.6	+	7	773	c.604G>A	c.(604-606)Gaa>Aaa	p.E202K	ADAM11_ENST00000535346.1_Missense_Mutation_p.G3E	NM_002390.4	NP_002381.2	O75078	ADA11_HUMAN	ADAM metallopeptidase domain 11	202					integrin-mediated signaling pathway (GO:0007229)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(15)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Prostate(33;0.0959)				CGGATGCAGGGAACCAGGTAA	0.657																																					p.E202K												.	.	0			c.G604A	17						.						33.0	32.0	32.0					17																	42849695		2199	4296	6495	40205221	SO:0001583	missense	4185	exon7			D17390	CCDS11486.1	17q21.3	2014-08-12	2005-08-18		ENSG00000073670			"""ADAM metallopeptidase domain containing"""	189	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, cysteine-rich protein"""	155120	"""a disintegrin and metalloproteinase domain 11"""	MDC		8252040	Standard	XM_005257373		Approved		uc002ihh.3	O75078	OTTHUMG00000179038	ENST00000200557.6:c.604G>A	17.37:g.42849695G>A	ENSP00000200557:p.Glu202Lys	None		Capture	Illumina HiSeq	Phase_I	40205221	NM_002390	Q14808|Q14809|Q14810	Missense_Mutation	SNP	ENST00000200557.6	37	CCDS11486.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.54|16.54	3.153095|3.153095	0.57259|0.57259	.|.	.|.	ENSG00000073670|ENSG00000073670	ENST00000200557;ENST00000355638|ENST00000535346	T;T|T	0.06371|0.01613	4.44;3.31|4.73	4.96|4.96	4.96|4.96	0.65561|0.65561	.|.	0.660509|.	0.14436|.	N|.	0.319696|.	T|T	0.01454|0.01454	0.0047|0.0047	N|N	0.08118|0.08118	0|0	0.30260|0.30260	N|N	0.793201|0.793201	B|B	0.34161|0.31893	0.439|0.345	B|B	0.29942|0.24701	0.109|0.055	T|T	0.43782|0.43782	-0.9370|-0.9370	10|9	0.07030|0.72032	T|D	0.85|0.01	.|.	15.1252|15.1252	0.72478|0.72478	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	202|3	O75078|B4DKD2	ADA11_HUMAN|.	K|E	202;102|3	ENSP00000200557:E202K;ENSP00000347856:E102K|ENSP00000443773:G3E	ENSP00000200557:E202K|ENSP00000443773:G3E	E|G	+|+	1|2	0|0	ADAM11|ADAM11	40205221|40205221	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.896000|0.896000	0.52359|0.52359	4.471000|4.471000	0.60182|0.60182	2.309000|2.309000	0.77851|0.77851	0.511000|0.511000	0.50034|0.50034	GAA|GGA		ADAM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444531.1	NM_002390	
ELP2	55250	broad.mit.edu	37	18	33716274	33716274	+	Silent	SNP	T	T	C			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr18:33716274T>C	ENST00000358232.6	+	3	285	c.222T>C	c.(220-222)ccT>ccC	p.P74P	ELP2_ENST00000442325.2_Silent_p.P74P|ELP2_ENST00000423854.2_Silent_p.P74P|ELP2_ENST00000350494.6_Silent_p.P74P|ELP2_ENST00000351393.6_Silent_p.P74P|ELP2_ENST00000542824.1_Silent_p.P74P	NM_018255.2	NP_060725.1	Q6IA86	ELP2_HUMAN	elongator acetyltransferase complex subunit 2	74					chromatin organization (GO:0006325)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|nucleolus (GO:0005730)|transcription elongation factor complex (GO:0008023)		p.P74P(1)		NS(1)|breast(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|skin(2)|urinary_tract(2)	30						TTTCAGCCCCTTCTACTGAAT	0.323																																					p.P74P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T222C	18						.						87.0	94.0	92.0					18																	33716274		2203	4299	6502	31970272	SO:0001819	synonymous_variant	55250	exon3			AK001741	CCDS11918.1, CCDS56065.1, CCDS56066.1, CCDS56067.1, CCDS56068.1, CCDS56069.1	18q12.1	2013-01-10	2012-08-08	2007-04-20	ENSG00000134759	ENSG00000134759		"""Elongator acetyltransferase complex subunits"", ""WD repeat domain containing"""	18248	protein-coding gene	gene with protein product			"""signal transducer and activator of transcription 3 interacting protein 1"", ""elongation protein 2 homolog (S. cerevisiae)"""	STATIP1		11714725, 10954736	Standard	NM_001242875		Approved	FLJ10879, StIP	uc002kzk.2	Q6IA86	OTTHUMG00000132589	ENST00000358232.6:c.222T>C	18.37:g.33716274T>C		Somatic		Capture	Illumina HiSeq	Phase_I	31970272	NM_018255	A8KAI6|B4DTG0|B4DXP0|E7EP23|E9PCX0|Q53GZ0|Q687Y8|Q8N5C2|Q96GV4|Q96PI7|Q9H9N0|Q9NV81	Silent	SNP	ENST00000358232.6	37	CCDS11918.1																																																																																				ELP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255800.2	NM_018255	
SYT4	6860	broad.mit.edu	37	18	40853908	40853908	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr18:40853908T>A	ENST00000255224.3	-	2	854	c.486A>T	c.(484-486)gaA>gaT	p.E162D	SYT4_ENST00000590752.1_Missense_Mutation_p.E144D|SYT4_ENST00000586678.1_Intron	NM_020783.3	NP_065834.1	Q9H2B2	SYT4_HUMAN	synaptotagmin IV	162	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.|Phospholipid binding. {ECO:0000305}.				exocytosis (GO:0006887)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of vesicle fusion (GO:0031339)|neurotransmitter secretion (GO:0007269)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)	p.E162D(2)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44						CGAAGTTGTATTCTAAGGAGA	0.448																																					p.E162D	NSCLC(85;81 1419 2855 22820 35912)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A486T	18						.						49.0	48.0	48.0					18																	40853908		2203	4299	6502	39107906	SO:0001583	missense	6860	exon2			BC036538	CCDS11922.1	18q12.3	2013-01-21			ENSG00000132872	ENSG00000132872		"""Synaptotagmins"""	11512	protein-coding gene	gene with protein product		600103				8058779	Standard	NM_020783		Approved	KIAA1342, HsT1192	uc002law.3	Q9H2B2	OTTHUMG00000132610	ENST00000255224.3:c.486A>T	18.37:g.40853908T>A	ENSP00000255224:p.Glu162Asp	Somatic		Capture	Illumina HiSeq	Phase_I	39107906	NM_020783	B4DEU3|Q9P2K4	Missense_Mutation	SNP	ENST00000255224.3	37	CCDS11922.1	.	.	.	.	.	.	.	.	.	.	T	3.272	-0.148960	0.06585	.	.	ENSG00000132872	ENST00000255224	T	0.07800	3.16	5.87	1.25	0.21368	C2 calcium/lipid-binding domain, CaLB (1);Synaptotagmin (1);	0.000000	0.85682	D	0.000000	T	0.03564	0.0102	N	0.04355	-0.22	0.53005	D	0.999961	P;P	0.40638	0.725;0.725	B;B	0.41894	0.369;0.369	T	0.41016	-0.9532	10	0.05721	T	0.95	.	11.0434	0.47844	0.0:0.6914:0.0:0.3086	.	144;162	B4DEU3;Q9H2B2	.;SYT4_HUMAN	D	162	ENSP00000255224:E162D	ENSP00000255224:E162D	E	-	3	2	SYT4	39107906	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	0.833000	0.27504	0.393000	0.25203	-0.290000	0.09829	GAA		SYT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255851.2	NM_020783	
EMR3	84658	broad.mit.edu	37	19	14757998	14757998	+	Missense_Mutation	SNP	C	C	T	rs375117467		TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr19:14757998C>T	ENST00000253673.5	-	8	977	c.877G>A	c.(877-879)Gtg>Atg	p.V293M	EMR3_ENST00000344373.4_Missense_Mutation_p.V241M|EMR3_ENST00000443157.2_Missense_Mutation_p.V167M|EMR3_ENST00000599900.1_Missense_Mutation_p.V78M	NM_032571.3	NP_115960.2	Q9BY15	EMR3_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 3	293					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.V293M(1)		NS(1)|autonomic_ganglia(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(14)|ovary(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	50						CCCACCTTCACGTGCTGGAAA	0.502													C|||	1	0.000199681	0.0	0.0	5008	,	,		18319	0.0		0.0	False		,,,				2504	0.001				p.V293M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G877A	19						.	C	MET/VAL	0,4406		0,0,2203	250.0	215.0	226.0		877	-6.1	0.0	19		226	1,8599	1.2+/-3.3	0,1,4299	no	missense	EMR3	NM_032571.3	21	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	293/653	14757998	1,13005	2203	4300	6503	14618998	SO:0001583	missense	84658	exon8			AF239764	CCDS12315.1, CCDS74296.1, CCDS74297.1	19p13.1	2014-08-08				ENSG00000131355		"""-"", ""GPCR / Class B : Orphans"""	23647	protein-coding gene	gene with protein product		606101				11279179, 12975309	Standard	XM_005260118		Approved		uc002mzi.4	Q9BY15		ENST00000253673.5:c.877G>A	19.37:g.14757998C>T	ENSP00000253673:p.Val293Met	Somatic		Capture	Illumina HiSeq	Phase_I	14618998	NM_032571		Missense_Mutation	SNP	ENST00000253673.5	37	CCDS12315.1	.	.	.	.	.	.	.	.	.	.	C	7.981	0.751258	0.15778	0.0	1.16E-4	ENSG00000131355	ENST00000443157;ENST00000253673;ENST00000344373	T;T;T	0.56941	1.01;0.43;1.11	3.94	-6.12	0.02124	.	.	.	.	.	T	0.26159	0.0638	N	0.19112	0.55	0.09310	N	1	P;B;B	0.34522	0.455;0.224;0.302	B;B;B	0.26969	0.075;0.018;0.042	T	0.12192	-1.0557	9	0.36615	T	0.2	.	5.4194	0.16392	0.0:0.2896:0.2614:0.449	.	167;241;293	E7EW83;Q9BY15-2;Q9BY15	.;.;EMR3_HUMAN	M	167;293;241	ENSP00000396208:V167M;ENSP00000253673:V293M;ENSP00000340758:V241M	ENSP00000253673:V293M	V	-	1	0	EMR3	14618998	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-3.069000	0.00619	-1.070000	0.03149	0.644000	0.83932	GTG		EMR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466488.1	NM_032571	
NOTCH3	4854	broad.mit.edu	37	19	15276277	15276277	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr19:15276277C>T	ENST00000263388.2	-	31	5792	c.5717G>A	c.(5716-5718)gGc>gAc	p.G1906D		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1906					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.G1906D(1)		breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			TGCCGTTGAGCCATCTGCCAT	0.577																																					p.G1906D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5717A	19						.						71.0	65.0	67.0					19																	15276277		2203	4300	6503	15137277	SO:0001583	missense	4854	exon31			U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.5717G>A	19.37:g.15276277C>T	ENSP00000263388:p.Gly1906Asp	Somatic		Capture	Illumina HiSeq	Phase_I	15137277	NM_000435	Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	ENST00000263388.2	37	CCDS12326.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.471391	0.84533	.	.	ENSG00000074181	ENST00000263388	T	0.59772	0.24	4.9	4.9	0.64082	Ankyrin repeat-containing domain (3);	0.000000	0.32901	N	0.005511	T	0.78272	0.4257	M	0.82630	2.6	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81890	-0.0725	10	0.87932	D	0	.	17.02	0.86431	0.0:1.0:0.0:0.0	.	1906	Q9UM47	NOTC3_HUMAN	D	1906	ENSP00000263388:G1906D	ENSP00000263388:G1906D	G	-	2	0	NOTCH3	15137277	1.000000	0.71417	0.589000	0.28718	0.637000	0.38172	7.183000	0.77697	2.560000	0.86352	0.561000	0.74099	GGC		NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1	NM_000435	
AP3D1	8943	broad.mit.edu	37	19	2132554	2132554	+	Silent	SNP	G	G	A	rs201989084	byFrequency	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr19:2132554G>A	ENST00000345016.5	-	5	609	c.378C>T	c.(376-378)taC>taT	p.Y126Y	AP3D1_ENST00000355272.6_Silent_p.Y126Y|AP3D1_ENST00000356926.4_Silent_p.Y126Y|AP3D1_ENST00000350812.6_Intron	NM_003938.6	NP_003929.4	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1 subunit	126					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|endosome to melanosome transport (GO:0035646)|eye pigment biosynthetic process (GO:0006726)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein localization to membrane (GO:0072657)|protein localization to organelle (GO:0033365)|regulation of sequestering of zinc ion (GO:0061088)|synaptic vesicle membrane organization (GO:0048499)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane coat (GO:0030117)|terminal bouton (GO:0043195)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)	p.Y126Y(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(23)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACCTGTGTCGTACTGGCTGG	0.592													G|||	2	0.000399361	0.0008	0.0	5008	,	,		18025	0.0		0.001	False		,,,				2504	0.0				p.Y126Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C378T	19						.	G	,	1,4113		0,1,2056	103.0	114.0	110.0		378,378	-2.5	1.0	19		110	1,8373		0,1,4186	no	coding-synonymous,coding-synonymous	AP3D1	NM_001077523.1,NM_003938.5	,	0,2,6242	AA,AG,GG		0.0119,0.0243,0.016	,	126/1113,126/1154	2132554	2,12486	2057	4187	6244	2083554	SO:0001819	synonymous_variant	8943	exon5			U91930	CCDS42459.1, CCDS58638.1	19p13.3	2014-09-04			ENSG00000065000	ENSG00000065000			568	protein-coding gene	gene with protein product		607246				9151686, 9303295	Standard	NM_003938		Approved	ADTD	uc002lva.4	O14617	OTTHUMG00000180354	ENST00000345016.5:c.378C>T	19.37:g.2132554G>A		Somatic		Capture	Illumina HiSeq	Phase_I	2083554	NM_003938	O00202|O75262|Q59HF5|Q96G11|Q9H3C6	Silent	SNP	ENST00000345016.5	37	CCDS42459.1																																																																																				AP3D1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450912.1		
HOMER3	9454	broad.mit.edu	37	19	19049233	19049233	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr19:19049233C>A	ENST00000539827.1	-	3	884	c.232G>T	c.(232-234)Ggg>Tgg	p.G78W	HOMER3_ENST00000594794.1_Intron|HOMER3_ENST00000433218.2_Missense_Mutation_p.G78W|HOMER3_ENST00000355887.6_Missense_Mutation_p.G78W|AC005932.1_ENST00000601106.1_RNA|HOMER3_ENST00000392351.3_Missense_Mutation_p.G78W|HOMER3_ENST00000542541.2_Missense_Mutation_p.G78W|HOMER3_ENST00000594439.1_Missense_Mutation_p.G78W|HOMER3_ENST00000221222.11_Missense_Mutation_p.G78W			Q9NSC5	HOME3_HUMAN	homer homolog 3 (Drosophila)	78	WH1. {ECO:0000255|PROSITE- ProRule:PRU00410}.				G-protein coupled glutamate receptor signaling pathway (GO:0007216)|protein targeting (GO:0006605)	basal part of cell (GO:0045178)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)		p.G78W(1)		endometrium(3)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	10			Epithelial(12;0.0107)			GCCCACTGCCCGAACTTCTGG	0.577																																					p.G78W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G232T	19						.						126.0	117.0	120.0					19																	19049233		2203	4300	6503	18910233	SO:0001583	missense	9454	exon4			Y18894	CCDS12391.1, CCDS46022.1, CCDS46023.1	19p13.1	2008-02-05				ENSG00000051128			17514	protein-coding gene	gene with protein product		604800				10653696, 9808459	Standard	NM_004838		Approved	HOMER-3	uc002nkv.2	Q9NSC5		ENST00000539827.1:c.232G>T	19.37:g.19049233C>A	ENSP00000439937:p.Gly78Trp	Somatic		Capture	Illumina HiSeq	Phase_I	18910233	NM_001145721	E9PCW9|O14580|O95350|Q9NSB9|Q9NSC0|Q9NSC1	Missense_Mutation	SNP	ENST00000539827.1	37	CCDS12391.1	.	.	.	.	.	.	.	.	.	.	C	17.38	3.374779	0.61735	.	.	ENSG00000051128	ENST00000392351;ENST00000433218;ENST00000542541;ENST00000221222;ENST00000539827;ENST00000357832;ENST00000355887	D;D;D;D;D;D	0.98792	-5.14;-5.14;-5.14;-5.14;-5.14;-5.14	4.22	4.22	0.49857	EVH1 (3);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	D	0.99223	0.9730	M	0.90595	3.13	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.99007	1.0813	10	0.87932	D	0	.	15.7601	0.78073	0.0:1.0:0.0:0.0	.	78;78;78	E9PCW9;Q9NSC5-2;Q9NSC5	.;.;HOME3_HUMAN	W	78	ENSP00000376162:G78W;ENSP00000396154:G78W;ENSP00000446026:G78W;ENSP00000221222:G78W;ENSP00000439937:G78W;ENSP00000348150:G78W	ENSP00000221222:G78W	G	-	1	0	HOMER3	18910233	1.000000	0.71417	0.987000	0.45799	0.333000	0.28666	7.508000	0.81686	2.184000	0.69523	0.561000	0.74099	GGG		HOMER3-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464607.1		
GLTSCR1	29998	broad.mit.edu	37	19	48179165	48179165	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr19:48179165G>A	ENST00000396720.3	+	5	336	c.142G>A	c.(142-144)Ggt>Agt	p.G48S	CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_015711.3	NP_056526.3	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	48								p.G48S(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|pancreas(3)|prostate(4)|skin(2)	20		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		CTTCTATGAAGGTCCTGGGGT	0.607																																					p.G48S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G142A	19						.						35.0	31.0	32.0					19																	48179165		1568	3582	5150	52870977	SO:0001583	missense	29998	exon5			AF182077	CCDS46134.1	19q13.3	2012-11-29			ENSG00000063169	ENSG00000063169			4332	protein-coding gene	gene with protein product		605690				10708517	Standard	NM_015711		Approved		uc002phh.4	Q9NZM4		ENST00000396720.3:c.142G>A	19.37:g.48179165G>A	ENSP00000379946:p.Gly48Ser	Somatic		Capture	Illumina HiSeq	Phase_I	52870977	NM_015711	A8MW01	Missense_Mutation	SNP	ENST00000396720.3	37	CCDS46134.1	.	.	.	.	.	.	.	.	.	.	G	13.93	2.382996	0.42207	.	.	ENSG00000063169	ENST00000396720	T	0.64618	-0.11	3.84	3.84	0.44239	.	.	.	.	.	T	0.54711	0.1875	N	0.05280	-0.08	0.30618	N	0.758802	D	0.60160	0.987	P	0.58577	0.841	T	0.53865	-0.8378	9	0.21014	T	0.42	.	15.0285	0.71687	0.0:0.0:1.0:0.0	.	48	Q9NZM4	GSCR1_HUMAN	S	48	ENSP00000379946:G48S	ENSP00000379946:G48S	G	+	1	0	GLTSCR1	52870977	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.807000	0.47955	2.145000	0.66743	0.544000	0.68410	GGT		GLTSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465846.1	NM_015711	
SIGLEC7	27036	broad.mit.edu	37	19	51649120	51649120	+	Missense_Mutation	SNP	G	G	T	rs368786039		TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr19:51649120G>T	ENST00000317643.6	+	4	838	c.769G>T	c.(769-771)Gct>Tct	p.A257S	SIGLEC7_ENST00000305628.7_Missense_Mutation_p.A164S|SIGLEC7_ENST00000600577.1_Intron	NM_014385.2	NP_055200.1	Q9Y286	SIGL7_HUMAN	sialic acid binding Ig-like lectin 7	257	Ig-like C2-type 2.				cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)	p.A257S(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(11)|skin(2)|stomach(1)	29		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000836)|OV - Ovarian serous cystadenocarcinoma(262;0.00297)		AGCATCCACAGCTCTGGGGAA	0.517																																					p.A257S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G769T	19						.						154.0	153.0	153.0					19																	51649120		2203	4300	6503	56340932	SO:0001583	missense	27036	exon4			AF170485	CCDS12826.1, CCDS42601.1, CCDS62771.1	19q13.41	2014-03-20			ENSG00000168995	ENSG00000168995		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10876	protein-coding gene	gene with protein product		604410	"""sialic acid binding Ig-like lectin 19, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 2"""	SIGLEC19P, SIGLECP2		10567377	Standard	NM_001277201		Approved	SIGLEC-7, p75/AIRM1, QA79, CD328	uc002pvv.1	Q9Y286	OTTHUMG00000182895	ENST00000317643.6:c.769G>T	19.37:g.51649120G>T	ENSP00000323328:p.Ala257Ser	Somatic		Capture	Illumina HiSeq	Phase_I	56340932	NM_014385	Q9NZQ1|Q9UJ86|Q9UJ87|Q9Y502	Missense_Mutation	SNP	ENST00000317643.6	37	CCDS12826.1	.	.	.	.	.	.	.	.	.	.	.	0.977	-0.698191	0.03279	.	.	ENSG00000168995	ENST00000317643;ENST00000305628	T;T	0.15834	2.48;2.39	2.32	-4.63	0.03359	Immunoglobulin-like (1);	1.529970	0.04719	U	0.418972	T	0.08088	0.0202	L	0.33753	1.03	0.09310	N	1	B;B	0.32653	0.379;0.029	B;B	0.18263	0.021;0.017	T	0.26643	-1.0097	10	0.10902	T	0.67	.	2.963	0.05899	0.4206:0.0:0.3862:0.1932	.	164;257	Q9Y286-2;Q9Y286	.;SIGL7_HUMAN	S	257;164	ENSP00000323328:A257S;ENSP00000306757:A164S	ENSP00000306757:A164S	A	+	1	0	SIGLEC7	56340932	0.000000	0.05858	0.000000	0.03702	0.050000	0.14768	-0.091000	0.11146	-1.167000	0.02779	-0.489000	0.04712	GCT		SIGLEC7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464226.2	NM_016543	
SIGLEC6	946	broad.mit.edu	37	19	52033694	52033694	+	Missense_Mutation	SNP	C	C	T	rs201148057		TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr19:52033694C>T	ENST00000425629.3	-	4	905	c.751G>A	c.(751-753)Gca>Aca	p.A251T	SIGLEC6_ENST00000474054.1_5'Flank|SIGLEC6_ENST00000391797.3_Missense_Mutation_p.A240T|SIGLEC6_ENST00000436458.1_Intron|SIGLEC6_ENST00000346477.3_Intron|SIGLEC6_ENST00000343300.4_Missense_Mutation_p.A251T|SIGLEC6_ENST00000359982.4_Missense_Mutation_p.A262T	NM_001245.5	NP_001236.4	O43699	SIGL6_HUMAN	sialic acid binding Ig-like lectin 6	251	Ig-like C2-type 2.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)	p.A251T(1)		endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(15)|ovary(1)|stomach(1)	28		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00115)|OV - Ovarian serous cystadenocarcinoma(262;0.0165)		TTCCTACCTGCGCTGTTTCCT	0.562																																					p.A251T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G751A	19						.	C	,THR/ALA,THR/ALA,THR/ALA,,THR/ALA	0,3996		0,0,1998	57.0	58.0	58.0		,784,718,751,,751	0.7	0.2	19		58	4,8364		0,4,4180	yes	intron,missense,missense,missense,intron,missense	SIGLEC6	NM_001177547.1,NM_001177548.1,NM_001177549.1,NM_001245.5,NM_198845.4,NM_198846.4	,58,58,58,,58	0,4,6178	TT,TC,CC		0.0478,0.0,0.0324	,benign,benign,benign,,benign	,262/390,240/343,251/454,,251/354	52033694	4,12360	1998	4184	6182	56725506	SO:0001583	missense	946	exon4			D86358	CCDS12834.3, CCDS12835.3, CCDS12836.3, CCDS54307.1, CCDS54308.1, CCDS59417.1	19q13.3	2013-01-29			ENSG00000105492	ENSG00000105492		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10875	protein-coding gene	gene with protein product		604405		CD33L, CD33L1		9465907	Standard	NM_001245		Approved	OB-BP1, SIGLEC-6, CD327	uc002pwy.3	O43699	OTTHUMG00000133571	ENST00000425629.3:c.751G>A	19.37:g.52033694C>T	ENSP00000401502:p.Ala251Thr	Somatic		Capture	Illumina HiSeq	Phase_I	56725506	NM_001245	A8MV71|B2RTS8|C9JBE5|F8WA78|O15388|O43700	Missense_Mutation	SNP	ENST00000425629.3	37	CCDS12834.3	.	.	.	.	.	.	.	.	.	.	C	0.020	-1.443382	0.01089	0.0	4.78E-4	ENSG00000105492	ENST00000425629;ENST00000359982;ENST00000343300	T;T;T	0.46819	1.3;1.51;0.86	3.03	0.731	0.18277	Immunoglobulin-like (1);	1.520390	0.04750	N	0.424326	T	0.10121	0.0248	N	0.00098	-2.145	0.24851	N	0.992402	B;B;B;B	0.06786	0.0;0.001;0.001;0.001	B;B;B;B	0.04013	0.001;0.001;0.001;0.0	T	0.40346	-0.9568	10	0.02654	T	1	.	2.4475	0.04509	0.236:0.1404:0.0:0.6236	.	262;240;251;251	F8WA78;O43699-4;O43699-2;O43699	.;.;.;SIGL6_HUMAN	T	251;262;251	ENSP00000401502:A251T;ENSP00000353071:A262T;ENSP00000345907:A251T	ENSP00000345907:A251T	A	-	1	0	SIGLEC6	56725506	0.175000	0.23083	0.226000	0.23910	0.007000	0.05969	0.052000	0.14163	-0.009000	0.14296	-1.772000	0.00662	GCA		SIGLEC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257670.3	NM_001245	
ZNF468	90333	broad.mit.edu	37	19	53352388	53352388	+	Silent	SNP	A	A	G	rs536376293	byFrequency	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr19:53352388A>G	ENST00000595646.1	-	3	214	c.94T>C	c.(94-96)Tta>Cta	p.L32L	ZNF468_ENST00000390651.4_5'UTR|ZNF468_ENST00000396409.4_5'UTR|ZNF28_ENST00000594602.1_Intron|ZNF468_ENST00000243639.4_Silent_p.L32L			Q5VIY5	ZN468_HUMAN	zinc finger protein 468	32	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L32L(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|stomach(3)|urinary_tract(1)	23				GBM - Glioblastoma multiforme(134;0.0358)		TCCCTGTATAAAGTCCTCTGA	0.468													-|||	32	0.00638978	0.0129	0.0	5008	,	,		18523	0.001		0.0099	False		,,,				2504	0.0041				p.L32L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T94C	19						.						147.0	149.0	149.0					19																	53352388		2203	4300	6503	58044200	SO:0001819	synonymous_variant	90333	exon3			AK023558	CCDS33094.1, CCDS62781.1	19q13.41	2013-01-08				ENSG00000204604		"""Zinc fingers, C2H2-type"", ""-"""	33105	protein-coding gene	gene with protein product						16144304	Standard	NM_001277120		Approved		uc002qaf.3	Q5VIY5		ENST00000595646.1:c.94T>C	19.37:g.53352388A>G		Somatic		Capture	Illumina HiSeq	Phase_I	58044200	NM_001008801	A8MV20|Q5CZB8|Q5VIY4|Q68DI7	Silent	SNP	ENST00000595646.1	37	CCDS33094.1																																																																																				ZNF468-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463098.1	NM_001008801	
KIR3DL1	3811	broad.mit.edu	37	19	55317670	55317670	+	Intron	SNP	C	C	T	rs530171318		TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr19:55317670C>T	ENST00000538269.1	+	2	61				KIR2DL4_ENST00000346587.4_Missense_Mutation_p.P114L|KIR3DL1_ENST00000541392.1_Intron|KIR3DL1_ENST00000402254.2_Intron|KIR2DL4_ENST00000396293.1_Missense_Mutation_p.P114L|KIR2DL4_ENST00000396284.2_Missense_Mutation_p.P207L|KIR2DL4_ENST00000359085.4_Missense_Mutation_p.P209L|KIR2DL4_ENST00000345540.5_Missense_Mutation_p.P209L|KIR2DL4_ENST00000463062.1_3'UTR|KIR2DL4_ENST00000357494.4_Missense_Mutation_p.P209L			P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1						immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)	p.P209L(2)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		TGGTCAGACCCGAGTGACCCA	0.562																																					p.P209L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C626T	19						.						1.0	1.0	1.0					19																	55317670		159	343	502	60009482	SO:0001627	intron_variant	3805	exon4			L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000538269.1:c.35-11319C>T	19.37:g.55317670C>T		Somatic		Capture	Illumina HiSeq	Phase_I	60009482	NM_001080772	O43473|Q14946|Q16541	Missense_Mutation	SNP	ENST00000538269.1	37		.	.	.	.	.	.	.	.	.	.	C	8.086	0.773354	0.16051	.	.	ENSG00000189013	ENST00000396284;ENST00000359085;ENST00000345540;ENST00000357494;ENST00000396293;ENST00000346587;ENST00000396289	T;T;T;T;T;T;T	0.12465	2.68;2.68;2.68;2.68;2.68;2.68;2.68	1.01	1.01	0.19927	Immunoglobulin-like fold (1);	1.308390	0.05965	U	0.641286	T	0.41119	0.1145	M	0.91196	3.185	0.09310	N	1	P;D;D;D;D;P;D;D	0.89917	0.896;0.965;0.997;1.0;1.0;0.916;1.0;0.983	B;B;P;D;D;B;D;P	0.65573	0.172;0.215;0.767;0.917;0.917;0.223;0.936;0.48	T	0.09271	-1.0682	10	0.87932	D	0	.	5.3942	0.16261	0.0:1.0:0.0:0.0	.	209;207;209;209;209;114;209;114	Q99706;E7EST5;Q8N741;Q99706-4;Q99706-2;Q8N736;Q99706-3;Q8N738	KI2L4_HUMAN;.;.;.;.;.;.;.	L	207;209;209;209;114;114;207	ENSP00000379580:P207L;ENSP00000351988:P209L;ENSP00000339634:P209L;ENSP00000350088:P209L;ENSP00000379588:P114L;ENSP00000345331:P114L;ENSP00000379584:P207L	ENSP00000339634:P209L	P	+	2	0	KIR2DL4	60009482	0.001000	0.12720	0.009000	0.14445	0.002000	0.02628	0.735000	0.26115	0.858000	0.35431	0.194000	0.17425	CCG		KIR3DL1-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_013289	
NLRP5	126206	broad.mit.edu	37	19	56544941	56544941	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr19:56544941G>T	ENST00000390649.3	+	9	2481	c.2481G>T	c.(2479-2481)caG>caT	p.Q827H		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	827					cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)	p.Q827H(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		CTGGTGTGCAGCACCTCTGGA	0.502																																					p.Q827H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2481T	19						.						198.0	196.0	197.0					19																	56544941		1981	4177	6158	61236753	SO:0001583	missense	126206	exon9			AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.2481G>T	19.37:g.56544941G>T	ENSP00000375063:p.Gln827His	Somatic		Capture	Illumina HiSeq	Phase_I	61236753	NM_153447	A8MTY4|Q86W29	Missense_Mutation	SNP	ENST00000390649.3	37	CCDS12938.1	.	.	.	.	.	.	.	.	.	.	G	12.12	1.843216	0.32606	.	.	ENSG00000171487	ENST00000390649	T	0.17213	2.29	3.05	-5.48	0.02592	.	1.426140	0.05286	N	0.520162	T	0.22244	0.0536	L	0.48362	1.52	0.09310	N	1	D	0.60575	0.988	P	0.61800	0.894	T	0.27331	-1.0077	10	0.40728	T	0.16	.	0.5905	0.00727	0.3922:0.1197:0.1723:0.3158	.	827	P59047	NALP5_HUMAN	H	827	ENSP00000375063:Q827H	ENSP00000375063:Q827H	Q	+	3	2	NLRP5	61236753	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.015000	0.03637	-1.395000	0.02074	-0.145000	0.13849	CAG		NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313735.1	NM_153447	
FLG	2312	broad.mit.edu	37	1	152281382	152281382	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr1:152281382G>T	ENST00000368799.1	-	3	6015	c.5980C>A	c.(5980-5982)Cat>Aat	p.H1994N	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1994	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.H1994N(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCCTGTTCATGGGATGACGCA	0.567									Ichthyosis																												p.H1994N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5980A	1						.						605.0	482.0	524.0					1																	152281382		2203	4300	6503	150548006	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.5980C>A	1.37:g.152281382G>T	ENSP00000357789:p.His1994Asn	Somatic		Capture	Illumina HiSeq	Phase_I	150548006	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	g	10.34	1.323111	0.24080	.	.	ENSG00000143631	ENST00000368799	T	0.00808	5.67	3.71	1.71	0.24356	.	.	.	.	.	T	0.00384	0.0012	L	0.54323	1.7	0.09310	N	1	B	0.26400	0.148	B	0.22152	0.038	T	0.43766	-0.9371	9	0.27785	T	0.31	.	4.4873	0.11796	0.1299:0.2343:0.6358:0.0	.	1994	P20930	FILA_HUMAN	N	1994	ENSP00000357789:H1994N	ENSP00000357789:H1994N	H	-	1	0	FLG	150548006	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.076000	0.11412	0.845000	0.35118	0.586000	0.80456	CAT		FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
TMEM79	84283	broad.mit.edu	37	1	156255277	156255277	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr1:156255277C>T	ENST00000405535.2	+	2	431	c.260C>T	c.(259-261)cCg>cTg	p.P87L	TMEM79_ENST00000495881.1_3'UTR|TMEM79_ENST00000295694.5_Missense_Mutation_p.P87L|SMG5_ENST00000361813.5_5'Flank|TMEM79_ENST00000357501.2_Intron|SMG5_ENST00000368267.5_5'Flank	NM_032323.2	NP_115699.1	Q9BSE2	TMM79_HUMAN	transmembrane protein 79	87					cornification (GO:0070268)|cuticle development (GO:0042335)|epithelial cell maturation (GO:0002070)|establishment of skin barrier (GO:0061436)|hair follicle morphogenesis (GO:0031069)|positive regulation of epidermis development (GO:0045684)|regulated secretory pathway (GO:0045055)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)		p.P87L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|urinary_tract(1)	21	Hepatocellular(266;0.158)					CCCAGTGCTCCGTTCCCGGAT	0.622																																					p.P87L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C260T	1						.						48.0	53.0	51.0					1																	156255277		2203	4300	6503	154521901	SO:0001583	missense	84283	exon2			BC005094	CCDS1138.1	1q22	2014-04-22			ENSG00000163472	ENSG00000163472			28196	protein-coding gene	gene with protein product	"""mattrin"""	615531					Standard	NM_032323		Approved	MGC13102, FLJ16057, FLJ32254, MATT	uc009wrw.3	Q9BSE2	OTTHUMG00000019788	ENST00000405535.2:c.260C>T	1.37:g.156255277C>T	ENSP00000384748:p.Pro87Leu	Somatic		Capture	Illumina HiSeq	Phase_I	154521901	NM_032323	B2RE22|D3DVB8	Missense_Mutation	SNP	ENST00000405535.2	37	CCDS1138.1	.	.	.	.	.	.	.	.	.	.	C	13.36	2.214208	0.39102	.	.	ENSG00000163472	ENST00000295694;ENST00000405535	T;T	0.49432	0.78;0.78	5.84	3.99	0.46301	.	0.156505	0.39834	N	0.001249	T	0.16342	0.0393	L	0.36672	1.1	0.43334	D	0.995378	B	0.16396	0.017	B	0.16722	0.016	T	0.06427	-1.0827	9	.	.	.	-23.7621	6.2927	0.21069	0.0:0.6853:0.1519:0.1628	.	87	Q9BSE2	TMM79_HUMAN	L	87	ENSP00000295694:P87L;ENSP00000384748:P87L	.	P	+	2	0	TMEM79	154521901	0.000000	0.05858	0.618000	0.29105	0.953000	0.61014	0.159000	0.16442	0.815000	0.34398	0.655000	0.94253	CCG		TMEM79-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052101.1	NM_032323	
KIRREL	55243	broad.mit.edu	37	1	158061193	158061193	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr1:158061193C>T	ENST00000359209.6	+	11	1385	c.1318C>T	c.(1318-1320)Cgc>Tgc	p.R440C	KIRREL_ENST00000360089.4_Missense_Mutation_p.R276C|KIRREL_ENST00000392272.2_Missense_Mutation_p.R337C|KIRREL_ENST00000368172.1_Missense_Mutation_p.R254C|KIRREL_ENST00000368173.3_Missense_Mutation_p.R456C|KIRREL_ENST00000416935.2_Missense_Mutation_p.R340C			Q96J84	KIRR1_HUMAN	kin of IRRE like (Drosophila)	440	Ig-like C2-type 5.				excretion (GO:0007588)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of actin filament polymerization (GO:0030838)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|dendritic shaft (GO:0043198)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	myosin binding (GO:0017022)	p.R456C(1)|p.R276C(1)		NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(5)|skin(3)|stomach(1)	38	all_hematologic(112;0.0378)					GACCCTGGAACGCTATACAGT	0.562																																					p.R440C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1318T	1						.						114.0	109.0	111.0					1																	158061193		2203	4300	6503	156327817	SO:0001583	missense	55243	exon11			AK001707	CCDS1172.2, CCDS72952.1	1q21-q25	2013-01-29			ENSG00000183853	ENSG00000183853		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15734	protein-coding gene	gene with protein product	"""nephrin-like protein 1"""	607428				12424224	Standard	NM_001286349		Approved	NEPH1	uc001frn.4	Q96J84	OTTHUMG00000022438	ENST00000359209.6:c.1318C>T	1.37:g.158061193C>T	ENSP00000352138:p.Arg440Cys	Somatic		Capture	Illumina HiSeq	Phase_I	156327817	NM_018240	Q5W0F8|Q5XKC6|Q7Z696|Q7Z7N8|Q8TB15|Q9H9N1|Q9NVA5	Missense_Mutation	SNP	ENST00000359209.6	37	CCDS1172.2	.	.	.	.	.	.	.	.	.	.	C	20.3	3.972205	0.74246	.	.	ENSG00000183853	ENST00000360089;ENST00000368173;ENST00000392272;ENST00000359209;ENST00000416935;ENST00000368172	T;T;T;T;T;T	0.53206	4.06;4.06;0.63;4.06;0.63;0.63	5.13	4.16	0.48862	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.39210	N	0.001428	T	0.63034	0.2477	M	0.82056	2.57	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;0.999	T	0.67448	-0.5668	10	0.72032	D	0.01	-25.4807	13.3602	0.60652	0.1577:0.8423:0.0:0.0	.	340;276;254;440	B4DN67;Q5W0F9;Q5W0G0;Q96J84	.;.;.;KIRR1_HUMAN	C	276;456;337;440;340;254	ENSP00000353202:R276C;ENSP00000357155:R456C;ENSP00000376098:R337C;ENSP00000352138:R440C;ENSP00000389674:R340C;ENSP00000357154:R254C	ENSP00000352138:R440C	R	+	1	0	KIRREL	156327817	1.000000	0.71417	0.993000	0.49108	0.978000	0.69477	3.109000	0.50345	2.539000	0.85634	0.563000	0.77884	CGC		KIRREL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058342.3	NM_018240	
ACTL8	81569	broad.mit.edu	37	1	18152404	18152404	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr1:18152404G>A	ENST00000375406.1	+	3	707	c.491G>A	c.(490-492)cGc>cAc	p.R164H		NM_030812.2	NP_110439.2	Q9H568	ACTL8_HUMAN	actin-like 8	164					epithelial cell differentiation (GO:0030855)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.R164H(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(10)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	28		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00186)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;6.43e-06)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.00652)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)		CACCAGGGCCGCCCCTTGCCC	0.617											OREG0013157	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R164H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G491A	1						.						34.0	34.0	34.0					1																	18152404		2203	4300	6503	18024991	SO:0001583	missense	81569	exon3			AK057339	CCDS183.1	1p36.2-p35	2009-03-25			ENSG00000117148	ENSG00000117148			24018	protein-coding gene	gene with protein product	"""cancer/testis antigen 57"""						Standard	NM_030812		Approved	CT57	uc001bat.3	Q9H568	OTTHUMG00000002512	ENST00000375406.1:c.491G>A	1.37:g.18152404G>A	ENSP00000364555:p.Arg164His	Somatic	723	Capture	Illumina HiSeq	Phase_I	18024991	NM_030812	Q13104|Q96M75	Missense_Mutation	SNP	ENST00000375406.1	37	CCDS183.1	.	.	.	.	.	.	.	.	.	.	G	18.56	3.649480	0.67358	.	.	ENSG00000117148	ENST00000375406	D	0.94457	-3.43	5.1	-8.45	0.00946	.	0.560553	0.15168	N	0.276784	T	0.80864	0.4705	N	0.11560	0.145	0.09310	N	1	B	0.13594	0.008	B	0.10450	0.005	T	0.67130	-0.5748	10	0.87932	D	0	-16.3618	1.404	0.02276	0.4568:0.1918:0.1581:0.1933	.	164	Q9H568	ACTL8_HUMAN	H	164	ENSP00000364555:R164H	ENSP00000364555:R164H	R	+	2	0	ACTL8	18024991	0.010000	0.17322	0.000000	0.03702	0.007000	0.05969	1.426000	0.34870	-1.289000	0.02375	-0.947000	0.02670	CGC		ACTL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007143.1	NM_030812	
CD1E	913	broad.mit.edu	37	1	158325132	158325132	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr1:158325132C>T	ENST00000368167.3	+	3	637	c.398C>T	c.(397-399)gCc>gTc	p.A133V	CD1E_ENST00000368166.3_Intron|CD1E_ENST00000368161.3_Missense_Mutation_p.A133V|CD1E_ENST00000368160.3_Missense_Mutation_p.A133V|CD1E_ENST00000368165.3_Intron|CD1E_ENST00000368154.1_Intron|CD1E_ENST00000368155.3_Intron|CD1E_ENST00000434258.1_Missense_Mutation_p.A131V|CD1E_ENST00000368157.1_Intron|CD1E_ENST00000444681.2_Missense_Mutation_p.A34V|CD1E_ENST00000452291.2_Intron|CD1E_ENST00000368163.3_Missense_Mutation_p.A133V|CD1E_ENST00000368164.3_Intron|CD1E_ENST00000368156.1_Intron	NM_030893.3	NP_112155.2	P15812	CD1E_HUMAN	CD1e molecule	133					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	lipid binding (GO:0008289)	p.A133V(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(27)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|urinary_tract(1)	49	all_hematologic(112;0.0378)					AGAATGAATGCCCCACAAATC	0.463																																					p.A133V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C398T	1						.						133.0	127.0	129.0					1																	158325132		1830	4080	5910	156591756	SO:0001583	missense	913	exon3			AJ289111	CCDS41417.1, CCDS41418.1, CCDS41419.1, CCDS41420.1, CCDS41421.1, CCDS41422.1, CCDS53387.1, CCDS53388.1, CCDS53389.1, CCDS53390.1, CCDS53384.1, CCDS53385.1, CCDS53386.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158488	ENSG00000158488		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1638	protein-coding gene	gene with protein product		188411	"""CD1E antigen, e polypeptide"", ""CD1e antigen"""			10948205	Standard	NM_001042585		Approved		uc001fse.3	P15812	OTTHUMG00000017515	ENST00000368167.3:c.398C>T	1.37:g.158325132C>T	ENSP00000357149:p.Ala133Val	Somatic		Capture	Illumina HiSeq	Phase_I	156591756	NM_030893	B4DZV3|E7EP01|Q5TDJ9|Q5TDK3|Q5TDK4|Q5TDK5|Q5TDK6|Q5TDK8|Q5TDL1|Q712E4|Q712E5|Q712E6|Q712E7|Q712E8|Q712E9|Q712F0|Q712F1|Q712F2|Q712F3|Q712F4|Q712F5|Q96TD0|Q96TD1|Q9UMM1|Q9Y5M3	Missense_Mutation	SNP	ENST00000368167.3	37	CCDS41417.1	.	.	.	.	.	.	.	.	.	.	C	12.72	2.022749	0.35701	.	.	ENSG00000158488	ENST00000434258;ENST00000444681;ENST00000368167;ENST00000368163;ENST00000368160;ENST00000368161	T;T;T;T;T;T	0.06768	3.26;3.26;3.26;3.26;3.26;3.26	4.53	2.58	0.30949	MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	1.046570	0.07557	N	0.916484	T	0.02688	0.0081	L	0.48935	1.535	0.09310	N	1	B;B;B;B;B;B;B	0.22276	0.014;0.039;0.007;0.001;0.014;0.067;0.028	B;B;B;B;B;B;B	0.16722	0.004;0.002;0.001;0.001;0.002;0.006;0.016	T	0.44467	-0.9326	10	0.45353	T	0.12	0.2529	5.5003	0.16825	0.1964:0.6998:0.0:0.1037	.	34;131;34;133;133;133;133	B4E042;E7ET31;E7EP01;P15812-2;P15812;P15812-3;P15812-4	.;.;.;.;CD1E_HUMAN;.;.	V	131;34;133;133;133;133	ENSP00000401957:A131V;ENSP00000402906:A34V;ENSP00000357149:A133V;ENSP00000357145:A133V;ENSP00000357142:A133V;ENSP00000357143:A133V	ENSP00000357142:A133V	A	+	2	0	CD1E	156591756	0.001000	0.12720	0.000000	0.03702	0.030000	0.12068	1.083000	0.30815	0.601000	0.29879	0.563000	0.77884	GCC		CD1E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046353.3	NM_030893	
KIF21B	23046	broad.mit.edu	37	1	200967611	200967611	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr1:200967611A>C	ENST00000422435.2	-	14	2294	c.1978T>G	c.(1978-1980)Ttg>Gtg	p.L660V	KIF21B_ENST00000360529.5_Missense_Mutation_p.L660V|KIF21B_ENST00000332129.2_Missense_Mutation_p.L660V|KIF21B_ENST00000461742.2_Missense_Mutation_p.L660V	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	660					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						AGCGTCTGCAACCGCCGCTGG	0.567																																					p.L660V												.	.	0			c.T1978G	1						.						94.0	91.0	92.0					1																	200967611		2203	4300	6503	199234234	SO:0001583	missense	23046	exon14			BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.1978T>G	1.37:g.200967611A>C	ENSP00000411831:p.Leu660Val	None		Capture	Illumina HiSeq	Phase_I	199234234	NM_017596	B2RP62|B7ZMI0|Q5T4J3	Missense_Mutation	SNP	ENST00000422435.2	37	CCDS58056.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.261790	0.80358	.	.	ENSG00000116852	ENST00000332129;ENST00000360529;ENST00000461742;ENST00000422435;ENST00000539858	T;T;T;T	0.22743	1.94;1.94;1.94;1.94	5.31	4.4	0.53042	.	0.174794	0.39475	N	0.001353	T	0.48095	0.1481	M	0.84326	2.69	0.43863	D	0.996463	D;D;D;D	0.71674	0.997;0.997;0.997;0.998	D;D;D;D	0.78314	0.978;0.991;0.978;0.99	T	0.53655	-0.8408	10	0.72032	D	0.01	.	12.3325	0.55048	0.1423:0.0:0.8577:0.0	.	660;660;660;660	B7ZMI0;B2RP62;O75037;O75037-2	.;.;KI21B_HUMAN;.	V	660	ENSP00000328494:L660V;ENSP00000353724:L660V;ENSP00000433808:L660V;ENSP00000411831:L660V	ENSP00000328494:L660V	L	-	1	2	KIF21B	199234234	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.587000	0.60991	1.232000	0.43678	-0.154000	0.13518	TTG		KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382635.1	XM_371332	
RYR2	6262	broad.mit.edu	37	1	237780665	237780665	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr1:237780665T>C	ENST00000366574.2	+	38	6112	c.5795T>C	c.(5794-5796)tTt>tCt	p.F1932S	RYR2_ENST00000542537.1_Missense_Mutation_p.F1916S|RYR2_ENST00000360064.6_Missense_Mutation_p.F1930S	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1932	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.F1930S(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TCAGATGATTTTGTGGCTAAG	0.458																																					p.F1932S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T5795C	1						.						85.0	78.0	80.0					1																	237780665		1949	4150	6099	235847288	SO:0001583	missense	6262	exon38			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.5795T>C	1.37:g.237780665T>C	ENSP00000355533:p.Phe1932Ser	Somatic		Capture	Illumina HiSeq	Phase_I	235847288	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.293304	0.80914	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;T;T	0.72051	-0.62;-0.62;-0.62	5.39	5.39	0.77823	.	0.000000	0.64402	D	0.000003	T	0.79464	0.4450	M	0.70595	2.14	0.80722	D	1	D	0.63046	0.992	P	0.59487	0.858	T	0.81833	-0.0751	10	0.87932	D	0	.	10.6301	0.45532	0.1432:0.0:0.0:0.8568	.	1932	Q92736	RYR2_HUMAN	S	1932;1930;1916	ENSP00000355533:F1932S;ENSP00000353174:F1930S;ENSP00000443798:F1916S	ENSP00000353174:F1930S	F	+	2	0	RYR2	235847288	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.985000	0.63845	2.036000	0.60181	0.528000	0.53228	TTT		RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
ZNF496	84838	broad.mit.edu	37	1	247492716	247492716	+	Silent	SNP	G	G	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr1:247492716G>T	ENST00000294753.4	-	3	629	c.165C>A	c.(163-165)ggC>ggA	p.G55G	ZNF496_ENST00000366498.2_Silent_p.G55G	NM_032752.1	NP_116141.1	Q96IT1	ZN496_HUMAN	zinc finger protein 496	55	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear body (GO:0016604)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.G55G(1)		NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	36	all_cancers(71;0.000136)|all_epithelial(71;2.62e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)		OV - Ovarian serous cystadenocarcinoma(106;0.00703)			CCTCCCGGGGGCCCGCCGCCT	0.711																																					p.G55G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C165A	1						.						16.0	23.0	21.0					1																	247492716		2191	4288	6479	245559339	SO:0001819	synonymous_variant	84838	exon3			BC007263	CCDS1631.1	1q44	2013-01-09			ENSG00000162714	ENSG00000162714		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23713	protein-coding gene	gene with protein product		613911				12477932	Standard	NM_032752		Approved	ZKSCAN17, MGC15548, ZSCAN49	uc001ico.3	Q96IT1	OTTHUMG00000041164	ENST00000294753.4:c.165C>A	1.37:g.247492716G>T		Somatic		Capture	Illumina HiSeq	Phase_I	245559339	NM_032752	Q8TBS2	Silent	SNP	ENST00000294753.4	37	CCDS1631.1																																																																																				ZNF496-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098655.2	NM_032752	
AHDC1	27245	broad.mit.edu	37	1	27875387	27875387	+	Silent	SNP	A	A	T	rs148001847	byFrequency	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr1:27875387A>T	ENST00000247087.5	-	5	3836	c.3240T>A	c.(3238-3240)tcT>tcA	p.S1080S	AHDC1_ENST00000374011.2_Silent_p.S1080S			Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	1080							DNA binding (GO:0003677)	p.S1080S(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		CAGAGGCTGCAGAGGTGGCAG	0.682																																					p.S1080S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T3240A	1						.						12.0	14.0	13.0					1																	27875387		2176	4253	6429	27747974	SO:0001819	synonymous_variant	27245	exon6			AK125431	CCDS30652.1	1p36.13	2008-02-05			ENSG00000126705	ENSG00000126705			25230	protein-coding gene	gene with protein product		615790				8619474, 9110174	Standard	XM_005245848		Approved	DJ159A19.3, RP1-159A19.1	uc009vsy.3	Q5TGY3	OTTHUMG00000003398	ENST00000247087.5:c.3240T>A	1.37:g.27875387A>T		Somatic		Capture	Illumina HiSeq	Phase_I	27747974	NM_001029882	Q5TGY4|Q6PJK1|Q6ZUQ6|Q99769|Q9NUF5	Silent	SNP	ENST00000247087.5	37	CCDS30652.1																																																																																				AHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009523.3		
SYDE2	84144	broad.mit.edu	37	1	85634889	85634889	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr1:85634889T>G	ENST00000341460.5	-	5	2740	c.2691A>C	c.(2689-2691)ttA>ttC	p.L897F		NM_032184.1	NP_115560.1	Q5VT97	SYDE2_HUMAN	synapse defective 1, Rho GTPase, homolog 2 (C. elegans)	897	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				activation of Rho GTPase activity (GO:0032862)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)	p.L897F(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)	20				all cancers(265;0.0126)|Epithelial(280;0.0336)		GGAGTTCTCTTAAATAATCCT	0.343																																					p.L897F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2691C	1						.						109.0	104.0	105.0					1																	85634889		1826	4076	5902	85407477	SO:0001583	missense	84144	exon5			AL834286	CCDS44169.1	1p22.3	2008-02-05		2005-08-09	ENSG00000097096	ENSG00000097096			25841	protein-coding gene	gene with protein product							Standard	NM_032184		Approved	FLJ13815	uc009wcm.3	Q5VT97	OTTHUMG00000009956	ENST00000341460.5:c.2691A>C	1.37:g.85634889T>G	ENSP00000340594:p.Leu897Phe	Somatic		Capture	Illumina HiSeq	Phase_I	85407477	NM_032184	Q5VT96|Q8NDB8|Q9H8A6	Missense_Mutation	SNP	ENST00000341460.5	37	CCDS44169.1	.	.	.	.	.	.	.	.	.	.	T	17.18	3.323931	0.60634	.	.	ENSG00000097096	ENST00000341460	T	0.60424	0.19	5.33	1.72	0.24424	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.157337	0.40818	N	0.001017	T	0.48822	0.1521	L	0.46885	1.475	0.58432	D	0.999999	D	0.71674	0.998	D	0.73380	0.98	T	0.50600	-0.8809	10	0.42905	T	0.14	.	3.6019	0.08028	0.1806:0.3298:0.0:0.4896	.	897	Q5VT97	SYDE2_HUMAN	F	897	ENSP00000340594:L897F	ENSP00000340594:L897F	L	-	3	2	SYDE2	85407477	0.995000	0.38212	1.000000	0.80357	0.998000	0.95712	0.326000	0.19646	0.327000	0.23409	0.482000	0.46254	TTA		SYDE2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127989.2		
HFM1	164045	broad.mit.edu	37	1	91790280	91790280	+	Silent	SNP	T	T	G	rs375189931		TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr1:91790280T>G	ENST00000370425.3	-	21	2477	c.2379A>C	c.(2377-2379)acA>acC	p.T793T	HFM1_ENST00000462405.1_5'UTR|HFM1_ENST00000294696.5_Silent_p.T25T|HFM1_ENST00000370424.3_Silent_p.T472T	NM_001017975.3	NP_001017975.3	A2PYH4	HFM1_HUMAN	HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)	793	SEC63.				resolution of meiotic recombination intermediates (GO:0000712)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.T793T(1)		breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(33)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	75		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		ATTTCTTCACTGTCTCAAATG	0.308																																					p.T793T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A2379C	1						.						45.0	49.0	48.0					1																	91790280		2201	4296	6497	91562868	SO:0001819	synonymous_variant	164045	exon21			AB204867	CCDS30769.2	1p22.2	2008-03-26			ENSG00000162669	ENSG00000162669			20193	protein-coding gene	gene with protein product		615684	"""SEC63 domain containing 1"""	SEC63D1		14702039, 17286053	Standard	XM_006710395		Approved	MER3, FLJ39011, FLJ36760	uc001doa.4	A2PYH4	OTTHUMG00000010093	ENST00000370425.3:c.2379A>C	1.37:g.91790280T>G		Somatic		Capture	Illumina HiSeq	Phase_I	91562868	NM_001017975	B1B0B6|Q8N9Q0	Silent	SNP	ENST00000370425.3	37	CCDS30769.2	.	.	.	.	.	.	.	.	.	.	T	7.793	0.712014	0.15306	.	.	ENSG00000162669	ENST00000430465	.	.	.	5.43	-1.34	0.09143	.	.	.	.	.	T	0.23649	0.0572	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.27020	-1.0086	4	.	.	.	.	1.8124	0.03093	0.1944:0.1847:0.0999:0.521	.	.	.	.	P	49	.	.	Q	-	2	0	HFM1	91562868	1.000000	0.71417	0.987000	0.45799	0.895000	0.52256	0.498000	0.22530	-0.578000	0.05959	-2.929000	0.00088	CAG		HFM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316716.2	NM_001017975	
OR2M4	26245	broad.mit.edu	37	1	248402421	248402421	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr1:248402421G>A	ENST00000306687.1	+	1	191	c.191G>A	c.(190-192)aGt>aAt	p.S64N		NM_017504.1	NP_059974.1	Q96R27	OR2M4_HUMAN	olfactory receptor, family 2, subfamily M, member 4	64					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S64N(1)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(27)|skin(3)|upper_aerodigestive_tract(2)	50	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			TTCCTCCTCAGTCAACTGTCC	0.473																																					p.S64N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G191A	1						.						213.0	195.0	201.0					1																	248402421		2203	4300	6503	246469044	SO:0001583	missense	26245	exon1			X64992	CCDS31108.1	1q44	2012-08-09			ENSG00000171180	ENSG00000171180		"""GPCR / Class A : Olfactory receptors"""	8270	protein-coding gene	gene with protein product						1370859, 9119360	Standard	NM_017504		Approved	HTPCRX18, TPCR100, HSHTPCRX18, OST710	uc010pzh.2	Q96R27	OTTHUMG00000040456	ENST00000306687.1:c.191G>A	1.37:g.248402421G>A	ENSP00000306688:p.Ser64Asn	Somatic		Capture	Illumina HiSeq	Phase_I	246469044	NM_017504	Q15611|Q8NG82	Missense_Mutation	SNP	ENST00000306687.1	37	CCDS31108.1	.	.	.	.	.	.	.	.	.	.	g	14.93	2.681150	0.47886	.	.	ENSG00000171180	ENST00000306687	T	0.00402	7.56	3.19	2.25	0.28309	GPCR, rhodopsin-like superfamily (1);	0.271234	0.26213	N	0.025673	T	0.00784	0.0026	M	0.85945	2.785	0.09310	N	1	D	0.55385	0.971	P	0.55871	0.786	T	0.41610	-0.9499	10	0.66056	D	0.02	.	5.95	0.19239	0.0:0.1847:0.4379:0.3774	.	64	Q96R27	OR2M4_HUMAN	N	64	ENSP00000306688:S64N	ENSP00000306688:S64N	S	+	2	0	OR2M4	246469044	0.000000	0.05858	0.609000	0.28983	0.989000	0.77384	0.589000	0.23939	0.644000	0.30656	0.543000	0.68304	AGT		OR2M4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097352.1	NM_017504	
THBD	7056	broad.mit.edu	37	20	23029137	23029137	+	Silent	SNP	C	C	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr20:23029137C>T	ENST00000377103.2	-	1	1241	c.1005G>A	c.(1003-1005)ccG>ccA	p.P335P		NM_000361.2	NP_000352.1	P07204	TRBM_HUMAN	thrombomodulin	335	EGF-like 3; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				blood coagulation (GO:0007596)|female pregnancy (GO:0007565)|leukocyte migration (GO:0050900)|negative regulation of blood coagulation (GO:0030195)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of platelet activation (GO:0010544)|response to cAMP (GO:0051591)|response to lipopolysaccharide (GO:0032496)|response to X-ray (GO:0010165)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.P335P(1)		endometrium(2)|large_intestine(3)|ovary(1)|skin(1)	7	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)				Drotrecogin alfa(DB00055)|Ibuprofen(DB01050)	GCTGCGGACACGGACTGGGCT	0.652																																					p.P335P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1005A	20						.						42.0	37.0	38.0					20																	23029137		2203	4300	6503	22977137	SO:0001819	synonymous_variant	7056	exon1				CCDS13148.1	20p11.21	2014-09-17			ENSG00000178726	ENSG00000178726		"""CD molecules"""	11784	protein-coding gene	gene with protein product		188040					Standard	NM_000361		Approved	CD141	uc002wss.3	P07204	OTTHUMG00000032053	ENST00000377103.2:c.1005G>A	20.37:g.23029137C>T		Somatic		Capture	Illumina HiSeq	Phase_I	22977137	NM_000361	Q8IV29|Q9UC32	Silent	SNP	ENST00000377103.2	37	CCDS13148.1																																																																																				THBD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078307.2		
ZHX3	23051	broad.mit.edu	37	20	39830697	39830697	+	Splice_Site	SNP	C	C	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr20:39830697C>T	ENST00000309060.3	-	4	3275	c.2860G>A	c.(2860-2862)Gaa>Aaa	p.E954K	ZHX3_ENST00000432768.2_Splice_Site_p.E954K|ZHX3_ENST00000540170.1_Splice_Site_p.E954K|ZHX3_ENST00000544979.2_Intron|ZHX3_ENST00000559234.1_Splice_Site_p.E954K|ZHX3_ENST00000558993.1_Intron|ZHX3_ENST00000557816.1_Intron|ZHX3_ENST00000560361.1_Splice_Site_p.E954K			Q9H4I2	ZHX3_HUMAN	zinc fingers and homeoboxes 3	954					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of osteoblast differentiation (GO:0045669)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.E954K(1)		endometrium(2)|kidney(5)|large_intestine(8)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		Myeloproliferative disorder(115;0.00425)				GACTCCTTACCGAGCTGACGT	0.587																																					p.E954K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2860A	20						.						40.0	35.0	37.0					20																	39830697		2203	4300	6503	39264111	SO:0001630	splice_region_variant	23051	exon3			AB007855	CCDS13315.1	20q12	2012-03-09	2004-01-29	2004-01-30	ENSG00000174306	ENSG00000174306		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	15935	protein-coding gene	gene with protein product		609598	"""triple homeobox 1"""	TIX1		9455477	Standard	XM_005260343		Approved	KIAA0395	uc002xjs.1	Q9H4I2	OTTHUMG00000032481	ENST00000309060.3:c.2860+1G>A	20.37:g.39830697C>T		Somatic		Capture	Illumina HiSeq	Phase_I	39264111	NM_015035	E1P5W5|F5H820|O43145|Q6NUJ7	Missense_Mutation	SNP	ENST00000309060.3	37	CCDS13315.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	18.81|18.81|18.81	3.702347|3.702347|3.702347	0.68501|0.68501|0.68501	.|.|.	.|.|.	ENSG00000174306|ENSG00000174306|ENSG00000174306	ENST00000309060;ENST00000373263;ENST00000540170|ENST00000373262|ENST00000421422	T;T|.|.	0.10573|.|.	2.86;2.86|.|.	6.02|6.02|6.02	6.02|6.02|6.02	0.97574|0.97574|0.97574	.|.|.	1.298620|.|.	0.05374|.|.	N|.|.	0.536025|.|.	T|T|T	0.57533|0.57533|0.57533	0.2060|0.2060|0.2060	N|N|N	0.24115|0.24115|0.24115	0.695|0.695|0.695	0.50039|0.50039|0.50039	D|D|D	0.999849|0.999849|0.999849	D|.|.	0.76494|.|.	0.999|.|.	D|.|.	0.73380|.|.	0.98|.|.	T|T|T	0.48625|0.48625|0.48625	-0.9019|-0.9019|-0.9019	9|5|5	.|.|.	.|.|.	.|.|.	1.398|1.398|1.398	20.5407|20.5407|20.5407	0.99260|0.99260|0.99260	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	954|.|.	Q9H4I2|.|.	ZHX3_HUMAN|.|.	K|S|Q	954|732|662	ENSP00000362360:E954K;ENSP00000442290:E954K|.|.	.|.|.	E|G|R	-|-|-	1|1|2	0|0|0	ZHX3|ZHX3|ZHX3	39264111|39264111|39264111	0.997000|0.997000|0.997000	0.39634|0.39634|0.39634	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.993000|0.993000|0.993000	0.82548|0.82548|0.82548	3.942000|3.942000|3.942000	0.56614|0.56614|0.56614	2.865000|2.865000|2.865000	0.98341|0.98341|0.98341	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GAA|GGT|CGG		ZHX3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079262.3	NM_015035	Missense_Mutation
ADAMTS5	11096	broad.mit.edu	37	21	28338434	28338434	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr21:28338434C>T	ENST00000284987.5	-	1	398	c.277G>A	c.(277-279)Gcg>Acg	p.A93T		NM_007038.3	NP_008969.2	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 5	93					defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.A93T(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	72						CGGCCGCCCGCGTAGACGAGG	0.701																																					p.A93T	Esophageal Squamous(53;683 1080 10100 14424 45938)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G277A	21						.						53.0	51.0	52.0					21																	28338434		2188	4276	6464	27260305	SO:0001583	missense	11096	exon1			AF142099	CCDS13579.1	21q21.3	2008-07-31	2008-07-31		ENSG00000154736	ENSG00000154736		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	221	protein-coding gene	gene with protein product	"""aggrecanase-2"""	605007	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)"""			10438522	Standard	NM_007038		Approved	ADMP-2, ADAMTS11	uc002ymg.3	Q9UNA0	OTTHUMG00000078686	ENST00000284987.5:c.277G>A	21.37:g.28338434C>T	ENSP00000284987:p.Ala93Thr	Somatic		Capture	Illumina HiSeq	Phase_I	27260305	NM_007038	Q52LV4|Q9UKP2	Missense_Mutation	SNP	ENST00000284987.5	37	CCDS13579.1	.	.	.	.	.	.	.	.	.	.	C	17.51	3.407547	0.62399	.	.	ENSG00000154736	ENST00000284987	T	0.08896	3.04	4.17	3.23	0.37069	Peptidase M12B, propeptide (1);	0.306760	0.28504	N	0.015106	T	0.08846	0.0219	L	0.55017	1.72	0.29788	N	0.833417	P	0.52061	0.95	B	0.38327	0.271	T	0.11941	-1.0567	10	0.56958	D	0.05	.	12.2839	0.54781	0.1694:0.8306:0.0:0.0	.	93	Q9UNA0	ATS5_HUMAN	T	93	ENSP00000284987:A93T	ENSP00000284987:A93T	A	-	1	0	ADAMTS5	27260305	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.466000	0.53071	2.135000	0.66039	0.563000	0.77884	GCG		ADAMTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171648.1		
KRTAP26-1	388818	broad.mit.edu	37	21	31691743	31691743	+	Missense_Mutation	SNP	C	C	T	rs146155445		TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr21:31691743C>T	ENST00000360542.3	-	1	864	c.611G>A	c.(610-612)cGt>cAt	p.R204H		NM_203405.1	NP_981950.1	Q6PEX3	KR261_HUMAN	keratin associated protein 26-1	204						intermediate filament (GO:0005882)		p.R204H(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	16						GCAAGATGGACGACACGTGCT	0.488													C|||	1	0.000199681	0.0	0.0	5008	,	,		19323	0.001		0.0	False		,,,				2504	0.0				p.R204H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G611A	21						.						120.0	125.0	123.0					21																	31691743		2203	4300	6503	30613614	SO:0001583	missense	388818	exon1			AB096936	CCDS13588.1	21q22.11	2007-11-23			ENSG00000197683	ENSG00000197683		"""Keratin associated proteins"""	33760	protein-coding gene	gene with protein product							Standard	NM_203405		Approved		uc002ynw.3	Q6PEX3	OTTHUMG00000057766	ENST00000360542.3:c.611G>A	21.37:g.31691743C>T	ENSP00000353742:p.Arg204His	Somatic		Capture	Illumina HiSeq	Phase_I	30613614	NM_203405	B0RZD3	Missense_Mutation	SNP	ENST00000360542.3	37	CCDS13588.1	.	.	.	.	.	.	.	.	.	.	C	5.013	0.188013	0.09547	.	.	ENSG00000197683	ENST00000360542	T	0.04156	3.69	4.96	-0.0774	0.13719	.	0.275189	0.28521	N	0.015054	T	0.05823	0.0152	L	0.61218	1.895	0.26115	N	0.980634	B	0.25809	0.135	B	0.24394	0.053	T	0.24119	-1.0169	10	0.44086	T	0.13	-8.227	8.4899	0.33093	0.0:0.5785:0.0:0.4215	.	204	Q6PEX3	KR261_HUMAN	H	204	ENSP00000353742:R204H	ENSP00000353742:R204H	R	-	2	0	KRTAP26-1	30613614	0.813000	0.29090	0.104000	0.21259	0.023000	0.10783	-0.293000	0.08320	-0.139000	0.11414	-0.808000	0.03180	CGT		KRTAP26-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128218.1	NM_203405	
ITSN1	6453	broad.mit.edu	37	21	35237557	35237557	+	Silent	SNP	C	C	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr21:35237557C>A	ENST00000381318.3	+	32	4281	c.3993C>A	c.(3991-3993)cgC>cgA	p.R1331R	AP000304.12_ENST00000429238.1_Intron|ITSN1_ENST00000437442.2_Silent_p.R1326R|ITSN1_ENST00000381285.4_Silent_p.R1331R|ITSN1_ENST00000399326.3_3'UTR|ITSN1_ENST00000399367.3_Silent_p.R1326R	NM_003024.2	NP_003015.2	Q15811	ITSN1_HUMAN	intersectin 1 (SH3 domain protein)	1331	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|kinase activator activity (GO:0019209)|proline-rich region binding (GO:0070064)|protein complex scaffold (GO:0032947)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R1331R(1)		breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(26)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	67						CCTACATCCGCTTCTGCAGCC	0.592																																					p.R1331R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3993A	21						.						30.0	25.0	26.0					21																	35237557		2203	4300	6503	34159427	SO:0001819	synonymous_variant	6453	exon32			AF064244	CCDS33545.1, CCDS33546.1	21q22.1-q22.2	2013-01-10			ENSG00000205726	ENSG00000205726		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	6183	protein-coding gene	gene with protein product	"""SH3 domain protein-1A"", ""human intersectin-SH3 domain-containing protein SH3P17"", ""Src homology 3 domain-containing protein"", ""intersectin 1 short form variant, 11"", ""intersectin 1 short form variant 3"", ""intersectin short variant 12"""	602442		SH3D1A, ITSN		9799604, 9813051	Standard	NM_003024		Approved	SH3P17, MGC134948, MGC134949	uc002yta.1	Q15811	OTTHUMG00000065284	ENST00000381318.3:c.3993C>A	21.37:g.35237557C>A		Somatic		Capture	Illumina HiSeq	Phase_I	34159427	NM_003024	A7Y322|A8CTX8|A8CTY3|A8CTY7|A8D7D0|A8DCP3|B4DTM2|E7ERJ1|E9PE44|E9PG01|E9PHV2|O95216|Q0PW94|Q0PW95|Q0PW97|Q14BD3|Q1ED40|Q20BK3|Q9UET5|Q9UK60|Q9UNK1|Q9UNK2|Q9UQ92	Silent	SNP	ENST00000381318.3	37	CCDS33545.1	.	.	.	.	.	.	.	.	.	.	C	10.32	1.316824	0.23908	.	.	ENSG00000205726	ENST00000381284	.	.	.	5.92	3.01	0.34805	.	.	.	.	.	T	0.56307	0.1976	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52931	-0.8509	4	.	.	.	.	7.8253	0.29311	0.0:0.5785:0.2252:0.1963	.	.	.	.	I	67	.	.	L	+	1	0	ITSN1	34159427	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.921000	0.28718	1.510000	0.48803	-0.136000	0.14681	CTT		ITSN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000140070.4	NM_003024	
MAPK1	5594	broad.mit.edu	37	22	22162101	22162101	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr22:22162101C>A	ENST00000215832.6	-	2	342	c.154G>T	c.(154-156)Gct>Tct	p.A52S	MAPK1_ENST00000544786.1_Missense_Mutation_p.A52S|MAPK1_ENST00000398822.3_Missense_Mutation_p.A52S	NM_002745.4	NP_002736.3	P28482	MK01_HUMAN	mitogen-activated protein kinase 1	52	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|caveolin-mediated endocytosis (GO:0072584)|cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|chemotaxis (GO:0006935)|cytosine metabolic process (GO:0019858)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|labyrinthine layer blood vessel development (GO:0060716)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|mammary gland epithelial cell proliferation (GO:0033598)|MAPK cascade (GO:0000165)|MAPK import into nucleus (GO:0000189)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell differentiation (GO:0045596)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|Ras protein signal transduction (GO:0007265)|regulation of cytoskeleton organization (GO:0051493)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of protein stability (GO:0031647)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of stress-activated MAPK cascade (GO:0032872)|response to epidermal growth factor (GO:0070849)|response to estrogen (GO:0043627)|response to exogenous dsRNA (GO:0043330)|response to stress (GO:0006950)|response to toxic substance (GO:0009636)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein complex (GO:0043234)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MAP kinase activity (GO:0004707)|phosphatase binding (GO:0019902)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)	p.A52S(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Colorectal(54;0.105)	all_lung(157;3.89e-05)		READ - Rectum adenocarcinoma(21;0.0689)	Arsenic trioxide(DB01169)|Isoprenaline(DB01064)	TTCTTGATAGCTACTCGAACT	0.418																																					p.A52S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G154T	22						.						132.0	130.0	130.0					22																	22162101		2203	4300	6503	20492101	SO:0001583	missense	5594	exon2			M84489	CCDS13795.1	22q11.2	2014-09-17			ENSG00000100030	ENSG00000100030	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6871	protein-coding gene	gene with protein product		176948		PRKM2, PRKM1			Standard	NM_138957		Approved	ERK, ERK2, p41mapk, MAPK2	uc002zvn.3	P28482	OTTHUMG00000030508	ENST00000215832.6:c.154G>T	22.37:g.22162101C>A	ENSP00000215832:p.Ala52Ser	Somatic		Capture	Illumina HiSeq	Phase_I	20492101	NM_138957	A8CZ64	Missense_Mutation	SNP	ENST00000215832.6	37	CCDS13795.1	.	.	.	.	.	.	.	.	.	.	C	31	5.103698	0.94245	.	.	ENSG00000100030	ENST00000215832;ENST00000415911;ENST00000398822;ENST00000544786	T;T;T	0.73363	-0.74;-0.74;-0.74	4.53	4.53	0.55603	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.053549	0.85682	D	0.000000	D	0.90380	0.6989	H	0.95402	3.665	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93356	0.6722	10	0.87932	D	0	.	17.803	0.88593	0.0:1.0:0.0:0.0	.	52;52	A8CZ64;P28482	.;MK01_HUMAN	S	52;40;52;52	ENSP00000215832:A52S;ENSP00000381803:A52S;ENSP00000440842:A52S	ENSP00000215832:A52S	A	-	1	0	MAPK1	20492101	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	7.609000	0.82925	2.506000	0.84524	0.591000	0.81541	GCT		MAPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000075396.2		
ATP6V1C2	245973	broad.mit.edu	37	2	10917763	10917763	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr2:10917763A>G	ENST00000272238.4	+	11	987	c.878A>G	c.(877-879)aAg>aGg	p.K293R	ATP6V1C2_ENST00000381661.3_Intron	NM_001039362.1	NP_001034451.1	Q8NEY4	VATC2_HUMAN	ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2	293					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of Wnt signaling pathway (GO:0030177)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)|protein dimerization activity (GO:0046983)	p.K293R(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.15)|OV - Ovarian serous cystadenocarcinoma(76;0.152)		CCGGACCACAAGGTTAAGGTA	0.512																																					p.K293R	NSCLC(188;1042 2136 10807 16813 47705)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A878G	2						.						128.0	125.0	126.0					2																	10917763		1905	4131	6036	10835214	SO:0001583	missense	245973	exon11			AY039759	CCDS1674.1, CCDS42653.1	2p25.1	2010-04-21	2006-01-13		ENSG00000143882	ENSG00000143882		"""ATPases / V-type"""	18264	protein-coding gene	gene with protein product			"""ATPase, H+ transporting, lysosomal 42kD, V1 subunit C isoform 2"", ""ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C isoform 2"""			12384298	Standard	XR_426949		Approved	VMA5, ATP6C2	uc002ras.3	Q8NEY4	OTTHUMG00000090459	ENST00000272238.4:c.878A>G	2.37:g.10917763A>G	ENSP00000272238:p.Lys293Arg	Somatic		Capture	Illumina HiSeq	Phase_I	10835214	NM_001039362	Q96EL8	Missense_Mutation	SNP	ENST00000272238.4	37	CCDS42653.1	.	.	.	.	.	.	.	.	.	.	A	9.672	1.146925	0.21288	.	.	ENSG00000143882	ENST00000272238	T	0.43294	0.95	5.54	3.02	0.34903	.	0.233816	0.20745	U	0.086464	T	0.26231	0.0640	N	0.22421	0.69	0.80722	D	1	B	0.15473	0.013	B	0.20577	0.03	T	0.04767	-1.0928	10	0.23302	T	0.38	-6.6117	8.4152	0.32668	0.7096:0.0:0.0:0.2904	.	293	Q8NEY4	VATC2_HUMAN	R	293	ENSP00000272238:K293R	ENSP00000272238:K293R	K	+	2	0	ATP6V1C2	10835214	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.121000	0.31283	0.906000	0.36621	0.482000	0.46254	AAG		ATP6V1C2-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000323555.1	NM_144583	
RPL31	6160	broad.mit.edu	37	2	101622468	101622468	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr2:101622468A>T	ENST00000264258.3	+	4	882	c.281A>T	c.(280-282)gAg>gTg	p.E94V	RPL31_ENST00000409650.1_Missense_Mutation_p.E94V|RPL31_ENST00000409028.4_Missense_Mutation_p.E94V|RPL31_ENST00000409733.1_Missense_Mutation_p.E94V|RPL31_ENST00000409711.1_3'UTR|RPL31_ENST00000409320.3_Missense_Mutation_p.E94V|RPL31_ENST00000409038.1_Missense_Mutation_p.E94V	NM_000993.4	NP_000984.1	P62899	RL31_HUMAN	ribosomal protein L31	94					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)	p.E94V(1)		kidney(1)|large_intestine(2)|lung(1)|prostate(1)|urinary_tract(3)	8						AAACGTAATGAGGATGAAGAT	0.383																																					p.E94V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A281T	2						.						64.0	61.0	62.0					2																	101622468		2203	4300	6503	100988900	SO:0001583	missense	6160	exon4			X15940	CCDS2049.1, CCDS46373.1, CCDS46374.1	2q11.2	2011-04-06			ENSG00000071082	ENSG00000071082		"""L ribosomal proteins"""	10334	protein-coding gene	gene with protein product						2780320, 11875025	Standard	NM_000993		Approved	L31	uc010fiu.1	P62899	OTTHUMG00000130687	ENST00000264258.3:c.281A>T	2.37:g.101622468A>T	ENSP00000264258:p.Glu94Val	Somatic		Capture	Illumina HiSeq	Phase_I	100988900	NM_000993	B7Z4K2|D3DVJ4|P12947|Q53SQ5|Q6IRZ0|Q6LBJ6	Missense_Mutation	SNP	ENST00000264258.3	37	CCDS2049.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	27.6|27.6	4.844982|4.844982	0.91197|0.91197	.|.	.|.	ENSG00000071082|ENSG00000071082	ENST00000264258;ENST00000409028;ENST00000409320;ENST00000409733;ENST00000409650;ENST00000409038;ENST00000456292|ENST00000441435	.|.	.|.	.|.	5.14|5.14	5.14|5.14	0.70334|0.70334	Ribosomal protein L31e domain (2);|.	0.000000|.	0.85682|.	U|.	0.000000|.	D|D	0.85767|0.85767	0.5773|0.5773	M|M	0.93808|0.93808	3.46|3.46	0.80722|0.80722	D|D	1|1	B;P;B;B;B|.	0.52842|.	0.437;0.956;0.333;0.437;0.036|.	P;D;P;B;B|.	0.63381|.	0.511;0.914;0.461;0.317;0.169|.	D|D	0.89690|0.89690	0.3897|0.3897	9|5	0.72032|.	D|.	0.01|.	.|.	15.1389|15.1389	0.72595|0.72595	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	94;94;94;94;94|.	B7Z4E3;B7Z4C8;B7Z4K2;Q6IRZ0;P62899|.	.;.;.;.;RL31_HUMAN|.	V|W	94|82	.|.	ENSP00000264258:E94V|.	E|R	+|+	2|1	0|2	RPL31|RPL31	100988900|100988900	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.996000|0.996000	0.88848|0.88848	8.943000|8.943000	0.92975|0.92975	2.155000|2.155000	0.67459|0.67459	0.460000|0.460000	0.39030|0.39030	GAG|AGG		RPL31-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253182.3	NM_001098577	
MARCO	8685	broad.mit.edu	37	2	119739206	119739206	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr2:119739206G>A	ENST00000327097.4	+	10	1010	c.875G>A	c.(874-876)gGt>gAt	p.G292D	MARCO_ENST00000541757.1_Missense_Mutation_p.G214D	NM_006770.3	NP_006761.1	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure	292	Collagen-like.				apoptotic cell clearance (GO:0043277)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)	p.G292D(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(12)|lung(37)|ovary(4)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	70						GGTTTGGCTGGTTTTCCTGGA	0.443																																					p.G292D	GBM(8;18 374 7467 11269 32796)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G875A	2						.						74.0	79.0	77.0					2																	119739206		2203	4298	6501	119455676	SO:0001583	missense	8685	exon10			AF035819	CCDS2124.1	2q14.2	2011-10-11			ENSG00000019169	ENSG00000019169			6895	protein-coding gene	gene with protein product	"""scavenger receptor class A, member 2"""	604870				9468508, 7867067, 10331948	Standard	NM_006770		Approved	SCARA2	uc002tln.1	Q9UEW3	OTTHUMG00000131400	ENST00000327097.4:c.875G>A	2.37:g.119739206G>A	ENSP00000318916:p.Gly292Asp	Somatic		Capture	Illumina HiSeq	Phase_I	119455676	NM_006770	B4DW79|Q9Y5S3	Missense_Mutation	SNP	ENST00000327097.4	37	CCDS2124.1	.	.	.	.	.	.	.	.	.	.	G	16.48	3.135424	0.56828	.	.	ENSG00000019169	ENST00000327097;ENST00000410021;ENST00000541757	D;D	0.99619	-6.28;-6.28	5.2	5.2	0.72013	.	0.000000	0.64402	D	0.000001	D	0.99829	0.9923	H	0.99391	4.545	0.51767	D	0.999937	D	0.89917	1.0	D	0.97110	1.0	D	0.96734	0.9541	9	.	.	.	.	14.0999	0.65049	0.0:0.0:1.0:0.0	.	292	Q9UEW3	MARCO_HUMAN	D	292;292;214	ENSP00000318916:G292D;ENSP00000441769:G214D	.	G	+	2	0	MARCO	119455676	1.000000	0.71417	0.879000	0.34478	0.965000	0.64279	5.075000	0.64407	2.706000	0.92434	0.561000	0.74099	GGT		MARCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254190.2	NM_006770	
LRP1B	53353	broad.mit.edu	37	2	141356241	141356241	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr2:141356241C>T	ENST00000389484.3	-	43	8124	c.7153G>A	c.(7153-7155)Gga>Aga	p.G2385R		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2385					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.G2385R(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TCAATTTTTCCTAGACTGCCA	0.373										TSP Lung(27;0.18)																											p.G2385R	Colon(99;50 2074 2507 20106)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G7153A	2						.						153.0	138.0	143.0					2																	141356241		2203	4300	6503	141072711	SO:0001583	missense	53353	exon43			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.7153G>A	2.37:g.141356241C>T	ENSP00000374135:p.Gly2385Arg	Somatic		Capture	Illumina HiSeq	Phase_I	141072711	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.275844	0.80580	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.92545	-3.06	5.64	5.64	0.86602	Six-bladed beta-propeller, TolB-like (1);	0.069564	0.56097	U	0.000023	D	0.91818	0.7411	L	0.47716	1.5	0.53005	D	0.999963	P	0.50272	0.933	P	0.49665	0.618	D	0.88983	0.3409	10	0.17369	T	0.5	.	19.6983	0.96039	0.0:1.0:0.0:0.0	.	2385	Q9NZR2	LRP1B_HUMAN	R	2385;2323	ENSP00000374135:G2385R	ENSP00000374135:G2385R	G	-	1	0	LRP1B	141072711	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.990000	0.70595	2.669000	0.90835	0.460000	0.39030	GGA		LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
SCN1A	6323	broad.mit.edu	37	2	166894532	166894532	+	Silent	SNP	G	G	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr2:166894532G>A	ENST00000303395.4	-	15	2699	c.2700C>T	c.(2698-2700)atC>atT	p.I900I	SCN1A_ENST00000409050.1_Silent_p.I872I|SCN1A_ENST00000423058.2_Silent_p.I900I|AC010127.3_ENST00000595647.1_RNA|AC010127.3_ENST00000597623.1_RNA|AC010127.3_ENST00000599041.1_RNA|AC010127.3_ENST00000595268.1_RNA|SCN1A_ENST00000375405.3_Silent_p.I889I			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	900					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)	p.I889I(1)		NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AAATGAAGACGATGATGGCCA	0.468																																					p.I872I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2616T	2						.						110.0	106.0	107.0					2																	166894532		2203	4300	6503	166602778	SO:0001819	synonymous_variant	6323	exon15			AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.2700C>T	2.37:g.166894532G>A		Somatic		Capture	Illumina HiSeq	Phase_I	166602778	NM_001165964	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Silent	SNP	ENST00000303395.4	37	CCDS54413.1																																																																																				SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920	
ITGA6	3655	broad.mit.edu	37	2	173334098	173334098	+	Silent	SNP	T	T	C			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr2:173334098T>C	ENST00000264106.6	+	4	836	c.633T>C	c.(631-633)taT>taC	p.Y211Y	ITGA6_ENST00000409532.1_Silent_p.Y97Y|ITGA6_ENST00000409080.1_Silent_p.Y211Y|ITGA6_ENST00000343713.4_Silent_p.Y211Y|ITGA6_ENST00000375221.2_Silent_p.Y211Y|ITGA6_ENST00000264107.7_Silent_p.Y211Y			P23229	ITA6_HUMAN	integrin, alpha 6	211					amelogenesis (GO:0097186)|blood coagulation (GO:0007596)|brown fat cell differentiation (GO:0050873)|cell adhesion mediated by integrin (GO:0033627)|cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|cellular response to extracellular stimulus (GO:0031668)|cellular response to organic cyclic compound (GO:0071407)|digestive tract development (GO:0048565)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|nail development (GO:0035878)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|renal system development (GO:0072001)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|external side of plasma membrane (GO:0009897)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha6-beta4 complex (GO:0034676)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)	p.Y211Y(1)		NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	44			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			CGGGTACTTATAACTGGAAAG	0.358																																					p.Y211Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T633C	2						.						82.0	85.0	84.0					2																	173334098		2203	4300	6503	173042344	SO:0001819	synonymous_variant	3655	exon4				CCDS2249.1, CCDS46451.1	2q31.1	2010-09-20			ENSG00000091409	ENSG00000091409		"""CD molecules"", ""Integrins"""	6142	protein-coding gene	gene with protein product		147556					Standard	NM_001079818		Approved	CD49f	uc002uhp.1	P23229	OTTHUMG00000132277	ENST00000264106.6:c.633T>C	2.37:g.173334098T>C		Somatic		Capture	Illumina HiSeq	Phase_I	173042344	NM_000210	B2RMU9|B4DG69|B4DKB8|C4AM96|G5E9H1|Q08443|Q0MRC7|Q14646|Q16508|Q53RX7|Q59HB7|Q86VL6|Q9UCT1|Q9UN03	Silent	SNP	ENST00000264106.6	37																																																																																					ITGA6-201	KNOWN	basic	protein_coding	protein_coding			
CIR1	9541	broad.mit.edu	37	2	175213362	175213362	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr2:175213362G>A	ENST00000342016.3	-	10	1308	c.1216C>T	c.(1216-1218)Cgg>Tgg	p.R406W	CIR1_ENST00000362053.5_3'UTR	NM_004882.3	NP_004873.3	Q86X95	CIR1_HUMAN	corepressor interacting with RBPJ, 1	406	Arg/Ser-rich (RS domain).				mRNA processing (GO:0006397)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.R406W(1)		central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(5)|skin(1)	15						CGCTGTGCCCGTTTCCTTGTC	0.522																																					p.R406W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1216T	2						.						185.0	181.0	183.0					2																	175213362		2203	4300	6503	174921608	SO:0001583	missense	9541	exon10			AF098297	CCDS2256.1	2q31.1	2009-07-14			ENSG00000138433	ENSG00000138433			24217	protein-coding gene	gene with protein product	"""recepin"", ""CBF1 interacting corepressor"""	605228				15652350, 11222720, 9874765	Standard	NM_004882		Approved	CIR	uc002uim.3	Q86X95	OTTHUMG00000132338	ENST00000342016.3:c.1216C>T	2.37:g.175213362G>A	ENSP00000339723:p.Arg406Trp	Somatic		Capture	Illumina HiSeq	Phase_I	174921608	NM_004882	A6NFI6|A8K8M4|O95367|Q12804|Q4G1B9|Q6PJI4|Q8IWI2	Missense_Mutation	SNP	ENST00000342016.3	37	CCDS2256.1	.	.	.	.	.	.	.	.	.	.	G	5.265	0.234389	0.09969	.	.	ENSG00000138433	ENST00000342016	.	.	.	6.03	-4.3	0.03710	.	1.619920	0.03409	N	0.204427	T	0.25269	0.0614	L	0.28115	0.83	0.09310	N	1	B;B	0.11235	0.004;0.001	B;B	0.06405	0.002;0.001	T	0.15122	-1.0448	9	0.51188	T	0.08	.	1.1479	0.01779	0.4044:0.0985:0.2011:0.2961	.	406;406	A0PJI7;Q86X95	.;CIR1_HUMAN	W	406	.	ENSP00000339723:R406W	R	-	1	2	CIR1	174921608	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-1.121000	0.03270	-0.632000	0.05553	-0.252000	0.11476	CGG		CIR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255460.1	NM_004882	
CALCRL	10203	broad.mit.edu	37	2	188248019	188248019	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr2:188248019G>T	ENST00000409998.1	-	6	846	c.65C>A	c.(64-66)gCa>gAa	p.A22E	CALCRL_ENST00000392370.3_Missense_Mutation_p.A22E|CALCRL_ENST00000410068.1_Missense_Mutation_p.A22E|AC007319.1_ENST00000453517.1_RNA|AC007319.1_ENST00000412276.1_RNA			Q16602	CALRL_HUMAN	calcitonin receptor-like	22					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|angiogenesis (GO:0001525)|calcium ion transport (GO:0006816)|cAMP biosynthetic process (GO:0006171)|cellular response to sucrose stimulus (GO:0071329)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|heart development (GO:0007507)|negative regulation of inflammatory response (GO:0050728)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|regulation of muscle contraction (GO:0006937)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	adrenomedullin receptor activity (GO:0001605)|calcitonin gene-related polypeptide receptor activity (GO:0001635)|calcitonin receptor activity (GO:0004948)|G-protein coupled receptor activity (GO:0004930)|protein transporter activity (GO:0008565)	p.A22E(1)		endometrium(1)|large_intestine(7)|lung(21)|ovary(1)|prostate(1)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(96;0.227)			TTCTAATTCTGCTGTAACAAG	0.338																																					p.A22E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C65A	2						.						79.0	74.0	76.0					2																	188248019		2201	4297	6498	187956264	SO:0001583	missense	10203	exon5			U17473	CCDS2293.1	2q21.1-q21.3	2012-08-10			ENSG00000064989	ENSG00000064989		"""GPCR / Class B : Calcitonin receptors"""	16709	protein-coding gene	gene with protein product		114190				7818539, 8626685	Standard	NM_005795		Approved	CGRPR, CRLR	uc010frt.4	Q16602	OTTHUMG00000132636	ENST00000409998.1:c.65C>A	2.37:g.188248019G>T	ENSP00000386972:p.Ala22Glu	Somatic		Capture	Illumina HiSeq	Phase_I	187956264	NM_005795	A8K6G5|A8KAD3|Q53S02|Q53TS5	Missense_Mutation	SNP	ENST00000409998.1	37	CCDS2293.1	.	.	.	.	.	.	.	.	.	.	G	11.31	1.601669	0.28534	.	.	ENSG00000064989	ENST00000392370;ENST00000409998;ENST00000410068;ENST00000447403;ENST00000410102	T;T;T;T;T	0.59906	0.96;0.96;0.96;1.45;0.23	5.78	5.78	0.91487	.	0.000000	0.64402	D	0.000014	T	0.48447	0.1500	L	0.38175	1.15	0.44500	D	0.997443	B	0.11235	0.004	B	0.09377	0.004	T	0.33497	-0.9866	10	0.27082	T	0.32	.	15.5166	0.75830	0.0:0.0:1.0:0.0	.	22	Q16602	CALRL_HUMAN	E	22	ENSP00000376177:A22E;ENSP00000386972:A22E;ENSP00000387190:A22E;ENSP00000415626:A22E;ENSP00000386599:A22E	ENSP00000376177:A22E	A	-	2	0	CALCRL	187956264	0.937000	0.31787	1.000000	0.80357	0.116000	0.19942	3.197000	0.51028	2.736000	0.93811	0.557000	0.71058	GCA		CALCRL-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334648.1	NM_005795	
COL5A2	1290	broad.mit.edu	37	2	189927974	189927974	+	Missense_Mutation	SNP	C	C	T	rs529317104		TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr2:189927974C>T	ENST00000374866.3	-	27	2067	c.1793G>A	c.(1792-1794)cGt>cAt	p.R598H		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	598					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)	p.R598H(1)		NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			AGGACCTGGACGGCCATCTTC	0.512													C|||	1	0.000199681	0.0008	0.0	5008	,	,		14467	0.0		0.0	False		,,,				2504	0.0				p.R598H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1793A	2						.						64.0	71.0	69.0					2																	189927974		2203	4300	6503	189636219	SO:0001583	missense	1290	exon27			Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.1793G>A	2.37:g.189927974C>T	ENSP00000364000:p.Arg598His	Somatic		Capture	Illumina HiSeq	Phase_I	189636219	NM_000393	P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	ENST00000374866.3	37	CCDS33350.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.462907	0.84425	.	.	ENSG00000204262	ENST00000374866;ENST00000452536	D	0.94497	-3.44	4.82	3.92	0.45320	.	0.000000	0.46758	D	0.000275	D	0.95698	0.8601	L	0.50333	1.59	0.80722	D	1	D;D	0.76494	0.995;0.999	P;D	0.72982	0.63;0.979	D	0.94809	0.7977	9	.	.	.	.	14.6218	0.68592	0.1469:0.8531:0.0:0.0	.	238;598	Q5PR22;P05997	.;CO5A2_HUMAN	H	598;238	ENSP00000364000:R598H	.	R	-	2	0	COL5A2	189636219	1.000000	0.71417	0.789000	0.31954	0.775000	0.43874	5.687000	0.68219	1.126000	0.42016	0.460000	0.39030	CGT		COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	NM_000393	
C2orf69	205327	broad.mit.edu	37	2	200789807	200789807	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr2:200789807G>A	ENST00000319974.5	+	2	539	c.356G>A	c.(355-357)cGt>cAt	p.R119H	C2orf69_ENST00000491721.1_Intron	NM_153689.5	NP_710156.3	Q8N8R5	CB069_HUMAN	chromosome 2 open reading frame 69	119						extracellular region (GO:0005576)		p.R119H(1)		central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(2)|stomach(1)|urinary_tract(1)	11						ATTATGACTCGTCATCCTGAG	0.308																																					p.R119H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G356A	2						.						31.0	29.0	30.0					2																	200789807		1819	4072	5891	200498052	SO:0001583	missense	205327	exon2				CCDS46482.1	2q33.1	2008-08-08			ENSG00000178074	ENSG00000178074			26799	protein-coding gene	gene with protein product	"""hypothetical protein FLJ38973"""					12477932	Standard	NM_153689		Approved	FLJ38973	uc010zhb.2	Q8N8R5	OTTHUMG00000154480	ENST00000319974.5:c.356G>A	2.37:g.200789807G>A	ENSP00000312770:p.Arg119His	Somatic		Capture	Illumina HiSeq	Phase_I	200498052	NM_153689	Q8NE30	Missense_Mutation	SNP	ENST00000319974.5	37	CCDS46482.1	.	.	.	.	.	.	.	.	.	.	G	9.443	1.088546	0.20390	.	.	ENSG00000178074	ENST00000319974	.	.	.	5.89	1.3	0.21679	.	0.557695	0.20894	N	0.083778	T	0.37210	0.0995	L	0.50333	1.59	0.26619	N	0.972681	B	0.06786	0.001	B	0.06405	0.002	T	0.28808	-1.0032	9	0.14252	T	0.57	-1.5465	11.5557	0.50745	0.2442:0.0:0.7558:0.0	.	119	Q8N8R5	CB069_HUMAN	H	119	.	ENSP00000312770:R119H	R	+	2	0	C2orf69	200498052	0.467000	0.25831	0.997000	0.53966	0.999000	0.98932	0.767000	0.26575	0.027000	0.15297	0.655000	0.94253	CGT		C2orf69-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335446.1	NM_153689	
ERBB4	2066	broad.mit.edu	37	2	212615365	212615365	+	Splice_Site	SNP	A	A	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr2:212615365A>T	ENST00000342788.4	-	5	931	c.621T>A	c.(619-621)acT>acA	p.T207T	ERBB4_ENST00000436443.1_Splice_Site_p.T207T|ERBB4_ENST00000402597.1_Splice_Site_p.T207T|ERBB4_ENST00000484474.1_5'UTR	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	207	Cys-rich.				cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.T207T(1)		NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	AACACTTACAAGTCTGGCAAT	0.453										TSP Lung(8;0.080)																											p.T207T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T621A	2						.						137.0	111.0	120.0					2																	212615365		2203	4300	6503	212323610	SO:0001630	splice_region_variant	2066	exon5			L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.622+1T>A	2.37:g.212615365A>T		Somatic		Capture	Illumina HiSeq	Phase_I	212323610	NM_005235	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Silent	SNP	ENST00000342788.4	37	CCDS2394.1	.	.	.	.	.	.	.	.	.	.	A	11.47	1.647093	0.29246	.	.	ENSG00000178568	ENST00000260943	.	.	.	5.58	-5.0	0.03001	.	.	.	.	.	T	0.38054	0.1026	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38329	-0.9666	4	.	.	.	.	2.2566	0.04057	0.1196:0.2141:0.3493:0.317	.	.	.	.	H	207	.	.	L	-	2	0	ERBB4	212323610	0.997000	0.39634	0.967000	0.41034	0.986000	0.74619	0.290000	0.18975	-0.814000	0.04352	-0.341000	0.08007	CTT		ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599	Silent
SGPP2	130367	broad.mit.edu	37	2	223339308	223339308	+	Missense_Mutation	SNP	G	G	A	rs138702204		TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr2:223339308G>A	ENST00000321276.7	+	2	327	c.241G>A	c.(241-243)Gtg>Atg	p.V81M		NM_152386.2	NP_689599.2	Q8IWX5	SGPP2_HUMAN	sphingosine-1-phosphate phosphatase 2	81					dephosphorylation (GO:0016311)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	sphingosine-1-phosphate phosphatase activity (GO:0042392)	p.V81M(2)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	18		Renal(207;0.0376)		Epithelial(121;2.08e-09)|all cancers(144;9.25e-07)|LUSC - Lung squamous cell carcinoma(224;0.011)|Lung(261;0.0143)		GAAGTACGTCGTGAAGAATTA	0.363													G|||	1	0.000199681	0.0	0.0	5008	,	,		18637	0.0		0.001	False		,,,				2504	0.0				p.V81M												.	.	2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	c.G241A	2						.	G	MET/VAL	1,4403	2.1+/-5.4	0,1,2201	140.0	142.0	141.0		241	5.5	1.0	2	dbSNP_134	141	1,8599	1.2+/-3.3	0,1,4299	no	missense	SGPP2	NM_152386.2	21	0,2,6500	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging	81/400	223339308	2,13002	2202	4300	6502	223047552	SO:0001583	missense	130367	exon2			AF542512	CCDS2453.1	2q36.3	2010-05-26	2010-05-26		ENSG00000163082	ENSG00000163082			19953	protein-coding gene	gene with protein product		612827				12411432	Standard	NM_152386		Approved	SPP2, FLJ39004	uc010zlo.2	Q8IWX5	OTTHUMG00000133156	ENST00000321276.7:c.241G>A	2.37:g.223339308G>A	ENSP00000315137:p.Val81Met	Somatic		Capture	Illumina HiSeq	Phase_I	223047552	NM_152386	A3KPB4|Q8N8Q6	Missense_Mutation	SNP	ENST00000321276.7	37	CCDS2453.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	23.0	4.366997	0.82463	2.27E-4	1.16E-4	ENSG00000163082	ENST00000321276	.	.	.	5.52	5.52	0.82312	.	0.000000	0.64402	D	0.000004	T	0.79592	0.4472	M	0.71206	2.165	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.80999	-0.1131	9	0.72032	D	0.01	-19.3372	19.4318	0.94772	0.0:0.0:1.0:0.0	.	81	Q8IWX5	SGPP2_HUMAN	M	81	.	ENSP00000315137:V81M	V	+	1	0	SGPP2	223047552	1.000000	0.71417	0.958000	0.39756	0.916000	0.54674	7.558000	0.82253	2.582000	0.87167	0.561000	0.74099	GTG		SGPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256856.2		
CAD	790	broad.mit.edu	37	2	27445074	27445074	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr2:27445074G>A	ENST00000403525.1	+	4	509	c.365G>A	c.(364-366)cGg>cAg	p.R122Q	CAD_ENST00000264705.4_Missense_Mutation_p.R122Q			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)	p.R122Q(1)		NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTAGACACTCGGGAGCTGACC	0.512																																					p.R122Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G365A	2						.						80.0	74.0	76.0					2																	27445074		2203	4300	6503	27298578	SO:0001583	missense	790	exon4			D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.365G>A	2.37:g.27445074G>A	ENSP00000384510:p.Arg122Gln	Somatic		Capture	Illumina HiSeq	Phase_I	27298578	NM_004341	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	ENST00000403525.1	37		.	.	.	.	.	.	.	.	.	.	G	34	5.371296	0.95923	.	.	ENSG00000084774	ENST00000264705;ENST00000403525	D;D	0.98531	-4.98;-4.98	5.0	5.0	0.66597	Carbamoyl-phosphate synthase, small subunit, N-terminal (3);	0.000000	0.64402	D	0.000001	D	0.99459	0.9808	H	0.99197	4.465	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.979	D	0.97964	1.0339	10	0.87932	D	0	-0.0902	16.124	0.81380	0.0:0.0:1.0:0.0	.	122;122	F8VPD4;P27708	.;PYR1_HUMAN	Q	122	ENSP00000264705:R122Q;ENSP00000384510:R122Q	ENSP00000264705:R122Q	R	+	2	0	CAD	27298578	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.928000	0.92853	2.480000	0.83734	0.491000	0.48974	CGG		CAD-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000324970.1		
ALMS1	7840	broad.mit.edu	37	2	73717195	73717195	+	Silent	SNP	G	G	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr2:73717195G>A	ENST00000264448.6	+	10	8217	c.8106G>A	c.(8104-8106)ccG>ccA	p.P2702P	ALMS1_ENST00000409009.1_Silent_p.P2660P|AC096546.1_ENST00000408160.1_RNA	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2702					endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.P2702P(1)		breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						CACAAATGCCGTCCCCAGAAC	0.408																																					p.P2702P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G8106A	2						.						161.0	149.0	153.0					2																	73717195		1864	4108	5972	73570703	SO:0001819	synonymous_variant	7840	exon10			AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.8106G>A	2.37:g.73717195G>A		Somatic		Capture	Illumina HiSeq	Phase_I	73570703	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Silent	SNP	ENST00000264448.6	37	CCDS42697.1																																																																																				ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
LOXL3	84695	broad.mit.edu	37	2	74762841	74762841	+	Silent	SNP	G	G	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr2:74762841G>A	ENST00000264094.3	-	8	1361	c.1290C>T	c.(1288-1290)gtC>gtT	p.V430V	LOXL3_ENST00000409986.1_Silent_p.V285V|LOXL3_ENST00000393937.2_Silent_p.V285V|LOXL3_ENST00000409249.1_Intron|LOXL3_ENST00000409549.1_Intron	NM_032603.2	NP_115992.1	P58215	LOXL3_HUMAN	lysyl oxidase-like 3	430	SRCR 4. {ECO:0000255|PROSITE- ProRule:PRU00196}.				epithelial to mesenchymal transition (GO:0001837)|negative regulation of transcription, DNA-templated (GO:0045892)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|nucleus (GO:0005634)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)	p.V430V(1)		endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30						TTTGCACCTCGACTCGCCCCT	0.622																																					p.V430V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1290T	2						.						42.0	50.0	47.0					2																	74762841		2202	4300	6502	74616349	SO:0001819	synonymous_variant	84695	exon8			AF282619	CCDS1953.1, CCDS74527.1	2p13	2008-05-23			ENSG00000115318	ENSG00000115318			13869	protein-coding gene	gene with protein product		607163				11386757	Standard	NM_032603		Approved		uc002smp.1	P58215	OTTHUMG00000129953	ENST00000264094.3:c.1290C>T	2.37:g.74762841G>A		Somatic		Capture	Illumina HiSeq	Phase_I	74616349	NM_032603	D6W5J1|Q2EHP2|Q6IPL7|Q96RS1	Silent	SNP	ENST00000264094.3	37	CCDS1953.1	.	.	.	.	.	.	.	.	.	.	G	5.458	0.269622	0.10349	.	.	ENSG00000115318	ENST00000420535	.	.	.	5.11	-10.2	0.00374	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.804	0.08770	0.2751:0.3992:0.1943:0.1314	.	.	.	.	X	157	.	.	R	-	1	2	LOXL3	74616349	0.000000	0.05858	0.043000	0.18650	0.990000	0.78478	-2.218000	0.01219	-3.807000	0.00104	-0.471000	0.05019	CGA		LOXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252215.1	NM_032603	
CTNNA2	1496	broad.mit.edu	37	2	80646700	80646700	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr2:80646700C>A	ENST00000402739.4	+	8	1269	c.1264C>A	c.(1264-1266)Cgt>Agt	p.R422S	CTNNA2_ENST00000343114.3_Missense_Mutation_p.R101S|CTNNA2_ENST00000540488.1_Missense_Mutation_p.R422S|CTNNA2_ENST00000466387.1_Missense_Mutation_p.R422S|CTNNA2_ENST00000496558.1_Missense_Mutation_p.R422S|CTNNA2_ENST00000361291.4_Missense_Mutation_p.R456S|CTNNA2_ENST00000541047.1_Missense_Mutation_p.R422S	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	422					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)	p.R422S(1)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						CCAAGTTTTCCGTGAGCATGC	0.443																																					p.R423S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1267A	2						.						103.0	103.0	103.0					2																	80646700		2035	4233	6268	80500211	SO:0001583	missense	1496	exon9				CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.1264C>A	2.37:g.80646700C>A	ENSP00000384638:p.Arg422Ser	Somatic		Capture	Illumina HiSeq	Phase_I	80500211	NM_004389	B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	ENST00000402739.4	37		.	.	.	.	.	.	.	.	.	.	C	21.6	4.179388	0.78564	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488;ENST00000343114;ENST00000409550	T;T;T;T;T;T;T;T	0.36520	1.25;1.25;1.25;1.25;1.25;1.25;1.25;1.25	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.36744	0.0978	L	0.58925	1.835	0.80722	D	1	B;P;P;P	0.43662	0.26;0.814;0.55;0.55	B;B;B;B	0.34931	0.078;0.192;0.188;0.188	T	0.15607	-1.0431	9	.	.	.	.	20.5568	0.99304	0.0:1.0:0.0:0.0	.	54;422;422;422	F6KRI5;P26232;P26232-3;P26232-2	.;CTNA2_HUMAN;.;.	S	422;422;456;422;422;422;101;87	ENSP00000418191:R422S;ENSP00000419295:R422S;ENSP00000355398:R456S;ENSP00000384638:R422S;ENSP00000444675:R422S;ENSP00000441705:R422S;ENSP00000341500:R101S;ENSP00000386587:R87S	.	R	+	1	0	CTNNA2	80500211	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.818000	0.86416	2.861000	0.98227	0.655000	0.94253	CGT		CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000328511.4	NM_004389	
SP140L	93349	broad.mit.edu	37	2	231249989	231249989	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr2:231249989A>G	ENST00000415673.2	+	9	840	c.754A>G	c.(754-756)Atg>Gtg	p.M252V	SP140L_ENST00000243810.6_Missense_Mutation_p.M252V|SP140L_ENST00000396563.4_Missense_Mutation_p.M252V|SP140L_ENST00000444636.1_Missense_Mutation_p.M252V	NM_138402.4	NP_612411.4	Q9H930	SP14L_HUMAN	SP140 nuclear body protein-like	252						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.M252V(1)		central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(7)|prostate(1)|skin(1)	20						GAAGGCGAACATGAATCTGAA	0.453																																					p.M252V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A754G	2						.						110.0	110.0	110.0					2																	231249989		1875	4106	5981	230958233	SO:0001583	missense	93349	exon9			BC004921	CCDS46538.1	2q37.1	2013-01-28			ENSG00000185404	ENSG00000185404		"""Zinc fingers, PHD-type"""	25105	protein-coding gene	gene with protein product						12477932	Standard	NM_138402		Approved		uc010fxm.1	Q9H930	OTTHUMG00000153730	ENST00000415673.2:c.754A>G	2.37:g.231249989A>G	ENSP00000397911:p.Met252Val	Somatic		Capture	Illumina HiSeq	Phase_I	230958233	NM_138402	Q2M375|Q4ZG65|Q9BSP3	Missense_Mutation	SNP	ENST00000415673.2	37	CCDS46538.1	.	.	.	.	.	.	.	.	.	.	a	0	-2.762970	0.00082	.	.	ENSG00000185404	ENST00000444636;ENST00000415673;ENST00000243810;ENST00000396563	T;T;T;D	0.82433	-1.45;-1.11;-1.45;-1.61	2.24	-3.23	0.05109	.	.	.	.	.	T	0.50377	0.1612	N	0.01576	-0.805	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.50311	-0.8843	9	0.02654	T	1	.	7.0823	0.25237	0.5594:0.0:0.4406:0.0	.	252;252	Q9H930-2;Q9H930-4	.;.	V	252	ENSP00000395195:M252V;ENSP00000397911:M252V;ENSP00000243810:M252V;ENSP00000379811:M252V	ENSP00000243810:M252V	M	+	1	0	SP140L	230958233	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.249000	0.08842	-0.890000	0.03945	-1.388000	0.01159	ATG		SP140L-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374538.1	NM_138402	
ATP2B2	491	broad.mit.edu	37	3	10413731	10413732	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	-	-	-	T	-	-	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr3:10413731_10413732insT	ENST00000352432.4	-	11	1489_1490	c.1420_1421insA	c.(1420-1422)atgfs	p.M474fs	ATP2B2_ENST00000343816.4_Frame_Shift_Ins_p.M460fs|ATP2B2_ENST00000360273.2_Frame_Shift_Ins_p.M474fs|ATP2B2_ENST00000397077.1_Frame_Shift_Ins_p.M429fs|ATP2B2_ENST00000383800.4_Frame_Shift_Ins_p.M429fs			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	474					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)	p.M429fs*15(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						GTCCTTCATCATTTTCTGGGAG	0.564																																					p.M474fs	Ovarian(125;1619 1709 15675 19819 38835)											.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1421_1422insA	3						.																																			10388732	SO:0001589	frameshift_variant	491	exon12			X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.1421dupA	3.37:g.10413735_10413735dupT	ENSP00000324172:p.Met474fs	Somatic		Capture	Illumina HiSeq	Phase_I	10388731	NM_001001331	O00766|Q12994|Q16818	Frame_Shift_Ins	INS	ENST00000352432.4	37	CCDS33701.1																																																																																				ATP2B2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250576.2	NM_001683	
TIGIT	201633	broad.mit.edu	37	3	114014634	114014634	+	Missense_Mutation	SNP	G	G	A	rs146935299		TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr3:114014634G>A	ENST00000486257.1	+	3	561	c.304G>A	c.(304-306)Gat>Aat	p.D102N	TIGIT_ENST00000481065.1_Missense_Mutation_p.D169N|TIGIT_ENST00000383671.3_Missense_Mutation_p.D102N			Q495A1	TIGIT_HUMAN	T cell immunoreceptor with Ig and ITIM domains	102	Ig-like V-type.				negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|positive regulation of interleukin-10 production (GO:0032733)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.D102N(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(7)|prostate(1)	17						GACCGTGAACGATACAGGGGA	0.567													G|||	1	0.000199681	0.0	0.0	5008	,	,		20059	0.001		0.0	False		,,,				2504	0.0				p.D102N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G304A	3						.	G	ASN/ASP	0,4406		0,0,2203	80.0	76.0	77.0		304	4.7	1.0	3	dbSNP_134	77	3,8597	3.0+/-9.4	0,3,4297	no	missense	TIGIT	NM_173799.3	23	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	probably-damaging	102/245	114014634	3,13003	2203	4300	6503	115497324	SO:0001583	missense	201633	exon2			AK097192	CCDS2980.1	3q13.31	2013-01-11	2008-10-13	2008-10-13	ENSG00000181847	ENSG00000181847		"""Immunoglobulin superfamily / V-set domain containing"""	26838	protein-coding gene	gene with protein product		612859	"""V-set and immunoglobulin domain containing 9"", ""V-set and transmembrane domain containing 3"""	VSIG9, VSTM3		19011627	Standard	NM_173799		Approved	FLJ39873, DKFZp667A205	uc003ebg.2	Q495A1	OTTHUMG00000159331	ENST00000486257.1:c.304G>A	3.37:g.114014634G>A	ENSP00000419085:p.Asp102Asn	Somatic		Capture	Illumina HiSeq	Phase_I	115497324	NM_173799	Q495A3|Q5JPD8|Q6MZS2|Q8N877	Missense_Mutation	SNP	ENST00000486257.1	37	CCDS2980.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	16.23	3.063831	0.55432	0.0	3.49E-4	ENSG00000181847	ENST00000461158;ENST00000481065;ENST00000486257;ENST00000383671;ENST00000484319	D;D;D;D;D	0.87809	-2.3;-2.3;-2.3;-2.3;-2.3	4.71	4.71	0.59529	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.56097	D	0.000023	D	0.93680	0.7981	M	0.87180	2.865	0.39671	D	0.970751	D	0.89917	1.0	D	0.91635	0.999	D	0.94696	0.7878	10	0.87932	D	0	-24.7507	13.3415	0.60547	0.0:0.0:1.0:0.0	.	102	Q495A1	TIGIT_HUMAN	N	81;169;102;102;81	ENSP00000418917:D81N;ENSP00000420552:D169N;ENSP00000419085:D102N;ENSP00000373167:D102N;ENSP00000419706:D81N	ENSP00000373167:D102N	D	+	1	0	TIGIT	115497324	0.997000	0.39634	0.963000	0.40424	0.008000	0.06430	3.023000	0.49666	2.628000	0.89032	0.561000	0.74099	GAT		TIGIT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354690.1	NM_173799	
PAQR9	344838	broad.mit.edu	37	3	142681159	142681159	+	Silent	SNP	C	C	G			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr3:142681159C>G	ENST00000340634.3	-	1	1019	c.1020G>C	c.(1018-1020)ccG>ccC	p.P340P	RP11-372E1.6_ENST00000594095.1_RNA|RP11-372E1.6_ENST00000608686.1_RNA|RP11-372E1.6_ENST00000608349.1_RNA|RP11-372E1.6_ENST00000478823.1_RNA|RP11-372E1.6_ENST00000493825.1_RNA|RP11-372E1.6_ENST00000598139.1_RNA|RP11-372E1.6_ENST00000607937.1_RNA|RP11-372E1.6_ENST00000598787.1_RNA|RP11-372E1.6_ENST00000595774.1_RNA|RP11-372E1.6_ENST00000595248.1_RNA|RP11-372E1.6_ENST00000593321.1_RNA|RP11-372E1.6_ENST00000497652.1_RNA	NM_198504.2	NP_940906.1	Q6ZVX9	PAQR9_HUMAN	progestin and adipoQ receptor family member IX	340						integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.P340P(1)		endometrium(2)|large_intestine(7)|lung(12)|prostate(1)	22						GTGCGGCAGGCGGCGCCTGGA	0.587																																					p.P340P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1020C	3						.						71.0	85.0	80.0					3																	142681159		2203	4300	6503	144163849	SO:0001819	synonymous_variant	344838	exon1			AY424287	CCDS3128.1	3q23	2008-05-02			ENSG00000188582	ENSG00000188582			30131	protein-coding gene	gene with protein product		614580					Standard	NM_198504		Approved	FLJ41938	uc003evg.3	Q6ZVX9	OTTHUMG00000159313	ENST00000340634.3:c.1020G>C	3.37:g.142681159C>G		Somatic		Capture	Illumina HiSeq	Phase_I	144163849	NM_198504	Q147T6	Silent	SNP	ENST00000340634.3	37	CCDS3128.1	.	.	.	.	.	.	.	.	.	.	C	6.840	0.524178	0.13066	.	.	ENSG00000188582	ENST00000492509	.	.	.	5.62	-1.44	0.08856	.	.	.	.	.	T	0.54631	0.1870	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46442	-0.9191	4	.	.	.	-33.5647	9.192	0.37204	0.0:0.253:0.4728:0.2742	.	.	.	.	P	81	.	.	A	-	1	0	PAQR9	144163849	0.282000	0.24268	0.702000	0.30337	0.921000	0.55340	-0.787000	0.04618	-0.673000	0.05259	0.650000	0.86243	GCC		PAQR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354538.1	NM_198504	
HTR3E	285242	broad.mit.edu	37	3	183824281	183824281	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr3:183824281C>A	ENST00000415389.2	+	9	1637	c.1171C>A	c.(1171-1173)Cag>Aag	p.Q391K	HTR3E_ENST00000440596.2_Missense_Mutation_p.Q417K|HTR3E_ENST00000425359.2_Missense_Mutation_p.Q376K|HTR3E_ENST00000335304.2_Missense_Mutation_p.Q406K|HTR3E-AS1_ENST00000431427.1_RNA|HTR3E_ENST00000436361.2_Missense_Mutation_p.Q391K	NM_001256613.1|NM_198313.2	NP_001243542.1|NP_938055.1	A5X5Y0	5HT3E_HUMAN	5-hydroxytryptamine (serotonin) receptor 3E, ionotropic	391					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)	p.Q406K(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(20)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	40	all_cancers(143;1.46e-10)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)		Ergoloid mesylate(DB01049)	ATCAGCAGGGCAGATGCCGGG	0.617																																					p.Q406K	Melanoma(7;227 727 6634 44770)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1216A	3						.						40.0	41.0	41.0					3																	183824281		2203	4300	6503	185306975	SO:0001583	missense	285242	exon8			AY159813	CCDS3251.1, CCDS58868.1, CCDS58869.1, CCDS58870.1, CCDS58871.1	3q27	2012-05-22	2012-02-03		ENSG00000186038	ENSG00000186038		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	24005	protein-coding gene	gene with protein product		610123	"""5-hydroxytryptamine (serotonin) receptor 3, family member E"""			12801637, 15157181	Standard	NM_001256613		Approved		uc010hxr.3	A5X5Y0	OTTHUMG00000156857	ENST00000415389.2:c.1171C>A	3.37:g.183824281C>A	ENSP00000401444:p.Gln391Lys	Somatic		Capture	Illumina HiSeq	Phase_I	185306975	NM_182589	A8IKD7|E9PGF1|Q495G1|Q495G3|Q6V706|Q6V707|Q7Z6B2	Missense_Mutation	SNP	ENST00000415389.2	37	CCDS58868.1	.	.	.	.	.	.	.	.	.	.	c	0.024	-1.386888	0.01194	.	.	ENSG00000186038	ENST00000415389;ENST00000425359;ENST00000335304;ENST00000436361;ENST00000440596	T;T;T;T;T	0.81415	-1.49;-1.49;-1.49;-1.49;-1.49	3.98	-3.09	0.05331	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.763586	0.10462	N	0.671794	T	0.36138	0.0956	N	0.00436	-1.5	0.09310	N	1	B;B;B;B;B	0.06786	0.0;0.001;0.001;0.001;0.001	B;B;B;B;B	0.14023	0.01;0.001;0.001;0.001;0.001	T	0.49113	-0.8973	10	0.02654	T	1	.	1.043	0.01563	0.4592:0.2011:0.2013:0.1385	.	417;391;391;406;376	E9PGF1;A5X5Y0;A5X5Y0-4;A5X5Y0-3;A5X5Y0-2	.;5HT3E_HUMAN;.;.;.	K	391;376;406;391;417	ENSP00000401444:Q391K;ENSP00000401900:Q376K;ENSP00000335511:Q406K;ENSP00000395833:Q391K;ENSP00000406050:Q417K	ENSP00000335511:Q406K	Q	+	1	0	HTR3E	185306975	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	0.033000	0.13754	-0.333000	0.08476	-0.182000	0.12963	CAG		HTR3E-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346284.1	NM_182589	
SRGAP3	9901	broad.mit.edu	37	3	9079763	9079763	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr3:9079763C>T	ENST00000383836.3	-	11	1847	c.1420G>A	c.(1420-1422)Gaa>Aaa	p.E474K	SRGAP3_ENST00000360413.3_Missense_Mutation_p.E474K|SRGAP3_ENST00000433332.3_5'UTR	NM_014850.3	NP_055665.1	O43295	SRGP3_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	474	F-BAR domain.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)		SRGAP3/RAF1(6)	breast(1)|endometrium(2)|kidney(21)|large_intestine(7)|lung(13)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	54				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		GTGCCGCATTCTGCTCTTTCC	0.448			T	RAF1	pilocytic astrocytoma																																p.E474K			Dom	yes		3	3p25.3	9901	SLIT-ROBO Rho GTPase activating protein 3		M	.	.	0			c.G1420A	3						.						147.0	128.0	135.0					3																	9079763		2203	4300	6503	9054763	SO:0001583	missense	9901	exon11			AB007871	CCDS2572.1, CCDS33689.1	3p25.3	2011-07-04	2004-11-12	2004-11-12	ENSG00000196220	ENSG00000196220		"""Rho GTPase activating proteins"""	19744	protein-coding gene	gene with protein product		606525	"""SLIT-ROBO Rho GTPase activating protein 2"""	SRGAP2		12195014	Standard	NM_014850		Approved	KIAA0411, MEGAP, WRP, ARHGAP14	uc003brf.2	O43295	OTTHUMG00000090589	ENST00000383836.3:c.1420G>A	3.37:g.9079763C>T	ENSP00000373347:p.Glu474Lys	None		Capture	Illumina HiSeq	Phase_I	9054763	NM_014850	Q8IX13|Q8IZV8	Missense_Mutation	SNP	ENST00000383836.3	37	CCDS2572.1	.	.	.	.	.	.	.	.	.	.	C	16.26	3.071819	0.55646	.	.	ENSG00000196220	ENST00000383836;ENST00000360413	T;T	0.25579	1.79;2.23	5.42	5.42	0.78866	.	0.210158	0.42548	D	0.000691	T	0.17238	0.0414	L	0.27053	0.805	0.80722	D	1	B;B;B	0.34290	0.241;0.447;0.319	B;B;B	0.27608	0.075;0.081;0.037	T	0.05354	-1.0890	10	0.08381	T	0.77	.	18.8222	0.92102	0.0:1.0:0.0:0.0	.	343;474;474	Q9ULR4;O43295-2;O43295	.;.;SRGP2_HUMAN	K	474	ENSP00000373347:E474K;ENSP00000353587:E474K	ENSP00000353587:E474K	E	-	1	0	SRGAP3	9054763	1.000000	0.71417	0.982000	0.44146	0.587000	0.36485	6.888000	0.75622	2.521000	0.84997	0.655000	0.94253	GAA		SRGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207137.3		
KIF9	64147	broad.mit.edu	37	3	47284677	47284677	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr3:47284677C>T	ENST00000265529.3	-	17	2253	c.1573G>A	c.(1573-1575)Gtt>Att	p.V525I	KIF9-AS1_ENST00000429315.3_RNA|KIF9_ENST00000335044.2_Missense_Mutation_p.V525I|KIF9_ENST00000352910.4_Intron|KIF9_ENST00000487440.1_5'UTR|KIF9_ENST00000452770.2_Missense_Mutation_p.V525I|KIF9_ENST00000444589.2_Intron			Q9HAQ2	KIF9_HUMAN	kinesin family member 9	525					ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|extracellular matrix disassembly (GO:0022617)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle disassembly (GO:1903008)|regulation of podosome assembly (GO:0071801)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|podosome (GO:0002102)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|protein dimerization activity (GO:0046983)	p.V525I(1)		central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(15)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)	34		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000284)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		GAGGTGGAAACGTAATCCAAG	0.562																																					p.V525I	Colon(44;962 1147 15977 24541)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1573A	3						.						102.0	82.0	88.0					3																	47284677		2203	4300	6503	47259681	SO:0001583	missense	64147	exon16			AF311212	CCDS2751.1, CCDS2752.1	3p21.31	2008-03-03			ENSG00000088727	ENSG00000088727		"""Kinesins"""	16666	protein-coding gene	gene with protein product		607910				11483511	Standard	NM_022342		Approved	MGC104186	uc003cqx.3	Q9HAQ2	OTTHUMG00000133512	ENST00000265529.3:c.1573G>A	3.37:g.47284677C>T	ENSP00000265529:p.Val525Ile	Somatic		Capture	Illumina HiSeq	Phase_I	47259681	NM_182902	Q86Z28|Q9H8A4	Missense_Mutation	SNP	ENST00000265529.3	37	CCDS2752.1	.	.	.	.	.	.	.	.	.	.	C	2.411	-0.335321	0.05278	.	.	ENSG00000088727	ENST00000335044;ENST00000265529;ENST00000452770	T;T;T	0.43294	0.95;0.95;0.95	5.49	-11.0	0.00169	.	1.478100	0.03515	N	0.220081	T	0.20740	0.0499	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.05750	-1.0866	10	0.22706	T	0.39	.	4.4683	0.11700	0.2179:0.1431:0.0733:0.5657	.	525	Q9HAQ2	KIF9_HUMAN	I	525	ENSP00000333942:V525I;ENSP00000265529:V525I;ENSP00000391100:V525I	ENSP00000265529:V525I	V	-	1	0	KIF9	47259681	0.000000	0.05858	0.000000	0.03702	0.073000	0.16967	-4.108000	0.00293	-2.799000	0.00353	-0.291000	0.09656	GTT		KIF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257475.2		
DNAH1	25981	broad.mit.edu	37	3	52428658	52428658	+	Missense_Mutation	SNP	G	G	A	rs377385985		TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr3:52428658G>A	ENST00000420323.2	+	67	11065	c.10804G>A	c.(10804-10806)Gac>Aac	p.D3602N		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	3667					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.D3602N(1)		cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GGTCATCTTCGACAGCCTTGA	0.582																																					p.D3602N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G10804A	3						.	G	ASN/ASP	0,3912		0,0,1956	66.0	70.0	68.0		10804	5.3	0.9	3		68	1,8257		0,1,4128	no	missense	DNAH1	NM_015512.4	23	0,1,6084	AA,AG,GG		0.0121,0.0,0.0082	probably-damaging	3602/4266	52428658	1,12169	1956	4129	6085	52403698	SO:0001583	missense	25981	exon67			U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.10804G>A	3.37:g.52428658G>A	ENSP00000401514:p.Asp3602Asn	Somatic		Capture	Illumina HiSeq	Phase_I	52403698	NM_015512	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	ENST00000420323.2	37	CCDS46842.1	.	.	.	.	.	.	.	.	.	.	G	31	5.086297	0.94100	0.0	1.21E-4	ENSG00000114841	ENST00000420323;ENST00000273600	T	0.09723	2.95	5.27	5.27	0.74061	.	0.000000	0.64402	D	0.000001	T	0.37945	0.1022	M	0.79926	2.475	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.18999	-1.0319	10	0.56958	D	0.05	.	18.9133	0.92494	0.0:0.0:1.0:0.0	.	3602;3667	C9JXH6;Q9P2D7-2	.;.	N	3602;355	ENSP00000401514:D3602N	ENSP00000273600:D355N	D	+	1	0	DNAH1	52403698	1.000000	0.71417	0.936000	0.37596	0.924000	0.55760	8.371000	0.90123	2.475000	0.83589	0.655000	0.94253	GAC		DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	
FEZF2	55079	broad.mit.edu	37	3	62357951	62357951	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr3:62357951G>A	ENST00000283268.3	-	2	887	c.593C>T	c.(592-594)gCg>gTg	p.A198V	FEZF2_ENST00000475839.1_Missense_Mutation_p.A198V|FEZF2_ENST00000486811.1_Missense_Mutation_p.A198V|PTPRG-AS1_ENST00000490916.1_RNA|PTPRG-AS1_ENST00000495542.1_RNA	NM_018008.3	NP_060478.3	Q8TBJ5	FEZF2_HUMAN	FEZ family zinc finger 2	198					axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cerebral cortex GABAergic interneuron migration (GO:0021853)|dendrite development (GO:0016358)|dentate gyrus development (GO:0021542)|forebrain anterior/posterior pattern specification (GO:0021797)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.A198V(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|lung(8)|skin(1)	20		Lung SC(41;0.0262)		BRCA - Breast invasive adenocarcinoma(55;0.000221)|KIRC - Kidney renal clear cell carcinoma(15;0.00834)|Kidney(15;0.00957)		GGGGGCCTGCGCATTGAGGAG	0.682																																					p.A198V	NSCLC(170;1772 2053 12525 15604 23984)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C593T	3						.						10.0	14.0	13.0					3																	62357951		2192	4284	6476	62332991	SO:0001583	missense	55079	exon2			AF064845	CCDS2897.1	3p21.1	2013-01-08	2006-08-15	2006-08-15	ENSG00000153266	ENSG00000153266		"""Zinc fingers, C2H2-type"""	13506	protein-coding gene	gene with protein product		607414	"""zinc finger protein 312"""	ZNF312			Standard	NM_018008		Approved	FLJ10142, FKSG36, TOF, FEZL, Zfp312	uc003dli.2	Q8TBJ5	OTTHUMG00000158705	ENST00000283268.3:c.593C>T	3.37:g.62357951G>A	ENSP00000283268:p.Ala198Val	Somatic		Capture	Illumina HiSeq	Phase_I	62332991	NM_018008	A8K349|Q9BZ91|Q9NWB9	Missense_Mutation	SNP	ENST00000283268.3	37	CCDS2897.1	.	.	.	.	.	.	.	.	.	.	G	10.62	1.400683	0.25291	.	.	ENSG00000153266	ENST00000486811;ENST00000283268;ENST00000475839	T;T;T	0.07444	3.19;3.19;3.19	5.15	4.27	0.50696	.	0.281572	0.40385	N	0.001105	T	0.11452	0.0279	L	0.56769	1.78	0.34731	D	0.729744	B	0.22346	0.068	B	0.19391	0.025	T	0.05500	-1.0881	10	0.66056	D	0.02	-5.6543	13.5084	0.61497	0.0:0.1579:0.8421:0.0	.	198	Q8TBJ5	FEZF2_HUMAN	V	198	ENSP00000418589:A198V;ENSP00000283268:A198V;ENSP00000418804:A198V	ENSP00000283268:A198V	A	-	2	0	FEZF2	62332991	1.000000	0.71417	0.987000	0.45799	0.870000	0.49936	5.233000	0.65337	1.167000	0.42706	-0.314000	0.08810	GCG		FEZF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351813.1	NM_018008	
MFI2	4241	broad.mit.edu	37	3	196737616	196737616	+	Missense_Mutation	SNP	G	G	A	rs371452660		TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr3:196737616G>A	ENST00000296350.5	-	10	1396	c.1283C>T	c.(1282-1284)gCg>gTg	p.A428V		NM_005929.5	NP_005920.2	P08582	TRFM_HUMAN	antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5	428	Transferrin-like 2. {ECO:0000255|PROSITE- ProRule:PRU00741}.				cellular iron ion homeostasis (GO:0006879)|iron ion import (GO:0097286)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of plasminogen activation (GO:0010756)	anchored component of plasma membrane (GO:0046658)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ferric iron binding (GO:0008199)|iron ion binding (GO:0005506)	p.A428V(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|prostate(1)	20	all_cancers(143;3.95e-09)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.55e-24)|all cancers(36;2.87e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00536)		CGTCTTCCCCGCCGTGTAAAT	0.642																																					p.A428V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1283T	3						.	G	VAL/ALA	0,4406		0,0,2203	47.0	48.0	48.0		1283	5.5	0.3	3		48	1,8599	1.2+/-3.3	0,1,4299	no	missense	MFI2	NM_005929.5	64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	428/739	196737616	1,13005	2203	4300	6503	198222013	SO:0001583	missense	4241	exon10				CCDS3325.1, CCDS3326.1	3q28-q29	2012-10-02			ENSG00000163975	ENSG00000163975		"""CD molecules"""	7037	protein-coding gene	gene with protein product	"""melanotransferrin"", ""membrane-bound transferrin-like protein"""	155750					Standard	NM_033316		Approved	CD228, FLJ38863, MAP97, MGC4856, MTF1	uc003fxk.4	P08582	OTTHUMG00000155518	ENST00000296350.5:c.1283C>T	3.37:g.196737616G>A	ENSP00000296350:p.Ala428Val	Somatic		Capture	Illumina HiSeq	Phase_I	198222013	NM_005929	Q9BQE2	Missense_Mutation	SNP	ENST00000296350.5	37	CCDS3325.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.363837	0.82353	0.0	1.16E-4	ENSG00000163975	ENST00000296350	T	0.35421	1.31	5.5	5.5	0.81552	.	0.052442	0.85682	D	0.000000	T	0.70762	0.3261	M	0.93939	3.475	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.79188	-0.1906	10	0.87932	D	0	-23.6633	17.9744	0.89122	0.0:0.0:1.0:0.0	.	428	P08582	TRFM_HUMAN	V	428	ENSP00000296350:A428V	ENSP00000296350:A428V	A	-	2	0	MFI2	198222013	1.000000	0.71417	0.344000	0.25628	0.565000	0.35776	7.349000	0.79376	2.575000	0.86900	0.563000	0.77884	GCG		MFI2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340458.1		
SLIT2	9353	broad.mit.edu	37	4	20255583	20255583	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr4:20255583G>A	ENST00000504154.1	+	1	397	c.145G>A	c.(145-147)Gtg>Atg	p.V49M	SLIT2_ENST00000273739.5_Missense_Mutation_p.V49M|SLIT2_ENST00000503837.1_Missense_Mutation_p.V49M|SLIT2_ENST00000503823.1_Missense_Mutation_p.V49M	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	49	LRRNT.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)	p.V49M(1)		NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						GCTGCGCAGCGTGCCCAGGAA	0.672																																					p.V49M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G145A	4						.						97.0	82.0	87.0					4																	20255583		2203	4300	6503	19864681	SO:0001583	missense	9353	exon1			AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.145G>A	4.37:g.20255583G>A	ENSP00000422591:p.Val49Met	Somatic		Capture	Illumina HiSeq	Phase_I	19864681	NM_004787	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	SNP	ENST00000504154.1	37	CCDS3426.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.500054	0.85176	.	.	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837	D;D;D;D	0.97256	-4.31;-4.31;-4.31;-4.31	3.85	3.85	0.44370	Leucine-rich repeat-containing N-terminal (2);	0.000000	0.64402	D	0.000002	D	0.97170	0.9075	M	0.83603	2.65	0.58432	D	0.999996	D;D	0.64830	0.994;0.988	P;P	0.47891	0.493;0.56	D	0.97884	1.0293	10	0.72032	D	0.01	.	15.8964	0.79338	0.0:0.0:1.0:0.0	.	49;49	O94813-3;O94813	.;SLIT2_HUMAN	M	49	ENSP00000427548:V49M;ENSP00000422591:V49M;ENSP00000273739:V49M;ENSP00000422261:V49M	ENSP00000273739:V49M	V	+	1	0	SLIT2	19864681	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.776000	0.68924	2.130000	0.65690	0.313000	0.20887	GTG		SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2		
GNRHR	2798	broad.mit.edu	37	4	68619894	68619894	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr4:68619894C>A	ENST00000226413.4	-	1	184	c.160G>T	c.(160-162)Gct>Tct	p.A54S	UBA6-AS1_ENST00000500538.2_RNA|GNRHR_ENST00000420975.2_Missense_Mutation_p.A54S|UBA6-AS1_ENST00000502758.1_RNA	NM_000406.2	NP_000397.1	P30968	GNRHR_HUMAN	gonadotropin-releasing hormone receptor	54					cellular response to gonadotropin-releasing hormone (GO:0097211)|G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	gonadotropin-releasing hormone receptor activity (GO:0004968)	p.A54S(1)		endometrium(2)|large_intestine(4)|liver(1)|lung(4)|ovary(1)|urinary_tract(1)	13					Abarelix(DB00106)|Buserelin(DB06719)|Cetrorelix(DB00050)|Danazol(DB01406)|Degarelix(DB06699)|Gonadorelin(DB00644)|Goserelin(DB00014)|Leuprolide(DB00007)|Nafarelin(DB00666)	AAGAAAGAAGCATTAAAGGTC	0.448																																					p.A54S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G160T	4						.						76.0	81.0	79.0					4																	68619894		2203	4300	6503	68302489	SO:0001583	missense	2798	exon1				CCDS3517.1, CCDS47064.1	4q21.2	2012-08-08			ENSG00000109163	ENSG00000109163		"""GPCR / Class A : Gonadotropin-releasing hormone receptors"""	4421	protein-coding gene	gene with protein product		138850		GRHR		8386108	Standard	NM_000406		Approved	LHRHR	uc003hdn.3	P30968	OTTHUMG00000129302	ENST00000226413.4:c.160G>T	4.37:g.68619894C>A	ENSP00000226413:p.Ala54Ser	Somatic		Capture	Illumina HiSeq	Phase_I	68302489	NM_000406	O75793|Q14D13|Q92644	Missense_Mutation	SNP	ENST00000226413.4	37	CCDS3517.1	.	.	.	.	.	.	.	.	.	.	C	1.717	-0.497550	0.04291	.	.	ENSG00000109163	ENST00000226413;ENST00000420975	T;T	0.36699	1.24;1.24	6.03	3.41	0.39046	GPCR, rhodopsin-like superfamily (1);	0.279124	0.31472	N	0.007597	T	0.21145	0.0509	L	0.27053	0.805	0.22171	N	0.999312	B;B	0.21147	0.009;0.052	B;B	0.16289	0.005;0.015	T	0.16041	-1.0416	10	0.29301	T	0.29	-4.6437	5.5075	0.16862	0.2802:0.5732:0.0:0.1465	.	54;54	P30968;P30968-2	GNRHR_HUMAN;.	S	54	ENSP00000226413:A54S;ENSP00000397561:A54S	ENSP00000226413:A54S	A	-	1	0	GNRHR	68302489	0.001000	0.12720	0.790000	0.31976	0.132000	0.20833	0.190000	0.17057	0.462000	0.27095	-0.122000	0.15005	GCT		GNRHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251432.2		
PPM1K	152926	broad.mit.edu	37	4	89199590	89199590	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr4:89199590C>T	ENST00000608933.1	-	2	535	c.146G>A	c.(145-147)cGg>cAg	p.R49Q	PPM1K_ENST00000514204.1_Missense_Mutation_p.R49Q|PPM1K_ENST00000508256.1_Intron|PPM1K_ENST00000315194.4_Missense_Mutation_p.R49Q|PPM1K_ENST00000506423.1_5'UTR|PPM1K_ENST00000295908.7_Missense_Mutation_p.R49Q	NM_152542.4	NP_689755.3	Q8N3J5	PPM1K_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1K	49					protein dephosphorylation (GO:0006470)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)	p.R49Q(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(1)	13		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000192)		TGGGTCAAACCGAGAACACCT	0.567																																					p.R49Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G146A	4						.						80.0	76.0	77.0					4																	89199590		2203	4300	6503	89418614	SO:0001583	missense	152926	exon2			BC037552	CCDS3629.1	4q22.1	2012-04-17	2010-03-05		ENSG00000163644	ENSG00000163644	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	25415	protein-coding gene	gene with protein product	"""PP2C-type mitochondrial phosphoprotein phosphatase"", ""protein phosphatase 2C kappa"", ""branched-chain &#945;-ketoacid dehydrogenase phosphatase"""	611065	"""protein phosphatase 1K (PP2C domain containing)"""			22291014	Standard	NM_152542		Approved	DKFZp761G058, PP2Ckappa, hPTMP, PP2Cm, BDP	uc003hrm.5	Q8N3J5	OTTHUMG00000130952	ENST00000608933.1:c.146G>A	4.37:g.89199590C>T	ENSP00000477341:p.Arg49Gln	Somatic		Capture	Illumina HiSeq	Phase_I	89418614	NM_152542	B2RAZ1|Q05CT5|Q49AB5|Q4W5E6|Q56AN8|Q8IUZ7|Q8IXG7|Q8ND70|Q96NT4	Missense_Mutation	SNP	ENST00000608933.1	37	CCDS3629.1	.	.	.	.	.	.	.	.	.	.	C	35	5.509784	0.96386	.	.	ENSG00000163644	ENST00000295908;ENST00000506423;ENST00000315194	T;T;T	0.61392	1.64;0.11;0.11	4.55	4.55	0.56014	.	0.766246	0.12642	N	0.451190	T	0.75852	0.3906	M	0.69823	2.125	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;P	0.83275	0.996;0.996;0.788	T	0.73646	-0.3917	10	0.45353	T	0.12	-14.5152	16.6368	0.85061	0.0:1.0:0.0:0.0	.	49;49;49	Q8N3J5-2;Q8N3J5-3;Q8N3J5	.;.;PPM1K_HUMAN	Q	49	ENSP00000295908:R49Q;ENSP00000424155:R49Q;ENSP00000324761:R49Q	ENSP00000295908:R49Q	R	-	2	0	PPM1K	89418614	1.000000	0.71417	0.998000	0.56505	0.934000	0.57294	7.273000	0.78527	2.536000	0.85505	0.491000	0.48974	CGG		PPM1K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253553.4	NM_152542	
ANK2	287	broad.mit.edu	37	4	114288752	114288752	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr4:114288752C>A	ENST00000357077.4	+	42	11116	c.11063C>A	c.(11062-11064)aCt>aAt	p.T3688N	ANK2_ENST00000506722.1_Missense_Mutation_p.T1594N|ANK2_ENST00000264366.6_Missense_Mutation_p.T3655N|ANK2_ENST00000509550.1_Missense_Mutation_p.T779N|ANK2_ENST00000394537.3_Missense_Mutation_p.T1603N|ANK2_ENST00000510275.2_Missense_Mutation_p.T255N	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	3688					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.T3688N(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GAGTTATGCACTGCACAGCAC	0.388																																					p.T1603N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4808A	4						.						77.0	76.0	76.0					4																	114288752		2203	4300	6503	114508201	SO:0001583	missense	287	exon41			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.11063C>A	4.37:g.114288752C>A	ENSP00000349588:p.Thr3688Asn	Somatic		Capture	Illumina HiSeq	Phase_I	114508201	NM_020977	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.529|8.529	0.870625|0.870625	0.17322|0.17322	.|.	.|.	ENSG00000145362|ENSG00000145362	ENST00000514960|ENST00000506722;ENST00000431447;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056;ENST00000509550;ENST00000510275;ENST00000505342	.|T;T;T;T;T;D;D	.|0.96041	.|-0.23;-0.2;-0.23;-0.24;-0.98;-1.98;-3.89	5.29|5.29	2.6|2.6	0.31112|0.31112	.|.	.|1.831260	.|0.02953	.|N	.|0.141970	D|D	0.94118|0.94118	0.8114|0.8114	L|L	0.50333|0.50333	1.59|1.59	0.09310|0.09310	N|N	1|1	.|B;B;B;P;B;P	.|0.39940	.|0.011;0.012;0.201;0.696;0.02;0.551	.|B;B;B;B;B;B	.|0.40982	.|0.008;0.015;0.014;0.345;0.017;0.196	D|D	0.84076|0.84076	0.0382|0.0382	5|10	.|0.54805	.|T	.|0.06	.|.	8.0762|8.0762	0.30718|0.30718	0.0:0.4539:0.3922:0.1539|0.0:0.4539:0.3922:0.1539	.|.	.|779;638;604;1603;3688;1594	.|E9PCH6;F8W694;Q7Z344;Q01484-2;Q01484-4;Q01484-5	.|.;.;.;.;.;.	Q|N	604|1594;638;1603;3688;3655;1594;779;255;698	.|ENSP00000421067:T1594N;ENSP00000378044:T1603N;ENSP00000349588:T3688N;ENSP00000264366:T3655N;ENSP00000426944:T779N;ENSP00000421023:T255N;ENSP00000422498:T698N	.|ENSP00000264366:T3655N	H|T	+|+	3|2	2|0	ANK2|ANK2	114508201|114508201	0.001000|0.001000	0.12720|0.12720	0.000000|0.000000	0.03702|0.03702	0.329000|0.329000	0.28539|0.28539	1.073000|1.073000	0.30691|0.30691	0.220000|0.220000	0.20860|0.20860	0.484000|0.484000	0.47621|0.47621	CAC|ACT		ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
APC	324	broad.mit.edu	37	5	112173917	112173917	+	Nonsense_Mutation	SNP	C	C	T	rs121913333		TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr5:112173917C>T	ENST00000457016.1	+	16	3006	c.2626C>T	c.(2626-2628)Cga>Tga	p.R876*	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Nonsense_Mutation_p.R876*|APC_ENST00000257430.4_Nonsense_Mutation_p.R876*			P25054	APC_HUMAN	adenomatous polyposis coli	876	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R876*(38)|p.S874_R876>*(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TTCTTCAAAGCGAGGTTTGCA	0.463		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R858X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,NS,Substitution - Nonsense,0 	.	40	Substitution - Nonsense(38)|Unknown(1)|Complex - deletion inframe(1)	large_intestine(37)|lung(1)|breast(1)|skin(1)	c.C2572T	5	GRCh37	CM942020	APC	M	rs121913333	.						70.0	72.0	71.0					5																	112173917		2202	4300	6502	112201816	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2626C>T	5.37:g.112173917C>T	ENSP00000413133:p.Arg876*	Somatic		Capture	Illumina HiSeq	Phase_I	112201816	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	37	6.588996	0.97688	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.92	4.09	0.47781	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.2738	14.8639	0.70401	0.3912:0.6088:0.0:0.0	.	.	.	.	X	876;858;876;876;876	.	ENSP00000257430:R876X	R	+	1	2	APC	112201816	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	1.385000	0.34408	0.785000	0.33685	0.557000	0.71058	CGA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
DNAH5	1767	broad.mit.edu	37	5	13830717	13830717	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr5:13830717C>T	ENST00000265104.4	-	36	6154	c.6050G>A	c.(6049-6051)cGg>cAg	p.R2017Q		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2017	AAA 1. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R2017Q(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CTTAAAAATCCGTCCAAGTCC	0.393									Kartagener syndrome																												p.R2017Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6050A	5						.						89.0	90.0	90.0					5																	13830717		2203	4300	6503	13883717	SO:0001583	missense	1767	exon36	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.6050G>A	5.37:g.13830717C>T	ENSP00000265104:p.Arg2017Gln	Somatic		Capture	Illumina HiSeq	Phase_I	13883717	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	C	32	5.191681	0.94923	.	.	ENSG00000039139	ENST00000265104	T	0.47869	0.83	5.53	5.53	0.82687	ATPase, AAA+ type, core (1);	0.053328	0.64402	D	0.000001	T	0.70072	0.3182	M	0.70903	2.155	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.72211	-0.4359	10	0.72032	D	0.01	.	19.4895	0.95044	0.0:1.0:0.0:0.0	.	2017	Q8TE73	DYH5_HUMAN	Q	2017	ENSP00000265104:R2017Q	ENSP00000265104:R2017Q	R	-	2	0	DNAH5	13883717	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.818000	0.86416	2.596000	0.87737	0.655000	0.94253	CGG		DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
SIL1	64374	broad.mit.edu	37	5	138283055	138283056	+	Nonsense_Mutation	DNP	GC	GC	TT			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	GC	GC					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr5:138283055_138283056GC>TT	ENST00000394817.2	-	10	1275_1276	c.1136_1137GC>AA	c.(1135-1137)tGC>tAA	p.C379*	SIL1_ENST00000509534.1_Nonsense_Mutation_p.C386*|SIL1_ENST00000515008.1_5'UTR|SIL1_ENST00000265195.5_Nonsense_Mutation_p.C379*	NM_022464.4	NP_071909.1	Q9H173	SIL1_HUMAN	SIL1 nucleotide exchange factor	379					intracellular protein transport (GO:0006886)|protein folding (GO:0006457)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)	unfolded protein binding (GO:0051082)	p.C379>?(1)		endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|urinary_tract(1)	13			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			CCGTGATCTCGCACCAGCCCTG	0.663									Marinesco-Sjgren syndrome																												.												.	.	1	Complex(1)	large_intestine(1)	c.1136_1137AA	5						.																																			138310955	SO:0001587	stop_gained	64374	exon11	Familial Cancer Database	Marinesco-Sjogren syndrome	AK075177	CCDS4209.1	5q31	2013-08-21	2013-08-21		ENSG00000120725	ENSG00000120725			24624	protein-coding gene	gene with protein product		608005	"""Marinesco-Sjogren syndrome"", ""SIL1 homolog, endoplasmic reticulum chaperone (S. cerevisiae)"""	MSS		11101517, 12356756, 16282977	Standard	XM_006714671		Approved	BAP, ULG5	uc003ldp.3	Q9H173	OTTHUMG00000129226	ENST00000394817.2:c.1136_1137delinsTT	5.37:g.138283055_138283056delinsTT	ENSP00000378294:p.Cys379*	Somatic		Capture	Illumina HiSeq	Phase_I	138310954	NM_001037633	D3DQC2|Q8N2L3	Nonsense_Mutation	DNP	ENST00000394817.2	37	CCDS4209.1																																																																																				SIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251319.1	NM_022464	
PCDHB5	26167	broad.mit.edu	37	5	140515206	140515206	+	Missense_Mutation	SNP	G	G	A	rs139218724		TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr5:140515206G>A	ENST00000231134.5	+	1	407	c.190G>A	c.(190-192)Gcg>Acg	p.A64T		NM_015669.2	NP_056484.1	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5	64	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A64T(2)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|kidney(1)|large_intestine(18)|lung(25)|ovary(3)|prostate(6)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	81			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CACTCGGGGCGCGCGAATGCA	0.493																																					p.A64T												.	.	2	Substitution - Missense(2)	upper_aerodigestive_tract(1)|large_intestine(1)	c.G190A	5						.	G	THR/ALA	0,4406		0,0,2203	62.0	70.0	67.0		190	5.4	0.7	5	dbSNP_134	67	1,8599	1.2+/-3.3	0,1,4299	no	missense	PCDHB5	NM_015669.2	58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	64/796	140515206	1,13005	2203	4300	6503	140495390	SO:0001583	missense	26167	exon1			AF152498	CCDS4247.1	5q31	2010-01-26			ENSG00000113209	ENSG00000113209		"""Cadherins / Protocadherins : Clustered"""	8690	other	protocadherin		606331				10380929	Standard	NM_015669		Approved	DKFZp586B0217, PCDH-BETA5	uc003liq.3	Q9Y5E4	OTTHUMG00000129616	ENST00000231134.5:c.190G>A	5.37:g.140515206G>A	ENSP00000231134:p.Ala64Thr	Somatic		Capture	Illumina HiSeq	Phase_I	140495390	NM_015669	Q549F4|Q9UFU9	Missense_Mutation	SNP	ENST00000231134.5	37	CCDS4247.1	.	.	.	.	.	.	.	.	.	.	G	16.12	3.033180	0.54896	0.0	1.16E-4	ENSG00000113209	ENST00000231134	T	0.15372	2.43	5.37	5.37	0.77165	Cadherin, N-terminal (1);Cadherin (1);	.	.	.	.	T	0.39145	0.1067	M	0.91717	3.235	0.34084	D	0.659879	P	0.47302	0.893	P	0.49528	0.614	T	0.60831	-0.7185	9	0.46703	T	0.11	.	13.9806	0.64301	0.0:0.0:0.8482:0.1517	.	64	Q9Y5E4	PCDB5_HUMAN	T	64	ENSP00000231134:A64T	ENSP00000231134:A64T	A	+	1	0	PCDHB5	140495390	0.001000	0.12720	0.726000	0.30738	0.559000	0.35586	0.931000	0.28871	2.683000	0.91414	0.555000	0.69702	GCG		PCDHB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251811.1	NM_015669	
PCDHB15	56121	broad.mit.edu	37	5	140627316	140627316	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr5:140627316C>T	ENST00000231173.3	+	1	2170	c.2170C>T	c.(2170-2172)Cgc>Tgc	p.R724C		NM_018935.2	NP_061758.1	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15	724					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.R724C(1)		NS(1)|breast(3)|endometrium(8)|kidney(3)|large_intestine(14)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	61			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTCAGTGGGTCGCTGCTCGGT	0.657																																					p.R724C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2170T	5						.						94.0	106.0	102.0					5																	140627316		2203	4299	6502	140607500	SO:0001583	missense	56121	exon1			AF152494	CCDS4257.1	5q31	2011-06-07			ENSG00000113248	ENSG00000113248		"""Cadherins / Protocadherins : Clustered"""	8686	other	protocadherin		606341				10380929	Standard	NM_018935		Approved	PCDH-BETA15	uc003lje.3	Q9Y5E8	OTTHUMG00000129609	ENST00000231173.3:c.2170C>T	5.37:g.140627316C>T	ENSP00000231173:p.Arg724Cys	Somatic		Capture	Illumina HiSeq	Phase_I	140607500	NM_018935	Q8IUX5	Missense_Mutation	SNP	ENST00000231173.3	37	CCDS4257.1	.	.	.	.	.	.	.	.	.	.	C	10.37	1.330913	0.24167	.	.	ENSG00000113248	ENST00000231173	T	0.51071	0.72	4.34	-1.86	0.07760	.	.	.	.	.	T	0.45696	0.1355	M	0.77313	2.365	0.09310	N	1	B	0.14012	0.009	B	0.11329	0.006	T	0.48139	-0.9061	9	0.49607	T	0.09	.	8.9883	0.36008	0.0765:0.6142:0.2073:0.102	.	724	Q9Y5E8	PCDBF_HUMAN	C	724	ENSP00000231173:R724C	ENSP00000231173:R724C	R	+	1	0	PCDHB15	140607500	0.000000	0.05858	0.000000	0.03702	0.125000	0.20455	-0.807000	0.04520	-0.230000	0.09840	0.556000	0.70494	CGC		PCDHB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251804.2	NM_018935	
PCDHGA2	56113	broad.mit.edu	37	5	140720953	140720953	+	Silent	SNP	G	G	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr5:140720953G>A	ENST00000394576.2	+	1	2415	c.2415G>A	c.(2413-2415)acG>acA	p.T805T	PCDHGA3_ENST00000253812.6_5'Flank|PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	805					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T805T(2)		breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGAAGAAACGTTTTCTCAGG	0.388																																					p.T805T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G2415A	5						.						60.0	65.0	63.0					5																	140720953		2201	4300	6501	140701137	SO:0001819	synonymous_variant	56113	exon1			AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.2415G>A	5.37:g.140720953G>A		Somatic		Capture	Illumina HiSeq	Phase_I	140701137	NM_032009	Q52LL6|Q9Y5D5	Silent	SNP	ENST00000394576.2	37	CCDS47289.1																																																																																				PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374738.1	NM_018915	
SLC6A3	6531	broad.mit.edu	37	5	1416312	1416312	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr5:1416312C>T	ENST00000270349.9	-	7	1059	c.932G>A	c.(931-933)tGg>tAg	p.W311*	SLC6A3_ENST00000453492.2_Nonsense_Mutation_p.W311*	NM_001044.4	NP_001035.1	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 3	311					adenohypophysis development (GO:0021984)|aging (GO:0007568)|cation transmembrane transport (GO:0098655)|cell death (GO:0008219)|dopamine biosynthetic process (GO:0042416)|dopamine catabolic process (GO:0042420)|dopamine transport (GO:0015872)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|neurotransmitter biosynthetic process (GO:0042136)|positive regulation of multicellular organism growth (GO:0040018)|prepulse inhibition (GO:0060134)|regulation of dopamine metabolic process (GO:0042053)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to iron ion (GO:0010039)|response to nicotine (GO:0035094)|sensory perception of smell (GO:0007608)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine transmembrane transporter activity (GO:0005329)|dopamine:sodium symporter activity (GO:0005330)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)	p.W311*(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(19)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Benzatropine(DB00245)|Benzphetamine(DB00865)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Cocaine(DB00907)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Diphenylpyraline(DB01146)|Dopamine(DB00988)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fencamfamine(DB01463)|Imipramine(DB00458)|Ioflupane I 123(DB08824)|Lisdexamfetamine(DB01255)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Mirtazapine(DB00370)|Modafinil(DB00745)|Nefazodone(DB01149)|Pethidine(DB00454)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Trimipramine(DB00726)|Venlafaxine(DB00285)	CGCGTCAATCCAAACCTGCAG	0.622																																					p.W311X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G932A	5						.						61.0	56.0	58.0					5																	1416312		2203	4300	6503	1469312	SO:0001587	stop_gained	6531	exon7				CCDS3863.1	5p15.3	2013-07-19	2013-07-19		ENSG00000142319	ENSG00000142319		"""Solute carriers"""	11049	protein-coding gene	gene with protein product	"""dopamine transporter"""	126455	"""solute carrier family 6 (neurotransmitter transporter, dopamine), member 3"", ""dopamine transporter 1"""	DAT1		1406597	Standard	NM_001044		Approved	DAT	uc003jck.3	Q01959	OTTHUMG00000131016	ENST00000270349.9:c.932G>A	5.37:g.1416312C>T	ENSP00000270349:p.Trp311*	Somatic		Capture	Illumina HiSeq	Phase_I	1469312	NM_001044	A2RUN4|Q14996	Nonsense_Mutation	SNP	ENST00000270349.9	37	CCDS3863.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.313508	0.81358	.	.	ENSG00000142319	ENST00000270349;ENST00000453492;ENST00000513308	.	.	.	3.88	3.88	0.44766	.	0.130951	0.56097	D	0.000033	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.7023	0.62616	0.0:1.0:0.0:0.0	.	.	.	.	X	311;311;237	.	ENSP00000270349:W311X	W	-	2	0	SLC6A3	1469312	1.000000	0.71417	0.900000	0.35374	0.094000	0.18550	7.015000	0.76387	1.891000	0.54761	0.561000	0.74099	TGG		SLC6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253650.3	NM_001044	
PCDHGA5	56110	broad.mit.edu	37	5	140744763	140744763	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr5:140744763C>T	ENST00000518069.1	+	1	866	c.866C>T	c.(865-867)tCg>tTg	p.S289L	PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018918.2|NM_032054.1	NP_061741.1|NP_114443.1	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5	289	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S289L(4)		endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|upper_aerodigestive_tract(3)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAAAAAATTTCGGAGACTTTC	0.463																																					p.S289L												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.C866T	5						.						34.0	35.0	34.0					5																	140744763		1865	4107	5972	140724947	SO:0001583	missense	56110	exon1			AF152512	CCDS54925.1, CCDS75333.1	5q31	2010-01-26				ENSG00000253485		"""Cadherins / Protocadherins : Clustered"""	8703	other	protocadherin	"""cadherin ME3"""	606292				10380929	Standard	NM_018918		Approved	CDH-GAMMA-A5, ME3, PCDH-GAMMA-A5		Q9Y5G8		ENST00000518069.1:c.866C>T	5.37:g.140744763C>T	ENSP00000429834:p.Ser289Leu	Somatic		Capture	Illumina HiSeq	Phase_I	140724947	NM_032054	Q2M3F5|Q9Y5D2	Missense_Mutation	SNP	ENST00000518069.1	37	CCDS54925.1	.	.	.	.	.	.	.	.	.	.	.	5.229	0.227704	0.09916	.	.	ENSG00000253485	ENST00000518069	T	0.03094	4.05	5.52	3.6	0.41247	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.03136	0.0092	N	0.25957	0.775	0.09310	N	1	B;B	0.20671	0.012;0.047	B;B	0.20767	0.013;0.031	T	0.42949	-0.9421	9	0.27785	T	0.31	.	7.1449	0.25577	0.0:0.5795:0.2838:0.1367	.	289;289	Q9Y5G8-2;Q9Y5G8	.;PCDG5_HUMAN	L	289	ENSP00000429834:S289L	ENSP00000429834:S289L	S	+	2	0	PCDHGA5	140724947	0.000000	0.05858	0.789000	0.31954	0.857000	0.48899	-0.804000	0.04535	1.437000	0.47472	0.563000	0.77884	TCG		PCDHGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374742.1	NM_018918	
AMACR	23600	broad.mit.edu	37	5	33989381	33989381	+	Silent	SNP	G	G	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr5:33989381G>A	ENST00000335606.6	-	5	1054	c.966C>T	c.(964-966)gaC>gaT	p.D322D	AMACR_ENST00000382085.3_Silent_p.D322D|AMACR_ENST00000514195.1_5'UTR|AMACR_ENST00000502637.1_Silent_p.D307D|AMACR_ENST00000382072.2_3'UTR|RP11-1084J3.4_ENST00000382079.3_3'UTR	NM_001167595.1|NM_014324.5	NP_001161067.1|NP_055139.4	Q9UHK6	AMACR_HUMAN	alpha-methylacyl-CoA racemase	322					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	alpha-methylacyl-CoA racemase activity (GO:0008111)|receptor binding (GO:0005102)	p.D322D(1)		endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|stomach(1)|urinary_tract(1)	19						GGGGGCTCACGTCCTGCTCCT	0.517																																					p.D322D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C966T	5						.						93.0	91.0	91.0					5																	33989381		2203	4300	6503	34025138	SO:0001819	synonymous_variant	23600	exon5			AF047020	CCDS3902.1, CCDS3903.1, CCDS54836.1	5p13.2	2012-05-16			ENSG00000242110	ENSG00000242110	5.1.99.4		451	protein-coding gene	gene with protein product		604489				9307041	Standard	NM_014324		Approved	RACE	uc003jij.3	Q9UHK6	OTTHUMG00000090734	ENST00000335606.6:c.966C>T	5.37:g.33989381G>A		Somatic		Capture	Illumina HiSeq	Phase_I	34025138	NM_014324	A5YM47|B8Y916|B8Y918|F8W9N1|O43673|Q3KT79|Q96GH1|Q9Y3Q1	Silent	SNP	ENST00000335606.6	37	CCDS3902.1																																																																																				AMACR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207467.1	NM_014324	
GHR	2690	broad.mit.edu	37	5	42699959	42699959	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr5:42699959C>A	ENST00000230882.4	+	6	663	c.473C>A	c.(472-474)aCt>aAt	p.T158N	GHR_ENST00000357703.3_Missense_Mutation_p.T136N|GHR_ENST00000537449.1_5'UTR	NM_000163.4|NM_001242399.2|NM_001242400.2|NM_001242401.3|NM_001242402.2|NM_001242403.2|NM_001242404.2|NM_001242405.2|NM_001242406.2	NP_000154.1|NP_001229328.1|NP_001229329.1|NP_001229330.1|NP_001229331.1|NP_001229332.1|NP_001229333.1|NP_001229334.1|NP_001229335.1	P10912	GHR_HUMAN	growth hormone receptor	158	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				2-oxoglutarate metabolic process (GO:0006103)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPK activity (GO:0000187)|allantoin metabolic process (GO:0000255)|cellular response to hormone stimulus (GO:0032870)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|endocytosis (GO:0006897)|fatty acid metabolic process (GO:0006631)|growth hormone receptor signaling pathway (GO:0060396)|insulin-like growth factor receptor signaling pathway (GO:0048009)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|multicellular organismal metabolic process (GO:0044236)|oxaloacetate metabolic process (GO:0006107)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|receptor internalization (GO:0031623)|regulation of multicellular organism growth (GO:0040014)|response to cycloheximide (GO:0046898)|response to estradiol (GO:0032355)|succinate metabolic process (GO:0006105)|taurine metabolic process (GO:0019530)|valine metabolic process (GO:0006573)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|growth hormone receptor complex (GO:0070195)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cytokine receptor activity (GO:0004896)|growth factor binding (GO:0019838)|peptide hormone binding (GO:0017046)|proline-rich region binding (GO:0070064)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)	p.T158N(1)		NS(2)|endometrium(2)|kidney(3)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39		Myeloproliferative disorder(839;0.00878)			Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	CTCAACTGGACTTTACTGAAC	0.433																																					p.T158N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C473A	5						.						129.0	110.0	117.0					5																	42699959		2203	4300	6503	42735716	SO:0001583	missense	2690	exon6				CCDS3940.1, CCDS56364.1, CCDS75239.1, CCDS75240.1	5p14-p12	2013-03-25			ENSG00000112964	ENSG00000112964		"""Fibronectin type III domain containing"""	4263	protein-coding gene	gene with protein product	"""growth hormone binding protein"""	600946					Standard	NM_001242460		Approved	GHBP	uc003jmt.3	P10912	OTTHUMG00000094791	ENST00000230882.4:c.473C>A	5.37:g.42699959C>A	ENSP00000230882:p.Thr158Asn	Somatic		Capture	Illumina HiSeq	Phase_I	42735716	NM_000163	Q9HCX2	Missense_Mutation	SNP	ENST00000230882.4	37	CCDS3940.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.649951	0.87958	.	.	ENSG00000112964	ENST00000230882;ENST00000357703;ENST00000356276	D;D	0.94576	-3.46;-3.46	5.91	5.05	0.67936	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.97300	0.9117	M	0.90977	3.165	0.80722	D	1	D	0.63880	0.993	P	0.59115	0.852	D	0.97962	1.0338	10	0.87932	D	0	-17.6264	15.2538	0.73568	0.0:0.9327:0.0:0.0673	.	158	P10912	GHR_HUMAN	N	158;136;158	ENSP00000230882:T158N;ENSP00000350335:T136N	ENSP00000230882:T158N	T	+	2	0	GHR	42735716	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.232000	0.78116	1.497000	0.48584	0.655000	0.94253	ACT		GHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211605.2	NM_000163	
NDUFAF2	91942	broad.mit.edu	37	5	60368952	60368952	+	Splice_Site	SNP	G	G	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr5:60368952G>A	ENST00000296597.5	+	2	255	c.128G>A	c.(127-129)gGa>gAa	p.G43E	NDUFAF2_ENST00000511107.1_Intron|NDUFAF2_ENST00000512623.1_3'UTR	NM_174889.4	NP_777549.1	Q8N183	MIMIT_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 2	43					negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)	mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)	p.G43E(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|ovary(1)	6		Lung NSC(810;3.36e-05)|Prostate(74;0.0225)|Ovarian(174;0.17)|Breast(144;0.237)				TGTCTTATAGGACAAACTATT	0.308																																					p.G43E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G128A	5						.						70.0	80.0	77.0					5																	60368952		2203	4296	6499	60404709	SO:0001630	splice_region_variant	91942	exon2			AB183433	CCDS3979.1	5q12.1	2012-10-12	2012-05-08	2008-02-15	ENSG00000164182	ENSG00000164182		"""Mitochondrial respiratory chain complex assembly factors"""	28086	protein-coding gene	gene with protein product	"""Myc-induced mitochondrial protein"""	609653	"""NDUFA12-like"", ""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 2"""	NDUFA12L		15774466, 16200211, 17383918	Standard	NM_174889		Approved	B17.2L, MMTN, mimitin	uc003jsp.4	Q8N183	OTTHUMG00000131221	ENST00000296597.5:c.128-1G>A	5.37:g.60368952G>A		Somatic		Capture	Illumina HiSeq	Phase_I	60404709	NM_174889	A8K5I1	Missense_Mutation	SNP	ENST00000296597.5	37	CCDS3979.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	20.9|20.9	4.073152|4.073152	0.76415|0.76415	.|.	.|.	ENSG00000164182|ENSG00000164182	ENST00000502658|ENST00000296597	.|T	.|0.38401	.|1.14	5.44|5.44	5.44|5.44	0.79542|0.79542	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.71821|0.71821	0.3385|0.3385	H|H	0.95365|0.95365	3.66|3.66	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	T|T	0.80630|0.80630	-0.1297|-0.1297	5|9	.|.	.|.	.|.	.|.	16.5428|16.5428	0.84406|0.84406	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|43	.|Q8N183	.|MIMIT_HUMAN	N|E	17|43	.|ENSP00000296597:G43E	.|.	D|G	+|+	1|2	0|0	NDUFAF2|NDUFAF2	60404709|60404709	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.937000|0.937000	0.57800|0.57800	5.541000|5.541000	0.67212|0.67212	2.692000|2.692000	0.91855|0.91855	0.650000|0.650000	0.86243|0.86243	GAC|GGA		NDUFAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253965.1	NM_174889	Missense_Mutation
COL23A1	91522	broad.mit.edu	37	5	177695738	177695738	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr5:177695738C>T	ENST00000390654.3	-	7	845	c.488G>A	c.(487-489)gGg>gAg	p.G163E	COL23A1_ENST00000407622.1_Missense_Mutation_p.G127E	NM_173465.3	NP_775736.2	Q86Y22	CONA1_HUMAN	collagen, type XXIII, alpha 1	163	Collagen-like 1.|Gly-rich.				collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G163E(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)		TACCTTTTCCCCTTTCGGGCC	0.562																																					p.G163E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G488A	5						.						67.0	70.0	69.0					5																	177695738		1978	4159	6137	177628344	SO:0001583	missense	91522	exon7			AL137461	CCDS4436.1	5q35.3	2013-01-16			ENSG00000050767	ENSG00000050767		"""Collagens"""	22990	protein-coding gene	gene with protein product		610043				12644459	Standard	NM_173465		Approved	DKFZp434K0621	uc021yiz.1	Q86Y22	OTTHUMG00000130890	ENST00000390654.3:c.488G>A	5.37:g.177695738C>T	ENSP00000375069:p.Gly163Glu	Somatic		Capture	Illumina HiSeq	Phase_I	177628344	NM_173465	Q8IVR4|Q9NT93	Missense_Mutation	SNP	ENST00000390654.3	37	CCDS4436.1	.	.	.	.	.	.	.	.	.	.	C	15.03	2.711494	0.48517	.	.	ENSG00000050767	ENST00000390654;ENST00000407622	D;D	0.99619	-6.28;-6.28	4.9	4.02	0.46733	.	0.290122	0.26840	N	0.022223	D	0.99796	0.9913	H	0.99573	4.635	0.46203	D	0.998927	D	0.89917	1.0	D	0.97110	1.0	D	0.97382	0.9983	10	0.87932	D	0	-1.0363	9.4524	0.38734	0.0:0.9007:0.0:0.0993	.	163	Q86Y22	CONA1_HUMAN	E	163;127	ENSP00000375069:G163E;ENSP00000385092:G127E	ENSP00000375069:G163E	G	-	2	0	COL23A1	177628344	1.000000	0.71417	0.998000	0.56505	0.927000	0.56198	4.520000	0.60524	1.198000	0.43158	0.555000	0.69702	GGG		COL23A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253475.1	NM_173465	
SCML4	256380	broad.mit.edu	37	6	108066254	108066254	+	Missense_Mutation	SNP	C	C	T	rs555376188		TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr6:108066254C>T	ENST00000369020.3	-	5	826	c.581G>A	c.(580-582)cGa>cAa	p.R194Q	SCML4_ENST00000369021.3_Missense_Mutation_p.R165Q|SCML4_ENST00000369022.2_Missense_Mutation_p.R136Q|SCML4_ENST00000479803.1_5'Flank	NM_198081.3	NP_932347.2	Q8N228	SCML4_HUMAN	sex comb on midleg-like 4 (Drosophila)	194					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R165Q(2)		endometrium(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(1)	25		all_cancers(87;3.26e-06)|Acute lymphoblastic leukemia(125;3.08e-08)|all_hematologic(75;1.15e-06)|all_epithelial(87;0.00142)|Colorectal(196;0.0316)		BRCA - Breast invasive adenocarcinoma(108;0.01)|Epithelial(106;0.0509)|all cancers(137;0.0586)|OV - Ovarian serous cystadenocarcinoma(136;0.0758)		CAGGAGGCTTCGGCACAGCTT	0.587																																					p.R194Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G581A	6						.						65.0	55.0	59.0					6																	108066254		2203	4300	6503	108172947	SO:0001583	missense	256380	exon5				CCDS5060.2, CCDS69163.1, CCDS75500.1	6q21	2013-01-10			ENSG00000146285	ENSG00000146285		"""Sterile alpha motif (SAM) domain containing"""	21397	protein-coding gene	gene with protein product							Standard	NM_001286409		Approved	dJ47M23.1	uc010kdf.3	Q8N228	OTTHUMG00000015313	ENST00000369020.3:c.581G>A	6.37:g.108066254C>T	ENSP00000358016:p.Arg194Gln	Somatic		Capture	Illumina HiSeq	Phase_I	108172947	NM_198081	B0QZ10|B0QZ11|B7ZBX3|Q5JXD0|Q5T0T6|Q8IYY6	Missense_Mutation	SNP	ENST00000369020.3	37	CCDS5060.2	.	.	.	.	.	.	.	.	.	.	C	15.66	2.900077	0.52227	.	.	ENSG00000146285	ENST00000369022;ENST00000369020;ENST00000369021;ENST00000440927	T;T;T;T	0.41758	0.99;0.99;0.99;0.99	5.38	3.44	0.39384	.	0.169399	0.53938	N	0.000054	T	0.14700	0.0355	L	0.37750	1.13	0.58432	D	0.999999	B;B;P	0.39003	0.393;0.327;0.654	B;B;B	0.35312	0.081;0.053;0.2	T	0.03662	-1.1015	10	0.11794	T	0.64	.	12.8262	0.57721	0.0:0.8468:0.0:0.1532	.	194;194;165	B4E0X3;Q8N228;Q8N228-3	.;SCML4_HUMAN;.	Q	136;194;165;165	ENSP00000358018:R136Q;ENSP00000358016:R194Q;ENSP00000358017:R165Q;ENSP00000404688:R165Q	ENSP00000358016:R194Q	R	-	2	0	SCML4	108172947	1.000000	0.71417	0.996000	0.52242	0.946000	0.59487	2.326000	0.43849	1.475000	0.48197	0.655000	0.94253	CGA		SCML4-005	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000041700.3	XM_171128	
SOGA3	387104	broad.mit.edu	37	6	127796951	127796951	+	Silent	SNP	C	C	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr6:127796951C>T	ENST00000525778.1	-	6	2965	c.2220G>A	c.(2218-2220)tcG>tcA	p.S740S	SOGA3_ENST00000556132.1_Silent_p.S740S|SOGA3_ENST00000465909.2_Silent_p.S740S|SOGA3_ENST00000474293.2_5'Flank|SOGA3_ENST00000481848.2_Silent_p.S740S|SOGA3_ENST00000368268.2_Silent_p.S740S			Q5TF21	SOGA3_HUMAN	SOGA family member 3	740					regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)		p.S740S(1)									TGCCCAGGTGCGAGGCCAGGT	0.687																																					p.S740S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2220A	6						.						54.0	61.0	59.0					6																	127796951		2173	4279	6452	127838644	SO:0001819	synonymous_variant	387104	exon6			AK096490	CCDS43505.1	6q22.33	2013-03-28	2012-02-27	2012-02-27	ENSG00000214338	ENSG00000214338			21494	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 174"""	C6orf174			Standard	NM_001012279		Approved	dJ403A15.3	uc003qbd.3	Q5TF21	OTTHUMG00000166438	ENST00000525778.1:c.2220G>A	6.37:g.127796951C>T		Somatic		Capture	Illumina HiSeq	Phase_I	127838644	NM_001012279		Silent	SNP	ENST00000525778.1	37	CCDS43505.1																																																																																				SOGA3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388246.1	NM_001012279	
ABHD16A	7920	broad.mit.edu	37	6	31656804	31656804	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr6:31656804G>A	ENST00000395952.3	-	13	1336	c.1174C>T	c.(1174-1176)Cca>Tca	p.P392S	XXbac-BPG32J3.20_ENST00000461287.1_3'UTR|ABHD16A_ENST00000440843.2_Missense_Mutation_p.P359S|ABHD16A_ENST00000375842.4_Missense_Mutation_p.P173S|ABHD16A_ENST00000471644.1_5'UTR	NM_021160.2	NP_066983.1	O95870	ABHGA_HUMAN	abhydrolase domain containing 16A	392						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)	p.P392S(1)		endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)	10						CAGCTGTCTGGCATGACCTTC	0.592																																					p.P359S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1075T	6						.						61.0	50.0	54.0					6																	31656804		2203	4300	6503	31764783	SO:0001583	missense	7920	exon11			AF129756	CCDS4713.1, CCDS54988.1	6p21.3	2013-01-17	2010-12-09	2010-12-09	ENSG00000204427	ENSG00000204427		"""Abhydrolase domain containing"""	13921	protein-coding gene	gene with protein product		142620	"""HLA-B associated transcript 5"""	BAT5		2911734, 2813433	Standard	NM_021160		Approved	NG26, D6S82E	uc003nvy.2	O95870	OTTHUMG00000031177	ENST00000395952.3:c.1174C>T	6.37:g.31656804G>A	ENSP00000379282:p.Pro392Ser	Somatic		Capture	Illumina HiSeq	Phase_I	31764783	NM_001177515	A2BEY3|B7Z4R6|Q5SRR1|Q5SRR2|Q8WYH0|Q9NW33	Missense_Mutation	SNP	ENST00000395952.3	37	CCDS4713.1	.	.	.	.	.	.	.	.	.	.	G	31	5.075087	0.94000	.	.	ENSG00000204427	ENST00000395952;ENST00000375842;ENST00000440843	T;T;T	0.58797	0.31;0.31;0.31	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.77691	0.4168	M	0.89601	3.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.80743	-0.1246	10	0.54805	T	0.06	-14.0544	17.1454	0.86765	0.0:0.0:1.0:0.0	.	359;392	B7Z4R6;O95870	.;ABHGA_HUMAN	S	392;173;359	ENSP00000379282:P392S;ENSP00000365002:P173S;ENSP00000410347:P359S	ENSP00000365002:P173S	P	-	1	0	ABHD16A	31764783	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	8.079000	0.89508	2.652000	0.90054	0.462000	0.41574	CCA		ABHD16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076342.4		
FGD2	221472	broad.mit.edu	37	6	36979618	36979618	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr6:36979618G>A	ENST00000274963.8	+	4	686	c.515G>A	c.(514-516)cGc>cAc	p.R172H		NM_173558.3	NP_775829.2	Q7Z6J4	FGD2_HUMAN	FYVE, RhoGEF and PH domain containing 2	172	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.R172H(1)		central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	25						CTGCAGCGGCGCCTGGACGAC	0.617																																					p.R172H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G515A	6						.						86.0	65.0	72.0					6																	36979618		2203	4300	6503	37087596	SO:0001583	missense	221472	exon4			AK097230	CCDS4829.1	6p21.2	2013-01-10	2004-08-24		ENSG00000146192	ENSG00000146192		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3664	protein-coding gene	gene with protein product		605091	"""FGD1 family, member 2"""			10458911	Standard	NM_173558		Approved	ZFYVE4	uc010jwp.1	Q7Z6J4	OTTHUMG00000014616	ENST00000274963.8:c.515G>A	6.37:g.36979618G>A	ENSP00000274963:p.Arg172His	Somatic		Capture	Illumina HiSeq	Phase_I	37087596	NM_173558	Q5T8I1|Q6P6A8|Q6ZNL5|Q8IZ32|Q8N868|Q9H7M2	Missense_Mutation	SNP	ENST00000274963.8	37	CCDS4829.1	.	.	.	.	.	.	.	.	.	.	G	35	5.541096	0.96474	.	.	ENSG00000146192	ENST00000274963	T	0.35236	1.32	5.69	5.69	0.88448	Dbl homology (DH) domain (5);	0.000000	0.45361	D	0.000362	T	0.65831	0.2729	M	0.90977	3.165	0.53688	D	0.999971	D	0.89917	1.0	D	0.91635	0.999	T	0.73541	-0.3950	10	0.87932	D	0	1.069	19.4149	0.94690	0.0:0.0:1.0:0.0	.	172	Q7Z6J4	FGD2_HUMAN	H	172	ENSP00000274963:R172H	ENSP00000274963:R172H	R	+	2	0	FGD2	37087596	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.676000	0.84012	2.676000	0.91093	0.655000	0.94253	CGC		FGD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040398.2	NM_173558	
RPS6KA2	6196	broad.mit.edu	37	6	166873030	166873030	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr6:166873030G>A	ENST00000265678.4	-	12	1205	c.982C>T	c.(982-984)Cgg>Tgg	p.R328W	RPS6KA2-IT1_ENST00000416770.1_RNA|RPS6KA2_ENST00000481261.2_Missense_Mutation_p.R239W|RPS6KA2_ENST00000503859.1_Missense_Mutation_p.R336W|RPS6KA2_ENST00000510118.1_Missense_Mutation_p.R353W|RPS6KA2_ENST00000405189.3_Missense_Mutation_p.R239W	NM_021135.4	NP_066958.2	Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 2	328	AGC-kinase C-terminal.				axon guidance (GO:0007411)|brain renin-angiotensin system (GO:0002035)|cardiac muscle cell apoptotic process (GO:0010659)|cellular response to carbohydrate stimulus (GO:0071322)|heart contraction (GO:0060047)|heart development (GO:0007507)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of meiosis (GO:0045835)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oocyte maturation (GO:0001556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of gene expression (GO:0010628)|regulation of protein processing (GO:0070613)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ribosomal protein S6 kinase activity (GO:0004711)	p.R336W(1)|p.R328W(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)		ATCTCCTTCCGGTACAGCGTC	0.567																																					p.R328W												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C982T	6						.						154.0	115.0	128.0					6																	166873030		2203	4300	6503	166793020	SO:0001583	missense	6196	exon12			L07598	CCDS5294.1, CCDS34570.1	6q27	2011-04-05	2002-08-29		ENSG00000071242	ENSG00000071242			10431	protein-coding gene	gene with protein product		601685	"""ribosomal protein S6 kinase, 90kD, polypeptide 2"""			8141249	Standard	NM_001006932		Approved	RSK, RSK3, HU-2	uc003qvc.1	Q15349	OTTHUMG00000016007	ENST00000265678.4:c.982C>T	6.37:g.166873030G>A	ENSP00000265678:p.Arg328Trp	Somatic		Capture	Illumina HiSeq	Phase_I	166793020	NM_021135	B3KTK9|Q15419|Q59GJ3|Q5TI68|Q96J38|Q9UJN5	Missense_Mutation	SNP	ENST00000265678.4	37	CCDS5294.1	.	.	.	.	.	.	.	.	.	.	G	15.36	2.809961	0.50421	.	.	ENSG00000071242	ENST00000265678;ENST00000510118;ENST00000503859;ENST00000481261;ENST00000405189	T;T;T;T;T	0.52057	0.68;0.68;0.68;0.68;0.68	5.0	-1.16	0.09678	AGC-kinase, C-terminal (2);Protein kinase-like domain (1);	0.055818	0.64402	D	0.000002	T	0.64305	0.2586	H	0.96398	3.815	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.994	D;D;B	0.66847	0.947;0.939;0.304	T	0.70475	-0.4861	10	0.87932	D	0	.	8.9876	0.36003	0.0851:0.0:0.3782:0.5367	.	353;336;328	F2Z2J1;Q15349-3;Q15349	.;.;KS6A2_HUMAN	W	328;353;336;239;239	ENSP00000265678:R328W;ENSP00000422435:R353W;ENSP00000427015:R336W;ENSP00000422484:R239W;ENSP00000386050:R239W	ENSP00000265678:R328W	R	-	1	2	RPS6KA2	166793020	0.967000	0.33354	0.995000	0.50966	0.511000	0.34104	-0.001000	0.12947	-0.167000	0.10871	0.563000	0.77884	CGG		RPS6KA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043075.3	NM_021135	
SLC13A1	6561	broad.mit.edu	37	7	122809382	122809382	+	Silent	SNP	G	G	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr7:122809382G>A	ENST00000194130.2	-	4	412	c.373C>T	c.(373-375)Ctg>Ttg	p.L125L	SLC13A1_ENST00000539873.1_Silent_p.L61L	NM_022444.3	NP_071889.2	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 1	125					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)	p.L125L(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	45					Succinic acid(DB00139)	ATGAACCCCAGCGTCAGCCTG	0.488																																					p.L125L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C373T	7						.						89.0	87.0	88.0					7																	122809382		2203	4300	6503	122596618	SO:0001819	synonymous_variant	6561	exon4				CCDS5786.1	7q31.32	2013-07-18	2013-07-18		ENSG00000081800	ENSG00000081800		"""Solute carriers"""	10916	protein-coding gene	gene with protein product		606193	"""solute carrier family 13 (sodium/sulphate symporters), member 1"""			11161786	Standard	NM_022444		Approved	NaSi-1, NAS1	uc003vkm.3	Q9BZW2	OTTHUMG00000157087	ENST00000194130.2:c.373C>T	7.37:g.122809382G>A		Somatic		Capture	Illumina HiSeq	Phase_I	122596618	NM_022444	Q9H5Z0	Silent	SNP	ENST00000194130.2	37	CCDS5786.1																																																																																				SLC13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347404.1	NM_022444	
CPA1	1357	broad.mit.edu	37	7	130023270	130023270	+	Silent	SNP	C	C	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr7:130023270C>T	ENST00000011292.3	+	5	672	c.522C>T	c.(520-522)atC>atT	p.I174I	CPA1_ENST00000484324.1_Silent_p.I86I	NM_001868.2	NP_001859.1	P15085	CBPA1_HUMAN	carboxypeptidase A1 (pancreatic)	174					proteolysis (GO:0006508)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.I174I(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)	21	Melanoma(18;0.0435)					CCATCTGGATCGACACGGGCA	0.617																																					p.I174I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C522T	7						.						52.0	56.0	55.0					7																	130023270		2203	4300	6503	129810506	SO:0001819	synonymous_variant	1357	exon5				CCDS5820.1	7q32	2012-02-10			ENSG00000091704	ENSG00000091704	3.4.17.1		2296	protein-coding gene	gene with protein product	"""pancreatic carboxypeptidase A"""	114850		CPA			Standard	NM_001868		Approved		uc003vpx.3	P15085	OTTHUMG00000157826	ENST00000011292.3:c.522C>T	7.37:g.130023270C>T		Somatic		Capture	Illumina HiSeq	Phase_I	129810506	NM_001868	A4D1M1|Q53XU0|Q9BS67|Q9UCF2	Silent	SNP	ENST00000011292.3	37	CCDS5820.1																																																																																				CPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349736.2	NM_001868	
CALD1	800	broad.mit.edu	37	7	134632355	134632355	+	Silent	SNP	C	C	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr7:134632355C>T	ENST00000361675.2	+	8	1858	c.1629C>T	c.(1627-1629)cgC>cgT	p.R543R	CALD1_ENST00000361901.2_Silent_p.R288R|CALD1_ENST00000543443.1_Silent_p.R293R|CALD1_ENST00000495522.1_Silent_p.R308R|CALD1_ENST00000361388.2_Silent_p.R314R|CALD1_ENST00000424922.1_Silent_p.R282R|CALD1_ENST00000422748.1_Silent_p.R314R|CALD1_ENST00000393118.2_Silent_p.R308R|CALD1_ENST00000417172.1_Silent_p.R288R			Q05682	CALD1_HUMAN	caldesmon 1	543	Poly-Arg.				cellular component movement (GO:0006928)|muscle contraction (GO:0006936)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|calmodulin binding (GO:0005516)|tropomyosin binding (GO:0005523)	p.R543R(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(15)|lung(10)	43						GTCGTCGTCGCGGGGAGACCG	0.627																																					p.R314R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C942T	7						.						23.0	23.0	23.0					7																	134632355		2175	4268	6443	134282895	SO:0001819	synonymous_variant	800	exon8			M64110	CCDS5834.1, CCDS5835.1, CCDS5836.1, CCDS47716.1, CCDS47717.1, CCDS5836.2	7q33	2007-04-23			ENSG00000122786	ENSG00000122786			1441	protein-coding gene	gene with protein product		114213				1885618	Standard	NM_004342		Approved	CDM, H-CAD, L-CAD	uc003vrz.3	Q05682	OTTHUMG00000155407	ENST00000361675.2:c.1629C>T	7.37:g.134632355C>T		Somatic		Capture	Illumina HiSeq	Phase_I	134282895	NM_033157	A8K0X1|Q13978|Q13979|Q14741|Q14742|Q9UD91	Silent	SNP	ENST00000361675.2	37	CCDS5835.1																																																																																				CALD1-005	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339939.1	NM_033138	
NUP205	23165	broad.mit.edu	37	7	135301969	135301969	+	Missense_Mutation	SNP	C	C	T	rs202152654		TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr7:135301969C>T	ENST00000285968.6	+	26	3690	c.3664C>T	c.(3664-3666)Cgg>Tgg	p.R1222W		NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	1222					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)	p.R1222W(1)		breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						CAAGAATTTACGGGGACAGAC	0.418													C|||	1	0.000199681	0.0	0.0	5008	,	,		15659	0.001		0.0	False		,,,				2504	0.0				p.R1222W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3664T	7						.						117.0	113.0	115.0					7																	135301969		2203	4300	6503	134952509	SO:0001583	missense	23165	exon26			D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.3664C>T	7.37:g.135301969C>T	ENSP00000285968:p.Arg1222Trp	Somatic		Capture	Illumina HiSeq	Phase_I	134952509	NM_015135	A6H8X3|Q86YC1	Missense_Mutation	SNP	ENST00000285968.6	37	CCDS34759.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	22.0	4.233981	0.79688	.	.	ENSG00000155561	ENST00000285968	T	0.31510	1.49	5.68	4.72	0.59763	.	0.107751	0.64402	D	0.000006	T	0.24005	0.0581	N	0.14661	0.345	0.80722	D	1	P	0.43431	0.807	B	0.43360	0.417	T	0.07271	-1.0781	10	0.66056	D	0.02	-2.8663	15.4662	0.75403	0.2283:0.7717:0.0:0.0	.	1222	Q92621	NU205_HUMAN	W	1222	ENSP00000285968:R1222W	ENSP00000285968:R1222W	R	+	1	2	NUP205	134952509	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.809000	0.62591	2.679000	0.91253	0.557000	0.71058	CGG		NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340358.1		
SDK1	221935	broad.mit.edu	37	7	3678739	3678739	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr7:3678739G>A	ENST00000404826.2	+	3	701	c.562G>A	c.(562-564)Gca>Aca	p.A188T	SDK1_ENST00000389531.3_Missense_Mutation_p.A188T	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	188					cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.A188T(1)		NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		AGTTCAAGTCGCATGTATGTG	0.438																																					p.A188T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G562A	7						.						58.0	50.0	53.0					7																	3678739		2203	4300	6503	3645265	SO:0001583	missense	221935	exon3			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.562G>A	7.37:g.3678739G>A	ENSP00000385899:p.Ala188Thr	Somatic		Capture	Illumina HiSeq	Phase_I	3645265	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	37	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	G	18.08	3.544099	0.65198	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.42131	0.98;0.98	4.89	4.0	0.46444	.	0.000000	0.44097	D	0.000482	T	0.67869	0.2939	M	0.91300	3.195	0.54753	D	0.999988	D	0.76494	0.999	D	0.63793	0.918	T	0.75554	-0.3277	10	0.66056	D	0.02	.	12.838	0.57784	0.0:0.0:0.8361:0.1639	.	188	Q7Z5N4	SDK1_HUMAN	T	188	ENSP00000385899:A188T;ENSP00000374182:A188T	ENSP00000374182:A188T	A	+	1	0	SDK1	3645265	1.000000	0.71417	0.851000	0.33527	0.484000	0.33280	8.679000	0.91220	1.151000	0.42436	0.563000	0.77884	GCA		SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
DNAH11	8701	broad.mit.edu	37	7	21775307	21775307	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr7:21775307A>T	ENST00000409508.3	+	46	7521	c.7490A>T	c.(7489-7491)gAg>gTg	p.E2497V	DNAH11_ENST00000328843.6_Missense_Mutation_p.E2504V	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2504	AAA 3. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.E2504V(1)		NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						TATTTCATGGAGTTGTTGCTT	0.438									Kartagener syndrome																												p.G2504G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A7512T	7						.						99.0	93.0	95.0					7																	21775307		1877	4122	5999	21741832	SO:0001583	missense	8701	exon46	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.7490A>T	7.37:g.21775307A>T	ENSP00000475939:p.Glu2497Val	Somatic		Capture	Illumina HiSeq	Phase_I	21741832	NM_003777	Q9UJ82	Missense_Mutation	SNP	ENST00000409508.3	37		.	.	.	.	.	.	.	.	.	.	A	17.46	3.395364	0.62066	.	.	ENSG00000105877	ENST00000328843	T	0.39787	1.06	5.03	5.03	0.67393	.	0.156920	0.53938	D	0.000041	T	0.49864	0.1582	.	.	.	0.43579	D	0.995916	P	0.36438	0.553	P	0.44732	0.459	T	0.54833	-0.8234	9	0.72032	D	0.01	.	15.0661	0.71996	1.0:0.0:0.0:0.0	.	2504	Q96DT5	DYH11_HUMAN	V	2504	ENSP00000330671:E2504V	ENSP00000330671:E2504V	E	+	2	0	DNAH11	21741832	1.000000	0.71417	0.018000	0.16275	0.417000	0.31264	6.935000	0.75886	2.022000	0.59522	0.533000	0.62120	GAG		DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777	
HOXA2	3199	broad.mit.edu	37	7	27141044	27141044	+	Silent	SNP	C	C	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr7:27141044C>A	ENST00000222718.5	-	2	742	c.432G>T	c.(430-432)cgG>cgT	p.R144R	HOTAIRM1_ENST00000425358.2_RNA|HOTAIRM1_ENST00000429611.3_RNA|HOTAIRM1_ENST00000593300.1_RNA|HOTAIRM1_ENST00000434063.3_RNA|HOTAIRM1_ENST00000428939.3_RNA	NM_006735.3	NP_006726.1	O43364	HXA2_HUMAN	homeobox A2	144					anterior/posterior pattern specification (GO:0009952)|brain segmentation (GO:0035284)|cell fate determination (GO:0001709)|dorsal/ventral pattern formation (GO:0009953)|embryonic viscerocranium morphogenesis (GO:0048703)|middle ear morphogenesis (GO:0042474)|motor neuron axon guidance (GO:0008045)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoblast development (GO:0002076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|rhombomere 2 development (GO:0021568)|rhombomere 3 morphogenesis (GO:0021658)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R144R(1)		breast(3)|cervix(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(1)	22						TTCTCAGGCGCCGCGATCCCC	0.552																																					p.R144R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G432T	7						.						22.0	24.0	23.0					7																	27141044		2203	4300	6503	27107569	SO:0001819	synonymous_variant	3199	exon2				CCDS5403.1	7p15.2	2011-06-20	2005-12-22		ENSG00000105996	ENSG00000105996		"""Homeoboxes / ANTP class : HOXL subclass"""	5103	protein-coding gene	gene with protein product		604685	"""homeo box A2"""	HOX1K		1358459	Standard	NM_006735		Approved		uc003syh.3	O43364	OTTHUMG00000023208	ENST00000222718.5:c.432G>T	7.37:g.27141044C>A		Somatic		Capture	Illumina HiSeq	Phase_I	27107569	NM_006735	A1L4K3|B2RMW3	Silent	SNP	ENST00000222718.5	37	CCDS5403.1																																																																																				HOXA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358508.2		
PPP1R17	10842	broad.mit.edu	37	7	31735210	31735210	+	Silent	SNP	G	G	A	rs546448910		TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr7:31735210G>A	ENST00000342032.3	+	3	838	c.210G>A	c.(208-210)gcG>gcA	p.A70A	PPP1R17_ENST00000409146.3_Intron	NM_006658.4	NP_006649.2	O96001	PPR17_HUMAN	protein phosphatase 1, regulatory subunit 17	70					central nervous system development (GO:0007417)|intracellular signal transduction (GO:0035556)|regulation of phosphatase activity (GO:0010921)		protein serine/threonine phosphatase inhibitor activity (GO:0004865)	p.A70A(1)									ATACACCGGCGCTGCACATCC	0.448													G|||	1	0.000199681	0.0	0.0	5008	,	,		16082	0.001		0.0	False		,,,				2504	0.0				p.A70A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G210A	7						.						133.0	129.0	130.0					7																	31735210		2203	4300	6503	31701735	SO:0001819	synonymous_variant	10842	exon3			AF071789	CCDS5436.1, CCDS47570.1	7p15	2012-04-17	2011-10-11	2011-10-11	ENSG00000106341	ENSG00000106341		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16973	protein-coding gene	gene with protein product	"""G-substrate"""	604088	"""chromosome 7 open reading frame 16"""	C7orf16		10051666, 9920894	Standard	NM_006658		Approved	GSBS	uc003tcl.3	O96001	OTTHUMG00000128629	ENST00000342032.3:c.210G>A	7.37:g.31735210G>A		Somatic		Capture	Illumina HiSeq	Phase_I	31701735	NM_006658	B4DE58|Q9UDQ0	Silent	SNP	ENST00000342032.3	37	CCDS5436.1																																																																																				PPP1R17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250498.1	NM_006658	
SGCE	8910	broad.mit.edu	37	7	94228194	94228194	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr7:94228194C>T	ENST00000265735.7	-	9	1256	c.1146G>A	c.(1144-1146)tgG>tgA	p.W382*	SGCE_ENST00000428696.2_Nonsense_Mutation_p.W373*|SGCE_ENST00000445866.2_Nonsense_Mutation_p.W382*|SGCE_ENST00000437425.2_Nonsense_Mutation_p.W341*|SGCE_ENST00000415788.2_Nonsense_Mutation_p.W418*|SGCE_ENST00000447873.1_Nonsense_Mutation_p.W373*	NM_003919.2	NP_003910.1	O43556	SGCE_HUMAN	sarcoglycan, epsilon	382					cell-matrix adhesion (GO:0007160)|muscle organ development (GO:0007517)	cytoskeleton (GO:0005856)|dendrite membrane (GO:0032590)|dystrophin-associated glycoprotein complex (GO:0016010)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcoglycan complex (GO:0016012)	calcium ion binding (GO:0005509)	p.W382*(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|skin(1)	14	all_cancers(62;8.26e-10)|all_epithelial(64;5.59e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			TTGACAGGGGCCATGCTATCT	0.443																																					p.W382X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1146A	7						.						194.0	175.0	182.0					7																	94228194		2203	4300	6503	94066130	SO:0001587	stop_gained	8910	exon9			AF036364	CCDS5637.1, CCDS47642.1, CCDS47643.1, CCDS75634.1	7q21.3	2014-09-17			ENSG00000127990	ENSG00000127990			10808	protein-coding gene	gene with protein product		604149		DYT11		9475163, 9405466	Standard	NM_001099401		Approved		uc003unn.2	O43556	OTTHUMG00000022828	ENST00000265735.7:c.1146G>A	7.37:g.94228194C>T	ENSP00000265735:p.Trp382*	Somatic		Capture	Illumina HiSeq	Phase_I	94066130	NM_003919	B2R8N2|D6W5Q8|E9PF60|G5E9K6|Q6L8P0|Q75MH8|Q8NFG8|Q8WW28	Nonsense_Mutation	SNP	ENST00000265735.7	37	CCDS5637.1	.	.	.	.	.	.	.	.	.	.	C	36	5.920816	0.97105	.	.	ENSG00000127990	ENST00000265735;ENST00000445866;ENST00000437425;ENST00000447873;ENST00000428696;ENST00000415788	.	.	.	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-31.1694	19.1084	0.93307	0.0:1.0:0.0:0.0	.	.	.	.	X	382;382;341;373;373;418	.	ENSP00000265735:W382X	W	-	3	0	SGCE	94066130	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	7.349000	0.79376	2.604000	0.88044	0.644000	0.83932	TGG		SGCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255251.2		
SSPO	23145	broad.mit.edu	37	7	149504037	149504037	+	RNA	SNP	A	A	T	rs367788937		TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr7:149504037A>T	ENST00000378016.2	+	0	8861							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GGGCAGCTCTATGCATCAGGA	0.667																																					p.M2957L												.	.	0			c.A8869T	7						.						12.0	15.0	14.0					7																	149504037		2056	4162	6218	149134970			23145	exon57			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149504037A>T		None		Capture	Illumina HiSeq	Phase_I	149134970	NM_198455	Q76B61	Missense_Mutation	SNP	ENST00000378016.2	37																																																																																					SSPO-202	KNOWN	basic	processed_transcript	processed_transcript			
COL14A1	7373	broad.mit.edu	37	8	121344394	121344394	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr8:121344394G>T	ENST00000297848.3	+	41	4944	c.4674G>T	c.(4672-4674)aaG>aaT	p.K1558N	COL14A1_ENST00000247781.3_Missense_Mutation_p.K1463N|COL14A1_ENST00000309791.4_Missense_Mutation_p.K1558N	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1									p.K1558N(1)		NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			TTCCGGGAAAGGATGGATCCT	0.463																																					p.K1558N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4674T	8						.						79.0	78.0	79.0					8																	121344394		2203	4300	6503	121413575	SO:0001583	missense	7373	exon41				CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.4674G>T	8.37:g.121344394G>T	ENSP00000297848:p.Lys1558Asn	Somatic		Capture	Illumina HiSeq	Phase_I	121413575	NM_021110		Missense_Mutation	SNP	ENST00000297848.3	37	CCDS34938.1	.	.	.	.	.	.	.	.	.	.	G	10.77	1.443296	0.25987	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781	D;D;D	0.94232	-3.38;-3.38;-3.38	5.14	-0.0559	0.13807	.	0.134244	0.64402	D	0.000003	D	0.85173	0.5636	N	0.25647	0.755	0.80722	D	1	B	0.16802	0.019	B	0.19946	0.027	T	0.71115	-0.4686	10	0.19147	T	0.46	.	8.8046	0.34929	0.5419:0.0:0.4581:0.0	.	1558	Q05707	COEA1_HUMAN	N	1558;1558;1463	ENSP00000311809:K1558N;ENSP00000297848:K1558N;ENSP00000247781:K1463N	ENSP00000247781:K1463N	K	+	3	2	COL14A1	121413575	0.999000	0.42202	0.993000	0.49108	0.581000	0.36288	0.280000	0.18790	0.033000	0.15463	-0.345000	0.07892	AAG		COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110	
TNFRSF10A	8797	broad.mit.edu	37	8	23056824	23056824	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr8:23056824C>A	ENST00000221132.3	-	8	1033	c.969G>T	c.(967-969)ttG>ttT	p.L323F		NM_003844.3	NP_003835.3	O00220	TR10A_HUMAN	tumor necrosis factor receptor superfamily, member 10a	323					activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|signal transduction (GO:0007165)|TRAIL-activated apoptotic signaling pathway (GO:0036462)	integral component of membrane (GO:0016021)	death receptor activity (GO:0005035)|protease binding (GO:0002020)|receptor activity (GO:0004872)|TRAIL binding (GO:0045569)|transcription factor binding (GO:0008134)	p.L323F(1)		NS(2)|central_nervous_system(3)|endometrium(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(1)|skin(1)	16		Prostate(55;0.0421)|Breast(100;0.14)		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)		TGACACCTGTCAAATCTGCCG	0.582																																					p.L323F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G969T	8						.						78.0	72.0	74.0					8																	23056824		2203	4300	6503	23112769	SO:0001583	missense	8797	exon8			U90875	CCDS6039.1	8p21	2006-02-22			ENSG00000104689	ENSG00000104689		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11904	protein-coding gene	gene with protein product		603611				9311998, 9082980	Standard	NM_003844		Approved	DR4, Apo2, TRAILR-1, CD261	uc003xda.3	O00220	OTTHUMG00000097843	ENST00000221132.3:c.969G>T	8.37:g.23056824C>A	ENSP00000221132:p.Leu323Phe	Somatic		Capture	Illumina HiSeq	Phase_I	23112769	NM_003844	A8K5I4|Q53Y72|Q96E62	Missense_Mutation	SNP	ENST00000221132.3	37	CCDS6039.1	.	.	.	.	.	.	.	.	.	.	C	12.01	1.809410	0.31961	.	.	ENSG00000104689	ENST00000221132	D	0.84516	-1.86	3.12	1.29	0.21616	.	1.733070	0.03579	U	0.229768	D	0.84790	0.5550	L	0.50333	1.59	0.09310	N	1	D	0.61697	0.99	P	0.50537	0.643	T	0.69150	-0.5221	10	0.39692	T	0.17	.	5.1238	0.14875	0.0:0.7189:0.0:0.2811	.	323	O00220	TR10A_HUMAN	F	323	ENSP00000221132:L323F	ENSP00000221132:L323F	L	-	3	2	TNFRSF10A	23112769	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.212000	0.09319	0.331000	0.23511	0.591000	0.81541	TTG		TNFRSF10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215133.2	NM_003844	
FAM135B	51059	broad.mit.edu	37	8	139158276	139158276	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr8:139158276G>A	ENST00000395297.1	-	15	3636	c.3466C>T	c.(3466-3468)Cgg>Tgg	p.R1156W		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	1156								p.R1156W(2)		NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			TTTACCAGCCGGAGGTCTGCA	0.438										HNSCC(54;0.14)																											p.R1156W												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C3466T	8						.						86.0	91.0	89.0					8																	139158276		2203	4300	6503	139227458	SO:0001583	missense	51059	exon15			AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.3466C>T	8.37:g.139158276G>A	ENSP00000378710:p.Arg1156Trp	Somatic		Capture	Illumina HiSeq	Phase_I	139227458	NM_015912	B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	ENST00000395297.1	37	CCDS6375.2	.	.	.	.	.	.	.	.	.	.	G	14.11	2.437532	0.43224	.	.	ENSG00000147724	ENST00000395297	T	0.52526	0.66	5.81	3.97	0.46021	Domain of unknown function DUF676, lipase-like (1);	0.071746	0.56097	D	0.000028	T	0.68961	0.3058	M	0.84773	2.715	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.71371	-0.4613	10	0.87932	D	0	-17.1577	9.9617	0.41699	0.0717:0.0:0.7897:0.1386	.	1156;1156	Q49AJ0-4;Q49AJ0	.;F135B_HUMAN	W	1156	ENSP00000378710:R1156W	ENSP00000378710:R1156W	R	-	1	2	FAM135B	139227458	1.000000	0.71417	0.917000	0.36280	0.570000	0.35934	4.763000	0.62257	0.746000	0.32786	0.655000	0.94253	CGG		FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912	
TRPM3	80036	broad.mit.edu	37	9	73164540	73164540	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chr9:73164540G>T	ENST00000377111.2	-	24	3832	c.3589C>A	c.(3589-3591)Caa>Aaa	p.Q1197K	TRPM3_ENST00000357533.2_Missense_Mutation_p.Q1201K|TRPM3_ENST00000358082.3_Missense_Mutation_p.Q1059K|TRPM3_ENST00000396280.5_Missense_Mutation_p.Q1046K|TRPM3_ENST00000408909.2_Missense_Mutation_p.Q1056K|TRPM3_ENST00000377105.1_Missense_Mutation_p.Q1056K|TRPM3_ENST00000377110.3_Missense_Mutation_p.Q1197K|TRPM3_ENST00000423814.3_Missense_Mutation_p.Q1224K|TRPM3_ENST00000377106.1_Missense_Mutation_p.Q1069K|TRPM3_ENST00000396285.1_Missense_Mutation_p.Q1056K|TRPM3_ENST00000396292.4_Missense_Mutation_p.Q1069K|TRPM3_ENST00000360823.2_Missense_Mutation_p.Q1059K	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	1222					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)	p.Q1069K(1)		NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						TCTATGCATTGCTCTTCAAAG	0.398																																					p.Q1197K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3589A	9						.						151.0	124.0	133.0					9																	73164540		2203	4300	6503	72354360	SO:0001583	missense	80036	exon24			AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.3589C>A	9.37:g.73164540G>T	ENSP00000366315:p.Gln1197Lys	Somatic		Capture	Illumina HiSeq	Phase_I	72354360	NM_001007471	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	ENST00000377111.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.51|19.51	3.840289|3.840289	0.71488|0.71488	.|.	.|.	ENSG00000083067|ENSG00000083067	ENST00000396280|ENST00000377111;ENST00000377110;ENST00000377106;ENST00000360823;ENST00000377105;ENST00000357533;ENST00000408909;ENST00000396285;ENST00000396292;ENST00000358082;ENST00000423814	.|T;T;T;T;T;T;T;T;T;T;T	.|0.35789	.|1.29;1.29;1.29;1.29;1.29;1.29;1.29;1.29;1.29;1.29;1.29	6.05|6.05	6.05|6.05	0.98169|0.98169	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.59891|0.59891	0.2227|0.2227	M|M	0.63843|0.63843	1.955|1.955	0.58432|0.58432	D|D	0.99999|0.99999	.|B;B;D;B;B;D;P;P	.|0.65815	.|0.357;0.198;0.995;0.125;0.243;0.992;0.532;0.94	.|B;B;D;B;B;D;P;P	.|0.79108	.|0.155;0.108;0.992;0.074;0.074;0.912;0.525;0.497	T|T	0.48375|0.48375	-0.9041|-0.9041	5|10	.|0.32370	.|T	.|0.25	-21.4305|-21.4305	20.6013|20.6013	0.99457|0.99457	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1197;1197;1187;1201;1059;1056;1169;1056	.|Q9HCF6-2;Q9HCF6-10;Q9HCF6-4;A2A3F7;A2A3F4;G5E9G1;Q9HCF6-8;A2A3F3	.|.;.;.;.;.;.;.;.	E|K	1045|1197;1197;1069;1059;1056;1201;1056;1056;1069;1059;1224	.|ENSP00000366315:Q1197K;ENSP00000366314:Q1197K;ENSP00000366310:Q1069K;ENSP00000354066:Q1059K;ENSP00000366309:Q1056K;ENSP00000350140:Q1201K;ENSP00000386127:Q1056K;ENSP00000379581:Q1056K;ENSP00000379587:Q1069K;ENSP00000350791:Q1059K;ENSP00000389542:Q1224K	.|ENSP00000350140:Q1201K	A|Q	-|-	2|1	0|0	TRPM3|TRPM3	72354360|72354360	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	9.476000|9.476000	0.97823|0.97823	2.878000|2.878000	0.98634|0.98634	0.650000|0.650000	0.86243|0.86243	GCA|CAA		TRPM3-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000214157.5	NM_206945	
MAMLD1	10046	broad.mit.edu	37	X	149639553	149639553	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3870-01A-01W-0995-10	TCGA-AA-3870-10A-01W-0995-10	g.chrX:149639553C>T	ENST00000370401.2	+	4	2018	c.1708C>T	c.(1708-1710)Ctc>Ttc	p.L570F	MAMLD1_ENST00000426613.2_Missense_Mutation_p.L545F|MAMLD1_ENST00000262858.5_Missense_Mutation_p.L570F|MAMLD1_ENST00000432680.2_Missense_Mutation_p.L545F|MAMLD1_ENST00000455522.2_Missense_Mutation_p.L51F			Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	570					male gonad development (GO:0008584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.L570F(1)|p.L497F(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)	37	Acute lymphoblastic leukemia(192;6.56e-05)					GCCTTCCCTGCTCCACTACCT	0.597																																					p.L545F												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1633T	X						.						91.0	82.0	85.0					X																	149639553		2203	4300	6503	149390211	SO:0001583	missense	10046	exon2			U46023	CCDS14693.2, CCDS55525.1, CCDS55526.1	Xq28	2008-02-05	2008-01-03	2008-01-03	ENSG00000013619	ENSG00000013619			2568	protein-coding gene	gene with protein product		300120	"""chromosome X open reading frame 6"""	CXorf6		9169146, 17086185, 18162467	Standard	NM_001177465		Approved	CG1, F18	uc011mxu.2	Q13495	OTTHUMG00000024157	ENST00000370401.2:c.1708C>T	X.37:g.149639553C>T	ENSP00000359428:p.Leu570Phe	Somatic		Capture	Illumina HiSeq	Phase_I	149390211	NM_001177466	B2RCQ4|B4DG93|B9EGA5	Missense_Mutation	SNP	ENST00000370401.2	37	CCDS14693.2	.	.	.	.	.	.	.	.	.	.	C	16.41	3.115604	0.56505	.	.	ENSG00000013619	ENST00000445612;ENST00000370401;ENST00000432680;ENST00000262858;ENST00000426613;ENST00000455522	T;T;T;T;T	0.77489	-1.1;-1.1;-1.1;-1.1;-1.1	5.58	4.72	0.59763	.	0.187587	0.35870	N	0.002934	D	0.84692	0.5528	M	0.72894	2.215	0.33315	D	0.566587	B;D;P;D	0.89917	0.385;1.0;0.933;1.0	B;D;P;D	0.85130	0.161;0.997;0.479;0.997	D	0.87265	0.2282	10	0.54805	T	0.06	-19.3811	7.0422	0.25027	0.3037:0.6079:0.0:0.0884	.	442;545;545;570	F6WVG1;Q13495-4;Q13495-3;Q13495	.;.;.;MAMD1_HUMAN	F	442;570;545;570;545;51	ENSP00000359428:L570F;ENSP00000414517:L545F;ENSP00000262858:L570F;ENSP00000397438:L545F;ENSP00000389106:L51F	ENSP00000262858:L570F	L	+	1	0	MAMLD1	149390211	1.000000	0.71417	0.993000	0.49108	0.911000	0.54048	1.889000	0.39718	1.122000	0.41944	0.600000	0.82982	CTC		MAMLD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060844.2	NM_005491	
