#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
HPS1	3257	broad.mit.edu	37	10	100177972	100177972	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr10:100177972C>T	ENST00000325103.6	-	19	2133	c.1900G>A	c.(1900-1902)Gac>Aac	p.D634N	HPS1_ENST00000467246.1_5'UTR|HPS1_ENST00000361490.4_Missense_Mutation_p.D634N	NM_000195.3	NP_000186.2	Q92902	HPS1_HUMAN	Hermansky-Pudlak syndrome 1	634					blood coagulation (GO:0007596)|eye pigmentation (GO:0048069)|lysosome organization (GO:0007040)|melanocyte differentiation (GO:0030318)|positive regulation of natural killer cell activation (GO:0032816)|retina development in camera-type eye (GO:0060041)|secretion of lysosomal enzymes (GO:0033299)|visual perception (GO:0007601)	BLOC-3 complex (GO:0031085)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	protein dimerization activity (GO:0046983)	p.D634N(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	23		Colorectal(252;0.234)		Epithelial(162;3.87e-12)|all cancers(201;5.63e-10)		GGCACTGAGTCGTCGGAGAGG	0.612									Hermansky-Pudlak syndrome																												p.D634N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1900A	10						.						143.0	121.0	129.0					10																	100177972		2203	4300	6503	100167962	SO:0001583	missense	3257	exon19	Familial Cancer Database	HPS, HPS1-8	U79136	CCDS7475.1, CCDS7476.1	10q23.1-q23.3	2014-06-18		2002-05-01	ENSG00000107521	ENSG00000107521			5163	protein-coding gene	gene with protein product		604982	"""Hermansky-Pudlak syndrome"""	HPS		8541858, 7573033	Standard	NM_182639		Approved		uc021pwv.1	Q92902	OTTHUMG00000018876	ENST00000325103.6:c.1900G>A	10.37:g.100177972C>T	ENSP00000326649:p.Asp634Asn	Somatic		Capture	Illumina HiSeq	Phase_I	100167962	NM_000195	A8MRT2|O15402|O15502|Q5TAA3|Q8WXE5	Missense_Mutation	SNP	ENST00000325103.6	37	CCDS7475.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.878753	0.91740	.	.	ENSG00000107521	ENST00000325103;ENST00000361490;ENST00000407891	T;T	0.53857	0.6;0.6	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.70072	0.3182	L	0.58101	1.795	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.66069	-0.6015	10	0.34782	T	0.22	.	19.1379	0.93435	0.0:1.0:0.0:0.0	.	601;635	Q92902-2;D3DR62	.;.	N	634;634;601	ENSP00000326649:D634N;ENSP00000355310:D634N	ENSP00000326649:D634N	D	-	1	0	HPS1	100167962	1.000000	0.71417	0.863000	0.33907	0.646000	0.38490	5.661000	0.68025	2.610000	0.88304	0.561000	0.74099	GAC		HPS1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049776.1	NM_000195, NM_182637, NM_182638, NM_182639	
ACSL5	51703	broad.mit.edu	37	10	114164329	114164329	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr10:114164329A>G	ENST00000393081.1	+	4	633	c.326A>G	c.(325-327)aAa>aGa	p.K109R	ACSL5_ENST00000433418.1_Missense_Mutation_p.K109R|RP11-324O2.3_ENST00000594870.2_RNA|ACSL5_ENST00000479936.1_3'UTR|ACSL5_ENST00000354273.4_Missense_Mutation_p.K109R|ACSL5_ENST00000356116.1_Missense_Mutation_p.K165R|RP11-324O2.3_ENST00000449782.2_RNA|ACSL5_ENST00000354655.4_Missense_Mutation_p.K109R|RP11-324O2.3_ENST00000598447.1_RNA	NM_203380.1	NP_976314.1	Q9ULC5	ACSL5_HUMAN	acyl-CoA synthetase long-chain family member 5	109					cellular lipid metabolic process (GO:0044255)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)	p.K165R(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|stomach(1)	21		Colorectal(252;0.117)|Breast(234;0.222)		Epithelial(162;0.0343)|all cancers(201;0.137)		CTATCTTACAAACAGGTAAGT	0.368																																					p.K165R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A494G	10						.						82.0	83.0	82.0					10																	114164329		2203	4300	6503	114154319	SO:0001583	missense	51703	exon4			AB033899	CCDS7572.1, CCDS7573.1	10q25.1-q25.2	2004-06-21	2004-02-19	2004-02-20	ENSG00000197142	ENSG00000197142		"""Acyl-CoA synthetase family"""	16526	protein-coding gene	gene with protein product	"""FACL5 for fatty acid coenzyme A ligase 5"", ""long-chain acyl-CoA synthetase 5"", ""long-chain fatty acid coenzyme A ligase 5"", ""fatty-acid-Coenzyme A ligase, long-chain 5"""	605677	"""fatty-acid-Coenzyme A ligase, long-chain 5"""	FACL5		11127823	Standard	NM_016234		Approved	ACS5, ACS2	uc001kzu.3	Q9ULC5	OTTHUMG00000019060	ENST00000393081.1:c.326A>G	10.37:g.114164329A>G	ENSP00000376796:p.Lys109Arg	Somatic		Capture	Illumina HiSeq	Phase_I	114154319	NM_016234	A6GV77|D3DRB3|Q6UX44|Q9UIU4	Missense_Mutation	SNP	ENST00000393081.1	37	CCDS7573.1	.	.	.	.	.	.	.	.	.	.	A	14.10	2.433721	0.43224	.	.	ENSG00000197142	ENST00000354655;ENST00000393081;ENST00000356116;ENST00000433418;ENST00000354273	T;T;T;T;T	0.37411	1.2;1.2;1.2;1.2;1.2	5.3	4.15	0.48705	AMP-dependent synthetase/ligase (1);	0.113319	0.64402	N	0.000005	T	0.29652	0.0740	L	0.39326	1.205	0.80722	D	1	B;B;B	0.16603	0.018;0.007;0.003	B;B;B	0.22152	0.038;0.011;0.013	T	0.05550	-1.0878	10	0.37606	T	0.19	-13.1525	10.5073	0.44841	0.9216:0.0:0.0784:0.0	.	109;165;109	A6GV77;Q9ULC5-3;Q9ULC5	.;.;ACSL5_HUMAN	R	109;109;165;109;109	ENSP00000346680:K109R;ENSP00000376796:K109R;ENSP00000348429:K165R;ENSP00000403647:K109R;ENSP00000346223:K109R	ENSP00000346223:K109R	K	+	2	0	ACSL5	114154319	1.000000	0.71417	0.996000	0.52242	0.796000	0.44982	4.908000	0.63307	0.948000	0.37687	0.533000	0.62120	AAA		ACSL5-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050386.1	NM_016234	
DMBT1	1755	broad.mit.edu	37	10	124358297	124358297	+	Silent	SNP	A	A	G			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr10:124358297A>G	ENST00000338354.3	+	26	3070	c.2964A>G	c.(2962-2964)gaA>gaG	p.E988E	DMBT1_ENST00000368909.3_Silent_p.E988E|DMBT1_ENST00000368955.3_Silent_p.E978E|DMBT1_ENST00000344338.3_Silent_p.E978E|DMBT1_ENST00000359586.6_Intron|DMBT1_ENST00000330163.4_Silent_p.E489E|DMBT1_ENST00000368956.2_Silent_p.E489E			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	988					defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)	p.E988E(2)		breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TAGGATCTGAATCCAGTTTGG	0.527																																					p.E988E	Ovarian(182;93 2026 18125 22222 38972)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A2964G	10						.						318.0	301.0	307.0					10																	124358297		1962	4163	6125	124348287	SO:0001819	synonymous_variant	1755	exon26				CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.2964A>G	10.37:g.124358297A>G		Somatic		Capture	Illumina HiSeq	Phase_I	124348287	NM_007329	A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Silent	SNP	ENST00000338354.3	37																																																																																					DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406	
FBXO18	84893	broad.mit.edu	37	10	5963427	5963427	+	Silent	SNP	C	C	T	rs17146330	byFrequency	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr10:5963427C>T	ENST00000362091.4	+	15	2332	c.2217C>T	c.(2215-2217)gaC>gaT	p.D739D	FBXO18_ENST00000397269.3_Silent_p.D226D|FBXO18_ENST00000379999.5_Silent_p.D790D	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18	739					DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)	p.D790D(1)		NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						TTAGAGGTGACGCAAAGGGGC	0.458													C|||	54	0.0107827	0.0008	0.0519	5008	,	,		21660	0.0169		0.0	False		,,,				2504	0.0				p.D790D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2370T	10						.	C	,	3,4403	4.2+/-10.8	0,3,2200	120.0	108.0	112.0		2370,2217	-11.7	0.0	10	dbSNP_123	112	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous	FBXO18	NM_032807.3,NM_178150.1	,	0,5,6498	TT,TC,CC		0.0233,0.0681,0.0384	,	790/1095,739/1044	5963427	5,13001	2203	4300	6503	6003433	SO:0001819	synonymous_variant	84893	exon16			AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.2217C>T	10.37:g.5963427C>T		Somatic		Capture	Illumina HiSeq	Phase_I	6003433	NM_032807	Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	Silent	SNP	ENST00000362091.4	37	CCDS7072.1																																																																																				FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046596.1	NM_032807	
SFMBT2	57713	broad.mit.edu	37	10	7214510	7214510	+	Missense_Mutation	SNP	C	C	T	rs374674288		TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr10:7214510C>T	ENST00000361972.4	-	18	2188	c.2098G>A	c.(2098-2100)Gtg>Atg	p.V700M	SFMBT2_ENST00000397167.1_Missense_Mutation_p.V700M	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	700					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)	p.V700M(1)		NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						TTCTTCTGCACGAAAATGGAT	0.607																																					p.V700M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2098A	10						.	C	MET/VAL,MET/VAL	1,4405	2.1+/-5.4	0,1,2202	48.0	49.0	49.0		2098,2098	5.4	1.0	10		49	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	SFMBT2	NM_001018039.1,NM_001029880.2	21,21	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging,probably-damaging	700/895,700/895	7214510	2,13004	2203	4300	6503	7254516	SO:0001583	missense	57713	exon18			AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.2098G>A	10.37:g.7214510C>T	ENSP00000355109:p.Val700Met	Somatic		Capture	Illumina HiSeq	Phase_I	7254516	NM_001029880	A7MD09|Q9HCF5	Missense_Mutation	SNP	ENST00000361972.4	37	CCDS31138.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.948163	0.92593	2.27E-4	1.16E-4	ENSG00000198879	ENST00000361972;ENST00000397167	T;T	0.18338	2.22;2.22	5.37	5.37	0.77165	.	0.056873	0.64402	D	0.000001	T	0.43433	0.1247	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.23013	-1.0200	10	0.49607	T	0.09	.	18.7057	0.91637	0.0:1.0:0.0:0.0	.	700	Q5VUG0	SMBT2_HUMAN	M	700	ENSP00000355109:V700M;ENSP00000380353:V700M	ENSP00000355109:V700M	V	-	1	0	SFMBT2	7254516	1.000000	0.71417	0.985000	0.45067	0.836000	0.47400	7.098000	0.76974	2.508000	0.84585	0.484000	0.47621	GTG		SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046673.1	NM_001029880	
FRMD4A	55691	broad.mit.edu	37	10	13716986	13716986	+	Silent	SNP	C	C	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr10:13716986C>T	ENST00000357447.2	-	16	1544	c.1176G>A	c.(1174-1176)aaG>aaA	p.K392K	FRMD4A_ENST00000358621.4_Silent_p.K377K|FRMD4A_ENST00000378503.1_Silent_p.K392K|RP11-295P9.12_ENST00000609756.1_RNA	NM_018027.3	NP_060497.3	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A	392					establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)		p.K392K(1)		breast(4)|endometrium(9)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	41						CCTGCCTGGACTTCAAGGCAG	0.552																																					p.K392K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1176A	10						.						122.0	103.0	109.0					10																	13716986		2203	4300	6503	13756992	SO:0001819	synonymous_variant	55691	exon16			AB037715	CCDS7101.1	10p14	2004-07-15	2004-07-15	2004-07-15	ENSG00000151474	ENSG00000151474			25491	protein-coding gene	gene with protein product			"""FERM domain containing 4"""	FRMD4		10718198	Standard	NM_018027		Approved	FLJ10210, KIAA1294, bA295P9.4	uc001ims.3	Q9P2Q2	OTTHUMG00000017708	ENST00000357447.2:c.1176G>A	10.37:g.13716986C>T		Somatic		Capture	Illumina HiSeq	Phase_I	13756992	NM_018027	A7E2Y3|Q5T377	Silent	SNP	ENST00000357447.2	37	CCDS7101.1																																																																																				FRMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046889.1	NM_018027	
ITGA8	8516	broad.mit.edu	37	10	15686209	15686209	+	Missense_Mutation	SNP	C	C	T	rs374664941		TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr10:15686209C>T	ENST00000378076.3	-	13	1572	c.1219G>A	c.(1219-1221)Gga>Aga	p.G407R		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	407			G -> R (in RHDA1; the mutant does not localize at the cell membrane). {ECO:0000269|PubMed:24439109}.		brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)	p.G407R(1)		NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						AAAGGCACTCCGATGGCAATG	0.388																																					p.G407R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1219A	10						.	C	ARG/GLY	0,4406		0,0,2203	90.0	75.0	80.0		1219	5.1	0.3	10		80	1,8599	1.2+/-3.3	0,1,4299	no	missense	ITGA8	NM_003638.1	125	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	407/1064	15686209	1,13005	2203	4300	6503	15726215	SO:0001583	missense	8516	exon13			L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.1219G>A	10.37:g.15686209C>T	ENSP00000367316:p.Gly407Arg	Somatic		Capture	Illumina HiSeq	Phase_I	15726215	NM_003638	B0YJ31|Q5VX94	Missense_Mutation	SNP	ENST00000378076.3	37	CCDS31155.1	.	.	.	.	.	.	.	.	.	.	C	16.56	3.157750	0.57368	0.0	1.16E-4	ENSG00000077943	ENST00000378076;ENST00000538044	T	0.36699	1.24	6.02	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.70666	0.3250	H	0.94542	3.55	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.80656	-0.1285	10	0.87932	D	0	.	15.5172	0.75833	0.0:0.9339:0.0:0.0661	.	392;407	F5H818;P53708	.;ITA8_HUMAN	R	407;392	ENSP00000367316:G407R	ENSP00000367316:G407R	G	-	1	0	ITGA8	15726215	0.998000	0.40836	0.315000	0.25238	0.395000	0.30598	3.826000	0.55738	1.568000	0.49683	-0.137000	0.14449	GGA		ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046987.1	NM_003638	
C10orf128	170371	broad.mit.edu	37	10	50369665	50369665	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr10:50369665C>T	ENST00000474718.1	-	5	294	c.272G>A	c.(271-273)cGa>cAa	p.R91Q	C10orf128_ENST00000374153.2_Silent_p.A117A|C10orf128_ENST00000374148.1_Silent_p.A143A|C10orf128_ENST00000374151.3_Silent_p.A143A	NM_001010863.1	NP_001010863.1	Q5T292	CJ128_HUMAN	chromosome 10 open reading frame 128	91						integral component of membrane (GO:0016021)		p.R91Q(1)		breast(1)|large_intestine(1)|lung(1)	3						ATTGTGGTTTCGCCTGCAAAA	0.463											OREG0020181	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R91Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G272A	10						.						127.0	118.0	121.0					10																	50369665		1920	4133	6053	50039671	SO:0001583	missense	170371	exon5			BC031641	CCDS41519.1, CCDS73128.1	10q11.23	2012-06-13			ENSG00000204161	ENSG00000204161			27274	protein-coding gene	gene with protein product						12477932	Standard	NM_001010863		Approved	Em:AC084727.5	uc001jhn.4	Q5T292	OTTHUMG00000018188	ENST00000474718.1:c.272G>A	10.37:g.50369665C>T	ENSP00000417246:p.Arg91Gln	Somatic	969	Capture	Illumina HiSeq	Phase_I	50039671	NM_001010863	A6XND2|Q5T289|Q5T291	Missense_Mutation	SNP	ENST00000474718.1	37	CCDS41519.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.872|1.872	-0.460019|-0.460019	0.04508|0.04508	.|.	.|.	ENSG00000204161|ENSG00000204161	ENST00000453436;ENST00000374149|ENST00000474718	T|T	0.48522|0.42900	0.81|0.96	4.74|4.74	-9.09|-9.09	0.00717|0.00717	.|.	.|.	.|.	.|.	.|.	T|T	0.16727|0.16727	0.0402|0.0402	N|N	0.14661|0.14661	0.345|0.345	0.21861|0.21861	N|N	0.999507|0.999507	.|B	.|0.18610	.|0.029	.|B	.|0.09377	.|0.004	T|T	0.13019|0.13019	-1.0525|-1.0525	7|9	0.24483|0.21540	T|T	0.36|0.41	.|.	4.3296|4.3296	0.11057|0.11057	0.2067:0.2178:0.4801:0.0953|0.2067:0.2178:0.4801:0.0953	.|.	.|91	.|Q5T292	.|CJ128_HUMAN	K|Q	73;75|91	ENSP00000395067:E73K|ENSP00000417246:R91Q	ENSP00000363264:E75K|ENSP00000417246:R91Q	E|R	-|-	1|2	0|0	C10orf128|C10orf128	50039671|50039671	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.004000|0.004000	0.04260|0.04260	-1.235000|-1.235000	0.02928|0.02928	-1.755000|-1.755000	0.01320|0.01320	-1.605000|-1.605000	0.00808|0.00808	GAA|CGA		C10orf128-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047978.1	NM_001010863	
PCDH15	65217	broad.mit.edu	37	10	55839125	55839125	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr10:55839125A>T	ENST00000320301.6	-	17	2451	c.2057T>A	c.(2056-2058)cTg>cAg	p.L686Q	PCDH15_ENST00000395438.1_Missense_Mutation_p.L686Q|PCDH15_ENST00000395445.1_Missense_Mutation_p.L693Q|PCDH15_ENST00000395432.2_Missense_Mutation_p.L649Q|PCDH15_ENST00000414778.1_Missense_Mutation_p.L691Q|PCDH15_ENST00000409834.1_Missense_Mutation_p.L297Q|PCDH15_ENST00000373957.3_Missense_Mutation_p.L664Q|PCDH15_ENST00000395430.1_Missense_Mutation_p.L686Q|PCDH15_ENST00000395446.1_Missense_Mutation_p.L686Q|PCDH15_ENST00000373955.1_Missense_Mutation_p.L686Q|PCDH15_ENST00000373965.2_Missense_Mutation_p.L693Q|PCDH15_ENST00000361849.3_Missense_Mutation_p.L686Q|PCDH15_ENST00000437009.1_Missense_Mutation_p.L615Q|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395433.1_Missense_Mutation_p.L664Q	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	686	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)	p.L686Q(1)|p.L691Q(1)		NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TGTGATGATCAGAATGTAGCG	0.423										HNSCC(58;0.16)																											p.L649Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T1946A	10						.						255.0	227.0	236.0					10																	55839125		2203	4300	6503	55509131	SO:0001583	missense	65217	exon16			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.2057T>A	10.37:g.55839125A>T	ENSP00000322604:p.Leu686Gln	Somatic		Capture	Illumina HiSeq	Phase_I	55509131	NM_001142767	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	37	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	A	24.3	4.517022	0.85495	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395446;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000373957;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.74421	-0.84;-0.84;-0.84;-0.84;-0.84;0.26;-0.84;-0.84;-0.84;-0.84;-0.84;-0.84;-0.37;-0.84	5.9	5.9	0.94986	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.92097	0.7495	H	0.99058	4.415	0.49213	D	0.999765	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	0.999;1.0;1.0;1.0;0.999;1.0;0.999;0.999;0.999;1.0;0.999;0.999;0.997;1.0;1.0	D	0.95140	0.8263	9	0.87932	D	0	.	15.9796	0.80097	1.0:0.0:0.0:0.0	.	664;686;686;691;615;649;686;686;693;693;686;691;686;664;686	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;A2A3D8;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	Q	693;691;686;686;297;693;686;649;686;664;664;686;686;691;615;686	ENSP00000363076:L693Q;ENSP00000410304:L691Q;ENSP00000378826:L686Q;ENSP00000386693:L297Q;ENSP00000378832:L693Q;ENSP00000378833:L686Q;ENSP00000378820:L649Q;ENSP00000354950:L686Q;ENSP00000378821:L664Q;ENSP00000363068:L664Q;ENSP00000322604:L686Q;ENSP00000378818:L686Q;ENSP00000412628:L615Q;ENSP00000363066:L686Q	ENSP00000322604:L686Q	L	-	2	0	PCDH15	55509131	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.446000	0.73460	2.259000	0.74868	0.482000	0.46254	CTG		PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	
LRRC20	55222	broad.mit.edu	37	10	72100454	72100454	+	Silent	SNP	C	C	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr10:72100454C>T	ENST00000355790.4	-	3	564	c.87G>A	c.(85-87)ctG>ctA	p.L29L	LRRC20_ENST00000395010.1_Silent_p.L29L|LRRC20_ENST00000358141.2_Intron|LRRC20_ENST00000373224.1_Silent_p.L29L|LRRC20_ENST00000395011.1_Intron	NM_001278212.1|NM_001278214.1|NM_207119.1	NP_001265141.1|NP_001265143.1|NP_997002.1	Q8TCA0	LRC20_HUMAN	leucine rich repeat containing 20	29								p.L29L(1)		endometrium(2)|large_intestine(4)|lung(2)|urinary_tract(1)	9						TGCACTCGGCCAGGTCTGCAG	0.547																																					p.L29L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G87A	10						.						148.0	121.0	130.0					10																	72100454		2203	4300	6503	71770460	SO:0001819	synonymous_variant	55222	exon3			BC024001	CCDS7300.1, CCDS7301.1, CCDS7302.1, CCDS73145.1	10q22.2	2004-04-15			ENSG00000172731	ENSG00000172731			23421	protein-coding gene	gene with protein product							Standard	NM_207119		Approved	FLJ10751, FLJ10844	uc031pvr.1	Q8TCA0	OTTHUMG00000018407	ENST00000355790.4:c.87G>A	10.37:g.72100454C>T		Somatic		Capture	Illumina HiSeq	Phase_I	71770460	NM_207119	Q5T6D4|Q5T6D6|Q9NVA6|Q9NVG3	Silent	SNP	ENST00000355790.4	37	CCDS7302.1																																																																																				LRRC20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048510.1	NM_018239	
DYDC2	84332	broad.mit.edu	37	10	82126469	82126469	+	Missense_Mutation	SNP	C	C	T	rs142842576		TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr10:82126469C>T	ENST00000372199.1	+	6	894	c.296C>T	c.(295-297)aCg>aTg	p.T99M	DYDC2_ENST00000372197.1_Missense_Mutation_p.T99M|DYDC2_ENST00000444807.2_Missense_Mutation_p.T99M|DYDC2_ENST00000256039.2_Missense_Mutation_p.T99M|DYDC2_ENST00000372198.1_Missense_Mutation_p.T113M			Q96IM9	DYDC2_HUMAN	DPY30 domain containing 2	99								p.T99M(1)		breast(1)|large_intestine(3)|lung(6)|skin(1)	11			Colorectal(32;0.229)			ACTGTTTCCACGAAGAAGACC	0.418																																					p.T99M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C296T	10						.	C	MET/THR	1,4405	2.1+/-5.4	0,1,2202	131.0	139.0	136.0		296	3.8	0.0	10	dbSNP_134	136	0,8600		0,0,4300	no	missense	DYDC2	NM_032372.4	81	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	99/178	82126469	1,13005	2203	4300	6503	82116449	SO:0001583	missense	84332	exon5			BC018606	CCDS7367.1, CCDS58088.1	10q23.1	2006-06-16			ENSG00000133665	ENSG00000133665			23468	protein-coding gene	gene with protein product						12477932	Standard	NM_032372		Approved	bA36D19.6, MGC16186	uc031pwk.1	Q96IM9	OTTHUMG00000018610	ENST00000372199.1:c.296C>T	10.37:g.82126469C>T	ENSP00000361273:p.Thr99Met	Somatic		Capture	Illumina HiSeq	Phase_I	82116449	NM_032372	D3DWD6|Q5QP07|Q5QP11	Missense_Mutation	SNP	ENST00000372199.1	37	CCDS7367.1	.	.	.	.	.	.	.	.	.	.	C	11.93	1.786701	0.31593	2.27E-4	0.0	ENSG00000133665	ENST00000372199;ENST00000372198;ENST00000372197;ENST00000444807;ENST00000411538;ENST00000256039	T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78	4.68	3.78	0.43462	.	1.451810	0.04154	N	0.321797	T	0.42653	0.1212	L	0.27053	0.805	0.09310	N	1	D	0.62365	0.991	P	0.45377	0.478	T	0.37502	-0.9703	10	0.59425	D	0.04	0.6007	9.0147	0.36161	0.0:0.9018:0.0:0.0982	.	99	Q96IM9	DYDC2_HUMAN	M	99;113;99;99;99;99	ENSP00000361273:T99M;ENSP00000361272:T113M;ENSP00000361271:T99M;ENSP00000410285:T99M;ENSP00000256039:T99M	ENSP00000256039:T99M	T	+	2	0	DYDC2	82116449	0.002000	0.14202	0.027000	0.17364	0.011000	0.07611	1.457000	0.35212	1.581000	0.49865	0.655000	0.94253	ACG		DYDC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000049063.1	NM_032372	
LRRC27	80313	broad.mit.edu	37	10	134178935	134178935	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr10:134178935C>T	ENST00000368614.3	+	10	1402	c.1297C>T	c.(1297-1299)Cag>Tag	p.Q433*	LRRC27_ENST00000432555.2_Nonsense_Mutation_p.Q306*|LRRC27_ENST00000368612.1_Nonsense_Mutation_p.Q371*|LRRC27_ENST00000475747.1_3'UTR|LRRC27_ENST00000392638.2_3'UTR|LRRC27_ENST00000368613.4_Nonsense_Mutation_p.Q433*|LRRC27_ENST00000368610.3_Nonsense_Mutation_p.Q371*	NM_030626.2	NP_085129.1	Q9C0I9	LRC27_HUMAN	leucine rich repeat containing 27	433								p.Q433*(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)	18		all_cancers(35;6.28e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;9.12e-05)|Epithelial(32;0.000116)|all cancers(32;0.000145)|BRCA - Breast invasive adenocarcinoma(275;0.218)		CAGTGCCCTGCAGGAGAGAAA	0.488																																					p.Q433X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1297T	10						.						70.0	69.0	69.0					10																	134178935		2203	4300	6503	134028925	SO:0001587	stop_gained	80313	exon10			AB051461	CCDS31316.1, CCDS44496.1	10q26.3	2013-09-20			ENSG00000148814	ENSG00000148814			29346	protein-coding gene	gene with protein product						11214970	Standard	NM_030626		Approved	KIAA1674	uc010quw.1	Q9C0I9	OTTHUMG00000019284	ENST00000368614.3:c.1297C>T	10.37:g.134178935C>T	ENSP00000357603:p.Gln433*	Somatic		Capture	Illumina HiSeq	Phase_I	134028925	NM_001143757	A6NE72|A6NJB4|A6NKD3|D3DRH0|Q5SZH6|Q5SZH8|Q5SZH9|Q86XT5|Q8N7C8|Q8NA21	Nonsense_Mutation	SNP	ENST00000368614.3	37	CCDS31316.1	.	.	.	.	.	.	.	.	.	.	C	36	5.762180	0.96906	.	.	ENSG00000148814	ENST00000368614;ENST00000368613;ENST00000368612;ENST00000368610;ENST00000432555	.	.	.	2.6	1.65	0.23941	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.2062	7.2363	0.26072	0.0:0.722:0.278:0.0	.	.	.	.	X	433;433;371;371;306	.	ENSP00000357599:Q371X	Q	+	1	0	LRRC27	134028925	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.088000	0.14979	0.621000	0.30232	-0.512000	0.04463	CAG		LRRC27-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051058.2	XM_290462	
VPS51	738	broad.mit.edu	37	11	64875685	64875686	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr11:64875685_64875686insC	ENST00000279281.3	+	5	834_835	c.742_743insC	c.(742-744)gccfs	p.A248fs	AP003068.9_ENST00000528887.1_RNA|VPS51_ENST00000527646.1_3'UTR	NM_013265.2	NP_037397.2	Q9UID3	VPS51_HUMAN	vacuolar protein sorting 51 homolog (S. cerevisiae)	248					autophagy (GO:0006914)|lipid transport (GO:0006869)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	GARP complex (GO:0000938)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.E250fs*115(1)									CGGCTCAGGCGCCCCGGAGCAG	0.723																																					p.A248fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.742_743insC	11						.																																			64632262	SO:0001589	frameshift_variant	738	exon5			AF024631	CCDS8093.1	11q13.1	2012-07-19	2012-07-19	2012-07-19	ENSG00000149823	ENSG00000149823			1172	protein-coding gene	gene with protein product	"""fat-free homolog (zebrafish)"""	615738	"""chromosome 11 open reading frame 3"", ""chromosome 11 open reading frame 2"""	C11orf3, C11orf2		9286704, 20685960	Standard	NM_013265		Approved	ANG2, ANG3, FFR	uc001ocr.2	Q9UID3	OTTHUMG00000165600	ENST00000279281.3:c.746dupC	11.37:g.64875689_64875689dupC	ENSP00000279281:p.Ala248fs	Somatic		Capture	Illumina HiSeq	Phase_I	64632261	NM_013265	Q6PJV5|Q7L8A6|Q8WZ35|Q96DF4|Q96GR3	Frame_Shift_Ins	INS	ENST00000279281.3	37	CCDS8093.1																																																																																				VPS51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385217.1	NM_013265	
OR51B2	79345	broad.mit.edu	37	11	5345304	5345304	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr11:5345304G>A	ENST00000328813.2	-	1	278	c.224C>T	c.(223-225)aCg>aTg	p.T75M	HBG2_ENST00000380259.2_Intron|HBG2_ENST00000380252.1_Intron|HBE1_ENST00000380237.1_Intron	NM_033180.4	NP_149420.4	Q9Y5P1	O51B2_HUMAN	olfactory receptor, family 51, subfamily B, member 2	75						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T75M(1)		NS(1)|biliary_tract(1)|central_nervous_system(1)|large_intestine(6)|lung(21)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGTAGGCATCGTGGTCAATGT	0.498																																					p.T75M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C224T	11						.						127.0	106.0	113.0					11																	5345304		2201	4297	6498	5301880	SO:0001583	missense	79345	exon1			AF399503	CCDS31377.1	11p15.4	2012-08-09			ENSG00000184881	ENSG00000184881		"""GPCR / Class A : Olfactory receptors"""	14703	protein-coding gene	gene with protein product				OR51B1P			Standard	NM_033180		Approved		uc001mao.1	Q9Y5P1	OTTHUMG00000066682	ENST00000328813.2:c.224C>T	11.37:g.5345304G>A	ENSP00000327540:p.Thr75Met	Somatic		Capture	Illumina HiSeq	Phase_I	5301880	NM_033180	Q96RD4	Missense_Mutation	SNP	ENST00000328813.2	37	CCDS31377.1	.	.	.	.	.	.	.	.	.	.	G	13.42	2.232397	0.39498	.	.	ENSG00000184881	ENST00000328813	T	0.00316	8.13	4.39	1.51	0.23008	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39544	U	0.001336	T	0.00754	0.0025	M	0.92412	3.305	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.29549	-1.0008	10	0.87932	D	0	.	8.5607	0.33509	0.2575:0.0:0.7425:0.0	.	75	Q9Y5P1	O51B2_HUMAN	M	75	ENSP00000327540:T75M	ENSP00000327540:T75M	T	-	2	0	OR51B2	5301880	0.508000	0.26154	0.060000	0.19600	0.719000	0.41307	3.070000	0.50033	0.164000	0.19529	0.644000	0.83932	ACG		OR51B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142983.1	NM_033180	
MACROD1	28992	broad.mit.edu	37	11	63766819	63766819	+	Missense_Mutation	SNP	T	T	C	rs75347416		TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr11:63766819T>C	ENST00000255681.6	-	8	941	c.875A>G	c.(874-876)gAg>gGg	p.E292G	OTUB1_ENST00000535715.1_Intron	NM_014067.3	NP_054786.2	Q9BQ69	MACD1_HUMAN	MACRO domain containing 1	292	Macro. {ECO:0000255|PROSITE- ProRule:PRU00490}.				cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)	p.E292G(2)		breast(1)|large_intestine(3)|lung(6)|skin(1)	11						CTTGTGCTGCTCCAGCCACTC	0.711																																					p.E292G												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A875G	11						.						9.0	9.0	9.0					11																	63766819		2141	4211	6352	63523395	SO:0001583	missense	28992	exon8			AF202922	CCDS8056.1	11q13.1	2007-07-24	2007-06-11		ENSG00000133315	ENSG00000133315			29598	protein-coding gene	gene with protein product		610400				15691879	Standard	NM_014067		Approved	LRP16	uc001nyh.3	Q9BQ69	OTTHUMG00000167843	ENST00000255681.6:c.875A>G	11.37:g.63766819T>C	ENSP00000255681:p.Glu292Gly	Somatic		Capture	Illumina HiSeq	Phase_I	63523395	NM_014067	Q9UH96	Missense_Mutation	SNP	ENST00000255681.6	37	CCDS8056.1	.	.	.	.	.	.	.	.	.	.	T	15.03	2.712626	0.48517	.	.	ENSG00000133315	ENST00000255681	T	0.24151	1.87	3.92	3.92	0.45320	Appr-1-p processing (1);	0.221355	0.29544	U	0.011851	T	0.28665	0.0710	M	0.72576	2.205	0.51233	D	0.999918	B	0.13145	0.007	B	0.14023	0.01	T	0.14615	-1.0466	10	0.62326	D	0.03	-23.4342	10.5957	0.45336	0.0:0.0:0.0:1.0	.	292	Q9BQ69	MACD1_HUMAN	G	292	ENSP00000255681:E292G	ENSP00000255681:E292G	E	-	2	0	MACROD1	63523395	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	1.107000	0.31110	1.574000	0.49760	0.379000	0.24179	GAG		MACROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396570.1	NM_014067	
PRPF19	27339	broad.mit.edu	37	11	60665417	60665417	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr11:60665417delA	ENST00000227524.4	-	15	1523	c.1318delT	c.(1318-1320)tcafs	p.S440fs		NM_014502.4	NP_055317.1			pre-mRNA processing factor 19											haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	22						AAGATCAGTGACTTTACCTGC	0.448																																					p.S440fs												.	.	0			c.1318delT	11						.						85.0	86.0	86.0					11																	60665417		2203	4299	6502	60421993	SO:0001589	frameshift_variant	27339	exon15			BC018698	CCDS7995.1	11q12.2	2014-05-20	2013-06-10	2005-04-01	ENSG00000110107	ENSG00000110107		"""WD repeat domain containing"", ""U-box domain containing"""	17896	protein-coding gene	gene with protein product	"""nuclear matrix protein NMP200 related to splicing factor PRP19"", ""psoralen 4"""	608330	"""PRP19/PSO4 homolog (S. cerevisiae)"", ""PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae)"""	PRP19		12960389	Standard	NM_014502		Approved	UBOX4, NMP200, PSO4, hPSO4	uc001nqf.3	Q9UMS4	OTTHUMG00000167798	ENST00000227524.4:c.1318delT	11.37:g.60665417delA	ENSP00000227524:p.Ser440fs	None		Capture	Illumina HiSeq	Phase_I	60421993	NM_014502		Frame_Shift_Del	DEL	ENST00000227524.4	37	CCDS7995.1																																																																																				PRPF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396334.1	NM_014502	
LRRC32	2615	broad.mit.edu	37	11	76370932	76370932	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr11:76370932G>C	ENST00000407242.2	-	3	1947	c.1705C>G	c.(1705-1707)Cag>Gag	p.Q569E	AP001189.4_ENST00000447519.1_RNA|LRRC32_ENST00000464145.1_Intron|LRRC32_ENST00000260061.5_Missense_Mutation_p.Q569E|LRRC32_ENST00000404995.1_Missense_Mutation_p.Q569E	NM_005512.2	NP_005503.1	Q14392	LRC32_HUMAN	leucine rich repeat containing 32	569					negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cytokine secretion (GO:0050710)|positive regulation of gene expression (GO:0010628)	integral component of plasma membrane (GO:0005887)		p.Q569E(1)		endometrium(1)|large_intestine(3)|lung(26)|upper_aerodigestive_tract(1)	31						GGATTCCCCTGCAGGTAGAGG	0.657																																					p.Q569E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1705G	11						.						26.0	28.0	27.0					11																	76370932		2199	4292	6491	76048580	SO:0001583	missense	2615	exon3			Z24680	CCDS8245.1	11q13.5-q14	2008-02-05	2005-02-25	2005-02-25	ENSG00000137507	ENSG00000137507			4161	protein-coding gene	gene with protein product		137207	"""glycoprotein A repetitions predominant"""	D11S833E, GARP		8180135, 1543912	Standard	NM_005512		Approved		uc001oxq.4	Q14392	OTTHUMG00000133687	ENST00000407242.2:c.1705C>G	11.37:g.76370932G>C	ENSP00000384126:p.Gln569Glu	Somatic		Capture	Illumina HiSeq	Phase_I	76048580	NM_001128922	Q86V06	Missense_Mutation	SNP	ENST00000407242.2	37	CCDS8245.1	.	.	.	.	.	.	.	.	.	.	G	10.64	1.406785	0.25378	.	.	ENSG00000137507	ENST00000260061;ENST00000407242;ENST00000404995	T;T;T	0.57273	0.41;0.41;0.41	4.44	3.48	0.39840	.	0.480653	0.22594	N	0.058051	T	0.26085	0.0636	N	0.16266	0.395	0.26146	N	0.980212	P	0.43578	0.811	B	0.41135	0.348	T	0.39035	-0.9633	10	0.02654	T	1	.	2.8114	0.05443	0.1018:0.26:0.4696:0.1687	.	569	Q14392	LRC32_HUMAN	E	569	ENSP00000260061:Q569E;ENSP00000384126:Q569E;ENSP00000385766:Q569E	ENSP00000260061:Q569E	Q	-	1	0	LRRC32	76048580	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	1.014000	0.29950	2.301000	0.77427	0.491000	0.48974	CAG		LRRC32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257926.2	NM_005512	
MYO1H	283446	broad.mit.edu	37	12	109839012	109839012	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr12:109839012G>A	ENST00000431443.2	+	5	637	c.637G>A	c.(637-639)Gaa>Aaa	p.E213K	MYO1H_ENST00000310903.5_Missense_Mutation_p.E213K	NM_001101421.3	NP_001094891.3	Q8N1T3	MYO1H_HUMAN	myosin IH	213	Myosin motor.					myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.E213K(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(17)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	47						GGCAGGTGGCGAAGAGGAGCG	0.532																																					p.E213K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G637A	12						.						45.0	48.0	47.0					12																	109839012		2053	4203	6256	108323395	SO:0001583	missense	283446	exon5				CCDS53826.1	12q24.11	2011-09-27			ENSG00000174527	ENSG00000174527		"""Myosins / Myosin superfamily : Class I"""	13879	protein-coding gene	gene with protein product		614636					Standard	NM_001101421		Approved	FLJ37587	uc010sxn.1	Q8N1T3	OTTHUMG00000169252	ENST00000431443.2:c.637G>A	12.37:g.109839012G>A	ENSP00000444076:p.Glu213Lys	Somatic		Capture	Illumina HiSeq	Phase_I	108323395	NM_001101421	F5H3C6	Missense_Mutation	SNP	ENST00000431443.2	37		.	.	.	.	.	.	.	.	.	.	G	14.64	2.595028	0.46318	.	.	ENSG00000174527	ENST00000310903;ENST00000431443	T;T	0.71579	-0.58;-0.58	4.6	4.6	0.57074	.	.	.	.	.	T	0.62974	0.2472	L	0.35487	1.065	0.22213	N	0.999287	B	0.20550	0.046	B	0.16289	0.015	T	0.55347	-0.8155	9	0.44086	T	0.13	.	16.8448	0.85977	0.0:0.0:1.0:0.0	.	213	F5H3C6	.	K	213	ENSP00000439182:E213K;ENSP00000444076:E213K	ENSP00000439182:E213K	E	+	1	0	MYO1H	108323395	1.000000	0.71417	0.247000	0.24249	0.553000	0.35397	3.593000	0.54001	2.275000	0.75901	0.650000	0.86243	GAA		MYO1H-201	KNOWN	basic	protein_coding	protein_coding		NM_173597	
OAS2	4939	broad.mit.edu	37	12	113433226	113433226	+	Missense_Mutation	SNP	C	C	T	rs533259756		TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr12:113433226C>T	ENST00000342315.4	+	3	788	c.574C>T	c.(574-576)Cgt>Tgt	p.R192C	OAS2_ENST00000392583.2_Missense_Mutation_p.R192C|RP1-71H24.1_ENST00000552784.1_RNA	NM_016817.2	NP_058197.2	P29728	OAS2_HUMAN	2'-5'-oligoadenylate synthetase 2, 69/71kDa	192	OAS domain 1.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|nucleobase-containing compound metabolic process (GO:0006139)|protein glycosylation (GO:0006486)|protein myristoylation (GO:0018377)|purine nucleotide biosynthetic process (GO:0006164)|response to virus (GO:0009615)|RNA catabolic process (GO:0006401)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)	p.R192C(1)		NS(1)|breast(2)|endometrium(4)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						TTTTGACAACCGTCCTGGAAA	0.393																																					p.R192C	Pancreas(199;709 2232 18410 33584 35052)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C574T	12						.						93.0	90.0	91.0					12																	113433226		2203	4300	6503	111917609	SO:0001583	missense	4939	exon3			M87284	CCDS31906.1, CCDS41839.1, CCDS44982.1	12q24.2	2008-05-02	2002-08-29			ENSG00000111335			8087	protein-coding gene	gene with protein product		603350	"""2'-5'-oligoadenylate synthetase 2 (69-71 kD)"""			9790745	Standard	NM_002535		Approved		uc001tuj.3	P29728	OTTHUMG00000169802	ENST00000342315.4:c.574C>T	12.37:g.113433226C>T	ENSP00000342278:p.Arg192Cys	Somatic		Capture	Illumina HiSeq	Phase_I	111917609	NM_002535	A8K9T1|Q6PJ33|Q86XX8	Missense_Mutation	SNP	ENST00000342315.4	37	CCDS31906.1	.	.	.	.	.	.	.	.	.	.	C	3.870	-0.028049	0.07589	.	.	ENSG00000111335	ENST00000342315;ENST00000392583;ENST00000552756	T;T;T	0.12569	2.67;2.67;2.67	4.21	-1.89	0.07689	-oligoadenylate synthetase 1, domain 2/C-terminal (2);-5&apos (2);2&apos (2);	2.833050	0.01634	U	0.023691	T	0.13500	0.0327	L	0.41236	1.265	0.09310	N	1	B;B	0.18310	0.027;0.008	B;B	0.12156	0.007;0.003	T	0.35101	-0.9802	10	0.49607	T	0.09	-23.8138	8.5572	0.33489	0.0:0.3012:0.0:0.6988	.	192;192	P29728;P29728-2	OAS2_HUMAN;.	C	192;192;117	ENSP00000342278:R192C;ENSP00000376362:R192C;ENSP00000446977:R117C	ENSP00000342278:R192C	R	+	1	0	OAS2	111917609	0.000000	0.05858	0.000000	0.03702	0.086000	0.17979	-0.041000	0.12084	-0.699000	0.05077	-0.444000	0.05651	CGT		OAS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405937.1		
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12D	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0 	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35A	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	12.37:g.25398284C>T	ENSP00000256078:p.Gly12Asp	Somatic		Capture	Illumina HiSeq	Phase_I	25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
IPO8	10526	broad.mit.edu	37	12	30837269	30837269	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr12:30837269C>A	ENST00000256079.4	-	3	627	c.289G>T	c.(289-291)Gtg>Ttg	p.V97L	IPO8_ENST00000538338.1_5'Flank	NM_006390.3	NP_006381.2	O15397	IPO8_HUMAN	importin 8	97	Importin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00115}.				intracellular protein transport (GO:0006886)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	Ran GTPase binding (GO:0008536)	p.V97L(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(16)|liver(1)|lung(22)|prostate(2)|skin(2)|urinary_tract(2)	52	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					ATTCCTTCCACAATGTTATCA	0.423																																					p.V97L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G289T	12						.						264.0	234.0	244.0					12																	30837269		2203	4300	6503	30728536	SO:0001583	missense	10526	exon3			U77494	CCDS8719.1, CCDS53773.1	12p11.21	2011-05-23	2003-03-11	2003-03-14	ENSG00000133704	ENSG00000133704		"""Importins"""	9853	protein-coding gene	gene with protein product		605600	"""RAN binding protein 8"""	RANBP8		9214382	Standard	NM_006390		Approved	IMP8	uc001rjd.3	O15397	OTTHUMG00000169172	ENST00000256079.4:c.289G>T	12.37:g.30837269C>A	ENSP00000256079:p.Val97Leu	Somatic		Capture	Illumina HiSeq	Phase_I	30728536	NM_006390	B7Z7M3	Missense_Mutation	SNP	ENST00000256079.4	37	CCDS8719.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.184997	0.78677	.	.	ENSG00000133704	ENST00000256079;ENST00000535989;ENST00000543446	T;T;T	0.60040	0.22;0.22;0.22	3.71	3.71	0.42584	Armadillo-like helical (1);Armadillo-type fold (1);Importin-beta, N-terminal (3);	0.132175	0.49916	D	0.000123	T	0.49338	0.1551	L	0.34521	1.04	0.80722	D	1	B	0.19935	0.04	B	0.30782	0.12	T	0.43032	-0.9416	10	0.21540	T	0.41	-16.6174	16.763	0.85517	0.0:1.0:0.0:0.0	.	97	O15397	IPO8_HUMAN	L	97;35;74	ENSP00000256079:V97L;ENSP00000440979:V35L;ENSP00000439413:V74L	ENSP00000256079:V97L	V	-	1	0	IPO8	30728536	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.467000	0.60155	2.365000	0.80145	0.585000	0.79938	GTG		IPO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402700.2	NM_006390	
LRRK2	120892	broad.mit.edu	37	12	40761466	40761466	+	Missense_Mutation	SNP	G	G	A	rs150062967	byFrequency	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr12:40761466G>A	ENST00000298910.7	+	51	7541	c.7483G>A	c.(7483-7485)Gtt>Att	p.V2495I		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	2495					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)	p.V2495I(1)|p.V2502I(1)		NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TTGCTTGACCGTTTGGGACAT	0.308													G|||	4	0.000798722	0.0	0.0	5008	,	,		13164	0.0		0.0	False		,,,				2504	0.0041				p.V2495I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G7483A	12						.	G	ILE/VAL	0,4404		0,0,2202	52.0	55.0	54.0		7483	1.3	1.0	12	dbSNP_134	54	2,8592	2.2+/-6.3	0,2,4295	no	missense	LRRK2	NM_198578.3	29	0,2,6497	AA,AG,GG		0.0233,0.0,0.0154	benign	2495/2528	40761466	2,12996	2202	4297	6499	39047733	SO:0001583	missense	120892	exon51			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.7483G>A	12.37:g.40761466G>A	ENSP00000298910:p.Val2495Ile	Somatic		Capture	Illumina HiSeq	Phase_I	39047733	NM_198578	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	ENST00000298910.7	37	CCDS31774.1	.	.	.	.	.	.	.	.	.	.	G	12.79	2.042209	0.35989	0.0	2.33E-4	ENSG00000188906	ENST00000298910	T	0.35236	1.32	5.3	1.26	0.21427	WD40 repeat-like-containing domain (1);	0.180568	0.47852	N	0.000201	T	0.23094	0.0558	L	0.28740	0.885	0.26564	N	0.97367	B;B	0.24426	0.103;0.103	B;B	0.19946	0.027;0.027	T	0.13124	-1.0521	10	0.36615	T	0.2	.	9.0439	0.36333	0.3094:0.0:0.6906:0.0	.	2495;2495	Q17RV3;Q5S007	.;LRRK2_HUMAN	I	2495	ENSP00000298910:V2495I	ENSP00000298910:V2495I	V	+	1	0	LRRK2	39047733	1.000000	0.71417	0.995000	0.50966	0.962000	0.63368	1.541000	0.36126	-0.044000	0.13491	-0.291000	0.09656	GTT		LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513	
KRT84	3890	broad.mit.edu	37	12	52777578	52777578	+	Missense_Mutation	SNP	C	C	A	rs386763043|rs1613931	byFrequency	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr12:52777578C>A	ENST00000257951.3	-	2	617	c.551G>T	c.(550-552)cGg>cTg	p.R184L	RP3-416H24.4_ENST00000547174.1_RNA	NM_033045.3	NP_149034.2	Q9NSB2	KRT84_HUMAN	keratin 84	184	Coil 1A.|Rod.		R -> Q (in dbSNP:rs1613931).		hair follicle development (GO:0001942)|nail development (GO:0035878)|regulation of keratinocyte differentiation (GO:0045616)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of epidermis (GO:0030280)	p.R184L(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(1)|lung(10)|skin(3)	27	all_hematologic(5;0.12)			BRCA - Breast invasive adenocarcinoma(357;0.189)		CTCTAGGAACCGAACCTAAAT	0.493																																					p.R184L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G551T	12						.						57.0	58.0	57.0					12																	52777578		2203	4300	6503	51063845	SO:0001583	missense	3890	exon2			Y19209	CCDS8825.1	12q13	2013-06-25	2006-07-17	2006-07-17	ENSG00000161849	ENSG00000161849		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6461	protein-coding gene	gene with protein product	"""hard keratin type II 4"""	602766	"""keratin, hair, basic, 4"""	KRTHB4		2431943, 16831889	Standard	NM_033045		Approved	Hb-4	uc001sah.1	Q9NSB2	OTTHUMG00000169634	ENST00000257951.3:c.551G>T	12.37:g.52777578C>A	ENSP00000257951:p.Arg184Leu	Somatic		Capture	Illumina HiSeq	Phase_I	51063845	NM_033045	B2RA43|Q6ISB0|Q701L6	Missense_Mutation	SNP	ENST00000257951.3	37	CCDS8825.1	.	.	.	.	.	.	.	.	.	.	C	32	5.114347	0.94339	.	.	ENSG00000161849	ENST00000257951	D	0.92446	-3.04	5.32	5.32	0.75619	Filament (1);	0.000000	0.45867	D	0.000325	D	0.97682	0.9240	H	0.96748	3.875	0.53005	D	0.999962	D	0.89917	1.0	D	0.91635	0.999	D	0.98308	1.0522	10	0.87932	D	0	.	19.5787	0.95455	0.0:1.0:0.0:0.0	.	184	Q9NSB2	KRT84_HUMAN	L	184	ENSP00000257951:R184L	ENSP00000257951:R184L	R	-	2	0	KRT84	51063845	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	5.903000	0.69877	2.941000	0.99782	0.655000	0.94253	CGG		KRT84-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405187.1	NM_033045	
FAM71C	196472	broad.mit.edu	37	12	100042389	100042389	+	Missense_Mutation	SNP	G	G	A	rs372415607		TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr12:100042389G>A	ENST00000324341.1	+	1	859	c.437G>A	c.(436-438)cGc>cAc	p.R146H	ANKS1B_ENST00000329257.7_Intron|ANKS1B_ENST00000547776.2_Intron|ANKS1B_ENST00000547010.1_Intron	NM_153364.3	NP_699195.1	Q8NEG0	FA71C_HUMAN	family with sequence similarity 71, member C	146								p.R146H(2)		breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				OV - Ovarian serous cystadenocarcinoma(2;0.00733)|Epithelial(2;0.0385)|all cancers(2;0.19)		GCCACGGGCCGCTCTTTTTAT	0.468																																					p.R146H												.	.	2	Substitution - Missense(2)	large_intestine(1)|breast(1)	c.G437A	12						.	G	,HIS/ARG	0,4406		0,0,2203	66.0	64.0	65.0		,437	-0.4	0.4	12		65	1,8599	1.2+/-3.3	0,1,4299	no	intron,missense	ANKS1B,FAM71C	NM_152788.4,NM_153364.3	,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,probably-damaging	,146/242	100042389	1,13005	2203	4300	6503	98566520	SO:0001583	missense	196472	exon1				CCDS9072.1	12q23.1	2006-02-03				ENSG00000180219			28594	protein-coding gene	gene with protein product						12477932	Standard	NM_153364		Approved	MGC39520	uc001tgn.3	Q8NEG0		ENST00000324341.1:c.437G>A	12.37:g.100042389G>A	ENSP00000315247:p.Arg146His	Somatic		Capture	Illumina HiSeq	Phase_I	98566520	NM_153364	B2R6Y6	Missense_Mutation	SNP	ENST00000324341.1	37	CCDS9072.1	.	.	.	.	.	.	.	.	.	.	G	15.04	2.715095	0.48622	0.0	1.16E-4	ENSG00000180219	ENST00000324341	T	0.29655	1.56	3.6	-0.365	0.12549	.	0.213463	0.31461	N	0.007610	T	0.44329	0.1288	M	0.84948	2.725	0.22112	N	0.999358	D	0.53312	0.959	P	0.54590	0.756	T	0.33828	-0.9853	9	.	.	.	-9.7394	6.1328	0.20215	0.5032:0.0:0.4968:0.0	.	146	Q8NEG0	FA71C_HUMAN	H	146	ENSP00000315247:R146H	.	R	+	2	0	FAM71C	98566520	0.003000	0.15002	0.444000	0.26895	0.662000	0.39071	0.531000	0.23052	-0.079000	0.12707	0.555000	0.69702	CGC		FAM71C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408458.1	NM_153364	
DNAH10	196385	broad.mit.edu	37	12	124272434	124272434	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr12:124272434G>A	ENST00000409039.3	+	10	1347	c.1322G>A	c.(1321-1323)cGg>cAg	p.R441Q		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	441	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R441Q(1)|p.R259Q(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TTTGACACCCGGGCCAAGATA	0.552																																					p.R441Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1322A	12						.						51.0	48.0	49.0					12																	124272434		2203	4300	6503	122838387	SO:0001583	missense	196385	exon10			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.1322G>A	12.37:g.124272434G>A	ENSP00000386770:p.Arg441Gln	Somatic		Capture	Illumina HiSeq	Phase_I	122838387	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	37	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	G	24.6	4.549700	0.86127	.	.	ENSG00000197653	ENST00000409039	T	0.56611	0.45	5.55	4.65	0.58169	Dynein heavy chain, domain-1 (1);	0.274240	0.28098	N	0.016609	T	0.63343	0.2503	M	0.79805	2.47	0.38127	D	0.938048	P	0.51147	0.942	P	0.48738	0.588	T	0.71122	-0.4684	10	0.45353	T	0.12	.	14.8564	0.70341	0.0:0.1432:0.8568:0.0	.	441	Q8IVF4	DYH10_HUMAN	Q	441	ENSP00000386770:R441Q	ENSP00000386770:R441Q	R	+	2	0	DNAH10	122838387	1.000000	0.71417	0.813000	0.32504	0.532000	0.34746	9.774000	0.98992	1.321000	0.45227	0.561000	0.74099	CGG		DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
WBP4	11193	broad.mit.edu	37	13	41654879	41654879	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr13:41654879C>T	ENST00000379487.3	+	9	1254	c.854C>T	c.(853-855)tCg>tTg	p.S285L	WBP4_ENST00000542082.1_Missense_Mutation_p.S264L	NM_007187.3	NP_009118.1	O75554	WBP4_HUMAN	WW domain binding protein 4	285					mRNA cis splicing, via spliceosome (GO:0045292)	nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spliceosomal complex (GO:0005681)	nucleic acid binding (GO:0003676)|proline-rich region binding (GO:0070064)|zinc ion binding (GO:0008270)	p.S285L(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(2)|prostate(1)|skin(1)	12		Lung NSC(96;3.55e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;3.11e-09)|Epithelial(112;3.37e-06)|OV - Ovarian serous cystadenocarcinoma(117;8.3e-05)|GBM - Glioblastoma multiforme(144;0.00102)|BRCA - Breast invasive adenocarcinoma(63;0.07)		GAAGAAAAATCGAAAACTCTT	0.333																																					p.S285L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C854T	13						.						94.0	97.0	96.0					13																	41654879		2203	4300	6503	40552879	SO:0001583	missense	11193	exon9			AF071185	CCDS9375.1	13q13.3	2012-10-17	2012-10-17		ENSG00000120688	ENSG00000120688			12739	protein-coding gene	gene with protein product	"""formin binding protein 21"""	604981				9724750	Standard	NM_007187		Approved	FBP21, MGC117310	uc001uxt.3	O75554	OTTHUMG00000016784	ENST00000379487.3:c.854C>T	13.37:g.41654879C>T	ENSP00000368801:p.Ser285Leu	Somatic		Capture	Illumina HiSeq	Phase_I	40552879	NM_007187	B7Z4M2|Q32P29	Missense_Mutation	SNP	ENST00000379487.3	37	CCDS9375.1	.	.	.	.	.	.	.	.	.	.	C	10.76	1.441244	0.25900	.	.	ENSG00000120688	ENST00000379487;ENST00000542082	.	.	.	5.64	4.79	0.61399	.	0.840456	0.10962	N	0.614838	T	0.33323	0.0859	L	0.43152	1.355	0.28693	N	0.904474	B;P	0.40681	0.0;0.727	B;B	0.32289	0.0;0.143	T	0.21245	-1.0251	9	0.42905	T	0.14	-12.97	12.2624	0.54658	0.0:0.9178:0.0:0.0822	.	264;285	B7Z4M2;O75554	.;WBP4_HUMAN	L	285;264	.	ENSP00000368801:S285L	S	+	2	0	WBP4	40552879	0.309000	0.24518	0.635000	0.29338	0.053000	0.15095	2.842000	0.48230	2.660000	0.90430	0.561000	0.74099	TCG		WBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044655.2	NM_007187	
PCDH9	5101	broad.mit.edu	37	13	67800426	67800426	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr13:67800426G>A	ENST00000377865.2	-	1	2281	c.2147C>T	c.(2146-2148)aCt>aTt	p.T716I	PCDH9_ENST00000377861.3_Missense_Mutation_p.T716I|PCDH9_ENST00000328454.5_Missense_Mutation_p.T716I|PCDH9_ENST00000544246.1_Missense_Mutation_p.T716I|PCDH9_ENST00000456367.1_Missense_Mutation_p.T716I			Q9HC56	PCDH9_HUMAN	protocadherin 9	716	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T716I(1)		breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		ACTCACTATAGTATACTTTAG	0.438																																					p.T716I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2147T	13						.						126.0	126.0	126.0					13																	67800426		2203	4300	6503	66698427	SO:0001583	missense	5101	exon2			AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.2147C>T	13.37:g.67800426G>A	ENSP00000367096:p.Thr716Ile	Somatic		Capture	Illumina HiSeq	Phase_I	66698427	NM_020403	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	ENST00000377865.2	37	CCDS9444.1	.	.	.	.	.	.	.	.	.	.	G	16.99	3.274177	0.59649	.	.	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454;ENST00000377861	T;T;T;T;T	0.52754	0.65;0.65;0.65;0.65;0.65	5.4	5.4	0.78164	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.63640	0.2528	L	0.53617	1.68	0.80722	D	1	P;P;P;P	0.51240	0.943;0.943;0.93;0.943	P;P;P;P	0.60236	0.762;0.664;0.796;0.871	T	0.63341	-0.6659	10	0.62326	D	0.03	.	19.3757	0.94508	0.0:0.0:1.0:0.0	.	716;716;716;716	B7ZM79;Q5VT82;Q9HC56-2;Q9HC56	.;.;.;PCDH9_HUMAN	I	716	ENSP00000442186:T716I;ENSP00000367096:T716I;ENSP00000401699:T716I;ENSP00000332060:T716I;ENSP00000367092:T716I	ENSP00000332060:T716I	T	-	2	0	PCDH9	66698427	1.000000	0.71417	0.587000	0.28692	0.324000	0.28378	6.343000	0.72986	2.814000	0.96858	0.655000	0.94253	ACT		PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	NM_203487	
SLC10A2	6555	broad.mit.edu	37	13	103710614	103710614	+	Splice_Site	SNP	C	C	A			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr13:103710614C>A	ENST00000245312.3	-	2	1092	c.496G>T	c.(496-498)Ggt>Tgt	p.G166C		NM_000452.2	NP_000443	Q12908	NTCP2_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 2	166					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)	bile acid:sodium symporter activity (GO:0008508)	p.G166C(1)		breast(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)				Aciclovir(DB00787)|Cyclosporine(DB00091)|Ursodeoxycholic acid(DB01586)|Valaciclovir(DB00577)	GATGACTTACCTATGTTATCA	0.502																																					p.G166C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G496T	13						.						135.0	123.0	127.0					13																	103710614		2203	4300	6503	102508615	SO:0001630	splice_region_variant	6555	exon2			U10417	CCDS9506.1	13q33	2013-07-18	2013-07-18		ENSG00000125255	ENSG00000125255		"""Solute carriers"""	10906	protein-coding gene	gene with protein product		601295		ASBT, ISBT		8661017	Standard	NM_000452		Approved		uc001vpy.4	Q12908	OTTHUMG00000017313	ENST00000245312.3:c.496+1G>T	13.37:g.103710614C>A		Somatic		Capture	Illumina HiSeq	Phase_I	102508615	NM_000452	A1L4F4|Q13839	Missense_Mutation	SNP	ENST00000245312.3	37	CCDS9506.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.882631	0.91740	.	.	ENSG00000125255	ENST00000245312	T	0.12147	2.71	5.74	5.74	0.90152	.	0.098933	0.64402	D	0.000001	T	0.38825	0.1055	M	0.89163	3.01	0.80722	D	1	P	0.36990	0.577	P	0.48141	0.568	T	0.12192	-1.0557	9	.	.	.	-17.0948	20.2982	0.98569	0.0:1.0:0.0:0.0	.	166	Q12908	NTCP2_HUMAN	C	166	ENSP00000245312:G166C	.	G	-	1	0	SLC10A2	102508615	1.000000	0.71417	1.000000	0.80357	0.785000	0.44390	7.456000	0.80751	2.873000	0.98535	0.563000	0.77884	GGT		SLC10A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045716.1		Missense_Mutation
ACOT4	122970	broad.mit.edu	37	14	74060511	74060512	+	Frame_Shift_Ins	INS	-	-	TCAA	rs79684878|rs373880503	byFrequency	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr14:74060511_74060512insTCAA	ENST00000326303.4	+	2	817_818	c.563_564insTCAA	c.(562-567)ctagctfs	p.A189fs		NM_152331.3	NP_689544.3	Q8N9L9	ACOT4_HUMAN	acyl-CoA thioesterase 4	189				ALAY -> DLQS (in Ref. 1; BAC04313). {ECO:0000305}.	acyl-CoA metabolic process (GO:0006637)|dicarboxylic acid catabolic process (GO:0043649)|dicarboxylic acid metabolic process (GO:0043648)|long-chain fatty acid metabolic process (GO:0001676)|saturated monocarboxylic acid metabolic process (GO:0032788)|short-chain fatty acid metabolic process (GO:0046459)|succinyl-CoA metabolic process (GO:0006104)|unsaturated monocarboxylic acid metabolic process (GO:0032789)|very long-chain fatty acid metabolic process (GO:0000038)	peroxisome (GO:0005777)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)|succinyl-CoA hydrolase activity (GO:0004778)			endometrium(1)|large_intestine(3)|lung(4)	8				BRCA - Breast invasive adenocarcinoma(234;0.00331)		ACGTTGGCTCTAGCTTATTATA	0.495														6	0.00119808	0.0	0.0	5008	,	,		16663	0.0		0.006	False		,,,				2504	0.0				p.L188fs												.	.	0			c.563_564insTCAA	14						.																																			73130265	SO:0001589	frameshift_variant	122970	exon2			BC031799	CCDS9817.1	14q24.1	2011-02-16			ENSG00000177465	ENSG00000177465		"""Acyl CoA thioesterases"""	19748	protein-coding gene	gene with protein product		614314				16103133, 16940157	Standard	NM_152331		Approved	FLJ31235, PTE-Ib, PTE2B	uc001xoo.3	Q8N9L9	OTTHUMG00000169485	Exception_encountered	14.37:g.74060511_74060512insTCAA	ENSP00000323071:p.Ala189fs	None		Capture	Illumina HiSeq	Phase_I	73130264	NM_152331	Q17RF4|Q5BKT6|Q86TX0|Q86TX1|Q96N88	Frame_Shift_Ins	INS	ENST00000326303.4	37	CCDS9817.1																																																																																				ACOT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404298.2	NM_152331	
ACIN1	22985	broad.mit.edu	37	14	23533366	23533366	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr14:23533366C>T	ENST00000262710.1	-	12	3044	c.2717G>A	c.(2716-2718)gGc>gAc	p.G906D	ACIN1_ENST00000338631.6_Missense_Mutation_p.G179D|ACIN1_ENST00000605057.1_Missense_Mutation_p.G848D|ACIN1_ENST00000357481.2_Missense_Mutation_p.G148D|ACIN1_ENST00000557515.1_Missense_Mutation_p.G147D|ACIN1_ENST00000555053.1_Missense_Mutation_p.G893D|ACIN1_ENST00000397341.3_Missense_Mutation_p.G148D|ACIN1_ENST00000457657.1_Missense_Mutation_p.G866D	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	906					apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.G906D(1)		breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		CCCATCATCGCCATTACGCTC	0.557																																					p.G179D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G536A	14						.						123.0	110.0	115.0					14																	23533366		2203	4300	6503	22603206	SO:0001583	missense	22985	exon5			AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.2717G>A	14.37:g.23533366C>T	ENSP00000262710:p.Gly906Asp	Somatic		Capture	Illumina HiSeq	Phase_I	22603206	NM_001164816	B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Missense_Mutation	SNP	ENST00000262710.1	37	CCDS9587.1	.	.	.	.	.	.	.	.	.	.	C	19.77	3.889507	0.72524	.	.	ENSG00000100813	ENST00000557515;ENST00000338631;ENST00000357481;ENST00000262710;ENST00000457657;ENST00000397341;ENST00000555053;ENST00000555566	T;T;T;T;T;T;T	0.14893	3.45;3.46;3.46;2.47;2.48;3.46;3.55	5.1	5.1	0.69264	.	0.000000	0.41938	D	0.000800	T	0.28896	0.0717	L	0.40543	1.245	0.46521	D	0.999087	D;D;D;D;P	0.89917	1.0;0.999;0.999;0.974;0.936	D;D;D;P;P	0.81914	0.995;0.988;0.988;0.806;0.651	T	0.01127	-1.1443	10	0.11794	T	0.64	-9.6636	14.06	0.64793	0.0:0.8478:0.1522:0.0	.	893;906;866;179;148	G3V3M7;Q9UKV3;E7EQT4;Q9UKV3-2;Q9UKV3-3	.;ACINU_HUMAN;.;.;.	D	147;179;148;906;866;148;893;136	ENSP00000451138:G147D;ENSP00000345541:G179D;ENSP00000350073:G148D;ENSP00000262710:G906D;ENSP00000405677:G866D;ENSP00000380502:G148D;ENSP00000451328:G893D	ENSP00000262710:G906D	G	-	2	0	ACIN1	22603206	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.873000	0.48475	2.814000	0.96858	0.563000	0.77884	GGC		ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071707.3	NM_014977	
NUMB	8650	broad.mit.edu	37	14	73750955	73750955	+	Silent	SNP	G	G	A			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr14:73750955G>A	ENST00000355058.3	-	10	1061	c.783C>T	c.(781-783)atC>atT	p.I261I	NUMB_ENST00000359560.3_Silent_p.I250I|NUMB_ENST00000557597.1_Silent_p.I250I|NUMB_ENST00000560335.1_Intron|NUMB_ENST00000535282.1_Silent_p.I250I|NUMB_ENST00000559312.1_Intron|NUMB_ENST00000454166.4_Intron|NUMB_ENST00000555738.2_Intron|NUMB_ENST00000555394.1_Silent_p.I261I|NUMB_ENST00000554546.1_Silent_p.I250I|NUMB_ENST00000356296.4_Silent_p.I261I|NUMB_ENST00000554521.2_Intron|NUMB_ENST00000544991.3_Intron|NUMB_ENST00000555238.1_Silent_p.I261I|NUMB_ENST00000556772.1_Silent_p.I117I			P49757	NUMB_HUMAN	numb homolog (Drosophila)	261					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|lateral ventricle development (GO:0021670)|lung epithelial cell differentiation (GO:0060487)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of protein localization to plasma membrane (GO:1903077)|neuroblast division in subventricular zone (GO:0021849)|Notch signaling pathway (GO:0007219)|positive regulation of cell migration (GO:0030335)|positive regulation of neurogenesis (GO:0050769)|positive regulation of polarized epithelial cell differentiation (GO:0030862)	apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.I261I(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00471)|OV - Ovarian serous cystadenocarcinoma(108;0.161)		GCCGGCGTGGGATGGCATGAG	0.542																																					p.I261I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C783T	14						.						173.0	159.0	164.0					14																	73750955		2203	4300	6503	72820708	SO:0001819	synonymous_variant	8650	exon10			L40393	CCDS9814.1, CCDS32115.1, CCDS32116.1, CCDS55927.1	14q24.3	2011-11-25	2001-11-28			ENSG00000133961			8060	protein-coding gene	gene with protein product		603728	"""numb (Drosophila) homolog"", ""chromosome 14 open reading frame 41"""	C14orf41			Standard	NM_003744		Approved		uc001xny.1	P49757		ENST00000355058.3:c.783C>T	14.37:g.73750955G>A		Somatic		Capture	Illumina HiSeq	Phase_I	72820708	NM_001005744	B1P2N5|B1P2N6|B1P2N7|B1P2N8|B1P2N9|B4E2B1|Q6NUQ7|Q86SY1|Q8WW73|Q9UBG1|Q9UEQ4|Q9UKE8|Q9UKE9|Q9UKF0|Q9UQJ4	Silent	SNP	ENST00000355058.3	37	CCDS32116.1																																																																																				NUMB-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414416.1		
ACOT4	122970	broad.mit.edu	37	14	74060514	74060517	+	Frame_Shift_Del	DEL	CTTA	CTTA	-	rs74553611|rs562751690|rs77261428|rs77814755|rs375801976|rs77408762	byFrequency	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	CTTA	CTTA					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr14:74060514_74060517delCTTA	ENST00000326303.4	+	2	820_823	c.566_569delCTTA	c.(565-570)gcttatfs	p.AY189fs		NM_152331.3	NP_689544.3	Q8N9L9	ACOT4_HUMAN	acyl-CoA thioesterase 4	189				ALAY -> DLQS (in Ref. 1; BAC04313). {ECO:0000305}.	acyl-CoA metabolic process (GO:0006637)|dicarboxylic acid catabolic process (GO:0043649)|dicarboxylic acid metabolic process (GO:0043648)|long-chain fatty acid metabolic process (GO:0001676)|saturated monocarboxylic acid metabolic process (GO:0032788)|short-chain fatty acid metabolic process (GO:0046459)|succinyl-CoA metabolic process (GO:0006104)|unsaturated monocarboxylic acid metabolic process (GO:0032789)|very long-chain fatty acid metabolic process (GO:0000038)	peroxisome (GO:0005777)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)|succinyl-CoA hydrolase activity (GO:0004778)	p.A189fs*32(2)		endometrium(1)|large_intestine(3)|lung(4)	8				BRCA - Breast invasive adenocarcinoma(234;0.00331)		TTGGCTCTAGCTTATTATAACTTT	0.495																																					p.189_190del												.	.	2	Deletion - Frameshift(2)	large_intestine(2)	c.566_569del	14						.			103,4159		3,97,2031						4.3	1.0			126	861,7311		130,601,3355	no	frameshift	ACOT4	NM_152331.3		133,698,5386	A1A1,A1R,RR		10.536,2.4167,7.7529				964,11470				73130270	SO:0001589	frameshift_variant	122970	exon2			BC031799	CCDS9817.1	14q24.1	2011-02-16			ENSG00000177465	ENSG00000177465		"""Acyl CoA thioesterases"""	19748	protein-coding gene	gene with protein product		614314				16103133, 16940157	Standard	NM_152331		Approved	FLJ31235, PTE-Ib, PTE2B	uc001xoo.3	Q8N9L9	OTTHUMG00000169485	ENST00000326303.4:c.566_569delCTTA	14.37:g.74060514_74060517delCTTA	ENSP00000323071:p.Ala189fs	Somatic		Capture	Illumina HiSeq	Phase_I	73130267	NM_152331	Q17RF4|Q5BKT6|Q86TX0|Q86TX1|Q96N88	Frame_Shift_Del	DEL	ENST00000326303.4	37	CCDS9817.1																																																																																				ACOT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404298.2	NM_152331	
SNW1	22938	broad.mit.edu	37	14	78198836	78198836	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr14:78198836C>T	ENST00000261531.7	-	9	945	c.883G>A	c.(883-885)Gat>Aat	p.D295N	SNW1_ENST00000555761.1_Missense_Mutation_p.D295N|SLIRP_ENST00000557431.1_Intron|SNW1_ENST00000554775.1_Missense_Mutation_p.D133N	NM_012245.2	NP_036377.1	Q13573	SNW1_HUMAN	SNW domain containing 1	295	SNW.				cellular response to retinoic acid (GO:0071300)|gene expression (GO:0010467)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of vitamin D receptor signaling pathway (GO:0070564)|regulation of retinoic acid receptor signaling pathway (GO:0048385)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of vitamin D receptor signaling pathway (GO:0070562)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|chromatin (GO:0000785)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	Notch binding (GO:0005112)|nuclear hormone receptor binding (GO:0035257)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)|SMAD binding (GO:0046332)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|vitamin D receptor binding (GO:0042809)	p.D295N(1)		NS(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		ACCTTCCGATCAGCAATGTAG	0.368																																					p.D295N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G883A	14						.						118.0	113.0	115.0					14																	78198836		2203	4300	6503	77268589	SO:0001583	missense	22938	exon9			AF045184	CCDS9867.1	14q22.1-q22.3	2005-09-13	2005-09-13	2005-09-13		ENSG00000100603			16696	protein-coding gene	gene with protein product		603055	"""SKI interacting protein"""	SKIIP		8973337, 9632709	Standard	NM_012245		Approved	NCoA-62, SKIP, Prp45, PRPF45, Bx42	uc001xuf.3	Q13573		ENST00000261531.7:c.883G>A	14.37:g.78198836C>T	ENSP00000261531:p.Asp295Asn	Somatic		Capture	Illumina HiSeq	Phase_I	77268589	NM_012245	A8K8A9|Q13483|Q32N03|Q5D0D6	Missense_Mutation	SNP	ENST00000261531.7	37	CCDS9867.1	.	.	.	.	.	.	.	.	.	.	C	35	5.416102	0.96092	.	.	ENSG00000100603	ENST00000261531;ENST00000554775;ENST00000555761	.	.	.	6.08	5.18	0.71444	SKI-interacting protein SKIP, SNW domain (1);	0.000000	0.85682	D	0.000000	D	0.85665	0.5749	M	0.92077	3.27	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.83275	0.994;0.996	D	0.88412	0.3022	9	0.87932	D	0	.	15.8101	0.78552	0.0:0.9341:0.0:0.0659	.	295;295	G3V3A4;Q13573	.;SNW1_HUMAN	N	295;133;295	.	ENSP00000261531:D295N	D	-	1	0	SNW1	77268589	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.776000	0.85560	2.894000	0.99253	0.655000	0.94253	GAT		SNW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413912.1	NM_012245	
NDN	4692	broad.mit.edu	37	15	23932351	23932351	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr15:23932351C>A	ENST00000331837.4	-	1	99	c.14G>T	c.(13-15)aGt>aTt	p.S5I		NM_002487.2	NP_002478.1	Q99608	NECD_HUMAN	necdin, melanoma antigen (MAGE) family member	5					axon extension (GO:0048675)|axonal fasciculation (GO:0007413)|central nervous system development (GO:0007417)|genetic imprinting (GO:0071514)|glial cell migration (GO:0008347)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-embryonic development (GO:0009791)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|respiratory system process (GO:0003016)|sensory perception of pain (GO:0019233)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S5I(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|skin(1)	39		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		CAGATCCTTACTTTGTTCTGA	0.642									Prader-Willi syndrome																												p.S5I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G14T	15						.						30.0	28.0	28.0					15																	23932351		1746	3463	5209	21483444	SO:0001583	missense	4692	exon1	Familial Cancer Database	Prader-Labhart-Willi syndrome	U35139	CCDS10014.1	15q11-q12	2012-12-07	2012-12-07		ENSG00000182636	ENSG00000182636			7675	protein-coding gene	gene with protein product	"""Prader-Willi syndrome chromosome region"""	602117	"""necdin (mouse) homolog"", ""necdin homolog (mouse)"""			9302265	Standard	NM_002487		Approved	HsT16328, PWCR	uc001ywk.3	Q99608	OTTHUMG00000129161	ENST00000331837.4:c.14G>T	15.37:g.23932351C>A	ENSP00000332643:p.Ser5Ile	Somatic		Capture	Illumina HiSeq	Phase_I	21483444	NM_002487	B2R6Z5	Missense_Mutation	SNP	ENST00000331837.4	37	CCDS10014.1	.	.	.	.	.	.	.	.	.	.	C	11.96	1.795307	0.31777	.	.	ENSG00000182636	ENST00000331837	T	0.02837	4.14	3.75	1.57	0.23409	.	0.911450	0.09278	N	0.824191	T	0.01835	0.0058	N	0.08118	0	0.29241	N	0.872621	P	0.41041	0.736	B	0.41271	0.352	T	0.45338	-0.9268	10	0.29301	T	0.29	.	4.8014	0.13298	0.0:0.6549:0.2199:0.1252	.	5	Q99608	NECD_HUMAN	I	5	ENSP00000332643:S5I	ENSP00000332643:S5I	S	-	2	0	NDN	21483444	0.996000	0.38824	1.000000	0.80357	0.544000	0.35116	0.648000	0.24828	0.847000	0.35167	0.561000	0.74099	AGT		NDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251226.2	NM_002487	
RGMA	56963	broad.mit.edu	37	15	93588423	93588423	+	Silent	SNP	G	G	A	rs201262127	byFrequency	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr15:93588423G>A	ENST00000329082.7	-	4	1429	c.1158C>T	c.(1156-1158)ggC>ggT	p.G386G	RGMA_ENST00000543599.1_Silent_p.G370G|RGMA_ENST00000556658.1_Silent_p.G277G|RGMA_ENST00000542321.2_Silent_p.G370G|RGMA_ENST00000557420.1_3'UTR|RGMA_ENST00000557301.1_Silent_p.G394G|RGMA_ENST00000538818.1_Silent_p.G277G|RGMA_ENST00000425933.2_Silent_p.G370G	NM_020211.2	NP_064596	Q96B86	RGMA_HUMAN	repulsive guidance molecule family member a	386					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|neural tube closure (GO:0001843)|regulation of BMP signaling pathway (GO:0030510)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)	p.G386G(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	9	Lung NSC(78;0.0542)|all_lung(78;0.0786)		BRCA - Breast invasive adenocarcinoma(143;0.0312)|OV - Ovarian serous cystadenocarcinoma(32;0.108)			AGTTCACGTCGCCCGTGGTGA	0.577																																					p.G394G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1182T	15						.	G	,,,,,	0,4230		0,0,2115	39.0	42.0	41.0		1182,1110,1110,1110,1110,1158	-9.2	0.0	15		41	1,8473		0,1,4236	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	RGMA	NM_001166283.1,NM_001166286.1,NM_001166287.1,NM_001166288.1,NM_001166289.1,NM_020211.2	,,,,,	0,1,6351	AA,AG,GG		0.0118,0.0,0.0079	,,,,,	394/459,370/435,370/435,370/435,370/435,386/451	93588423	1,12703	2115	4237	6352	91389427	SO:0001819	synonymous_variant	56963	exon4			AL390083	CCDS45357.1, CCDS53973.1, CCDS53974.1	15q26.1	2013-11-06	2013-11-06			ENSG00000182175			30308	protein-coding gene	gene with protein product		607362	"""RGM domain family, member A"""			15975920	Standard	NM_020211		Approved	RGM, RGMa	uc010urc.2	Q96B86		ENST00000329082.7:c.1158C>T	15.37:g.93588423G>A		Somatic		Capture	Illumina HiSeq	Phase_I	91389427	NM_001166283	B2RTW1|B7Z5S8|F5GXQ7|F5GZU6|G3V518|Q0JV97|Q8NC80|Q9H0E6|Q9NPM3	Silent	SNP	ENST00000329082.7	37	CCDS45357.1																																																																																				RGMA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000415091.1	NM_020211	
ABCC6	368	broad.mit.edu	37	16	16315527	16315527	+	Silent	SNP	G	G	A			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr16:16315527G>A	ENST00000205557.7	-	2	227	c.198C>T	c.(196-198)tcC>tcT	p.S66S	ABCC6_ENST00000575728.1_Silent_p.S66S|RP11-517A5.7_ENST00000574883.1_RNA|ABCC6_ENST00000574094.1_5'UTR	NM_001171.5	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 6	66					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)	p.S66S(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|skin(6)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)	TGAAGAGTGGGGACATCCGGA	0.607																																					p.S66S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C198T	16						.						35.0	34.0	34.0					16																	16315527		2197	4300	6497	16223028	SO:0001819	synonymous_variant	368	exon2			AF076622	CCDS10568.1, CCDS58430.1	16p13.11	2013-01-08			ENSG00000091262	ENSG00000091262		"""ATP binding cassette transporters / subfamily C"""	57	protein-coding gene	gene with protein product		603234	"""pseudoxanthoma elasticum"""	ARA, PXE		9721217, 11439001	Standard	NM_001079528		Approved	MRP6, EST349056, MLP1, URG7	uc002den.4	O95255	OTTHUMG00000129967	ENST00000205557.7:c.198C>T	16.37:g.16315527G>A		Somatic		Capture	Illumina HiSeq	Phase_I	16223028	NM_001079528	A2RRN8|A8KIG6|A8Y988|E7ESW8|P78420|Q8TCY8|Q9UMZ7	Silent	SNP	ENST00000205557.7	37	CCDS10568.1																																																																																				ABCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252232.2		
PLK1	5347	broad.mit.edu	37	16	23698843	23698843	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr16:23698843C>T	ENST00000300093.4	+	6	1201	c.1090C>T	c.(1090-1092)Cga>Tga	p.R364*	CTD-2196E14.5_ENST00000566143.1_RNA	NM_005030.3	NP_005021.2	P53350	PLK1_HUMAN	polo-like kinase 1	364					activation of mitotic anaphase-promoting complex activity (GO:0007092)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|centrosome organization (GO:0051297)|cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|G2 DNA damage checkpoint (GO:0031572)|G2/M transition of mitotic cell cycle (GO:0000086)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-serine phosphorylation (GO:0018105)|polar body extrusion after meiotic divisions (GO:0040038)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of proteolysis (GO:0045862)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein destabilization (GO:0031648)|protein localization to chromatin (GO:0071168)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of mitotic cell cycle (GO:0007346)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of protein binding (GO:0043393)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to antibiotic (GO:0046677)	centrosome (GO:0005813)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	anaphase-promoting complex binding (GO:0010997)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|microtubule binding (GO:0008017)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)	p.R364*(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				GBM - Glioblastoma multiforme(48;0.0156)		ACCAGTGGTTCGAGAGACAGG	0.607																																					p.R364X	Colon(12;240 564 27038 33155)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1090T	16						.						95.0	91.0	92.0					16																	23698843		2197	4300	6497	23606344	SO:0001587	stop_gained	5347	exon6				CCDS10616.1	16p	2013-01-17	2010-06-24	2004-01-28	ENSG00000166851	ENSG00000166851			9077	protein-coding gene	gene with protein product		602098	"""polo-like kinase (Drosophila)"""	PLK		8127874	Standard	NM_005030		Approved		uc002dlz.1	P53350	OTTHUMG00000096984	ENST00000300093.4:c.1090C>T	16.37:g.23698843C>T	ENSP00000300093:p.Arg364*	Somatic		Capture	Illumina HiSeq	Phase_I	23606344	NM_005030	Q15153|Q99746	Nonsense_Mutation	SNP	ENST00000300093.4	37	CCDS10616.1	.	.	.	.	.	.	.	.	.	.	C	37	6.345021	0.97494	.	.	ENSG00000166851	ENST00000300093;ENST00000425844	.	.	.	5.8	5.8	0.92144	.	0.615092	0.18063	N	0.152872	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	-12.5369	17.5569	0.87894	0.0:1.0:0.0:0.0	.	.	.	.	X	364;267	.	ENSP00000300093:R364X	R	+	1	2	PLK1	23606344	0.997000	0.39634	0.982000	0.44146	0.991000	0.79684	3.277000	0.51654	2.735000	0.93741	0.655000	0.94253	CGA		PLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214057.2	NM_005030	
MYLK3	91807	broad.mit.edu	37	16	46766194	46766194	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr16:46766194G>A	ENST00000394809.4	-	4	1503	c.1388C>T	c.(1387-1389)gCa>gTa	p.A463V	MYLK3_ENST00000536476.1_Missense_Mutation_p.A122V	NM_182493.2	NP_872299.2	Q32MK0	MYLK3_HUMAN	myosin light chain kinase 3	463					cardiac myofibril assembly (GO:0055003)|cellular response to interleukin-1 (GO:0071347)|positive regulation of sarcomere organization (GO:0060298)|protein phosphorylation (GO:0006468)|regulation of vascular permeability involved in acute inflammatory response (GO:0002528)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)	p.A463V(1)|p.A542V(1)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(5)|stomach(3)	37		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				AGCCCTGGCTGCACAGTCCTG	0.652																																					p.A463V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1388T	16						.						37.0	41.0	40.0					16																	46766194		2203	4300	6503	45323695	SO:0001583	missense	91807	exon4			AJ247087	CCDS10723.2	16q11.2	2008-10-23			ENSG00000140795	ENSG00000140795			29826	protein-coding gene	gene with protein product	"""MLC kinase"""	612147				17885681	Standard	NM_182493		Approved	caMLCK, MLCK	uc002eei.4	Q32MK0	OTTHUMG00000132543	ENST00000394809.4:c.1388C>T	16.37:g.46766194G>A	ENSP00000378288:p.Ala463Val	Somatic		Capture	Illumina HiSeq	Phase_I	45323695	NM_182493	B5BUL9|B7Z5U8|Q32MK1|Q96DV1	Missense_Mutation	SNP	ENST00000394809.4	37	CCDS10723.2	.	.	.	.	.	.	.	.	.	.	G	12.30	1.895329	0.33442	.	.	ENSG00000140795	ENST00000394809;ENST00000536476	T;T	0.69685	-0.42;-0.38	5.38	-0.353	0.12594	.	1.100830	0.07204	N	0.858024	T	0.50684	0.1630	L	0.50333	1.59	0.09310	N	1	P;P	0.35077	0.483;0.483	B;B	0.27887	0.084;0.084	T	0.31166	-0.9953	10	0.19147	T	0.46	.	4.0235	0.09677	0.3536:0.0:0.4901:0.1563	.	463;463	B5BUL9;Q32MK0	.;MYLK3_HUMAN	V	463;122	ENSP00000378288:A463V;ENSP00000439297:A122V	ENSP00000378288:A463V	A	-	2	0	MYLK3	45323695	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.842000	0.27627	0.260000	0.21731	-0.258000	0.10820	GCA		MYLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255743.2	NM_182493	
RSPRY1	89970	broad.mit.edu	37	16	57255307	57255307	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr16:57255307G>A	ENST00000537866.1	+	10	2014	c.1141G>A	c.(1141-1143)Gac>Aac	p.D381N	RSPRY1_ENST00000394420.4_Missense_Mutation_p.D381N			Q96DX4	RSPRY_HUMAN	ring finger and SPRY domain containing 1	381	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					extracellular region (GO:0005576)	zinc ion binding (GO:0008270)	p.D381N(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|urinary_tract(3)	27						GGCCACTCGAGACAGCAAATT	0.483																																					p.D381N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1141A	16						.						141.0	128.0	133.0					16																	57255307		2198	4300	6498	55812808	SO:0001583	missense	89970	exon10			AB075852	CCDS10775.1	16q13	2014-02-12			ENSG00000159579	ENSG00000159579		"""RING-type (C3HC4) zinc fingers"""	29420	protein-coding gene	gene with protein product						11853319	Standard	NM_133368		Approved	KIAA1972	uc002elb.3	Q96DX4	OTTHUMG00000133462	ENST00000537866.1:c.1141G>A	16.37:g.57255307G>A	ENSP00000443176:p.Asp381Asn	Somatic		Capture	Illumina HiSeq	Phase_I	55812808	NM_133368	Q6UX21|Q8ND53	Missense_Mutation	SNP	ENST00000537866.1	37	CCDS10775.1	.	.	.	.	.	.	.	.	.	.	G	19.57	3.851632	0.71719	.	.	ENSG00000159579	ENST00000394420;ENST00000537866	T;T	0.73469	-0.75;-0.75	6.03	6.03	0.97812	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.043285	0.85682	D	0.000000	T	0.64972	0.2647	N	0.25144	0.715	0.80722	D	1	B	0.31548	0.328	B	0.30401	0.115	T	0.59742	-0.7397	10	0.26408	T	0.33	.	20.5568	0.99304	0.0:0.0:1.0:0.0	.	381	Q96DX4	RSPRY_HUMAN	N	381	ENSP00000377942:D381N;ENSP00000443176:D381N	ENSP00000377942:D381N	D	+	1	0	RSPRY1	55812808	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	8.025000	0.88777	2.861000	0.98227	0.655000	0.94253	GAC		RSPRY1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432953.1	NM_133368	
CDH11	1009	broad.mit.edu	37	16	65022216	65022216	+	Silent	SNP	G	G	A			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr16:65022216G>A	ENST00000268603.4	-	7	1458	c.843C>T	c.(841-843)gcC>gcT	p.A281A	CDH11_ENST00000394156.3_Silent_p.A281A|CDH11_ENST00000566827.1_Silent_p.A155A	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	281	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A281A(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		CCCCAGGGACGGCTGCTTCTG	0.393			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																											p.A281A			Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C843T	16						.						172.0	157.0	162.0					16																	65022216		2203	4300	6503	63579717	SO:0001819	synonymous_variant	1009	exon7			D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.843C>T	16.37:g.65022216G>A		Somatic		Capture	Illumina HiSeq	Phase_I	63579717	NM_001797	A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Silent	SNP	ENST00000268603.4	37	CCDS10803.1																																																																																				CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268755.1	NM_033664	
GRIN2A	2903	broad.mit.edu	37	16	9943663	9943663	+	Silent	SNP	G	G	A			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr16:9943663G>A	ENST00000396573.2	-	6	1587	c.1278C>T	c.(1276-1278)acC>acT	p.T426T	GRIN2A_ENST00000562109.1_Silent_p.T426T|GRIN2A_ENST00000404927.2_Silent_p.T426T|GRIN2A_ENST00000396575.2_Silent_p.T426T|GRIN2A_ENST00000535259.1_Silent_p.T269T|GRIN2A_ENST00000330684.3_Silent_p.T426T	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	426					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.T426T(1)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CACACGTCTCGGTCAGGGGGT	0.542																																					p.T426T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1278T	16						.						181.0	141.0	154.0					16																	9943663		2197	4300	6497	9851164	SO:0001819	synonymous_variant	2903	exon5				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.1278C>T	16.37:g.9943663G>A		Somatic		Capture	Illumina HiSeq	Phase_I	9851164	NM_001134408	O00669|Q17RZ6	Silent	SNP	ENST00000396573.2	37	CCDS10539.1																																																																																				GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		
TAF1C	9013	broad.mit.edu	37	16	84215969	84215969	+	Missense_Mutation	SNP	G	G	C	rs201410237		TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr16:84215969G>C	ENST00000567759.1	-	7	742	c.560C>G	c.(559-561)gCg>gGg	p.A187G	TAF1C_ENST00000566732.1_Missense_Mutation_p.A187G|TAF1C_ENST00000378541.4_Missense_Mutation_p.A187G|TAF1C_ENST00000541676.1_Missense_Mutation_p.A120G|TAF1C_ENST00000565544.1_5'Flank|TAF1C_ENST00000341690.6_Missense_Mutation_p.A120G|TAF1C_ENST00000570117.1_5'UTR	NM_005679.3	NP_005670	Q15572	TAF1C_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa	187					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	26						CAAGTGGCTCGCCACCGACGT	0.672																																					p.A120G												.	.	0			c.C359G	16						.						13.0	15.0	14.0					16																	84215969		2192	4293	6485	82773470	SO:0001583	missense	9013	exon7			L39059	CCDS32496.1, CCDS45535.1, CCDS58488.1, CCDS58489.1	16q24	2008-02-05	2002-08-29			ENSG00000103168			11534	protein-coding gene	gene with protein product		604905	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kD"""			7801123	Standard	NM_005679		Approved	TAFI110, TAFI95, SL1, MGC:39976	uc010vnx.2	Q15572		ENST00000567759.1:c.560C>G	16.37:g.84215969G>C	ENSP00000455265:p.Ala187Gly	None		Capture	Illumina HiSeq	Phase_I	82773470	NM_139353	B7Z5K5|B7Z5S4|B7Z908|B7Z9L7|Q59F67|Q8N6V3	Missense_Mutation	SNP	ENST00000567759.1	37	CCDS32496.1	.	.	.	.	.	.	.	.	.	.	G	8.254	0.809732	0.16537	.	.	ENSG00000103168	ENST00000378541;ENST00000541676;ENST00000341690;ENST00000537450	T;T;T	0.04083	3.76;3.71;3.71	4.65	1.42	0.22433	.	0.886560	0.09370	N	0.811390	T	0.06050	0.0157	L	0.46157	1.445	0.09310	N	1	P;P;P;P	0.45715	0.584;0.584;0.865;0.584	B;B;P;B	0.46076	0.314;0.267;0.503;0.267	T	0.37033	-0.9723	10	0.33940	T	0.23	-13.7599	2.4481	0.04511	0.1081:0.1868:0.5128:0.1923	.	187;187;187;120	F5H7W6;Q15572-6;Q15572;Q15572-2	.;.;TAF1C_HUMAN;.	G	187;120;120;187	ENSP00000367802:A187G;ENSP00000437900:A120G;ENSP00000345305:A120G	ENSP00000345305:A120G	A	-	2	0	TAF1C	82773470	0.444000	0.25649	0.368000	0.25939	0.362000	0.29581	1.841000	0.39240	1.107000	0.41642	0.561000	0.74099	GCG		TAF1C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000433045.2	NM_139353	
SOX9	6662	broad.mit.edu	37	17	70119864	70119865	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	-	-	-	C	-	-	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr17:70119864_70119865insC	ENST00000245479.2	+	3	1238_1239	c.866_867insC	c.(865-870)ttcgatfs	p.D290fs		NM_000346.3	NP_000337.1	P48436	SOX9_HUMAN	SRY (sex determining region Y)-box 9	290					astrocyte fate commitment (GO:0060018)|branching involved in ureteric bud morphogenesis (GO:0001658)|cAMP-mediated signaling (GO:0019933)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cell fate specification (GO:0001708)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to heparin (GO:0071504)|cellular response to interleukin-1 (GO:0071347)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|chondrocyte hypertrophy (GO:0003415)|chromatin remodeling (GO:0006338)|cochlea morphogenesis (GO:0090103)|cytoskeleton organization (GO:0007010)|endocardial cushion morphogenesis (GO:0003203)|endocrine pancreas development (GO:0031018)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation involved in prostatic bud elongation (GO:0060517)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|heart valve development (GO:0003170)|heart valve formation (GO:0003188)|heart valve morphogenesis (GO:0003179)|intestinal epithelial structure maintenance (GO:0060729)|intrahepatic bile duct development (GO:0035622)|limb bud formation (GO:0060174)|lung epithelial cell differentiation (GO:0060487)|male germ-line sex determination (GO:0019100)|male gonad development (GO:0008584)|mammary gland development (GO:0030879)|metanephric nephron tubule formation (GO:0072289)|morphogenesis of a branching epithelium (GO:0061138)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biomineral tissue development (GO:0070168)|negative regulation of bone mineralization (GO:0030502)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of immune system process (GO:0002683)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of ossification (GO:0030279)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell development (GO:0014032)|notochord development (GO:0030903)|nucleosome assembly (GO:0006334)|oligodendrocyte differentiation (GO:0048709)|ossification (GO:0001503)|otic vesicle formation (GO:0030916)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation involved in heart morphogenesis (GO:2000138)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of extracellular matrix assembly (GO:1901203)|positive regulation of kidney development (GO:0090184)|positive regulation of male gonad development (GO:2000020)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein complex assembly (GO:0006461)|protein kinase B signaling (GO:0043491)|regulation of apoptotic process (GO:0042981)|regulation of branching involved in lung morphogenesis (GO:0061046)|regulation of cell adhesion (GO:0030155)|regulation of cell cycle process (GO:0010564)|regulation of cell proliferation (GO:0042127)|regulation of cell proliferation involved in tissue homeostasis (GO:0060784)|regulation of epithelial cell proliferation involved in lung morphogenesis (GO:2000794)|renal vesicle induction (GO:0072034)|retina development in camera-type eye (GO:0060041)|retinal rod cell differentiation (GO:0060221)|Sertoli cell development (GO:0060009)|Sertoli cell differentiation (GO:0060008)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|spermatogenesis (GO:0007283)|tissue homeostasis (GO:0001894)|transcription from RNA polymerase II promoter (GO:0006366)|ureter morphogenesis (GO:0072197)|ureter smooth muscle cell differentiation (GO:0072193)|ureter urothelium development (GO:0072190)	nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|enhancer binding (GO:0035326)|enhancer sequence-specific DNA binding (GO:0001158)|pre-mRNA intronic binding (GO:0097157)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase activity (GO:0004672)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D290fs*6(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(5)|pancreas(1)|upper_aerodigestive_tract(2)	26		Colorectal(1115;0.245)	STAD - Stomach adenocarcinoma(260;0.119)			ATCGAGACCTTCGATGTCAACG	0.663																																					p.F289fs	Pancreas(42;83 1041 2320 35205 39456)											.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.866_867insC	17						.																																			67631460	SO:0001589	frameshift_variant	6662	exon3			S74506	CCDS11689.1	17q24.3	2013-10-17	2008-07-31		ENSG00000125398	ENSG00000125398		"""SRY (sex determining region Y)-boxes"""	11204	protein-coding gene	gene with protein product		608160	"""campomelic dysplasia, autosomal sex-reversal"""	CMD1, CMPD1		8348155	Standard	NM_000346		Approved	SRA1	uc002jiw.3	P48436	OTTHUMG00000166300	ENST00000245479.2:c.867dupC	17.37:g.70119865_70119865dupC	ENSP00000245479:p.Asp290fs	Somatic		Capture	Illumina HiSeq	Phase_I	67631459	NM_000346	Q53Y80	Frame_Shift_Ins	INS	ENST00000245479.2	37	CCDS11689.1																																																																																				SOX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389032.1	NM_000346	
PRPF8	10594	broad.mit.edu	37	17	1576820	1576820	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr17:1576820C>T	ENST00000572621.1	-	22	3753	c.3488G>A	c.(3487-3489)cGg>cAg	p.R1163Q	PRPF8_ENST00000304992.6_Missense_Mutation_p.R1163Q			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	1163	Reverse transcriptase homology domain.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)	p.R1163Q(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		AGTCACTGACCGTGGCAAGCG	0.537																																					p.R1163Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3488A	17						.						165.0	133.0	144.0					17																	1576820		2203	4300	6503	1523570	SO:0001583	missense	10594	exon23			AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.3488G>A	17.37:g.1576820C>T	ENSP00000460348:p.Arg1163Gln	Somatic		Capture	Illumina HiSeq	Phase_I	1523570	NM_006445	O14547|O75965	Missense_Mutation	SNP	ENST00000572621.1	37	CCDS11010.1	.	.	.	.	.	.	.	.	.	.	C	32	5.184637	0.94885	.	.	ENSG00000174231	ENST00000304992	T	0.80994	-1.44	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	D	0.92873	0.7733	M	0.93283	3.4	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.93026	0.6444	10	0.52906	T	0.07	.	20.4171	0.99027	0.0:1.0:0.0:0.0	.	1163	Q6P2Q9	PRP8_HUMAN	Q	1163	ENSP00000304350:R1163Q	ENSP00000304350:R1163Q	R	-	2	0	PRPF8	1523570	1.000000	0.71417	1.000000	0.80357	0.802000	0.45316	7.814000	0.86154	2.832000	0.97577	0.585000	0.79938	CGG		PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438412.2		
KRTAP1-3	81850	broad.mit.edu	37	17	39190679	39190679	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr17:39190679G>A	ENST00000344363.5	-	1	428	c.395C>T	c.(394-396)aCc>aTc	p.T132I		NM_030966.1	NP_112228.1	Q8IUG1	KRA13_HUMAN	keratin associated protein 1-3	142						keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)	p.T132I(1)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(6)	12		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			CTGGCAGCAGGTTGGGGGTGT	0.672																																					p.T132I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C395T	17						.						28.0	34.0	32.0					17																	39190679		2097	4201	6298	36444205	SO:0001583	missense	81850	exon1			AJ406927	CCDS42323.1	17q21.2	2013-06-20			ENSG00000221880	ENSG00000221880		"""Keratin associated proteins"""	16771	protein-coding gene	gene with protein product		608820				11279113	Standard	NM_030966		Approved	KAP1.3	uc002hvv.3	Q8IUG1	OTTHUMG00000133583	ENST00000344363.5:c.395C>T	17.37:g.39190679G>A	ENSP00000344420:p.Thr132Ile	Somatic		Capture	Illumina HiSeq	Phase_I	36444205	NM_030966	Q07628|Q8IUG0|Q9BYS2	Missense_Mutation	SNP	ENST00000344363.5	37	CCDS42323.1	.	.	.	.	.	.	.	.	.	.	G	14.96	2.692631	0.48202	.	.	ENSG00000221880	ENST00000344363	T	0.35605	1.3	4.52	4.52	0.55395	.	.	.	.	.	T	0.56906	0.2017	.	.	.	0.21473	N	0.999676	D	0.71674	0.998	D	0.70487	0.969	T	0.47289	-0.9129	8	0.54805	T	0.06	.	13.4537	0.61187	0.0:0.0:1.0:0.0	.	142	Q8IUG1	KRA13_HUMAN	I	132	ENSP00000344420:T132I	ENSP00000344420:T132I	T	-	2	0	KRTAP1-3	36444205	0.992000	0.36948	0.939000	0.37840	0.878000	0.50629	2.681000	0.46926	2.435000	0.82474	0.643000	0.83706	ACC		KRTAP1-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257687.1		
ITGA2B	3674	broad.mit.edu	37	17	42455814	42455814	+	Silent	SNP	G	G	A	rs372777804		TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr17:42455814G>A	ENST00000262407.5	-	20	2041	c.2010C>T	c.(2008-2010)aaC>aaT	p.N670N	ITGA2B_ENST00000353281.4_Silent_p.N670N	NM_000419.3	NP_000410.2	P08514	ITA2B_HUMAN	integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)	670					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)	extracellular matrix binding (GO:0050840)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)	p.N670N(1)		biliary_tract(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.191)	Abciximab(DB00054)|Tirofiban(DB00775)	CCTCGCCCTCGTTGGCTGCGT	0.652																																					p.N670N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2010T	17						.						26.0	27.0	26.0					17																	42455814		2203	4300	6503	39811340	SO:0001819	synonymous_variant	3674	exon20				CCDS32665.1	17q21.32	2014-09-17	2006-02-22			ENSG00000005961		"""CD molecules"", ""Integrins"""	6138	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 93"""	607759	"""integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41B)"""	GP2B			Standard	NM_000419		Approved	CD41B, CD41, PPP1R93	uc002igt.1	P08514		ENST00000262407.5:c.2010C>T	17.37:g.42455814G>A		Somatic		Capture	Illumina HiSeq	Phase_I	39811340	NM_000419	B2RCY8|O95366|Q14443|Q17R67	Silent	SNP	ENST00000262407.5	37	CCDS32665.1																																																																																				ITGA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439823.1		
GEMIN4	50628	broad.mit.edu	37	17	649281	649281	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr17:649281C>T	ENST00000319004.5	-	2	2120	c.2002G>A	c.(2002-2004)Gac>Aac	p.D668N	GEMIN4_ENST00000576778.1_Missense_Mutation_p.D657N	NM_015721.2	NP_056536.2	P57678	GEMI4_HUMAN	gem (nuclear organelle) associated protein 4	668					gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)		p.D668N(1)		breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(4)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(207;0.204)		UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		AGACTGAGGTCTACCTCTTCA	0.527																																					p.D668N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2002A	17						.						46.0	49.0	48.0					17																	649281		1961	4153	6114	596031	SO:0001583	missense	50628	exon2			AF177341	CCDS45559.1	17p13.3	2008-07-18				ENSG00000179409			15717	protein-coding gene	gene with protein product	"""HCC-associated protein 1"", ""component of gems 4"""	606969				10725331	Standard	NM_015721		Approved	HHRF-1, DKFZP434B131, p97, DKFZP434D174, HC56, HCAP1	uc002frs.1	P57678		ENST00000319004.5:c.2002G>A	17.37:g.649281C>T	ENSP00000321706:p.Asp668Asn	Somatic		Capture	Illumina HiSeq	Phase_I	596031	NM_015721	Q9NZS7|Q9UG32|Q9Y4Q2	Missense_Mutation	SNP	ENST00000319004.5	37	CCDS45559.1	.	.	.	.	.	.	.	.	.	.	C	13.47	2.246553	0.39697	.	.	ENSG00000179409	ENST00000319004	T	0.06294	3.32	5.57	5.57	0.84162	.	0.235163	0.42420	D	0.000716	T	0.09113	0.0225	L	0.51422	1.61	0.80722	D	1	P	0.38504	0.634	B	0.39258	0.295	T	0.07597	-1.0764	10	0.42905	T	0.14	-11.6758	13.5009	0.61454	0.1559:0.8441:0.0:0.0	.	668	P57678	GEMI4_HUMAN	N	668	ENSP00000321706:D668N	ENSP00000321706:D668N	D	-	1	0	GEMIN4	596031	1.000000	0.71417	0.948000	0.38648	0.866000	0.49608	5.259000	0.65485	2.621000	0.88768	0.655000	0.94253	GAC		GEMIN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437181.1	NM_015721	
FBXO39	162517	broad.mit.edu	37	17	6690620	6690620	+	Splice_Site	SNP	C	C	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr17:6690620C>T	ENST00000321535.4	+	4	1332	c.1202C>T	c.(1201-1203)gCg>gTg	p.A401V		NM_153230.2	NP_694962.1	Q8N4B4	FBX39_HUMAN	F-box protein 39	401								p.A401V(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	26						TTGGCACAGGCGAGAATTTAT	0.443																																					p.A401V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1202T	17						.						94.0	89.0	91.0					17																	6690620		2203	4300	6503	6631344	SO:0001630	splice_region_variant	162517	exon4			BC034782	CCDS11082.1	17p13.2	2014-01-21			ENSG00000177294	ENSG00000177294		"""F-boxes /  ""other"""""	28565	protein-coding gene	gene with protein product		609106				12477932	Standard	NM_153230		Approved	MGC35179, Fbx39, CT144	uc010vtg.2	Q8N4B4	OTTHUMG00000102062	ENST00000321535.4:c.1201-1C>T	17.37:g.6690620C>T		Somatic		Capture	Illumina HiSeq	Phase_I	6631344	NM_153230		Missense_Mutation	SNP	ENST00000321535.4	37	CCDS11082.1	.	.	.	.	.	.	.	.	.	.	C	2.759	-0.258249	0.05791	.	.	ENSG00000177294	ENST00000321535	T	0.08102	3.13	5.23	4.15	0.48705	.	0.105796	0.41294	N	0.000908	T	0.02494	0.0076	N	0.01874	-0.695	0.22199	N	0.999299	B	0.02656	0.0	B	0.01281	0.0	T	0.45352	-0.9267	10	0.02654	T	1	-25.0923	8.3076	0.32051	0.0:0.0912:0.0:0.9088	.	401	Q8N4B4	FBX39_HUMAN	V	401	ENSP00000321386:A401V	ENSP00000321386:A401V	A	+	2	0	FBXO39	6631344	1.000000	0.71417	1.000000	0.80357	0.775000	0.43874	3.684000	0.54671	0.934000	0.37316	-0.417000	0.06048	GCG		FBXO39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219866.2	NM_153230	Missense_Mutation
SMG8	55181	broad.mit.edu	37	17	57290175	57290175	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr17:57290175A>T	ENST00000543872.2	+	4	2255	c.1991A>T	c.(1990-1992)aAa>aTa	p.K664I	CTD-2510F5.6_ENST00000577660.1_Intron|SMG8_ENST00000580498.1_3'UTR|SMG8_ENST00000300917.5_Missense_Mutation_p.K664I			Q8ND04	SMG8_HUMAN	SMG8 nonsense mediated mRNA decay factor	664					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of protein kinase activity (GO:0045859)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)				NS(1)|breast(5)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	33						GCTCCTGCTAAAAATGAATCC	0.418																																					p.K664I												.	.	0			c.A1991T	17						.						126.0	142.0	136.0					17																	57290175		2203	4300	6503	54644957	SO:0001583	missense	55181	exon3			AL834490	CCDS11615.1	17q23.2	2013-07-02	2013-07-02	2011-06-21					25551	protein-coding gene	gene with protein product		613175	"""chromosome 17 open reading frame 71"", ""smg-8 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf71		19417104	Standard	NM_018149		Approved	FLJ10587, FLJ23205	uc002ixi.3	Q8ND04		ENST00000543872.2:c.1991A>T	17.37:g.57290175A>T	ENSP00000438748:p.Lys664Ile	None		Capture	Illumina HiSeq	Phase_I	54644957	NM_018149	Q8N5U5|Q8TDN0|Q9H5P5|Q9NVQ1	Missense_Mutation	SNP	ENST00000543872.2	37	CCDS11615.1	.	.	.	.	.	.	.	.	.	.	A	12.67	2.008452	0.35415	.	.	ENSG00000167447	ENST00000300917;ENST00000543872	T;T	0.47177	0.85;0.85	6.05	6.05	0.98169	.	0.252690	0.51477	D	0.000096	T	0.35941	0.0949	L	0.27053	0.805	0.40488	D	0.980511	B	0.30211	0.273	B	0.31245	0.126	T	0.34576	-0.9823	10	0.66056	D	0.02	-17.0458	10.0128	0.41997	0.9184:0.0:0.0816:0.0	.	664	Q8ND04	SMG8_HUMAN	I	664	ENSP00000300917:K664I;ENSP00000438748:K664I	ENSP00000300917:K664I	K	+	2	0	SMG8	54644957	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	4.512000	0.60469	2.323000	0.78572	0.533000	0.62120	AAA		SMG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445960.2	NM_018149	
SDK2	54549	broad.mit.edu	37	17	71410867	71410867	+	Silent	SNP	C	C	T	rs139471859		TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr17:71410867C>T	ENST00000392650.3	-	18	2400	c.2400G>A	c.(2398-2400)gcG>gcA	p.A800A	SDK2_ENST00000388726.3_Silent_p.A800A	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	800	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.A800A(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						TGGTGGCTTCCGCGTGCACAT	0.602																																					p.A800A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2400A	17						.	C		0,4406		0,0,2203	94.0	78.0	83.0		2400	-10.8	0.0	17	dbSNP_134	83	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	SDK2	NM_001144952.1		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		800/2173	71410867	2,13004	2203	4300	6503	68922462	SO:0001819	synonymous_variant	54549	exon18			AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.2400G>A	17.37:g.71410867C>T		Somatic		Capture	Illumina HiSeq	Phase_I	68922462	NM_001144952	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Silent	SNP	ENST00000392650.3	37	CCDS45769.1																																																																																				SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	NM_019064	
OGFOD3	79701	broad.mit.edu	37	17	80361958	80361958	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr17:80361958C>T	ENST00000313056.5	-	7	705	c.554G>A	c.(553-555)cGg>cAg	p.R185Q	OGFOD3_ENST00000329197.5_Missense_Mutation_p.R185Q|RP13-20L14.4_ENST00000579188.1_RNA	NM_024648.2|NM_175902.4	NP_078924.1|NP_787098.3	Q6PK18	OGFD3_HUMAN	2-oxoglutarate and iron-dependent oxygenase domain containing 3	185						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)	p.R185Q(1)									GACCTTCTGCCGCACCTCCCT	0.622																																					p.R185Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G554A	17						.						74.0	58.0	63.0					17																	80361958		2202	4299	6501	77955247	SO:0001583	missense	79701	exon7			BC023602	CCDS11811.1, CCDS11812.1	17q25.3	2012-10-23	2012-10-23	2012-10-23	ENSG00000181396	ENSG00000181396			26174	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 101"""	C17orf101		12477932	Standard	NM_175902		Approved	FLJ22222	uc002keu.2	Q6PK18		ENST00000313056.5:c.554G>A	17.37:g.80361958C>T	ENSP00000320116:p.Arg185Gln	Somatic		Capture	Illumina HiSeq	Phase_I	77955247	NM_175902	C9JDC8|Q8IZ37|Q9H6J2	Missense_Mutation	SNP	ENST00000313056.5	37	CCDS11811.1	.	.	.	.	.	.	.	.	.	.	C	19.58	3.853929	0.71719	.	.	ENSG00000181396	ENST00000313056;ENST00000329197	T;T	0.33654	1.86;1.4	5.25	5.25	0.73442	Prolyl 4-hydroxylase, alpha subunit (1);	0.000000	0.85682	D	0.000000	T	0.61022	0.2314	M	0.76002	2.32	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.947	T	0.61347	-0.7081	10	0.44086	T	0.13	-23.4345	17.4316	0.87541	0.0:1.0:0.0:0.0	.	185;185	Q6PK18;Q6PK18-2	CQ101_HUMAN;.	Q	185	ENSP00000320116:R185Q;ENSP00000330075:R185Q	ENSP00000320116:R185Q	R	-	2	0	C17orf101	77955247	1.000000	0.71417	0.992000	0.48379	0.110000	0.19582	6.778000	0.75043	2.439000	0.82584	0.655000	0.94253	CGG		OGFOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442895.1	NM_175902	
PIP5K1C	23396	broad.mit.edu	37	19	3645992	3645992	+	Missense_Mutation	SNP	G	G	A	rs146759793	byFrequency	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr19:3645992G>A	ENST00000335312.3	-	11	1413	c.1325C>T	c.(1324-1326)aCg>aTg	p.T442M	PIP5K1C_ENST00000589578.1_Missense_Mutation_p.T442M|PIP5K1C_ENST00000539785.1_Missense_Mutation_p.T442M|PIP5K1C_ENST00000537021.1_Missense_Mutation_p.T442M	NM_001195733.1|NM_012398.2	NP_001182662.1|NP_036530.1	O60331	PI51C_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type I, gamma	442	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				actin cytoskeleton organization (GO:0030036)|adherens junction assembly (GO:0034333)|axon guidance (GO:0007411)|clathrin-mediated endocytosis (GO:0072583)|cytoskeletal anchoring at plasma membrane (GO:0007016)|neutrophil chemotaxis (GO:0030593)|phagocytosis (GO:0006909)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet aggregation (GO:0070527)|single organismal cell-cell adhesion (GO:0016337)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle exocytosis (GO:0016079)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|uropod (GO:0001931)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)	p.T442M(1)		large_intestine(3)|ovary(1)|skin(3)|stomach(2)	9		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.95e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0026)|STAD - Stomach adenocarcinoma(1328;0.183)		CCGAAAGACCGTGTTGCTCAT	0.657													g|||	2	0.000399361	0.0	0.0014	5008	,	,		16829	0.001		0.0	False		,,,				2504	0.0				p.T442M	Esophageal Squamous(135;99 1744 12852 27186 39851)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1325T	19						.		MET/THR,MET/THR	1,4405	2.1+/-5.4	0,1,2202	75.0	78.0	77.0		1325,1325	4.2	1.0	19	dbSNP_134	77	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	PIP5K1C	NM_001195733.1,NM_012398.2	81,81	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging,probably-damaging	442/641,442/669	3645992	2,13004	2203	4300	6503	3596992	SO:0001583	missense	23396	exon11			AB011161	CCDS32872.1, CCDS56074.1, CCDS74257.1	19p13.3	2012-10-02			ENSG00000186111	ENSG00000186111			8996	protein-coding gene	gene with protein product		606102				9535851	Standard	NM_001195733		Approved	PIP5Kgamma, KIAA0589, LCCS3	uc002lyj.2	O60331	OTTHUMG00000180870	ENST00000335312.3:c.1325C>T	19.37:g.3645992G>A	ENSP00000335333:p.Thr442Met	Somatic		Capture	Illumina HiSeq	Phase_I	3596992	NM_001195733	B7Z9E7|C6GIJ7|C6GIJ8|Q7LE07	Missense_Mutation	SNP	ENST00000335312.3	37	CCDS32872.1	.	.	.	.	.	.	.	.	.	.	g	12.09	1.832890	0.32421	2.27E-4	1.16E-4	ENSG00000186111	ENST00000335312;ENST00000539785;ENST00000537021	T;T;T	0.35605	1.3;1.3;1.3	4.19	4.19	0.49359	Phosphatidylinositol-4-phosphate 5-kinase, core (2);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	0.112865	0.64402	U	0.000017	T	0.31979	0.0814	M	0.64997	1.995	0.31375	N	0.679658	P;P	0.51791	0.948;0.657	B;B	0.32677	0.15;0.148	T	0.55392	-0.8148	10	0.62326	D	0.03	-21.8191	15.8577	0.78994	0.0:0.0:1.0:0.0	.	442;442	O60331-3;O60331	.;PI51C_HUMAN	M	442	ENSP00000335333:T442M;ENSP00000445992:T442M;ENSP00000444779:T442M	ENSP00000335333:T442M	T	-	2	0	PIP5K1C	3596992	1.000000	0.71417	0.963000	0.40424	0.734000	0.41952	3.704000	0.54815	2.055000	0.61198	0.306000	0.20318	ACG		PIP5K1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453432.2	NM_012398	
OR7A10	390892	broad.mit.edu	37	19	14952390	14952390	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr19:14952390C>G	ENST00000248058.1	-	1	299	c.300G>C	c.(298-300)caG>caC	p.Q100H		NM_001005190.1	NP_001005190.1	O76100	OR7AA_HUMAN	olfactory receptor, family 7, subfamily A, member 10	100						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q100H(1)		NS(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|stomach(1)	19	Ovarian(108;0.203)					AAAAGCACATCTGGGTGATGC	0.483																																					p.Q100H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G300C	19						.						123.0	104.0	110.0					19																	14952390		2203	4300	6503	14813390	SO:0001583	missense	390892	exon1				CCDS32936.1	19p13.1	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8356	protein-coding gene	gene with protein product							Standard	NM_001005190		Approved		uc002mzx.1	O76100		ENST00000248058.1:c.300G>C	19.37:g.14952390C>G	ENSP00000248058:p.Gln100His	Somatic		Capture	Illumina HiSeq	Phase_I	14813390	NM_001005190	Q6IFP0|Q96R97	Missense_Mutation	SNP	ENST00000248058.1	37	CCDS32936.1	.	.	.	.	.	.	.	.	.	.	c	7.735	0.700096	0.15106	.	.	ENSG00000127515	ENST00000248058	T	0.00472	7.19	2.8	1.74	0.24563	GPCR, rhodopsin-like superfamily (1);	0.000000	0.37136	U	0.002240	T	0.02047	0.0064	H	0.98238	4.18	0.22719	N	0.998813	D	0.89917	1.0	D	0.77557	0.99	T	0.33548	-0.9864	10	0.87932	D	0	.	4.8687	0.13622	0.0:0.7004:0.0:0.2996	.	100	O76100	OR7AA_HUMAN	H	100	ENSP00000248058:Q100H	ENSP00000248058:Q100H	Q	-	3	2	OR7A10	14813390	0.000000	0.05858	0.038000	0.18304	0.022000	0.10575	-0.388000	0.07352	0.524000	0.28502	0.194000	0.17425	CAG		OR7A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466520.1	NM_001005190	
ZBTB32	27033	broad.mit.edu	37	19	36205955	36205955	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr19:36205955G>A	ENST00000392197.2	+	3	745	c.427G>A	c.(427-429)Ggg>Agg	p.G143R	KMT2B_ENST00000341701.1_5'Flank|KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000222270.7_5'Flank|KMT2B_ENST00000420124.1_5'Flank|ZBTB32_ENST00000262630.3_Missense_Mutation_p.G143R			Q9Y2Y4	ZBT32_HUMAN	zinc finger and BTB domain containing 32	143					DNA repair (GO:0006281)|hemopoiesis (GO:0030097)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of cytokine production (GO:0001817)|T cell proliferation (GO:0042098)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.G143R(1)		large_intestine(5)|lung(1)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	14	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GAGAGAACTGGGGGACCCTGG	0.552																																					p.G143R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G427A	19						.						41.0	45.0	44.0					19																	36205955		2203	4300	6503	40897795	SO:0001583	missense	27033	exon2			AF130255	CCDS12471.1	19q13.1	2013-01-08			ENSG00000011590	ENSG00000011590		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16763	protein-coding gene	gene with protein product	"""repressor of GATA"""	605859				10572087	Standard	XM_005258739		Approved	TZFP, FAZF, FAXF, Rog, ZNF538	uc002oay.3	Q9Y2Y4	OTTHUMG00000048118	ENST00000392197.2:c.427G>A	19.37:g.36205955G>A	ENSP00000376035:p.Gly143Arg	Somatic		Capture	Illumina HiSeq	Phase_I	40897795	NM_014383	Q8WVP2	Missense_Mutation	SNP	ENST00000392197.2	37	CCDS12471.1	.	.	.	.	.	.	.	.	.	.	G	12.66	2.003331	0.35320	.	.	ENSG00000011590	ENST00000262630;ENST00000392197	T;T	0.09350	2.99;2.99	5.15	0.376	0.16193	.	0.323197	0.22632	N	0.057576	T	0.06508	0.0167	L	0.29908	0.895	0.09310	N	1	B	0.14805	0.011	B	0.11329	0.006	T	0.29088	-1.0023	10	0.39692	T	0.17	-6.5473	4.3925	0.11348	0.1734:0.0:0.5187:0.308	.	143	Q9Y2Y4	ZBT32_HUMAN	R	143	ENSP00000262630:G143R;ENSP00000376035:G143R	ENSP00000262630:G143R	G	+	1	0	ZBTB32	40897795	0.038000	0.19896	0.024000	0.17045	0.321000	0.28281	0.851000	0.27751	0.171000	0.19730	-0.140000	0.14226	GGG		ZBTB32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109491.3	NM_014383	
RYR1	6261	broad.mit.edu	37	19	38991284	38991284	+	Silent	SNP	C	C	T	rs369428665		TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr19:38991284C>T	ENST00000359596.3	+	46	7362	c.7362C>T	c.(7360-7362)cgC>cgT	p.R2454R	RYR1_ENST00000360985.3_Silent_p.R2454R|RYR1_ENST00000355481.4_Silent_p.R2454R			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	2454	6 X approximate repeats.		R -> C (in MHS1; induces an increase sensitivity to caffeine). {ECO:0000269|PubMed:10612851, ECO:0000269|PubMed:12411788, ECO:0000269|PubMed:16163667}.|R -> H (in CCD and MHS1; severe form). {ECO:0000269|PubMed:10051009, ECO:0000269|PubMed:10823104, ECO:0000269|PubMed:11575529, ECO:0000269|PubMed:12059893, ECO:0000269|PubMed:12709367, ECO:0000269|PubMed:15448513, ECO:0000269|PubMed:16163667, ECO:0000269|PubMed:23558838}.		calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.R2454R(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	TGCGGATCCGCGCCATCCTCC	0.642																																					p.R2454R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C7362T	19						.	C	,	0,4406		0,0,2203	57.0	50.0	52.0		7362,7362	-8.0	0.3	19		52	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	RYR1	NM_000540.2,NM_001042723.1	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	2454/5039,2454/5034	38991284	1,13005	2203	4300	6503	43683124	SO:0001819	synonymous_variant	6261	exon46			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.7362C>T	19.37:g.38991284C>T		Somatic		Capture	Illumina HiSeq	Phase_I	43683124	NM_001042723	Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	ENST00000359596.3	37	CCDS33011.1																																																																																				RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
PRX	57716	broad.mit.edu	37	19	40901440	40901440	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr19:40901440C>T	ENST00000324001.7	-	7	3089	c.2819G>A	c.(2818-2820)gGg>gAg	p.G940E	PRX_ENST00000291825.7_3'UTR	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	940					axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.G940E(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CACCTTTGGCCCCGAGAGTCC	0.572																																					p.G940E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2819A	19						.						89.0	100.0	96.0					19																	40901440		2203	4300	6503	45593280	SO:0001583	missense	57716	exon7			AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.2819G>A	19.37:g.40901440C>T	ENSP00000326018:p.Gly940Glu	Somatic		Capture	Illumina HiSeq	Phase_I	45593280	NM_181882	Q9BXL9|Q9HCF2	Missense_Mutation	SNP	ENST00000324001.7	37	CCDS33028.1	.	.	.	.	.	.	.	.	.	.	C	15.25	2.779291	0.49891	.	.	ENSG00000105227	ENST00000324001;ENST00000341562	T	0.01059	5.39	5.07	5.07	0.68467	.	0.000000	0.48286	D	0.000181	T	0.03348	0.0097	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.60566	-0.7238	10	0.51188	T	0.08	-36.2979	11.511	0.50494	0.0:0.912:0.0:0.088	.	940	Q9BXM0	PRAX_HUMAN	E	940	ENSP00000326018:G940E	ENSP00000326018:G940E	G	-	2	0	PRX	45593280	0.371000	0.25056	0.999000	0.59377	0.919000	0.55068	1.579000	0.36536	2.362000	0.80069	0.462000	0.41574	GGG		PRX-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000462582.1	NM_020956	
SPTBN4	57731	broad.mit.edu	37	19	41081408	41081408	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr19:41081408C>T	ENST00000352632.3	+	36	7714	c.7628C>T	c.(7627-7629)tCa>tTa	p.S2543L	SHKBP1_ENST00000291842.5_5'Flank|SHKBP1_ENST00000600733.1_5'Flank|SPTBN4_ENST00000593816.1_3'UTR|SPTBN4_ENST00000392025.1_Missense_Mutation_p.S1286L|SPTBN4_ENST00000598249.1_Missense_Mutation_p.S2543L			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	2543					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.S2543L(1)		breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CCCACTACTTCATCCACAGAT	0.627																																					p.S2543L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C7628T	19						.						50.0	38.0	42.0					19																	41081408		2203	4300	6503	45773248	SO:0001583	missense	57731	exon36			AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.7628C>T	19.37:g.41081408C>T	ENSP00000263373:p.Ser2543Leu	Somatic		Capture	Illumina HiSeq	Phase_I	45773248	NM_020971	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	ENST00000352632.3	37	CCDS12559.1	.	.	.	.	.	.	.	.	.	.	C	17.19	3.325944	0.60743	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000392025	T;T	0.79247	-1.25;0.04	4.65	4.65	0.58169	.	0.119918	0.35320	U	0.003288	T	0.62514	0.2434	N	0.08118	0	0.80722	D	1	B;B	0.27351	0.176;0.107	B;B	0.26517	0.07;0.021	T	0.65755	-0.6091	10	0.72032	D	0.01	.	16.6678	0.85257	0.0:1.0:0.0:0.0	.	1286;2543	C9JY79;Q9H254	.;SPTN4_HUMAN	L	2543;2543;1286	ENSP00000263373:S2543L;ENSP00000375879:S1286L	ENSP00000263373:S2543L	S	+	2	0	SPTBN4	45773248	0.998000	0.40836	0.742000	0.31022	0.941000	0.58515	4.762000	0.62250	2.296000	0.77279	0.462000	0.41574	TCA		SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2		
EXOSC5	56915	broad.mit.edu	37	19	41903163	41903163	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr19:41903163G>A	ENST00000221233.4	-	1	221	c.71C>T	c.(70-72)cCt>cTt	p.P24L	CTC-435M10.3_ENST00000604424.1_Intron|CTC-435M10.10_ENST00000598988.1_RNA|BCKDHA_ENST00000595085.1_Intron|CTC-435M10.3_ENST00000540732.1_Intron|BCKDHA_ENST00000457836.2_5'Flank|EXOSC5_ENST00000596905.1_Missense_Mutation_p.P24L|BCKDHA_ENST00000269980.2_5'Flank	NM_020158.3	NP_064543.3	Q9NQT4	EXOS5_HUMAN	exosome component 5	24					defense response to virus (GO:0051607)|DNA deamination (GO:0045006)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|nucleolus (GO:0005730)|transcriptionally active chromatin (GO:0035327)	3'-5'-exoribonuclease activity (GO:0000175)|RNA binding (GO:0003723)	p.P24L(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|urinary_tract(1)	7						GCTGCAGCCAGGACCCCGAGG	0.602																																					p.P24L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C71T	19						.						128.0	118.0	122.0					19																	41903163		2203	4300	6503	46595003	SO:0001583	missense	56915	exon1			AF285785	CCDS12580.1	19q13.1	2008-02-05				ENSG00000077348			24662	protein-coding gene	gene with protein product	"""exosome component Rrp46"""	606492				11110791, 11812149	Standard	NM_020158		Approved	hRrp46p, Rrp46p, RRP46, RRP41B, MGC12901, p12B	uc002oqo.3	Q9NQT4		ENST00000221233.4:c.71C>T	19.37:g.41903163G>A	ENSP00000221233:p.Pro24Leu	Somatic		Capture	Illumina HiSeq	Phase_I	46595003	NM_020158	Q32Q81|Q8NG16|Q96I89	Missense_Mutation	SNP	ENST00000221233.4	37	CCDS12580.1	.	.	.	.	.	.	.	.	.	.	G	14.25	2.480866	0.44044	.	.	ENSG00000077348	ENST00000221233	T	0.33865	1.39	5.37	3.22	0.36961	.	0.581199	0.16418	N	0.215277	T	0.20333	0.0489	N	0.16743	0.435	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.16453	-1.0402	10	0.72032	D	0.01	-14.3286	4.6492	0.12587	0.1747:0.0:0.6495:0.1757	.	24	Q9NQT4	EXOS5_HUMAN	L	24	ENSP00000221233:P24L	ENSP00000221233:P24L	P	-	2	0	EXOSC5	46595003	0.092000	0.21681	0.002000	0.10522	0.137000	0.21094	2.879000	0.48522	0.804000	0.34136	0.590000	0.80494	CCT		EXOSC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463492.1	NM_020158	
GRWD1	83743	broad.mit.edu	37	19	48956173	48956173	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr19:48956173A>G	ENST00000253237.5	+	7	1465	c.1232A>G	c.(1231-1233)cAc>cGc	p.H411R	KCNJ14_ENST00000342291.2_5'Flank	NM_031485.3	NP_113673.3	Q9BQ67	GRWD1_HUMAN	glutamate-rich WD repeat containing 1	411						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.H411R(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|stomach(1)	19		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000206)|all cancers(93;0.000207)|Epithelial(262;0.0125)|GBM - Glioblastoma multiforme(486;0.0222)		CTGTTCGTGCACCAGGGCGAG	0.687																																					p.H411R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1232G	19						.						42.0	43.0	43.0					19																	48956173		2201	4297	6498	53647985	SO:0001583	missense	83743	exon7			AF337808	CCDS12720.1	19q13.33	2013-05-21				ENSG00000105447		"""WD repeat domain containing"""	21270	protein-coding gene	gene with protein product	regulator of ribosome biogenesis 1 homolog (S. cerevisiae)	610597				15885502	Standard	NM_031485		Approved	WDR28, GRWD, RRB1	uc002pjd.2	Q9BQ67		ENST00000253237.5:c.1232A>G	19.37:g.48956173A>G	ENSP00000253237:p.His411Arg	Somatic		Capture	Illumina HiSeq	Phase_I	53647985	NM_031485	Q8TF59	Missense_Mutation	SNP	ENST00000253237.5	37	CCDS12720.1	.	.	.	.	.	.	.	.	.	.	A	26.4	4.737991	0.89573	.	.	ENSG00000105447	ENST00000253237	T	0.01295	5.04	5.2	5.2	0.72013	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.109676	0.64402	D	0.000011	T	0.12732	0.0309	M	0.94021	3.485	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00773	-1.1572	10	0.87932	D	0	-24.1348	14.3542	0.66724	1.0:0.0:0.0:0.0	.	411	Q9BQ67	GRWD1_HUMAN	R	411	ENSP00000253237:H411R	ENSP00000253237:H411R	H	+	2	0	GRWD1	53647985	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	8.228000	0.89789	2.100000	0.63781	0.459000	0.35465	CAC		GRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466122.1	NM_031485	
ALDH16A1	126133	broad.mit.edu	37	19	49969143	49969143	+	Missense_Mutation	SNP	G	G	A	rs140469932		TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr19:49969143G>A	ENST00000293350.4	+	13	1880	c.1717G>A	c.(1717-1719)Gct>Act	p.A573T	CTD-3148I10.9_ENST00000599536.1_Intron|ALDH16A1_ENST00000455361.2_Missense_Mutation_p.A522T|ALDH16A1_ENST00000540132.1_Missense_Mutation_p.A410T|ALDH16A1_ENST00000433981.2_Missense_Mutation_p.A408T	NM_153329.3	NP_699160.2	Q8IZ83	A16A1_HUMAN	aldehyde dehydrogenase 16 family, member A1	573						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)	p.A573T(1)		cervix(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|skin(2)|urinary_tract(3)	20		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0251)		TGTGGAGGCCGCTCACCAGGC	0.642																																					p.A573T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1717A	19						.	G	THR/ALA,THR/ALA	0,4406		0,0,2203	34.0	34.0	34.0		1564,1717	4.8	0.9	19	dbSNP_134	34	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ALDH16A1	NM_001145396.1,NM_153329.3	58,58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	522/752,573/803	49969143	1,13005	2203	4300	6503	54660955	SO:0001583	missense	126133	exon13			AY007096	CCDS12766.1, CCDS46141.1	19q13.33	2014-08-12			ENSG00000161618	ENSG00000161618		"""Aldehyde dehydrogenases"""	28114	protein-coding gene	gene with protein product		613358					Standard	NM_153329		Approved	MGC10204	uc002pnt.3	Q8IZ83	OTTHUMG00000183163	ENST00000293350.4:c.1717G>A	19.37:g.49969143G>A	ENSP00000293350:p.Ala573Thr	Somatic		Capture	Illumina HiSeq	Phase_I	54660955	NM_153329	B4DLQ1|C9JBH6|Q86YF0|Q8IYL4|Q8TEI8	Missense_Mutation	SNP	ENST00000293350.4	37	CCDS12766.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.496330	0.85069	0.0	1.16E-4	ENSG00000161618	ENST00000293350;ENST00000455361;ENST00000540132;ENST00000433981	D;D;D;D	0.90324	-2.65;-2.65;-2.65;-2.65	4.77	4.77	0.60923	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.420227	0.23513	N	0.047363	D	0.96821	0.8962	H	0.96142	3.775	0.45883	D	0.998734	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.98100	1.0414	10	0.87932	D	0	-14.0174	15.3078	0.74008	0.0:0.0:1.0:0.0	.	410;522;573	F5H4B6;B4DLQ1;Q8IZ83	.;.;A16A1_HUMAN	T	573;522;410;408	ENSP00000293350:A573T;ENSP00000410142:A522T;ENSP00000445088:A410T;ENSP00000398675:A408T	ENSP00000293350:A573T	A	+	1	0	ALDH16A1	54660955	0.964000	0.33143	0.860000	0.33809	0.986000	0.74619	4.359000	0.59449	2.206000	0.71126	0.561000	0.74099	GCT		ALDH16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465358.1	NM_153329	
MUC16	94025	broad.mit.edu	37	19	8966766	8966766	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr19:8966766G>A	ENST00000397910.4	-	81	43390	c.43187C>T	c.(43186-43188)tCg>tTg	p.S14396L	MUC16_ENST00000380951.5_Missense_Mutation_p.S1037L	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	14494				Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.S14396L(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGCCAGTGGCGAGAAGTTACA	0.532																																					p.S14396L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C43187T	19						.						26.0	30.0	29.0					19																	8966766		1956	4135	6091	8827766	SO:0001583	missense	94025	exon81			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.43187C>T	19.37:g.8966766G>A	ENSP00000381008:p.Ser14396Leu	Somatic		Capture	Illumina HiSeq	Phase_I	8827766	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	10.78|10.78	1.447962|1.447962	0.26074|0.26074	.|.	.|.	ENSG00000181143|ENSG00000181143	ENST00000542240|ENST00000397910;ENST00000380951	.|T;T	.|0.39056	.|1.1;1.1	4.22|4.22	3.18|3.18	0.36537|0.36537	.|SEA (2);	1.029670|.	0.07728|.	N|.	0.944810|.	T|T	0.63988|0.63988	0.2558|0.2558	M|M	0.87328|0.87328	2.875|2.875	.|.	.|.	.|.	.|D;D	.|0.89917	.|0.99;1.0	.|P;D	.|0.71656	.|0.666;0.974	T|T	0.74031|0.74031	-0.3795|-0.3795	5|7	.|.	.|.	.|.	.|.	8.1423|8.1423	0.31091|0.31091	0.1104:0.0:0.8896:0.0|0.1104:0.0:0.8896:0.0	.|.	.|22041;14396	.|Q8WXI7;B5ME49	.|MUC16_HUMAN;.	C|L	1219|14396;1037	.|ENSP00000381008:S14396L;ENSP00000370338:S1037L	.|.	R|S	-|-	1|2	0|0	MUC16|MUC16	8827766|8827766	0.000000|0.000000	0.05858|0.05858	0.146000|0.146000	0.22360|0.22360	0.014000|0.014000	0.08584|0.08584	0.575000|0.575000	0.23729|0.23729	1.138000|1.138000	0.42230|0.42230	-0.144000|-0.144000	0.13903|0.13903	CGC|TCG		MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ZNF583	147949	broad.mit.edu	37	19	56934607	56934607	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr19:56934607C>T	ENST00000333201.9	+	5	790	c.580C>T	c.(580-582)Cga>Tga	p.R194*	ZNF583_ENST00000585612.1_3'UTR|ZNF583_ENST00000291598.7_Nonsense_Mutation_p.R194*	NM_001159861.1|NM_152478.2	NP_001153333.1|NP_689691.2	Q96ND8	ZN583_HUMAN	zinc finger protein 583	194					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R194*(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(2)|prostate(1)|skin(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0564)		GAAAAGTTACCGAAAAAAATC	0.343																																					p.R194X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C580T	19						.						51.0	56.0	54.0					19																	56934607		2201	4295	6496	61626419	SO:0001587	stop_gained	147949	exon5			AK055592	CCDS12943.1	19q13.43	2013-09-20			ENSG00000198440	ENSG00000198440		"""Zinc fingers, C2H2-type"", ""-"""	26427	protein-coding gene	gene with protein product							Standard	NM_152478		Approved	FLJ31030	uc010ygl.1	Q96ND8	OTTHUMG00000168874	ENST00000333201.9:c.580C>T	19.37:g.56934607C>T	ENSP00000388502:p.Arg194*	Somatic		Capture	Illumina HiSeq	Phase_I	61626419	NM_001159860	O14850|Q2NKK3	Nonsense_Mutation	SNP	ENST00000333201.9	37	CCDS12943.1	.	.	.	.	.	.	.	.	.	.	C	18.36	3.607744	0.66558	.	.	ENSG00000198440	ENST00000291598;ENST00000333201	.	.	.	4.43	-4.33	0.03677	.	0.612590	0.13477	N	0.384990	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.2206	0.10556	0.4547:0.2235:0.0:0.3217	.	.	.	.	X	194	.	.	R	+	1	2	ZNF583	61626419	0.000000	0.05858	0.000000	0.03702	0.250000	0.25880	-0.568000	0.05909	-0.299000	0.08909	0.462000	0.41574	CGA		ZNF583-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401453.1	NM_152478	
TNFRSF4	7293	broad.mit.edu	37	1	1147407	1147408	+	Frame_Shift_Ins	INS	-	-	G	rs191704944		TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr1:1147407_1147408insG	ENST00000379236.3	-	5	552_553	c.548_549insC	c.(547-549)ccgfs	p.P183fs	TNFRSF4_ENST00000453580.1_5'UTR	NM_003327.3	NP_003318.1	P43489	TNR4_HUMAN	tumor necrosis factor receptor superfamily, member 4	183					cellular defense response (GO:0006968)|immune response (GO:0006955)|inflammatory response (GO:0006954)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of immunoglobulin secretion (GO:0051024)|regulation of apoptotic process (GO:0042981)|regulation of protein kinase activity (GO:0045859)|T cell proliferation (GO:0042098)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	tumor necrosis factor-activated receptor activity (GO:0005031)	p.A184fs*10(1)		large_intestine(1)|lung(2)|urinary_tract(1)	4	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.73e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.01e-21)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		TGGGCCTGGCCGGGGGGCCCTG	0.713																																					p.P183fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.549_550insC	1						.																																			1137271	SO:0001589	frameshift_variant	7293	exon5			X75962	CCDS11.1	1p36	2008-02-05			ENSG00000186827	ENSG00000186827		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11918	protein-coding gene	gene with protein product		600315		TXGP1L		7510240, 2828930	Standard	NM_003327		Approved	ACT35, OX40, CD134	uc001ade.3	P43489	OTTHUMG00000001415	ENST00000379236.3:c.549dupC	1.37:g.1147413_1147413dupG	ENSP00000368538:p.Pro183fs	Somatic		Capture	Illumina HiSeq	Phase_I	1137270	NM_003327	Q13663|Q2M312|Q5T7M0	Frame_Shift_Ins	INS	ENST00000379236.3	37	CCDS11.1																																																																																				TNFRSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004086.1		
BAI2	576	broad.mit.edu	37	1	32208507	32208508	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr1:32208507_32208508insG	ENST00000373658.3	-	7	1524_1525	c.1183_1184insC	c.(1183-1185)cagfs	p.Q395fs	BAI2_ENST00000398542.1_Intron|BAI2_ENST00000398556.3_Frame_Shift_Ins_p.Q343fs|BAI2_ENST00000440175.2_Frame_Shift_Ins_p.Q37fs|BAI2_ENST00000398538.1_Frame_Shift_Ins_p.Q383fs|BAI2_ENST00000257070.4_Frame_Shift_Ins_p.Q395fs|BAI2_ENST00000398547.1_Frame_Shift_Ins_p.Q328fs|BAI2_ENST00000373655.2_Frame_Shift_Ins_p.Q395fs|BAI2_ENST00000527361.1_Frame_Shift_Ins_p.Q395fs	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	395	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.Q395fs*11(1)		breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		GCCGCCGTGCTGGGGGGGCACG	0.713																																					p.Q395fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1184_1185insC	1						.																																			31981095	SO:0001589	frameshift_variant	576	exon7			AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.1184dupC	1.37:g.32208514_32208514dupG	ENSP00000362762:p.Gln395fs	Somatic		Capture	Illumina HiSeq	Phase_I	31981094	NM_001703	B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Frame_Shift_Ins	INS	ENST00000373658.3	37	CCDS346.2																																																																																				BAI2-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000381838.1	NM_001703	
MASP2	10747	broad.mit.edu	37	1	11103408	11103408	+	Silent	SNP	G	G	A	rs7536030	byFrequency	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr1:11103408G>A	ENST00000400897.3	-	5	744	c.729C>T	c.(727-729)taC>taT	p.Y243Y		NM_006610.3	NP_006601.2	O00187	MASP2_HUMAN	mannan-binding lectin serine peptidase 2	243	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|complement component C4b binding (GO:0001855)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)	p.Y243Y(1)		biliary_tract(1)|endometrium(2)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.071)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.12e-07)|COAD - Colon adenocarcinoma(227;7.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)|STAD - Stomach adenocarcinoma(313;0.192)		TGAGAAAGTCGTAGGGACACA	0.587													G|||	367	0.0732827	0.2648	0.0187	5008	,	,		19805	0.0		0.0	False		,,,				2504	0.0041				p.Y243Y	GBM(35;611 746 20780 22741 36496)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C729T	1						.	G		1054,3346	365.4+/-317.4	125,804,1271	56.0	43.0	47.0		729	-1.1	1.0	1	dbSNP_116	47	21,8579	11.9+/-42.8	1,19,4280	no	coding-synonymous	MASP2	NM_006610.3		126,823,5551	AA,AG,GG		0.2442,23.9545,8.2692		243/687	11103408	1075,11925	2200	4300	6500	11025995	SO:0001819	synonymous_variant	10747	exon5			X98400	CCDS123.1, CCDS124.1	1p36.3-p36.2	2014-09-17	2005-08-17		ENSG00000009724	ENSG00000009724			6902	protein-coding gene	gene with protein product		605102	"""mannan-binding lectin serine protease 2"", ""mannan-binding lectin serine peptidase 1 pseudogene 1"", ""mannan-binding lectin serine protease 1 pseudogene 1"""	MASP1P1		9087411, 9777418	Standard	NM_006610		Approved		uc001aru.3	O00187	OTTHUMG00000002121	ENST00000400897.3:c.729C>T	1.37:g.11103408G>A		Somatic		Capture	Illumina HiSeq	Phase_I	11025995	NM_006610	A8K458|A8MWJ2|O75754|Q5TEQ5|Q5TER0|Q96QG4|Q9BZH0|Q9H498|Q9H499|Q9UBP3|Q9UC48|Q9ULC7|Q9UMV3|Q9Y270	Silent	SNP	ENST00000400897.3	37	CCDS123.1																																																																																				MASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006072.1	NM_006610	
LCE2C	353140	broad.mit.edu	37	1	152648744	152648744	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr1:152648744C>T	ENST00000368783.1	+	2	308	c.253C>T	c.(253-255)Cgg>Tgg	p.R85W	LCE2B_ENST00000417924.2_Intron	NM_178429.2	NP_848516.1	Q5TA81	LCE2C_HUMAN	late cornified envelope 2C	85	Cys-rich.				keratinization (GO:0031424)			p.R85W(2)|p.R85R(1)		endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)	13	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCACCGGCGCCGGCACCAGAG	0.682																																					p.R85W												.	.	3	Substitution - Missense(2)|Substitution - coding silent(1)	lung(1)|large_intestine(1)|prostate(1)	c.C253T	1						.						34.0	43.0	40.0					1																	152648744		2201	4297	6498	150915368	SO:0001583	missense	353140	exon2				CCDS1019.1	1q21.3	2008-02-05			ENSG00000187180	ENSG00000187180		"""Late cornified envelopes"""	29460	protein-coding gene	gene with protein product		612611				11698679	Standard	NM_178429		Approved	LEP11	uc001fah.4	Q5TA81	OTTHUMG00000012389	ENST00000368783.1:c.253C>T	1.37:g.152648744C>T	ENSP00000357772:p.Arg85Trp	Somatic		Capture	Illumina HiSeq	Phase_I	150915368	NM_178429		Missense_Mutation	SNP	ENST00000368783.1	37	CCDS1019.1	.	.	.	.	.	.	.	.	.	.	C	10.90	1.480372	0.26598	.	.	ENSG00000187180	ENST00000368783	T	0.04654	3.58	3.15	-6.29	0.02013	.	.	.	.	.	T	0.06462	0.0166	M	0.65498	2.005	0.09310	N	1	D	0.71674	0.998	P	0.61874	0.895	T	0.00345	-1.1801	9	0.62326	D	0.03	.	14.6747	0.68969	0.8474:0.1526:0.0:0.0	.	85	Q5TA81	LCE2C_HUMAN	W	85	ENSP00000357772:R85W	ENSP00000357772:R85W	R	+	1	2	LCE2C	150915368	0.000000	0.05858	0.000000	0.03702	0.789000	0.44602	-1.343000	0.02642	-1.753000	0.01323	-0.311000	0.09066	CGG		LCE2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034509.1	NM_178429	
SPRR2F	6705	broad.mit.edu	37	1	153085010	153085010	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr1:153085010C>A	ENST00000468739.1	-	2	260	c.200G>T	c.(199-201)tGt>tTt	p.C67F	SPRR2B_ENST00000368752.4_Intron	NM_001014450.1	NP_001014450.1	Q96RM1	SPR2F_HUMAN	small proline-rich protein 2F	67					epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)		p.C67F(1)		large_intestine(1)|lung(1)|prostate(1)|urinary_tract(1)	4	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTTGGGTGGACACTTTGGCTG	0.542																																					p.C67F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G200T	1						.						252.0	237.0	242.0					1																	153085010		2203	4298	6501	151351634	SO:0001583	missense	6705	exon2			AF333956	CCDS30867.1	1q21-q22	2008-02-05			ENSG00000244094	ENSG00000244094			11266	protein-coding gene	gene with protein product						8325635, 11279051	Standard	NM_001014450		Approved		uc001fbi.3	Q96RM1	OTTHUMG00000014398	ENST00000468739.1:c.200G>T	1.37:g.153085010C>A	ENSP00000418193:p.Cys67Phe	Somatic		Capture	Illumina HiSeq	Phase_I	151351634	NM_001014450	Q5T9T3	Missense_Mutation	SNP	ENST00000468739.1	37	CCDS30867.1	.	.	.	.	.	.	.	.	.	.	C	5.920	0.353776	0.11182	.	.	ENSG00000244094	ENST00000468739	T	0.33438	1.41	4.0	3.09	0.35607	.	0.203948	0.24779	N	0.035663	T	0.10895	0.0266	.	.	.	0.27899	N	0.939047	B	0.25743	0.133	B	0.27170	0.077	T	0.15292	-1.0442	9	0.87932	D	0	.	7.7382	0.28827	0.0:0.8828:0.0:0.1172	.	67	Q96RM1	SPR2F_HUMAN	F	67	ENSP00000418193:C67F	ENSP00000418193:C67F	C	-	2	0	SPRR2F	151351634	0.375000	0.25089	1.000000	0.80357	0.691000	0.40173	0.762000	0.26503	0.915000	0.36847	-0.699000	0.03677	TGT		SPRR2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040056.1		
TNR	7143	broad.mit.edu	37	1	175331865	175331865	+	Missense_Mutation	SNP	C	C	T	rs531733667		TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr1:175331865C>T	ENST00000367674.2	-	14	3496	c.2788G>A	c.(2788-2790)Gaa>Aaa	p.E930K	TNR_ENST00000263525.2_Missense_Mutation_p.E930K			Q92752	TENR_HUMAN	tenascin R	930	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)		p.E930K(2)		NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					AGGCTGATTTCGTATTCGGTA	0.532																																					p.E930K												.	.	2	Substitution - Missense(2)	large_intestine(1)|breast(1)	c.G2788A	1						.						215.0	181.0	193.0					1																	175331865		2203	4300	6503	173598488	SO:0001583	missense	7143	exon14			X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.2788G>A	1.37:g.175331865C>T	ENSP00000356646:p.Glu930Lys	Somatic		Capture	Illumina HiSeq	Phase_I	173598488	NM_003285	C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	37	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	C	11.70	1.717377	0.30413	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.58210	0.35;0.35	5.59	5.59	0.84812	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.42017	0.1184	L	0.31420	0.93	0.80722	D	1	P	0.44578	0.838	B	0.40534	0.332	T	0.21042	-1.0257	10	0.15066	T	0.55	.	17.3759	0.87391	0.0:1.0:0.0:0.0	.	930	Q92752	TENR_HUMAN	K	930;930;840	ENSP00000356646:E930K;ENSP00000263525:E930K	ENSP00000263525:E930K	E	-	1	0	TNR	173598488	1.000000	0.71417	0.987000	0.45799	0.744000	0.42396	6.819000	0.75262	2.625000	0.88918	0.650000	0.86243	GAA		TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285	
RGL1	23179	broad.mit.edu	37	1	183873985	183873985	+	Splice_Site	SNP	A	A	G			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr1:183873985A>G	ENST00000360851.3	+	13	1530	c.1352A>G	c.(1351-1353)gAa>gGa	p.E451G	RGL1_ENST00000539189.1_Splice_Site_p.E422G|RGL1_ENST00000536277.1_Splice_Site_p.E449G|RGL1_ENST00000304685.4_Splice_Site_p.E486G			Q9NZL6	RGL1_HUMAN	ral guanine nucleotide dissociation stimulator-like 1	451	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				cellular lipid metabolic process (GO:0044255)|positive regulation of Ral GTPase activity (GO:0032852)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	Ral guanyl-nucleotide exchange factor activity (GO:0008321)	p.E486G(1)		breast(5)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(17)|ovary(4)|prostate(3)|stomach(1)	51						CTGCTTTAGGAATTTGAAGTG	0.378																																					p.E486G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1457G	1						.						103.0	107.0	106.0					1																	183873985		2203	4300	6503	182140608	SO:0001630	splice_region_variant	23179	exon14			AF186780	CCDS1359.1, CCDS72992.1	1q25.2	2008-02-05			ENSG00000143344	ENSG00000143344			30281	protein-coding gene	gene with protein product		605667				10760592, 10231032	Standard	XM_005245010		Approved	RGL	uc001gqm.3	Q9NZL6	OTTHUMG00000035328	ENST00000360851.3:c.1351-1A>G	1.37:g.183873985A>G		Somatic		Capture	Illumina HiSeq	Phase_I	182140608	NM_015149	Q5SXQ2|Q5SXQ6|Q9HBY3|Q9HBY4|Q9NZL5|Q9UG43|Q9Y2G6	Missense_Mutation	SNP	ENST00000360851.3	37		.	.	.	.	.	.	.	.	.	.	A	29.5	5.009466	0.93346	.	.	ENSG00000143344	ENST00000304685;ENST00000367531;ENST00000536277;ENST00000543395;ENST00000360851;ENST00000539189	T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52	5.38	5.38	0.77491	Guanine-nucleotide dissociation stimulator CDC25 (3);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.65112	0.2660	M	0.92367	3.3	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.998;0.999;0.998;0.998	D;D;D;D;D	0.83275	0.996;0.991;0.991;0.991;0.991	T	0.75062	-0.3450	10	0.87932	D	0	.	15.0613	0.71955	1.0:0.0:0.0:0.0	.	422;449;256;451;486	F5H6U6;B7Z2W5;F5H3C3;Q9NZL6;Q5SXQ6	.;.;.;RGL1_HUMAN;.	G	486;486;449;256;451;422	ENSP00000303192:E486G;ENSP00000356501:E486G;ENSP00000438662:E449G;ENSP00000354097:E451G;ENSP00000437355:E422G	ENSP00000303192:E486G	E	+	2	0	RGL1	182140608	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.907000	0.92634	2.036000	0.60181	0.528000	0.53228	GAA		RGL1-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000085742.1	NM_015149	Missense_Mutation
RUNX3	864	broad.mit.edu	37	1	25291054	25291054	+	Silent	SNP	C	C	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr1:25291054C>T	ENST00000338888.3	-	2	254	c.9G>A	c.(7-9)tcG>tcA	p.S3S	RUNX3_ENST00000399916.1_Silent_p.S3S|RP11-84D1.1_ENST00000456316.1_RNA			Q13761	RUNX3_HUMAN	runt-related transcription factor 3	0					axon guidance (GO:0007411)|cell maturation (GO:0048469)|chondrocyte differentiation (GO:0002062)|hair follicle morphogenesis (GO:0031069)|interferon-gamma production (GO:0032609)|negative regulation of cell cycle (GO:0045786)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peripheral nervous system neuron development (GO:0048935)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S3S(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(3)	18		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00131)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;2.85e-26)|Colorectal(126;4.35e-08)|COAD - Colon adenocarcinoma(152;1.92e-06)|GBM - Glioblastoma multiforme(114;0.000102)|STAD - Stomach adenocarcinoma(196;0.000766)|KIRC - Kidney renal clear cell carcinoma(1967;0.00148)|BRCA - Breast invasive adenocarcinoma(304;0.00173)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.136)		AGATGCTGTTCGATGCCATGC	0.562																																					p.S3S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G9A	1						.						65.0	51.0	56.0					1																	25291054		2203	4299	6502	25163641	SO:0001819	synonymous_variant	864	exon1			BC013362	CCDS257.1, CCDS30633.1	1p36	2008-02-05			ENSG00000020633	ENSG00000020633			10473	protein-coding gene	gene with protein product		600210		CBFA3		7835892	Standard	NM_001031680		Approved	AML2, PEBP2A3	uc001bjq.3	Q13761	OTTHUMG00000003316	ENST00000338888.3:c.9G>A	1.37:g.25291054C>T		Somatic		Capture	Illumina HiSeq	Phase_I	25163641	NM_001031680	B1AJV5|Q12969|Q13760	Silent	SNP	ENST00000338888.3	37	CCDS30633.1																																																																																				RUNX3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000009285.1	NM_004350	
PTPRU	10076	broad.mit.edu	37	1	29650006	29650006	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr1:29650006C>T	ENST00000345512.3	+	28	4111	c.3982C>T	c.(3982-3984)Cgg>Tgg	p.R1328W	PTPRU_ENST00000356870.3_Missense_Mutation_p.R1324W|PTPRU_ENST00000428026.2_Missense_Mutation_p.R1315W|PTPRU_ENST00000460170.2_Missense_Mutation_p.R1324W|PTPRU_ENST00000323874.8_Missense_Mutation_p.R1324W|PTPRU_ENST00000373779.3_Missense_Mutation_p.R1318W	NM_005704.4	NP_005695.3	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	1328	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|homotypic cell-cell adhesion (GO:0034109)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|organ regeneration (GO:0031100)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|response to glucocorticoid (GO:0051384)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.R1328W(1)		breast(4)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(26)|ovary(1)|prostate(3)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	79		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		GAACATCTCTCGGGTGAGTGG	0.607																																					p.R1328W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3982T	1						.						33.0	33.0	33.0					1																	29650006		2203	4300	6503	29522593	SO:0001583	missense	10076	exon28			U71075	CCDS334.1, CCDS335.1, CCDS44098.1, CCDS44098.2, CCDS53290.1	1p35.3	2013-02-11			ENSG00000060656	ENSG00000060656		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9683	protein-coding gene	gene with protein product	"""pi R-PTP-Psi"""	602454				8700514, 9434160	Standard	NM_133178		Approved	PTPRO, hPTP-J, PCP-2, FMI, PTP	uc001bru.3	Q92729	OTTHUMG00000003699	ENST00000345512.3:c.3982C>T	1.37:g.29650006C>T	ENSP00000334941:p.Arg1328Trp	Somatic		Capture	Illumina HiSeq	Phase_I	29522593	NM_005704	A6H8L1|O00197|P78399|Q59HA4|Q5SYU4|Q5SYU5|Q92735|Q92850	Missense_Mutation	SNP	ENST00000345512.3	37	CCDS334.1	.	.	.	.	.	.	.	.	.	.	C	19.28	3.796471	0.70567	.	.	ENSG00000060656	ENST00000345512;ENST00000373779;ENST00000356870;ENST00000323874;ENST00000428026;ENST00000460170	T;T;T;T;T;T	0.14144	2.53;2.53;2.53;2.53;2.53;2.53	3.58	3.58	0.41010	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.64402	U	0.000002	T	0.37839	0.1018	M	0.84846	2.72	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.27191	-1.0081	9	.	.	.	.	10.1961	0.43056	0.1988:0.8012:0.0:0.0	.	1315;1324;1318;1324;1328	Q92729-3;Q92729-4;Q92729-2;E9PH42;Q92729	.;.;.;.;PTPRU_HUMAN	W	1328;1318;1324;1324;1315;1324	ENSP00000334941:R1328W;ENSP00000362884:R1318W;ENSP00000349333:R1324W;ENSP00000314987:R1324W;ENSP00000392332:R1315W;ENSP00000432906:R1324W	.	R	+	1	2	PTPRU	29522593	0.322000	0.24634	1.000000	0.80357	0.994000	0.84299	0.827000	0.27421	1.998000	0.58463	0.462000	0.41574	CGG		PTPRU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010447.1		
COL24A1	255631	broad.mit.edu	37	1	86196269	86196269	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr1:86196269C>T	ENST00000370571.2	-	60	5471	c.5105G>A	c.(5104-5106)cGa>cAa	p.R1702Q	COL24A1_ENST00000436319.1_Missense_Mutation_p.R1681Q	NM_152890.5	NP_690850.2	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1	1702	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				extracellular matrix organization (GO:0030198)|hematopoietic progenitor cell differentiation (GO:0002244)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)	p.R1702Q(1)		NS(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(9)|liver(1)|lung(56)|ovary(4)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	101				all cancers(265;0.0627)|Epithelial(280;0.0689)		GTAATACTTTCGTTCAGTTTT	0.413																																					p.R1702Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5105A	1						.						133.0	125.0	128.0					1																	86196269		1863	4103	5966	85968857	SO:0001583	missense	255631	exon60			AF410793	CCDS41353.1	1p22.3-p22.2	2013-01-16			ENSG00000171502	ENSG00000171502		"""Collagens"""	20821	protein-coding gene	gene with protein product		610025					Standard	NM_152890		Approved		uc001dlj.3	Q17RW2	OTTHUMG00000010629	ENST00000370571.2:c.5105G>A	1.37:g.86196269C>T	ENSP00000359603:p.Arg1702Gln	Somatic		Capture	Illumina HiSeq	Phase_I	85968857	NM_152890	C9J1X6|Q14BD7|Q59EX5|Q5VY50|Q7Z5L5	Missense_Mutation	SNP	ENST00000370571.2	37	CCDS41353.1	.	.	.	.	.	.	.	.	.	.	C	6.560	0.471700	0.12461	.	.	ENSG00000171502	ENST00000370571;ENST00000436319	T;T	0.66995	-0.24;-0.24	5.39	-5.3	0.02738	Fibrillar collagen, C-terminal (4);	0.000000	0.38436	N	0.001682	T	0.06050	0.0157	N	0.00086	-2.195	0.09310	N	0.999995	B;B	0.12013	0.005;0.002	B;B	0.12156	0.007;0.004	T	0.35748	-0.9776	10	0.02654	T	1	.	16.9259	0.86176	0.0:0.09:0.0:0.91	.	1702;1681	Q17RW2;Q17RW2-2	COOA1_HUMAN;.	Q	1702;1681	ENSP00000359603:R1702Q;ENSP00000392531:R1681Q	ENSP00000359603:R1702Q	R	-	2	0	COL24A1	85968857	0.000000	0.05858	0.037000	0.18230	0.635000	0.38103	-0.425000	0.07017	-1.237000	0.02539	-0.312000	0.09012	CGA		COL24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029335.4	NM_152890	
CCBL2	56267	broad.mit.edu	37	1	89408756	89408756	+	Missense_Mutation	SNP	C	C	T	rs145574653	byFrequency	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr1:89408756C>T	ENST00000260508.4	-	13	1571	c.1234G>A	c.(1234-1236)Gtt>Att	p.V412I	CCBL2_ENST00000370491.3_Missense_Mutation_p.V378I|CCBL2_ENST00000446900.2_5'UTR|CCBL2_ENST00000370485.2_3'UTR	NM_001008661.2	NP_001008661.1	Q6YP21	KAT3_HUMAN	cysteine conjugate-beta lyase 2	412					2-oxoglutarate metabolic process (GO:0006103)|biosynthetic process (GO:0009058)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|kynurenine metabolic process (GO:0070189)|L-kynurenine metabolic process (GO:0097052)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)	mitochondrion (GO:0005739)	cysteine-S-conjugate beta-lyase activity (GO:0047804)|kynurenine-glyoxylate transaminase activity (GO:0047315)|kynurenine-oxoglutarate transaminase activity (GO:0016212)|poly(A) RNA binding (GO:0044822)|pyridoxal phosphate binding (GO:0030170)	p.V378I(1)|p.V412I(1)		endometrium(3)|kidney(4)|large_intestine(2)|lung(4)|ovary(2)|skin(2)|soft_tissue(1)	18		Lung NSC(277;0.123)		all cancers(265;0.0117)|Epithelial(280;0.0341)		AATGCTGAAACGGGGATGGCT	0.318													C|||	4	0.000798722	0.0	0.0	5008	,	,		15212	0.002		0.001	False		,,,				2504	0.001				p.V378I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1132A	1						.	C	ILE/VAL,ILE/VAL	0,4406		0,0,2203	114.0	125.0	122.0		1234,1132	5.1	1.0	1	dbSNP_134	122	4,8596	3.7+/-12.6	0,4,4296	yes	missense,missense	CCBL2	NM_001008661.2,NM_001008662.2	29,29	0,4,6499	TT,TC,CC		0.0465,0.0,0.0308	benign,benign	412/455,378/421	89408756	4,13002	2203	4300	6503	89181344	SO:0001583	missense	56267	exon12			AF091090	CCDS30766.1, CCDS30767.1	1p22.2	2009-06-23			ENSG00000137944	ENSG00000137944			33238	protein-coding gene	gene with protein product		610656				16376499	Standard	NM_001008662		Approved	RBM1, RP11-82K18.3, KAT3	uc001dmp.2	Q6YP21	OTTHUMG00000010617	ENST00000260508.4:c.1234G>A	1.37:g.89408756C>T	ENSP00000260508:p.Val412Ile	Somatic		Capture	Illumina HiSeq	Phase_I	89181344	NM_001008662	B3KQ13|O95335|Q5JS27|Q5T9T7|Q5T9T8|Q6AI27|Q6ICW1|Q9BVY5	Missense_Mutation	SNP	ENST00000260508.4	37	CCDS30766.1	.	.	.	.	.	.	.	.	.	.	C	10.93	1.490132	0.26686	0.0	4.65E-4	ENSG00000137944	ENST00000370491;ENST00000260508	T;T	0.41758	0.99;0.99	5.05	5.05	0.67936	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.265483	0.37261	N	0.002168	T	0.21062	0.0507	L	0.57536	1.79	0.80722	D	1	B	0.23854	0.092	B	0.21917	0.037	T	0.07539	-1.0767	10	0.23891	T	0.37	-26.4365	8.2932	0.31969	0.0:0.7037:0.2094:0.0869	.	412	Q6YP21	KAT3_HUMAN	I	378;412	ENSP00000359522:V378I;ENSP00000260508:V412I	ENSP00000260508:V412I	V	-	1	0	CCBL2	89181344	0.991000	0.36638	1.000000	0.80357	0.993000	0.82548	1.728000	0.38105	2.510000	0.84645	0.557000	0.71058	GTT		CCBL2-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000029300.3	NM_001008661	
ACTN2	88	broad.mit.edu	37	1	236891031	236891031	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr1:236891031T>G	ENST00000366578.4	+	6	756	c.590T>G	c.(589-591)cTc>cGc	p.L197R	ACTN2_ENST00000492634.1_3'UTR|ACTN2_ENST00000542672.1_Missense_Mutation_p.L197R	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	197	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)			endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			CGGCCTGACCTCATTGACTAC	0.537																																					p.L197R												.	.	0			c.T590G	1						.						155.0	128.0	137.0					1																	236891031		2203	4300	6503	234957654	SO:0001583	missense	88	exon6			BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.590T>G	1.37:g.236891031T>G	ENSP00000355537:p.Leu197Arg	None		Capture	Illumina HiSeq	Phase_I	234957654	NM_001103	B1ANE4|B2RCS5|Q86TF4|Q86TI8	Missense_Mutation	SNP	ENST00000366578.4	37	CCDS1613.1	.	.	.	.	.	.	.	.	.	.	T	26.3	4.726771	0.89390	.	.	ENSG00000077522	ENST00000542672;ENST00000366578	T;T	0.63580	-0.05;-0.05	5.27	5.27	0.74061	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	D	0.85915	0.5808	H	0.96970	3.915	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.85130	0.995;0.997	D	0.90789	0.4685	10	0.87932	D	0	.	15.1906	0.73041	0.0:0.0:0.0:1.0	.	197;197	B2RCS5;P35609	.;ACTN2_HUMAN	R	197	ENSP00000443495:L197R;ENSP00000355537:L197R	ENSP00000355537:L197R	L	+	2	0	ACTN2	234957654	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.980000	0.88113	1.981000	0.57761	0.379000	0.24179	CTC		ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096628.1	NM_001103	
BPIFB4	149954	broad.mit.edu	37	20	31685501	31685501	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr20:31685501A>C	ENST00000375483.3	+	11	1477	c.1477A>C	c.(1477-1479)Aag>Cag	p.K493Q		NM_182519.2	NP_872325.2	P59827	BPIB4_HUMAN	BPI fold containing family B, member 4	493						cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)	p.K454Q(1)									GATGCTGCAGAAGGACAAAGC	0.582																																					p.K493Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1477C	20						.						151.0	118.0	129.0					20																	31685501		2203	4300	6503	31149162	SO:0001583	missense	149954	exon11			AF549190	CCDS13213.2	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186191	ENSG00000186191		"""BPI fold containing"""	16179	protein-coding gene	gene with protein product		615718	"""chromosome 20 open reading frame 186"""	C20orf186		11971875, 21787333	Standard	NM_182519		Approved	dJ726C3.5, LPLUNC4	uc010zue.2	P59827	OTTHUMG00000032235	ENST00000375483.3:c.1477A>C	20.37:g.31685501A>C	ENSP00000364632:p.Lys493Gln	Somatic		Capture	Illumina HiSeq	Phase_I	31149162	NM_182519	Q5TDX6	Missense_Mutation	SNP	ENST00000375483.3	37	CCDS13213.2	.	.	.	.	.	.	.	.	.	.	A	10.80	1.452540	0.26074	.	.	ENSG00000186191	ENST00000375483	T	0.06768	3.26	5.33	4.21	0.49690	.	0.138084	0.49916	N	0.000130	T	0.10035	0.0246	M	0.65975	2.015	0.28417	N	0.917934	B	0.21606	0.058	B	0.23018	0.043	T	0.23048	-1.0199	10	0.16896	T	0.51	-15.9028	9.437	0.38646	0.8206:0.1794:0.0:0.0	.	493	P59827	BPIB4_HUMAN	Q	493	ENSP00000364632:K493Q	ENSP00000364632:K493Q	K	+	1	0	BPIFB4	31149162	1.000000	0.71417	1.000000	0.80357	0.663000	0.39108	3.352000	0.52239	0.925000	0.37094	0.379000	0.24179	AAG		BPIFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078655.5	NM_182519	
ACSS2	55902	broad.mit.edu	37	20	33501246	33501246	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr20:33501246C>A	ENST00000360596.2	+	4	728	c.517C>A	c.(517-519)Ctt>Att	p.L173I	ACSS2_ENST00000476922.1_Intron|ACSS2_ENST00000336325.4_Missense_Mutation_p.L123I|ACSS2_ENST00000253382.5_Missense_Mutation_p.L173I	NM_018677.3	NP_061147.1	Q9NR19	ACSA_HUMAN	acyl-CoA synthetase short-chain family member 2	173					acetate biosynthetic process (GO:0019413)|acetyl-CoA biosynthetic process from acetate (GO:0019427)|ethanol oxidation (GO:0006069)|lipid biosynthetic process (GO:0008610)|propionate biosynthetic process (GO:0019542)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	acetate-CoA ligase activity (GO:0003987)|AMP binding (GO:0016208)|ATP binding (GO:0005524)	p.L173I(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(9)	21					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	GATCCCAGAGCTTGTGGTGGC	0.567																																					p.L173I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C517A	20						.						117.0	113.0	114.0					20																	33501246		2203	4300	6503	32964907	SO:0001583	missense	55902	exon4			AF263614	CCDS13243.1, CCDS42868.1, CCDS42868.2	20q11.22	2012-07-13	2005-09-08	2005-09-08	ENSG00000131069	ENSG00000131069	6.2.1.1	"""Acyl-CoA synthetase family"""	15814	protein-coding gene	gene with protein product		605832	"""acetyl-Coenzyme A synthetase 2 (ADP forming)"""	ACAS2		10843999	Standard	NM_018677		Approved	ACS, ACSA, AceCS, dJ1161H23.1	uc010gey.2	Q9NR19	OTTHUMG00000032317	ENST00000360596.2:c.517C>A	20.37:g.33501246C>A	ENSP00000353804:p.Leu173Ile	Somatic		Capture	Illumina HiSeq	Phase_I	32964907	NM_018677	A6NE90|Q5QPH2|Q5QPH3|Q8N238|Q96EL0|Q9NQP7|Q9UJ15	Missense_Mutation	SNP	ENST00000360596.2	37	CCDS13243.1	.	.	.	.	.	.	.	.	.	.	C	17.03	3.284538	0.59867	.	.	ENSG00000131069	ENST00000488172;ENST00000336325;ENST00000360596;ENST00000374693;ENST00000473172;ENST00000253382	T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9	5.09	5.09	0.68999	AMP-dependent synthetase/ligase (1);	0.066974	0.64402	D	0.000008	T	0.52693	0.1750	M	0.75150	2.29	0.80722	D	1	P;P	0.38535	0.635;0.494	P;B	0.44811	0.461;0.314	T	0.56183	-0.8021	10	0.52906	T	0.07	-6.9042	15.8075	0.78527	0.0:0.8643:0.1357:0.0	.	173;173	Q5QPH3;Q9NR19	.;ACSA_HUMAN	I	123;123;173;173;186;173	ENSP00000417783:L123I;ENSP00000337190:L123I;ENSP00000353804:L173I;ENSP00000419925:L186I;ENSP00000253382:L173I	ENSP00000253382:L173I	L	+	1	0	ACSS2	32964907	1.000000	0.71417	0.997000	0.53966	0.999000	0.98932	5.885000	0.69736	2.638000	0.89438	0.655000	0.94253	CTT		ACSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078823.3	NM_018677	
TGM2	7052	broad.mit.edu	37	20	36784312	36784312	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr20:36784312C>A	ENST00000361475.2	-	3	543	c.370G>T	c.(370-372)Ggc>Tgc	p.G124C	TGM2_ENST00000536724.1_Missense_Mutation_p.G64C|TGM2_ENST00000536701.1_Intron	NM_004613.2|NM_198951.1	NP_004604.2|NP_945189.1	P21980	TGM2_HUMAN	transglutaminase 2	124					apoptotic cell clearance (GO:0043277)|blood vessel remodeling (GO:0001974)|branching involved in salivary gland morphogenesis (GO:0060445)|isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein homooligomerization (GO:0051260)|salivary gland cavitation (GO:0060662)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.G124C(1)		endometrium(2)|large_intestine(11)|liver(1)|lung(7)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Myeloproliferative disorder(115;0.00878)			L-Glutamine(DB00130)	CCCTGGTAGCCAGTGGAGGCC	0.642																																					p.G124C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G370T	20						.						33.0	31.0	32.0					20																	36784312		2202	4300	6502	36217726	SO:0001583	missense	7052	exon3			M98478	CCDS13302.1	20q12	2013-05-02	2013-05-02		ENSG00000198959	ENSG00000198959	2.3.2.13	"""Transglutaminases"""	11778	protein-coding gene	gene with protein product	"""C polypeptide, protein-glutamine-gamma-glutamyltransferase"""	190196	"""transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)"""			7912692, 11390390	Standard	NM_004613		Approved	TGC	uc002xhr.3	P21980	OTTHUMG00000032437	ENST00000361475.2:c.370G>T	20.37:g.36784312C>A	ENSP00000355330:p.Gly124Cys	Somatic		Capture	Illumina HiSeq	Phase_I	36217726	NM_198951	E1P5V9|Q16436|Q6B838|Q9BTN7|Q9UH35	Missense_Mutation	SNP	ENST00000361475.2	37	CCDS13302.1	.	.	.	.	.	.	.	.	.	.	C	15.85	2.953828	0.53293	.	.	ENSG00000198959	ENST00000361475;ENST00000536724;ENST00000373403;ENST00000453095	D;D;D;T	0.88818	-2.43;-2.43;-2.43;-1.37	5.3	5.3	0.74995	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.934265	0.09096	N	0.849187	D	0.92041	0.7478	L	0.29908	0.895	0.52501	D	0.999959	D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0	P;D;P;D;D	0.74348	0.872;0.98;0.831;0.922;0.983	D	0.88996	0.3418	10	0.51188	T	0.08	-4.6562	18.314	0.90213	0.0:1.0:0.0:0.0	.	64;124;124;64;124	F5H6P0;P21980-3;P21980-2;B4DTN7;P21980	.;.;.;.;TGM2_HUMAN	C	124;64;124;124	ENSP00000355330:G124C;ENSP00000437479:G64C;ENSP00000362502:G124C;ENSP00000387642:G124C	ENSP00000355330:G124C	G	-	1	0	TGM2	36217726	0.852000	0.29690	0.995000	0.50966	0.028000	0.11728	5.398000	0.66308	2.648000	0.89879	0.561000	0.74099	GGC		TGM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079151.2	NM_198951	
COL6A2	1292	broad.mit.edu	37	21	47536581	47536581	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr21:47536581A>G	ENST00000300527.4	+	9	1048	c.944A>G	c.(943-945)gAc>gGc	p.D315G	COL6A2_ENST00000397763.1_Missense_Mutation_p.D315G|COL6A2_ENST00000409416.1_Missense_Mutation_p.D315G|COL6A2_ENST00000310645.5_Missense_Mutation_p.D315G|COL6A2_ENST00000357838.4_Missense_Mutation_p.D315G	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	315	Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		TTTGGAGCCGACGGTCGCAAG	0.617																																					p.D315G												.	.	0			c.A944G	21						.						41.0	45.0	43.0					21																	47536581		2202	4300	6502	46361009	SO:0001583	missense	1292	exon9			M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.944A>G	21.37:g.47536581A>G	ENSP00000300527:p.Asp315Gly	None		Capture	Illumina HiSeq	Phase_I	46361009	NM_001849	Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Missense_Mutation	SNP	ENST00000300527.4	37	CCDS13728.1	.	.	.	.	.	.	.	.	.	.	A	11.33	1.607487	0.28623	.	.	ENSG00000142173	ENST00000300527;ENST00000357838;ENST00000310645;ENST00000409416;ENST00000397763	D;D;D;D;D	0.94330	-3.4;-3.4;-3.18;-3.18;-3.4	4.96	4.96	0.65561	.	0.249868	0.39759	N	0.001277	D	0.95050	0.8397	L	0.55017	1.72	0.26797	N	0.969276	D;D;B	0.63880	0.993;0.983;0.202	D;P;B	0.67548	0.952;0.79;0.211	D	0.90114	0.4194	10	0.37606	T	0.19	-23.7475	14.9649	0.71184	1.0:0.0:0.0:0.0	.	315;315;315	P12110;P12110-2;P12110-3	CO6A2_HUMAN;.;.	G	315	ENSP00000300527:D315G;ENSP00000350497:D315G;ENSP00000312529:D315G;ENSP00000387115:D315G;ENSP00000380870:D315G	ENSP00000300527:D315G	D	+	2	0	COL6A2	46361009	0.965000	0.33210	0.323000	0.25347	0.832000	0.47134	3.294000	0.51787	1.996000	0.58369	0.533000	0.62120	GAC		COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206971.1		
DIP2A	23181	broad.mit.edu	37	21	47987479	47987479	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr21:47987479C>T	ENST00000417564.2	+	38	4681	c.4660C>T	c.(4660-4662)Cgg>Tgg	p.R1554W	DIP2A_ENST00000400274.1_Missense_Mutation_p.R1550W|DIP2A_ENST00000479654.1_3'UTR|DIP2A_ENST00000318711.7_Missense_Mutation_p.R1555W			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	1554					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.R1554W(1)		cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		CATGCACCTGCGGGACGGCTT	0.632																																					p.R1554W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4660T	21						.						82.0	93.0	90.0					21																	47987479		2203	4300	6503	46811907	SO:0001583	missense	23181	exon38			AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.4660C>T	21.37:g.47987479C>T	ENSP00000392066:p.Arg1554Trp	Somatic		Capture	Illumina HiSeq	Phase_I	46811907	NM_015151	A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Missense_Mutation	SNP	ENST00000417564.2	37	CCDS46655.1	.	.	.	.	.	.	.	.	.	.	C	18.88	3.717915	0.68844	.	.	ENSG00000160305	ENST00000400274;ENST00000318711;ENST00000417564	T;T;T	0.14516	2.5;2.5;2.5	5.56	2.5	0.30297	.	0.000000	0.85682	D	0.000000	T	0.46092	0.1375	M	0.93638	3.44	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.61004	-0.7150	10	0.87932	D	0	-25.1595	13.5584	0.61773	0.5022:0.4978:0.0:0.0	.	1555;1554	E9PER1;Q14689	.;DIP2A_HUMAN	W	1550;1555;1554	ENSP00000383133:R1550W;ENSP00000323633:R1555W;ENSP00000392066:R1554W	ENSP00000323633:R1555W	R	+	1	2	DIP2A	46811907	0.925000	0.31364	0.975000	0.42487	0.843000	0.47879	0.357000	0.20199	0.672000	0.31204	0.655000	0.94253	CGG		DIP2A-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376736.1	NM_015151	
SLC5A1	6523	broad.mit.edu	37	22	32479101	32479101	+	Silent	SNP	G	G	A	rs144581584	byFrequency	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr22:32479101G>A	ENST00000266088.4	+	7	874	c.624G>A	c.(622-624)acG>acA	p.T208T	SLC5A1_ENST00000543737.1_Silent_p.T81T	NM_000343.3	NP_000334.1	P13866	SC5A1_HUMAN	solute carrier family 5 (sodium/glucose cotransporter), member 1	208					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|intestinal absorption (GO:0050892)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glucose:sodium symporter activity (GO:0005412)	p.T208T(1)		NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(2)|skin(4)|urinary_tract(1)	37					Canagliflozin(DB08907)	CCTTGCAGACGGTGATCATGC	0.582													G|||	3	0.000599042	0.0	0.0	5008	,	,		22003	0.003		0.0	False		,,,				2504	0.0				p.T208T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G624A	22						.	G		0,4406		0,0,2203	157.0	120.0	133.0		624	-10.2	0.0	22	dbSNP_134	133	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	SLC5A1	NM_000343.3		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		208/665	32479101	2,13004	2203	4300	6503	30809101	SO:0001819	synonymous_variant	6523	exon7				CCDS13902.1, CCDS58805.1	22q12.3	2013-05-22			ENSG00000100170	ENSG00000100170		"""Solute carriers"""	11036	protein-coding gene	gene with protein product	"""sodium/glucose cotransporter 1"""	182380		SGLT1		8195156	Standard	NM_000343		Approved	D22S675, NAGT	uc003amc.3	P13866	OTTHUMG00000030768	ENST00000266088.4:c.624G>A	22.37:g.32479101G>A		Somatic		Capture	Illumina HiSeq	Phase_I	30809101	NM_000343	B2R7E2|B7Z4Q9|B7ZA69	Silent	SNP	ENST00000266088.4	37	CCDS13902.1																																																																																				SLC5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075656.3	NM_000343	
SCUBE1	80274	broad.mit.edu	37	22	43617215	43617215	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr22:43617215C>T	ENST00000360835.4	-	13	1639	c.1513G>A	c.(1513-1515)Gca>Aca	p.A505T		NM_173050.3	NP_766638.2	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1	505					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|post-embryonic development (GO:0009791)|protein homooligomerization (GO:0051260)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(4)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_neural(38;0.0414)|Ovarian(80;0.07)				TTTGCTCGTGCCTGGCTGTGG	0.637																																					p.A505T												.	.	0			c.G1513A	22						.						31.0	35.0	34.0					22																	43617215		2203	4299	6502	41947159	SO:0001583	missense	80274	exon13				CCDS14048.1	22q13	2008-07-01			ENSG00000159307	ENSG00000159307			13441	protein-coding gene	gene with protein product		611746				11087664	Standard	NM_173050		Approved		uc003bdt.2	Q8IWY4	OTTHUMG00000150679	ENST00000360835.4:c.1513G>A	22.37:g.43617215C>T	ENSP00000354080:p.Ala505Thr	None		Capture	Illumina HiSeq	Phase_I	41947159	NM_173050	Q5R336	Missense_Mutation	SNP	ENST00000360835.4	37	CCDS14048.1	.	.	.	.	.	.	.	.	.	.	C	5.382	0.255702	0.10185	.	.	ENSG00000159307	ENST00000360835;ENST00000381243	D	0.85013	-1.93	4.68	3.66	0.41972	.	0.275715	0.39909	N	0.001237	T	0.75155	0.3811	L	0.29908	0.895	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.67154	-0.5742	10	0.15499	T	0.54	.	12.7988	0.57573	0.0:0.92:0.0:0.08	.	505	Q8IWY4	SCUB1_HUMAN	T	505;135	ENSP00000354080:A505T	ENSP00000354080:A505T	A	-	1	0	SCUBE1	41947159	0.001000	0.12720	0.268000	0.24571	0.008000	0.06430	1.239000	0.32719	1.195000	0.43115	-0.119000	0.15052	GCA		SCUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319582.3	NM_173050	
PARVB	29780	broad.mit.edu	37	22	44543766	44543766	+	Silent	SNP	C	C	T	rs16991550	byFrequency	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr22:44543766C>T	ENST00000338758.7	+	9	801	c.738C>T	c.(736-738)ttC>ttT	p.F246F	PARVB_ENST00000404989.1_Silent_p.F209F|PARVB_ENST00000406477.3_Silent_p.F279F	NM_013327.4	NP_037459.2	Q9HBI1	PARVB_HUMAN	parvin, beta	246					actin cytoskeleton reorganization (GO:0031532)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell projection assembly (GO:0030031)|establishment or maintenance of cell polarity regulating cell shape (GO:0071963)|lamellipodium assembly (GO:0030032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)		p.F279F(1)		NS(1)|breast(1)|endometrium(3)|large_intestine(7)|lung(8)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	25		Ovarian(80;0.0246)|all_neural(38;0.0423)				ACACGCTGTTCGACCACGCCC	0.577													C|||	37	0.00738818	0.0265	0.0029	5008	,	,		18765	0.0		0.0	False		,,,				2504	0.0				p.F279F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C837T	22						.	C	,	75,4331	67.0+/-104.6	1,73,2129	98.0	78.0	85.0		837,738	2.1	1.0	22	dbSNP_123	85	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	PARVB	NM_001003828.2,NM_013327.4	,	1,73,6429	TT,TC,CC		0.0,1.7022,0.5767	,	279/398,246/365	44543766	75,12931	2203	4300	6503	42875099	SO:0001819	synonymous_variant	29780	exon10			AF151814	CCDS14056.1, CCDS46724.1, CCDS58808.1, CCDS74874.1	22q13.2-q13.33	2013-01-24			ENSG00000188677	ENSG00000188677		"""Parvins"""	14653	protein-coding gene	gene with protein product	"""affixin"""	608121				10810093, 11171322	Standard	NM_001003828		Approved	CGI-56	uc003ben.3	Q9HBI1	OTTHUMG00000150665	ENST00000338758.7:c.738C>T	22.37:g.44543766C>T		Somatic		Capture	Illumina HiSeq	Phase_I	42875099	NM_001003828	B0QYM8|B0QYN1|B2R9X6|Q5TGJ5|Q86X93|Q96PN1|Q9NSP7|Q9UGT3|Q9Y368|Q9Y3L6|Q9Y3L7	Silent	SNP	ENST00000338758.7	37	CCDS14056.1																																																																																				PARVB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319518.2	NM_001003828	
LRP1B	53353	broad.mit.edu	37	2	141083429	141083429	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr2:141083429A>C	ENST00000389484.3	-	80	13213	c.12242T>G	c.(12241-12243)tTt>tGt	p.F4081C		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	4081					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.F4081C(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GCGTTCACTAAAATAATCCAC	0.368										TSP Lung(27;0.18)																											p.F4081C	Colon(99;50 2074 2507 20106)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T12242G	2						.						110.0	101.0	104.0					2																	141083429		2203	4300	6503	140799899	SO:0001583	missense	53353	exon80			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.12242T>G	2.37:g.141083429A>C	ENSP00000374135:p.Phe4081Cys	Somatic		Capture	Illumina HiSeq	Phase_I	140799899	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.25|17.25	3.341916|3.341916	0.61073|0.61073	.|.	.|.	ENSG00000168702|ENSG00000168702	ENST00000389484;ENST00000544579|ENST00000437977	D|.	0.93659|.	-3.26|.	5.13|5.13	3.98|3.98	0.46160|0.46160	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);|.	0.151801|.	0.43919|.	U|.	0.000502|.	T|T	0.53449|0.53449	0.1797|0.1797	L|L	0.58101|0.58101	1.795|1.795	0.37152|0.37152	D|D	0.902213|0.902213	P|.	0.39131|.	0.661|.	B|.	0.36186|.	0.219|.	T|T	0.58526|0.58526	-0.7621|-0.7621	10|5	0.38643|.	T|.	0.18|.	.|.	5.7009|5.7009	0.17881|0.17881	0.7703:0.0:0.0794:0.1503|0.7703:0.0:0.0794:0.1503	.|.	4081|.	Q9NZR2|.	LRP1B_HUMAN|.	C|V	4081;4019|313	ENSP00000374135:F4081C|.	ENSP00000374135:F4081C|.	F|L	-|-	2|1	0|2	LRP1B|LRP1B	140799899|140799899	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.993000|0.993000	0.82548|0.82548	3.963000|3.963000	0.56773|0.56773	1.930000|1.930000	0.55929|0.55929	0.482000|0.482000	0.46254|0.46254	TTT|TTA		LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
KCNS3	3790	broad.mit.edu	37	2	18112710	18112710	+	Silent	SNP	G	G	A	rs373467913		TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr2:18112710G>A	ENST00000403915.1	+	3	886	c.435G>A	c.(433-435)tcG>tcA	p.S145S	KCNS3_ENST00000465292.1_Intron|KCNS3_ENST00000304101.4_Silent_p.S145S	NM_001282428.1	NP_001269357.1	Q9BQ31	KCNS3_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3	145					energy reserve metabolic process (GO:0006112)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel regulator activity (GO:0015459)	p.S145S(2)		endometrium(5)|kidney(1)|large_intestine(7)|lung(11)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					CCGACTCCTCGTTTGAAGAGT	0.478																																					p.S145S												.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.G435A	2						.	G		0,4406		0,0,2203	84.0	87.0	86.0		435	-1.7	0.7	2		86	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	KCNS3	NM_002252.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		145/492	18112710	1,13005	2203	4300	6503	17976191	SO:0001819	synonymous_variant	3790	exon3			AF043472	CCDS1692.1	2p24	2011-07-05			ENSG00000170745	ENSG00000170745		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6302	protein-coding gene	gene with protein product		603888				10484328, 16382104	Standard	NM_002252		Approved	Kv9.3	uc002rcw.3	Q9BQ31	OTTHUMG00000044150	ENST00000403915.1:c.435G>A	2.37:g.18112710G>A		Somatic		Capture	Illumina HiSeq	Phase_I	17976191	NM_002252	D6W520|O43651|Q4ZFY1|Q96B56	Silent	SNP	ENST00000403915.1	37	CCDS1692.1																																																																																				KCNS3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323808.1	NM_002252	
LRP2	4036	broad.mit.edu	37	2	170081863	170081863	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr2:170081863G>T	ENST00000263816.3	-	33	5780	c.5495C>A	c.(5494-5496)tCa>tAa	p.S1832*		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	1832					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	AAGGTTTCTTGAAATCCAATC	0.383																																					p.S1832X												.	.	0			c.C5495A	2						.						97.0	94.0	95.0					2																	170081863		2203	4300	6503	169790109	SO:0001587	stop_gained	4036	exon33				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.5495C>A	2.37:g.170081863G>T	ENSP00000263816:p.Ser1832*	None		Capture	Illumina HiSeq	Phase_I	169790109	NM_004525	O00711|Q16215	Nonsense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	G	46	12.913887	0.99705	.	.	ENSG00000081479	ENST00000263816	.	.	.	5.78	5.78	0.91487	.	0.059910	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.0175	0.97485	0.0:0.0:1.0:0.0	.	.	.	.	X	1832	.	ENSP00000263816:S1832X	S	-	2	0	LRP2	169790109	1.000000	0.71417	1.000000	0.80357	0.151000	0.21798	7.876000	0.87215	2.730000	0.93505	0.650000	0.86243	TCA		LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
HECW2	57520	broad.mit.edu	37	2	197157327	197157327	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr2:197157327G>A	ENST00000260983.3	-	14	3144	c.2962C>T	c.(2962-2964)Ccg>Tcg	p.P988S	RN7SL820P_ENST00000583941.1_RNA|HECW2_ENST00000409111.1_Missense_Mutation_p.P632S	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	988	Interaction with TP73.|WW 2. {ECO:0000255|PROSITE- ProRule:PRU00224}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						CATCCCCGCGGCAGCTCTAGC	0.557																																					p.P988S												.	.	0			c.C2962T	2						.						208.0	161.0	177.0					2																	197157327		2203	4300	6503	196865572	SO:0001583	missense	57520	exon14			AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.2962C>T	2.37:g.197157327G>A	ENSP00000260983:p.Pro988Ser	None		Capture	Illumina HiSeq	Phase_I	196865572	NM_020760	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	ENST00000260983.3	37	CCDS33354.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.927972	0.92389	.	.	ENSG00000138411	ENST00000409111;ENST00000260983	D;D	0.88277	-2.36;-2.36	5.09	5.09	0.68999	WW/Rsp5/WWP (5);	0.000000	0.85682	D	0.000000	D	0.96182	0.8755	H	0.94183	3.505	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96516	0.9382	10	0.52906	T	0.07	.	18.6786	0.91539	0.0:0.0:1.0:0.0	.	988	Q9P2P5	HECW2_HUMAN	S	632;988	ENSP00000386775:P632S;ENSP00000260983:P988S	ENSP00000260983:P988S	P	-	1	0	HECW2	196865572	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.238000	0.95380	2.647000	0.89833	0.655000	0.94253	CCG		HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3	NM_020760	
VWC2L	402117	broad.mit.edu	37	2	215440420	215440420	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr2:215440420C>T	ENST00000312504.5	+	4	1347	c.545C>T	c.(544-546)aCg>aTg	p.T182M	AC107218.3_ENST00000412896.1_RNA|VWC2L_ENST00000427124.1_Nonsense_Mutation_p.R139*|AC107218.3_ENST00000437883.1_RNA	NM_001080500.2	NP_001073969.1	B2RUY7	VWC2L_HUMAN	von Willebrand factor C domain containing protein 2-like	182					negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of neuron differentiation (GO:0045666)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)		p.T182M(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(10)|prostate(1)	16						GCAGGAACGACGATAATTCCA	0.468																																					p.T182M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C545T	2						.						198.0	190.0	193.0					2																	215440420		1984	4198	6182	215148665	SO:0001583	missense	402117	exon4			AB374231	CCDS46509.1	2q34-q35	2011-01-25	2011-01-25		ENSG00000174453	ENSG00000174453			37203	protein-coding gene	gene with protein product			"""von Willebrand factor C domain-containing protein 2-like"""				Standard	NM_001080500		Approved		uc002vet.2	B2RUY7	OTTHUMG00000154811	ENST00000312504.5:c.545C>T	2.37:g.215440420C>T	ENSP00000308976:p.Thr182Met	Somatic		Capture	Illumina HiSeq	Phase_I	215148665	NM_001080500	A6NC69|B2RUW7|B7X8X1	Missense_Mutation	SNP	ENST00000312504.5	37	CCDS46509.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	43|43	10.328472|10.328472	0.99384|0.99384	.|.	.|.	ENSG00000174453|ENSG00000174453	ENST00000427124|ENST00000312504	.|T	.|0.46451	.|0.87	5.78|5.78	5.78|5.78	0.91487|0.91487	.|.	.|.	.|.	.|.	.|.	.|T	.|0.58481	.|0.2125	L|L	0.59436|0.59436	1.845|1.845	0.42100|0.42100	D|D	0.991338|0.991338	.|D	.|0.71674	.|0.998	.|P	.|0.57324	.|0.818	.|T	.|0.56214	.|-0.8016	.|9	0.02654|0.48119	T|T	1|0.1	-1.6776|-1.6776	20.0203|20.0203	0.97492|0.97492	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|182	.|B2RUY7	.|VWC2L_HUMAN	X|M	139|182	.|ENSP00000308976:T182M	ENSP00000403779:R139X|ENSP00000308976:T182M	R|T	+|+	1|2	2|0	VWC2L|VWC2L	215148665|215148665	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.953000|0.953000	0.61014|0.61014	7.437000|7.437000	0.80417|0.80417	2.730000|2.730000	0.93505|0.93505	0.655000|0.655000	0.94253|0.94253	CGA|ACG		VWC2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337175.1	NM_001080500	
CTDSP1	58190	broad.mit.edu	37	2	219266356	219266356	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr2:219266356T>G	ENST00000273062.2	+	2	473	c.137T>G	c.(136-138)gTc>gGc	p.V46G	CTDSP1_ENST00000488627.1_3'UTR|MIR26B_ENST00000362251.2_RNA|RP11-378A13.2_ENST00000608367.1_RNA|CTDSP1_ENST00000443891.1_Missense_Mutation_p.V46G	NM_021198.2|NM_182642.2	NP_067021.1|NP_872580.1	Q9GZU7	CTDS1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1	46					negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|protein dephosphorylation (GO:0006470)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|metal ion binding (GO:0046872)	p.V46G(1)		NS(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	8		Renal(207;0.0915)		Epithelial(149;9.96e-07)|all cancers(144;0.00017)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TTCTGCTGTGTCTGCCGGGAT	0.652																																					p.V46G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T137G	2						.						48.0	47.0	48.0					2																	219266356		2203	4300	6503	218974600	SO:0001583	missense	58190	exon2			AF229162	CCDS2416.1, CCDS56166.1	2q35	2010-06-21			ENSG00000144579	ENSG00000144579		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	21614	protein-coding gene	gene with protein product	"""nuclear LIM interactor-interacting factor"", ""small CTD phosphatase 1"""	605323				11950066, 12721286	Standard	NM_021198		Approved	NLIIF, SCP1	uc021vwv.1	Q9GZU7	OTTHUMG00000133109	ENST00000273062.2:c.137T>G	2.37:g.219266356T>G	ENSP00000273062:p.Val46Gly	Somatic		Capture	Illumina HiSeq	Phase_I	218974600	NM_182642	C9IYG0|Q7Z5Q3|Q7Z5Q4	Missense_Mutation	SNP	ENST00000273062.2	37	CCDS2416.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.48|18.48	3.634151|3.634151	0.67130|0.67130	.|.	.|.	ENSG00000144579|ENSG00000144579	ENST00000452977;ENST00000428361;ENST00000431127|ENST00000443891;ENST00000273062	.|T;T	.|0.15139	.|2.45;2.46	5.08|5.08	5.08|5.08	0.68730|0.68730	.|.	.|0.510978	.|0.14921	.|N	.|0.290661	T|T	0.20414|0.20414	0.0491|0.0491	L|L	0.44542|0.44542	1.39|1.39	0.80722|0.80722	D|D	1|1	.|B;B	.|0.30455	.|0.28;0.001	.|B;B	.|0.35727	.|0.209;0.003	T|T	0.03240|0.03240	-1.1057|-1.1057	5|10	.|0.42905	.|T	.|0.14	-36.2523|-36.2523	14.5434|14.5434	0.68013|0.68013	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|46;46	.|Q9GZU7;C9IYG0	.|CTDS1_HUMAN;.	A|G	32;48;116|46	.|ENSP00000392248:V46G;ENSP00000273062:V46G	.|ENSP00000273062:V46G	S|V	+|+	1|2	0|0	CTDSP1|CTDSP1	218974600|218974600	0.993000|0.993000	0.37304|0.37304	0.999000|0.999000	0.59377|0.59377	0.860000|0.860000	0.49131|0.49131	4.967000|4.967000	0.63722|0.63722	1.915000|1.915000	0.55452|0.55452	0.533000|0.533000	0.62120|0.62120	TCT|GTC		CTDSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256774.1	NM_182642, NM_021198	
BOC	91653	broad.mit.edu	37	3	112991277	112991277	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr3:112991277C>T	ENST00000495514.1	+	7	1392	c.688C>T	c.(688-690)Cgc>Tgc	p.R230C	BOC_ENST00000273395.4_Missense_Mutation_p.R230C|BOC_ENST00000355385.3_Missense_Mutation_p.R230C			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	230					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)		p.R230C(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			TGAGGCTGCCCGCATCATCTA	0.622																																					p.R230C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C688T	3						.						132.0	128.0	129.0					3																	112991277		2203	4300	6503	114473967	SO:0001583	missense	91653	exon7			AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.688C>T	3.37:g.112991277C>T	ENSP00000418663:p.Arg230Cys	Somatic		Capture	Illumina HiSeq	Phase_I	114473967	NM_033254	A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Missense_Mutation	SNP	ENST00000495514.1	37	CCDS2971.1	.	.	.	.	.	.	.	.	.	.	C	33	5.196398	0.94960	.	.	ENSG00000144857	ENST00000495514;ENST00000273395;ENST00000355385	T;T;T	0.63096	-0.02;-0.02;-0.02	5.93	5.93	0.95920	Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.83464	0.5260	M	0.89095	3.005	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.76575	0.988;0.973	D	0.84412	0.0566	10	0.54805	T	0.06	.	20.3409	0.98764	0.0:1.0:0.0:0.0	.	230;230	Q9BWV1-3;Q9BWV1	.;BOC_HUMAN	C	230	ENSP00000418663:R230C;ENSP00000273395:R230C;ENSP00000347546:R230C	ENSP00000273395:R230C	R	+	1	0	BOC	114473967	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	5.623000	0.67757	2.814000	0.96858	0.655000	0.94253	CGC		BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354485.3	NM_033254	
SEMA5B	54437	broad.mit.edu	37	3	122629731	122629731	+	Missense_Mutation	SNP	C	C	T	rs372894044		TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr3:122629731C>T	ENST00000357599.3	-	22	3639	c.3253G>A	c.(3253-3255)Gga>Aga	p.G1085R	SEMA5B_ENST00000195173.4_3'UTR|SEMA5B_ENST00000451055.2_Missense_Mutation_p.G1139R	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	1085					cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.G1139R(1)|p.G1085R(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		GGGGTGCCTCCGCCCTTGTAG	0.527																																					p.G1085R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3253A	3						.	C	ARG/GLY	0,4406		0,0,2203	94.0	91.0	92.0		3253	4.9	1.0	3		92	1,8599	1.2+/-3.3	0,1,4299	no	missense	SEMA5B	NM_001031702.2	125	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	1085/1152	122629731	1,13005	2203	4300	6503	124112421	SO:0001583	missense	54437	exon22			AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.3253G>A	3.37:g.122629731C>T	ENSP00000350215:p.Gly1085Arg	Somatic		Capture	Illumina HiSeq	Phase_I	124112421	NM_001031702	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	ENST00000357599.3	37	CCDS35491.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.103328	0.76983	0.0	1.16E-4	ENSG00000082684	ENST00000357599;ENST00000418793;ENST00000451055;ENST00000393583	T;T;T	0.33654	1.4;1.44;1.47	4.86	4.86	0.63082	.	0.314863	0.32473	N	0.006047	T	0.23014	0.0556	N	0.08118	0	0.80722	D	1	P;P	0.50819	0.939;0.9	P;B	0.47744	0.556;0.354	T	0.02852	-1.1102	10	0.66056	D	0.02	.	6.6735	0.23082	0.0:0.8101:0.0:0.1899	.	991;1085	D3YTI7;Q9P283	.;SEM5B_HUMAN	R	1085;991;1139;1085	ENSP00000350215:G1085R;ENSP00000389588:G1139R;ENSP00000377208:G1085R	ENSP00000350215:G1085R	G	-	1	0	SEMA5B	124112421	1.000000	0.71417	0.998000	0.56505	0.821000	0.46438	5.397000	0.66302	2.525000	0.85131	0.655000	0.94253	GGA		SEMA5B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277165.1	NM_001031702	
ESYT3	83850	broad.mit.edu	37	3	138188329	138188329	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr3:138188329A>C	ENST00000389567.4	+	15	1672	c.1486A>C	c.(1486-1488)Aag>Cag	p.K496Q		NM_031913.3	NP_114119.2	A0FGR9	ESYT3_HUMAN	extended synaptotagmin-like protein 3	496	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|organelle membrane contact site (GO:0044232)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	25						TGTAGGCAAGAAGACACATAC	0.468																																					p.K496Q												.	.	0			c.A1486C	3						.						130.0	110.0	117.0					3																	138188329		2203	4300	6503	139671019	SO:0001583	missense	83850	exon15			AJ303366	CCDS3101.2	3q22.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000158220	ENSG00000158220		"""Synaptotagmins"""	24295	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member C"""	FAM62C		11543631, 17672888	Standard	NM_031913		Approved	CHR3SYT	uc003esk.3	A0FGR9	OTTHUMG00000147354	ENST00000389567.4:c.1486A>C	3.37:g.138188329A>C	ENSP00000374218:p.Lys496Gln	None		Capture	Illumina HiSeq	Phase_I	139671019	NM_031913	A8K0G5|Q6ZV21|Q8NDZ5|Q9BQR9	Missense_Mutation	SNP	ENST00000389567.4	37	CCDS3101.2	.	.	.	.	.	.	.	.	.	.	A	13.37	2.216443	0.39201	.	.	ENSG00000158220	ENST00000389567	T	0.69175	-0.38	4.57	4.57	0.56435	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	1.378140	0.04629	N	0.403381	T	0.57814	0.2079	L	0.35414	1.06	0.80722	D	1	B	0.34103	0.437	B	0.34536	0.185	T	0.32877	-0.9890	10	0.16420	T	0.52	-0.226	10.2893	0.43586	1.0:0.0:0.0:0.0	.	496	A0FGR9	ESYT3_HUMAN	Q	496	ENSP00000374218:K496Q	ENSP00000374218:K496Q	K	+	1	0	ESYT3	139671019	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	2.796000	0.47869	1.922000	0.55676	0.459000	0.35465	AAG		ESYT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000303993.1	NM_031913	
ZBBX	79740	broad.mit.edu	37	3	167000145	167000145	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr3:167000145A>G	ENST00000392766.2	-	19	2358	c.2018T>C	c.(2017-2019)aTt>aCt	p.I673T	ZBBX_ENST00000392767.2_Missense_Mutation_p.I673T|ZBBX_ENST00000307529.5_Missense_Mutation_p.I712T|ZBBX_ENST00000392764.1_Missense_Mutation_p.I644T|ZBBX_ENST00000455345.2_Missense_Mutation_p.I712T	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	673	Ser-rich.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.I712T(1)|p.I673T(1)		NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						AATTTCTGAAATTTCAGAAGC	0.363																																					p.I673T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T2018C	3						.						109.0	103.0	105.0					3																	167000145		1839	4096	5935	168482839	SO:0001583	missense	79740	exon19			AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.2018T>C	3.37:g.167000145A>G	ENSP00000376519:p.Ile673Thr	Somatic		Capture	Illumina HiSeq	Phase_I	168482839	NM_024687	A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Missense_Mutation	SNP	ENST00000392766.2	37	CCDS3199.2	.	.	.	.	.	.	.	.	.	.	A	13.17	2.158049	0.38119	.	.	ENSG00000169064	ENST00000392766;ENST00000392767;ENST00000455345;ENST00000307529;ENST00000392764	T;T;T;T;T	0.24151	2.05;2.05;2.13;2.13;1.87	5.28	5.28	0.74379	.	0.334023	0.27768	N	0.017932	T	0.40015	0.1100	L	0.55481	1.735	0.31595	N	0.6534	D;D	0.57257	0.979;0.964	P;P	0.56563	0.801;0.563	T	0.51888	-0.8648	10	0.87932	D	0	-8.2352	13.1818	0.59660	1.0:0.0:0.0:0.0	.	712;673	A8MT70-2;A8MT70	.;ZBBX_HUMAN	T	673;673;712;712;644	ENSP00000376519:I673T;ENSP00000376520:I673T;ENSP00000390232:I712T;ENSP00000305065:I712T;ENSP00000376517:I644T	ENSP00000305065:I712T	I	-	2	0	ZBBX	168482839	1.000000	0.71417	1.000000	0.80357	0.697000	0.40408	4.410000	0.59774	1.995000	0.58328	0.528000	0.53228	ATT		ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257657.3	NM_024687	
ABHD14B	84836	broad.mit.edu	37	3	52005562	52005562	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr3:52005562C>T	ENST00000483233.1	-	3	631	c.125G>A	c.(124-126)cGc>cAc	p.R42H	ABHD14B_ENST00000461108.1_Missense_Mutation_p.R42H|ABHD14B_ENST00000315877.10_Missense_Mutation_p.R42H|ABHD14B_ENST00000395008.2_Missense_Mutation_p.R42H|ABHD14B_ENST00000525795.1_Missense_Mutation_p.R42H|ABHD14B_ENST00000487005.1_Intron|RP11-155D18.14_ENST00000489595.2_Intron|RP11-155D18.12_ENST00000488257.1_RNA|ABHD14B_ENST00000361143.5_Missense_Mutation_p.R42H			Q96IU4	ABHEB_HUMAN	abhydrolase domain containing 14B	42					metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)	p.R42H(1)		large_intestine(2)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000548)|KIRC - Kidney renal clear cell carcinoma(197;0.00072)		GGAGGAGAAGCGAATACCATG	0.642																																					p.R42H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G125A	3						.						46.0	45.0	45.0					3																	52005562		2203	4300	6503	51980602	SO:0001583	missense	84836	exon2			AK075112	CCDS2842.1	3p21.2	2009-01-12			ENSG00000114779	ENSG00000114779		"""Abhydrolase domain containing"""	28235	protein-coding gene	gene with protein product							Standard	NM_032750		Approved	MGC15429, CIB	uc011bdy.2	Q96IU4	OTTHUMG00000157816	ENST00000483233.1:c.125G>A	3.37:g.52005562C>T	ENSP00000420065:p.Arg42His	Somatic		Capture	Illumina HiSeq	Phase_I	51980602	NM_001146314	Q86VK8|Q8N8W5	Missense_Mutation	SNP	ENST00000483233.1	37	CCDS2842.1	.	.	.	.	.	.	.	.	.	.	C	18.25	3.582354	0.65992	.	.	ENSG00000114779	ENST00000483233;ENST00000315877;ENST00000395008;ENST00000361143;ENST00000439982;ENST00000461108;ENST00000525795	T;T;T;T;T;T	0.67171	1.95;1.95;1.95;1.95;-0.25;1.95	5.69	4.82	0.62117	.	0.057175	0.64402	D	0.000003	T	0.64472	0.2601	M	0.78049	2.395	0.80722	D	1	P;B	0.34412	0.453;0.149	B;B	0.23852	0.049;0.038	T	0.66578	-0.5888	10	0.45353	T	0.12	-6.6977	14.1148	0.65146	0.0:0.9275:0.0:0.0724	.	42;42	B4DQI4;Q96IU4	.;ABHEB_HUMAN	H	42	ENSP00000420065:R42H;ENSP00000318248:R42H;ENSP00000378455:R42H;ENSP00000354841:R42H;ENSP00000417564:R42H;ENSP00000433388:R42H	ENSP00000318248:R42H	R	-	2	0	ABHD14B	51980602	0.145000	0.22656	0.986000	0.45419	0.976000	0.68499	2.028000	0.41088	1.425000	0.47237	0.561000	0.74099	CGC		ABHD14B-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349673.1	NM_032750	
FEZF2	55079	broad.mit.edu	37	3	62356955	62356955	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr3:62356955G>A	ENST00000283268.3	-	4	1351	c.1057C>T	c.(1057-1059)Cgc>Tgc	p.R353C	PTPRG-AS1_ENST00000490916.1_RNA|PTPRG-AS1_ENST00000495542.1_RNA|FEZF2_ENST00000475839.1_Missense_Mutation_p.R353C|FEZF2_ENST00000486811.1_Missense_Mutation_p.R353C	NM_018008.3	NP_060478.3	Q8TBJ5	FEZF2_HUMAN	FEZ family zinc finger 2	353					axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cerebral cortex GABAergic interneuron migration (GO:0021853)|dendrite development (GO:0016358)|dentate gyrus development (GO:0021542)|forebrain anterior/posterior pattern specification (GO:0021797)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.R353C(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|lung(8)|skin(1)	20		Lung SC(41;0.0262)		BRCA - Breast invasive adenocarcinoma(55;0.000221)|KIRC - Kidney renal clear cell carcinoma(15;0.00834)|Kidney(15;0.00957)		GCGTGGATGCGGATATGCGTG	0.552																																					p.R353C	NSCLC(170;1772 2053 12525 15604 23984)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1057T	3						.						135.0	122.0	127.0					3																	62356955		2203	4300	6503	62331995	SO:0001583	missense	55079	exon4			AF064845	CCDS2897.1	3p21.1	2013-01-08	2006-08-15	2006-08-15	ENSG00000153266	ENSG00000153266		"""Zinc fingers, C2H2-type"""	13506	protein-coding gene	gene with protein product		607414	"""zinc finger protein 312"""	ZNF312			Standard	NM_018008		Approved	FLJ10142, FKSG36, TOF, FEZL, Zfp312	uc003dli.2	Q8TBJ5	OTTHUMG00000158705	ENST00000283268.3:c.1057C>T	3.37:g.62356955G>A	ENSP00000283268:p.Arg353Cys	Somatic		Capture	Illumina HiSeq	Phase_I	62331995	NM_018008	A8K349|Q9BZ91|Q9NWB9	Missense_Mutation	SNP	ENST00000283268.3	37	CCDS2897.1	.	.	.	.	.	.	.	.	.	.	G	14.92	2.679704	0.47886	.	.	ENSG00000153266	ENST00000486811;ENST00000283268;ENST00000475839	T;T;T	0.58506	0.33;0.33;0.33	6.16	5.28	0.74379	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.80602	0.4654	M	0.92026	3.265	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.85308	0.1077	10	0.87932	D	0	-34.2584	14.529	0.67912	0.0:0.0:0.7329:0.2671	.	353	Q8TBJ5	FEZF2_HUMAN	C	353	ENSP00000418589:R353C;ENSP00000283268:R353C;ENSP00000418804:R353C	ENSP00000283268:R353C	R	-	1	0	FEZF2	62331995	1.000000	0.71417	1.000000	0.80357	0.368000	0.29767	5.483000	0.66838	1.603000	0.50134	-0.188000	0.12872	CGC		FEZF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351813.1	NM_018008	
OR5K3	403277	broad.mit.edu	37	3	98109984	98109984	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr3:98109984G>T	ENST00000383695.1	+	1	475	c.475G>T	c.(475-477)Gaa>Taa	p.E159*	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005516.1	NP_001005516.1	A6NET4	OR5K3_HUMAN	olfactory receptor, family 5, subfamily K, member 3	159						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E159*(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|prostate(1)|skin(1)|urinary_tract(1)	27						TCCCATGATTGAAGTAGAGTT	0.423																																					p.E159X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G475T	3						.						156.0	150.0	152.0					3																	98109984		2203	4300	6503	99592674	SO:0001587	stop_gained	403277	exon1				CCDS33803.1	3q11.2	2013-09-23			ENSG00000206536	ENSG00000206536		"""GPCR / Class A : Olfactory receptors"""	31290	protein-coding gene	gene with protein product							Standard	NM_001005516		Approved		uc011bgw.2	A6NET4	OTTHUMG00000160077	ENST00000383695.1:c.475G>T	3.37:g.98109984G>T	ENSP00000373194:p.Glu159*	Somatic		Capture	Illumina HiSeq	Phase_I	99592674	NM_001005516		Nonsense_Mutation	SNP	ENST00000383695.1	37	CCDS33803.1	.	.	.	.	.	.	.	.	.	.	G	9.114	1.007296	0.19199	.	.	ENSG00000206536	ENST00000383695	.	.	.	5.15	1.34	0.21922	.	0.834044	0.10216	N	0.701553	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-7.3908	15.3252	0.74154	0.0:0.3968:0.6032:0.0	.	.	.	.	X	159	.	ENSP00000373194:E159X	E	+	1	0	OR5K3	99592674	0.000000	0.05858	0.001000	0.08648	0.035000	0.12851	-0.483000	0.06536	-0.038000	0.13624	-0.327000	0.08410	GAA		OR5K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359110.1		
IMPG2	50939	broad.mit.edu	37	3	100962558	100962558	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr3:100962558delG	ENST00000193391.7	-	13	2804	c.2617delC	c.(2617-2619)cacfs	p.H873fs		NM_016247.3	NP_057331.2	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	873					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)|receptor complex (GO:0043235)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|hyaluronic acid binding (GO:0005540)	p.H873fs*18(1)		NS(1)|breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(14)|lung(32)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64					Hyaluronan(DB08818)	TCTGTGGAGTGAACACTTGTT	0.478																																					p.H873fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.2617delC	3						.						183.0	165.0	171.0					3																	100962558		2203	4300	6503	102445248	SO:0001589	frameshift_variant	50939	exon13			AF173155	CCDS2940.1	3q12.2-q12.3	2014-01-28			ENSG00000081148	ENSG00000081148			18362	protein-coding gene	gene with protein product		607056				10542133	Standard	NM_016247		Approved	IPM200, RP56	uc003duq.2	Q9BZV3	OTTHUMG00000159091	ENST00000193391.7:c.2617delC	3.37:g.100962558delG	ENSP00000193391:p.His873fs	Somatic		Capture	Illumina HiSeq	Phase_I	102445248	NM_016247	A8MWT5|Q9UKD4|Q9UKK5	Frame_Shift_Del	DEL	ENST00000193391.7	37	CCDS2940.1																																																																																				IMPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353256.3		
PIK3CA	5290	broad.mit.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.E545K	Colon(199;1504 1750 3362 26421 31210 32040)		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA,urinary_tract,bladder,Substitution - Missense,0 	.	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)	c.G1633A	3						.						61.0	60.0	60.0					3																	178936091		1813	4072	5885	180418785	SO:0001583	missense	5290	exon10				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	Somatic		Capture	Illumina HiSeq	Phase_I	180418785	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG		PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
HGFAC	3083	broad.mit.edu	37	4	3449218	3449219	+	Splice_Site	INS	-	-	C			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr4:3449218_3449219insC	ENST00000382774.3	+	11	1470_1471		c.e11-1		HGFAC_ENST00000511533.1_Splice_Site	NM_001528.2	NP_001519.1	Q04756	HGFA_HUMAN	HGF activator						proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|rough endoplasmic reticulum (GO:0005791)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.R455fs*91(1)		central_nervous_system(3)|cervix(1)|endometrium(4)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		CCCTTGCACAGCCCCCCCAGGG	0.673																																					.												.	.	1	Unknown(1)	large_intestine(1)	.	4						.			7,4259		0,7,2126						3.6	0.9			59	8,8244		0,8,4118	no	frameshift-near-splice	HGFAC	NM_001528.2		0,15,6244	A1A1,A1R,RR		0.0969,0.1641,0.1198				15,12503				3419017	SO:0001630	splice_region_variant	3083	.			D14012	CCDS3369.1, CCDS75098.1	4p16	2008-02-07			ENSG00000109758	ENSG00000109758	3.4.21.-		4894	protein-coding gene	gene with protein product		604552				7683665, 8226803	Standard	XM_005247966		Approved	HGFAP, HGFA	uc003ghc.3	Q04756	OTTHUMG00000090281	ENST00000382774.3:c.1356-1->C	4.37:g.3449225_3449225dupC		Somatic		Capture	Illumina HiSeq	Phase_I	3419016	.	Q14726|Q2M1W7|Q53X47	Splice_Site	INS	ENST00000382774.3	37	CCDS3369.1																																																																																				HGFAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206607.3		Intron
FGFR3	2261	broad.mit.edu	37	4	1806176	1806176	+	Missense_Mutation	SNP	C	C	T	rs370064407		TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr4:1806176C>T	ENST00000260795.2	+	8	1297	c.1195C>T	c.(1195-1197)Cgc>Tgc	p.R399C	FGFR3_ENST00000340107.4_Missense_Mutation_p.R401C|FGFR3_ENST00000481110.2_Missense_Mutation_p.R399C|FGFR3_ENST00000412135.2_Intron|FGFR3_ENST00000440486.2_Missense_Mutation_p.R399C|FGFR3_ENST00000352904.1_Intron			P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3	399					alveolar secondary septum development (GO:0061144)|axonogenesis involved in innervation (GO:0060385)|bone maturation (GO:0070977)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cell-cell signaling (GO:0007267)|central nervous system myelination (GO:0022010)|chondrocyte differentiation (GO:0002062)|chondrocyte proliferation (GO:0035988)|cochlea development (GO:0090102)|digestive tract morphogenesis (GO:0048546)|endochondral bone growth (GO:0003416)|endochondral ossification (GO:0001958)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell fate commitment (GO:0072148)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor apoptotic signaling pathway (GO:1902178)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear receptor cell differentiation (GO:0060113)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade (GO:0007259)|lens fiber cell development (GO:0070307)|lens morphogenesis in camera-type eye (GO:0002089)|MAPK cascade (GO:0000165)|morphogenesis of an epithelium (GO:0002009)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of developmental growth (GO:0048640)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|protein tyrosine kinase activity (GO:0004713)	p.R399C(1)		NS(1)|central_nervous_system(5)|cervix(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(40)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(9)|skin(339)|soft_tissue(4)|testis(2)|upper_aerodigestive_tract(58)|urinary_tract(2607)	3091		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)|Pazopanib(DB06589)|Ponatinib(DB08901)	CTGCCGCCTGCGCAGCCCCCC	0.627		1	"""Mis, T"""	"""IGH@, ETV6"""	"""bladder, MM, T-cell lymphoma"""		"""Hypochondroplasia, Thanatophoric dysplasia"""		Saethre-Chotzen syndrome;Muenke syndrome																												p.R401C			Dom	yes		4	4p16.3	2261	fibroblast growth factor receptor 3	yes	"""L, E"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1201T	4						.	C	CYS/ARG,CYS/ARG,	0,4406		0,0,2203	141.0	154.0	149.0		1195,1201,	2.2	1.0	4		149	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,intron	FGFR3	NM_000142.4,NM_001163213.1,NM_022965.3	180,180,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,	399/807,401/809,	1806176	1,13005	2203	4300	6503	1775974	SO:0001583	missense	2261	exon9	Familial Cancer Database	Acrocephalosyndactyly type III;Muenke Nonsyndromic Coronal Craniosynostosis, FGFR3-related Craniosynostosis	M64347	CCDS3353.1, CCDS3354.1, CCDS54706.1	4p16.3	2013-01-11	2008-08-01		ENSG00000068078	ENSG00000068078		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3690	protein-coding gene	gene with protein product		134934	"""achondroplasia, thanatophoric dwarfism"""	ACH		1847508	Standard	NM_000142		Approved	CEK2, JTK4, CD333	uc003gdu.2	P22607	OTTHUMG00000121148	ENST00000260795.2:c.1195C>T	4.37:g.1806176C>T	ENSP00000260795:p.Arg399Cys	Somatic		Capture	Illumina HiSeq	Phase_I	1775974	NM_001163213	D3DVP9|D3DVQ0|Q14308|Q16294|Q16608|Q59FL9	Missense_Mutation	SNP	ENST00000260795.2	37	CCDS3353.1	.	.	.	.	.	.	.	.	.	.	c	17.03	3.284422	0.59867	0.0	1.16E-4	ENSG00000068078	ENST00000481110;ENST00000340107;ENST00000440486;ENST00000260795	D;D;D;D	0.86097	-2.07;-2.07;-2.07;-2.07	4.44	2.25	0.28309	.	0.327867	0.30840	N	0.008780	D	0.88392	0.6424	M	0.62266	1.93	0.80722	D	1	D;B;B	0.69078	0.997;0.016;0.084	P;B;B	0.61397	0.888;0.009;0.02	D	0.88194	0.2879	10	0.66056	D	0.02	.	10.8727	0.46894	0.6418:0.3581:0.0:0.0	.	401;399;399	P22607-2;P22607;F8W9L4	.;FGFR3_HUMAN;.	C	399;401;399;399	ENSP00000420533:R399C;ENSP00000339824:R401C;ENSP00000414914:R399C;ENSP00000260795:R399C	ENSP00000260795:R399C	R	+	1	0	FGFR3	1775974	0.999000	0.42202	0.994000	0.49952	0.380000	0.30137	0.836000	0.27545	0.963000	0.38082	0.462000	0.41574	CGC		FGFR3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000241632.2	NM_000142	
KCTD8	386617	broad.mit.edu	37	4	44176956	44176956	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr4:44176956G>C	ENST00000360029.3	-	2	1556	c.1273C>G	c.(1273-1275)Ctg>Gtg	p.L425V		NM_198353.2	NP_938167.1	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerization domain containing 8	425					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)		p.L425V(1)		central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(3)|upper_aerodigestive_tract(4)	41						TTTTTGGACAGATTTGTTTCC	0.403										HNSCC(17;0.042)																											p.L425V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1273G	4						.						205.0	215.0	212.0					4																	44176956		2203	4300	6503	43871713	SO:0001583	missense	386617	exon2			AK123347	CCDS3467.1	4p13	2013-06-20	2013-06-20		ENSG00000183783	ENSG00000183783			22394	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 8"""				Standard	NM_198353		Approved		uc003gwu.3	Q6ZWB6	OTTHUMG00000099409	ENST00000360029.3:c.1273C>G	4.37:g.44176956G>C	ENSP00000353129:p.Leu425Val	Somatic		Capture	Illumina HiSeq	Phase_I	43871713	NM_198353	A2RU39	Missense_Mutation	SNP	ENST00000360029.3	37	CCDS3467.1	.	.	.	.	.	.	.	.	.	.	G	5.512	0.279501	0.10458	.	.	ENSG00000183783	ENST00000360029	T	0.38560	1.13	4.76	4.76	0.60689	.	0.330797	0.21875	N	0.067829	T	0.28300	0.0699	N	0.24115	0.695	0.29513	N	0.854089	B	0.31837	0.342	B	0.24974	0.057	T	0.07616	-1.0763	10	0.15952	T	0.53	.	17.2866	0.87143	0.0:0.0:1.0:0.0	.	425	Q6ZWB6	KCTD8_HUMAN	V	425	ENSP00000353129:L425V	ENSP00000353129:L425V	L	-	1	2	KCTD8	43871713	1.000000	0.71417	1.000000	0.80357	0.749000	0.42624	3.498000	0.53302	2.622000	0.88805	0.650000	0.86243	CTG		KCTD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216868.1		
GPRIN3	285513	broad.mit.edu	37	4	90170041	90170041	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr4:90170041T>G	ENST00000609438.1	-	2	1739	c.1221A>C	c.(1219-1221)gaA>gaC	p.E407D	GPRIN3_ENST00000333209.4_Missense_Mutation_p.E407D	NM_198281.2	NP_938022.2	Q6ZVF9	GRIN3_HUMAN	GPRIN family member 3	407								p.E407D(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|prostate(2)|skin(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		CAAGTTTATTTTCCCGTTGGA	0.527																																					p.E407D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1221C	4						.						100.0	104.0	103.0					4																	90170041		2203	4300	6503	90389064	SO:0001583	missense	285513	exon2			AK124616	CCDS34030.1	4q22.1	2006-08-24				ENSG00000185477			27733	protein-coding gene	gene with protein product		611241				15488195	Standard	NM_198281		Approved	GRIN3, FLJ42625	uc003hsm.1	Q6ZVF9		ENST00000609438.1:c.1221A>C	4.37:g.90170041T>G	ENSP00000476603:p.Glu407Asp	Somatic		Capture	Illumina HiSeq	Phase_I	90389064	NM_198281	Q8IVE4	Missense_Mutation	SNP	ENST00000609438.1	37	CCDS34030.1	.	.	.	.	.	.	.	.	.	.	T	13.84	2.357135	0.41801	.	.	ENSG00000185477	ENST00000333209	T	0.10099	2.91	5.26	-2.32	0.06745	.	0.234856	0.21995	N	0.066087	T	0.05090	0.0136	L	0.27053	0.805	0.09310	N	1	B	0.17667	0.023	B	0.18871	0.023	T	0.33828	-0.9853	10	0.22706	T	0.39	-3.1121	2.7016	0.05150	0.1239:0.1521:0.4326:0.2914	.	407	Q6ZVF9	GRIN3_HUMAN	D	407	ENSP00000328672:E407D	ENSP00000328672:E407D	E	-	3	2	GPRIN3	90389064	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.109000	0.10840	-0.505000	0.06568	-0.316000	0.08728	GAA		GPRIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363540.2	NM_198281	
EGF	1950	broad.mit.edu	37	4	110895896	110895896	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr4:110895896C>T	ENST00000265171.5	+	12	2207	c.1762C>T	c.(1762-1764)Cgt>Tgt	p.R588C	EGF_ENST00000503392.1_Missense_Mutation_p.R588C|EGF_ENST00000509793.1_Missense_Mutation_p.R546C	NM_001178130.1|NM_001963.4	NP_001171601.1|NP_001954.2	P01133	EGF_HUMAN	epidermal growth factor	588					activation of MAPKK activity (GO:0000186)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mammary gland alveolus development (GO:0060749)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of secretion (GO:0051048)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)|positive regulation of DNA binding (GO:0043388)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of calcium ion import (GO:0090279)|regulation of protein localization to cell surface (GO:2000008)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)	p.R588C(1)		breast(1)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sucralfate(DB00364)	AAATGGGAAACGTTCCAAAAT	0.358																																					p.R588C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1762T	4						.						102.0	96.0	98.0					4																	110895896		2203	4300	6503	111115345	SO:0001583	missense	1950	exon12			X04571	CCDS3689.1, CCDS54794.1, CCDS54795.1	4q25	2012-10-02	2010-05-11		ENSG00000138798	ENSG00000138798			3229	protein-coding gene	gene with protein product		131530	"""epidermal growth factor (beta-urogastrone)"""				Standard	NM_001963		Approved		uc003hzy.4	P01133	OTTHUMG00000132044	ENST00000265171.5:c.1762C>T	4.37:g.110895896C>T	ENSP00000265171:p.Arg588Cys	Somatic		Capture	Illumina HiSeq	Phase_I	111115345	NM_001963	B4DRK7|E7EVD2|E9PBF0|Q52LZ6	Missense_Mutation	SNP	ENST00000265171.5	37	CCDS3689.1	.	.	.	.	.	.	.	.	.	.	C	10.51	1.370970	0.24771	.	.	ENSG00000138798	ENST00000509793;ENST00000265171;ENST00000503392	D;D;D	0.96073	-3.9;-3.9;-3.9	4.85	2.11	0.27256	Six-bladed beta-propeller, TolB-like (1);	0.543217	0.22515	N	0.059056	D	0.91466	0.7306	N	0.16368	0.405	0.09310	N	1	P;P;P	0.48911	0.917;0.572;0.917	B;B;P	0.51055	0.17;0.085;0.657	D	0.84774	0.0769	10	0.41790	T	0.15	.	7.6796	0.28505	0.0:0.6506:0.0:0.3494	.	588;546;588	E7EVD2;P01133-2;P01133	.;.;EGF_HUMAN	C	546;588;588	ENSP00000424316:R546C;ENSP00000265171:R588C;ENSP00000421384:R588C	ENSP00000265171:R588C	R	+	1	0	EGF	111115345	0.001000	0.12720	0.080000	0.20451	0.432000	0.31715	0.125000	0.15749	0.177000	0.19895	0.655000	0.94253	CGT		EGF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255065.1		
APC	324	broad.mit.edu	37	5	112163701	112163701	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr5:112163701C>T	ENST00000457016.1	+	13	2004	c.1624C>T	c.(1624-1626)Cag>Tag	p.Q542*	APC_ENST00000257430.4_Nonsense_Mutation_p.Q542*|CTC-554D6.1_ENST00000520401.1_Silent_p.S37S|APC_ENST00000508376.2_Nonsense_Mutation_p.Q542*			P25054	APC_HUMAN	adenomatous polyposis coli	542	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Q542*(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AGACTTACAGCAGGTACTATT	0.418		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Q524X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	2	Substitution - Nonsense(1)|Unknown(1)	large_intestine(1)|skin(1)	c.C1570T	5	GRCh37	CM071554	APC	M		.						87.0	83.0	84.0					5																	112163701		2202	4300	6502	112191600	SO:0001587	stop_gained	324	exon11	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.1624C>T	5.37:g.112163701C>T	ENSP00000413133:p.Gln542*	Somatic		Capture	Illumina HiSeq	Phase_I	112191600	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	39	7.719132	0.98450	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-7.6611	19.6223	0.95663	0.0:1.0:0.0:0.0	.	.	.	.	X	542;524;542;542;542	.	ENSP00000257430:Q542X	Q	+	1	0	APC	112191600	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.421000	0.80204	2.707000	0.92482	0.655000	0.94253	CAG		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
APC	324	broad.mit.edu	37	5	112175639	112175639	+	Nonsense_Mutation	SNP	C	C	T	rs121913332		TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr5:112175639C>T	ENST00000457016.1	+	16	4728	c.4348C>T	c.(4348-4350)Cga>Tga	p.R1450*	APC_ENST00000257430.4_Nonsense_Mutation_p.R1450*|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Nonsense_Mutation_p.R1450*			P25054	APC_HUMAN	adenomatous polyposis coli	1450	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R1450*(153)|p.?(1)|p.P1424fs*19(1)|p.K1192fs*3(1)|p.R1450fs*22(1)|p.S1436fs*22(1)|p.R1450fs*5(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TCAAACCAAGCGAGAAGTACC	0.478	R1450*(LS123_LARGE_INTESTINE)|R1450*(MKN74_STOMACH)|R1450*(SW1417_LARGE_INTESTINE)|R1450*(SW837_LARGE_INTESTINE)	12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R1432X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,rectum,Substitution - Nonsense,0 	.	159	Substitution - Nonsense(153)|Deletion - Frameshift(4)|Unknown(1)|Insertion - Frameshift(1)	large_intestine(136)|stomach(13)|soft_tissue(4)|small_intestine(3)|endometrium(1)|skin(1)|pancreas(1)	c.C4294T	5	GRCh37	CM930030	APC	M	rs121913332	.						102.0	90.0	94.0					5																	112175639		2202	4300	6502	112203538	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4348C>T	5.37:g.112175639C>T	ENSP00000413133:p.Arg1450*	Somatic		Capture	Illumina HiSeq	Phase_I	112203538	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	41	8.651223	0.98901	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.17	4.2	0.49525	.	0.600559	0.18052	N	0.153248	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-1.0649	14.037	0.64651	0.426:0.574:0.0:0.0	.	.	.	.	X	1450	.	.	R	+	1	2	APC	112203538	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.171000	0.50824	1.564000	0.49628	0.655000	0.94253	CGA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
AFF4	27125	broad.mit.edu	37	5	132270417	132270417	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr5:132270417C>T	ENST00000265343.5	-	3	719	c.340G>A	c.(340-342)Gca>Aca	p.A114T	AFF4_ENST00000491831.1_5'UTR|AFF4_ENST00000378595.3_Missense_Mutation_p.A114T	NM_014423.3	NP_055238.1	Q9UHB7	AFF4_HUMAN	AF4/FMR2 family, member 4	114	Ser-rich.				spermatid development (GO:0007286)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A114T(1)	SEPT8/AFF4(2)	breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(7)|lung(11)|ovary(3)|pancreas(1)|prostate(3)|skin(2)	43		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GTGCTGGGTGCGGGTCCTACT	0.498																																					p.A114T	Ovarian(126;889 1733 2942 10745 11605)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G340A	5						.						106.0	103.0	104.0					5																	132270417		2203	4300	6503	132298316	SO:0001583	missense	27125	exon3			AF197927	CCDS4164.1	5q31	2006-04-28			ENSG00000072364	ENSG00000072364			17869	protein-coding gene	gene with protein product	"""ALL1 fused gene from 5q31"""	604417				10588740	Standard	XM_005271963		Approved	AF5Q31, MCEF	uc003kyd.3	Q9UHB7	OTTHUMG00000059838	ENST00000265343.5:c.340G>A	5.37:g.132270417C>T	ENSP00000265343:p.Ala114Thr	Somatic		Capture	Illumina HiSeq	Phase_I	132298316	NM_014423	B2RP19|B7WPD2|Q498B2|Q59FB3|Q6P592|Q8TDR1|Q9P0E4	Missense_Mutation	SNP	ENST00000265343.5	37	CCDS4164.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.042636	0.93685	.	.	ENSG00000072364	ENST00000265343;ENST00000378595;ENST00000421773	T;T;T	0.64438	-0.1;-0.1;-0.1	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.70859	0.3272	L	0.38175	1.15	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.83275	0.992;0.996;0.996	T	0.61436	-0.7063	10	0.10636	T	0.68	-10.6928	20.1802	0.98196	0.0:1.0:0.0:0.0	.	114;114;114	Q9UHB7-3;Q9UHB7-2;Q9UHB7	.;.;AFF4_HUMAN	T	114	ENSP00000265343:A114T;ENSP00000367858:A114T;ENSP00000395268:A114T	ENSP00000265343:A114T	A	-	1	0	AFF4	132298316	0.998000	0.40836	1.000000	0.80357	0.977000	0.68977	3.148000	0.50647	2.777000	0.95525	0.655000	0.94253	GCA		AFF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133049.1	NM_014423	
PDCD6	10016	broad.mit.edu	37	5	306875	306875	+	Splice_Site	SNP	G	G	A	rs373052818		TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr5:306875G>A	ENST00000264933.4	+	4	467	c.367G>A	c.(367-369)Ggc>Agc	p.G123S	AHRR_ENST00000505113.1_Intron|PDCD6_ENST00000507528.1_Intron|PDCD6_ENST00000511482.1_3'UTR|PDCD6_ENST00000505221.1_Intron|AHRR_ENST00000316418.5_Intron|AHRR_ENST00000512529.1_Intron	NM_001267556.1|NM_001267558.1|NM_013232.3	NP_001254485.1|NP_001254487.1|NP_037364.1	O75340	PDCD6_HUMAN	programmed cell death 6	123	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.		G -> C (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|cellular response to heat (GO:0034605)|intracellular protein transport (GO:0006886)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|proteolysis (GO:0006508)|response to calcium ion (GO:0051592)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|calcium-dependent protein binding (GO:0048306)|protein dimerization activity (GO:0046983)	p.G123C(1)|p.G123S(1)		breast(2)|endometrium(1)|large_intestine(4)|lung(1)	8			Epithelial(17;0.00193)|OV - Ovarian serous cystadenocarcinoma(19;0.00489)|all cancers(22;0.00511)|Lung(60;0.113)			CTCAGGTTTCGGTAACTCACT	0.493																																					p.G123S												PDCD6,breast,NS,Substitution - Missense,0 	.	2	Substitution - Missense(2)	large_intestine(1)|breast(1)	c.G367A	5						.	G	,SER/GLY,	1,4405	4.2+/-10.8	0,1,2202	133.0	110.0	118.0		,367,	4.4	1.0	5		118	0,8600		0,0,4300	no	intron,missense-near-splice,intron	PDCD6,AHRR	NM_001242412.1,NM_013232.3,NM_020731.4	,56,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,probably-damaging,	,123/192,	306875	1,13005	2203	4300	6503	359875	SO:0001630	splice_region_variant	10016	exon4			AF035606	CCDS3854.1, CCDS58940.1, CCDS58941.1, CCDS75222.1, CCDS75223.1	5p15.33	2013-01-10			ENSG00000249915	ENSG00000249915		"""EF-hand domain containing"""	8765	protein-coding gene	gene with protein product	"""apoptosis-linked gene-2"""	601057				8560270	Standard	NM_013232		Approved	ALG-2, PEF1B	uc003jat.1	O75340	OTTHUMG00000090283	ENST00000264933.4:c.367+1G>A	5.37:g.306875G>A		Somatic		Capture	Illumina HiSeq	Phase_I	359875	NM_013232	B2RD16|E7ESR3|Q2YDC2|Q5TZS0	Missense_Mutation	SNP	ENST00000264933.4	37	CCDS3854.1	.	.	.	.	.	.	.	.	.	.	g	10.38	1.332964	0.24167	2.27E-4	0.0	ENSG00000249915	ENST00000264933	T	0.48201	0.82	5.29	4.41	0.53225	EF-hand-like domain (1);	.	.	.	.	T	0.76702	0.4024	H	0.96208	3.785	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.83369	0.0006	9	0.87932	D	0	.	12.1915	0.54275	0.0863:0.0:0.9137:0.0	.	123	O75340	PDCD6_HUMAN	S	123	ENSP00000264933:G123S	ENSP00000264933:G123S	G	+	1	0	PDCD6	359875	1.000000	0.71417	1.000000	0.80357	0.310000	0.27922	7.034000	0.76511	2.454000	0.82982	0.650000	0.86243	GGC		PDCD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206609.2	NM_013232	Missense_Mutation
ADAMTS16	170690	broad.mit.edu	37	5	5319202	5319202	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr5:5319202A>G	ENST00000274181.7	+	23	3764	c.3626A>G	c.(3625-3627)aAg>aGg	p.K1209R		NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	1209	PLAC. {ECO:0000255|PROSITE- ProRule:PRU00233}.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.K1209M(1)|p.K1209R(1)		breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						TGCAGCCACAAGTTCTACGGC	0.522																																					p.K1209R												.	.	2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	c.A3626G	5						.						49.0	51.0	50.0					5																	5319202		2018	4182	6200	5372202	SO:0001583	missense	170690	exon23			AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.3626A>G	5.37:g.5319202A>G	ENSP00000274181:p.Lys1209Arg	Somatic		Capture	Illumina HiSeq	Phase_I	5372202	NM_139056	C6G490|Q8IVE2	Missense_Mutation	SNP	ENST00000274181.7	37	CCDS43299.1	.	.	.	.	.	.	.	.	.	.	A	13.45	2.241233	0.39598	.	.	ENSG00000145536	ENST00000274181	T	0.51574	0.7	4.54	-5.19	0.02832	PLAC (2);	0.457730	0.21722	N	0.070120	T	0.23410	0.0566	N	0.25647	0.755	0.29867	N	0.827136	B	0.11235	0.004	B	0.14578	0.011	T	0.15925	-1.0420	10	0.18276	T	0.48	.	5.5384	0.17023	0.3497:0.2716:0.3787:0.0	.	1209	Q8TE57	ATS16_HUMAN	R	1209	ENSP00000274181:K1209R	ENSP00000274181:K1209R	K	+	2	0	ADAMTS16	5372202	0.996000	0.38824	0.002000	0.10522	0.884000	0.51177	1.172000	0.31908	-1.055000	0.03209	0.383000	0.25322	AAG		ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056	
ISL1	3670	broad.mit.edu	37	5	50685758	50685758	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr5:50685758G>C	ENST00000230658.7	+	4	1342	c.757G>C	c.(757-759)Gac>Cac	p.D253H	ISL1_ENST00000511384.1_Missense_Mutation_p.D253H|ISL1_ENST00000505475.2_3'UTR	NM_002202.2	NP_002193.2	P61371	ISL1_HUMAN	ISL LIM homeobox 1	253	Gln-rich.				atrial septum morphogenesis (GO:0060413)|axon regeneration (GO:0031103)|cardiac cell fate determination (GO:0060913)|cardiac muscle cell myoblast differentiation (GO:0060379)|cardiac right ventricle morphogenesis (GO:0003215)|cellular response to glucocorticoid stimulus (GO:0071385)|endocardial cushion morphogenesis (GO:0003203)|innervation (GO:0060384)|mesenchymal cell differentiation (GO:0048762)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of inflammatory response (GO:0050728)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of protein homodimerization activity (GO:0090074)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neuron fate specification (GO:0048665)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|pancreas development (GO:0031016)|peripheral nervous system neuron axonogenesis (GO:0048936)|pharyngeal system development (GO:0060037)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of granulocyte colony-stimulating factor production (GO:0071657)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 alpha production (GO:0032730)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage colony-stimulating factor production (GO:1901258)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|retinal ganglion cell axon guidance (GO:0031290)|secondary heart field specification (GO:0003139)|sensory system development (GO:0048880)|spinal cord motor neuron cell fate specification (GO:0021520)|spinal cord motor neuron differentiation (GO:0021522)|trigeminal nerve development (GO:0021559)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|zinc ion binding (GO:0008270)	p.D253H(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(11)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31		Lung NSC(810;0.000845)|Breast(144;0.0411)				GCAGCCCAATGACAAAACTGT	0.587																																					p.D253H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G757C	5						.						39.0	46.0	44.0					5																	50685758		2183	4288	6471	50721515	SO:0001583	missense	3670	exon4			BC031213	CCDS43314.1	5q11.2	2012-03-09	2007-07-13		ENSG00000016082	ENSG00000016082		"""Homeoboxes / LIM class"""	6132	protein-coding gene	gene with protein product		600366	"""ISL1 transcription factor, LIM/homeodomain, (islet-1)"""			7912209	Standard	NM_002202		Approved	Isl-1, ISLET1	uc003jor.3	P61371	OTTHUMG00000162281	ENST00000230658.7:c.757G>C	5.37:g.50685758G>C	ENSP00000230658:p.Asp253His	Somatic		Capture	Illumina HiSeq	Phase_I	50721515	NM_002202	P20663|P47894	Missense_Mutation	SNP	ENST00000230658.7	37	CCDS43314.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.85|18.85	3.711995|3.711995	0.68730|0.68730	.|.	.|.	ENSG00000016082|ENSG00000016082	ENST00000230658;ENST00000511384|ENST00000505475	D;D|.	0.85484|.	-1.99;-1.94|.	5.63|5.63	5.63|5.63	0.86233|0.86233	.|.	0.050255|.	0.85682|.	N|.	0.000000|.	T|.	0.77525|.	0.4143|.	M|M	0.74881|0.74881	2.28|2.28	0.80722|0.80722	D|D	1|1	B|.	0.23490|.	0.086|.	B|.	0.19148|.	0.024|.	T|.	0.76214|.	-0.3041|.	10|.	0.41790|.	T|.	0.15|.	.|.	19.6898|19.6898	0.95996|0.95996	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	253|.	P61371|.	ISL1_HUMAN|.	H|S	253|199	ENSP00000230658:D253H;ENSP00000422676:D253H|.	ENSP00000230658:D253H|.	D|X	+|+	1|2	0|2	ISL1|ISL1	50721515|50721515	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.145000|0.145000	0.21501|0.21501	7.899000|7.899000	0.87370|0.87370	2.634000|2.634000	0.89283|0.89283	0.650000|0.650000	0.86243|0.86243	GAC|TGA		ISL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368413.3	NM_002202	
TENM2	57451	broad.mit.edu	37	5	167626008	167626008	+	Silent	SNP	C	C	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr5:167626008C>T	ENST00000518659.1	+	16	3090	c.3051C>T	c.(3049-3051)ccC>ccT	p.P1017P	TENM2_ENST00000403607.2_Silent_p.P841P|TENM2_ENST00000545108.1_Silent_p.P1017P|TENM2_ENST00000520394.1_Silent_p.P785P|TENM2_ENST00000519204.1_Silent_p.P896P	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	1017					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.P850P(1)|p.P1017P(1)									ACTCCATCCCCAGCTGTGACC	0.587																																					p.P1008P												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C3024T	5						.						76.0	83.0	81.0					5																	167626008		2106	4216	6322	167558586	SO:0001819	synonymous_variant	57451	exon16			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.3051C>T	5.37:g.167626008C>T		Somatic		Capture	Illumina HiSeq	Phase_I	167558586	NM_001122679	Q9ULU2	Silent	SNP	ENST00000518659.1	37																																																																																					TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679	
VARS2	57176	broad.mit.edu	37	6	30884991	30884991	+	Missense_Mutation	SNP	C	C	T	rs374148426		TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr6:30884991C>T	ENST00000321897.5	+	8	1495	c.863C>T	c.(862-864)tCg>tTg	p.S288L	VARS2_ENST00000416670.2_Missense_Mutation_p.S288L|VARS2_ENST00000541562.1_Missense_Mutation_p.S318L|VARS2_ENST00000542001.1_Missense_Mutation_p.S148L			Q5ST30	SYVM_HUMAN	valyl-tRNA synthetase 2, mitochondrial	288					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)	p.S288L(1)		central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(3)|prostate(3)|skin(4)|urinary_tract(1)	46						TCAGCCATCTCGGACATTGAG	0.542																																					p.S148L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C443T	6						.	C	LEU/SER,LEU/SER,LEU/SER	1,3021		0,1,1510	181.0	180.0	181.0		443,953,863	4.8	1.0	6		181	0,5418		0,0,2709	no	missense,missense,missense	VARS2	NM_001167733.1,NM_001167734.1,NM_020442.4	145,145,145	0,1,4219	TT,TC,CC		0.0,0.0331,0.0118	probably-damaging,probably-damaging,probably-damaging	148/924,318/1094,288/1064	30884991	1,8439	1511	2709	4220	30992970	SO:0001583	missense	57176	exon8			AB067472	CCDS34387.1, CCDS54980.1	6p21.33	2012-10-26	2012-10-26	2007-02-23	ENSG00000137411	ENSG00000137411	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	21642	protein-coding gene	gene with protein product	"""valine tRNA ligase 2, mitochondrial"""	612802	"""valyl-tRNA synthetase 2-like"", ""valyl-tRNA synthetase like"", ""valyl-tRNA synthetase 2, mitochondrial (putative)"""	VARS2L, VARSL		1898367, 11572484, 18400783	Standard	NM_001167734		Approved	DKFZP434L1435, KIAA1885, G7a	uc011dmz.2	Q5ST30	OTTHUMG00000031263	ENST00000321897.5:c.863C>T	6.37:g.30884991C>T	ENSP00000316092:p.Ser288Leu	Somatic		Capture	Illumina HiSeq	Phase_I	30992970	NM_001167733	A2ABL7|B4DET4|B4E3P5|F5GXJ0|F5H323|Q2M2A0|Q59FI1|Q5SQ96|Q5SS98|Q6DKJ5|Q6ZV24|Q96GN2|Q96H77|Q96Q02|Q9H6R2|Q9UFH7	Missense_Mutation	SNP	ENST00000321897.5	37	CCDS34387.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.614983	0.87359	3.31E-4	0.0	ENSG00000137411	ENST00000321897;ENST00000416670;ENST00000542001;ENST00000428017;ENST00000541562	T;T;T;T;T	0.52526	0.66;0.66;0.66;0.66;0.66	4.81	4.81	0.61882	Rossmann-like alpha/beta/alpha sandwich fold (1);Aminoacyl-tRNA synthetase, class Ia (1);	0.128127	0.53938	D	0.000041	T	0.74604	0.3738	H	0.96142	3.775	0.58432	D	0.999993	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79784	0.993;0.988;0.975	T	0.83097	-0.0130	10	0.87932	D	0	-1.8576	15.4573	0.75325	0.0:1.0:0.0:0.0	.	288;318;288	B7ZL25;F5GXJ0;Q5ST30	.;.;SYVM_HUMAN	L	288;288;148;288;318	ENSP00000316092:S288L;ENSP00000394802:S288L;ENSP00000438200:S148L;ENSP00000403749:S288L;ENSP00000441000:S318L	ENSP00000316092:S288L	S	+	2	0	VARS2	30992970	1.000000	0.71417	0.982000	0.44146	0.734000	0.41952	6.838000	0.75359	2.508000	0.84585	0.555000	0.69702	TCG		VARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076566.2	NM_020442	
RXRB	6257	broad.mit.edu	37	6	33166996	33166996	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr6:33166996G>C	ENST00000374680.3	-	2	644	c.433C>G	c.(433-435)Ctg>Gtg	p.L145V	RXRB_ENST00000413614.2_Intron|RXRB_ENST00000544186.1_Intron|SLC39A7_ENST00000374677.3_5'Flank|RNY4P10_ENST00000365571.1_RNA|SLC39A7_ENST00000374675.3_5'Flank|RXRB_ENST00000374685.4_Missense_Mutation_p.L145V	NM_001270401.1|NM_021976.4	NP_001257330.1|NP_068811.1	P28702	RXRB_HUMAN	retinoid X receptor, beta	145	Modulating. {ECO:0000250}.|Pro-rich.				cardiac muscle cell proliferation (GO:0060038)|cellular response to retinoic acid (GO:0071300)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|maternal placenta development (GO:0001893)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	9-cis retinoic acid receptor activity (GO:0004886)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.L145V(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(1)|skin(2)	15					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Tazarotene(DB00799)|Tretinoin(DB00755)	GGAGGGGGCAGACCAGGGGAC	0.622																																					p.L145V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C433G	6						.						5.0	7.0	7.0					6																	33166996		2036	4081	6117	33274974	SO:0001583	missense	6257	exon2			M84820	CCDS4768.1, CCDS59007.1	6p21.3	2013-01-16			ENSG00000204231	ENSG00000204231		"""Nuclear hormone receptors"""	10478	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 2"""	180246				8257090	Standard	NM_021976		Approved	NR2B2, H-2RIIBP, RCoR-1	uc003odc.4	P28702	OTTHUMG00000031298	ENST00000374680.3:c.433C>G	6.37:g.33166996G>C	ENSP00000363812:p.Leu145Val	Somatic		Capture	Illumina HiSeq	Phase_I	33274974	NM_021976	P28703|Q59G65|Q5JP92|Q5STQ1	Missense_Mutation	SNP	ENST00000374680.3	37	CCDS4768.1	.	.	.	.	.	.	.	.	.	.	G	11.96	1.794825	0.31777	.	.	ENSG00000204231	ENST00000374685;ENST00000374680	D;D	0.92858	-3.12;-3.11	4.72	1.92	0.25849	.	0.513593	0.17545	N	0.170370	D	0.83492	0.5266	N	0.16903	0.455	0.80722	D	1	D;P;P	0.63880	0.993;0.941;0.88	D;D;P	0.71414	0.967;0.973;0.899	T	0.78069	-0.2348	10	0.18710	T	0.47	.	4.0375	0.09737	0.2759:0.0:0.5616:0.1625	.	145;185;145	B7Z6J2;Q59G65;P28702	.;.;RXRB_HUMAN	V	145	ENSP00000363817:L145V;ENSP00000363812:L145V	ENSP00000363812:L145V	L	-	1	2	RXRB	33274974	0.923000	0.31300	0.987000	0.45799	0.975000	0.68041	0.669000	0.25142	0.069000	0.16605	0.297000	0.19635	CTG		RXRB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076642.2	NM_021976	
RPS18	6222	broad.mit.edu	37	6	33240427	33240427	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr6:33240427T>C	ENST00000439602.2	+	2	136	c.26T>C	c.(25-27)tTc>tCc	p.F9S	VPS52_ENST00000445902.2_5'Flank|RPS18_ENST00000474973.1_5'UTR|VPS52_ENST00000436044.2_5'Flank|VPS52_ENST00000478934.1_5'Flank|RPS18_ENST00000476222.1_3'UTR|VPS52_ENST00000482399.1_5'Flank			P62269	RS18_HUMAN	ribosomal protein S18	9					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosome biogenesis (GO:0042254)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribosome (GO:0005840)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)	p.F9S(1)		kidney(2)|large_intestine(2)|lung(2)|prostate(2)|urinary_tract(1)	9						CCTGAAAAGTTCCAGCATATT	0.433																																					p.F9S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T26C	6						.						125.0	137.0	133.0					6																	33240427		2203	4300	6503	33348405	SO:0001583	missense	6222	exon2			X69150	CCDS4771.1	6p21.3	2011-04-05			ENSG00000231500	ENSG00000231500		"""S ribosomal proteins"""	10401	protein-coding gene	gene with protein product		180473		D6S218E		8441687, 9582194	Standard	NM_022551		Approved	KE3, KE-3, HKE3, S18	uc003odp.1	P62269	OTTHUMG00000031053	ENST00000439602.2:c.26T>C	6.37:g.33240427T>C	ENSP00000393241:p.Phe9Ser	Somatic		Capture	Illumina HiSeq	Phase_I	33348405	NM_022551	P25232|Q5SUJ3|Q6IPF8	Missense_Mutation	SNP	ENST00000439602.2	37	CCDS4771.1	.	.	.	.	.	.	.	.	.	.	T	18.04	3.535261	0.64972	.	.	ENSG00000231500	ENST00000439602	.	.	.	4.53	4.53	0.55603	.	0.000000	0.85682	D	0.000000	T	0.54498	0.1862	M	0.92026	3.265	0.80722	D	1	P	0.39250	0.665	B	0.31547	0.132	T	0.68202	-0.5471	9	0.59425	D	0.04	.	11.8524	0.52419	0.0:0.0:0.0:1.0	.	9	P62269	RS18_HUMAN	S	9	.	ENSP00000393241:F9S	F	+	2	0	RPS18	33348405	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.927000	0.75840	1.906000	0.55180	0.472000	0.43445	TTC		RPS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076059.2		
COL9A1	1297	broad.mit.edu	37	6	70961873	70961873	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr6:70961873G>A	ENST00000357250.6	-	28	1980	c.1822C>T	c.(1822-1824)Caa>Taa	p.Q608*	COL9A1_ENST00000489611.1_5'UTR|COL9A1_ENST00000370499.4_Nonsense_Mutation_p.Q365*|COL9A1_ENST00000320755.7_Nonsense_Mutation_p.Q365*	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	608	Collagen-like 6.|Triple-helical region (COL2).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)	p.Q608*(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						GGCCCCTGTTGGCCCTGTTAT	0.498																																					p.Q608X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1822T	6						.						109.0	120.0	116.0					6																	70961873		2203	4300	6503	71018594	SO:0001587	stop_gained	1297	exon28				CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.1822C>T	6.37:g.70961873G>A	ENSP00000349790:p.Gln608*	Somatic		Capture	Illumina HiSeq	Phase_I	71018594	NM_001851	Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Nonsense_Mutation	SNP	ENST00000357250.6	37	CCDS4971.1	.	.	.	.	.	.	.	.	.	.	G	19.73	3.882723	0.72410	.	.	ENSG00000112280	ENST00000357250;ENST00000320755;ENST00000370499	.	.	.	5.66	4.74	0.60224	.	0.275863	0.39834	N	0.001245	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08179	T	0.78	.	15.0073	0.71522	0.0:0.2367:0.7633:0.0	.	.	.	.	X	608;365;365	.	ENSP00000315252:Q365X	Q	-	1	0	COL9A1	71018594	0.985000	0.35326	0.983000	0.44433	0.769000	0.43574	2.748000	0.47483	2.665000	0.90641	0.563000	0.77884	CAA		COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041131.2		
COL12A1	1303	broad.mit.edu	37	6	75861681	75861681	+	Missense_Mutation	SNP	C	C	A	rs549336635	byFrequency	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr6:75861681C>A	ENST00000322507.8	-	20	4211	c.3902G>T	c.(3901-3903)cGa>cTa	p.R1301L	COL12A1_ENST00000345356.6_Missense_Mutation_p.R137L|COL12A1_ENST00000416123.2_Missense_Mutation_p.R1301L|COL12A1_ENST00000483888.2_Missense_Mutation_p.R1301L	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1301	VWFA 3. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)	p.R1301L(1)		breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						ACCAATTTTTCGAGCTCGAGG	0.438																																					p.R1301L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3902T	6						.						174.0	167.0	169.0					6																	75861681		1955	4146	6101	75918401	SO:0001583	missense	1303	exon20			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.3902G>T	6.37:g.75861681C>A	ENSP00000325146:p.Arg1301Leu	Somatic		Capture	Illumina HiSeq	Phase_I	75918401	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	37	CCDS43482.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.315513	0.81469	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888	D;D;D;D	0.83914	-1.78;-1.78;-1.78;-1.78	5.78	5.78	0.91487	von Willebrand factor, type A (3);	0.087213	0.47455	D	0.000238	D	0.86802	0.6020	M	0.64170	1.965	0.48571	D	0.999674	P;D	0.63046	0.62;0.992	B;D	0.68483	0.365;0.958	D	0.87335	0.2327	10	0.59425	D	0.04	.	13.2415	0.59999	0.0:0.9278:0.0:0.0722	.	137;1301	Q99715-2;Q99715	.;COCA1_HUMAN	L	1301;1301;137;1301;1301	ENSP00000325146:R1301L;ENSP00000305147:R137L;ENSP00000412864:R1301L;ENSP00000421216:R1301L	ENSP00000325146:R1301L	R	-	2	0	COL12A1	75918401	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.775000	0.55349	2.730000	0.93505	0.650000	0.86243	CGA		COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
TRDN	10345	broad.mit.edu	37	6	123833498	123833498	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr6:123833498T>G	ENST00000398178.3	-	7	581	c.560A>C	c.(559-561)aAg>aCg	p.K187T	TRDN_ENST00000334268.4_Missense_Mutation_p.K187T|TRDN_ENST00000546248.1_Missense_Mutation_p.K187T	NM_006073.3	NP_006064.2	Q13061	TRDN_HUMAN	triadin	187					cellular calcium ion homeostasis (GO:0006874)|cytoplasmic microtubule organization (GO:0031122)|endoplasmic reticulum membrane organization (GO:0090158)|heart contraction (GO:0060047)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|myotube differentiation (GO:0014902)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901846)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to organic cyclic compound (GO:0014070)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|protein homodimerization activity (GO:0042803)	p.K187T(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	41				GBM - Glioblastoma multiforme(226;0.184)		AATTTTTTCCTTGTGAGTTGC	0.279																																					p.K187T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A560C	6						.						17.0	16.0	16.0					6																	123833498		1768	4001	5769	123875197	SO:0001583	missense	10345	exon7			U18985	CCDS59035.1, CCDS75511.1	6q22.31	2008-05-15			ENSG00000186439	ENSG00000186439			12261	protein-coding gene	gene with protein product		603283				7588753	Standard	NM_001251987		Approved		uc003pzj.2	Q13061	OTTHUMG00000015497	ENST00000398178.3:c.560A>C	6.37:g.123833498T>G	ENSP00000381240:p.Lys187Thr	Somatic		Capture	Illumina HiSeq	Phase_I	123875197	NM_006073	A5D6W5|F5H2W7|Q6NSB8	Missense_Mutation	SNP	ENST00000398178.3	37	CCDS55053.1	.	.	.	.	.	.	.	.	.	.	T	13.93	2.385271	0.42308	.	.	ENSG00000186439	ENST00000398178;ENST00000398161;ENST00000334268;ENST00000542014;ENST00000543022;ENST00000546248;ENST00000333613	T;T;T	0.45276	1.31;1.31;0.9	4.83	4.83	0.62350	Aspartyl beta-hydroxylase/Triadin domain (1);	0.198955	0.43260	D	0.000595	T	0.50854	0.1640	M	0.73962	2.25	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.75484	0.948;0.979;0.979;0.986	T	0.58532	-0.7620	10	0.72032	D	0.01	-10.2057	7.5693	0.27898	0.0:0.0971:0.0:0.9029	.	187;187;187;187	F5H2W7;Q5SWK9;Q8IVK2;Q13061	.;.;.;TRDN_HUMAN	T	187;187;187;187;187;187;92	ENSP00000381240:K187T;ENSP00000333984:K187T;ENSP00000439281:K187T	ENSP00000329278:K92T	K	-	2	0	TRDN	123875197	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.213000	0.42844	1.939000	0.56221	0.455000	0.32223	AAG		TRDN-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
RBAK	57786	broad.mit.edu	37	7	5097043	5097043	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr7:5097043G>C	ENST00000353796.3	+	4	457	c.133G>C	c.(133-135)Gtt>Ctt	p.V45L	RBAK-RBAKDN_ENST00000396904.2_Missense_Mutation_p.V45L|RBAK-RBAKDN_ENST00000407184.1_Missense_Mutation_p.V45L|RBAK_ENST00000396912.1_Missense_Mutation_p.V45L	NM_001204456.1	NP_001191385.1	Q9NYW8	RBAK_HUMAN	RB-associated KRAB zinc finger	45	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.V45L(1)		NS(1)|kidney(1)|large_intestine(2)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	10		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		TAGCCATCTAGTTTCTGTGGG	0.433																																					p.V45L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G133C	7						.						258.0	259.0	259.0					7																	5097043		2203	4300	6503	5063569	SO:0001583	missense	57786	exon3			AF226869	CCDS5337.1	7p22.1	2013-01-08			ENSG00000146587	ENSG00000146587		"""Zinc fingers, C2H2-type"", ""-"""	17680	protein-coding gene	gene with protein product		608191					Standard	NM_021163		Approved	ZNF769	uc003sns.1	Q9NYW8	OTTHUMG00000121155	ENST00000353796.3:c.133G>C	7.37:g.5097043G>C	ENSP00000275423:p.Val45Leu	Somatic		Capture	Illumina HiSeq	Phase_I	5063569	NM_021163	A6NDF2|A8KAK4|B2RN44|B9EGS1|F8W6M7	Missense_Mutation	SNP	ENST00000353796.3	37	CCDS5337.1	.	.	.	.	.	.	.	.	.	.	G	5.485	0.274520	0.10403	.	.	ENSG00000146587	ENST00000407184;ENST00000353796;ENST00000396904;ENST00000396912	T;T;T;T	0.48522	0.81;0.81;0.81;0.81	2.88	-0.785	0.10950	Krueppel-associated box (4);	1.025620	0.07831	N	0.961333	T	0.37865	0.1019	L	0.53729	1.69	0.27298	N	0.957662	B	0.09022	0.002	B	0.12156	0.007	T	0.34551	-0.9824	9	0.33940	T	0.23	.	3.6917	0.08348	0.2921:0.425:0.2829:0.0	.	45	Q9NYW8	RBAK_HUMAN	L	45	ENSP00000385560:V45L;ENSP00000275423:V45L;ENSP00000380112:V45L;ENSP00000380120:V45L	ENSP00000275423:V45L	V	+	1	0	RBAK	5063569	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.457000	0.06745	-0.156000	0.11079	-0.312000	0.09012	GTT		RBAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241640.2	NM_021163	
RNF216	54476	broad.mit.edu	37	7	5752451	5752451	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr7:5752451G>A	ENST00000425013.2	-	12	1930	c.1706C>T	c.(1705-1707)cCa>cTa	p.P569L	RNF216_ENST00000389902.3_Missense_Mutation_p.P626L	NM_207111.3|NM_207116.2	NP_996994.1|NP_996999.1	Q9NWF9	RN216_HUMAN	ring finger protein 216	569					apoptotic process (GO:0006915)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|regulation of defense response to virus by host (GO:0050691)|regulation of interferon-beta production (GO:0032648)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)		FBXL18/RNF216(2)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)|skin(1)|urinary_tract(4)	33		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)		CTCACTGGTTGGGAACGAACA	0.483																																					p.P569L												.	.	0			c.C1706T	7						.						48.0	45.0	46.0					7																	5752451		2203	4300	6503	5718977	SO:0001583	missense	54476	exon12			AY062174	CCDS34594.1, CCDS34595.1	7p22.1	2014-02-12	2007-08-20		ENSG00000011275	ENSG00000011275		"""RING-type (C3HC4) zinc fingers"""	21698	protein-coding gene	gene with protein product		609948					Standard	NM_207111		Approved	TRIAD3, UBCE7IP1, ZIN	uc003sox.2	Q9NWF9	OTTHUMG00000155500	ENST00000425013.2:c.1706C>T	7.37:g.5752451G>A	ENSP00000404602:p.Pro569Leu	None		Capture	Illumina HiSeq	Phase_I	5718977	NM_207116	Q6Y691|Q75ML7|Q7Z2H7|Q7Z7C1|Q8NHW7|Q9NYT1	Missense_Mutation	SNP	ENST00000425013.2	37	CCDS34595.1	.	.	.	.	.	.	.	.	.	.	G	33	5.223654	0.95139	.	.	ENSG00000011275	ENST00000425013;ENST00000389902;ENST00000458425	T;T	0.32515	1.45;1.45	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.56156	0.1966	M	0.72894	2.215	0.80722	D	1	B;D	0.57571	0.34;0.98	B;D	0.65874	0.241;0.939	T	0.54344	-0.8308	10	0.56958	D	0.05	-10.0331	19.0838	0.93194	0.0:0.0:1.0:0.0	.	569;626	Q9NWF9;Q9NWF9-1	RN216_HUMAN;.	L	569;626;381	ENSP00000404602:P569L;ENSP00000374552:P626L	ENSP00000374552:P626L	P	-	2	0	RNF216	5718977	1.000000	0.71417	0.996000	0.52242	0.991000	0.79684	8.845000	0.92153	2.746000	0.94184	0.650000	0.86243	CCA		RNF216-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000340374.1	NM_207111	
CCZ1	51622	broad.mit.edu	37	7	5959526	5959526	+	Silent	SNP	C	C	T	rs139249929	byFrequency	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr7:5959526C>T	ENST00000325974.6	+	12	1101	c.1035C>T	c.(1033-1035)atC>atT	p.I345I	CCZ1_ENST00000537980.1_Silent_p.I202I	NM_015622.5	NP_056437.4	P86791	CCZ1_HUMAN	CCZ1 vacuolar protein trafficking and biogenesis associated homolog (S. cerevisiae)	345						lysosome (GO:0005764)|membrane (GO:0016020)		p.I345I(1)		large_intestine(3)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	6						TGGACAGCATCGTTGGGCCCC	0.478													c|||	4	0.000798722	0.0	0.0	5008	,	,		22318	0.0		0.004	False		,,,				2504	0.0				p.I345I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1035T	7						.	C		2,4400	2.1+/-5.4	0,2,2199	69.0	60.0	63.0		1035	-5.5	0.8	7	dbSNP_134	63	8,8582	5.0+/-18.6	0,8,4287	no	coding-synonymous	CCZ1	NM_015622.5		0,10,6486	TT,TC,CC		0.0931,0.0454,0.077		345/483	5959526	10,12982	2201	4295	6496	5926052	SO:0001819	synonymous_variant	51622	exon12			AF151801	CCDS34597.1	7p22.1	2014-02-13	2010-06-29	2010-06-29	ENSG00000122674	ENSG00000122674			21691	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 28A"""	C7orf28A		10810093, 20305638	Standard	NM_015622		Approved	CGI-43, CCZ1A	uc003spf.3	P86791	OTTHUMG00000155502	ENST00000325974.6:c.1035C>T	7.37:g.5959526C>T		Somatic		Capture	Illumina HiSeq	Phase_I	5926052	NM_015622	A2RU45|O95766|Q9UG65|Q9Y359	Silent	SNP	ENST00000325974.6	37	CCDS34597.1																																																																																				CCZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340391.1	NM_015622	
DNAH11	8701	broad.mit.edu	37	7	21721232	21721232	+	Silent	SNP	C	C	T	rs368444771		TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr7:21721232C>T	ENST00000409508.3	+	31	5428	c.5397C>T	c.(5395-5397)atC>atT	p.I1799I	DNAH11_ENST00000328843.6_Silent_p.I1804I	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1804	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.I1804I(1)		NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						GACAGAAGATCATGACAATTT	0.368									Kartagener syndrome																												p.I1804I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C5412T	7						.						132.0	125.0	127.0					7																	21721232		1899	4136	6035	21687757	SO:0001819	synonymous_variant	8701	exon31	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.5397C>T	7.37:g.21721232C>T		Somatic		Capture	Illumina HiSeq	Phase_I	21687757	NM_003777	Q9UJ82	Silent	SNP	ENST00000409508.3	37																																																																																					DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777	
CD36	948	broad.mit.edu	37	7	80290501	80290501	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr7:80290501T>C	ENST00000435819.1	+	8	1088	c.404T>C	c.(403-405)tTc>tCc	p.F135S	CD36_ENST00000309881.7_Missense_Mutation_p.F135S|CD36_ENST00000394788.3_Missense_Mutation_p.F135S|CD36_ENST00000447544.2_Missense_Mutation_p.F135S|CD36_ENST00000544133.1_Missense_Mutation_p.F135S|CD36_ENST00000538969.1_Missense_Mutation_p.F135S|CD36_ENST00000432207.1_Missense_Mutation_p.F135S|CD36_ENST00000534394.1_Missense_Mutation_p.F59S|CD36_ENST00000433696.2_Missense_Mutation_p.F135S			P16671	CD36_HUMAN	CD36 molecule (thrombospondin receptor)	135					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic cell clearance (GO:0043277)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cellular lipid metabolic process (GO:0044255)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to hydroperoxide (GO:0071447)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cGMP-mediated signaling (GO:0019934)|cholesterol transport (GO:0030301)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response (GO:0045087)|lipid metabolic process (GO:0006629)|lipid storage (GO:0019915)|lipoprotein transport (GO:0042953)|long-chain fatty acid import (GO:0044539)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle mediated signaling (GO:0055096)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of transcription factor import into nucleus (GO:0042992)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nitric oxide mediated signal transduction (GO:0007263)|phagocytosis, recognition (GO:0006910)|plasma lipoprotein particle clearance (GO:0034381)|plasma membrane long-chain fatty acid transport (GO:0015911)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood microparticle formation (GO:2000334)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of removal of superoxide radicals (GO:2000121)|response to stilbenoid (GO:0035634)|small molecule metabolic process (GO:0044281)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cell surface (GO:0009986)|endocytic vesicle membrane (GO:0030666)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)	high-density lipoprotein particle binding (GO:0008035)|lipid binding (GO:0008289)|lipoprotein particle binding (GO:0071813)|lipoteichoic acid receptor activity (GO:0070892)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|thrombospondin receptor activity (GO:0070053)|transforming growth factor beta binding (GO:0050431)	p.F135S(3)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(10)|large_intestine(1)|lung(6)|ovary(1)	21						GCTGACAACTTCACAGTTCTC	0.408																																					p.F135S												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.T404C	7						.						115.0	96.0	102.0					7																	80290501		2203	4300	6503	80128437	SO:0001583	missense	948	exon4			Z32770	CCDS34673.1	7q11.2	2010-02-26	2006-03-28		ENSG00000135218	ENSG00000135218		"""CD molecules"""	1663	protein-coding gene	gene with protein product		173510	"""CD36 antigen (collagen type I receptor, thrombospondin receptor)"""			7503937	Standard	NM_001001548		Approved	SCARB3, GPIV, FAT, GP4, GP3B	uc003uhg.4	P16671	OTTHUMG00000155383	ENST00000435819.1:c.404T>C	7.37:g.80290501T>C	ENSP00000399421:p.Phe135Ser	Somatic		Capture	Illumina HiSeq	Phase_I	80128437	NM_001127443	D9IX66|D9IX67|D9IX68|D9IX69|Q13966|Q16093|Q8TCV7|Q9BPZ8|Q9BQC2|Q9BZM8|Q9BZN3|Q9BZN4|Q9BZN5	Missense_Mutation	SNP	ENST00000435819.1	37	CCDS34673.1	.	.	.	.	.	.	.	.	.	.	T	13.96	2.394252	0.42410	.	.	ENSG00000135218	ENST00000435819;ENST00000309881;ENST00000534394;ENST00000438020;ENST00000394788;ENST00000447544;ENST00000426978;ENST00000432207;ENST00000413265;ENST00000419819;ENST00000538969;ENST00000544133;ENST00000433696	T;T;T;T;T;T;T;T;T;T;T;T;T	0.72167	-0.63;-0.63;-0.63;-0.63;-0.63;-0.63;-0.63;-0.63;-0.63;-0.63;-0.63;-0.63;-0.63	5.36	4.14	0.48551	.	0.408685	0.28688	N	0.014469	T	0.70159	0.3192	M	0.73598	2.24	0.32835	D	0.504596	P	0.37594	0.601	B	0.42959	0.403	T	0.76626	-0.2890	9	.	.	.	-3.8306	6.717	0.23308	0.1506:0.0:0.1564:0.6931	.	135	P16671	CD36_HUMAN	S	135;135;59;135;135;135;135;135;135;135;135;135;135	ENSP00000399421:F135S;ENSP00000308165:F135S;ENSP00000431296:F59S;ENSP00000410371:F135S;ENSP00000378268:F135S;ENSP00000415743:F135S;ENSP00000416388:F135S;ENSP00000411411:F135S;ENSP00000407690:F135S;ENSP00000392298:F135S;ENSP00000439543:F135S;ENSP00000441956:F135S;ENSP00000401863:F135S	.	F	+	2	0	CD36	80128437	0.718000	0.27976	0.732000	0.30844	0.194000	0.23727	2.310000	0.43708	2.046000	0.60703	0.528000	0.53228	TTC		CD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339767.6	NM_001001547	
PON1	5444	broad.mit.edu	37	7	94940769	94940771	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	AGA	AGA	AGA	-	AGA	AGA	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr7:94940769_94940771delAGA	ENST00000222381.3	-	5	720_722	c.489_491delTCT	c.(487-492)cttctg>ctg	p.163_164LL>L	PON1_ENST00000542556.1_In_Frame_Del_p.163_164LL>L	NM_000446.5	NP_000437.3	P27169	PON1_HUMAN	paraoxonase 1	163					aromatic compound catabolic process (GO:0019439)|carboxylic acid catabolic process (GO:0046395)|dephosphorylation (GO:0016311)|organophosphate catabolic process (GO:0046434)|phosphatidylcholine metabolic process (GO:0046470)|positive regulation of binding (GO:0051099)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of transporter activity (GO:0032411)|response to external stimulus (GO:0009605)|response to toxic substance (GO:0009636)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|intracellular membrane-bounded organelle (GO:0043231)|spherical high-density lipoprotein particle (GO:0034366)	aryldialkylphosphatase activity (GO:0004063)|arylesterase activity (GO:0004064)|calcium ion binding (GO:0005509)|phospholipid binding (GO:0005543)|protein homodimerization activity (GO:0042803)	p.L164delL(1)		autonomic_ganglia(1)|endometrium(2)|large_intestine(6)|lung(11)|pancreas(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	27	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0031)		Cefazolin(DB01327)	GTACTTAGGCAGAAGTTTATGTC	0.379																																					p.163_164del	GBM(119;715 1622 17358 22490 33240)											.	.	1	Deletion - In frame(1)	large_intestine(1)	c.489_491del	7						.																																			94778707	SO:0001651	inframe_deletion	5444	exon5			AF539592	CCDS5638.1	7q21.3	2014-03-14			ENSG00000005421	ENSG00000005421	3.1.1.2	"""Paraoxonases"""	9204	protein-coding gene	gene with protein product	"""esterase A"", ""arylesterase 1"""	168820		PON		8661009, 15450851	Standard	NM_000446		Approved	ESA	uc003uns.3	P27169	OTTHUMG00000153894	ENST00000222381.3:c.489_491delTCT	7.37:g.94940769_94940771delAGA	ENSP00000222381:p.Leu164del	Somatic		Capture	Illumina HiSeq	Phase_I	94778705	NM_000446	B2RA40|Q16052|Q6B0J6|Q9UCB1	In_Frame_Del	DEL	ENST00000222381.3	37	CCDS5638.1																																																																																				PON1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000332865.2	NM_000446	
DENND2A	27147	broad.mit.edu	37	7	140219442	140219442	+	Silent	SNP	C	C	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr7:140219442C>T	ENST00000275884.6	-	18	3405	c.2988G>A	c.(2986-2988)ctG>ctA	p.L996L	DENND2A_ENST00000537639.1_Silent_p.L996L|DENND2A_ENST00000496613.1_Silent_p.L996L			Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	996					positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.L996L(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(22)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49	Melanoma(164;0.00956)					CTAGTCCCTTCAGGAACTTAT	0.592																																					p.L996L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2988A	7						.						92.0	94.0	94.0					7																	140219442		1930	4121	6051	139865911	SO:0001819	synonymous_variant	27147	exon17			AB033103	CCDS43659.1	7q34	2012-10-03	2005-08-17	2005-08-17	ENSG00000146966	ENSG00000146966		"""DENN/MADD domain containing"""	22212	protein-coding gene	gene with protein product			"""KIAA1277"""	KIAA1277			Standard	NM_015689		Approved	FAM31D	uc010lnj.3	Q9ULE3	OTTHUMG00000157411	ENST00000275884.6:c.2988G>A	7.37:g.140219442C>T		Somatic		Capture	Illumina HiSeq	Phase_I	139865911	NM_015689	C9JUI3|Q1RMD5|Q86XY0	Silent	SNP	ENST00000275884.6	37	CCDS43659.1																																																																																				DENND2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348742.1	NM_015689	
MYOM2	9172	broad.mit.edu	37	8	2026860	2026860	+	Silent	SNP	G	G	A	rs138301259	byFrequency	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr8:2026860G>A	ENST00000262113.4	+	12	1449	c.1308G>A	c.(1306-1308)ccG>ccA	p.P436P	MYOM2_ENST00000523438.1_Intron	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	436	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)	p.P436P(1)		autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		ATGATGCACCGGTGAAAATCT	0.448																																					p.P436P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1308A	8						.						118.0	131.0	127.0					8																	2026860		2203	4300	6503	2014267	SO:0001819	synonymous_variant	9172	exon12				CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.1308G>A	8.37:g.2026860G>A		Somatic		Capture	Illumina HiSeq	Phase_I	2014267	NM_003970	Q7Z3Y2	Silent	SNP	ENST00000262113.4	37	CCDS5957.1																																																																																				MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251249.1	NM_003970	
CRISPLD1	83690	broad.mit.edu	37	8	75898238	75898238	+	Missense_Mutation	SNP	C	C	T	rs541154941		TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr8:75898238C>T	ENST00000262207.4	+	2	484	c.16C>T	c.(16-18)Cgg>Tgg	p.R6W	CRISPLD1_ENST00000519798.1_3'UTR	NM_031461.5	NP_113649.1	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain containing 1	6					face morphogenesis (GO:0060325)	extracellular vesicular exosome (GO:0070062)		p.R6W(2)		biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			GTGTACCGCGCGGGAGTGGCT	0.458													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17314	0.0		0.0	False		,,,				2504	0.0				p.R6W												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C16T	8						.																																			76060793	SO:0001583	missense	83690	exon2			AL834301	CCDS6219.1, CCDS69497.1, CCDS75754.1	8q21.13	2005-09-23	2005-02-16	2005-02-16	ENSG00000121005	ENSG00000121005			18206	protein-coding gene	gene with protein product			"""LCCL domain containing cysteine-rich secretory protein 1"""	LCRISP1			Standard	NM_031461		Approved	Cocoacrisp, DKFZp762F133	uc003yan.3	Q9H336	OTTHUMG00000164529	ENST00000262207.4:c.16C>T	8.37:g.75898238C>T	ENSP00000262207:p.Arg6Trp	Somatic		Capture	Illumina HiSeq	Phase_I	76060793	NM_031461	B2RA60|B7Z929	Missense_Mutation	SNP	ENST00000262207.4	37	CCDS6219.1	.	.	.	.	.	.	.	.	.	.	C	11.58	1.679809	0.29783	.	.	ENSG00000121005	ENST00000262207;ENST00000520277	T;T	0.59364	0.27;1.92	5.37	1.2	0.21068	.	1.173110	0.05930	N	0.634973	T	0.42426	0.1202	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31916	-0.9926	10	0.52906	T	0.07	.	5.5043	0.16846	0.4128:0.4087:0.1124:0.066	.	6	Q9H336	CRLD1_HUMAN	W	6	ENSP00000262207:R6W;ENSP00000430504:R6W	ENSP00000262207:R6W	R	+	1	2	CRISPLD1	76060793	0.961000	0.32948	0.273000	0.24645	0.981000	0.71138	1.176000	0.31957	0.012000	0.14892	-0.309000	0.09137	CGG		CRISPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379117.1	NM_031461	
CNBD1	168975	broad.mit.edu	37	8	88296940	88296940	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr8:88296940T>G	ENST00000518476.1	+	7	857	c.806T>G	c.(805-807)gTt>gGt	p.V269G	CNBD1_ENST00000522427.1_3'UTR	NM_173538.2	NP_775809.1	Q8NA66	CNBD1_HUMAN	cyclic nucleotide binding domain containing 1	269								p.V269G(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(4)|urinary_tract(1)	32						ACTCTGGAAGTTATGCCTCAG	0.388																																					p.V269G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T806G	8						.						79.0	76.0	77.0					8																	88296940		1843	4083	5926	88366056	SO:0001583	missense	168975	exon7			AK093121	CCDS55259.1	8q21.3	2005-08-09				ENSG00000176571			26663	protein-coding gene	gene with protein product							Standard	NM_173538		Approved	FLJ35802	uc003ydy.2	Q8NA66		ENST00000518476.1:c.806T>G	8.37:g.88296940T>G	ENSP00000430073:p.Val269Gly	Somatic		Capture	Illumina HiSeq	Phase_I	88366056	NM_173538		Missense_Mutation	SNP	ENST00000518476.1	37	CCDS55259.1	.	.	.	.	.	.	.	.	.	.	T	12.02	1.811691	0.32053	.	.	ENSG00000176571	ENST00000518476	D	0.96885	-4.16	4.9	0.125	0.14718	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);	1.336110	0.05404	N	0.541259	D	0.93588	0.7953	L	0.46157	1.445	0.09310	N	1	P	0.38195	0.622	B	0.38803	0.282	D	0.85273	0.1057	10	0.24483	T	0.36	-0.8274	8.5257	0.33304	0.4415:0.0:0.0:0.5585	.	269	Q8NA66	CNBD1_HUMAN	G	269	ENSP00000430073:V269G	ENSP00000430073:V269G	V	+	2	0	CNBD1	88366056	0.000000	0.05858	0.003000	0.11579	0.006000	0.05464	-0.419000	0.07071	0.176000	0.19873	0.482000	0.46254	GTT		CNBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375113.2	NM_173538	
ADCY8	114	broad.mit.edu	37	8	131916032	131916032	+	Missense_Mutation	SNP	C	C	T	rs201550256		TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr8:131916032C>T	ENST00000286355.5	-	7	3989	c.1897G>A	c.(1897-1899)Gtg>Atg	p.V633M	ADCY8_ENST00000377928.3_Missense_Mutation_p.V633M	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	633					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)	p.V633M(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			TGTTTCCCCACGATATTATCA	0.498										HNSCC(32;0.087)			C|||	1	0.000199681	0.0	0.0	5008	,	,		18822	0.0		0.001	False		,,,				2504	0.0				p.V633M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1897A	8						.	C	MET/VAL	2,4404	4.2+/-10.8	0,2,2201	105.0	92.0	97.0		1897	6.1	1.0	8		97	1,8599	1.2+/-3.3	0,1,4299	yes	missense	ADCY8	NM_001115.2	21	0,3,6500	TT,TC,CC		0.0116,0.0454,0.0231	benign	633/1252	131916032	3,13003	2203	4300	6503	131985214	SO:0001583	missense	114	exon7			Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.1897G>A	8.37:g.131916032C>T	ENSP00000286355:p.Val633Met	Somatic		Capture	Illumina HiSeq	Phase_I	131985214	NM_001115		Missense_Mutation	SNP	ENST00000286355.5	37	CCDS6363.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	34	5.388564	0.95988	4.54E-4	1.16E-4	ENSG00000155897	ENST00000286355;ENST00000377928;ENST00000522949	T;T;T	0.80909	-1.05;-1.05;-1.43	6.08	6.08	0.98989	.	0.063541	0.64402	D	0.000004	D	0.84160	0.5411	N	0.22421	0.69	0.50171	D	0.99985	D;D	0.76494	0.999;0.999	D;D	0.81914	0.995;0.921	D	0.83371	0.0007	10	0.41790	T	0.15	.	19.6603	0.95864	0.0:1.0:0.0:0.0	.	633;633	E7EVL1;P40145	.;ADCY8_HUMAN	M	633;633;248	ENSP00000286355:V633M;ENSP00000367161:V633M;ENSP00000428010:V248M	ENSP00000286355:V633M	V	-	1	0	ADCY8	131985214	1.000000	0.71417	0.994000	0.49952	0.953000	0.61014	5.414000	0.66405	2.894000	0.99253	0.591000	0.81541	GTG		ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1		
MUSK	4593	broad.mit.edu	37	9	113563184	113563184	+	Silent	SNP	G	G	C			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr9:113563184G>C	ENST00000374448.4	+	15	2660	c.2526G>C	c.(2524-2526)ctG>ctC	p.L842L	MUSK_ENST00000416899.2_Silent_p.L834L|MUSK_ENST00000189978.5_Silent_p.L842L	NM_001166281.1|NM_005592.3	NP_001159753.1|NP_005583.1	O15146	MUSK_HUMAN	muscle, skeletal, receptor tyrosine kinase	842	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|memory (GO:0007613)|multicellular organismal development (GO:0007275)|neuromuscular junction development (GO:0007528)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein geranylgeranylation (GO:2000541)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.L842L(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(23)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	49						GGAGCAAGCTGCCTGCAGACA	0.517																																					p.L756L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2268C	9						.						46.0	44.0	44.0					9																	113563184		2040	4197	6237	112603005	SO:0001819	synonymous_variant	4593	exon13			AF006464	CCDS48005.1, CCDS75874.1	9q31.3-q32	2013-01-29			ENSG00000030304	ENSG00000030304		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7525	protein-coding gene	gene with protein product		601296				7546737	Standard	NM_005592		Approved		uc022blv.1	O15146	OTTHUMG00000020485	ENST00000374448.4:c.2526G>C	9.37:g.113563184G>C		Somatic		Capture	Illumina HiSeq	Phase_I	112603005	NM_001166280	Q32MJ8|Q32MJ9|Q5VZW7|Q5VZW8	Silent	SNP	ENST00000374448.4	37	CCDS48005.1																																																																																				MUSK-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
CRAT	1384	broad.mit.edu	37	9	131862957	131862957	+	Missense_Mutation	SNP	G	G	A	rs141122671		TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr9:131862957G>A	ENST00000318080.2	-	7	1111	c.817C>T	c.(817-819)Cgg>Tgg	p.R273W	CRAT_ENST00000464290.1_5'Flank|RP11-247A12.1_ENST00000434250.1_RNA	NM_000755.3|NM_001257363.1	NP_000746|NP_001244292.1	P43155	CACP_HUMAN	carnitine O-acetyltransferase	273					carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carnitine O-acetyltransferase activity (GO:0004092)|receptor binding (GO:0005102)	p.R273W(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|skin(1)|urinary_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)	L-Carnitine(DB00583)	ACGGAATCCCGGTTCACCTTG	0.627													G|||	1	0.000199681	0.0	0.0	5008	,	,		19465	0.0		0.001	False		,,,				2504	0.0				p.R273W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C817T	9						.	G	TRP/ARG	3,4401	6.2+/-15.9	0,3,2199	107.0	72.0	84.0		817	1.9	1.0	9	dbSNP_134	84	5,8595	4.3+/-15.6	0,5,4295	yes	missense	CRAT	NM_000755.3	101	0,8,6494	AA,AG,GG		0.0581,0.0681,0.0615	probably-damaging	273/627	131862957	8,12996	2202	4300	6502	130902778	SO:0001583	missense	1384	exon7			X78706	CCDS6919.1	9q34.1	2010-04-27	2010-04-27		ENSG00000095321	ENSG00000095321	2.3.1.7		2342	protein-coding gene	gene with protein product		600184	"""carnitine acetyltransferase"""			7829107	Standard	NM_000755		Approved	CAT1	uc004bxh.3	P43155	OTTHUMG00000147343	ENST00000318080.2:c.817C>T	9.37:g.131862957G>A	ENSP00000315013:p.Arg273Trp	Somatic		Capture	Illumina HiSeq	Phase_I	130902778	NM_000755	Q5T952|Q9BW16	Missense_Mutation	SNP	ENST00000318080.2	37	CCDS6919.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	17.15	3.317165	0.60524	6.81E-4	5.81E-4	ENSG00000095321	ENST00000351352;ENST00000318080	D	0.89270	-2.49	5.01	1.89	0.25635	.	0.055265	0.64402	D	0.000001	D	0.92084	0.7491	M	0.66560	2.04	0.80722	D	1	D	0.71674	0.998	D	0.64687	0.928	D	0.91991	0.5603	10	0.87932	D	0	-32.1735	12.4051	0.55434	0.0:0.0:0.3565:0.6435	.	273	P43155	CACP_HUMAN	W	273	ENSP00000315013:R273W	ENSP00000315013:R273W	R	-	1	2	CRAT	130902778	1.000000	0.71417	1.000000	0.80357	0.691000	0.40173	3.722000	0.54948	0.683000	0.31428	-0.277000	0.10078	CGG		CRAT-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253700.1		
RXRA	6256	broad.mit.edu	37	9	137328442	137328442	+	Silent	SNP	G	G	T	rs1805348	byFrequency	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chr9:137328442G>T	ENST00000481739.1	+	10	1423	c.1371G>T	c.(1369-1371)gcG>gcT	p.A457A	RXRA_ENST00000540193.1_Silent_p.A360A|RXRA_ENST00000356384.4_3'UTR	NM_002957.4	NP_002948.1	P19793	RXRA_HUMAN	retinoid X receptor, alpha	457	Ligand-binding.				camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|cellular lipid metabolic process (GO:0044255)|cholesterol metabolic process (GO:0008203)|embryo implantation (GO:0007566)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|maternal placenta development (GO:0001893)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|response to retinoic acid (GO:0032526)|retinoic acid receptor signaling pathway (GO:0048384)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|vitamin metabolic process (GO:0006766)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	9-cis retinoic acid receptor activity (GO:0004886)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein heterodimerization activity (GO:0046982)|retinoic acid receptor activity (GO:0003708)|retinoic acid-responsive element binding (GO:0044323)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|vitamin D receptor binding (GO:0042809)|zinc ion binding (GO:0008270)	p.A457A(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19				OV - Ovarian serous cystadenocarcinoma(145;4.66e-08)|Epithelial(140;6.72e-08)|all cancers(34;2.22e-07)	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Etodolac(DB00749)	TGCTGGAGGCGCCGCACCAAA	0.592																																					p.A457A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1371T	9						.						95.0	85.0	88.0					9																	137328442		2203	4300	6503	136468263	SO:0001819	synonymous_variant	6256	exon10			X52773	CCDS35172.1	9q34	2013-01-16			ENSG00000186350	ENSG00000186350		"""Nuclear hormone receptors"""	10477	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 1"""	180245				2159111	Standard	XM_005263409		Approved	NR2B1	uc004cfa.1	P19793	OTTHUMG00000020887	ENST00000481739.1:c.1371G>T	9.37:g.137328442G>T		Somatic		Capture	Illumina HiSeq	Phase_I	136468263	NM_002957	B3KY83|Q2NL52|Q2V504	Silent	SNP	ENST00000481739.1	37	CCDS35172.1																																																																																				RXRA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054949.1	NM_002957	
HS6ST2	90161	broad.mit.edu	37	X	132091133	132091133	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chrX:132091133C>T	ENST00000370836.2	-	3	1065	c.650G>A	c.(649-651)cGc>cAc	p.R217H	HS6ST2_ENST00000521489.1_Missense_Mutation_p.R217H|HS6ST2_ENST00000370833.2_Missense_Mutation_p.R71H	NM_147175.3	NP_671704.3	Q96MM7	H6ST2_HUMAN	heparan sulfate 6-O-sulfotransferase 2	217					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)	p.R71H(1)		central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(2)	9	Acute lymphoblastic leukemia(192;0.000127)					GTCTACCTTGCGCAGGAGGTC	0.632																																					p.R217H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G650A	X						.						32.0	37.0	36.0					X																	132091133		2145	4236	6381	131918815	SO:0001583	missense	90161	exon3			AB067776	CCDS48169.1, CCDS48170.1	Xq26.2	2008-02-05			ENSG00000171004	ENSG00000171004		"""Sulfotransferases, membrane-bound"""	19133	protein-coding gene	gene with protein product		300545				10644753	Standard	NM_147175		Approved		uc011mvd.1	Q96MM7	OTTHUMG00000022430	ENST00000370836.2:c.650G>A	X.37:g.132091133C>T	ENSP00000359873:p.Arg217His	Somatic		Capture	Illumina HiSeq	Phase_I	131918815	NM_001077188	B9WRT4|B9WRT5|E9PDY5|Q2TB13|Q4VC07|Q6PIC4|Q86SM9|Q8N3T4|Q8NBN4|Q96SJ4	Missense_Mutation	SNP	ENST00000370836.2	37	CCDS48169.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.184454	0.78677	.	.	ENSG00000171004	ENST00000370837;ENST00000370836;ENST00000521489;ENST00000370833;ENST00000319809	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.52773	0.1755	L	0.27053	0.805	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.959;0.994	T	0.57636	-0.7777	10	0.72032	D	0.01	-7.0983	16.5431	0.84407	0.0:1.0:0.0:0.0	.	217;217	Q96MM7;E9PDY5	H6ST2_HUMAN;.	H	71;217;217;71;58	ENSP00000359874:R71H;ENSP00000359873:R217H;ENSP00000429473:R217H;ENSP00000359870:R71H	ENSP00000324617:R58H	R	-	2	0	HS6ST2	131918815	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.638000	0.67861	2.212000	0.71576	0.529000	0.55759	CGC		HS6ST2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058332.3	NM_147174	
NLGN4X	57502	broad.mit.edu	37	X	5827154	5827154	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chrX:5827154A>T	ENST00000381095.3	-	4	1379	c.752T>A	c.(751-753)tTt>tAt	p.F251Y	NLGN4X_ENST00000275857.6_Missense_Mutation_p.F251Y|NLGN4X_ENST00000538097.1_Missense_Mutation_p.F251Y|NLGN4X_ENST00000381092.1_Missense_Mutation_p.F251Y|NLGN4X_ENST00000381093.2_Missense_Mutation_p.F271Y	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	251					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)	p.F251Y(1)		breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						CCCCGAGCCAAAGATGGTCAC	0.582																																					p.F251Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T752A	X						.						71.0	66.0	68.0					X																	5827154		2203	4300	6503	5837154	SO:0001583	missense	57502	exon4			AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.752T>A	X.37:g.5827154A>T	ENSP00000370485:p.Phe251Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	5837154	NM_020742	Q6UX10|Q9ULG0	Missense_Mutation	SNP	ENST00000381095.3	37	CCDS14126.1	.	.	.	.	.	.	.	.	.	.	A	19.30	3.800928	0.70567	.	.	ENSG00000146938	ENST00000381095;ENST00000381093;ENST00000275857;ENST00000381092;ENST00000538097	T;T;T;T;T	0.73152	-0.72;-0.72;-0.72;-0.72;-0.72	3.48	3.48	0.39840	Carboxylesterase, type B (1);	.	.	.	.	D	0.86435	0.5932	M	0.93241	3.395	0.50813	D	0.999899	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.998	D	0.88527	0.3100	9	0.87932	D	0	.	10.9666	0.47416	1.0:0.0:0.0:0.0	.	308;251;271	A6NMU8;Q8N0W4;Q8N0W4-2	.;NLGNX_HUMAN;.	Y	251;271;251;251;251	ENSP00000370485:F251Y;ENSP00000370483:F271Y;ENSP00000275857:F251Y;ENSP00000370482:F251Y;ENSP00000439203:F251Y	ENSP00000275857:F251Y	F	-	2	0	NLGN4X	5837154	1.000000	0.71417	0.980000	0.43619	0.509000	0.34042	7.907000	0.87430	1.222000	0.43521	0.486000	0.48141	TTT		NLGN4X-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055673.1	NM_020742	
FAM47A	158724	broad.mit.edu	37	X	34148353	34148353	+	Silent	SNP	C	C	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chrX:34148353C>T	ENST00000346193.3	-	1	2094	c.2043G>A	c.(2041-2043)acG>acA	p.T681T		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	681								p.T681T(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						AATTCGATGGCGTGTGGAATT	0.443																																					p.T681T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2043A	X						.						83.0	81.0	82.0					X																	34148353		2201	4300	6501	34058274	SO:0001819	synonymous_variant	158724	exon1			BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.2043G>A	X.37:g.34148353C>T		Somatic		Capture	Illumina HiSeq	Phase_I	34058274	NM_203408	A8K8I9|Q8TAA0	Silent	SNP	ENST00000346193.3	37	CCDS43926.1																																																																																				FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408	
ZNF41	7592	broad.mit.edu	37	X	47307754	47307754	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chrX:47307754C>T	ENST00000377065.4	-	5	2054	c.1415G>A	c.(1414-1416)tGt>tAt	p.C472Y	ZNF41_ENST00000313116.7_Missense_Mutation_p.C472Y|ZNF41_ENST00000465311.1_5'Flank|ZNF41_ENST00000397050.2_Missense_Mutation_p.C482Y	NM_153380.2	NP_700359.1	P51814	ZNF41_HUMAN	zinc finger protein 41	514					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.C472Y(1)		breast(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|upper_aerodigestive_tract(2)	24		all_lung(315;0.000129)				GGATTTCCCACAGTCACTGCA	0.423																																					p.C472Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1415A	X						.						94.0	86.0	88.0					X																	47307754		2203	4300	6503	47192698	SO:0001583	missense	7592	exon5			X60155	CCDS14279.1	Xp11.23	2013-01-08			ENSG00000147124	ENSG00000147124		"""Zinc fingers, C2H2-type"", ""-"""	13107	protein-coding gene	gene with protein product		314995				2037297	Standard	NM_007130		Approved	MGC8941, MRX89	uc004dhy.4	P51814	OTTHUMG00000021448	ENST00000377065.4:c.1415G>A	X.37:g.47307754C>T	ENSP00000366265:p.Cys472Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	47192698	NM_153380	A8K1V6|B4DH01|Q96LE8|Q9UMC4|Q9UMV5|Q9UMV6|Q9UMV7|Q9UMV8|Q9UMV9|Q9UMW0|Q9UMW1	Missense_Mutation	SNP	ENST00000377065.4	37	CCDS14279.1	.	.	.	.	.	.	.	.	.	.	C	12.23	1.876921	0.33162	.	.	ENSG00000147124	ENST00000313116;ENST00000377065;ENST00000397050	D;D;D	0.85861	-2.04;-2.04;-2.04	3.98	3.11	0.35812	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.206543	0.24654	N	0.036699	D	0.93471	0.7917	H	0.95745	3.715	0.30389	N	0.781209	B;B;D;P;P	0.89917	0.334;0.334;1.0;0.563;0.617	B;B;D;B;B	0.91635	0.126;0.126;0.999;0.176;0.269	D	0.89880	0.4029	10	0.87932	D	0	.	8.6233	0.33875	0.0:0.8822:0.0:0.1178	.	472;474;482;506;514	P51814-6;P51814-2;P51814-3;P51814-5;P51814	.;.;.;.;ZNF41_HUMAN	Y	472;472;482	ENSP00000315173:C472Y;ENSP00000366265:C472Y;ENSP00000380243:C482Y	ENSP00000315173:C472Y	C	-	2	0	ZNF41	47192698	1.000000	0.71417	0.004000	0.12327	0.311000	0.27955	5.162000	0.64942	1.043000	0.40175	0.600000	0.82982	TGT		ZNF41-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056429.1	NM_153380	
CFP	5199	broad.mit.edu	37	X	47487606	47487606	+	Missense_Mutation	SNP	G	G	A	rs132630259		TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chrX:47487606G>A	ENST00000396992.3	-	3	418	c.298C>T	c.(298-300)Cgg>Tgg	p.R100W	CFP_ENST00000247153.3_Missense_Mutation_p.R100W|CFP_ENST00000377005.2_Missense_Mutation_p.R100W|CFP_ENST00000480317.1_5'UTR	NM_001145252.1	NP_001138724.1	P27918	PROP_HUMAN	complement factor properdin	100	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.		R -> W (in PFD; type II). {ECO:0000269|PubMed:8530058}.		complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)		p.R100W(1)		breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	18						CGCCGGTACCGCAGCTGGGAG	0.647																																					p.R100W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C298T	X	GRCh37	CM950925	CFP	M	rs132630259	.						47.0	40.0	42.0					X																	47487606		2203	4300	6503	47372550	SO:0001583	missense	5199	exon4			M83652	CCDS14282.1	Xp11.4	2014-09-17	2006-03-02	2006-03-02	ENSG00000126759	ENSG00000126759		"""Complement system"""	8864	protein-coding gene	gene with protein product		300383	"""properdin P factor, complement"""	PFC		1783405	Standard	NM_001145252		Approved		uc004dih.3	P27918	OTTHUMG00000021451	ENST00000396992.3:c.298C>T	X.37:g.47487606G>A	ENSP00000380189:p.Arg100Trp	Somatic		Capture	Illumina HiSeq	Phase_I	47372550	NM_002621	O15134|O15135|O15136|O75826	Missense_Mutation	SNP	ENST00000396992.3	37	CCDS14282.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.949932	0.73787	.	.	ENSG00000126759	ENST00000396992;ENST00000247153;ENST00000377005	T;T;T	0.80909	-1.43;-1.43;-1.43	5.97	4.14	0.48551	.	0.000000	0.85682	D	0.000000	D	0.93530	0.7935	H	0.99143	4.445	0.53688	D	0.999974	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93444	0.6796	10	0.87932	D	0	.	10.7015	0.45931	0.0:0.0:0.6534:0.3466	.	36;100	B3KVK6;P27918	.;PROP_HUMAN	W	100	ENSP00000380189:R100W;ENSP00000247153:R100W;ENSP00000366204:R100W	ENSP00000247153:R100W	R	-	1	2	CFP	47372550	1.000000	0.71417	0.999000	0.59377	0.841000	0.47740	1.105000	0.31086	0.588000	0.29660	0.600000	0.82982	CGG		CFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056435.2	NM_002621	
AMER1	139285	broad.mit.edu	37	X	63412110	63412110	+	Nonsense_Mutation	SNP	G	G	A	rs137852216		TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chrX:63412110G>A	ENST00000330258.3	-	2	1329	c.1057C>T	c.(1057-1059)Cga>Tga	p.R353*	AMER1_ENST00000374869.3_Nonsense_Mutation_p.R353*|AMER1_ENST00000403336.1_Nonsense_Mutation_p.R353*	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	353					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)|p.R353*(6)									GTCCCATCTCGGTTTGCTCTC	0.522																																					p.R353X												.	.	73	Whole gene deletion(67)|Substitution - Nonsense(6)	kidney(69)|large_intestine(3)|ovary(1)	c.C1057T	X	GRCh37	CM090021	FAM123B	M	rs137852216	.						155.0	137.0	143.0					X																	63412110		2203	4300	6503	63328835	SO:0001587	stop_gained	139285	exon2			AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.1057C>T	X.37:g.63412110G>A	ENSP00000329117:p.Arg353*	Somatic		Capture	Illumina HiSeq	Phase_I	63328835	NM_152424	A2IB86|Q8N885	Nonsense_Mutation	SNP	ENST00000330258.3	37	CCDS14377.2	.	.	.	.	.	.	.	.	.	.	G	39	7.320143	0.98210	.	.	ENSG00000184675	ENST00000374869;ENST00000330258;ENST00000403336	.	.	.	5.18	2.27	0.28462	.	0.134606	0.49305	D	0.000153	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.3649	9.2932	0.37800	0.0:0.1375:0.572:0.2905	.	.	.	.	X	353	.	ENSP00000329117:R353X	R	-	1	2	FAM123B	63328835	1.000000	0.71417	0.986000	0.45419	0.990000	0.78478	0.950000	0.29122	0.228000	0.21019	0.529000	0.55759	CGA		AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424	
FAM46D	169966	broad.mit.edu	37	X	79699159	79699159	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chrX:79699159T>C	ENST00000308293.5	+	3	1360	c.1121T>C	c.(1120-1122)tTc>tCc	p.F374S	FAM46D_ENST00000538312.1_Missense_Mutation_p.F374S	NM_152630.4	NP_689843.1	Q8NEK8	FA46D_HUMAN	family with sequence similarity 46, member D	374										kidney(1)|large_intestine(6)|liver(3)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23						CCCGTTAGCTTCCAGCCATAC	0.403																																					p.F374S												.	.	0			c.T1121C	X						.						39.0	38.0	38.0					X																	79699159		2203	4298	6501	79585815	SO:0001583	missense	169966	exon5			BX537938	CCDS14446.1	Xq21.1	2009-08-18			ENSG00000174016	ENSG00000174016			28399	protein-coding gene	gene with protein product	"""cancer/testis antigen 112"""					12477932	Standard	NM_152630		Approved	MGC26999, CT1.26, CT112	uc004edl.1	Q8NEK8	OTTHUMG00000021902	ENST00000308293.5:c.1121T>C	X.37:g.79699159T>C	ENSP00000308575:p.Phe374Ser	None		Capture	Illumina HiSeq	Phase_I	79585815	NM_001170574	B2R9Q6|Q7Z3F6|Q8NHU1	Missense_Mutation	SNP	ENST00000308293.5	37	CCDS14446.1	.	.	.	.	.	.	.	.	.	.	T	0.280	-0.986889	0.02180	.	.	ENSG00000174016	ENST00000538312;ENST00000308293	T;T	0.21031	2.03;2.03	4.93	3.61	0.41365	.	0.967687	0.08459	U	0.942673	T	0.18635	0.0447	L	0.51422	1.61	0.09310	N	1	P	0.42827	0.791	B	0.37650	0.255	T	0.09885	-1.0654	10	0.21540	T	0.41	-3.861	7.9041	0.29752	0.3139:0.0:0.0:0.6861	.	374	Q8NEK8	FA46D_HUMAN	S	374	ENSP00000443410:F374S;ENSP00000308575:F374S	ENSP00000308575:F374S	F	+	2	0	FAM46D	79585815	1.000000	0.71417	0.044000	0.18714	0.008000	0.06430	2.388000	0.44398	1.624000	0.50355	0.481000	0.45027	TTC		FAM46D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057338.1	NM_152630	
GPR101	83550	broad.mit.edu	37	X	136113329	136113329	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chrX:136113329C>T	ENST00000298110.1	-	1	504	c.505G>A	c.(505-507)Ggc>Agc	p.G169S		NM_054021.1	NP_473362.1	Q96P66	GP101_HUMAN	G protein-coupled receptor 101	169						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)	p.G169S(1)		autonomic_ganglia(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(18)|ovary(3)|skin(1)|urinary_tract(1)	42	Acute lymphoblastic leukemia(192;0.000127)					TGGCCCCAGCCGTAGAGTGGA	0.607																																					p.G169S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G505A	X						.						44.0	38.0	40.0					X																	136113329		2203	4300	6503	135940995	SO:0001583	missense	83550	exon1			AF411115	CCDS14662.1	Xq26.3	2014-01-30			ENSG00000165370	ENSG00000165370		"""GPCR / Class A : Orphans"""	14963	protein-coding gene	gene with protein product		300393				11574155	Standard	NM_054021		Approved		uc011mwh.2	Q96P66	OTTHUMG00000022521	ENST00000298110.1:c.505G>A	X.37:g.136113329C>T	ENSP00000298110:p.Gly169Ser	Somatic		Capture	Illumina HiSeq	Phase_I	135940995	NM_054021	Q5JSM8|Q8NG93	Missense_Mutation	SNP	ENST00000298110.1	37	CCDS14662.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.610362	0.87258	.	.	ENSG00000165370	ENST00000298110	T	0.73363	-0.74	5.04	5.04	0.67666	GPCR, rhodopsin-like superfamily (1);	0.000000	0.34411	N	0.003998	T	0.81206	0.4774	L	0.52573	1.65	0.58432	D	0.999996	D	0.89917	1.0	D	0.91635	0.999	T	0.77297	-0.2640	10	0.18710	T	0.47	-25.9529	14.8213	0.70074	0.0:1.0:0.0:0.0	.	169	Q96P66	GP101_HUMAN	S	169	ENSP00000298110:G169S	ENSP00000298110:G169S	G	-	1	0	GPR101	135940995	1.000000	0.71417	0.998000	0.56505	0.978000	0.69477	4.771000	0.62318	2.081000	0.62600	0.600000	0.82982	GGC		GPR101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058519.1		
USP9Y	8287	broad.mit.edu	37	Y	14924968	14924968	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-3939-01A-01W-0995-10	TCGA-AA-3939-10A-01W-0995-10	g.chrY:14924968C>G	ENST00000338981.3	+	31	5535	c.4590C>G	c.(4588-4590)taC>taG	p.Y1530*	USP9Y_ENST00000426564.2_3'UTR	NM_004654.3	NP_004645.2	O00507	USP9Y_HUMAN	ubiquitin specific peptidase 9, Y-linked	1530					BMP signaling pathway (GO:0030509)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)	co-SMAD binding (GO:0070410)|cysteine-type peptidase activity (GO:0008234)|ubiquitin-specific protease activity (GO:0004843)	p.Y1530*(1)		kidney(1)|large_intestine(8)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						AAATGTATTACATGGGCACAG	0.323																																					p.Y1530X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C4590G	Y						.						49.0	45.0	46.0					Y																	14924968		596	1925	2521	13434362	SO:0001587	stop_gained	8287	exon31			Y13618	CCDS14781.1	Yq11.2	2010-04-09	2009-03-17		ENSG00000114374	ENSG00000114374		"""Ubiquitin-specific peptidases"""	12633	protein-coding gene	gene with protein product	"""fat facets-like homolog (Drosophila)"""	400005	"""ubiquitin specific peptidase 9, Y-linked (fat facets-like, Drosophila)"""			8922996, 9384609, 19246359	Standard	NM_004654		Approved	DFFRY	uc004fst.1	O00507	OTTHUMG00000036469	ENST00000338981.3:c.4590C>G	Y.37:g.14924968C>G	ENSP00000342812:p.Tyr1530*	Somatic		Capture	Illumina HiSeq	Phase_I	13434362	NM_004654	O14601	Nonsense_Mutation	SNP	ENST00000338981.3	37	CCDS14781.1																																																																																				USP9Y-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088703.2	NM_004654	
