#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SESN3	143686	hgsc.bcm.edu	37	11	94923113	94923114	+	Frame_Shift_Ins	INS	-	-	TCTA			TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	-	-	-	TCTA	-	-	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr11:94923113_94923114insTCTA	ENST00000536441.1	-	4	690_691	c.354_355insTAGA	c.(352-357)agacatfs	p.H119fs	RP11-712B9.2_ENST00000534864.1_RNA|SESN3_ENST00000393234.1_Frame_Shift_Ins_p.H119fs|RP11-712B9.2_ENST00000534891.1_RNA|SESN3_ENST00000278499.2_Intron|SESN3_ENST00000537480.1_5'Flank|SESN3_ENST00000416495.2_Frame_Shift_Ins_p.H119fs	NM_001271594.1|NM_144665.2	NP_001258523.1|NP_653266.2	P58005	SESN3_HUMAN	sestrin 3	119					glucose homeostasis (GO:0042593)|regulation of protein kinase B signaling (GO:0051896)|regulation of response to reactive oxygen species (GO:1901031)|response to insulin (GO:0032868)	nucleus (GO:0005634)		p.H119fs*1(1)		endometrium(5)|large_intestine(6)|lung(3)|skin(1)|stomach(1)	16		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)		BRCA - Breast invasive adenocarcinoma(274;0.234)		GAACACTGATGTCTAGCTGCAG	0.342																																					p.H119_Q120delinsX												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.355_356insTAGA	11						.																																			94562762	SO:0001589	frameshift_variant	143686	exon4			AK096300	CCDS8303.1, CCDS60938.1	11q21	2005-09-18			ENSG00000149212	ENSG00000149212			23060	protein-coding gene	gene with protein product		607768				12607115	Standard	NM_144665		Approved	SEST3, MGC29667	uc001pfj.4	P58005	OTTHUMG00000167829	ENST00000536441.1:c.351_354dupTAGA	11.37:g.94923114_94923117dupTCTA	ENSP00000441927:p.His119fs	Somatic		Capture	SOLID	Phase_I	94562761	NM_144665	B7Z7P9|Q96AD1	Frame_Shift_Ins	INS	ENST00000536441.1	37	CCDS8303.1																																																																																				SESN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396475.3	NM_144665	
CUX1	1523	hgsc.bcm.edu	37	7	101926061	101926061	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr7:101926061G>A	ENST00000437600.4	+	22	2306	c.1954G>A	c.(1954-1956)Gcc>Acc	p.A652T	CUX1_ENST00000292538.4_Missense_Mutation_p.A654T|CUX1_ENST00000547394.2_Missense_Mutation_p.A638T|CUX1_ENST00000560541.1_3'UTR|SH2B2_ENST00000536178.1_5'Flank|CUX1_ENST00000425244.2_Missense_Mutation_p.A608T|CUX1_ENST00000393824.3_Missense_Mutation_p.A615T	NM_181500.2	NP_852477.1	P39880	CUX1_HUMAN	cut-like homeobox 1	0					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)	p.A654T(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						CACCTTCTGCGCCAAGAAGTG	0.662																																					p.A652T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1954A	7						.						57.0	52.0	54.0					7																	101926061		2203	4300	6503	101712781	SO:0001583	missense	1523	exon22			M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000437600.4:c.1954G>A	7.37:g.101926061G>A	ENSP00000414091:p.Ala652Thr	Somatic		Capture	SOLID	Phase_I	101712781	NM_181500	B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Missense_Mutation	SNP	ENST00000437600.4	37	CCDS47672.1	.	.	.	.	.	.	.	.	.	.	G	19.34	3.809302	0.70797	.	.	ENSG00000257923	ENST00000292538;ENST00000547394;ENST00000425244;ENST00000437600	T;T;T;T	0.31247	1.5;1.5;1.51;1.5	3.67	3.67	0.42095	.	.	.	.	.	T	0.38904	0.1058	L	0.27053	0.805	0.35579	D	0.806114	D;D;D;D;D	0.89917	1.0;1.0;0.99;1.0;0.992	D;D;P;D;P	0.77557	0.965;0.99;0.661;0.977;0.565	T	0.39313	-0.9620	9	0.22109	T	0.4	.	13.6226	0.62146	0.0:0.0:1.0:0.0	.	615;608;638;652;654	B4DZZ2;B3KV79;G3V1Z6;Q13948-2;Q13948	.;.;.;.;CASP_HUMAN	T	654;638;608;652	ENSP00000292538:A654T;ENSP00000449371:A638T;ENSP00000409745:A608T;ENSP00000414091:A652T	ENSP00000292538:A654T	A	+	1	0	CUX1	101712781	1.000000	0.71417	0.999000	0.59377	0.878000	0.50629	8.658000	0.91110	1.803000	0.52742	0.550000	0.68814	GCC		CUX1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347534.3	NM_001913	
FBXL13	222235	hgsc.bcm.edu	37	7	102566812	102566812	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr7:102566812T>C	ENST00000313221.4	-	10	1213	c.787A>G	c.(787-789)Atg>Gtg	p.M263V	FBXL13_ENST00000455112.2_Missense_Mutation_p.M263V|LRRC17_ENST00000249377.4_Intron|LRRC17_ENST00000339431.4_Intron|FBXL13_ENST00000436908.1_Missense_Mutation_p.M263V|FBXL13_ENST00000379308.3_Missense_Mutation_p.M263V|FBXL13_ENST00000379306.3_Missense_Mutation_p.M263V|FBXL13_ENST00000456695.1_Missense_Mutation_p.M263V|FBXL13_ENST00000379305.3_Missense_Mutation_p.M263V|FBXL13_ENST00000393772.2_Missense_Mutation_p.M263V	NM_145032.3	NP_659469.3	Q8NEE6	FXL13_HUMAN	F-box and leucine-rich repeat protein 13	263								p.M263V(1)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|skin(3)|stomach(1)	27						ATGTGTCTCATTGATTCATCC	0.453																																					p.M263V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A787G	7						.						55.0	52.0	53.0					7																	102566812		2203	4300	6503	102354048	SO:0001583	missense	222235	exon10			BC031285	CCDS5726.1, CCDS47678.1, CCDS75649.1	7q22.1	2014-07-18			ENSG00000161040	ENSG00000161040		"""F-boxes / Leucine-rich repeats"""	21658	protein-coding gene	gene with protein product		609080					Standard	NM_145032		Approved	MGC21636, Fbl13	uc003vaq.2	Q8NEE6	OTTHUMG00000157224	ENST00000313221.4:c.787A>G	7.37:g.102566812T>C	ENSP00000321927:p.Met263Val	Somatic		Capture	SOLID	Phase_I	102354048	NM_001111038	C9J565|C9J566|Q6UVW7|Q6UVW8|Q75MN5|Q86UJ5|Q8N7Y4|Q8TCL2|Q8WUF9|Q8WUG0	Missense_Mutation	SNP	ENST00000313221.4	37	CCDS5726.1	.	.	.	.	.	.	.	.	.	.	T	14.22	2.469413	0.43839	.	.	ENSG00000161040	ENST00000393772;ENST00000379308;ENST00000379306;ENST00000379305;ENST00000436908;ENST00000313221;ENST00000456695;ENST00000455112	T;T;T;T;T;T;T;T	0.15718	4.88;4.88;2.4;4.88;4.88;4.88;2.4;4.88	5.42	5.42	0.78866	.	0.116303	0.64402	D	0.000017	T	0.14570	0.0352	N	0.13352	0.335	0.80722	D	1	B;P;P;B	0.40230	0.207;0.532;0.708;0.437	B;B;B;P	0.44447	0.122;0.175;0.383;0.45	T	0.09378	-1.0677	10	0.39692	T	0.17	.	13.983	0.64317	0.0:0.0:0.0:1.0	.	263;263;263;263	Q8NEE6-3;Q8NEE6-4;Q8NEE6-2;Q8NEE6	.;.;.;FXL13_HUMAN	V	263	ENSP00000377367:M263V;ENSP00000368610:M263V;ENSP00000368608:M263V;ENSP00000368607:M263V;ENSP00000388608:M263V;ENSP00000321927:M263V;ENSP00000409716:M263V;ENSP00000391550:M263V	ENSP00000321927:M263V	M	-	1	0	FBXL13	102354048	1.000000	0.71417	0.969000	0.41365	0.997000	0.91878	5.084000	0.64462	2.189000	0.69895	0.533000	0.62120	ATG		FBXL13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348001.1	NM_145032	
INHBA	3624	hgsc.bcm.edu	37	7	41729394	41729394	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr7:41729394G>A	ENST00000242208.4	-	3	1381	c.1135C>T	c.(1135-1137)Cgg>Tgg	p.R379W	INHBA_ENST00000442711.1_Missense_Mutation_p.R379W|INHBA_ENST00000464515.1_5'UTR|AC005027.3_ENST00000416150.1_RNA	NM_002192.2	NP_002183.1	P08476	INHBA_HUMAN	inhibin, beta A	379				RMR -> AC (in Ref. 7; CAA51163). {ECO:0000305}.	activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|defense response (GO:0006952)|endodermal cell differentiation (GO:0035987)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|eyelid development in camera-type eye (GO:0061029)|G1/S transition of mitotic cell cycle (GO:0000082)|growth (GO:0040007)|hair follicle development (GO:0001942)|hematopoietic progenitor cell differentiation (GO:0002244)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|mesodermal cell differentiation (GO:0048333)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|odontogenesis (GO:0042476)|ovarian follicle development (GO:0001541)|palate development (GO:0060021)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of follicle-stimulating hormone secretion (GO:0046880)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)	activin A complex (GO:0043509)|extracellular region (GO:0005576)|inhibin A complex (GO:0043512)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|peptide hormone binding (GO:0017046)|type II activin receptor binding (GO:0070699)	p.R379W(1)		biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(15)|lung(26)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						CTATGGCCCCGCATGCGGTAG	0.537										TSP Lung(11;0.080)																											p.R379W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1135T	7						.						126.0	112.0	117.0					7																	41729394		2203	4300	6503	41695919	SO:0001583	missense	3624	exon3				CCDS5464.1	7p15-p13	2014-01-30	2007-07-30		ENSG00000122641	ENSG00000122641		"""Endogenous ligands"""	6066	protein-coding gene	gene with protein product		147290	"""inhibin, beta A (activin A, activin AB alpha polypeptide)"""			3345731	Standard	NM_002192		Approved		uc003thr.3	P08476	OTTHUMG00000023574	ENST00000242208.4:c.1135C>T	7.37:g.41729394G>A	ENSP00000242208:p.Arg379Trp	Somatic		Capture	SOLID	Phase_I	41695919	NM_002192	Q14599	Missense_Mutation	SNP	ENST00000242208.4	37	CCDS5464.1	.	.	.	.	.	.	.	.	.	.	.	14.76	2.631060	0.46944	.	.	ENSG00000122641	ENST00000242208;ENST00000442711	D;D	0.85339	-1.97;-1.97	5.86	2.59	0.31030	Transforming growth factor-beta, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.92319	0.7563	M	0.83118	2.625	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93414	0.6771	10	0.87932	D	0	-21.1176	15.948	0.79809	0.0:0.0:0.5124:0.4876	.	379	P08476	INHBA_HUMAN	W	379	ENSP00000242208:R379W;ENSP00000397197:R379W	ENSP00000242208:R379W	R	-	1	2	INHBA	41695919	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.507000	0.22675	0.732000	0.32470	0.591000	0.81541	CGG		INHBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250793.1		
EPHA1	2041	hgsc.bcm.edu	37	7	143088820	143088820	+	Silent	SNP	A	A	G			TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr7:143088820A>G	ENST00000275815.3	-	17	2831	c.2745T>C	c.(2743-2745)taT>taC	p.Y915Y	EPHA1_ENST00000458129.1_5'Flank	NM_005232.4	NP_005223.4	P21709	EPHA1_HUMAN	EPH receptor A1	915	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				activation of Rho GTPase activity (GO:0032862)|angiogenesis (GO:0001525)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of cell migration (GO:0030336)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|regulation of Rac GTPase activity (GO:0032314)|substrate adhesion-dependent cell spreading (GO:0034446)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|transmembrane-ephrin receptor activity (GO:0005005)	p.Y915Y(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(21)|ovary(4)|skin(1)|stomach(1)|urinary_tract(3)	51	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)				AGACGGTTCGATATGGGATCC	0.577																																					p.Y915Y												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T2745C	7						.						83.0	64.0	70.0					7																	143088820		2203	4300	6503	142798942	SO:0001819	synonymous_variant	2041	exon17			M18391	CCDS5884.1	7q32-q36	2013-02-11	2004-10-28		ENSG00000146904	ENSG00000146904	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3385	protein-coding gene	gene with protein product		179610	"""EphA1"""	EPHT, EPHT1		9267020	Standard	NM_005232		Approved	EPH	uc003wcz.3	P21709	OTTHUMG00000155894	ENST00000275815.3:c.2745T>C	7.37:g.143088820A>G		Somatic		Capture	SOLID	Phase_I	142798942	NM_005232	A1L3V3|B5A966|B5A967|Q15405	Silent	SNP	ENST00000275815.3	37	CCDS5884.1																																																																																				EPHA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342154.1		
TBC1D20	128637	hgsc.bcm.edu	37	20	419798	419798	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr20:419798G>A	ENST00000354200.4	-	7	1057	c.910C>T	c.(910-912)Cca>Tca	p.P304S	TBC1D20_ENST00000461188.1_5'UTR	NM_144628.2	NP_653229.1	Q96BZ9	TBC20_HUMAN	TBC1 domain family, member 20	304					acrosome assembly (GO:0001675)|cargo loading into COPII-coated vesicle (GO:0090110)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|lens fiber cell morphogenesis (GO:0070309)|lipid particle organization (GO:0034389)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|seminiferous tubule development (GO:0072520)|virion assembly (GO:0019068)	endoplasmic reticulum membrane (GO:0005789)|integral component of Golgi membrane (GO:0030173)|nuclear membrane (GO:0031965)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)	p.P304S(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	12		all_epithelial(17;0.228)|Breast(17;0.231)				AGTTCGGATGGGGGAAACTGA	0.567																																					p.P304S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C910T	20						.						85.0	73.0	77.0					20																	419798		2203	4300	6503	367798	SO:0001583	missense	128637	exon7			AK055573	CCDS13002.1	20p13	2013-07-10	2005-01-05	2005-01-05	ENSG00000125875	ENSG00000125875			16133	protein-coding gene	gene with protein product		611663	"""chromosome 20 open reading frame 140"""	C20orf140		17901050	Standard	XM_005260661		Approved	dJ852M4.2	uc002wds.3	Q96BZ9	OTTHUMG00000031637	ENST00000354200.4:c.910C>T	20.37:g.419798G>A	ENSP00000346139:p.Pro304Ser	Somatic		Capture	SOLID	Phase_I	367798	NM_144628	A8K6I3|B9A6M1|Q5JWQ7|Q6ZSY8|Q96NE1|Q9BYM7|Q9H140	Missense_Mutation	SNP	ENST00000354200.4	37	CCDS13002.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.609948	0.87258	.	.	ENSG00000125875	ENST00000354200;ENST00000246077	T	0.38077	1.16	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.61862	0.2381	M	0.76170	2.325	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.60984	-0.7154	10	0.52906	T	0.07	-25.3281	18.6556	0.91452	0.0:0.0:1.0:0.0	.	304	Q96BZ9	TBC20_HUMAN	S	304;329	ENSP00000346139:P304S	ENSP00000246077:P329S	P	-	1	0	TBC1D20	367798	1.000000	0.71417	0.998000	0.56505	0.672000	0.39443	9.165000	0.94761	2.884000	0.98904	0.655000	0.94253	CCA		TBC1D20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251397.2	NM_144628	
TTI1	9675	hgsc.bcm.edu	37	20	36641394	36641394	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr20:36641394C>G	ENST00000373448.2	-	3	1063	c.825G>C	c.(823-825)agG>agC	p.R275S	TTI1_ENST00000373447.3_Missense_Mutation_p.R275S|TTI1_ENST00000487362.1_Intron|TTI1_ENST00000449821.1_Missense_Mutation_p.R275S	NM_014657.1	NP_055472.1	O43156	TTI1_HUMAN	TELO2 interacting protein 1	275					regulation of TOR signaling (GO:0032006)	cytoplasm (GO:0005737)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)		p.R275S(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	47						AATCTGCTTCCCTGTAAACCA	0.433																																					p.R275S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G825C	20						.						207.0	210.0	209.0					20																	36641394		2203	4300	6503	36074808	SO:0001583	missense	9675	exon3			BC013121	CCDS13300.1	20q11.23	2011-11-10	2011-11-10	2010-06-22	ENSG00000101407	ENSG00000101407			29029	protein-coding gene	gene with protein product	"""smg-10 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	614425	"""KIAA0406"", ""Tel2 interacting protein 1 homolog (S. pombe)"""	KIAA0406		9455477, 20427287, 20371770	Standard	NM_014657		Approved	smg-10	uc002xhl.3	O43156	OTTHUMG00000032433	ENST00000373448.2:c.825G>C	20.37:g.36641394C>G	ENSP00000362547:p.Arg275Ser	Somatic		Capture	SOLID	Phase_I	36074808	NM_014657	D6W4K3|Q5JX67|Q96A38|Q9BR47|Q9H4K0	Missense_Mutation	SNP	ENST00000373448.2	37	CCDS13300.1	.	.	.	.	.	.	.	.	.	.	C	13.06	2.123540	0.37436	.	.	ENSG00000101407	ENST00000373448;ENST00000373447;ENST00000449821	T;T;T	0.20738	2.05;2.05;2.05	5.24	-0.043	0.13861	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.40196	0.1107	M	0.77103	2.36	0.58432	D	0.999991	D	0.89917	1.0	D	0.72982	0.979	T	0.20405	-1.0276	10	0.56958	D	0.05	-16.5182	8.5459	0.33421	0.0:0.4835:0.0:0.5165	.	275	O43156	TTI1_HUMAN	S	275	ENSP00000362547:R275S;ENSP00000362546:R275S;ENSP00000407270:R275S	ENSP00000362546:R275S	R	-	3	2	TTI1	36074808	0.996000	0.38824	0.983000	0.44433	0.746000	0.42486	0.895000	0.28363	0.139000	0.18822	-0.157000	0.13467	AGG		TTI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079138.2	NM_014657	
SLC13A3	64849	hgsc.bcm.edu	37	20	45221120	45221120	+	Silent	SNP	G	G	A			TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr20:45221120G>A	ENST00000279027.4	-	6	861	c.843C>T	c.(841-843)ttC>ttT	p.F281F	SLC13A3_ENST00000435032.1_5'UTR|SLC13A3_ENST00000495082.1_Silent_p.F234F|SLC13A3_ENST00000396360.1_Silent_p.F234F|SLC13A3_ENST00000290317.5_Silent_p.F234F|SLC13A3_ENST00000472148.1_Silent_p.F234F|SLC13A3_ENST00000413164.2_Intron|SLC13A3_ENST00000372121.1_Intron	NM_001193342.1|NM_022829.5	NP_001180271.1|NP_073740.2	Q8WWT9	S13A3_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3	281					transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-affinity sodium:dicarboxylate symporter activity (GO:0015362)	p.F281F(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	GAGGGAAGGCGAAAATGAACC	0.527																																					p.F281F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C843T	20						.						148.0	113.0	125.0					20																	45221120		2203	4300	6503	44654527	SO:0001819	synonymous_variant	64849	exon6			AF154121	CCDS13400.1, CCDS42886.1, CCDS54469.1, CCDS54470.1	20q13.12	2013-05-22			ENSG00000158296	ENSG00000158296		"""Solute carriers"""	14430	protein-coding gene	gene with protein product		606411				10794676, 10992006	Standard	NM_001011554		Approved	NADC3, SDCT2	uc002xsf.2	Q8WWT9	OTTHUMG00000033042	ENST00000279027.4:c.843C>T	20.37:g.45221120G>A		Somatic		Capture	SOLID	Phase_I	44654527	NM_022829	B4DIR8|E1P5U4|F6WI18|Q5JYC9|Q5JYD0|Q5JYD1|Q5TCQ2|Q8IVB1|Q8N8K4|Q96MM5|Q9BR25|Q9H1G1|Q9H3W4|Q9NQN5|Q9NS04	Silent	SNP	ENST00000279027.4	37	CCDS13400.1	.	.	.	.	.	.	.	.	.	.	G	11.05	1.525598	0.27299	.	.	ENSG00000158296	ENST00000450298	.	.	.	5.69	0.372	0.16173	.	.	.	.	.	T	0.55081	0.1898	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46735	-0.9170	4	.	.	.	-30.533	8.5354	0.33360	0.6008:0.0:0.3992:0.0	.	.	.	.	C	111	.	.	R	-	1	0	SLC13A3	44654527	0.731000	0.28111	0.988000	0.46212	0.998000	0.95712	-0.043000	0.12043	0.060000	0.16281	0.655000	0.94253	CGC		SLC13A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080329.2		
CHRNA4	1137	hgsc.bcm.edu	37	20	61981936	61981936	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr20:61981936G>A	ENST00000370263.4	-	5	1048	c.827C>T	c.(826-828)aCg>aTg	p.T276M	CHRNA4_ENST00000463705.1_5'UTR	NM_000744.6|NM_001256573.1	NP_000735.1|NP_001243502.1	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 (neuronal)	276					action potential (GO:0001508)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cognition (GO:0050890)|DNA repair (GO:0006281)|exploration behavior (GO:0035640)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|neurological system process (GO:0050877)|regulation of dopamine secretion (GO:0014059)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)	p.T276M(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(19)|prostate(3)|skin(3)|soft_tissue(1)	33	all_cancers(38;1.71e-10)				Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	GATGCACAGCGTGATCTTCTC	0.592																																					p.T276M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C827T	20						.						271.0	200.0	224.0					20																	61981936		2203	4300	6503	61452380	SO:0001583	missense	1137	exon5				CCDS13517.1	20q13.33	2013-09-20	2012-02-07		ENSG00000101204	ENSG00000101204		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1958	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 4 (neuronal)"""	118504	"""cholinergic receptor, nicotinic, alpha polypeptide 4"""	EBN, EBN1		1505988	Standard	NM_000744		Approved	BFNC	uc002yes.3	P43681	OTTHUMG00000033080	ENST00000370263.4:c.827C>T	20.37:g.61981936G>A	ENSP00000359285:p.Thr276Met	Somatic		Capture	SOLID	Phase_I	61452380	NM_000744	Q4JGR7|Q4VAQ5|Q4VAQ6	Missense_Mutation	SNP	ENST00000370263.4	37	CCDS13517.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.771403	0.90108	.	.	ENSG00000101204	ENST00000370258;ENST00000370263;ENST00000539366	D	0.88124	-2.34	5.06	5.06	0.68205	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.93802	0.8018	M	0.80028	2.48	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.981	D	0.94620	0.7812	10	0.87932	D	0	.	18.4025	0.90522	0.0:0.0:1.0:0.0	.	205;276	Q4VAQ5;P43681	.;ACHA4_HUMAN	M	182;276;205	ENSP00000359285:T276M	ENSP00000359280:T182M	T	-	2	0	CHRNA4	61452380	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.552000	0.98115	2.333000	0.79357	0.655000	0.94253	ACG		CHRNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080508.3		
SYN3	8224	hgsc.bcm.edu	37	22	33327411	33327411	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr22:33327411T>C	ENST00000358763.2	-	4	667	c.425A>G	c.(424-426)gAc>gGc	p.D142G	SYN3_ENST00000332840.5_Missense_Mutation_p.D142G	NM_001135774.1	NP_001129246.1	O14994	SYN3_HUMAN	synapsin III	142	C; actin-binding and synaptic-vesicle binding.				neurotransmitter secretion (GO:0007269)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)	p.D142G(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						GACCTGCATGTCCACCATGCA	0.453																																					p.D142G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A425G	22						.						115.0	107.0	110.0					22																	33327411		2203	4300	6503	31657411	SO:0001583	missense	8224	exon4			AF046873	CCDS13908.1	22q12.3	2008-05-14			ENSG00000185666	ENSG00000185666			11496	protein-coding gene	gene with protein product		602705				9539796	Standard	NM_003490		Approved		uc003amx.3	O14994	OTTHUMG00000031004	ENST00000358763.2:c.425A>G	22.37:g.33327411T>C	ENSP00000351614:p.Asp142Gly	Somatic		Capture	SOLID	Phase_I	31657411	NM_001135774	B1B1F9	Missense_Mutation	SNP	ENST00000358763.2	37	CCDS13908.1	.	.	.	.	.	.	.	.	.	.	T	17.70	3.455451	0.63401	.	.	ENSG00000185666	ENST00000358763;ENST00000332840;ENST00000390686	T;T	0.35236	1.32;1.32	5.42	5.42	0.78866	Pre-ATP-grasp fold (1);PreATP-grasp-like fold (1);Synapsin, pre-ATP-grasp domain (1);	0.000000	0.85682	D	0.000000	T	0.53384	0.1793	M	0.83603	2.65	0.58432	D	0.999991	P;P;P	0.35348	0.496;0.494;0.496	P;P;P	0.45343	0.477;0.46;0.477	T	0.58538	-0.7619	10	0.59425	D	0.04	.	14.7222	0.69314	0.0:0.0:0.0:1.0	.	142;142;142	Q17R54;B1B1F9;O14994	.;.;SYN3_HUMAN	G	142	ENSP00000351614:D142G;ENSP00000330219:D142G	ENSP00000330219:D142G	D	-	2	0	SYN3	31657411	1.000000	0.71417	1.000000	0.80357	0.751000	0.42716	6.788000	0.75105	2.169000	0.68431	0.460000	0.39030	GAC		SYN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075892.4		
SLC5A5	6528	hgsc.bcm.edu	37	19	17992837	17992837	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr19:17992837G>A	ENST00000222248.3	+	9	1474	c.1127G>A	c.(1126-1128)cGg>cAg	p.R376Q		NM_000453.2	NP_000444.1	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium/iodide cotransporter), member 5	376					cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|iodide transport (GO:0015705)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	iodide transmembrane transporter activity (GO:0015111)|sodium:iodide symporter activity (GO:0008507)	p.R376Q(1)		NS(2)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						CCTCGGCTGCGGAGCCTGGCA	0.602																																					p.R376Q	Melanoma(65;1008 1708 7910 46650)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1127A	19						.						96.0	90.0	92.0					19																	17992837		2203	4300	6503	17853837	SO:0001583	missense	6528	exon9				CCDS12368.1	19p13.11	2013-07-19	2013-07-19		ENSG00000105641	ENSG00000105641		"""Solute carriers"""	11040	protein-coding gene	gene with protein product		601843	"""solute carrier family 5 (sodium iodide symporter), member 5"""			9231811	Standard	NM_000453		Approved	NIS	uc002nhr.4	Q92911		ENST00000222248.3:c.1127G>A	19.37:g.17992837G>A	ENSP00000222248:p.Arg376Gln	Somatic		Capture	SOLID	Phase_I	17853837	NM_000453	O43702|Q2M335|Q9NYB6	Missense_Mutation	SNP	ENST00000222248.3	37	CCDS12368.1	.	.	.	.	.	.	.	.	.	.	G	7.685	0.689858	0.14973	.	.	ENSG00000105641	ENST00000222248	D	0.89810	-2.57	4.36	-0.711	0.11230	.	0.833279	0.10885	N	0.623396	D	0.82472	0.5044	L	0.43152	1.355	0.09310	N	1	B	0.13145	0.007	B	0.12156	0.007	T	0.65944	-0.6045	10	0.32370	T	0.25	.	8.7967	0.34883	0.2678:0.3383:0.3938:0.0	.	376	Q92911	SC5A5_HUMAN	Q	376	ENSP00000222248:R376Q	ENSP00000222248:R376Q	R	+	2	0	SLC5A5	17853837	0.031000	0.19500	0.000000	0.03702	0.000000	0.00434	0.290000	0.18975	-0.421000	0.07416	-2.352000	0.00242	CGG		SLC5A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466690.1		
DNM2	1785	hgsc.bcm.edu	37	19	10940995	10940995	+	Silent	SNP	G	G	A	rs114682382	byFrequency	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr19:10940995G>A	ENST00000355667.6	+	20	2564	c.2484G>A	c.(2482-2484)ccG>ccA	p.P828P	DNM2_ENST00000389253.4_Silent_p.P828P|DNM2_ENST00000408974.4_Silent_p.P824P|DNM2_ENST00000314646.5_Silent_p.P828P|DNM2_ENST00000359692.6_Silent_p.P824P|DNM2_ENST00000585892.1_Silent_p.P828P	NM_001005360.2|NM_001190716.1	NP_001005360.1|NP_001177645.1	P50570	DYN2_HUMAN	dynamin 2	828	Pro-rich.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|endocytosis (GO:0006897)|G2/M transition of mitotic cell cycle (GO:0000086)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|nitric oxide metabolic process (GO:0046209)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic vesicle transport (GO:0048489)|transferrin transport (GO:0033572)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	enzyme binding (GO:0019899)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|microtubule binding (GO:0008017)	p.P824P(2)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	42			Epithelial(33;4.17e-05)|all cancers(31;8.48e-05)			TCCCAGCCCCGCCTCAGATCC	0.677			"""F, N, Splice, Mis, O"""		ETP ALL								g|||	63	0.0125799	0.0461	0.0029	5008	,	,		15407	0.0		0.0	False		,,,				2504	0.0				p.P828P			Rec	yes		19	19p13.2	1785	dynamin 2		L	DNM2,central_nervous_system,brain,Substitution - coding silent,0	.	2	Substitution - coding silent(2)	large_intestine(1)|central_nervous_system(1)	c.G2484A	19						.		,,,,	160,4244	103.4+/-141.9	2,156,2044	58.0	58.0	58.0		2484,2484,2472,2484,2472	-5.0	0.9	19	dbSNP_132	58	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	DNM2	NM_001005360.2,NM_001005361.2,NM_001005362.2,NM_001190716.1,NM_004945.3	,,,,	2,156,6344	AA,AG,GG		0.0,3.6331,1.2304	,,,,	828/871,828/871,824/867,828/870,824/867	10940995	160,12844	2202	4300	6502	10801995	SO:0001819	synonymous_variant	1785	exon20				CCDS32907.1, CCDS32908.1, CCDS45968.1, CCDS45969.1, CCDS59351.1	19p	2014-09-17						"""Pleckstrin homology (PH) domain containing"""	2974	protein-coding gene	gene with protein product	"""dynamin II"", ""cytoskeletal protein"""	602378				7590285, 9143510	Standard	NM_001190716		Approved	DYNII, DYN2, CMTDIB, CMTDI1, DI-CMTB	uc002mps.2	P50570		ENST00000355667.6:c.2484G>A	19.37:g.10940995G>A		Somatic		Capture	SOLID	Phase_I	10801995	NM_001190716	A8K1B6|E7EV30|E9PEQ4|K7ESI9|Q5I0Y0|Q7Z5S3|Q9UPH4	Silent	SNP	ENST00000355667.6	37	CCDS45968.1																																																																																				DNM2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452592.1	NM_004945	
NCAN	1463	hgsc.bcm.edu	37	19	19356210	19356210	+	Missense_Mutation	SNP	G	G	A	rs368157092		TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr19:19356210G>A	ENST00000252575.6	+	13	3680	c.3581G>A	c.(3580-3582)cGc>cAc	p.R1194H	NCAN_ENST00000538881.1_Missense_Mutation_p.R645H	NM_004386.2	NP_004377.2	O14594	NCAN_HUMAN	neurocan	1194	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|regulation of synapse structural plasticity (GO:0051823)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)	p.R1194H(1)		breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(32)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64			Epithelial(12;0.00544)		Hyaluronan(DB08818)	GAAAGCGGGCGCTGGAACGAT	0.547																																					p.R1194H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3581A	19						.	G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	139.0	118.0	125.0		3581	-1.3	0.9	19		125	0,8600		0,0,4300	no	missense	NCAN	NM_004386.2	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	1194/1322	19356210	1,13005	2203	4300	6503	19217210	SO:0001583	missense	1463	exon13			AF026547	CCDS12397.1	19p12	2014-01-30	2007-02-15	2007-02-15	ENSG00000130287	ENSG00000130287		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"", ""Endogenous ligands"""	2465	protein-coding gene	gene with protein product	"""neurocan proteoglycan"""	600826	"""chondroitin sulfate proteoglycan 3"""	CSPG3		1326557, 21353194	Standard	NM_004386		Approved		uc002nlz.3	O14594		ENST00000252575.6:c.3581G>A	19.37:g.19356210G>A	ENSP00000252575:p.Arg1194His	Somatic		Capture	SOLID	Phase_I	19217210	NM_004386	Q9UPK6	Missense_Mutation	SNP	ENST00000252575.6	37	CCDS12397.1	.	.	.	.	.	.	.	.	.	.	G	13.52	2.262839	0.39995	2.27E-4	0.0	ENSG00000130287	ENST00000539499;ENST00000252575;ENST00000538881	T;T	0.19250	2.16;2.16	4.76	-1.31	0.09230	C-type lectin fold (1);C-type lectin, conserved site (1);C-type lectin-like (1);C-type lectin (3);	0.199479	0.25256	N	0.031996	T	0.13157	0.0319	L	0.41079	1.255	0.29680	N	0.841776	B	0.13594	0.008	B	0.10450	0.005	T	0.07790	-1.0754	10	0.54805	T	0.06	.	4.1685	0.10318	0.4443:0.0:0.3977:0.158	.	1194	O14594	NCAN_HUMAN	H	1208;1194;645	ENSP00000252575:R1194H;ENSP00000442202:R645H	ENSP00000252575:R1194H	R	+	2	0	NCAN	19217210	1.000000	0.71417	0.852000	0.33557	0.651000	0.38670	2.938000	0.48987	-0.267000	0.09325	-0.476000	0.04901	CGC		NCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460111.2	NM_004386	
NRAS	4893	hgsc.bcm.edu	37	1	115256530	115256530	+	Missense_Mutation	SNP	G	G	T	rs121913254		TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr1:115256530G>T	ENST00000369535.4	-	3	434	c.181C>A	c.(181-183)Caa>Aaa	p.Q61K		NM_002524.4	NP_002515.1	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog	61			Q -> K (in CMNS and NCMS; somatic mutation). {ECO:0000269|PubMed:23392294}.|Q -> R (in CMNS, NCMS and KNEN; also found in lung carcinoma cell and melanoma; dbSNP:rs11554290). {ECO:0000269|PubMed:18633438, ECO:0000269|PubMed:22499344, ECO:0000269|PubMed:23392294, ECO:0000269|PubMed:3276402}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of skeletal muscle tissue development (GO:0048642)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|small GTPase mediated signal transduction (GO:0007264)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.Q61K(595)|p.Q61E(9)|p.Q61L(3)|p.Q61R(2)|p.G60>?(1)		NS(134)|adrenal_gland(9)|autonomic_ganglia(9)|biliary_tract(6)|bone(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(11)|eye(3)|haematopoietic_and_lymphoid_tissue(1115)|kidney(3)|large_intestine(105)|liver(10)|lung(42)|meninges(2)|ovary(7)|pancreas(5)|prostate(8)|skin(1144)|soft_tissue(37)|stomach(5)|testis(8)|thyroid(359)|upper_aerodigestive_tract(28)|urinary_tract(13)	3085	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TACTCTTCTTGTCCAGCTGTA	0.458	Q61K(CHP212_AUTONOMIC_GANGLIA)|Q61K(HCC15_LUNG)|Q61K(HS936T_SKIN)|Q61K(HS944T_SKIN)|Q61K(HT1080_SOFT_TISSUE)|Q61K(HUT78_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61K(M07E_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61K(NCIH1299_LUNG)|Q61K(NCIH2087_LUNG)|Q61K(OCILY19_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61K(SKNAS_AUTONOMIC_GANGLIA)|Q61K(SKNSH_AUTONOMIC_GANGLIA)|Q61K(TYKNU_OVARY)	50	Mis		"""melanoma, MM, AML, thyroid"""				Noonan syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)																											p.Q61K			Dom	yes		1	1p13.2	4893	neuroblastoma RAS viral (v-ras) oncogene homolog		"""L, E"""	NRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0	.	610	Substitution - Missense(609)|Complex(1)	skin(372)|haematopoietic_and_lymphoid_tissue(73)|thyroid(55)|NS(29)|large_intestine(28)|soft_tissue(16)|lung(12)|autonomic_ganglia(6)|liver(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|cervix(2)|endometrium(2)|pancreas(2)|meninges(1)|kidney(1)|biliary_tract(1)|stomach(1)|ovary(1)|bone(1)	c.C181A	1						.						180.0	156.0	164.0					1																	115256530		2203	4300	6503	115058053	SO:0001583	missense	4893	exon3	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	BC005219	CCDS877.1	1p13.2	2014-09-17			ENSG00000213281	ENSG00000213281			7989	protein-coding gene	gene with protein product		164790					Standard	NM_002524		Approved	N-ras	uc009wgu.3	P01111	OTTHUMG00000012059	ENST00000369535.4:c.181C>A	1.37:g.115256530G>T	ENSP00000358548:p.Gln61Lys	Somatic		Capture	SOLID	Phase_I	115058053	NM_002524	Q14971|Q15104|Q15282	Missense_Mutation	SNP	ENST00000369535.4	37	CCDS877.1	.	.	.	.	.	.	.	.	.	.	G	33	5.255564	0.95336	.	.	ENSG00000213281	ENST00000369535	D	0.83506	-1.73	5.08	5.08	0.68730	Small GTP-binding protein domain (1);	0.000000	0.53938	U	0.000043	D	0.91845	0.7419	H	0.95850	3.73	0.80722	D	1	P	0.51791	0.948	P	0.54759	0.76	D	0.93711	0.7024	10	0.62326	D	0.03	.	18.6626	0.91477	0.0:0.0:1.0:0.0	.	61	P01111	RASN_HUMAN	K	61	ENSP00000358548:Q61K	ENSP00000358548:Q61K	Q	-	1	0	NRAS	115058053	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.520000	0.98027	2.624000	0.88883	0.655000	0.94253	CAA		NRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033395.2	NM_002524	
SETDB1	9869	hgsc.bcm.edu	37	1	150923179	150923179	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr1:150923179G>A	ENST00000271640.5	+	13	2016	c.1826G>A	c.(1825-1827)cGg>cAg	p.R609Q	SETDB1_ENST00000368969.4_Missense_Mutation_p.R609Q|SETDB1_ENST00000459773.1_Intron	NM_001145415.1|NM_012432.3	NP_001138887.1|NP_036564.3	Q15047	SETB1_HUMAN	SET domain, bifurcated 1	609	MBD. {ECO:0000255|PROSITE- ProRule:PRU00338}.				bone development (GO:0060348)|histone H3-K9 trimethylation (GO:0036124)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)	p.R609Q(2)		NS(1)|large_intestine(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			TATGACTTCCGGCGGATGACA	0.517																																					p.R609Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1826A	1						.						86.0	83.0	84.0					1																	150923179		2203	4300	6503	149189803	SO:0001583	missense	9869	exon13			D31891	CCDS972.1, CCDS44217.1, CCDS58026.1	1q21	2013-01-23			ENSG00000143379	ENSG00000143379		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Tudor domain containing"""	10761	protein-coding gene	gene with protein product	"""tudor domain containing 21"""	604396				10343109	Standard	NM_001145415		Approved	KG1T, KIAA0067, ESET, KMT1E, TDRD21	uc001evu.2	Q15047	OTTHUMG00000035003	ENST00000271640.5:c.1826G>A	1.37:g.150923179G>A	ENSP00000271640:p.Arg609Gln	Somatic		Capture	SOLID	Phase_I	149189803	NM_001145415	A6NEW2|Q5SZD8|Q5SZD9|Q5SZE0|Q5SZE7|Q96GM9	Missense_Mutation	SNP	ENST00000271640.5	37	CCDS44217.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.625668	0.87560	.	.	ENSG00000143379	ENST00000271640;ENST00000534805;ENST00000368969;ENST00000498193	D;T;D;D	0.99458	-5.93;1.49;-5.93;-5.93	5.42	5.42	0.78866	Methyl-CpG DNA binding (3);DNA-binding, integrase-type (1);	0.000000	0.85682	D	0.000000	D	0.98704	0.9565	N	0.20610	0.595	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.998;0.998	D;D;D;D	0.87578	0.998;0.991;0.986;0.992	D	0.98985	1.0806	10	0.25106	T	0.35	.	18.2186	0.89894	0.0:0.0:1.0:0.0	.	609;610;609;609	E9PRF4;E9PQM8;Q15047-3;Q15047	.;.;.;SETB1_HUMAN	Q	609;610;609;609	ENSP00000271640:R609Q;ENSP00000436148:R610Q;ENSP00000357965:R609Q;ENSP00000432348:R609Q	ENSP00000271640:R609Q	R	+	2	0	SETDB1	149189803	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	7.721000	0.84768	2.540000	0.85666	0.655000	0.94253	CGG		SETDB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084717.2		
C1orf116	79098	hgsc.bcm.edu	37	1	207200933	207200933	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr1:207200933C>G	ENST00000359470.5	-	2	260	c.11G>C	c.(10-12)aGg>aCg	p.R4T	C1orf116_ENST00000461135.2_Intron	NM_023938.5	NP_076427.2	Q9BW04	SARG_HUMAN	chromosome 1 open reading frame 116	4						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.R4T(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(4)|stomach(1)	29	Prostate(682;0.19)					CCACAGCTCCCTCTCGGGCAT	0.612																																					p.R4T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G11C	1						.						62.0	58.0	59.0					1																	207200933		2203	4300	6503	205267556	SO:0001583	missense	79098	exon2				CCDS1475.1, CCDS44306.1	1q32.1	2012-06-26			ENSG00000182795	ENSG00000182795			28667	protein-coding gene	gene with protein product	"""specifically androgen-regulated gene"""	611680				15525603, 9389513	Standard	NM_023938		Approved	SARG, FLJ36507, MGC2742, MGC4309	uc001hfd.2	Q9BW04	OTTHUMG00000036580	ENST00000359470.5:c.11G>C	1.37:g.207200933C>G	ENSP00000352447:p.Arg4Thr	Somatic		Capture	SOLID	Phase_I	205267556	NM_023938	C9JV41|Q658X3	Missense_Mutation	SNP	ENST00000359470.5	37	CCDS1475.1	.	.	.	.	.	.	.	.	.	.	C	15.13	2.740983	0.49151	.	.	ENSG00000182795	ENST00000359470	T	0.09163	3.01	5.3	3.39	0.38822	.	0.445255	0.27117	N	0.020857	T	0.09992	0.0245	L	0.54323	1.7	0.80722	D	1	B	0.14012	0.009	B	0.15052	0.012	T	0.13150	-1.0520	10	0.59425	D	0.04	-10.3802	3.7404	0.08527	0.0:0.559:0.2175:0.2235	.	4	Q9BW04	SARG_HUMAN	T	4	ENSP00000352447:R4T	ENSP00000352447:R4T	R	-	2	0	C1orf116	205267556	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	0.906000	0.28517	1.192000	0.43071	-0.176000	0.13171	AGG		C1orf116-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088973.1	NM_024115	
DENND5A	23258	hgsc.bcm.edu	37	11	9191453	9191453	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr11:9191453G>A	ENST00000328194.3	-	10	2421	c.2101C>T	c.(2101-2103)Cgg>Tgg	p.R701W	DENND5A_ENST00000530044.1_Missense_Mutation_p.R701W|DENND5A_ENST00000527700.1_Missense_Mutation_p.R44W	NM_001243254.1|NM_015213.3	NP_001230183.1|NP_056028.2	Q6IQ26	DEN5A_HUMAN	DENN/MADD domain containing 5A	701					positive regulation of Rab GTPase activity (GO:0032851)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.R701W(1)		breast(1)|endometrium(7)|kidney(2)|large_intestine(8)|liver(1)|lung(16)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						TGCTTCTGCCGATCTTTCCGC	0.453																																					p.R701W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2101T	11						.						292.0	242.0	259.0					11																	9191453		2201	4296	6497	9148029	SO:0001583	missense	23258	exon10			AB029014	CCDS31423.1, CCDS58119.1	11p15.3	2012-10-03	2008-08-14	2008-08-14	ENSG00000184014	ENSG00000184014		"""DENN/MADD domain containing"""	19344	protein-coding gene	gene with protein product			"""RAB6 interacting protein 1"""	RAB6IP1		10470851	Standard	NM_015213		Approved	KIAA1091, FLJ22354, FLJ33829, FLJ43455	uc001mhl.3	Q6IQ26	OTTHUMG00000165716	ENST00000328194.3:c.2101C>T	11.37:g.9191453G>A	ENSP00000328524:p.Arg701Trp	Somatic		Capture	SOLID	Phase_I	9148029	NM_015213	B4DJ15|E9PS91|Q96GN3|Q9H6U7|Q9UFV0|Q9UPR1	Missense_Mutation	SNP	ENST00000328194.3	37	CCDS31423.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.159115	0.78226	.	.	ENSG00000184014	ENST00000328194;ENST00000530044;ENST00000527700	T;T;T	0.23950	3.57;3.55;1.88	5.27	3.16	0.36331	.	0.000000	0.85682	D	0.000000	T	0.44180	0.1281	L	0.56769	1.78	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	D;D	0.68621	0.918;0.959	T	0.44967	-0.9293	10	0.72032	D	0.01	.	13.0048	0.58699	0.0:0.0:0.5521:0.4479	.	701;701	E9PS91;Q6IQ26	.;DEN5A_HUMAN	W	701;701;44	ENSP00000328524:R701W;ENSP00000435866:R701W;ENSP00000432549:R44W	ENSP00000328524:R701W	R	-	1	2	DENND5A	9148029	0.994000	0.37717	1.000000	0.80357	0.997000	0.91878	1.211000	0.32382	1.200000	0.43188	0.655000	0.94253	CGG		DENND5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385910.2	NM_015213	
ZP1	22917	hgsc.bcm.edu	37	11	60638572	60638572	+	Silent	SNP	C	C	T			TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr11:60638572C>T	ENST00000278853.5	+	5	969	c.969C>T	c.(967-969)ttC>ttT	p.F323F		NM_207341.2	NP_997224.2	P60852	ZP1_HUMAN	zona pellucida glycoprotein 1 (sperm receptor)	323	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)		p.F323F(1)		breast(3)|endometrium(2)|large_intestine(8)|lung(8)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	26						CGGAAGCTTTCGTGGTCTTCT	0.597																																					p.F323F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C969T	11						.						110.0	99.0	103.0					11																	60638572		2203	4299	6502	60395148	SO:0001819	synonymous_variant	22917	exon5			BC067899	CCDS31572.1	11q12.2	2013-01-17			ENSG00000149506	ENSG00000149506		"""Zona pellucida glycoproteins"""	13187	protein-coding gene	gene with protein product		195000				10542331	Standard	NM_207341		Approved		uc001nqd.3	P60852	OTTHUMG00000167797	ENST00000278853.5:c.969C>T	11.37:g.60638572C>T		Somatic		Capture	SOLID	Phase_I	60395148	NM_207341		Silent	SNP	ENST00000278853.5	37	CCDS31572.1																																																																																				ZP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396329.1	NM_207341	
SIK2	23235	hgsc.bcm.edu	37	11	111571671	111571671	+	Silent	SNP	C	C	T			TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr11:111571671C>T	ENST00000304987.3	+	5	713	c.540C>T	c.(538-540)ccC>ccT	p.P180P		NM_015191.1	NP_056006.1	Q9H0K1	SIK2_HUMAN	salt-inducible kinase 2	180	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of insulin receptor signaling pathway (GO:0046626)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.P180P(1)		breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	30						GTGGCAGCCCCCCTTATGCAG	0.433																																					p.P180P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C540T	11						.						68.0	71.0	70.0					11																	111571671		2201	4297	6498	111076881	SO:0001819	synonymous_variant	23235	exon5			AB018324	CCDS8347.1	11q23.1	2008-12-23	2008-12-23	2008-12-23	ENSG00000170145	ENSG00000170145			21680	protein-coding gene	gene with protein product		608973	"""SNF1-like kinase 2"""	SNF1LK2		15067358	Standard	NM_015191		Approved	KIAA0781, QIK, DKFZp434K1115, LOH11CR1I	uc001plt.3	Q9H0K1	OTTHUMG00000150644	ENST00000304987.3:c.540C>T	11.37:g.111571671C>T		Somatic		Capture	SOLID	Phase_I	111076881	NM_015191	A8K5B8|B0YJ94|O94878|Q17RV0|Q6AZE2|Q76N03|Q8NCV7|Q96CZ8	Silent	SNP	ENST00000304987.3	37	CCDS8347.1																																																																																				SIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319352.3	NM_015191	
ATXN1	6310	hgsc.bcm.edu	37	6	16327635	16327635	+	Missense_Mutation	SNP	G	G	A	rs374338186		TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr6:16327635G>A	ENST00000244769.4	-	8	1843	c.907C>T	c.(907-909)Cgg>Tgg	p.R303W	ATXN1_ENST00000436367.1_Missense_Mutation_p.R303W	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	303					adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)	p.R303W(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				GTGGCCTCCCGAGGGACAAAG	0.662																																					p.R303W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C907T	6						.	G	TRP/ARG,TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	31.0	36.0	34.0		907,907	4.9	0.3	6		34	0,8600		0,0,4300	no	missense,missense	ATXN1	NM_000332.3,NM_001128164.1	101,101	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	303/816,303/816	16327635	1,13005	2203	4300	6503	16435614	SO:0001583	missense	6310	exon8			X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.907C>T	6.37:g.16327635G>A	ENSP00000244769:p.Arg303Trp	Somatic		Capture	SOLID	Phase_I	16435614	NM_000332	Q17S02|Q9UJG2|Q9Y4J1	Missense_Mutation	SNP	ENST00000244769.4	37	CCDS34342.1	.	.	.	.	.	.	.	.	.	.	G	16.96	3.267394	0.59540	2.27E-4	0.0	ENSG00000124788	ENST00000244769;ENST00000450222;ENST00000436367	T;T	0.37058	1.22;1.22	4.94	4.94	0.65067	.	0.000000	0.64402	D	0.000007	T	0.45357	0.1338	L	0.56769	1.78	0.42717	D	0.993662	D	0.89917	1.0	D	0.79784	0.993	T	0.47947	-0.9077	10	0.72032	D	0.01	-20.2388	11.5614	0.50778	0.0:0.0:0.6908:0.3092	.	303	P54253	ATX1_HUMAN	W	303	ENSP00000244769:R303W;ENSP00000416360:R303W	ENSP00000244769:R303W	R	-	1	2	ATXN1	16435614	0.972000	0.33761	0.261000	0.24466	0.796000	0.44982	3.311000	0.51919	2.283000	0.76528	0.462000	0.41574	CGG		ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332	
SESN1	27244	hgsc.bcm.edu	37	6	109308759	109308759	+	Silent	SNP	G	G	T			TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr6:109308759G>T	ENST00000356644.7	-	10	1561	c.1467C>A	c.(1465-1467)cgC>cgA	p.R489R	SESN1_ENST00000302071.2_Silent_p.R423R|SESN1_ENST00000436639.2_Silent_p.R548R	NM_001199933.1	NP_001186862.1	Q9Y6P5	SESN1_HUMAN	sestrin 1	489					cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|negative regulation of cell proliferation (GO:0008285)|regulation of protein kinase B signaling (GO:0051896)|regulation of response to reactive oxygen species (GO:1901031)	nucleus (GO:0005634)		p.R548R(1)		cervix(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	10		all_cancers(87;6.45e-05)|Acute lymphoblastic leukemia(125;3.55e-10)|all_hematologic(75;1.68e-07)|all_epithelial(87;0.0106)|Colorectal(196;0.0637)		Epithelial(106;0.0014)|BRCA - Breast invasive adenocarcinoma(108;0.00146)|all cancers(137;0.0031)|OV - Ovarian serous cystadenocarcinoma(136;0.0117)		AGGTCATATAGCGGGTAATGG	0.403																																					p.R548R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1644A	6						.						124.0	114.0	117.0					6																	109308759		2203	4300	6503	109415452	SO:0001819	synonymous_variant	27244	exon10			AF033120	CCDS5070.1, CCDS56444.1, CCDS56445.1	6q21	2008-10-23			ENSG00000080546	ENSG00000080546			21595	protein-coding gene	gene with protein product		606103				9926927, 7938006	Standard	NM_014454		Approved	SEST1, PA26	uc003psu.3	Q9Y6P5	OTTHUMG00000015338	ENST00000356644.7:c.1467C>A	6.37:g.109308759G>T		Somatic		Capture	SOLID	Phase_I	109415452	NM_014454	Q2M2B7|Q5T316|Q9NV00|Q9UPD5|Q9Y6P6	Silent	SNP	ENST00000356644.7	37	CCDS56445.1																																																																																				SESN1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041738.4	NM_014454	
BMP6	654	hgsc.bcm.edu	37	6	7845400	7845400	+	Missense_Mutation	SNP	G	G	A	rs566660170		TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr6:7845400G>A	ENST00000283147.6	+	2	851	c.692G>A	c.(691-693)cGt>cAt	p.R231H		NM_001718.4	NP_001709.1	P22004	BMP6_HUMAN	bone morphogenetic protein 6	231					BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular response to mechanical stimulus (GO:0071260)|endochondral ossification (GO:0001958)|eye development (GO:0001654)|growth (GO:0040007)|immune response (GO:0006955)|inflammatory response (GO:0006954)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|osteoblast differentiation (GO:0001649)|positive regulation of aldosterone biosynthetic process (GO:0032349)|positive regulation of aldosterone secretion (GO:2000860)|positive regulation of bone mineralization (GO:0030501)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to activity (GO:0014823)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to retinoic acid (GO:0032526)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|type B pancreatic cell development (GO:0003323)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)|protein heterodimerization activity (GO:0046982)	p.R231H(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(6)|ovary(1)|prostate(1)	23	Ovarian(93;0.0721)					TTCTCCCCTCGTCAGCGACAC	0.468													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19565	0.0		0.0	False		,,,				2504	0.0				p.R231H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G692A	6						.						129.0	126.0	127.0					6																	7845400		2203	4300	6503	7790399	SO:0001583	missense	654	exon2			AF083030	CCDS4503.1	6p24-p23	2014-01-30	2003-10-06		ENSG00000153162	ENSG00000153162		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1073	protein-coding gene	gene with protein product		112266	"""vegetal related growth factor (TGFB-related)"""	VGR		1427904, 1453478	Standard	NM_001718		Approved	VGR1	uc003mxu.4	P22004	OTTHUMG00000014217	ENST00000283147.6:c.692G>A	6.37:g.7845400G>A	ENSP00000283147:p.Arg231His	Somatic		Capture	SOLID	Phase_I	7790399	NM_001718	Q5TCP3	Missense_Mutation	SNP	ENST00000283147.6	37	CCDS4503.1	.	.	.	.	.	.	.	.	.	.	G	13.30	2.197499	0.38806	.	.	ENSG00000153162	ENST00000537240;ENST00000283147;ENST00000540959	T	0.66099	-0.19	5.41	2.67	0.31697	Transforming growth factor-beta, N-terminal (1);	0.253249	0.42294	N	0.000739	T	0.17662	0.0424	N	0.12961	0.28	0.25820	N	0.984296	B	0.13145	0.007	B	0.13407	0.009	T	0.15065	-1.0450	10	0.27082	T	0.32	.	4.5659	0.12186	0.3124:0.0:0.5362:0.1514	.	231	P22004	BMP6_HUMAN	H	153;231;194	ENSP00000283147:R231H	ENSP00000283147:R231H	R	+	2	0	BMP6	7790399	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.586000	0.46119	0.659000	0.30945	0.557000	0.71058	CGT		BMP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039794.1	NM_001718	
NKAPL	222698	hgsc.bcm.edu	37	6	28227574	28227574	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr6:28227574A>G	ENST00000343684.3	+	1	477	c.425A>G	c.(424-426)aAg>aGg	p.K142R	ZKSCAN4_ENST00000423974.2_5'Flank	NM_001007531.1	NP_001007532.1	Q5M9Q1	NKAPL_HUMAN	NFKB activating protein-like	142								p.K142R(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31						CCGTCTCCAAAGTTCCCTCAG	0.517																																					p.K142R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A425G	6						.						103.0	112.0	109.0					6																	28227574		2203	4300	6503	28335553	SO:0001583	missense	222698	exon1			BC038240	CCDS34353.1	6p21.33	2008-02-05	2007-08-16	2007-08-16	ENSG00000189134	ENSG00000189134			21584	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 194"""	C6orf194			Standard	NM_001007531		Approved	bA424I5.1	uc003nkt.4	Q5M9Q1	OTTHUMG00000014517	ENST00000343684.3:c.425A>G	6.37:g.28227574A>G	ENSP00000345716:p.Lys142Arg	Somatic		Capture	SOLID	Phase_I	28335553	NM_001007531	Q3MIV1|Q9H4Q7	Missense_Mutation	SNP	ENST00000343684.3	37	CCDS34353.1	.	.	.	.	.	.	.	.	.	.	A	10.40	1.339019	0.24253	.	.	ENSG00000189134	ENST00000343684	T	0.15372	2.43	5.1	1.43	0.22495	.	0.147488	0.64402	N	0.000013	T	0.04907	0.0132	L	0.48642	1.525	0.09310	N	1	B	0.15141	0.012	B	0.11329	0.006	T	0.34725	-0.9817	10	0.49607	T	0.09	-5.884	6.6544	0.22979	0.7229:0.0:0.2771:0.0	.	142	Q5M9Q1	NKAPL_HUMAN	R	142	ENSP00000345716:K142R	ENSP00000345716:K142R	K	+	2	0	NKAPL	28335553	1.000000	0.71417	0.002000	0.10522	0.617000	0.37484	3.476000	0.53143	0.169000	0.19679	0.533000	0.62120	AAG		NKAPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040185.1		
PGC	5225	hgsc.bcm.edu	37	6	41710097	41710097	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr6:41710097G>A	ENST00000373025.3	-	5	640	c.578C>T	c.(577-579)aCc>aTc	p.T193I	PGC_ENST00000425343.2_Missense_Mutation_p.T193I	NM_002630.3	NP_002621.1	P20142	PEPC_HUMAN	progastricsin (pepsinogen C)	193					digestion (GO:0007586)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)	p.T193I(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|skin(1)	16	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;0.000132)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00507)			CATAGCTGTGGTGGCCTCATC	0.607																																					p.T193I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C578T	6						.						124.0	92.0	103.0					6																	41710097		2203	4300	6503	41818075	SO:0001583	missense	5225	exon5				CCDS4859.1, CCDS55000.1	6p21.1	2012-10-02			ENSG00000096088	ENSG00000096088	3.4.23.3		8890	protein-coding gene	gene with protein product		169740					Standard	NM_002630		Approved		uc003ora.2	P20142	OTTHUMG00000014683	ENST00000373025.3:c.578C>T	6.37:g.41710097G>A	ENSP00000362116:p.Thr193Ile	Somatic		Capture	SOLID	Phase_I	41818075	NM_001166424	B4DVZ3|Q5T3D7|Q5T3D8	Missense_Mutation	SNP	ENST00000373025.3	37	CCDS4859.1	.	.	.	.	.	.	.	.	.	.	G	8.001	0.755392	0.15846	.	.	ENSG00000096088	ENST00000373025;ENST00000424183;ENST00000356667;ENST00000425343	T;T;T	0.58797	0.31;0.31;0.31	4.42	2.63	0.31362	Peptidase aspartic (1);Peptidase aspartic, catalytic (1);	0.135895	0.47093	N	0.000254	T	0.29783	0.0744	M	0.62209	1.925	0.33275	D	0.561579	P	0.40515	0.719	B	0.28638	0.092	T	0.13575	-1.0504	10	0.62326	D	0.03	.	9.4833	0.38913	0.08:0.1434:0.7767:0.0	.	193	P20142	PEPC_HUMAN	I	193;114;114;193	ENSP00000362116:T193I;ENSP00000349094:T114I;ENSP00000405094:T193I	ENSP00000349094:T114I	T	-	2	0	PGC	41818075	1.000000	0.71417	0.566000	0.28421	0.029000	0.11900	2.772000	0.47678	0.494000	0.27859	0.561000	0.74099	ACC		PGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040521.2		
ELOVL4	6785	hgsc.bcm.edu	37	6	80626571	80626571	+	Silent	SNP	C	C	T	rs17853840	byFrequency	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr6:80626571C>T	ENST00000369816.4	-	6	999	c.699G>A	c.(697-699)acG>acA	p.T233T		NM_022726.3	NP_073563.1	Q9GZR5	ELOV4_HUMAN	ELOVL fatty acid elongase 4	233					cellular lipid metabolic process (GO:0044255)|detection of visible light (GO:0009584)|fatty acid biosynthetic process (GO:0006633)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)	G-protein coupled photoreceptor activity (GO:0008020)|transferase activity (GO:0016740)	p.T233T(1)		central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		all_cancers(76;1.83e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.011)		BRCA - Breast invasive adenocarcinoma(397;0.0168)	Alpha-Linolenic Acid(DB00132)	GAGACAGTGCCGTGTGCCCAA	0.398													C|||	11	0.00219649	0.0	0.0	5008	,	,		18848	0.0109		0.0	False		,,,				2504	0.0				p.T233T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G699A	6						.	C		0,4406		0,0,2203	82.0	79.0	80.0		699	-2.6	1.0	6	dbSNP_123	80	3,8597	2.2+/-6.3	0,3,4297	no	coding-synonymous	ELOVL4	NM_022726.3		0,3,6500	TT,TC,CC		0.0349,0.0,0.0231		233/315	80626571	3,13003	2203	4300	6503	80683290	SO:0001819	synonymous_variant	6785	exon6			AF277094	CCDS4992.1	6q14	2013-01-08	2011-05-25		ENSG00000118402	ENSG00000118402			14415	protein-coding gene	gene with protein product	"""cancer/testis antigen 118"""	605512	"""elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4"""	STGD2, STGD3		11138005	Standard	NM_022726		Approved	CT118	uc003pja.4	Q9GZR5	OTTHUMG00000015087	ENST00000369816.4:c.699G>A	6.37:g.80626571C>T		Somatic		Capture	SOLID	Phase_I	80683290	NM_022726	B2R6B5|Q5TCS2|Q86YJ1|Q9H139	Silent	SNP	ENST00000369816.4	37	CCDS4992.1																																																																																				ELOVL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041315.1		
THBS2	7058	hgsc.bcm.edu	37	6	169646375	169646375	+	Splice_Site	SNP	C	C	T			TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr6:169646375C>T	ENST00000366787.3	-	5	860	c.611G>A	c.(610-612)gGt>gAt	p.G204D		NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	204	Heparin-binding. {ECO:0000255}.|Laminin G-like.				cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.G204D(1)		NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		CTGAAGCAAACCCTGTAAGTA	0.403																																					p.G204D	Esophageal Squamous(91;219 1934 18562 44706)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G611A	6						.						89.0	87.0	87.0					6																	169646375		2203	4300	6503	169388300	SO:0001630	splice_region_variant	7058	exon5				CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.610-1G>A	6.37:g.169646375C>T		Somatic		Capture	SOLID	Phase_I	169388300	NM_003247	A6H8N1|A7E232|Q5RI52	Missense_Mutation	SNP	ENST00000366787.3	37	CCDS34574.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.844669	0.91197	.	.	ENSG00000186340	ENST00000366787	T	0.16457	2.34	5.13	5.13	0.70059	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G, thrombospondin-type, N-terminal (1);	0.000000	0.41823	U	0.000813	T	0.37320	0.0999	M	0.81497	2.545	0.53005	D	0.999961	D	0.89917	1.0	D	0.97110	1.0	T	0.32981	-0.9886	10	0.87932	D	0	-33.8368	16.1088	0.81244	0.0:1.0:0.0:0.0	.	204	P35442	TSP2_HUMAN	D	204	ENSP00000355751:G204D	ENSP00000355751:G204D	G	-	2	0	THBS2	169388300	1.000000	0.71417	0.980000	0.43619	0.935000	0.57460	6.837000	0.75354	2.381000	0.81170	0.655000	0.94253	GGT		THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105439.1	NM_003247	Missense_Mutation
TP53	7157	hgsc.bcm.edu	37	17	7578502	7578502	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr17:7578502A>G	ENST00000269305.4	-	5	617	c.428T>C	c.(427-429)gTg>gCg	p.V143A	TP53_ENST00000420246.2_Missense_Mutation_p.V143A|TP53_ENST00000413465.2_Missense_Mutation_p.V143A|TP53_ENST00000445888.2_Missense_Mutation_p.V143A|TP53_ENST00000455263.2_Missense_Mutation_p.V143A|TP53_ENST00000359597.4_Missense_Mutation_p.V143A|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	143	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation; strong DNA binding ability at 32.5 degrees Celsius; strong reduction of transcriptional activity at 37.5 degrees Celsius; severely represses interaction with ZNF385A).|V -> E (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).|V -> M (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V143A(18)|p.0?(8)|p.V143E(5)|p.V11A(2)|p.V50A(2)|p.L137_W146del10(1)|p.P142_Q144delPVQ(1)|p.K139fs*4(1)|p.A138_V143delAKTCPV(1)|p.V143G(1)|p.V143_S149del(1)|p.C141fs*5(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCACAGCTGCACAGGGCAGGT	0.587		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.V143A	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,lung,NS,Substitution - Nonsense,+2	.	42	Substitution - Missense(28)|Whole gene deletion(8)|Deletion - In frame(4)|Deletion - Frameshift(2)	large_intestine(10)|stomach(7)|breast(6)|bone(4)|lung(3)|ovary(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|oesophagus(2)|vulva(1)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)	c.T428C	17						.						57.0	56.0	56.0					17																	7578502		2203	4300	6503	7519227	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.428T>C	17.37:g.7578502A>G	ENSP00000269305:p.Val143Ala	Somatic		Capture	SOLID	Phase_I	7519227	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	A	13.84	2.356636	0.41801	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99830	-7.01;-7.01;-7.01;-7.01;-7.01;-7.01;-7.01;-7.01;-7.01	5.48	1.94	0.25998	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.343688	0.28219	N	0.016151	D	0.99697	0.9885	M	0.87381	2.88	0.43191	D	0.995023	D;D;D;D;D;D;D	0.89917	0.999;0.996;0.996;0.998;0.996;0.999;1.0	D;D;D;D;D;D;D	0.87578	0.989;0.993;0.977;0.987;0.998;0.998;0.99	D	0.99035	1.0822	10	0.87932	D	0	-32.0412	3.2523	0.06819	0.6411:0.1439:0.0771:0.1378	.	104;143;143;50;143;143;143	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	A	143;143;143;143;143;143;132;50;11;50;11;143	ENSP00000410739:V143A;ENSP00000352610:V143A;ENSP00000269305:V143A;ENSP00000398846:V143A;ENSP00000391127:V143A;ENSP00000391478:V143A;ENSP00000425104:V11A;ENSP00000423862:V50A;ENSP00000424104:V143A	ENSP00000269305:V143A	V	-	2	0	TP53	7519227	1.000000	0.71417	0.664000	0.29753	0.012000	0.07955	9.264000	0.95635	0.097000	0.17492	-0.336000	0.08194	GTG		TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
DNAH3	55567	hgsc.bcm.edu	37	16	20976044	20976044	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr16:20976044C>A	ENST00000261383.3	-	53	9161	c.9162G>T	c.(9160-9162)tgG>tgT	p.W3054C	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3054	AAA 5. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.W3054C(2)		NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		CAGCAATCTGCCAGGCACGGA	0.512																																					p.W3054C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G9162T	16						.						79.0	70.0	73.0					16																	20976044		2201	4300	6501	20883545	SO:0001583	missense	55567	exon53			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.9162G>T	16.37:g.20976044C>A	ENSP00000261383:p.Trp3054Cys	Somatic		Capture	SOLID	Phase_I	20883545	NM_017539	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.943194	0.73672	.	.	ENSG00000158486	ENST00000261383	T	0.72051	-0.62	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	D	0.93148	0.7818	H	0.99952	5.035	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95911	0.8923	10	0.87932	D	0	.	20.5792	0.99380	0.0:1.0:0.0:0.0	.	3054	Q8TD57	DYH3_HUMAN	C	3054	ENSP00000261383:W3054C	ENSP00000261383:W3054C	W	-	3	0	DNAH3	20883545	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.873000	0.98535	0.561000	0.74099	TGG		DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539	
L3MBTL4	91133	hgsc.bcm.edu	37	18	6171929	6171929	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr18:6171929C>T	ENST00000284898.6	-	13	1194	c.994G>A	c.(994-996)Ggt>Agt	p.G332S	L3MBTL4_ENST00000400105.2_Missense_Mutation_p.G332S|L3MBTL4_ENST00000535782.1_Missense_Mutation_p.G145S|L3MBTL4_ENST00000317931.7_Missense_Mutation_p.G332S|L3MBTL4_ENST00000400104.3_Missense_Mutation_p.G332S	NM_173464.3	NP_775735.2	Q8NA19	LMBL4_HUMAN	l(3)mbt-like 4 (Drosophila)	332					chromatin modification (GO:0016568)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.G332S(1)		breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(17)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		Colorectal(10;0.0249)				TGGTCCCAACCATCAAAATGA	0.418																																					p.G332S	Esophageal Squamous(41;748 902 17366 28959 43175)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G994A	18						.						75.0	61.0	66.0					18																	6171929		2198	4286	6484	6161929	SO:0001583	missense	91133	exon13			BC039316	CCDS11839.2	18p11.31-p11.23	2013-01-10			ENSG00000154655	ENSG00000154655		"""Sterile alpha motif (SAM) domain containing"""	26677	protein-coding gene	gene with protein product						14702039	Standard	NM_173464		Approved	FLJ35936, HsT1031	uc010dkt.3	Q8NA19	OTTHUMG00000131573	ENST00000284898.6:c.994G>A	18.37:g.6171929C>T	ENSP00000284898:p.Gly332Ser	Somatic		Capture	SOLID	Phase_I	6161929	NM_173464	A8MTL8|Q8IXS3	Missense_Mutation	SNP	ENST00000284898.6	37	CCDS11839.2	.	.	.	.	.	.	.	.	.	.	C	30	5.055126	0.93793	.	.	ENSG00000154655	ENST00000400105;ENST00000317931;ENST00000284898;ENST00000535782;ENST00000400104	T;T;T;T;T	0.56941	0.43;0.43;0.43;0.43;0.43	5.64	5.64	0.86602	.	0.150087	0.43260	D	0.000590	T	0.73063	0.3539	M	0.77486	2.375	0.48395	D	0.999641	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.75587	-0.3266	10	0.66056	D	0.02	.	15.2049	0.73173	0.0:1.0:0.0:0.0	.	332;332	Q8NA19;F8W9S8	LMBL4_HUMAN;.	S	332;332;332;145;332	ENSP00000382976:G332S;ENSP00000318543:G332S;ENSP00000284898:G332S;ENSP00000444774:G145S;ENSP00000382975:G332S	ENSP00000284898:G332S	G	-	1	0	L3MBTL4	6161929	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	6.140000	0.71738	2.654000	0.90174	0.650000	0.86243	GGT		L3MBTL4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254448.2	NM_173464	
GALNT15	117248	hgsc.bcm.edu	37	3	16254135	16254135	+	Silent	SNP	C	C	T			TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr3:16254135C>T	ENST00000339732.5	+	6	1760	c.1257C>T	c.(1255-1257)taC>taT	p.Y419Y	GALNT15_ENST00000437509.1_Silent_p.Y419Y	NM_054110.4	NP_473451.3	Q8N3T1	GLT15_HUMAN	polypeptide N-acetylgalactosaminyltransferase 15	419	Catalytic subdomain B.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.Y419Y(1)									GACACATCTACCAAAATCAGG	0.542																																					p.Y419Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1257T	3						.						108.0	92.0	97.0					3																	16254135		2203	4300	6503	16229139	SO:0001819	synonymous_variant	117248	exon6			AY358443	CCDS33711.1	3p25.1	2014-03-13	2014-03-13	2013-01-25	ENSG00000131386	ENSG00000131386	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	21531	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 15"""	615131	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 2"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"""	GALNTL2		12975309, 14702039, 15147861	Standard	NM_054110		Approved	GALNT7, pp-GalNAc-T15	uc003car.4	Q8N3T1	OTTHUMG00000156893	ENST00000339732.5:c.1257C>T	3.37:g.16254135C>T		Somatic		Capture	SOLID	Phase_I	16229139	NM_054110	A6NMN1|B2R638|F1LIP6|Q86T60|Q96C46|Q96DJ5	Silent	SNP	ENST00000339732.5	37	CCDS33711.1																																																																																				GALNT15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346483.2	NM_054110	
HTR3D	200909	hgsc.bcm.edu	37	3	183755930	183755930	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr3:183755930C>T	ENST00000382489.3	+	6	782	c.782C>T	c.(781-783)gCc>gTc	p.A261V	HTR3D_ENST00000428798.2_Missense_Mutation_p.A213V|HTR3D_ENST00000334128.2_Missense_Mutation_p.A88V|HTR3D_ENST00000453435.1_Missense_Mutation_p.A42V	NM_001163646.1	NP_001157118.1	Q70Z44	5HT3D_HUMAN	5-hydroxytryptamine (serotonin) receptor 3D, ionotropic	261					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)	p.A88V(1)		large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(2)	10	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;6.23e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Ergoloid mesylate(DB01049)	GGGAATTGTGCCCCATTCAAG	0.517																																					p.A261V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C782T	3						.						131.0	112.0	119.0					3																	183755930		2203	4300	6503	185238624	SO:0001583	missense	200909	exon6			AY159812	CCDS3249.1, CCDS46966.1, CCDS54685.1	3q27	2012-05-22	2012-02-03		ENSG00000186090	ENSG00000186090		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	24004	protein-coding gene	gene with protein product		610122	"""5-hydroxytryptamine (serotonin) receptor 3 family member D"""			12801637	Standard	NM_001145143		Approved		uc011bqv.2	Q70Z44	OTTHUMG00000156858	ENST00000382489.3:c.782C>T	3.37:g.183755930C>T	ENSP00000371929:p.Ala261Val	Somatic		Capture	SOLID	Phase_I	185238624	NM_001163646	C9J2I6|J3QT78|Q495N5|Q495N6|Q7Z6B3	Missense_Mutation	SNP	ENST00000382489.3	37	CCDS54685.1	.	.	.	.	.	.	.	.	.	.	C	7.355	0.623584	0.14193	.	.	ENSG00000186090	ENST00000334128;ENST00000428798;ENST00000382489;ENST00000453435	T;T;T;T	0.80994	-1.44;-1.44;-1.44;-1.44	3.29	2.4	0.29515	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.076815	0.50627	D	0.000104	T	0.61248	0.2332	N	0.12527	0.23	0.24389	N	0.994758	B;B;B;B	0.32324	0.364;0.073;0.01;0.073	B;B;B;B	0.37943	0.261;0.075;0.03;0.075	T	0.54437	-0.8294	10	0.02654	T	1	-24.4361	9.758	0.40515	0.2078:0.7922:0.0:0.0	.	261;88;42;88	Q70Z44;Q70Z44-2;Q70Z44-3;F6WC43	5HT3D_HUMAN;.;.;.	V	88;213;261;42	ENSP00000334315:A88V;ENSP00000405409:A213V;ENSP00000371929:A261V;ENSP00000389268:A42V	ENSP00000334315:A88V	A	+	2	0	HTR3D	185238624	0.932000	0.31603	0.147000	0.22382	0.004000	0.04260	2.501000	0.45389	0.722000	0.32252	-0.268000	0.10319	GCC		HTR3D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346289.1	NM_182537	
BOD1L1	259282	hgsc.bcm.edu	37	4	13601870	13601870	+	Silent	SNP	G	G	A			TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr4:13601870G>A	ENST00000040738.5	-	10	6789	c.6654C>T	c.(6652-6654)ctC>ctT	p.L2218L		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	2218						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.L2218L(1)									TAGTGGAAATGAGAGCACATT	0.507																																					p.L2218L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C6654T	4						.						82.0	66.0	71.0					4																	13601870		2203	4300	6503	13210968	SO:0001819	synonymous_variant	259282	exon10			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.6654C>T	4.37:g.13601870G>A		Somatic		Capture	SOLID	Phase_I	13210968	NM_148894	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Silent	SNP	ENST00000040738.5	37	CCDS3411.2																																																																																				BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894	
FAAH2	158584	hgsc.bcm.edu	37	X	57358063	57358063	+	Missense_Mutation	SNP	C	C	T	rs184337210		TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chrX:57358063C>T	ENST00000374900.4	+	4	565	c.445C>T	c.(445-447)Cgt>Tgt	p.R149C		NM_174912.3	NP_777572.2	Q6GMR7	FAAH2_HUMAN	fatty acid amide hydrolase 2	149						integral component of membrane (GO:0016021)	carbon-nitrogen ligase activity, with glutamine as amido-N-donor (GO:0016884)|hydrolase activity (GO:0016787)	p.R149C(1)		endometrium(2)|large_intestine(4)|lung(10)|ovary(3)|upper_aerodigestive_tract(3)	22						CATGAACCGTCGTGATGCCAT	0.418										HNSCC(52;0.14)			.|||	2	0.000529801	0.0	0.0	3775	,	,		14597	0.002		0.0	False		,,,				2504	0.0				p.R149C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C445T	X						.						109.0	88.0	95.0					X																	57358063		2203	4300	6503	57374788	SO:0001583	missense	158584	exon4			AK055766	CCDS14375.1	Xp11.1	2008-02-05	2006-11-24	2006-11-24	ENSG00000165591	ENSG00000165591			26440	protein-coding gene	gene with protein product		300654	"""amidase domain containing"""	AMDD		17015445	Standard	NM_174912		Approved	RP11-479E16.1, FLJ31204, FAAH-2	uc004dvc.3	Q6GMR7	OTTHUMG00000021684	ENST00000374900.4:c.445C>T	X.37:g.57358063C>T	ENSP00000364035:p.Arg149Cys	Somatic		Capture	SOLID	Phase_I	57374788	NM_174912	Q86VT2|Q96N98	Missense_Mutation	SNP	ENST00000374900.4	37	CCDS14375.1	2	0.0012055455093429777	0	0.0	0	0.0	0	0.0	0	0.0	C	6.490	0.458566	0.12342	.	.	ENSG00000165591	ENST00000374900	T	0.55413	0.52	2.38	2.38	0.29361	Amidase signature domain (2);	0.321345	0.24271	U	0.039998	T	0.48909	0.1526	L	0.60012	1.86	0.34600	D	0.716397	B	0.19583	0.037	B	0.28232	0.087	T	0.60357	-0.7279	10	0.72032	D	0.01	.	10.0897	0.42439	0.0:1.0:0.0:0.0	.	149	Q6GMR7	FAAH2_HUMAN	C	149	ENSP00000364035:R149C	ENSP00000364035:R149C	R	+	1	0	FAAH2	57374788	0.025000	0.19082	0.591000	0.28745	0.411000	0.31082	0.707000	0.25704	0.910000	0.36722	0.506000	0.49869	CGT		FAAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056919.1	NM_174912	
ZEB2	9839	hgsc.bcm.edu	37	2	145162528	145162528	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr2:145162528C>T	ENST00000558170.2	-	5	1651	c.467G>A	c.(466-468)cGc>cAc	p.R156H	ZEB2_ENST00000303660.4_Missense_Mutation_p.R156H|ZEB2_ENST00000409487.3_Missense_Mutation_p.R156H|ZEB2_ENST00000539609.3_Missense_Mutation_p.R132H	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	156					cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)	p.R156H(2)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		ATGACCATCGCGTTCCTCCAG	0.473																																					p.R132H	Melanoma(33;1235 1264 5755 16332)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G395A	2						.						103.0	89.0	94.0					2																	145162528		2203	4300	6503	144878998	SO:0001583	missense	9839	exon4			AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.467G>A	2.37:g.145162528C>T	ENSP00000454157:p.Arg156His	Somatic		Capture	SOLID	Phase_I	144878998	NM_001171653	A0JP09|B7Z2P2|F5H814|Q9UED1	Missense_Mutation	SNP	ENST00000558170.2	37	CCDS2186.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.00|13.00	2.105804|2.105804	0.37145|0.37145	.|.	.|.	ENSG00000169554|ENSG00000169554	ENST00000431672;ENST00000440875|ENST00000392860;ENST00000539609;ENST00000303660;ENST00000409487;ENST00000427902;ENST00000392861	.|T;T;T;T;T	.|0.76709	.|-1.04;-1.04;-1.04;-1.04;-1.04	5.62|5.62	5.62|5.62	0.85841|0.85841	.|.	.|0.097230	.|0.64402	.|D	.|0.000002	T|T	0.63558|0.63558	0.2521|0.2521	N|N	0.22421|0.22421	0.69|0.69	0.31834|0.31834	N|N	0.624343|0.624343	.|P;P;B;B	.|0.41643	.|0.758;0.733;0.431;0.431	.|B;B;B;B	.|0.24974	.|0.023;0.057;0.057;0.057	T|T	0.71735|0.71735	-0.4503|-0.4503	5|10	.|0.49607	.|T	.|0.09	-6.2093|-6.2093	20.0114|20.0114	0.97452|0.97452	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|132;21;155;156	.|F5H814;Q53TD9;A0JP08;O60315	.|.;.;.;ZEB2_HUMAN	T|H	122;143|151;132;156;156;156;156	.|ENSP00000443792:R132H;ENSP00000302501:R156H;ENSP00000386854:R156H;ENSP00000395496:R156H;ENSP00000376601:R156H	.|ENSP00000302501:R156H	A|R	-|-	1|2	0|0	ZEB2|ZEB2	144878998|144878998	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.863000|4.863000	0.62983|0.62983	2.795000|2.795000	0.96236|0.96236	0.655000|0.655000	0.94253|0.94253	GCG|CGC		ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254778.5	NM_014795	
LRP2	4036	hgsc.bcm.edu	37	2	170177304	170177304	+	Missense_Mutation	SNP	G	G	A	rs115350461	byFrequency	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr2:170177304G>A	ENST00000263816.3	-	2	455	c.170C>T	c.(169-171)gCg>gTg	p.A57V	LRP2_ENST00000443831.1_Missense_Mutation_p.A57V	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	57	LDL-receptor class A 1. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.A57V(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	AATTTCATCCGCGTCATCTGA	0.483													G|||	5	0.000998403	0.003	0.0	5008	,	,		16639	0.001		0.0	False		,,,				2504	0.0				p.A57V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C170T	2						.	G	VAL/ALA	14,4392	21.2+/-45.6	0,14,2189	143.0	114.0	124.0		170	5.8	0.0	2	dbSNP_132	124	1,8599	1.2+/-3.3	0,1,4299	yes	missense	LRP2	NM_004525.2	64	0,15,6488	AA,AG,GG		0.0116,0.3177,0.1153	benign	57/4656	170177304	15,12991	2203	4300	6503	169885550	SO:0001583	missense	4036	exon2				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.170C>T	2.37:g.170177304G>A	ENSP00000263816:p.Ala57Val	Somatic		Capture	SOLID	Phase_I	169885550	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	3	0.0013736263736263737	3	0.006097560975609756	0	0.0	0	0.0	0	0.0	G	18.96	3.733380	0.69189	0.003177	1.16E-4	ENSG00000081479	ENST00000263816;ENST00000443831	D;D	0.95518	-3.73;-3.73	5.79	5.79	0.91817	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.841101	0.10590	N	0.656938	D	0.91882	0.7430	L	0.42245	1.32	0.21290	N	0.999736	B;B	0.27932	0.194;0.16	B;B	0.27608	0.064;0.081	T	0.82942	-0.0207	9	.	.	.	.	20.024	0.97514	0.0:0.0:1.0:0.0	.	57;57	E9PC35;P98164	.;LRP2_HUMAN	V	57	ENSP00000263816:A57V;ENSP00000409813:A57V	.	A	-	2	0	LRP2	169885550	1.000000	0.71417	0.007000	0.13788	0.012000	0.07955	9.434000	0.97515	2.718000	0.92993	0.655000	0.94253	GCG		LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
SFTPB	6439	hgsc.bcm.edu	37	2	85892780	85892780	+	Silent	SNP	G	G	A			TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr2:85892780G>A	ENST00000519937.2	-	5	550	c.531C>T	c.(529-531)gtC>gtT	p.V177V	SFTPB_ENST00000342375.3_Silent_p.V177V|SFTPB_ENST00000409383.1_Silent_p.V189V|SFTPB_ENST00000393822.3_Silent_p.V189V			P07988	PSPB_HUMAN	surfactant protein B	177					organ morphogenesis (GO:0009887)|respiratory gaseous exchange (GO:0007585)|sphingolipid metabolic process (GO:0006665)	extracellular region (GO:0005576)|lysosome (GO:0005764)		p.V177V(1)		central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|skin(3)	16						GCACAGGGAGGACGAGCTTGT	0.667																																					p.V189V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C567T	2						.						47.0	50.0	49.0					2																	85892780		2203	4300	6503	85746291	SO:0001819	synonymous_variant	6439	exon6			J02761	CCDS1983.1, CCDS1983.2	2p12-p11.2	2008-08-26	2008-08-26		ENSG00000168878	ENSG00000168878			10801	protein-coding gene	gene with protein product		178640	"""surfactant, pulmonary-associated protein B"""	SFTP3		2924687, 1346779	Standard	NM_198843		Approved	SP-B	uc002sqh.3	P07988	OTTHUMG00000130181	ENST00000519937.2:c.531C>T	2.37:g.85892780G>A		Somatic		Capture	SOLID	Phase_I	85746291	NM_198843	Q96R04	Silent	SNP	ENST00000519937.2	37		.	.	.	.	.	.	.	.	.	.	g	9.618	1.133065	0.21041	.	.	ENSG00000168878	ENST00000428225	.	.	.	4.11	0.891	0.19224	.	.	.	.	.	T	0.42787	0.1218	.	.	.	0.40823	D	0.983527	.	.	.	.	.	.	T	0.29701	-1.0003	4	.	.	.	-3.9869	2.0691	0.03609	0.1146:0.2:0.4801:0.2052	.	.	.	.	S	174	.	.	P	-	1	0	SFTPB	85746291	0.968000	0.33430	0.923000	0.36655	0.319000	0.28217	1.676000	0.37565	0.435000	0.26365	0.556000	0.70494	CCT		SFTPB-001	KNOWN	alternative_3_UTR|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000252499.3	NM_198843	
MAP2	4133	hgsc.bcm.edu	37	2	210574735	210574735	+	Silent	SNP	T	T	A			TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr2:210574735T>A	ENST00000360351.4	+	12	5336	c.4830T>A	c.(4828-4830)tcT>tcA	p.S1610S	MAP2_ENST00000475600.1_3'UTR|MAP2_ENST00000392194.1_Silent_p.S254S|MAP2_ENST00000361559.4_Silent_p.S254S|MAP2_ENST00000199940.6_Silent_p.S311S|MAP2_ENST00000447185.1_Silent_p.S1606S	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	1610					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.S1610S(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	CAAGTTATTCTTCACGCACAC	0.582																																					p.S254S	Pancreas(27;423 979 28787 29963)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T762A	2						.						132.0	119.0	124.0					2																	210574735		2203	4300	6503	210282980	SO:0001819	synonymous_variant	4133	exon9				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.4830T>A	2.37:g.210574735T>A		Somatic		Capture	SOLID	Phase_I	210282980	NM_031847	Q17S04|Q8IUX2|Q99975|Q99976	Silent	SNP	ENST00000360351.4	37	CCDS2384.1																																																																																				MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538	
ACO1	48	hgsc.bcm.edu	37	9	32419050	32419050	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr9:32419050G>A	ENST00000309951.6	+	7	811	c.673G>A	c.(673-675)Gaa>Aaa	p.E225K	ACO1_ENST00000379923.1_Missense_Mutation_p.E225K|ACO1_ENST00000541043.1_Missense_Mutation_p.E126K	NM_002197.2	NP_002188.1	P21399	ACOC_HUMAN	aconitase 1, soluble	225					cellular iron ion homeostasis (GO:0006879)|citrate metabolic process (GO:0006101)|intestinal absorption (GO:0050892)|post-embryonic development (GO:0009791)|regulation of translation (GO:0006417)|response to iron(II) ion (GO:0010040)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|aconitate hydratase activity (GO:0003994)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)	p.E225K(1)		breast(1)|endometrium(7)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	30			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;3.94e-06)		CGGTGGTATTGAAGCAGAAGC	0.488																																					p.E225K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G673A	9						.						177.0	127.0	144.0					9																	32419050		2203	4300	6503	32409050	SO:0001583	missense	48	exon7			M58510	CCDS6525.1	9p21.1	2013-05-21			ENSG00000122729	ENSG00000122729	4.2.1.3		117	protein-coding gene	gene with protein product	"""aconitate hydratase, cytoplasmic"""	100880		IREB1		2172968, 2771641	Standard	NM_002197		Approved	IRP1, IREBP	uc003zqw.4	P21399	OTTHUMG00000019740	ENST00000309951.6:c.673G>A	9.37:g.32419050G>A	ENSP00000309477:p.Glu225Lys	Somatic		Capture	SOLID	Phase_I	32409050	NM_002197	D3DRK7|Q14652|Q5VZA7	Missense_Mutation	SNP	ENST00000309951.6	37	CCDS6525.1	.	.	.	.	.	.	.	.	.	.	G	35	5.516233	0.96402	.	.	ENSG00000122729	ENST00000432017;ENST00000309951;ENST00000379923;ENST00000379921;ENST00000541043	T;T;T	0.26373	1.74;1.74;1.74	5.64	5.64	0.86602	Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomain 1/3 (1);Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha (3);	0.000000	0.85682	D	0.000000	T	0.70579	0.3240	H	0.98918	4.37	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.83475	0.0061	10	0.87932	D	0	-19.8444	18.4726	0.90779	0.0:0.0:1.0:0.0	.	261;225	Q59FI0;P21399	.;ACOC_HUMAN	K	261;225;225;225;126	ENSP00000309477:E225K;ENSP00000369255:E225K;ENSP00000438733:E126K	ENSP00000309477:E225K	E	+	1	0	ACO1	32409050	1.000000	0.71417	0.996000	0.52242	0.990000	0.78478	9.869000	0.99810	2.637000	0.89404	0.563000	0.77884	GAA		ACO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051998.3	NM_002197	
SECISBP2	79048	hgsc.bcm.edu	37	9	91947846	91947846	+	Silent	SNP	C	C	T	rs200187621		TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr9:91947846C>T	ENST00000375807.3	+	6	896	c.825C>T	c.(823-825)aaC>aaT	p.N275N	SECISBP2_ENST00000339901.4_Silent_p.N202N|SECISBP2_ENST00000534113.2_Silent_p.N207N	NM_001282688.1|NM_001282690.1|NM_024077.3	NP_001269617.1|NP_001269619.1|NP_076982.3	Q96T21	SEBP2_HUMAN	SECIS binding protein 2	275					translation (GO:0006412)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|selenocysteine insertion sequence binding (GO:0035368)	p.N275N(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(3)|skin(2)	32						TGAAAAATAACCCAAATGAAT	0.323													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20345	0.0		0.0	False		,,,				2504	0.0				p.N275N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C825T	9						.						94.0	90.0	91.0					9																	91947846		2203	4300	6503	91137666	SO:0001819	synonymous_variant	79048	exon6			AF380995	CCDS6683.1, CCDS65076.1, CCDS65077.1	9q22	2008-02-05			ENSG00000187742	ENSG00000187742			30972	protein-coding gene	gene with protein product		607693				11230166	Standard	XM_005252193		Approved		uc004aqj.1	Q96T21	OTTHUMG00000020182	ENST00000375807.3:c.825C>T	9.37:g.91947846C>T		Somatic		Capture	SOLID	Phase_I	91137666	NM_024077	F8W892|Q5HYY1|Q8IYC0|Q9H0A1	Silent	SNP	ENST00000375807.3	37	CCDS6683.1																																																																																				SECISBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052990.3	NM_024077	
PNPLA7	375775	hgsc.bcm.edu	37	9	140400491	140400491	+	Missense_Mutation	SNP	G	G	A	rs375690090		TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr9:140400491G>A	ENST00000277531.4	-	12	1381	c.1195C>T	c.(1195-1197)Cgt>Tgt	p.R399C	PNPLA7_ENST00000406427.1_Missense_Mutation_p.R424C|PNPLA7_ENST00000371457.1_Missense_Mutation_p.R5C	NM_152286.3	NP_689499.3	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7	399				Missing (in Ref. 1; BAC86509). {ECO:0000305}.	lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	lysophospholipase activity (GO:0004622)	p.R399C(1)		breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)		ACCCTGGCACGGTCACATGCC	0.652																																					p.R399C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1195T	9						.	G	CYS/ARG,CYS/ARG	0,4404		0,0,2202	71.0	63.0	66.0		1270,1195	1.9	0.8	9		66	1,8597	1.2+/-3.3	0,1,4298	no	missense,missense	PNPLA7	NM_001098537.1,NM_152286.3	180,180	0,1,6500	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	424/1343,399/1318	140400491	1,13001	2202	4299	6501	139520312	SO:0001583	missense	375775	exon12			AK126267	CCDS7045.1, CCDS48070.1	9q34.3	2009-01-12	2006-06-12	2006-06-12	ENSG00000130653	ENSG00000130653		"""Patatin-like phospholipase domain containing"""	24768	protein-coding gene	gene with protein product		612122	"""chromosome 9 open reading frame 111"""	C9orf111		16799181, 12640454, 19029121	Standard	XM_005266082		Approved	FLJ43070, FLJ31318, FLJ44279, RP11-48C7.2, NTEL1, NTE-R1	uc010ncj.1	Q6ZV29	OTTHUMG00000020990	ENST00000277531.4:c.1195C>T	9.37:g.140400491G>A	ENSP00000277531:p.Arg399Cys	Somatic		Capture	SOLID	Phase_I	139520312	NM_152286	B5MDD3|Q5T364|Q658X0|Q658Y3|Q6ZTS1|Q86YU8|Q8TAY5|Q96N75|Q9H7N5	Missense_Mutation	SNP	ENST00000277531.4	37	CCDS7045.1	.	.	.	.	.	.	.	.	.	.	G	8.584	0.882907	0.17467	0.0	1.16E-4	ENSG00000130653	ENST00000371457;ENST00000277531;ENST00000406427;ENST00000371451;ENST00000434090	T;T;T;T	0.75050	-0.9;0.02;0.01;0.03	3.96	1.93	0.25924	.	0.127757	0.51477	N	0.000099	T	0.81278	0.4789	M	0.80746	2.51	0.29683	N	0.841585	D;P	0.62365	0.991;0.72	P;B	0.61874	0.895;0.117	T	0.75065	-0.3449	10	0.62326	D	0.03	-9.4752	5.8164	0.18495	0.1105:0.0:0.6372:0.2523	.	424;399	Q6ZV29-5;Q6ZV29	.;PLPL7_HUMAN	C	5;399;424;399;390	ENSP00000360512:R5C;ENSP00000277531:R399C;ENSP00000384610:R424C;ENSP00000400582:R390C	ENSP00000277531:R399C	R	-	1	0	PNPLA7	139520312	0.000000	0.05858	0.810000	0.32431	0.040000	0.13550	0.191000	0.17076	0.785000	0.33685	-0.203000	0.12734	CGT		PNPLA7-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254787.1	NM_152286	
RXFP2	122042	hgsc.bcm.edu	37	13	32340101	32340101	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr13:32340101A>C	ENST00000298386.2	+	5	505	c.434A>C	c.(433-435)aAg>aCg	p.K145T	RXFP2_ENST00000380314.1_Missense_Mutation_p.K145T	NM_130806.3	NP_570718.1	Q8WXD0	RXFP2_HUMAN	relaxin/insulin-like family peptide receptor 2	145					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oocyte maturation (GO:0001556)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	peptide hormone binding (GO:0017046)|protein-hormone receptor activity (GO:0016500)	p.K145T(1)		cervix(1)|endometrium(2)|large_intestine(15)|lung(13)|prostate(1)|stomach(1)	33		Lung SC(185;0.0262)		all cancers(112;0.000559)|Epithelial(112;0.0017)|OV - Ovarian serous cystadenocarcinoma(117;0.0145)|BRCA - Breast invasive adenocarcinoma(63;0.0535)		aggtctcttaagaaaaacaaa	0.308																																					p.K145T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A434C	13						.						58.0	57.0	57.0					13																	32340101		2196	4285	6481	31238101	SO:0001583	missense	122042	exon5			AF403384	CCDS9342.1, CCDS53862.1	13q12.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000133105	ENSG00000133105		"""GPCR / Class A : Relaxin family peptide receptors"""	17318	protein-coding gene	gene with protein product		606655	"""leucine-rich repeat-containing G protein-coupled receptor 8"""	LGR8		12217959, 12970298, 15956688, 16507880	Standard	NM_130806		Approved	GREAT, GPR106, INSL3R, RXFPR2	uc001utt.3	Q8WXD0	OTTHUMG00000016690	ENST00000298386.2:c.434A>C	13.37:g.32340101A>C	ENSP00000298386:p.Lys145Thr	Somatic		Capture	SOLID	Phase_I	31238101	NM_001166058	B1ALE9|Q3KU23	Missense_Mutation	SNP	ENST00000298386.2	37	CCDS9342.1	.	.	.	.	.	.	.	.	.	.	A	13.98	2.399495	0.42512	.	.	ENSG00000133105	ENST00000380314;ENST00000298386	T;T	0.04275	4.35;3.66	4.77	4.77	0.60923	.	0.158698	0.53938	D	0.000053	T	0.02688	0.0081	N	0.04387	-0.21	0.47778	D	0.999512	B;B	0.18741	0.03;0.03	B;B	0.26517	0.07;0.07	T	0.49679	-0.8914	10	0.10377	T	0.69	.	12.5576	0.56263	1.0:0.0:0.0:0.0	.	145;145	Q3KU23;Q8WXD0	.;RXFP2_HUMAN	T	145	ENSP00000369670:K145T;ENSP00000298386:K145T	ENSP00000298386:K145T	K	+	2	0	RXFP2	31238101	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.249000	0.51437	1.912000	0.55364	0.533000	0.62120	AAG		RXFP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044399.1	NM_130806	
ZEB1	6935	hgsc.bcm.edu	37	10	31810524	31810524	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr10:31810524G>T	ENST00000320985.10	+	7	2371	c.2261G>T	c.(2260-2262)aGt>aTt	p.S754I	ZEB1_ENST00000560721.2_Missense_Mutation_p.S734I|ZEB1_ENST00000542815.3_Missense_Mutation_p.S687I|ZEB1_ENST00000361642.5_Missense_Mutation_p.S755I|ZEB1_ENST00000446923.2_Missense_Mutation_p.S738I|ZEB1_ENST00000559858.1_3'UTR			P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1	754					cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cellular response to amino acid stimulus (GO:0071230)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cochlea morphogenesis (GO:0090103)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pattern specification process (GO:0007389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mesenchymal cell proliferation (GO:0010464)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to activity (GO:0014823)|response to nutrient levels (GO:0031667)|semicircular canal morphogenesis (GO:0048752)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.S754I(1)		NS(2)|breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(38)|ovary(3)|skin(6)|upper_aerodigestive_tract(4)	77		Prostate(175;0.0156)				ACTATCACTAGTGTTTACCAG	0.423																																					p.S734I	Ovarian(40;423 959 14296 36701 49589)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2201T	10						.						99.0	95.0	96.0					10																	31810524		2203	4300	6503	31850530	SO:0001583	missense	6935	exon6			AK091478	CCDS7169.1, CCDS44370.1, CCDS53505.1, CCDS53506.1, CCDS53507.1	10p11.22	2014-02-14	2007-02-15	2007-02-15	ENSG00000148516	ENSG00000148516		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	11642	protein-coding gene	gene with protein product		189909	"""transcription factor 8 (represses interleukin 2 expression)"", ""posterior polymorphous corneal dystrophy 3"""	TCF8, PPCD3		1427828, 1840704, 15384081, 16252232	Standard	NM_001128128		Approved	BZP, ZEB, AREB6, NIL-2-A, Zfhep, Zfhx1a, FECD6	uc001ivu.4	P37275	OTTHUMG00000017907	ENST00000320985.10:c.2261G>T	10.37:g.31810524G>T	ENSP00000319248:p.Ser754Ile	Somatic		Capture	SOLID	Phase_I	31850530	NM_001174093	B4DJV0|B4DUW9|E9PCM7|F5H4I8|Q12924|Q13800|Q2KJ05|Q5T968|Q5VZ84|Q8NB68	Missense_Mutation	SNP	ENST00000320985.10	37	CCDS7169.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.49|15.49	2.847807|2.847807	0.51164|0.51164	.|.	.|.	ENSG00000148516|ENSG00000148516	ENST00000546250|ENST00000542879;ENST00000537225;ENST00000361642;ENST00000542815;ENST00000320985;ENST00000437844;ENST00000543514;ENST00000446923	.|T;T;T;T;T	.|0.14144	.|2.83;2.53;2.58;2.53;2.58	5.3|5.3	5.3|5.3	0.74995|0.74995	.|.	.|0.173904	.|0.42964	.|D	.|0.000631	.|T	.|0.39989	.|0.1099	M|M	0.69823|0.69823	2.125|2.125	0.53688|0.53688	D|D	0.999979|0.999979	.|D;D;D;D;D;P;D;D	.|0.76494	.|0.981;0.999;0.998;0.998;0.998;0.896;0.998;0.998	.|P;D;D;D;D;P;D;D	.|0.83275	.|0.817;0.996;0.991;0.991;0.991;0.542;0.991;0.991	.|T	.|0.16928	.|-1.0386	.|10	.|0.72032	.|D	.|0.01	.|-16.4864	19.3232|19.3232	0.94250|0.94250	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|687;754;738;754;754;734;755;754	.|F5H4I8;F5H1R1;E9PCM7;B2RBI8;A0JLS9;Q5VZ84;Q2KJ05;P37275	.|.;.;.;.;.;.;.;ZEB1_HUMAN	.|I	-1|536;754;755;687;754;734;645;738	.|ENSP00000444282:S536I;ENSP00000354487:S755I;ENSP00000444891:S687I;ENSP00000319248:S754I;ENSP00000391612:S738I	.|ENSP00000319248:S754I	.|S	+|+	.|2	.|0	ZEB1|ZEB1	31850530|31850530	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	4.977000|4.977000	0.63792|0.63792	2.633000|2.633000	0.89246|0.89246	0.650000|0.650000	0.86243|0.86243	.|AGT		ZEB1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000419083.2	NM_030751	
CRTAC1	55118	hgsc.bcm.edu	37	10	99696032	99696032	+	Missense_Mutation	SNP	C	C	T	rs373190208		TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr10:99696032C>T	ENST00000370597.3	-	3	671	c.316G>A	c.(316-318)Gcg>Acg	p.A106T	CRTAC1_ENST00000298819.4_Missense_Mutation_p.A106T|CRTAC1_ENST00000370591.2_Missense_Mutation_p.A106T	NM_018058.6	NP_060528.3	Q9NQ79	CRAC1_HUMAN	cartilage acidic protein 1	106						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)	p.A106T(1)		autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(6)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	35		Colorectal(252;0.24)		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)		TCCCGCAGCGCGTAGTAGGGT	0.617																																					p.A106T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G316A	10						.	C	THR/ALA,THR/ALA	0,4406		0,0,2203	66.0	54.0	58.0		316,316	4.8	1.0	10		58	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	CRTAC1	NM_001206528.2,NM_018058.6	58,58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	106/646,106/662	99696032	1,13005	2203	4300	6503	99686022	SO:0001583	missense	55118	exon3			AJ276171	CCDS31266.1, CCDS55723.1	10q22	2007-12-03			ENSG00000095713	ENSG00000095713			14882	protein-coding gene	gene with protein product		606276				11139377	Standard	NM_018058		Approved	FLJ10320, CEP-68, ASPIC1	uc001kou.2	Q9NQ79	OTTHUMG00000018871	ENST00000370597.3:c.316G>A	10.37:g.99696032C>T	ENSP00000359629:p.Ala106Thr	Somatic		Capture	SOLID	Phase_I	99686022	NM_018058	B1ALN4|Q5T4F8|Q8N4H6|Q8TE52|Q9NQ78|Q9NQ80|Q9NW46	Missense_Mutation	SNP	ENST00000370597.3	37	CCDS31266.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.129876	0.77549	0.0	1.16E-4	ENSG00000095713	ENST00000413387;ENST00000370597;ENST00000298819;ENST00000309155;ENST00000370591	T;T;T;T;T	0.75154	1.37;-0.91;1.25;-0.07;-0.07	4.76	4.76	0.60689	.	0.000000	0.85682	D	0.000000	T	0.79851	0.4517	L	0.53617	1.68	0.80722	D	1	P;D	0.69078	0.835;0.997	B;P	0.60609	0.089;0.877	T	0.75252	-0.3383	10	0.10111	T	0.7	-16.5833	17.7666	0.88480	0.0:1.0:0.0:0.0	.	106;106	Q9NQ79-2;Q9NQ79	.;CRAC1_HUMAN	T	2;106;106;98;106	ENSP00000408445:A2T;ENSP00000359629:A106T;ENSP00000298819:A106T;ENSP00000310810:A98T;ENSP00000359623:A106T	ENSP00000298819:A106T	A	-	1	0	CRTAC1	99686022	1.000000	0.71417	0.960000	0.40013	0.367000	0.29736	5.889000	0.69766	2.204000	0.70986	0.313000	0.20887	GCG		CRTAC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049754.1	NM_018058	
CDH10	1008	hgsc.bcm.edu	37	5	24487949	24487949	+	Silent	SNP	G	G	A	rs542487965		TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr5:24487949G>A	ENST00000264463.4	-	12	2697	c.2190C>T	c.(2188-2190)taC>taT	p.Y730Y	CDH10_ENST00000502921.1_5'UTR	NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	730					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Y730Y(1)		NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		CAAGTGAGTCGTAGGGGGGTG	0.463										HNSCC(23;0.051)			G|||	1	0.000199681	0.0008	0.0	5008	,	,		15892	0.0		0.0	False		,,,				2504	0.0				p.Y730Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2190T	5						.						106.0	109.0	108.0					5																	24487949		2203	4300	6503	24523706	SO:0001819	synonymous_variant	1008	exon12			AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.2190C>T	5.37:g.24487949G>A		Somatic		Capture	SOLID	Phase_I	24523706	NM_006727	Q9ULB3	Silent	SNP	ENST00000264463.4	37	CCDS3892.1																																																																																				CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	NM_006727	
DEPDC1B	55789	hgsc.bcm.edu	37	5	59982911	59982911	+	Silent	SNP	G	G	A			TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr5:59982911G>A	ENST00000265036.5	-	2	259	c.192C>T	c.(190-192)ggC>ggT	p.G64G	DEPDC1B_ENST00000453022.2_Silent_p.G64G|DEPDC1B_ENST00000545085.1_Silent_p.G37G	NM_018369.2	NP_060839.2	Q8WUY9	DEP1B_HUMAN	DEP domain containing 1B	64	DEP. {ECO:0000255|PROSITE- ProRule:PRU00066}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.G64G(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(2)|skin(2)	17		Lung NSC(810;0.000214)|Prostate(74;0.0147)|Breast(144;0.0991)|Ovarian(174;0.17)				TCACTTCAGGGCCGAAGTTTT	0.478																																					p.G64G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C192T	5						.						111.0	102.0	105.0					5																	59982911		2203	4300	6503	60018668	SO:0001819	synonymous_variant	55789	exon2			AF303178	CCDS3977.1, CCDS47214.1	5q12	2008-02-05			ENSG00000035499	ENSG00000035499			24902	protein-coding gene	gene with protein product	"""breast cancer cell 3"""					12477932	Standard	NM_001145208		Approved	XTP1, BRCC3	uc003jsh.3	Q8WUY9	OTTHUMG00000097083	ENST00000265036.5:c.192C>T	5.37:g.59982911G>A		Somatic		Capture	SOLID	Phase_I	60018668	NM_018369	A8K3R9|B4DUT4|Q86WJ3|Q8IZY6|Q9NUN3|Q9NW57	Silent	SNP	ENST00000265036.5	37	CCDS3977.1																																																																																				DEPDC1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214207.1	NM_018369	
PDE8B	8622	hgsc.bcm.edu	37	5	76624830	76624830	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AA-A00F-01A-01W-A005-10	TCGA-AA-A00F-10A-01W-A005-10	g.chr5:76624830C>T	ENST00000264917.5	+	4	643	c.598C>T	c.(598-600)Cgg>Tgg	p.R200W	PDE8B_ENST00000346042.3_Missense_Mutation_p.R200W|PDE8B_ENST00000342343.4_Missense_Mutation_p.R180W|PDE8B_ENST00000340978.3_Missense_Mutation_p.R200W|PDE8B_ENST00000333194.4_Missense_Mutation_p.R200W	NM_003719.3	NP_003710.1	O95263	PDE8B_HUMAN	phosphodiesterase 8B	200					cAMP catabolic process (GO:0006198)|cyclic nucleotide metabolic process (GO:0009187)|negative regulation of insulin secretion (GO:0046676)|negative regulation of steroid hormone biosynthetic process (GO:0090032)|phosphorelay signal transduction system (GO:0000160)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.R200W(1)	GMDS/PDE8B(2)	NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(10)|lung(15)|ovary(1)|prostate(2)|skin(3)	40		all_lung(232;0.00043)|Lung NSC(167;0.00114)|Ovarian(174;0.0107)|Prostate(461;0.0605)		OV - Ovarian serous cystadenocarcinoma(54;2.21e-49)|Epithelial(54;5.82e-43)|all cancers(79;4.06e-38)	Caffeine(DB00201)|Ketotifen(DB00920)	CAGGTCGATCCGGGCCACAAA	0.478																																					p.R200W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C598T	5						.						124.0	91.0	103.0					5																	76624830		2203	4300	6503	76660586	SO:0001583	missense	8622	exon4			AF079529	CCDS4037.1, CCDS34190.1, CCDS34191.1, CCDS34192.1, CCDS34193.1	5q14.1	2008-05-15			ENSG00000113231	ENSG00000113231	3.1.4.17	"""Phosphodiesterases"""	8794	protein-coding gene	gene with protein product		603390				9784418	Standard	NM_003719		Approved		uc003kfa.3	O95263	OTTHUMG00000102170	ENST00000264917.5:c.598C>T	5.37:g.76624830C>T	ENSP00000264917:p.Arg200Trp	Somatic		Capture	SOLID	Phase_I	76660586	NM_003719	Q5J7V7|Q86XK8|Q8IUJ7|Q8IUJ8|Q8IUJ9|Q8IUK0|Q8N3T2	Missense_Mutation	SNP	ENST00000264917.5	37	CCDS4037.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.749994	0.89753	.	.	ENSG00000113231	ENST00000505926;ENST00000340978;ENST00000346042;ENST00000264917;ENST00000342343;ENST00000333194;ENST00000502945	T;T;T;T;T;T;T	0.52754	0.65;0.65;0.65;0.65;0.65;0.65;0.65	5.18	5.18	0.71444	Signal transduction response regulator, receiver domain (1);	0.000000	0.85682	D	0.000000	T	0.72566	0.3476	M	0.82823	2.61	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.77437	-0.2588	10	0.87932	D	0	.	18.3497	0.90335	0.0:1.0:0.0:0.0	.	200;200;200;180;200	O95263-2;O95263-6;O95263-3;O95263-4;O95263	.;.;.;.;PDE8B_HUMAN	W	76;200;200;200;180;200;76	ENSP00000425720:R76W;ENSP00000345446:R200W;ENSP00000330428:R200W;ENSP00000264917:R200W;ENSP00000345646:R180W;ENSP00000331336:R200W;ENSP00000426200:R76W	ENSP00000264917:R200W	R	+	1	2	PDE8B	76660586	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	6.403000	0.73264	2.428000	0.82296	0.650000	0.86243	CGG		PDE8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000220015.3	NM_003719	
