#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
KCNMA1	3778	broad.mit.edu	37	10	78832893	78832893	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr10:78832893T>A	ENST00000286628.8	-	14	1710	c.1711A>T	c.(1711-1713)Atg>Ttg	p.M571L	KCNMA1_ENST00000372443.1_Missense_Mutation_p.M571L|KCNMA1_ENST00000484507.1_5'UTR|KCNMA1_ENST00000406533.3_Missense_Mutation_p.M571L|KCNMA1_ENST00000404857.1_Missense_Mutation_p.M571L|KCNMA1_ENST00000354353.5_Missense_Mutation_p.M571L|KCNMA1_ENST00000372440.1_Missense_Mutation_p.M571L|KCNMA1_ENST00000404771.3_Missense_Mutation_p.M571L|KCNMA1_ENST00000286627.5_Missense_Mutation_p.M571L	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	571	Segment S7.				blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	TTGGCAAGCATGGTGGAGAGG	0.512																																					p.M571L												.	.	0			c.A1711T	10						.						118.0	95.0	103.0					10																	78832893		2203	4300	6503	78502899	SO:0001583	missense	3778	exon14			U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.1711A>T	10.37:g.78832893T>A	ENSP00000286628:p.Met571Leu	None		Capture	Illumina HiSeq	Phase_I	78502899	NM_001161353	F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Missense_Mutation	SNP	ENST00000286628.8	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.20|12.20	1.865755|1.865755	0.32977|0.32977	.|.	.|.	ENSG00000156113|ENSG00000156113	ENST00000372421;ENST00000434208;ENST00000450795|ENST00000372440;ENST00000372408;ENST00000372437;ENST00000457953;ENST00000404771;ENST00000372443;ENST00000286627;ENST00000286628;ENST00000406533;ENST00000354353;ENST00000404857;ENST00000412708	.|T;T;T;T;T;T;T;T;T	.|0.25414	.|1.8;1.8;1.8;1.8;1.8;1.8;1.8;1.8;1.8	5.87|5.87	5.87|5.87	0.94306|0.94306	.|Potassium channel, calcium-activated, BK, alpha subunit (2);NAD(P)-binding domain (1);	.|0.039159	.|0.85682	.|D	.|0.000000	T|T	0.10895|0.10895	0.0266|0.0266	N|N	0.01219|0.01219	-0.95|-0.95	0.80722|0.80722	D|D	1|1	.|B;B;B;B;B;B;B;B	.|0.11235	.|0.003;0.004;0.003;0.003;0.003;0.001;0.002;0.004	.|B;B;B;B;B;B;B;B	.|0.18871	.|0.004;0.013;0.007;0.023;0.007;0.004;0.009;0.013	T|T	0.26883|0.26883	-1.0090|-1.0090	5|10	.|0.19590	.|T	.|0.45	-21.1347|-21.1347	16.2806|16.2806	0.82678|0.82678	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|571;571;571;571;571;353;571;571	.|Q12791-4;B7ZMF5;Q12791-2;Q12791;Q12791-5;C9JFZ9;F8WA96;Q5SVJ7	.|.;.;.;KCMA1_HUMAN;.;.;.;.	L|L	559;249;63|571;508;506;545;508;571;571;545;571;571;571;353	.|ENSP00000361517:M571L;ENSP00000361485:M508L;ENSP00000361514:M506L;ENSP00000396608:M545L;ENSP00000361520:M571L;ENSP00000286627:M571L;ENSP00000385552:M571L;ENSP00000346321:M571L;ENSP00000385806:M571L	.|ENSP00000286627:M571L	H|M	-|-	2|1	0|0	KCNMA1|KCNMA1	78502899|78502899	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	8.040000|8.040000	0.89188|0.89188	2.248000|2.248000	0.74166|0.74166	0.533000|0.533000	0.62120|0.62120	CAT|ATG		KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000048885.3	NM_002247	
STIM1	6786	broad.mit.edu	37	11	4112859	4112859	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr11:4112859T>C	ENST00000300737.4	+	12	2458	c.1889T>C	c.(1888-1890)gTt>gCt	p.V630A	STIM1_ENST00000533977.1_Missense_Mutation_p.V457A|STIM1_ENST00000527651.1_3'UTR	NM_003156.3	NP_003147.2	Q13586	STIM1_HUMAN	stromal interaction molecule 1	630					activation of store-operated calcium channel activity (GO:0032237)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|regulation of calcium ion transport (GO:0051924)|regulation of store-operated calcium entry (GO:2001256)|store-operated calcium entry (GO:0002115)	cortical endoplasmic reticulum (GO:0032541)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|growth cone (GO:0030426)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of plasma membrane (GO:0005887)|microtubule (GO:0005874)	calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|microtubule plus-end binding (GO:0051010)|store-operated calcium channel activity (GO:0015279)	p.V630A(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|liver(1)|lung(14)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30		Breast(177;0.00159)|Medulloblastoma(188;0.00258)|all_neural(188;0.0233)		BRCA - Breast invasive adenocarcinoma(625;0.114)|LUSC - Lung squamous cell carcinoma(625;0.141)		CCATCTCCAGTTGGGGACAGC	0.607																																					p.V630A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1889C	11						.						79.0	88.0	85.0					11																	4112859		2201	4298	6499	4069435	SO:0001583	missense	6786	exon12			BC021300, U52426	CCDS7749.1, CCDS60706.1, CCDS73247.1	11p15.5	2014-09-17			ENSG00000167323	ENSG00000167323		"""Sterile alpha motif (SAM) domain containing"""	11386	protein-coding gene	gene with protein product		605921				8921403, 11463338, 11983428	Standard	NM_003156		Approved	GOK, D11S4896E	uc021qco.1	Q13586	OTTHUMG00000133360	ENST00000300737.4:c.1889T>C	11.37:g.4112859T>C	ENSP00000300737:p.Val630Ala	Somatic		Capture	Illumina HiSeq	Phase_I	4069435	NM_003156	E9PQJ4|Q8N382	Missense_Mutation	SNP	ENST00000300737.4	37	CCDS7749.1	.	.	.	.	.	.	.	.	.	.	T	6.889	0.533526	0.13188	.	.	ENSG00000167323	ENST00000300737;ENST00000533977	T;T	0.63417	-0.04;-0.04	4.66	-0.829	0.10796	.	1.212830	0.05695	N	0.593044	T	0.38612	0.1047	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.20338	-1.0278	10	0.07482	T	0.82	-23.2424	8.202	0.31430	0.0:0.5226:0.0:0.4774	.	630	Q13586	STIM1_HUMAN	A	630;457	ENSP00000300737:V630A;ENSP00000434767:V457A	ENSP00000300737:V630A	V	+	2	0	STIM1	4069435	0.000000	0.05858	0.203000	0.23512	0.983000	0.72400	-0.150000	0.10189	-0.224000	0.09928	0.383000	0.25322	GTT		STIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257196.1	NM_003156	
KCNA4	3739	broad.mit.edu	37	11	30033451	30033451	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr11:30033451A>G	ENST00000328224.6	-	2	2008	c.775T>C	c.(775-777)Tat>Cat	p.Y259H	KCNA4_ENST00000526518.1_5'Flank	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4	259					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)	p.Y259H(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	CCCAACTGATAGAACTTCACC	0.502																																					p.Y259H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T775C	11						.						84.0	76.0	78.0					11																	30033451		1875	4132	6007	29990027	SO:0001583	missense	3739	exon2			M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.775T>C	11.37:g.30033451A>G	ENSP00000328511:p.Tyr259His	Somatic		Capture	Illumina HiSeq	Phase_I	29990027	NM_002233		Missense_Mutation	SNP	ENST00000328224.6	37	CCDS41629.1	.	.	.	.	.	.	.	.	.	.	A	20.1	3.935182	0.73442	.	.	ENSG00000182255	ENST00000328224	D	0.82526	-1.62	5.05	5.05	0.67936	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	D	0.94231	0.8148	H	0.97491	4.015	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96165	0.9118	10	0.87932	D	0	.	14.8213	0.70074	1.0:0.0:0.0:0.0	.	259	P22459	KCNA4_HUMAN	H	259	ENSP00000328511:Y259H	ENSP00000328511:Y259H	Y	-	1	0	KCNA4	29990027	1.000000	0.71417	0.998000	0.56505	0.967000	0.64934	9.301000	0.96167	1.910000	0.55303	0.533000	0.62120	TAT		KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388074.2	NM_002233	
PPP1R32	220004	broad.mit.edu	37	11	61254635	61254635	+	Silent	SNP	C	C	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr11:61254635C>T	ENST00000338608.2	+	11	1091	c.966C>T	c.(964-966)agC>agT	p.S322S	PPP1R32_ENST00000538185.1_5'Flank|PPP1R32_ENST00000366212.4_5'Flank|PPP1R32_ENST00000432063.2_Silent_p.S302S	NM_145017.2	NP_659454.2	Q7Z5V6	PPR32_HUMAN	protein phosphatase 1, regulatory subunit 32	322							phosphatase binding (GO:0019902)	p.S322S(1)									CAGGGTTCAGCCTTAACAACC	0.567																																					p.S322S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C966T	11						.						181.0	179.0	179.0					11																	61254635		2202	4299	6501	61011211	SO:0001819	synonymous_variant	220004	exon11			AK057333	CCDS8008.1, CCDS53641.1	11q12.2	2012-04-17	2011-10-11	2011-10-11	ENSG00000162148	ENSG00000162148		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	28869	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 66"""	C11orf66		12477932	Standard	NM_145017		Approved	IIIG9, FLJ32771	uc001nru.2	Q7Z5V6	OTTHUMG00000168176	ENST00000338608.2:c.966C>T	11.37:g.61254635C>T		Somatic		Capture	Illumina HiSeq	Phase_I	61011211	NM_145017	Q4G0P4|Q96M77	Silent	SNP	ENST00000338608.2	37	CCDS8008.1																																																																																				PPP1R32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398621.1	NM_145017	
IGHMBP2	3508	broad.mit.edu	37	11	68703833	68703833	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr11:68703833delT	ENST00000255078.3	+	13	1996	c.1885delT	c.(1885-1887)tatfs	p.Y629fs		NM_002180.2	NP_002171.2	P38935	SMBP2_HUMAN	immunoglobulin mu binding protein 2	629					ATP catabolic process (GO:0006200)|cell death (GO:0008219)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|protein homooligomerization (GO:0051260)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)	axon (GO:0030424)|cytoplasm (GO:0005737)|growth cone (GO:0030426)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|ATP-dependent 5'-3' RNA helicase activity (GO:0032575)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|ribosome binding (GO:0043022)|RNA binding (GO:0003723)|RNA-dependent ATPase activity (GO:0008186)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)|tRNA binding (GO:0000049)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|liver(1)|lung(15)|ovary(2)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			CCTGGTGGAGTATTTCACACA	0.537																																					p.Y629fs												.	.	0			c.1885delT	11						.						161.0	160.0	160.0					11																	68703833		2200	4294	6494	68460409	SO:0001589	frameshift_variant	3508	exon13			L14754	CCDS8187.1	11q13.3	2014-09-17			ENSG00000132740	ENSG00000132740		"""Zinc fingers, AN1-type domain containing"""	5542	protein-coding gene	gene with protein product	"""cardiac transcription factor 1"", ""zinc finger, AN1-type domain 7"""	600502				8349627	Standard	NM_002180		Approved	ZFAND7, SMUBP2, CATF1, SMARD1, HCSA, HMN6	uc001ook.1	P38935	OTTHUMG00000167894	ENST00000255078.3:c.1885delT	11.37:g.68703833delT	ENSP00000255078:p.Tyr629fs	None		Capture	Illumina HiSeq	Phase_I	68460409	NM_002180	A0PJD2|Q00443|Q14177	Frame_Shift_Del	DEL	ENST00000255078.3	37	CCDS8187.1																																																																																				IGHMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396862.1	NM_002180	
PHLDB1	23187	broad.mit.edu	37	11	118516174	118516174	+	Silent	SNP	A	A	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr11:118516174A>T	ENST00000361417.2	+	17	3633	c.3222A>T	c.(3220-3222)gcA>gcT	p.A1074A	PHLDB1_ENST00000524713.1_Silent_p.A217A|PHLDB1_ENST00000356063.5_Silent_p.A1027A|PHLDB1_ENST00000527898.1_Silent_p.A125A|PHLDB1_ENST00000534672.1_3'UTR	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	1074								p.A1074A(1)		breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		ACGGGGCAGCACCCTTCCCAG	0.662																																					p.A1074A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A3222T	11						.						45.0	54.0	51.0					11																	118516174		2200	4295	6495	118021384	SO:0001819	synonymous_variant	23187	exon16				CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.3222A>T	11.37:g.118516174A>T		Somatic		Capture	Illumina HiSeq	Phase_I	118021384	NM_001144758	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Silent	SNP	ENST00000361417.2	37	CCDS8401.1																																																																																				PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389279.1	NM_015157	
HECTD4	283450	broad.mit.edu	37	12	112720923	112720923	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr12:112720923C>T	ENST00000430131.2	-	8	1482	c.337G>A	c.(337-339)Gat>Aat	p.D113N	HECTD4_ENST00000377560.5_Missense_Mutation_p.D363N|HECTD4_ENST00000550722.1_Missense_Mutation_p.D363N			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	113					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.D113N(1)|p.D363N(1)									CCTGCTTGATCCTCTTTCAGT	0.483																																					p.D363N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1087A	12						.						93.0	92.0	93.0					12																	112720923		2012	4174	6186	111205306	SO:0001583	missense	283450	exon8			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.337G>A	12.37:g.112720923C>T	ENSP00000404379:p.Asp113Asn	Somatic		Capture	Illumina HiSeq	Phase_I	111205306	NM_001109662	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	ENST00000430131.2	37		.	.	.	.	.	.	.	.	.	.	C	36	5.819427	0.96982	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.52983	0.66;0.71;0.64	5.58	5.58	0.84498	.	.	.	.	.	T	0.32645	0.0836	N	0.08118	0	0.51482	D	0.999923	P	0.37525	0.598	B	0.34824	0.19	T	0.38607	-0.9653	9	0.87932	D	0	.	19.6303	0.95699	0.0:1.0:0.0:0.0	.	113	Q9Y4D8	K0614_HUMAN	N	363;113;363	ENSP00000366783:D363N;ENSP00000404379:D113N;ENSP00000449784:D363N	ENSP00000366783:D363N	D	-	1	0	C12orf51	111205306	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.456000	0.80751	2.659000	0.90383	0.555000	0.69702	GAT		HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
MED13L	23389	broad.mit.edu	37	12	116444160	116444160	+	Silent	SNP	C	C	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr12:116444160C>T	ENST00000281928.3	-	12	2501	c.2295G>A	c.(2293-2295)gtG>gtA	p.V765V		NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	765						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.V765V(1)		NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		TCCCATCAGGCACCGGCGTGG	0.413																																					p.V765V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2295A	12						.						103.0	99.0	101.0					12																	116444160		2203	4300	6503	114928543	SO:0001819	synonymous_variant	23389	exon12			AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.2295G>A	12.37:g.116444160C>T		Somatic		Capture	Illumina HiSeq	Phase_I	114928543	NM_015335	A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Silent	SNP	ENST00000281928.3	37	CCDS9177.1																																																																																				MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403879.3		
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	A	rs121913530		TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr12:25398285C>A	ENST00000256078.4	-	2	97	c.34G>T	c.(34-36)Ggt>Tgt	p.G12C	KRAS_ENST00000311936.3_Missense_Mutation_p.G12C|KRAS_ENST00000557334.1_Missense_Mutation_p.G12C|KRAS_ENST00000556131.1_Missense_Mutation_p.G12C	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12C	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,+1 	.	5144	Substitution - Missense(5142)|Insertion - In frame(2)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	c.G34T	12	GRCh37	CM076251	KRAS	M	rs121913530	.						93.0	83.0	86.0					12																	25398285		2203	4300	6503	25289552	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>T	12.37:g.25398285C>A	ENSP00000256078:p.Gly12Cys	Somatic		Capture	Illumina HiSeq	Phase_I	25289552	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676185	0.88445	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90466	0.7014	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.91833	0.5477	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	C	12	ENSP00000308495:G12C;ENSP00000452512:G12C;ENSP00000256078:G12C;ENSP00000451856:G12C	ENSP00000256078:G12C	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
PRPF40B	25766	broad.mit.edu	37	12	50028379	50028379	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr12:50028379G>T	ENST00000380281.1	+	11	993	c.929G>T	c.(928-930)cGt>cTt	p.R310L	PRPF40B_ENST00000548825.2_Missense_Mutation_p.R332L|PRPF40B_ENST00000261897.1_Missense_Mutation_p.R304L			Q6NWY9	PR40B_HUMAN	PRP40 pre-mRNA processing factor 40 homolog B (S. cerevisiae)	310	FF 1.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)		p.R310L(1)|p.R310H(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	34						ACCGACCCCCGTTACAGGTAG	0.612																																					p.R310L												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G929T	12						.						54.0	54.0	54.0					12																	50028379		2203	4300	6503	48314646	SO:0001583	missense	25766	exon11			AF049525	CCDS31796.1, CCDS31796.2	12q13.12	2014-09-17	2006-04-04			ENSG00000110844			25031	protein-coding gene	gene with protein product	"""Huntingtin interacting protein C"""		"""PRP40 pre-mRNA processing factor 40 homolog B (yeast)"""			9700202	Standard	NM_001031698		Approved	HYPC	uc001rus.2	Q6NWY9		ENST00000380281.1:c.929G>T	12.37:g.50028379G>T	ENSP00000369634:p.Arg310Leu	Somatic		Capture	Illumina HiSeq	Phase_I	48314646	NM_001031698	O75401|Q6PI09|Q6ZWB3|Q8NCZ1|Q9H5G4|Q9NT95	Missense_Mutation	SNP	ENST00000380281.1	37		.	.	.	.	.	.	.	.	.	.	G	31	5.060596	0.93846	.	.	ENSG00000110844	ENST00000261897;ENST00000380281	T;T	0.57595	0.39;0.39	5.07	4.16	0.48862	FF domain (4);	0.203531	0.32785	N	0.005646	T	0.68044	0.2958	M	0.71206	2.165	0.58432	D	0.999997	D;D;D	0.55172	0.97;0.963;0.963	P;P;P	0.62014	0.897;0.835;0.835	T	0.69741	-0.5063	9	.	.	.	-6.9895	14.6635	0.68891	0.0:0.1471:0.8529:0.0	.	310;304;310	Q6NWY9;Q6NWY9-2;Q6NWY9-3	PR40B_HUMAN;.;.	L	304;310	ENSP00000261897:R304L;ENSP00000369634:R310L	.	R	+	2	0	PRPF40B	48314646	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.601000	0.98297	1.252000	0.44001	0.655000	0.94253	CGT		PRPF40B-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000404838.1	NM_012272	
KRT74	121391	broad.mit.edu	37	12	52967172	52967172	+	Missense_Mutation	SNP	G	G	T	rs142973048		TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr12:52967172G>T	ENST00000305620.2	-	1	437	c.390C>A	c.(388-390)gaC>gaA	p.D130E	KRT74_ENST00000549343.1_Missense_Mutation_p.D130E	NM_175053.3	NP_778223.2	Q7RTS7	K2C74_HUMAN	keratin 74	130	Head.				intermediate filament cytoskeleton organization (GO:0045104)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	keratin filament binding (GO:1990254)|structural molecule activity (GO:0005198)	p.D130E(1)		kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	28				BRCA - Breast invasive adenocarcinoma(357;0.191)		GGATCTCAGGGTCCAGCTCCA	0.602																																					p.D130E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C390A	12						.						111.0	108.0	109.0					12																	52967172		2203	4300	6503	51253439	SO:0001583	missense	121391	exon1			BK000977	CCDS8832.1	12q13.13	2013-06-25			ENSG00000170484	ENSG00000170484		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28929	protein-coding gene	gene with protein product		608248				12648212, 16831889	Standard	NM_175053		Approved	K6IRS4, KRT5C, KRT6IRS4	uc001sap.1	Q7RTS7	OTTHUMG00000169658	ENST00000305620.2:c.390C>A	12.37:g.52967172G>T	ENSP00000307240:p.Asp130Glu	Somatic		Capture	Illumina HiSeq	Phase_I	51253439	NM_175053	B5MD61|Q86Y45	Missense_Mutation	SNP	ENST00000305620.2	37	CCDS8832.1	.	.	.	.	.	.	.	.	.	.	G	19.48	3.835982	0.71373	.	.	ENSG00000170484	ENST00000549343;ENST00000305620	T;T	0.77620	-1.11;-1.11	4.39	1.48	0.22813	.	0.000000	0.37483	N	0.002071	D	0.86969	0.6061	M	0.87547	2.89	0.38010	D	0.934493	D	0.89917	1.0	D	0.85130	0.997	D	0.86593	0.1861	10	0.87932	D	0	.	8.5573	0.33489	0.3944:0.0:0.6056:0.0	.	130	Q7RTS7	K2C74_HUMAN	E	130	ENSP00000447447:D130E;ENSP00000307240:D130E	ENSP00000307240:D130E	D	-	3	2	KRT74	51253439	1.000000	0.71417	0.976000	0.42696	0.985000	0.73830	2.009000	0.40903	0.179000	0.19938	0.555000	0.69702	GAC		KRT74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405324.1	NM_175053	
NTN4	59277	broad.mit.edu	37	12	96077487	96077487	+	Splice_Site	SNP	G	G	A	rs371661550		TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr12:96077487G>A	ENST00000343702.4	-	6	1629	c.1181C>T	c.(1180-1182)cCg>cTg	p.P394L	NTN4_ENST00000344911.4_Splice_Site_p.P357L|NTN4_ENST00000538383.1_Splice_Site_p.P357L|NTN4_ENST00000553059.1_Splice_Site_p.P394L	NM_021229.3	NP_067052.2	Q9HB63	NET4_HUMAN	netrin 4	394	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|extracellular matrix organization (GO:0030198)|neuron remodeling (GO:0016322)|regulation of branching involved in salivary gland morphogenesis by extracellular matrix-epithelial cell signaling (GO:0060668)	basement membrane (GO:0005604)|plasma membrane (GO:0005886)		p.P394L(2)		NS(2)|breast(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25						GCAGGAACACGCTACAACAGA	0.552																																					p.P394L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1181T	12						.						64.0	46.0	52.0					12																	96077487		2201	4299	6500	94601618	SO:0001630	splice_region_variant	59277	exon6			AF119916	CCDS9054.1	12q22	2013-03-01			ENSG00000074527	ENSG00000074527		"""Netrins"""	13658	protein-coding gene	gene with protein product	"""beta-netrin"", ""Netrin-4"""	610401				11038171	Standard	NM_021229		Approved		uc001tei.3	Q9HB63	OTTHUMG00000170290	ENST00000343702.4:c.1181-1C>T	12.37:g.96077487G>A		Somatic		Capture	Illumina HiSeq	Phase_I	94601618	NM_021229	B2RNC2|Q658K9|Q7L3F1|Q7L9D6|Q7Z5B6|Q9BZP1|Q9NT44|Q9P133	Missense_Mutation	SNP	ENST00000343702.4	37	CCDS9054.1	.	.	.	.	.	.	.	.	.	.	G	1.024	-0.684067	0.03353	.	.	ENSG00000074527	ENST00000343702;ENST00000344911;ENST00000538383;ENST00000553059	T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18	5.74	-1.59	0.08453	EGF-like, laminin (2);	3.392480	0.01001	N	0.003665	T	0.63920	0.2552	M	0.67953	2.075	0.42704	D	0.993627	B;B	0.12013	0.005;0.001	B;B	0.06405	0.002;0.001	T	0.49978	-0.8881	10	0.52906	T	0.07	.	13.2731	0.60172	0.4763:0.0:0.5237:0.0	.	394;394	Q9HB63-2;Q9HB63	.;NET4_HUMAN	L	394;357;357;394	ENSP00000340998:P394L;ENSP00000339436:P357L;ENSP00000444432:P357L;ENSP00000447292:P394L	ENSP00000340998:P394L	P	-	2	0	NTN4	94601618	0.000000	0.05858	0.162000	0.22713	0.016000	0.09150	-0.242000	0.08928	-0.535000	0.06307	-0.918000	0.02743	CCG		NTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408372.1	NM_021229	Missense_Mutation
ZNF26	7574	broad.mit.edu	37	12	133587016	133587016	+	Missense_Mutation	SNP	G	G	A	rs115196721		TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr12:133587016G>A	ENST00000328654.5	+	4	928	c.551G>A	c.(550-552)cGt>cAt	p.R184H	ZNF26_ENST00000534834.1_Missense_Mutation_p.R164H	NM_019591.3	NP_062537.2	P17031	ZNF26_HUMAN	zinc finger protein 26	184					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R184H(1)		autonomic_ganglia(1)|large_intestine(7)|lung(2)|prostate(1)|skin(2)	13	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;1.24e-11)|all_epithelial(31;1.21e-08)|Lung NSC(355;0.000431)		OV - Ovarian serous cystadenocarcinoma(86;9.53e-09)|Epithelial(86;2.63e-07)|all cancers(50;1.14e-05)		AAAGCTTTTCGTTGTAAGTCA	0.373																																					p.R184H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G551A	12						.						1.0	0.0	1.0					12																	133587016		1	0	1	132097089	SO:0001583	missense	7574	exon4			X52351	CCDS31939.1	12q24.33	2013-01-08	2006-05-10		ENSG00000198393	ENSG00000198393		"""Zinc fingers, C2H2-type"", ""-"""	13053	protein-coding gene	gene with protein product		194537	"""zinc finger protein 26 (KOX 20)"""				Standard	NM_001256279		Approved	KOX20, FLJ20755	uc031qkj.1	P17031	OTTHUMG00000167936	ENST00000328654.5:c.551G>A	12.37:g.133587016G>A	ENSP00000333725:p.Arg184His	Somatic		Capture	Illumina HiSeq	Phase_I	132097089	NM_019591	Q86X57|Q9NWL3	Missense_Mutation	SNP	ENST00000328654.5	37	CCDS31939.1	.	.	.	.	.	.	.	.	.	.	G	12.08	1.829405	0.32329	.	.	ENSG00000198393	ENST00000328654;ENST00000534834	T;T	0.08102	3.13;3.13	3.6	3.6	0.41247	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.32343	N	0.006236	T	0.04998	0.0134	L	0.42008	1.315	0.09310	N	1	P	0.52692	0.955	B	0.32211	0.142	T	0.42481	-0.9449	9	.	.	.	.	5.3006	0.15776	0.1161:0.2115:0.6723:0.0	.	184	P17031	ZNF26_HUMAN	H	184;164	ENSP00000333725:R184H;ENSP00000437420:R164H	.	R	+	2	0	ZNF26	132097089	0.000000	0.05858	1.000000	0.80357	0.960000	0.62799	-0.193000	0.09573	1.999000	0.58509	0.460000	0.39030	CGT		ZNF26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397145.2	NM_019591	
SLITRK1	114798	broad.mit.edu	37	13	84453603	84453603	+	Silent	SNP	T	T	G			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr13:84453603T>G	ENST00000377084.2	-	1	2925	c.2040A>C	c.(2038-2040)gcA>gcC	p.A680A		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	680					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)		p.A680A(1)		NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		GGGCCCCATCTGCGTTGTAAG	0.557																																					p.A680A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A2040C	13						.						63.0	59.0	61.0					13																	84453603		2203	4300	6503	83351604	SO:0001819	synonymous_variant	114798	exon1			AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.2040A>C	13.37:g.84453603T>G		Somatic		Capture	Illumina HiSeq	Phase_I	83351604	NM_052910	Q5U5I6|Q96SF9	Silent	SNP	ENST00000377084.2	37	CCDS9464.1																																																																																				SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910	
GRK1	6011	broad.mit.edu	37	13	114325830	114325830	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr13:114325830G>A	ENST00000335678.6	+	3	1076	c.844G>A	c.(844-846)Gtg>Atg	p.V282M		NM_002929.2	NP_002920.1	Q15835	RK_HUMAN	G protein-coupled receptor kinase 1	282	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of apoptotic process (GO:0043066)|photoreceptor cell morphogenesis (GO:0008594)|phototransduction, visible light (GO:0007603)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)|protein autophosphorylation (GO:0046777)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)|rhodopsin kinase activity (GO:0050254)	p.V282M(1)		ovary(2)	2	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.00696)|all_epithelial(44;0.00347)|all_lung(25;0.0221)|Breast(118;0.0411)|Lung NSC(25;0.0839)	all cancers(43;0.234)			CATCTACAACGTGAATGAGGA	0.592																																					p.V282M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G844A	13						.						59.0	63.0	62.0					13																	114325830		1987	4163	6150	113373831	SO:0001583	missense	6011	exon3					13q34	2013-09-02	2004-03-23	2004-03-24	ENSG00000185974	ENSG00000185974	2.7.11.14		10013	protein-coding gene	gene with protein product		180381	"""rhodopsin kinase"""	RHOK		8812493, 15057823	Standard	NM_002929		Approved	GPRK1, RK	uc010tkf.2	Q15835	OTTHUMG00000185528	ENST00000335678.6:c.844G>A	13.37:g.114325830G>A	ENSP00000334876:p.Val282Met	Somatic		Capture	Illumina HiSeq	Phase_I	113373831	NM_002929	Q53X14	Missense_Mutation	SNP	ENST00000335678.6	37		.	.	.	.	.	.	.	.	.	.	g	0.021	-1.423739	0.01126	.	.	ENSG00000185974	ENST00000335678	T	0.24908	1.83	4.43	4.43	0.53597	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.060898	0.64402	D	0.000003	T	0.08179	0.0204	.	.	.	0.39610	D	0.969879	P	0.35714	0.517	B	0.22601	0.04	T	0.22138	-1.0225	9	0.02654	T	1	-45.5138	8.7174	0.34419	0.1061:0.0:0.8939:0.0	.	282	Q15835	RK_HUMAN	M	282	ENSP00000334876:V282M	ENSP00000334876:V282M	V	+	1	0	GRK1	113373831	1.000000	0.71417	0.152000	0.22495	0.252000	0.25951	3.303000	0.51858	2.148000	0.66965	0.506000	0.49869	GTG		GRK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470655.1	NM_002929	
DYNC1H1	1778	broad.mit.edu	37	14	102507987	102507987	+	Silent	SNP	C	C	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr14:102507987C>T	ENST00000360184.4	+	65	12182	c.12018C>T	c.(12016-12018)caC>caT	p.H4006H	RP11-1017G21.4_ENST00000553701.1_RNA|RP11-1017G21.4_ENST00000557242.1_RNA|RP11-1017G21.4_ENST00000557551.1_RNA	NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	4006	AAA 6. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)	p.H4006H(2)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						CCATGGCCCACATGTTTGTTT	0.577																																					p.H4006H												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.C12018T	14						.						107.0	104.0	105.0					14																	102507987		2203	4300	6503	101577740	SO:0001819	synonymous_variant	1778	exon65			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.12018C>T	14.37:g.102507987C>T		Somatic		Capture	Illumina HiSeq	Phase_I	101577740	NM_001376	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Silent	SNP	ENST00000360184.4	37	CCDS9966.1																																																																																				DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	
RNASE11	122651	broad.mit.edu	37	14	21052110	21052110	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr14:21052110G>T	ENST00000610205.1	-	3	707	c.524C>A	c.(523-525)aCc>aAc	p.T175N	RNASE11_ENST00000398008.2_Missense_Mutation_p.T175N|RNASE11_ENST00000555841.1_Missense_Mutation_p.T175N|RNASE11_ENST00000553849.1_Missense_Mutation_p.T175N|RNASE11_ENST00000398009.2_Missense_Mutation_p.T175N|RNASE11_ENST00000432835.2_Missense_Mutation_p.T175N	NM_145250.3	NP_660293.1	Q8TAA1	RNS11_HUMAN	ribonuclease, RNase A family, 11 (non-active)	175						extracellular region (GO:0005576)	endonuclease activity (GO:0004519)|nucleic acid binding (GO:0003676)	p.T175N(1)		endometrium(1)|large_intestine(6)|lung(7)|ovary(3)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	21	all_cancers(95;0.00238)	all_lung(585;0.235)	Epithelial(56;1.85e-06)|all cancers(55;1.46e-05)	GBM - Glioblastoma multiforme(265;0.0139)		CTCTAATGAGGTAACACTATG	0.448																																					p.T175N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C524A	14						.						104.0	87.0	93.0					14																	21052110		2203	4300	6503	20121950	SO:0001583	missense	122651	exon3			BC025410	CCDS9553.1	14q11.1	2013-08-05	2004-11-18	2004-11-18	ENSG00000173464	ENSG00000173464		"""Ribonucleases, RNase A"""	19269	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 6"""	C14orf6			Standard	NM_145250		Approved		uc001vxs.3	Q8TAA1	OTTHUMG00000170990	ENST00000610205.1:c.524C>A	14.37:g.21052110G>T	ENSP00000476537:p.Thr175Asn	Somatic		Capture	Illumina HiSeq	Phase_I	20121950	NM_145250		Missense_Mutation	SNP	ENST00000610205.1	37	CCDS9553.1	.	.	.	.	.	.	.	.	.	.	G	18.24	3.580623	0.65992	.	.	ENSG00000173464	ENST00000335950;ENST00000553849;ENST00000555841;ENST00000398009;ENST00000398008;ENST00000432835;ENST00000443456;ENST00000557503	T;T;T;T;T;T;T;T	0.72725	-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68	4.06	4.06	0.47325	Ribonuclease A, domain (3);	0.509053	0.18370	N	0.143288	T	0.73705	0.3621	L	0.27053	0.805	0.18873	N	0.999985	D	0.89917	1.0	D	0.80764	0.994	T	0.64153	-0.6474	10	0.66056	D	0.02	-9.5473	12.0252	0.53367	0.0:0.0:1.0:0.0	.	175	Q8TAA1	RNS11_HUMAN	N	175	ENSP00000338288:T175N;ENSP00000451318:T175N;ENSP00000451563:T175N;ENSP00000381093:T175N;ENSP00000381092:T175N;ENSP00000395210:T175N;ENSP00000401398:T175N;ENSP00000451839:T175N	ENSP00000338288:T175N	T	-	2	0	RNASE11	20121950	0.911000	0.30947	0.240000	0.24138	0.303000	0.27691	3.515000	0.53429	2.549000	0.85964	0.511000	0.50034	ACC		RNASE11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073662.3	NM_145250	
RALGAPA1	253959	broad.mit.edu	37	14	36244924	36244924	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr14:36244924T>A	ENST00000389698.3	-	2	524	c.134A>T	c.(133-135)cAg>cTg	p.Q45L	RALGAPA1_ENST00000382366.3_Missense_Mutation_p.Q45L|RALGAPA1_ENST00000258840.6_Missense_Mutation_p.Q45L|RALGAPA1_ENST00000307138.6_Missense_Mutation_p.Q45L	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)	45					activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						GTCGAAAAACTGTTTAAGATC	0.269																																					p.Q45L												.	.	0			c.A134T	14						.						37.0	41.0	40.0					14																	36244924		2198	4282	6480	35314675	SO:0001583	missense	253959	exon2			AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.134A>T	14.37:g.36244924T>A	ENSP00000374348:p.Gln45Leu	None		Capture	Illumina HiSeq	Phase_I	35314675	NM_194301	A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Missense_Mutation	SNP	ENST00000389698.3	37	CCDS32065.1	.	.	.	.	.	.	.	.	.	.	T	14.88	2.666874	0.47677	.	.	ENSG00000174373	ENST00000389698;ENST00000307138;ENST00000335518;ENST00000258840;ENST00000382366;ENST00000553892	T;T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13;-1.13	5.71	5.71	0.89125	.	0.063541	0.64402	D	0.000004	T	0.72637	0.3485	L	0.60455	1.87	0.51482	D	0.999921	P;P;P;B	0.43094	0.799;0.698;0.481;0.304	B;B;B;B	0.36567	0.228;0.114;0.164;0.052	T	0.73711	-0.3897	10	0.35671	T	0.21	-7.9367	14.5565	0.68103	0.0:0.0:0.0:1.0	.	45;45;45;45	Q6GYQ0-6;B9EK38;Q6GYQ0-2;Q6GYQ0	.;.;.;RGPA1_HUMAN	L	45	ENSP00000374348:Q45L;ENSP00000302647:Q45L;ENSP00000258840:Q45L;ENSP00000371803:Q45L;ENSP00000451877:Q45L	ENSP00000258840:Q45L	Q	-	2	0	RALGAPA1	35314675	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.369000	0.79578	2.165000	0.68154	0.533000	0.62120	CAG		RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409829.1	XM_210022	
AHNAK2	113146	broad.mit.edu	37	14	105413202	105413203	+	Missense_Mutation	DNP	GC	GC	AT	rs367906140		TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	GC	GC					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr14:105413202_105413203GC>AT	ENST00000333244.5	-	7	8704_8705	c.8585_8586GC>AT	c.(8584-8586)cGC>cAT	p.R2862H	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2862			R -> S (in dbSNP:rs2582514).			costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.R2862>?(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGGGCTGAATGCGGATGTCAGT	0.634																																					.												.	.	1	Complex(1)	large_intestine(1)	c.8585_8586AT	14						.																																			104484248	SO:0001583	missense	113146	exon7			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.8585_8586delinsAT	14.37:g.105413202_105413203delinsAT	ENSP00000353114:p.Arg2862His	Somatic		Capture	Illumina HiSeq	Phase_I	104484247	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	DNP	ENST00000333244.5	37	CCDS45177.1																																																																																				AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
DISP2	85455	broad.mit.edu	37	15	40660639	40660640	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr15:40660639_40660640insG	ENST00000267889.3	+	8	2413_2414	c.2326_2327insG	c.(2326-2328)tggfs	p.W776fs	RP11-64K12.4_ENST00000558421.1_RNA	NM_033510.1	NP_277045.1	A7MBM2	DISP2_HUMAN	dispatched homolog 2 (Drosophila)	776					smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)		p.V778fs*14(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)	30		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)		GGTTTTGGTGTGGGGCGTCCTG	0.683																																					p.W776fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.2326_2327insG	15						.																																			38447932	SO:0001589	frameshift_variant	85455	exon8			AB051529	CCDS10056.1	15q14	2004-01-15			ENSG00000140323	ENSG00000140323			19712	protein-coding gene	gene with protein product		607503				11214970, 10619433	Standard	NM_033510		Approved	DISPB, KIAA1742, HsT16908	uc001zlk.1	A7MBM2	OTTHUMG00000129983	ENST00000267889.3:c.2330dupG	15.37:g.40660643_40660643dupG	ENSP00000267889:p.Trp776fs	Somatic		Capture	Illumina HiSeq	Phase_I	38447931	NM_033510	Q6AHW3|Q9C0C1	Frame_Shift_Ins	INS	ENST00000267889.3	37	CCDS10056.1																																																																																				DISP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252249.1	NM_033510	
RYR3	6263	broad.mit.edu	37	15	33765719	33765719	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr15:33765719G>A	ENST00000389232.4	+	2	221	c.151G>A	c.(151-153)Gaa>Aaa	p.E51K	RYR3_ENST00000415757.3_Missense_Mutation_p.E51K	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	51					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GTGCTTCTTGGAACCCACTTC	0.542																																					p.E51K												.	.	0			c.G151A	15						.						77.0	80.0	79.0					15																	33765719		2066	4192	6258	31553011	SO:0001583	missense	6263	exon2				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.151G>A	15.37:g.33765719G>A	ENSP00000373884:p.Glu51Lys	None		Capture	Illumina HiSeq	Phase_I	31553011	NM_001036	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	G	35	5.455924	0.96223	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.98493	-4.96;-4.96	4.86	4.86	0.63082	Inositol 1,4,5-trisphosphate/ryanodine receptor (1);	0.000000	0.85682	D	0.000000	D	0.98887	0.9623	M	0.83483	2.645	0.80722	D	1	D;D	0.76494	0.994;0.999	D;D	0.77557	0.99;0.968	D	0.99320	1.0906	10	0.51188	T	0.08	.	16.924	0.86170	0.0:0.0:1.0:0.0	.	51;51	Q15413-2;Q15413	.;RYR3_HUMAN	K	51	ENSP00000373884:E51K;ENSP00000399610:E51K	ENSP00000354735:E51K	E	+	1	0	RYR3	31553011	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.149000	0.94659	2.508000	0.84585	0.650000	0.86243	GAA		RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
RASGRP1	10125	broad.mit.edu	37	15	38786826	38786826	+	Silent	SNP	G	G	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr15:38786826G>A	ENST00000310803.5	-	16	2193	c.2016C>T	c.(2014-2016)gcC>gcT	p.A672A	RASGRP1_ENST00000559830.1_Intron|RASGRP1_ENST00000561180.1_Silent_p.A723A|RASGRP1_ENST00000539159.1_Silent_p.A624A|RASGRP1_ENST00000450598.2_Silent_p.A637A|RASGRP1_ENST00000558164.1_Intron	NM_001128602.1|NM_005739.3	NP_001122074.1|NP_005730.2	O95267	GRP1_HUMAN	RAS guanyl releasing protein 1 (calcium and DAG-regulated)	672					activation of Rho GTPase activity (GO:0032862)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response to antigenic stimulus (GO:0002437)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|platelet activation (GO:0030168)|Ras protein signal transduction (GO:0007265)|regulation of phosphatidylinositol 3-kinase signaling (GO:0014066)|secretory granule localization (GO:0032252)|signal transduction (GO:0007165)|vesicle transport along microtubule (GO:0047496)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|lipid binding (GO:0008289)	p.A672A(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20		all_cancers(109;6.38e-17)|all_epithelial(112;5.51e-15)|Lung NSC(122;2.12e-11)|all_lung(180;5.63e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;1.97e-07)|BRCA - Breast invasive adenocarcinoma(123;0.00248)		CAGTCTGGGTGGCCTTGTGGG	0.537																																					p.A672A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2016T	15						.						30.0	31.0	31.0					15																	38786826		1941	4128	6069	36574118	SO:0001819	synonymous_variant	10125	exon16			AF106071	CCDS45221.1, CCDS45222.1	15q15	2013-01-10				ENSG00000172575		"""EF-hand domain containing"""	9878	protein-coding gene	gene with protein product		603962				10087292, 9789079	Standard	NM_005739		Approved	CalDAG-GEFII, RASGRP	uc001zke.4	O95267		ENST00000310803.5:c.2016C>T	15.37:g.38786826G>A		Somatic		Capture	Illumina HiSeq	Phase_I	36574118	NM_005739	Q56CZ0|Q58G75|Q59HB1|Q5I3A8|Q6GV31|Q6NX39|Q7LDG6|Q9UI94|Q9UNN9	Silent	SNP	ENST00000310803.5	37	CCDS45222.1																																																																																				RASGRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418223.1	NM_005739	
FBN1	2200	broad.mit.edu	37	15	48729201	48729201	+	Silent	SNP	G	G	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr15:48729201G>A	ENST00000316623.5	-	53	6908	c.6453C>T	c.(6451-6453)tgC>tgT	p.C2151C		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	2151	EGF-like 36; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.		C -> W (in MFS). {ECO:0000269|PubMed:8136837}.		extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.C2151C(1)		NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		AGGGACACTCGCAGCGATAGG	0.363																																					p.C2151C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C6453T	15	GRCh37	CM940769	FBN1	M		.						118.0	114.0	115.0					15																	48729201		2198	4296	6494	46516493	SO:0001819	synonymous_variant	2200	exon53			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.6453C>T	15.37:g.48729201G>A		Somatic		Capture	Illumina HiSeq	Phase_I	46516493	NM_000138	B2RUU0|D2JYH6|Q15972|Q75N87	Silent	SNP	ENST00000316623.5	37	CCDS32232.1																																																																																				FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1		
MYO5A	4644	broad.mit.edu	37	15	52664518	52664518	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr15:52664518G>A	ENST00000399231.3	-	21	2863	c.2620C>T	c.(2620-2622)Cgg>Tgg	p.R874W	MYO5A_ENST00000356338.6_Missense_Mutation_p.R874W|MYO5A_ENST00000399233.2_Missense_Mutation_p.R874W|MYO5A_ENST00000358212.6_Missense_Mutation_p.R874W|MYO5A_ENST00000553916.1_Missense_Mutation_p.R874W	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	874	IQ 5. {ECO:0000255|PROSITE- ProRule:PRU00116}.				actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)	p.R874W(1)		breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		AGCCAGCCCCGGACTCGCTTC	0.517																																					p.R874W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2620T	15						.						43.0	42.0	43.0					15																	52664518		2035	4183	6218	50451810	SO:0001583	missense	4644	exon21				CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.2620C>T	15.37:g.52664518G>A	ENSP00000382177:p.Arg874Trp	Somatic		Capture	Illumina HiSeq	Phase_I	50451810	NM_000259	A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Missense_Mutation	SNP	ENST00000399231.3	37	CCDS42037.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.546895	0.86022	.	.	ENSG00000197535	ENST00000399231;ENST00000399229;ENST00000399233;ENST00000356338;ENST00000358212;ENST00000546028;ENST00000553916	T;T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07;-1.07	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	D	0.92580	0.7643	H	0.97983	4.12	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.74674	0.975;0.984	D	0.94640	0.7829	10	0.87932	D	0	.	16.6174	0.84920	0.0:0.0:0.8695:0.1305	.	874;874	Q9Y4I1;Q9Y4I1-2	MYO5A_HUMAN;.	W	874;408;874;874;874;504;874	ENSP00000382177:R874W;ENSP00000382179:R874W;ENSP00000348693:R874W;ENSP00000350945:R874W;ENSP00000451109:R874W	ENSP00000348693:R874W	R	-	1	2	MYO5A	50451810	0.999000	0.42202	1.000000	0.80357	0.989000	0.77384	2.723000	0.47277	2.890000	0.99128	0.650000	0.86243	CGG		MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268102.1	NM_000259	
MYO1E	4643	broad.mit.edu	37	15	59523927	59523927	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr15:59523927C>T	ENST00000288235.4	-	6	883	c.484G>A	c.(484-486)Gtc>Atc	p.V162I	MYO1E_ENST00000558814.1_5'UTR	NM_004998.3	NP_004989.2	Q12965	MYO1E_HUMAN	myosin IE	162	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(6)|lung(10)|pancreas(2)|prostate(1)|urinary_tract(1)	33				all cancers(107;0.207)		TTGTTCCGGACGGTCTTGGCG	0.522																																					p.V162I												.	.	0			c.G484A	15						.						136.0	110.0	119.0					15																	59523927		2190	4290	6480	57311219	SO:0001583	missense	4643	exon6			U14391	CCDS32254.1	15q21-q22	2011-09-27				ENSG00000157483		"""Myosins / Myosin superfamily : Class I"""	7599	protein-coding gene	gene with protein product	"""myosin-IC"""	601479				8884266	Standard	NM_004998		Approved	MYO1C, HuncM-IC, MGC104638	uc002aga.4	Q12965		ENST00000288235.4:c.484G>A	15.37:g.59523927C>T	ENSP00000288235:p.Val162Ile	None		Capture	Illumina HiSeq	Phase_I	57311219	NM_004998	Q14778	Missense_Mutation	SNP	ENST00000288235.4	37	CCDS32254.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.447151	0.84101	.	.	ENSG00000157483	ENST00000288235	D	0.87809	-2.3	5.55	5.55	0.83447	Myosin head, motor domain (3);	0.129904	0.51477	D	0.000091	D	0.86814	0.6023	L	0.50847	1.595	0.58432	D	0.999998	P	0.45672	0.864	B	0.43728	0.429	D	0.86984	0.2106	10	0.48119	T	0.1	.	19.5192	0.95179	0.0:1.0:0.0:0.0	.	162	Q12965	MYO1E_HUMAN	I	162	ENSP00000288235:V162I	ENSP00000288235:V162I	V	-	1	0	MYO1E	57311219	0.994000	0.37717	0.577000	0.28562	0.954000	0.61252	3.145000	0.50623	2.611000	0.88343	0.655000	0.94253	GTC		MYO1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416024.1	NM_004998	
VPS13C	54832	broad.mit.edu	37	15	62223446	62223446	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr15:62223446C>T	ENST00000261517.5	-	50	5954	c.5881G>A	c.(5881-5883)Gca>Aca	p.A1961T	VPS13C_ENST00000395896.4_Missense_Mutation_p.A1961T|VPS13C_ENST00000395898.3_Missense_Mutation_p.A1918T|VPS13C_ENST00000249837.3_Missense_Mutation_p.A1918T	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						TTATGAAATGCAACTCCAGAT	0.313																																					p.A1918T												.	.	0			c.G5752A	15						.						88.0	75.0	79.0					15																	62223446		2203	4300	6503	60010738	SO:0001583	missense	54832	exon48			AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.5881G>A	15.37:g.62223446C>T	ENSP00000261517:p.Ala1961Thr	None		Capture	Illumina HiSeq	Phase_I	60010738	NM_017684		Missense_Mutation	SNP	ENST00000261517.5	37	CCDS32257.1	.	.	.	.	.	.	.	.	.	.	C	10.02	1.236623	0.22711	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.43688	0.94;0.94;1.11	5.32	-10.6	0.00265	.	1.050350	0.07373	N	0.886128	T	0.19485	0.0468	N	0.08118	0	0.09310	N	1	B;B;B;B	0.13145	0.007;0.007;0.007;0.004	B;B;B;B	0.22386	0.039;0.039;0.039;0.017	T	0.41822	-0.9487	10	0.12430	T	0.62	.	16.0441	0.80707	0.2518:0.6572:0.0:0.091	.	1918;1961;1918;1961	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	T	1918;1961;1961;1961	ENSP00000249837:A1918T;ENSP00000261517:A1961T;ENSP00000379233:A1961T	ENSP00000249837:A1918T	A	-	1	0	VPS13C	60010738	0.837000	0.29446	0.056000	0.19401	0.105000	0.19272	0.819000	0.27308	-2.068000	0.00884	-1.179000	0.01719	GCA		VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	NM_017684	
ETFA	2108	broad.mit.edu	37	15	76578016	76578016	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr15:76578016C>T	ENST00000557943.1	-	7	706	c.626G>A	c.(625-627)cGa>cAa	p.R209Q	ETFA_ENST00000560726.1_5'UTR|ETFA_ENST00000560816.1_5'UTR|ETFA_ENST00000433983.2_Missense_Mutation_p.R160Q|ETFA_ENST00000559602.1_Missense_Mutation_p.R105Q	NM_000126.3	NP_000117.1	P13804	ETFA_HUMAN	electron-transfer-flavoprotein, alpha polypeptide	209	Domain II. {ECO:0000269|PubMed:8962055}.				cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|oxidoreductase activity (GO:0016491)	p.R209Q(1)		endometrium(1)|large_intestine(3)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	9						TAGCTCTGGTCGATCACTTTT	0.313																																					p.R160Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G479A	15						.						131.0	121.0	124.0					15																	76578016		2197	4294	6491	74365071	SO:0001583	missense	2108	exon6			J04058	CCDS32299.1, CCDS45311.1	15q23-q25	2012-04-04	2008-08-01		ENSG00000140374	ENSG00000140374			3481	protein-coding gene	gene with protein product	"""glutaric aciduria II"""	608053					Standard	NM_000126		Approved	GA2, EMA, MADD	uc002bbt.2	P13804	OTTHUMG00000172586	ENST00000557943.1:c.626G>A	15.37:g.76578016C>T	ENSP00000452762:p.Arg209Gln	Somatic		Capture	Illumina HiSeq	Phase_I	74365071	NM_001127716	B4DT43|Q53XN3	Missense_Mutation	SNP	ENST00000557943.1	37	CCDS32299.1	.	.	.	.	.	.	.	.	.	.	C	35	5.434253	0.96150	.	.	ENSG00000140374	ENST00000433983;ENST00000267950	D	0.92647	-3.08	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	D	0.96670	0.8913	M	0.88512	2.96	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.994;0.992;0.992	D	0.97321	0.9944	10	0.87932	D	0	-33.1882	17.6366	0.88124	0.0:1.0:0.0:0.0	.	160;209;209	B4DT43;Q53XN3;P13804	.;.;ETFA_HUMAN	Q	160;209	ENSP00000399273:R160Q	ENSP00000267950:R209Q	R	-	2	0	ETFA	74365071	1.000000	0.71417	0.973000	0.42090	0.992000	0.81027	6.981000	0.76166	2.513000	0.84729	0.455000	0.32223	CGA		ETFA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419302.2	NM_000126	
RASGRF1	5923	broad.mit.edu	37	15	79277532	79277532	+	Silent	SNP	A	A	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr15:79277532A>T	ENST00000419573.3	-	24	3553	c.3279T>A	c.(3277-3279)atT>atA	p.I1093I	RASGRF1_ENST00000560334.1_5'UTR|RP11-16K12.1_ENST00000316148.4_RNA|RASGRF1_ENST00000558480.2_Silent_p.I1077I|RASGRF1_ENST00000394745.3_Silent_p.I309I	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	1093	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.I1093I(1)		breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						TTTCTGAAGCAATCAAGTTAC	0.458																																					p.I1093I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T3279A	15						.						111.0	98.0	103.0					15																	79277532		2196	4293	6489	77064587	SO:0001819	synonymous_variant	5923	exon24			M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.3279T>A	15.37:g.79277532A>T		Somatic		Capture	Illumina HiSeq	Phase_I	77064587	NM_002891	F8VPA5|H0YKF2|J3KQP9|Q16027	Silent	SNP	ENST00000419573.3	37	CCDS10309.1																																																																																				RASGRF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000291371.3	NM_002891	
SRRM2	23524	broad.mit.edu	37	16	2818002	2818002	+	Silent	SNP	T	T	C	rs200929944	byFrequency	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr16:2818002T>C	ENST00000301740.8	+	11	8022	c.7473T>C	c.(7471-7473)aaT>aaC	p.N2491N	AC092117.2_ENST00000581119.1_RNA|SRRM2_ENST00000574593.1_3'UTR	NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	2491	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)	p.N2491N(1)		breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						GTGATCACAATGGCATGCTCT	0.622													T|||	2	0.000399361	0.0	0.0	5008	,	,		17914	0.002		0.0	False		,,,				2504	0.0				p.N2491N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T7473C	16						.						105.0	92.0	97.0					16																	2818002		2198	4300	6498	2758003	SO:0001819	synonymous_variant	23524	exon11			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.7473T>C	16.37:g.2818002T>C		Somatic		Capture	Illumina HiSeq	Phase_I	2758003	NM_016333	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Silent	SNP	ENST00000301740.8	37	CCDS32373.1																																																																																				SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
RRAD	6236	broad.mit.edu	37	16	66956176	66956177	+	Missense_Mutation	DNP	AC	AC	GT			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	AC	AC					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr16:66956176_66956177AC>GT	ENST00000299759.6	-	5	979_980	c.729_730GT>AC	c.(727-732)ctGTtt>ctACtt	p.F244L	RRAD_ENST00000420652.1_Missense_Mutation_p.F244L			P55042	RAD_HUMAN	Ras-related associated with diabetes	244					small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.L243>?(1)		endometrium(2)|kidney(4)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|urinary_tract(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0862)|Epithelial(162;0.198)		ACACCTTCAAACAGCGCCTGGA	0.604																																					.												.	.	1	Complex(1)	large_intestine(1)	c.729_730AC	16						.																																			65513678	SO:0001583	missense	6236	exon5			L24564	CCDS10824.1	16q22	2014-05-09			ENSG00000166592	ENSG00000166592			10446	protein-coding gene	gene with protein product		179503				7859947	Standard	NM_004165		Approved	REM3, RAD	uc002eqo.2	P55042	OTTHUMG00000137511	ENST00000299759.6:c.729_730delinsGT	16.37:g.66956176_66956177delinsGT	ENSP00000299759:p.Phe244Leu	Somatic		Capture	Illumina HiSeq	Phase_I	65513677	NM_004165	Q96F39	Missense_Mutation	DNP	ENST00000299759.6	37	CCDS10824.1																																																																																				RRAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268830.1	NM_004165	
HYDIN	54768	broad.mit.edu	37	16	71021902	71021902	+	Silent	SNP	G	G	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr16:71021902G>A	ENST00000393567.2	-	27	4269	c.4119C>T	c.(4117-4119)taC>taT	p.Y1373Y		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	1373					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.Y1372Y(1)|p.Y1324Y(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GTGTTATTTCGTAGGTGGGTC	0.463																																					p.Y1372Y												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C4116T	16						.						1.0	1.0	1.0					16																	71021902		2	2	4	69579403	SO:0001819	synonymous_variant	54768	exon27			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.4119C>T	16.37:g.71021902G>A		Somatic		Capture	Illumina HiSeq	Phase_I	69579403	NM_032821	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Silent	SNP	ENST00000393567.2	37	CCDS59269.1																																																																																				HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
TNFRSF13B	23495	broad.mit.edu	37	17	16842874	16842874	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr17:16842874C>A	ENST00000261652.2	-	5	881	c.869G>T	c.(868-870)gGc>gTc	p.G290V	TNFRSF13B_ENST00000581616.2_5'Flank|TNFRSF13B_ENST00000579315.1_Intron|TNFRSF13B_ENST00000437538.2_Intron|TNFRSF13B_ENST00000583789.1_Missense_Mutation_p.G244V	NM_012452.2	NP_036584.1	O14836	TR13B_HUMAN	tumor necrosis factor receptor superfamily, member 13B	290					B cell homeostasis (GO:0001782)|cell surface receptor signaling pathway (GO:0007166)|hematopoietic progenitor cell differentiation (GO:0002244)|negative regulation of B cell proliferation (GO:0030889)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)	p.G290V(1)		endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(7)|skin(1)	16						TGCACCTGGGCCCCCCTCCTG	0.617									IgA Deficiency, Selective																												p.G290V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G869T	17						.						34.0	35.0	35.0					17																	16842874		2202	4299	6501	16783599	SO:0001583	missense	23495	exon5	Familial Cancer Database	IGAD1, IGAD2	AF023614	CCDS11181.1	17p11.2	2014-09-17			ENSG00000240505	ENSG00000240505		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	18153	protein-coding gene	gene with protein product		604907				9311921	Standard	NM_012452		Approved	TACI, CD267	uc002gqs.1	O14836	OTTHUMG00000059262	ENST00000261652.2:c.869G>T	17.37:g.16842874C>A	ENSP00000261652:p.Gly290Val	Somatic		Capture	Illumina HiSeq	Phase_I	16783599	NM_012452	B2R8B0|B7Z6V8|Q32LX4|Q7Z6F5	Missense_Mutation	SNP	ENST00000261652.2	37	CCDS11181.1	.	.	.	.	.	.	.	.	.	.	C	7.409	0.634407	0.14322	.	.	ENSG00000240505	ENST00000261652	D	0.92249	-3.0	3.27	3.27	0.37495	.	1.351300	0.04966	N	0.463019	D	0.92054	0.7482	N	0.24115	0.695	0.44852	D	0.997863	D;D	0.61080	0.989;0.963	P;P	0.62740	0.906;0.808	D	0.85316	0.1081	10	0.25106	T	0.35	-4.4482	10.7104	0.45980	0.0:1.0:0.0:0.0	.	244;290	O14836-2;O14836	.;TR13B_HUMAN	V	290	ENSP00000261652:G290V	ENSP00000261652:G290V	G	-	2	0	TNFRSF13B	16783599	0.197000	0.23362	0.049000	0.19019	0.137000	0.21094	1.105000	0.31086	1.752000	0.51891	0.448000	0.29417	GGC		TNFRSF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131474.2		
KIAA0100	9703	broad.mit.edu	37	17	26965334	26965334	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr17:26965334G>T	ENST00000528896.2	-	13	1522	c.1448C>A	c.(1447-1449)gCg>gAg	p.A483E	KIAA0100_ENST00000389003.3_Missense_Mutation_p.A340E|KIAA0100_ENST00000544884.1_Missense_Mutation_p.A340E|RP11-192H23.7_ENST00000577814.1_RNA	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	483						extracellular region (GO:0005576)		p.A483E(1)		breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					TGGGTGTGGCGCCCGCTGAAT	0.582																																					p.A483E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1448A	17						.						60.0	58.0	59.0					17																	26965334		2203	4300	6503	23989461	SO:0001583	missense	9703	exon13			D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.1448C>A	17.37:g.26965334G>T	ENSP00000436773:p.Ala483Glu	Somatic		Capture	Illumina HiSeq	Phase_I	23989461	NM_014680	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	ENST00000528896.2	37	CCDS32595.1	.	.	.	.	.	.	.	.	.	.	G	33	5.213535	0.95069	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896;ENST00000544884	T;T	0.27104	1.74;1.69	5.83	5.83	0.93111	FMP27, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.42177	0.1191	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.03784	-1.1004	10	0.24483	T	0.36	.	20.1374	0.98035	0.0:0.0:1.0:0.0	.	483	Q14667	K0100_HUMAN	E	483;483;483;340	ENSP00000436773:A483E;ENSP00000446443:A340E	ENSP00000005905:A483E	A	-	2	0	KIAA0100	23989461	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.383000	0.97214	2.763000	0.94921	0.563000	0.77884	GCG		KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	NM_014680	
KRT13	3860	broad.mit.edu	37	17	39659587	39659587	+	Silent	SNP	G	G	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr17:39659587G>A	ENST00000246635.3	-	3	733	c.687C>T	c.(685-687)atC>atT	p.I229I	AC019349.5_ENST00000411759.1_RNA|KRT13_ENST00000587544.1_Silent_p.I229I|KRT13_ENST00000587118.1_5'Flank|KRT13_ENST00000336861.3_Silent_p.I229I	NM_153490.2	NP_705694	P13646	K1C13_HUMAN	keratin 13	229	Coil 1B.|Rod.				cellular response to retinoic acid (GO:0071300)|cytoskeleton organization (GO:0007010)|response to radiation (GO:0009314)|tongue morphogenesis (GO:0043587)	extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)	p.I229I(1)		NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	33		Breast(137;0.000286)				TCAGGCTCTCGATCTGCATCT	0.577																																					p.I229I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C687T	17						.						128.0	125.0	126.0					17																	39659587		2203	4300	6503	36913113	SO:0001819	synonymous_variant	3860	exon3				CCDS11396.1, CCDS11397.1	17q21.2	2013-06-20			ENSG00000171401	ENSG00000171401		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6415	protein-coding gene	gene with protein product	"""keratin, type I cytoskeletal 13"", ""cytokeratin 13"""	148065				16831889	Standard	NM_153490		Approved	K13, CK13, MGC3781, MGC161462	uc002hwu.1	P13646	OTTHUMG00000133434	ENST00000246635.3:c.687C>T	17.37:g.39659587G>A		Somatic		Capture	Illumina HiSeq	Phase_I	36913113	NM_153490	Q53G54|Q6AZK5|Q8N240	Silent	SNP	ENST00000246635.3	37	CCDS11396.1																																																																																				KRT13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257297.1	NM_153490	
KRT15	3866	broad.mit.edu	37	17	39673102	39673103	+	Missense_Mutation	DNP	GC	GC	CT			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	GC	GC					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr17:39673102_39673103GC>CT	ENST00000254043.3	-	3	4280_4281	c.695_696GC>AG	c.(694-696)gGC>gAG	p.G232E	KRT15_ENST00000393976.2_Missense_Mutation_p.G232E|KRT15_ENST00000393981.3_Missense_Mutation_p.G67E|KRT15_ENST00000393974.3_Missense_Mutation_p.G67E	NM_002275.3	NP_002266	P19012	K1C15_HUMAN	keratin 15	232	Coil 1B.|Rod.				epidermis development (GO:0008544)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)	p.G232>?(1)		NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16		Breast(137;0.000286)				CCTCATTCAGGCCCTCGATCTG	0.614																																					.												.	.	1	Complex(1)	large_intestine(1)	c.695_696AG	17						.																																			36926629	SO:0001583	missense	3866	exon3				CCDS11398.1	17q21.2	2013-06-20			ENSG00000171346	ENSG00000171346		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6421	protein-coding gene	gene with protein product	"""keratin-15, basic"", ""keratin-15, beta"", ""type I cytoskeletal 15"", ""cytokeratin 15"""	148030				16831889	Standard	NM_002275		Approved	K15, CK15, K1CO	uc002hwy.3	P19012	OTTHUMG00000133435	ENST00000254043.3:c.695_696delinsCT	17.37:g.39673102_39673103delinsCT	ENSP00000254043:p.Gly232Glu	Somatic		Capture	Illumina HiSeq	Phase_I	36926628	NM_002275	B3KQY1|B3KRA2|E0CX14|Q53XV8|Q9BUG4	Missense_Mutation	DNP	ENST00000254043.3	37	CCDS11398.1																																																																																				KRT15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257301.1	NM_002275	
TP53	7157	broad.mit.edu	37	17	7578263	7578263	+	Nonsense_Mutation	SNP	G	G	A	rs397516435		TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr17:7578263G>A	ENST00000269305.4	-	6	775	c.586C>T	c.(586-588)Cga>Tga	p.R196*	TP53_ENST00000445888.2_Nonsense_Mutation_p.R196*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R196*|TP53_ENST00000359597.4_Nonsense_Mutation_p.R196*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R196*|TP53_ENST00000574684.1_Intron|TP53_ENST00000413465.2_Nonsense_Mutation_p.R196*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	196	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R196*(167)|p.R64*(14)|p.R103*(14)|p.0?(8)|p.R196fs*51(7)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.R196R(2)|p.I195fs*50(1)|p.R64fs*>27(1)|p.R103fs*51(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I195fs*12(1)|p.P59_E66>Q(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCTTCCACTCGGATAAGATGC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R196X	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,central_nervous_system,brain,Substitution - Missense,-2 	.	232	Substitution - Nonsense(195)|Deletion - Frameshift(11)|Whole gene deletion(8)|Deletion - In frame(5)|Complex - deletion inframe(5)|Unknown(5)|Substitution - coding silent(2)|Complex - frameshift(1)	large_intestine(54)|breast(29)|upper_aerodigestive_tract(22)|lung(22)|haematopoietic_and_lymphoid_tissue(17)|skin(17)|biliary_tract(11)|central_nervous_system(11)|oesophagus(11)|ovary(11)|stomach(8)|urinary_tract(7)|bone(4)|liver(3)|pancreas(3)|eye(1)|kidney(1)	c.C586T	17	GRCh37	CM941329	TP53	M		.						102.0	91.0	94.0					17																	7578263		2203	4300	6503	7518988	SO:0001587	stop_gained	7157	exon6	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.586C>T	17.37:g.7578263G>A	ENSP00000269305:p.Arg196*	Somatic		Capture	Illumina HiSeq	Phase_I	7518988	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	14.02	2.409843	0.42715	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.41	4.44	0.53790	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.9531	12.3046	0.54895	0.0827:0.0:0.9173:0.0	.	.	.	.	X	196;196;196;196;196;196;185;103;64;103;64	.	ENSP00000269305:R196X	R	-	1	2	TP53	7518988	1.000000	0.71417	0.997000	0.53966	0.023000	0.10783	2.166000	0.42406	1.427000	0.47276	-0.140000	0.14226	CGA		TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
AXIN2	8313	broad.mit.edu	37	17	63533101	63533101	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr17:63533101C>T	ENST00000307078.5	-	7	2106	c.1793G>A	c.(1792-1794)gGg>gAg	p.G598E	AXIN2_ENST00000375702.5_Intron	NM_004655.3	NP_004646.3	Q9Y2T1	AXIN2_HUMAN	axin 2	598				Missing (in Ref. 2; AAF22799). {ECO:0000305}.	bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to organic cyclic compound (GO:0071407)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|dorsal/ventral axis specification (GO:0009950)|intramembranous ossification (GO:0001957)|maintenance of DNA repeat elements (GO:0043570)|mRNA stabilization (GO:0048255)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast differentiation (GO:0045668)|odontogenesis (GO:0042476)|positive regulation of cell death (GO:0010942)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein phosphorylation (GO:0001934)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of chondrocyte development (GO:0061181)|regulation of mismatch repair (GO:0032423)|secondary heart field specification (GO:0003139)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	34						GCCGGGGGCCCCTCCTTCCCT	0.677									Oligodontia, Ectodermal Dysplasia and Colorectal Polyp syndrome																												p.G598E												.	.	0			c.G1793A	17						.						31.0	33.0	32.0					17																	63533101		2203	4297	6500	60963563	SO:0001583	missense	8313	exon7	Familial Cancer Database	Oligodontia-Colorectal Cancer syndrome, Tooth Agenesis-Colorectal Cancer Syndrome	AF078165	CCDS11662.1	17q24.1	2014-09-17	2008-08-01		ENSG00000168646				904	protein-coding gene	gene with protein product	"""conductin"", ""axil"""	604025				10049590	Standard	NM_004655		Approved	MGC126582, DKFZp781B0869	uc002jfi.3	Q9Y2T1	OTTHUMG00000179353	ENST00000307078.5:c.1793G>A	17.37:g.63533101C>T	ENSP00000302625:p.Gly598Glu	None		Capture	Illumina HiSeq	Phase_I	60963563	NM_004655	Q3MJ88|Q9H3M6|Q9UH84	Missense_Mutation	SNP	ENST00000307078.5	37	CCDS11662.1	.	.	.	.	.	.	.	.	.	.	C	13.60	2.285615	0.40394	.	.	ENSG00000168646	ENST00000307078	T	0.62232	0.04	4.39	4.39	0.52855	.	0.000000	0.48286	D	0.000198	T	0.68421	0.2999	L	0.47716	1.5	0.80722	D	1	D	0.67145	0.996	D	0.64595	0.927	T	0.66756	-0.5843	10	0.37606	T	0.19	-33.7831	10.6341	0.45554	0.0:0.9094:0.0:0.0906	.	598	Q9Y2T1	AXIN2_HUMAN	E	598	ENSP00000302625:G598E	ENSP00000302625:G598E	G	-	2	0	AXIN2	60963563	1.000000	0.71417	0.996000	0.52242	0.981000	0.71138	1.761000	0.38440	2.124000	0.65301	0.462000	0.41574	GGG		AXIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445900.1	NM_004655	
CCDC40	55036	broad.mit.edu	37	17	78013679	78013679	+	Silent	SNP	G	G	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr17:78013679G>A	ENST00000397545.4	+	3	189	c.162G>A	c.(160-162)gaG>gaA	p.E54E	CCDC40_ENST00000374876.4_Silent_p.E54E|CCDC40_ENST00000269318.5_Silent_p.E54E|CCDC40_ENST00000374877.3_Silent_p.E54E	NM_017950.3	NP_060420.2	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40	54					axonemal dynein complex assembly (GO:0070286)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement (GO:0003351)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)|regulation of cilium beat frequency (GO:0003356)	cilium (GO:0005929)|cytoplasm (GO:0005737)		p.E54E(2)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	38	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			AGCATCCTGAGGAAGTCACAA	0.532																																					p.E54E												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G162A	17						.						56.0	59.0	58.0					17																	78013679		2013	4165	6178	75628274	SO:0001819	synonymous_variant	55036	exon3			AB046860	CCDS42395.1, CCDS58604.1	17q25.3	2013-11-15			ENSG00000141519	ENSG00000141519			26090	protein-coding gene	gene with protein product		613799				21131974	Standard	NM_017950		Approved	FLJ20753, KIAA1640, FLJ32021, CILD15, FAP172	uc010dht.3	Q4G0X9	OTTHUMG00000132707	ENST00000397545.4:c.162G>A	17.37:g.78013679G>A		Somatic		Capture	Illumina HiSeq	Phase_I	75628274	NM_017950	A8MTD2|C9JTI9|C9JTJ0|C9JXW1|Q6PE47|Q9HCD2|Q9NWL5	Silent	SNP	ENST00000397545.4	37	CCDS42395.1																																																																																				CCDC40-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256005.2	XM_371082	
CNTROB	116840	broad.mit.edu	37	17	7837540	7837540	+	Splice_Site	SNP	C	C	T	rs145359194		TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr17:7837540C>T	ENST00000563694.1	+	2	1280	c.355C>T	c.(355-357)Cgg>Tgg	p.R119W	CNTROB_ENST00000380262.3_Splice_Site_p.R119W|TRAPPC1_ENST00000540486.1_5'Flank|TRAPPC1_ENST00000303731.4_5'Flank|CNTROB_ENST00000380255.3_Splice_Site_p.R119W|CNTROB_ENST00000565740.1_Splice_Site_p.R119W	NM_053051.3	NP_444279.2	Q8N137	CNTRB_HUMAN	centrobin, centrosomal BRCA2 interacting protein	119					centriole replication (GO:0007099)|centrosome separation (GO:0051299)|cytokinesis (GO:0000910)	centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)	p.R119W(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)	25		Prostate(122;0.173)				TACAGCCTATCGTGAGTAAGC	0.493													C|||	1	0.000199681	0.0	0.0	5008	,	,		20337	0.0		0.001	False		,,,				2504	0.0				p.R119W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C355T	17						.	C	TRP/ARG,TRP/ARG	0,4406		0,0,2203	137.0	120.0	126.0		355,355	3.4	1.0	17	dbSNP_134	126	8,8592	5.7+/-21.5	0,8,4292	yes	missense-near-splice,missense-near-splice	CNTROB	NM_001037144.5,NM_053051.3	101,101	0,8,6495	TT,TC,CC		0.093,0.0,0.0615	probably-damaging,probably-damaging	119/926,119/904	7837540	8,12998	2203	4300	6503	7778265	SO:0001630	splice_region_variant	116840	exon2			AF331638	CCDS32557.1, CCDS11126.1	17p13.1	2006-03-15				ENSG00000170037			29616	protein-coding gene	gene with protein product	"""centrobin"""	611425				11984006, 16275750	Standard	NM_001037144		Approved	LIP8, PP1221	uc002gjp.3	Q8N137		ENST00000563694.1:c.355+1C>T	17.37:g.7837540C>T		Somatic		Capture	Illumina HiSeq	Phase_I	7778265	NM_053051	A6NHQ1|Q331K3|Q69YV7|Q8NCB8|Q8WXV3|Q96CQ7|Q9C060	Missense_Mutation	SNP	ENST00000563694.1	37	CCDS11126.1	.	.	.	.	.	.	.	.	.	.	C	18.88	3.717375	0.68844	0.0	9.3E-4	ENSG00000170037	ENST00000380262;ENST00000380255	T;T	0.50813	1.3;0.73	5.48	3.43	0.39272	.	0.000000	0.42294	D	0.000725	T	0.52041	0.1710	L	0.29908	0.895	0.80722	D	1	D;D;D	0.89917	0.998;0.998;1.0	P;P;D	0.74674	0.799;0.799;0.984	T	0.51260	-0.8728	10	0.66056	D	0.02	-18.9122	8.5322	0.33342	0.3109:0.5386:0.1504:0.0	.	119;119;119	Q8N137-3;Q8N137;Q8N137-2	.;CNTRB_HUMAN;.	W	119	ENSP00000369614:R119W;ENSP00000369605:R119W	ENSP00000369605:R119W	R	+	1	2	CNTROB	7778265	0.996000	0.38824	0.999000	0.59377	0.781000	0.44180	1.042000	0.30303	0.642000	0.30620	0.655000	0.94253	CGG		CNTROB-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000421372.1	NM_053051	Missense_Mutation
CARD14	79092	broad.mit.edu	37	17	78176130	78176130	+	Silent	SNP	C	C	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr17:78176130C>T	ENST00000573882.1	+	17	2666	c.2130C>T	c.(2128-2130)ttC>ttT	p.F710F	RP11-334C17.5_ENST00000573346.1_RNA|RP11-334C17.5_ENST00000572730.1_RNA|CARD14_ENST00000570421.1_Silent_p.F710F|RP11-334C17.5_ENST00000573935.1_RNA|RP11-334C17.5_ENST00000570309.1_RNA|CARD14_ENST00000344227.2_Silent_p.F710F|RP11-334C17.5_ENST00000576824.1_RNA|CARD14_ENST00000392434.2_Missense_Mutation_p.S431F			Q9BXL6	CAR14_HUMAN	caspase recruitment domain family, member 14	710					activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)	p.F710F(1)		NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(5)|prostate(1)|skin(1)	23	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.017)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			ACACCATGTTCCAGGGCTGCG	0.612																																					p.F710F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2130T	17						.						68.0	59.0	62.0					17																	78176130		2203	4300	6503	75790725	SO:0001819	synonymous_variant	79092	exon15			AF322642	CCDS11768.1, CCDS58605.1	17q25.3	2014-09-04			ENSG00000141527	ENSG00000141527			16446	protein-coding gene	gene with protein product		607211	"""psoriasis susceptibility 2"""	PSORS2		11278692, 11356195, 22521418	Standard	NM_052819		Approved	CARMA2, BIMP2	uc031res.1	Q9BXL6	OTTHUMG00000177549	ENST00000573882.1:c.2130C>T	17.37:g.78176130C>T		Somatic		Capture	Illumina HiSeq	Phase_I	75790725	NM_024110	B8QQJ3|Q9BVB5	Silent	SNP	ENST00000573882.1	37	CCDS11768.1	.	.	.	.	.	.	.	.	.	.	C	18.51	3.639051	0.67130	.	.	ENSG00000141527	ENST00000392434	T	0.17854	2.25	4.79	3.82	0.43975	.	.	.	.	.	T	0.14700	0.0355	.	.	.	0.23198	N	0.998133	.	.	.	.	.	.	T	0.23297	-1.0192	5	.	.	.	-24.196	6.7787	0.23634	0.0:0.7174:0.0:0.2826	.	.	.	.	F	431	ENSP00000376229:S431F	.	S	+	2	0	CARD14	75790725	0.893000	0.30496	0.999000	0.59377	0.949000	0.60115	3.010000	0.49559	1.009000	0.39289	0.462000	0.41574	TCC		CARD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437507.1		
ST8SIA5	29906	broad.mit.edu	37	18	44260278	44260278	+	Silent	SNP	C	C	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr18:44260278C>T	ENST00000315087.7	-	7	1518	c.858G>A	c.(856-858)tcG>tcA	p.S286S	ST8SIA5_ENST00000538168.1_Silent_p.S322S|ST8SIA5_ENST00000590497.1_5'UTR|ST8SIA5_ENST00000536490.1_Silent_p.S255S	NM_013305.4	NP_037437.2	O15466	SIA8E_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5	286					carbohydrate metabolic process (GO:0005975)|glycosphingolipid biosynthetic process (GO:0006688)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialyltransferase activity (GO:0008373)	p.S286S(1)		kidney(1)|large_intestine(10)|lung(7)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	22						GCCAGTAGCGCGACACGTTGA	0.617																																					p.S286S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G858A	18						.						106.0	80.0	89.0					18																	44260278		2203	4300	6503	42514276	SO:0001819	synonymous_variant	29906	exon7			U91641	CCDS11930.1	18q12.3	2013-03-01	2003-01-14	2005-02-07	ENSG00000101638	ENSG00000101638		"""Sialyltransferases"""	17827	protein-coding gene	gene with protein product	"""ST8Sia V"""	607162	"""sialyltransferase 8E (alpha-2, 8-polysialytransferase)"""	SIAT8E		9199191	Standard	XM_005258250		Approved		uc002lcj.1	O15466	OTTHUMG00000132643	ENST00000315087.7:c.858G>A	18.37:g.44260278C>T		Somatic		Capture	Illumina HiSeq	Phase_I	42514276	NM_013305	B7Z1K9|Q6IAW7	Silent	SNP	ENST00000315087.7	37	CCDS11930.1																																																																																				ST8SIA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255892.1	NM_013305	
ZNF20	7568	broad.mit.edu	37	19	12246700	12246700	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr19:12246700G>A	ENST00000334213.5	-	2	247	c.23C>T	c.(22-24)gCc>gTc	p.A8V	ZNF20_ENST00000485451.1_5'UTR|ZNF625-ZNF20_ENST00000430024.1_3'UTR|ZNF20_ENST00000600335.1_Missense_Mutation_p.A5V	NM_001203250.1|NM_021143.3	NP_001190179.1|NP_066966.2	P17024	ZNF20_HUMAN	zinc finger protein 20	8	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|lung(6)	8						ATCCTCAAAGGCCACTGAATC	0.463																																					p.A8V												.	.	0			c.C23T	19						.						63.0	64.0	64.0					19																	12246700		2202	4300	6502	12107700	SO:0001583	missense	7568	exon2			X52344	CCDS45986.1	19p13.2	2013-01-08	2006-05-10		ENSG00000132010	ENSG00000132010		"""Zinc fingers, C2H2-type"", ""-"""	12992	protein-coding gene	gene with protein product		194557	"""zinc finger protein 20 (KOX 13)"""				Standard	NM_021143		Approved	KOX13	uc002mtf.2	P17024	OTTHUMG00000156409	ENST00000334213.5:c.23C>T	19.37:g.12246700G>A	ENSP00000335437:p.Ala8Val	None		Capture	Illumina HiSeq	Phase_I	12107700	NM_021143	Q8N457|Q9UG41	Missense_Mutation	SNP	ENST00000334213.5	37	CCDS45986.1	.	.	.	.	.	.	.	.	.	.	G	12.74	2.028422	0.35797	.	.	ENSG00000132010	ENST00000334213;ENST00000292241;ENST00000418866	T;T	0.01787	4.64;4.64	0.94	-0.175	0.13315	Krueppel-associated box (4);	.	.	.	.	T	0.02304	0.0071	L	0.37750	1.13	0.22317	N	0.999204	D	0.54397	0.966	P	0.49887	0.625	T	0.47058	-0.9146	9	0.51188	T	0.08	.	3.1081	0.06348	0.3345:0.0:0.6655:0.0	.	8	P17024	ZNF20_HUMAN	V	8;8;5	ENSP00000335437:A8V;ENSP00000390115:A5V	ENSP00000292241:A8V	A	-	2	0	ZNF20	12107700	0.997000	0.39634	0.319000	0.25293	0.081000	0.17604	1.579000	0.36536	-0.041000	0.13558	0.313000	0.20887	GCC		ZNF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344101.1	NM_021143	
ZNF91	7644	broad.mit.edu	37	19	23544042	23544042	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr19:23544042C>A	ENST00000300619.7	-	4	1944	c.1739G>T	c.(1738-1740)gGc>gTc	p.G580V	ZNF91_ENST00000596528.1_5'Flank|ZNF91_ENST00000599743.1_Intron|ZNF91_ENST00000397082.2_Missense_Mutation_p.G548V	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	580					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.G580V(1)					all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				AAAAGCTTTGCCACATTCTTC	0.338																																					p.G580V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1739T	19						.						43.0	45.0	44.0					19																	23544042		2124	4264	6388	23335882	SO:0001583	missense	7644	exon4			M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.1739G>T	19.37:g.23544042C>A	ENSP00000300619:p.Gly580Val	Somatic		Capture	Illumina HiSeq	Phase_I	23335882	NM_003430	A8K5E1|B7Z6G6	Missense_Mutation	SNP	ENST00000300619.7	37	CCDS42541.1	.	.	.	.	.	.	.	.	.	.	C	12.74	2.028430	0.35797	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	T;T	0.22134	3.19;1.97	1.78	1.78	0.24846	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.47710	0.1460	M	0.86651	2.83	0.50313	D	0.999864	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.99	T	0.54906	-0.8223	9	0.87932	D	0	.	10.5193	0.44910	0.0:1.0:0.0:0.0	.	548;580	Q05481-2;Q05481	.;ZNF91_HUMAN	V	580;548	ENSP00000300619:G580V;ENSP00000380272:G548V	ENSP00000300619:G580V	G	-	2	0	ZNF91	23335882	0.167000	0.22975	0.039000	0.18376	0.114000	0.19823	0.567000	0.23608	0.962000	0.38057	0.313000	0.20887	GGC		ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465891.1	NM_003430	
ZNF91	7644	broad.mit.edu	37	19	23557553	23557553	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr19:23557553A>T	ENST00000300619.7	-	2	249	c.44T>A	c.(43-45)tTt>tAt	p.F15Y	ZNF91_ENST00000599743.1_Missense_Mutation_p.F15Y|ZNF91_ENST00000397082.2_Missense_Mutation_p.F15Y	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	15	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.F15Y(1)					all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				CACATCCCTAAATGTCAACAG	0.398																																					p.F15Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T44A	19						.						88.0	97.0	94.0					19																	23557553		2198	4300	6498	23349393	SO:0001583	missense	7644	exon2			M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.44T>A	19.37:g.23557553A>T	ENSP00000300619:p.Phe15Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	23349393	NM_003430	A8K5E1|B7Z6G6	Missense_Mutation	SNP	ENST00000300619.7	37	CCDS42541.1	.	.	.	.	.	.	.	.	.	.	A	10.26	1.299920	0.23650	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	T;T	0.08370	3.1;3.1	0.149	0.149	0.14863	Krueppel-associated box (4);	.	.	.	.	T	0.31167	0.0788	H	0.95260	3.645	0.09310	N	0.999999	B;D	0.59767	0.393;0.986	B;P	0.60068	0.294;0.868	T	0.07539	-1.0767	8	0.66056	D	0.02	.	.	.	.	.	15;15	Q05481-2;Q05481	.;ZNF91_HUMAN	Y	15	ENSP00000300619:F15Y;ENSP00000380272:F15Y	ENSP00000300619:F15Y	F	-	2	0	ZNF91	23349393	0.911000	0.30947	0.461000	0.27105	0.489000	0.33432	2.364000	0.44187	0.166000	0.19597	0.164000	0.16699	TTT		ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465891.1	NM_003430	
ARHGAP33	115703	broad.mit.edu	37	19	36271515	36271515	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr19:36271515T>A	ENST00000007510.4	+	9	878	c.734T>A	c.(733-735)cTc>cAc	p.L245H	ARHGAP33_ENST00000314737.5_Missense_Mutation_p.L245H|ARHGAP33_ENST00000378944.5_Missense_Mutation_p.L109H			O14559	RHG33_HUMAN	Rho GTPase activating protein 33	245	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|Rac GTPase activator activity (GO:0030675)			endometrium(7)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	37						TGTGTGGAACTCTTCACAGAG	0.657																																					p.L245H												.	.	0			c.T734A	19						.						52.0	50.0	51.0					19																	36271515		2203	4300	6503	40963355	SO:0001583	missense	115703	exon9			AY044864	CCDS12477.1, CCDS54254.1	19q13.13	2011-06-29	2010-02-19	2010-02-19		ENSG00000004777		"""Rho GTPase activating proteins"""	23085	protein-coding gene	gene with protein product		614902	"""sorting nexin 26"""	SNX26		12297274, 12461558	Standard	NM_052948		Approved	FLJ39019, TCGAP	uc002obs.2	O14559		ENST00000007510.4:c.734T>A	19.37:g.36271515T>A	ENSP00000007510:p.Leu245His	None		Capture	Illumina HiSeq	Phase_I	40963355	NM_052948	O14552|O14560|Q6ZSP6|Q96CP3|Q9NT23	Missense_Mutation	SNP	ENST00000007510.4	37		.	.	.	.	.	.	.	.	.	.	T	20.4	3.990853	0.74703	.	.	ENSG00000004777	ENST00000007510;ENST00000314737;ENST00000378944	T;T;T	0.33438	1.41;1.41;1.41	5.32	5.32	0.75619	.	0.000000	0.64402	D	0.000011	T	0.51873	0.1700	L	0.58302	1.8	0.45777	D	0.998663	D;D	0.89917	0.999;1.0	D;D	0.91635	0.992;0.999	T	0.54682	-0.8257	10	0.87932	D	0	.	14.2601	0.66078	0.0:0.0:0.0:1.0	.	109;245	O14559-10;O14559-11	.;.	H	245;245;109	ENSP00000007510:L245H;ENSP00000320038:L245H;ENSP00000368227:L109H	ENSP00000007510:L245H	L	+	2	0	ARHGAP33	40963355	1.000000	0.71417	0.922000	0.36590	0.733000	0.41908	7.245000	0.78237	2.018000	0.59344	0.459000	0.35465	CTC		ARHGAP33-201	KNOWN	basic	protein_coding	protein_coding		NM_052948	
FCGBP	8857	broad.mit.edu	37	19	40366143	40366143	+	Silent	SNP	G	G	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr19:40366143G>A	ENST00000221347.6	-	30	14098	c.14091C>T	c.(14089-14091)gaC>gaT	p.D4697D		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	4697						extracellular vesicular exosome (GO:0070062)		p.D4697D(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CTTGGCAGGCGTCCAGCAAGC	0.716																																					p.D4697D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C14091T	19						.						17.0	24.0	22.0					19																	40366143		2096	4123	6219	45057983	SO:0001819	synonymous_variant	8857	exon30			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.14091C>T	19.37:g.40366143G>A		Somatic		Capture	Illumina HiSeq	Phase_I	45057983	NM_003890	O95784	Silent	SNP	ENST00000221347.6	37	CCDS12546.1																																																																																				FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
ZNRF4	148066	broad.mit.edu	37	19	5456387	5456387	+	Silent	SNP	G	G	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr19:5456387G>A	ENST00000222033.4	+	1	962	c.885G>A	c.(883-885)caG>caA	p.Q295Q		NM_181710.3	NP_859061.3	Q8WWF5	ZNRF4_HUMAN	zinc and ring finger 4	295						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)	p.Q295Q(1)		NS(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;0.0002)		CTACCTGCCAGAAGGCCCAGG	0.622																																					p.Q295Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G885A	19						.						65.0	71.0	69.0					19																	5456387		2111	4217	6328	5407387	SO:0001819	synonymous_variant	148066	exon1			AK098722	CCDS42475.1	19p13.3	2013-01-09				ENSG00000105428		"""RING-type (C3HC4) zinc fingers"""	17726	protein-coding gene	gene with protein product		612063					Standard	NM_181710		Approved	spzn, Ssrzf1, RNF204	uc002mca.4	Q8WWF5		ENST00000222033.4:c.885G>A	19.37:g.5456387G>A		Somatic		Capture	Illumina HiSeq	Phase_I	5407387	NM_181710	A8K886|O75866	Silent	SNP	ENST00000222033.4	37	CCDS42475.1																																																																																				ZNRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450924.1	NM_181710	
MEIS3	56917	broad.mit.edu	37	19	47912433	47912433	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr19:47912433G>A	ENST00000558555.1	-	8	968	c.781C>T	c.(781-783)Cgg>Tgg	p.R261W	MEIS3_ENST00000560253.1_5'UTR|MEIS3_ENST00000561293.1_Missense_Mutation_p.R261W|MEIS3_ENST00000559524.1_Missense_Mutation_p.R261W|MEIS3_ENST00000561096.1_Missense_Mutation_p.R349W|MEIS3_ENST00000331559.5_Missense_Mutation_p.R244W|MEIS3_ENST00000441740.2_Missense_Mutation_p.R244W			Q99687	MEIS3_HUMAN	Meis homeobox 3	261					negative regulation of apoptotic signaling pathway (GO:2001234)|positive regulation of protein kinase B signaling (GO:0051897)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)	p.R261W(1)		breast(1)|large_intestine(5)|lung(11)|prostate(1)|skin(2)	20		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;0.000198)|OV - Ovarian serous cystadenocarcinoma(262;0.000439)|Epithelial(262;0.0113)|GBM - Glioblastoma multiforme(486;0.0223)		TTGTTTCGCCGTCGCTCCTGG	0.612																																					p.R261W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C781T	19						.						93.0	71.0	78.0					19																	47912433		2203	4300	6503	52604245	SO:0001583	missense	56917	exon8			BC025404	CCDS33064.1, CCDS46132.1, CCDS74406.1	19q13.32	2012-10-02	2007-02-15		ENSG00000105419	ENSG00000105419		"""Homeoboxes / TALE class"""	29537	protein-coding gene	gene with protein product			"""Meis1, myeloid ecotropic viral integration site 1 homolog 3 (mouse)"""			8950991	Standard	NM_020160		Approved	MRG2, DKFZp547H236	uc002pgt.4	Q99687	OTTHUMG00000172280	ENST00000558555.1:c.781C>T	19.37:g.47912433G>A	ENSP00000454073:p.Arg261Trp	Somatic		Capture	Illumina HiSeq	Phase_I	52604245	NM_020160	A8K1N5|Q6NT73|Q8TC66|Q9NPW2	Missense_Mutation	SNP	ENST00000558555.1	37		.	.	.	.	.	.	.	.	.	.	G	19.59	3.855464	0.71719	.	.	ENSG00000105419	ENST00000331559;ENST00000441740	D;D	0.93953	-3.32;-2.28	4.06	2.99	0.34606	Homeodomain-related (1);Homeobox (1);Homeodomain-like (1);	0.071502	0.53938	D	0.000058	D	0.93546	0.7940	L	0.36672	1.1	0.41418	D	0.98778	D;D;D;D;D	0.89917	0.999;0.997;1.0;1.0;0.999	P;P;D;D;P	0.85130	0.857;0.676;0.972;0.997;0.893	D	0.93052	0.6466	10	0.87932	D	0	-3.7783	9.04	0.36311	0.0:0.0:0.5815:0.4185	.	153;261;244;261;136	Q8TCW1;Q99687;Q99687-3;Q99687-2;Q59FK5	.;MEIS3_HUMAN;.;.;.	W	261;244	ENSP00000333552:R261W;ENSP00000388667:R244W	ENSP00000333552:R261W	R	-	1	2	MEIS3	52604245	1.000000	0.71417	0.999000	0.59377	0.960000	0.62799	4.267000	0.58877	1.221000	0.43506	0.655000	0.94253	CGG		MEIS3-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000417642.1	XM_085929	
LIM2	3982	broad.mit.edu	37	19	51885719	51885719	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr19:51885719G>T	ENST00000596399.1	-	3	325	c.278C>A	c.(277-279)tCc>tAc	p.S93Y	LIM2_ENST00000221973.3_Missense_Mutation_p.S135Y	NM_001161748.1	NP_001155220.1	P55344	LMIP_HUMAN	lens intrinsic membrane protein 2, 19kDa	93					cell-cell junction assembly (GO:0007043)|lens development in camera-type eye (GO:0002088)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	structural constituent of eye lens (GO:0005212)	p.S135Y(1)		endometrium(1)|large_intestine(3)|lung(2)|skin(1)	7		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000214)|OV - Ovarian serous cystadenocarcinoma(262;0.00985)		GGAGATGCGGGAGAAGGTAGG	0.572																																					p.S93Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C278A	19						.						144.0	122.0	129.0					19																	51885719		2203	4300	6503	56577531	SO:0001583	missense	3982	exon3				CCDS12831.1, CCDS59415.1	19q13.4	2008-07-17	2002-08-29			ENSG00000105370			6610	protein-coding gene	gene with protein product		154045	"""lens intrinsic membrane protein 2 (19kD)"""			1606837	Standard	NM_030657		Approved	MP19, MP17	uc002pwl.2	P55344		ENST00000596399.1:c.278C>A	19.37:g.51885719G>T	ENSP00000472090:p.Ser93Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	56577531	NM_001161748	Q6B083|Q9BXD0|Q9HAR5	Missense_Mutation	SNP	ENST00000596399.1	37	CCDS59415.1	.	.	.	.	.	.	.	.	.	.	G	7.524	0.657368	0.14580	.	.	ENSG00000105370	ENST00000221973	D	0.89123	-2.47	4.79	2.36	0.29203	.	0.954297	0.08762	N	0.897637	T	0.78528	0.4297	N	0.08118	0	0.23003	N	0.998447	B;B	0.26400	0.148;0.09	B;B	0.29077	0.098;0.038	T	0.69359	-0.5166	10	0.59425	D	0.04	-5.9259	8.1052	0.30881	0.0:0.136:0.6039:0.2601	.	93;135	P55344;P55344-2	LMIP_HUMAN;.	Y	135	ENSP00000221973:S135Y	ENSP00000221973:S135Y	S	-	2	0	LIM2	56577531	1.000000	0.71417	1.000000	0.80357	0.027000	0.11550	3.210000	0.51129	0.997000	0.38969	-0.175000	0.13238	TCC		LIM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464247.1	NM_030657	
SIGLEC10	89790	broad.mit.edu	37	19	51920143	51920143	+	Silent	SNP	C	C	T	rs200977765		TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr19:51920143C>T	ENST00000339313.5	-	3	599	c.483G>A	c.(481-483)acG>acA	p.T161T	SIGLEC10_ENST00000353836.5_Silent_p.T161T|SIGLEC10_ENST00000442846.3_Intron|CTD-2616J11.2_ENST00000526996.1_RNA|SIGLEC10_ENST00000356298.5_Silent_p.T161T|SIGLEC10_ENST00000432469.2_Intron|CTD-2616J11.2_ENST00000532688.1_RNA|SIGLEC10_ENST00000439889.2_Intron|SIGLEC10_ENST00000525998.1_Silent_p.T161T|CTD-2616J11.3_ENST00000532473.1_RNA|SIGLEC10_ENST00000436984.2_Intron|SIGLEC10_ENST00000441969.3_Intron			Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10	161	Ig-like C2-type 1.				cell adhesion (GO:0007155)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.T161T(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(27)|ovary(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		CACAGATGACCGTCACCGGCT	0.597													c|||	1	0.000199681	0.0	0.0	5008	,	,		17008	0.0		0.001	False		,,,				2504	0.0				p.T161T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G483A	19						.	C	,,,,,,	0,4406		0,0,2203	87.0	94.0	91.0		,483,,,,,483	-9.4	0.0	19		91	2,8598		0,2,4298	no	intron,coding-synonymous,intron,intron,intron,intron,coding-synonymous	SIGLEC10	NM_001171156.1,NM_001171157.1,NM_001171158.1,NM_001171159.1,NM_001171160.1,NM_001171161.1,NM_033130.4	,,,,,,	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	,,,,,,	,161/603,,,,,161/698	51920143	2,13004	2203	4300	6503	56611955	SO:0001819	synonymous_variant	89790	exon3			AF310233	CCDS12832.1, CCDS54301.1, CCDS54302.1, CCDS54303.1, CCDS54304.1, CCDS54305.1	19q13.3	2013-01-29			ENSG00000142512	ENSG00000142512		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15620	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 10 Ig-like lectin 7"", ""siglec-like gene 2"""	606091				11284738	Standard	NM_033130		Approved	SIGLEC-10, SLG2, PRO940, MGC126774	uc002pwo.3	Q96LC7	OTTHUMG00000165521	ENST00000339313.5:c.483G>A	19.37:g.51920143C>T		Somatic		Capture	Illumina HiSeq	Phase_I	56611955	NM_001171157	A8K1I5|A8K3C7|C9JJ33|C9JM10|F8W917|Q3MIR5|Q6UXI8|Q96G54|Q96LC8	Silent	SNP	ENST00000339313.5	37	CCDS12832.1																																																																																				SIGLEC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384620.2	NM_033130	
CLEC4M	10332	broad.mit.edu	37	19	7830731	7830731	+	Missense_Mutation	SNP	G	G	A	rs76899402		TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr19:7830731G>A	ENST00000327325.5	+	4	540	c.422G>A	c.(421-423)cGg>cAg	p.R141Q	CLEC4M_ENST00000359059.5_Intron|CLEC4M_ENST00000394122.2_Missense_Mutation_p.R129Q|CLEC4M_ENST00000596363.1_Missense_Mutation_p.R113Q|CLEC4M_ENST00000357361.2_Missense_Mutation_p.R141Q|CLEC4M_ENST00000595496.1_Missense_Mutation_p.R120Q|CLEC4M_ENST00000334806.5_Intron|CLEC4M_ENST00000248228.4_Intron|CLEC4M_ENST00000596707.1_Missense_Mutation_p.R120Q|CLEC4M_ENST00000597522.1_Missense_Mutation_p.R141Q	NM_001144909.1|NM_014257.4	NP_001138381.1|NP_055072.3	Q9H2X3	CLC4M_HUMAN	C-type lectin domain family 4, member M	141	7 X approximate tandem repeats.				antigen processing and presentation (GO:0019882)|cell-cell recognition (GO:0009988)|endocytosis (GO:0006897)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intracellular transport of virus (GO:0075733)|leukocyte cell-cell adhesion (GO:0007159)|modulation by virus of host morphology or physiology (GO:0019048)|peptide antigen transport (GO:0046968)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|viral genome replication (GO:0019079)|virion attachment to host cell (GO:0019062)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|ICAM-3 receptor activity (GO:0030369)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)|peptide antigen binding (GO:0042605)|receptor activity (GO:0004872)|virion binding (GO:0046790)	p.R141Q(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(1)|skin(1)	26						GAGCTGACCCGGCTGAAGGCT	0.582																																					p.R141Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G422A	19						.						13.0	13.0	13.0					19																	7830731		1642	3266	4908	7736731	SO:0001583	missense	10332	exon4			AB015629	CCDS12187.1, CCDS59346.1, CCDS59347.1, CCDS59348.1	19p13	2008-02-05	2005-02-04	2005-02-11		ENSG00000104938		"""C-type lectin domain containing"", ""CD molecules"""	13523	protein-coding gene	gene with protein product		605872	"""CD299 antigen"""	CD209L, CD299		10072769	Standard	NM_001144904		Approved	HP10347, DC-SIGNR, LSIGN, DCSIGNR, DC-SIGN2	uc010dvt.3	Q9H2X3		ENST00000327325.5:c.422G>A	19.37:g.7830731G>A	ENSP00000316228:p.Arg141Gln	Somatic		Capture	Illumina HiSeq	Phase_I	7736731	NM_001144908	A6NKI4|A8K8B3|Q69F40|Q969M4|Q96QP3|Q96QP4|Q96QP5|Q96QP6|Q9BXS3|Q9H2Q9|Q9H8F0|Q9Y2A8	Missense_Mutation	SNP	ENST00000327325.5	37	CCDS12187.1	.	.	.	.	.	.	.	.	.	.	A	0.008	-1.920834	0.00498	.	.	ENSG00000104938	ENST00000327325;ENST00000394122;ENST00000357361;ENST00000358690	T;T;T	0.22336	1.97;1.96;1.97	0.905	-1.81	0.07882	.	.	.	.	.	T	0.07188	0.0182	N	0.04636	-0.2	0.09310	N	1	B;B;B;B;B;B;B	0.17268	0.004;0.001;0.001;0.0;0.007;0.021;0.001	B;B;B;B;B;B;B	0.10450	0.003;0.005;0.001;0.0;0.002;0.003;0.005	T	0.33059	-0.9883	9	0.07482	T	0.82	.	6.6496	0.22955	0.409:0.0:0.591:0.0	.	120;113;141;113;120;141;85	Q9H2X3-5;B4DNV9;Q9H2X3;Q9H2X3-9;Q9H2X3-7;Q9H2X3-4;Q9H2X3-10	.;.;CLC4M_HUMAN;.;.;.;.	Q	141;129;141;85	ENSP00000316228:R141Q;ENSP00000377680:R129Q;ENSP00000349924:R141Q	ENSP00000316228:R141Q	R	+	2	0	CLEC4M	7736731	0.001000	0.12720	0.004000	0.12327	0.024000	0.10985	-1.792000	0.01756	-2.527000	0.00494	-2.768000	0.00120	CGG		CLEC4M-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461161.1	NM_014257	
LPAR2	9170	broad.mit.edu	37	19	19735224	19735224	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	A	A	A	A	A	A	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr19:19735224delA	ENST00000542587.1	-	6	1799	c.897delT	c.(895-897)gatfs	p.D299fs	LPAR2_ENST00000407877.3_Frame_Shift_Del_p.D299fs|LPAR2_ENST00000586703.1_Frame_Shift_Del_p.D299fs			Q9HBW0	LPAR2_HUMAN	lysophosphatidic acid receptor 2	299					activation of MAPK activity (GO:0000187)|activation of phospholipase C activity (GO:0007202)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of Rho protein signal transduction (GO:0035025)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)|lysophosphatidic acid receptor activity (GO:0070915)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	10						GCATCTCAGCATCTCGGCAAG	0.597																																					p.D299fs												.	.	0			c.897delT	19						.						105.0	91.0	96.0					19																	19735224		2203	4300	6503	19596224	SO:0001589	frameshift_variant	9170	exon3			AF011466	CCDS12407.1	19p12	2012-08-08	2008-04-11	2008-04-11		ENSG00000064547		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	3168	protein-coding gene	gene with protein product		605110	"""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 4"""	EDG4		9525886, 9804623	Standard	NM_004720		Approved	EDG-4, LPA2	uc002nnb.4	Q9HBW0		ENST00000542587.1:c.897delT	19.37:g.19735224delA	ENSP00000443256:p.Asp299fs	None		Capture	Illumina HiSeq	Phase_I	19596224	NM_004720	O00543|O43431	Frame_Shift_Del	DEL	ENST00000542587.1	37	CCDS12407.1																																																																																				LPAR2-003	KNOWN	alternative_5_UTR|non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460544.1	NM_004720	
LPAR2	9170	broad.mit.edu	37	19	19735233	19735236	+	Frame_Shift_Del	DEL	AGAG	AGAG	-			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	AGAG	AGAG	AGAG	AGAG	AGAG	AGAG	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr19:19735233_19735236delAGAG	ENST00000542587.1	-	6	1787_1790	c.885_888delCTCT	c.(883-888)tactctfs	p.YS295fs	LPAR2_ENST00000407877.3_Frame_Shift_Del_p.YS295fs|LPAR2_ENST00000586703.1_Frame_Shift_Del_p.YS295fs			Q9HBW0	LPAR2_HUMAN	lysophosphatidic acid receptor 2	295					activation of MAPK activity (GO:0000187)|activation of phospholipase C activity (GO:0007202)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of Rho protein signal transduction (GO:0035025)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)|lysophosphatidic acid receptor activity (GO:0070915)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	10						CATCTCGGCAAGAGTACACAGCAG	0.588																																					p.295_296del												.	.	0			c.885_888del	19						.																																			19596236	SO:0001589	frameshift_variant	9170	exon3			AF011466	CCDS12407.1	19p12	2012-08-08	2008-04-11	2008-04-11		ENSG00000064547		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	3168	protein-coding gene	gene with protein product		605110	"""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 4"""	EDG4		9525886, 9804623	Standard	NM_004720		Approved	EDG-4, LPA2	uc002nnb.4	Q9HBW0		ENST00000542587.1:c.885_888delCTCT	19.37:g.19735233_19735236delAGAG	ENSP00000443256:p.Tyr295fs	None		Capture	Illumina HiSeq	Phase_I	19596233	NM_004720	O00543|O43431	Frame_Shift_Del	DEL	ENST00000542587.1	37	CCDS12407.1																																																																																				LPAR2-003	KNOWN	alternative_5_UTR|non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460544.1	NM_004720	
SIGLEC8	27181	broad.mit.edu	37	19	51958744	51958744	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr19:51958744T>A	ENST00000321424.3	-	4	1045	c.979A>T	c.(979-981)Acc>Tcc	p.T327S	SIGLEC8_ENST00000597352.1_5'Flank|SIGLEC8_ENST00000430817.1_Missense_Mutation_p.T218S|SIGLEC8_ENST00000340550.5_Missense_Mutation_p.T234S	NM_014442.2	NP_055257.2	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8	327	Ig-like C2-type 2.				cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(11)|liver(3)|lung(15)|ovary(2)|skin(4)|stomach(3)|urinary_tract(2)	50		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		GCTCGGCAGGTGAATTCCCCT	0.647																																					p.T327S												.	.	0			c.A979T	19						.						58.0	55.0	56.0					19																	51958744		2203	4300	6503	56650556	SO:0001583	missense	27181	exon4			AF195092	CCDS33086.1	19q13.33-q13.41	2013-01-29			ENSG00000105366	ENSG00000105366		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10877	protein-coding gene	gene with protein product		605639				10625619	Standard	XR_243922		Approved	SIGLEC-8, SAF2, SIGLEC8L, MGC59785	uc002pwt.3	Q9NYZ4		ENST00000321424.3:c.979A>T	19.37:g.51958744T>A	ENSP00000321077:p.Thr327Ser	None		Capture	Illumina HiSeq	Phase_I	56650556	NM_014442	Q7Z728	Missense_Mutation	SNP	ENST00000321424.3	37	CCDS33086.1	.	.	.	.	.	.	.	.	.	.	.	12.79	2.044889	0.36085	.	.	ENSG00000105366	ENST00000430817;ENST00000321424;ENST00000340550	T;T;T	0.15487	2.42;2.42;2.42	2.19	-0.0352	0.13893	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.38837	N	0.001550	T	0.33644	0.0870	M	0.81179	2.53	0.09310	N	1	P;D;D	0.63046	0.843;0.992;0.988	P;D;D	0.68621	0.56;0.959;0.934	T	0.09271	-1.0682	10	0.62326	D	0.03	.	4.5202	0.11956	0.0:0.3361:0.0:0.6639	.	218;234;327	C9JT30;Q9NYZ4-2;Q9NYZ4	.;.;SIGL8_HUMAN	S	218;327;234	ENSP00000389142:T218S;ENSP00000321077:T327S;ENSP00000339448:T234S	ENSP00000321077:T327S	T	-	1	0	SIGLEC8	56650556	0.000000	0.05858	0.002000	0.10522	0.153000	0.21895	-1.582000	0.02117	-0.084000	0.12595	0.411000	0.27672	ACC		SIGLEC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463648.2	NM_014442	
YBX1	4904	broad.mit.edu	37	1	43166679	43166680	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr1:43166679_43166680insT	ENST00000321358.7	+	7	1107_1108	c.968_969insT	c.(967-972)gctgagfs	p.E324fs		NM_004559.3	NP_004550.2	P67809	YBOX1_HUMAN	Y box binding protein 1	324					CRD-mediated mRNA stabilization (GO:0070934)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|histone pre-mRNA 3'end processing complex (GO:0071204)|intracellular membrane-bounded organelle (GO:0043231)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|U12-type spliceosomal complex (GO:0005689)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)	p.E324fs*1(1)		large_intestine(2)|lung(4)|ovary(4)|prostate(4)|upper_aerodigestive_tract(2)	16	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CAGGGCGGGGCTGAGTAAATGC	0.525																																					p.A323fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.968_969insT	1						.																																			42939267	SO:0001589	frameshift_variant	4904	exon7			BC013838	CCDS470.1	1p34	2008-02-05	2005-08-11	2005-08-11	ENSG00000065978	ENSG00000065978			8014	protein-coding gene	gene with protein product		154030	"""nuclease sensitive element binding protein 1"""	NSEP1		1891370, 3174636	Standard	NM_004559		Approved	YB-1, YB1, DBPB, NSEP-1, MDR-NF1, BP-8, CSDB, CSDA2	uc001chs.3	P67809	OTTHUMG00000007523	ENST00000321358.7:c.969dupT	1.37:g.43166680_43166680dupT	ENSP00000361626:p.Glu324fs	Somatic		Capture	Illumina HiSeq	Phase_I	42939266	NM_004559	P16990|P16991|Q14972|Q15325|Q5FVF0	Frame_Shift_Ins	INS	ENST00000321358.7	37	CCDS470.1																																																																																				YBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019786.2	NM_004559	
AMY2A	279	broad.mit.edu	37	1	104166590	104166590	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr1:104166590C>T	ENST00000414303.2	+	8	1268	c.1204C>T	c.(1204-1206)Cga>Tga	p.R402*	AMY2A_ENST00000497748.1_3'UTR	NM_000699.2	NP_000690.1	P04746	AMYP_HUMAN	amylase, alpha 2A (pancreatic)	402					carbohydrate catabolic process (GO:0016052)|carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|calcium ion binding (GO:0005509)|chloride ion binding (GO:0031404)	p.R402*(1)		endometrium(3)|kidney(1)|large_intestine(5)|liver(3)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0654)|all cancers(265;0.0808)|Epithelial(280;0.0921)|Lung(183;0.111)	Acarbose(DB00284)|Icodextrin(DB00702)|Miglitol(DB00491)	CTGTGAACATCGATGGCGCCA	0.343																																					p.R402X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1204T	1						.						9.0	9.0	9.0					1																	104166590		1665	3373	5038	103968113	SO:0001587	stop_gained	279	exon8			BC007060	CCDS783.1	1p21.1	2012-10-02	2007-05-03		ENSG00000243480	ENSG00000243480	3.2.1.1		477	protein-coding gene	gene with protein product		104650	"""amylase, alpha 2A; pancreatic"""	AMY2		3260028	Standard	NM_000699		Approved		uc001dut.3	P04746	OTTHUMG00000011023	ENST00000414303.2:c.1204C>T	1.37:g.104166590C>T	ENSP00000397582:p.Arg402*	Somatic		Capture	Illumina HiSeq	Phase_I	103968113	NM_000699	B9EJG1|Q9UBH3	Nonsense_Mutation	SNP	ENST00000414303.2	37	CCDS783.1	.	.	.	.	.	.	.	.	.	.	-	34	5.347456	0.95807	.	.	ENSG00000243480	ENST00000414303;ENST00000393932	.	.	.	2.94	1.99	0.26369	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.5171	0.39113	0.3781:0.6219:0.0:0.0	.	.	.	.	X	402	.	ENSP00000377509:R402X	R	+	1	2	AMY2A	103968113	0.999000	0.42202	0.992000	0.48379	0.892000	0.51952	1.860000	0.39428	0.540000	0.28808	0.305000	0.20034	CGA		AMY2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030315.1	NM_000699	
PADI4	23569	broad.mit.edu	37	1	17682488	17682488	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr1:17682488C>T	ENST00000375448.4	+	12	1347	c.1321C>T	c.(1321-1323)Cgg>Tgg	p.R441W	PADI4_ENST00000487048.1_3'UTR	NM_012387.2	NP_036519.2	Q9UM07	PADI4_HUMAN	peptidyl arginine deiminase, type IV	441					cellular protein modification process (GO:0006464)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|histone citrullination (GO:0036414)|histone H3-R26 citrullination (GO:0036413)|innate immune response (GO:0045087)|nucleosome assembly (GO:0006334)|protein citrullination (GO:0018101)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	arginine deiminase activity (GO:0016990)|calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)	p.R441W(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(2)|urinary_tract(3)	26		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000338)|Lung NSC(340;0.00042)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00537)|BRCA - Breast invasive adenocarcinoma(304;8.54e-06)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(64;0.000223)|KIRC - Kidney renal clear cell carcinoma(64;0.00313)|STAD - Stomach adenocarcinoma(196;0.00707)|READ - Rectum adenocarcinoma(331;0.0689)|Lung(427;0.199)	L-Citrulline(DB00155)	CAATGACAGCCGGCAGATGCA	0.597																																					p.R441W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1321T	1						.						59.0	54.0	56.0					1																	17682488		2203	4300	6503	17555075	SO:0001583	missense	23569	exon12			AB017919	CCDS180.1	1p36.13	2014-06-06	2003-02-12		ENSG00000159339	ENSG00000159339	3.5.3.15	"""Peptidyl arginine deiminases"""	18368	protein-coding gene	gene with protein product		605347	"""peptidyl arginine deiminase, type V"""	PADI5		10488123	Standard	NM_012387		Approved	PAD, PDI5, PDI4	uc001baj.2	Q9UM07	OTTHUMG00000002371	ENST00000375448.4:c.1321C>T	1.37:g.17682488C>T	ENSP00000364597:p.Arg441Trp	Somatic		Capture	Illumina HiSeq	Phase_I	17555075	NM_012387	A8K392|B2RBW0|Q5VTZ8|Q70SX4	Missense_Mutation	SNP	ENST00000375448.4	37	CCDS180.1	.	.	.	.	.	.	.	.	.	.	C	17.84	3.488951	0.64074	.	.	ENSG00000159339	ENST00000375448	T	0.35048	1.33	5.28	4.29	0.51040	Protein-arginine deiminase, C-terminal (1);	0.136103	0.50627	D	0.000101	T	0.66096	0.2755	M	0.93016	3.37	0.29442	N	0.85912	D	0.89917	1.0	D	0.65773	0.938	T	0.69569	-0.5110	10	0.87932	D	0	-26.6527	14.3891	0.66965	0.1782:0.8218:0.0:0.0	.	441	Q9UM07	PADI4_HUMAN	W	441	ENSP00000364597:R441W	ENSP00000364597:R441W	R	+	1	2	PADI4	17555075	1.000000	0.71417	1.000000	0.80357	0.566000	0.35808	1.442000	0.35046	2.461000	0.83175	0.655000	0.94253	CGG		PADI4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006799.1	NM_012387	
PDE4DIP	9659	broad.mit.edu	37	1	144931337	144931337	+	Intron	SNP	T	T	G			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr1:144931337T>G	ENST00000369354.3	-	6	826				PDE4DIP_ENST00000369349.3_Intron|PDE4DIP_ENST00000530740.1_Intron|PDE4DIP_ENST00000313431.9_Missense_Mutation_p.R124S|PDE4DIP_ENST00000369356.4_Intron|PDE4DIP_ENST00000313382.9_Intron|PDE4DIP_ENST00000479408.2_Intron|PDE4DIP_ENST00000369359.4_Intron|PDE4DIP_ENST00000369351.3_Intron|PDE4DIP_ENST00000529945.1_Missense_Mutation_p.R124S			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein						cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		GTGCAGAGTATCTCGCATCGG	0.542			T	PDGFRB	MPD																																p.R124S			Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	.	.	0			c.A372C	1						.						189.0	182.0	184.0					1																	144931337		2203	4300	6503	143642694	SO:0001627	intron_variant	9659	exon1			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.637-7516A>C	1.37:g.144931337T>G		None		Capture	Illumina HiSeq	Phase_I	143642694	NM_001002811	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000369354.3	37	CCDS30824.1	.	.	.	.	.	.	.	.	.	.	T	15.85	2.954916	0.53293	.	.	ENSG00000178104	ENST00000369353;ENST00000313431;ENST00000529945	T;T	0.14893	2.47;2.47	5.3	1.53	0.23141	.	.	.	.	.	T	0.05914	0.0154	L	0.54323	1.7	0.80722	D	1	P	0.38504	0.634	B	0.34242	0.178	T	0.17471	-1.0368	9	0.62326	D	0.03	.	4.2182	0.10545	0.0:0.195:0.3058:0.4992	.	124	Q5VU43-2	.	S	124	ENSP00000316434:R124S;ENSP00000433392:R124S	ENSP00000316434:R124S	R	-	3	2	PDE4DIP	143642694	0.465000	0.25815	0.990000	0.47175	0.783000	0.44284	-0.086000	0.11233	0.348000	0.23949	0.379000	0.24179	AGA		PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359	
KIF17	57576	broad.mit.edu	37	1	21009326	21009326	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr1:21009326C>A	ENST00000247986.2	-	11	2593	c.2283G>T	c.(2281-2283)aaG>aaT	p.K761N	KIF17_ENST00000375044.1_Missense_Mutation_p.K661N|KIF17_ENST00000400463.3_Missense_Mutation_p.K761N|KIF17_ENST00000490034.1_5'UTR			Q9P2E2	KIF17_HUMAN	kinesin family member 17	761					ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)	p.K761N(1)		NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		CCTTCAGGTCCTTGTTCTTGG	0.602																																					p.K761N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2283T	1						.						90.0	78.0	82.0					1																	21009326		2203	4300	6503	20881913	SO:0001583	missense	57576	exon11			AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.2283G>T	1.37:g.21009326C>A	ENSP00000247986:p.Lys761Asn	Somatic		Capture	Illumina HiSeq	Phase_I	20881913	NM_001122819	A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Missense_Mutation	SNP	ENST00000247986.2	37	CCDS213.1	.	.	.	.	.	.	.	.	.	.	C	18.27	3.587970	0.66105	.	.	ENSG00000117245	ENST00000375044;ENST00000400463;ENST00000247986;ENST00000321188	T;T;T	0.73681	-0.77;-0.65;-0.64	5.76	4.84	0.62591	.	0.000000	0.34025	U	0.004322	D	0.82825	0.5121	M	0.72894	2.215	0.30311	N	0.788504	D;P;D	0.89917	1.0;0.552;0.999	D;B;D	0.71184	0.963;0.255;0.972	T	0.79533	-0.1764	10	0.42905	T	0.14	.	11.1198	0.48281	0.0:0.8572:0.0:0.1428	.	761;761;761	B0I1R5;Q9P2E2-3;Q9P2E2	.;.;KIF17_HUMAN	N	661;761;761;142	ENSP00000364184:K661N;ENSP00000383311:K761N;ENSP00000247986:K761N	ENSP00000247986:K761N	K	-	3	2	KIF17	20881913	0.998000	0.40836	1.000000	0.80357	0.989000	0.77384	0.508000	0.22692	2.724000	0.93272	0.563000	0.77884	AAG		KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276995.1	NM_020816	
REN	5972	broad.mit.edu	37	1	204125040	204125040	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr1:204125040C>T	ENST00000272190.8	-	9	995	c.967G>A	c.(967-969)Gtg>Atg	p.V323M	REN_ENST00000367195.2_Missense_Mutation_p.V320M	NM_000537.3	NP_000528.1	P00797	RENI_HUMAN	renin	323					angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cell maturation (GO:0048469)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|drinking behavior (GO:0042756)|hormone-mediated signaling pathway (GO:0009755)|kidney development (GO:0001822)|male gonad development (GO:0008584)|mesonephros development (GO:0001823)|proteolysis (GO:0006508)|regulation of blood pressure (GO:0008217)|regulation of MAPK cascade (GO:0043408)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to cAMP (GO:0051591)|response to cGMP (GO:0070305)|response to lipopolysaccharide (GO:0032496)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	aspartic-type endopeptidase activity (GO:0004190)|peptidase activity (GO:0008233)|receptor binding (GO:0005102)	p.V323M(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|skin(4)|urinary_tract(1)	19	all_cancers(21;0.00965)|Breast(84;0.116)|all_epithelial(62;0.157)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)		Aliskiren(DB01258)|Remikiren(DB00212)	TTACACTTCACGACATACTGG	0.557																																					p.V323M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G967A	1						.						39.0	40.0	40.0					1																	204125040		2203	4300	6503	202391663	SO:0001583	missense	5972	exon9			BC047752	CCDS30981.1	1q32	2008-02-05			ENSG00000143839	ENSG00000143839	3.4.23.15		9958	protein-coding gene	gene with protein product		179820					Standard	NM_000537		Approved		uc001haq.2	P00797	OTTHUMG00000036059	ENST00000272190.8:c.967G>A	1.37:g.204125040C>T	ENSP00000272190:p.Val323Met	Somatic		Capture	Illumina HiSeq	Phase_I	202391663	NM_000537	Q6FI38|Q6T5C2	Missense_Mutation	SNP	ENST00000272190.8	37	CCDS30981.1	.	.	.	.	.	.	.	.	.	.	C	16.84	3.235251	0.58886	.	.	ENSG00000143839	ENST00000367195;ENST00000545733;ENST00000272190	T;T	0.62498	0.02;0.02	4.24	3.31	0.37934	Peptidase aspartic (1);Peptidase aspartic, catalytic (1);	0.060342	0.64402	D	0.000003	T	0.80737	0.4680	M	0.90650	3.135	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.84697	0.0726	10	0.87932	D	0	.	12.0093	0.53278	0.0:0.9109:0.0:0.0891	.	323	P00797	RENI_HUMAN	M	320;242;323	ENSP00000356163:V320M;ENSP00000272190:V323M	ENSP00000272190:V323M	V	-	1	0	REN	202391663	0.998000	0.40836	0.988000	0.46212	0.513000	0.34164	4.111000	0.57838	1.901000	0.55032	0.467000	0.42956	GTG		REN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087891.1	NM_000537	
CTNNBIP1	56998	broad.mit.edu	37	1	9932101	9932101	+	Missense_Mutation	SNP	C	C	T	rs113935062	byFrequency	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr1:9932101C>T	ENST00000377263.1	-	4	333	c.22G>A	c.(22-24)Ggg>Agg	p.G8R	CTNNBIP1_ENST00000377258.1_Missense_Mutation_p.G8R|CTNNBIP1_ENST00000537447.1_Missense_Mutation_p.G8R|CTNNBIP1_ENST00000377256.1_Missense_Mutation_p.G8R|CTNNBIP1_ENST00000400904.3_Missense_Mutation_p.G8R	NM_001012329.1|NM_020248.2	NP_001012329.1|NP_064633.1	Q9NSA3	CNBP1_HUMAN	catenin, beta interacting protein 1	8					anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|negative regulation of DNA binding (GO:0043392)|negative regulation of mesenchymal cell proliferation (GO:0072201)|negative regulation of protein binding (GO:0032091)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription initiation from RNA polymerase II promoter (GO:0060633)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of monocyte differentiation (GO:0045657)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of vascular permeability involved in acute inflammatory response (GO:0002528)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)	p.G8R(1)		cervix(1)|large_intestine(1)|lung(1)	3		all_lung(284;1.82e-05)|Lung NSC(185;3.08e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|Colorectal(212;7.32e-08)|COAD - Colon adenocarcinoma(227;1.73e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000912)|KIRC - Kidney renal clear cell carcinoma(229;0.00112)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)		GGACTCTTCCCGGGAGCTCCC	0.582													C|||	8	0.00159744	0.0045	0.0	5008	,	,		19937	0.0		0.0	False		,,,				2504	0.002				p.G8R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G22A	1						.	C	ARG/GLY,ARG/GLY	9,4397	15.5+/-35.6	0,9,2194	100.0	90.0	93.0		22,22	5.2	1.0	1	dbSNP_132	93	9,8591	7.1+/-27.0	0,9,4291	yes	missense,missense	CTNNBIP1	NM_001012329.1,NM_020248.2	125,125	0,18,6485	TT,TC,CC		0.1047,0.2043,0.1384	probably-damaging,probably-damaging	8/82,8/82	9932101	18,12988	2203	4300	6503	9854688	SO:0001583	missense	56998	exon3			AB021262	CCDS106.1	1p36.22	2013-09-19	2001-11-29		ENSG00000178585	ENSG00000178585			16913	protein-coding gene	gene with protein product	"""beta-catenin-interacting protein ICAT"", ""inhibitor of beta-catenin and Tcf-4"""	607758	"""catenin, beta-interacting protein 1"""			10898789	Standard	XM_006710779		Approved	ICAT, MGC15093	uc001aql.1	Q9NSA3	OTTHUMG00000001796	ENST00000377263.1:c.22G>A	1.37:g.9932101C>T	ENSP00000366474:p.Gly8Arg	Somatic		Capture	Illumina HiSeq	Phase_I	9854688	NM_001012329	Q5T4V2	Missense_Mutation	SNP	ENST00000377263.1	37	CCDS106.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	C	20.7	4.033672	0.75504	0.002043	0.001047	ENSG00000178585	ENST00000377263;ENST00000537447;ENST00000400904;ENST00000377258;ENST00000377256	.	.	.	5.23	5.23	0.72850	.	0.000000	0.85682	U	0.000000	T	0.79851	0.4517	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80650	-0.1288	7	.	.	.	-5.1358	17.5659	0.87919	0.0:1.0:0.0:0.0	.	8	Q9NSA3	CNBP1_HUMAN	R	8	.	.	G	-	1	0	CTNNBIP1	9854688	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.137000	0.77295	2.451000	0.82905	0.484000	0.47621	GGG		CTNNBIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005012.1	NM_020248	
DCDC2B	149069	broad.mit.edu	37	1	32678190	32678191	+	Missense_Mutation	DNP	CT	CT	GG			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	CT	CT					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr1:32678190_32678191CT>GG	ENST00000409358.1	+	5	627_628	c.627_628CT>GG	c.(625-630)ccCTat>ccGGat	p.Y210D		NM_001099434.1	NP_001092904.1	A2VCK2	DCD2B_HUMAN	doublecortin domain containing 2B	210	Doublecortin 2. {ECO:0000255|PROSITE- ProRule:PRU00072}.				intracellular signal transduction (GO:0035556)			p.P209>?(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)	11		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				AGGACCTTCCCTATCTGGAGCT	0.614																																					.												.	.	1	Complex(1)	large_intestine(1)	c.627_628GG	1						.																																			32450778	SO:0001583	missense	149069	exon5			BC128073	CCDS44100.1	1p35.1	2008-05-13			ENSG00000222046	ENSG00000222046			32576	protein-coding gene	gene with protein product							Standard	NM_001099434		Approved		uc001bun.2	A2VCK2	OTTHUMG00000005741	Exception_encountered	1.37:g.32678190_32678191delinsGG	ENSP00000386870:p.Tyr210Asp	Somatic		Capture	Illumina HiSeq	Phase_I	32450777	NM_001099434	B7ZBC6	Missense_Mutation	DNP	ENST00000409358.1	37	CCDS44100.1																																																																																				DCDC2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328293.1	XM_940631	
ASB17	127247	broad.mit.edu	37	1	76397913	76397913	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr1:76397913G>T	ENST00000284142.6	-	1	203	c.64C>A	c.(64-66)Ctc>Atc	p.L22I		NM_080868.2	NP_543144.1	Q8WXJ9	ASB17_HUMAN	ankyrin repeat and SOCS box containing 17	22					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)			p.L22I(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|urinary_tract(1)	21						TTGTCAAGGAGATTGCAGAAT	0.358																																					p.L22I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C64A	1						.						72.0	75.0	74.0					1																	76397913		2203	4300	6503	76170501	SO:0001583	missense	127247	exon1			AF403035	CCDS671.1	1p22.3	2013-01-11	2011-01-25		ENSG00000154007	ENSG00000154007		"""Ankyrin repeat domain containing"""	19769	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 17"""			12076535	Standard	NM_080868		Approved		uc001dhe.2	Q8WXJ9	OTTHUMG00000009787	ENST00000284142.6:c.64C>A	1.37:g.76397913G>T	ENSP00000284142:p.Leu22Ile	Somatic		Capture	Illumina HiSeq	Phase_I	76170501	NM_080868	B1APB8|Q8N0X5	Missense_Mutation	SNP	ENST00000284142.6	37	CCDS671.1	.	.	.	.	.	.	.	.	.	.	G	16.88	3.245802	0.59103	.	.	ENSG00000154007	ENST00000284142	T	0.43688	0.94	6.08	5.17	0.71159	.	0.000000	0.47852	D	0.000207	T	0.37812	0.1017	L	0.27053	0.805	0.32283	N	0.56738	D	0.69078	0.997	D	0.72625	0.978	T	0.36866	-0.9730	10	0.87932	D	0	.	10.3163	0.43738	0.0869:0.0:0.9131:0.0	.	22	Q8WXJ9	ASB17_HUMAN	I	22	ENSP00000284142:L22I	ENSP00000284142:L22I	L	-	1	0	ASB17	76170501	1.000000	0.71417	0.985000	0.45067	0.958000	0.62258	2.677000	0.46892	2.890000	0.99128	0.655000	0.94253	CTC		ASB17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026982.1	NM_080868	
LYST	1130	broad.mit.edu	37	1	235826347	235826347	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr1:235826347A>G	ENST00000389794.3	-	53	11473	c.11299T>C	c.(11299-11301)Tac>Cac	p.Y3767H	LYST_ENST00000473037.1_5'UTR|LYST_ENST00000389793.2_Missense_Mutation_p.Y3767H			Q99698	LYST_HUMAN	lysosomal trafficking regulator	3767					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)		p.Y3767H(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TTTGCTGTGTACAAATGGTGG	0.403																																					p.Y3767H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T11299C	1						.						93.0	94.0	94.0					1																	235826347		2203	4300	6503	233892970	SO:0001583	missense	1130	exon53			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.11299T>C	1.37:g.235826347A>G	ENSP00000374444:p.Tyr3767His	Somatic		Capture	Illumina HiSeq	Phase_I	233892970	NM_000081	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	ENST00000389794.3	37	CCDS31062.1	.	.	.	.	.	.	.	.	.	.	A	27.6	4.848104	0.91277	.	.	ENSG00000143669	ENST00000389794;ENST00000389793	T;T	0.30714	1.52;1.52	5.87	5.87	0.94306	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.118890	0.64402	D	0.000015	T	0.55705	0.1937	M	0.74647	2.275	0.80722	D	1	D	0.76494	0.999	D	0.66602	0.945	T	0.59994	-0.7349	10	0.87932	D	0	.	16.2674	0.82597	1.0:0.0:0.0:0.0	.	3767	Q99698	LYST_HUMAN	H	3767	ENSP00000374444:Y3767H;ENSP00000374443:Y3767H	ENSP00000374443:Y3767H	Y	-	1	0	LYST	233892970	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.157000	0.94714	2.242000	0.73789	0.533000	0.62120	TAC		LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5		
SOGA1	140710	broad.mit.edu	37	20	35443698	35443698	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr20:35443698C>T	ENST00000357779.3	-	5	1759	c.1433G>A	c.(1432-1434)cGc>cAc	p.R478H	SOGA1_ENST00000456801.2_Missense_Mutation_p.R319H|SOGA1_ENST00000279034.6_Missense_Mutation_p.R478H|SOGA1_ENST00000237536.4_Missense_Mutation_p.R716H			O94964	SOGA1_HUMAN	suppressor of glucose, autophagy associated 1	478					insulin receptor signaling pathway (GO:0008286)|negative regulation of gluconeogenesis (GO:0045721)|regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.R716H(1)|p.R478H(1)		endometrium(5)|kidney(1)|lung(21)|urinary_tract(1)	28						CACGCTCAGGCGCACCAGGAT	0.612																																					p.R716H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2147A	20						.						47.0	53.0	51.0					20																	35443698		2202	4300	6502	34877112	SO:0001583	missense	140710	exon5			AK126630	CCDS46598.1, CCDS54459.1	20q11.23	2012-03-01	2012-02-27	2012-02-27	ENSG00000149639	ENSG00000149639			16111	protein-coding gene	gene with protein product	"""suppressor of glucose by autophagy"", ""suppressor of glucose from autophagy"""		"""chromosome 20 open reading frame 117"", ""KIAA0889"""	C20orf117, KIAA0889		20813965	Standard	NM_080627		Approved	dJ132F21.1, FLJ44670, SOGA	uc021wcx.1	O94964	OTTHUMG00000032395	ENST00000357779.3:c.1433G>A	20.37:g.35443698C>T	ENSP00000350424:p.Arg478His	Somatic		Capture	Illumina HiSeq	Phase_I	34877112	NM_080627	A6NK10|Q14DB2|Q5JW51|Q6ZTG8	Missense_Mutation	SNP	ENST00000357779.3	37		.	.	.	.	.	.	.	.	.	.	C	25.8	4.671028	0.88348	.	.	ENSG00000149639	ENST00000237536;ENST00000279034;ENST00000456801;ENST00000357779	T;T;T;T	0.28069	1.63;1.66;1.71;1.7	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.54919	0.1888	M	0.68593	2.085	0.54753	D	0.999986	D	0.89917	1.0	D	0.79784	0.993	T	0.56798	-0.7919	10	0.66056	D	0.02	-38.7722	17.3228	0.87240	0.0:1.0:0.0:0.0	.	478	O94964-4	.	H	716;478;319;478	ENSP00000237536:R716H;ENSP00000279034:R478H;ENSP00000413886:R319H;ENSP00000350424:R478H	ENSP00000237536:R716H	R	-	2	0	KIAA0889	34877112	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.636000	0.61339	2.629000	0.89072	0.561000	0.74099	CGC		SOGA1-201	KNOWN	basic	protein_coding	protein_coding		NM_199181	
SAMHD1	25939	broad.mit.edu	37	20	35533825	35533825	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr20:35533825C>G	ENST00000262878.4	-	12	1551	c.1352G>C	c.(1351-1353)cGt>cCt	p.R451P		NM_015474.3	NP_056289.2	Q9Y3Z3	SAMH1_HUMAN	SAM domain and HD domain 1	451					dATP catabolic process (GO:0046061)|defense response to virus (GO:0051607)|dGTP catabolic process (GO:0006203)|immune response (GO:0006955)|innate immune response (GO:0045087)|protein homotetramerization (GO:0051289)|regulation of innate immune response (GO:0045088)	intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dGTP binding (GO:0032567)|dGTPase activity (GO:0008832)|nucleic acid binding (GO:0003676)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.R451P(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|urinary_tract(1)	20		Myeloproliferative disorder(115;0.00878)				GAATAGATTACGGTATTCAAT	0.348																																					p.R451P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1352C	20						.						198.0	188.0	191.0					20																	35533825		2203	4300	6503	34967239	SO:0001583	missense	25939	exon12			AF228421	CCDS13288.1	20q11.23	2014-09-17			ENSG00000101347	ENSG00000101347		"""Sterile alpha motif (SAM) domain containing"""	15925	protein-coding gene	gene with protein product	"""HD domain containing 1"", ""monocyte protein 5"", ""Aicardi-Goutieres syndrome 5"""	606754				11064105, 11230166	Standard	NM_015474		Approved	SBBI88, Mg11, HDDC1, MOP-5, AGS5	uc002xgh.2	Q9Y3Z3	OTTHUMG00000032402	ENST00000262878.4:c.1352G>C	20.37:g.35533825C>G	ENSP00000262878:p.Arg451Pro	Somatic		Capture	Illumina HiSeq	Phase_I	34967239	NM_015474	B4E2A5|E1P5V2|Q5JXG8|Q8N491|Q9H004|Q9H005|Q9H3U9	Missense_Mutation	SNP	ENST00000262878.4	37	CCDS13288.1	.	.	.	.	.	.	.	.	.	.	C	17.99	3.523163	0.64747	.	.	ENSG00000101347	ENST00000262878	D	0.96913	-4.17	5.06	4.12	0.48240	.	0.000000	0.85682	D	0.000000	D	0.98369	0.9458	M	0.92833	3.35	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.99257	1.0889	10	0.87932	D	0	-9.9304	13.2528	0.60062	0.0:0.9229:0.0:0.0771	.	451	Q9Y3Z3	SAMH1_HUMAN	P	451	ENSP00000262878:R451P	ENSP00000262878:R451P	R	-	2	0	SAMHD1	34967239	1.000000	0.71417	0.271000	0.24616	0.651000	0.38670	6.102000	0.71486	1.378000	0.46305	0.462000	0.41574	CGT		SAMHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079062.2	NM_015474	
PTPRT	11122	broad.mit.edu	37	20	41419951	41419951	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr20:41419951C>T	ENST00000373187.1	-	3	369	c.370G>A	c.(370-372)Gtg>Atg	p.V124M	PTPRT_ENST00000373184.1_Missense_Mutation_p.V124M|PTPRT_ENST00000373198.4_Missense_Mutation_p.V124M|PTPRT_ENST00000356100.2_Missense_Mutation_p.V124M|PTPRT_ENST00000373190.1_Missense_Mutation_p.V124M|PTPRT_ENST00000373201.1_Missense_Mutation_p.V124M|PTPRT_ENST00000373193.3_Missense_Mutation_p.V124M			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	124	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)	p.V124M(1)		NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TTCACCTTCACGTAGACGTTC	0.582																																					p.V124M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G370A	20						.						76.0	79.0	78.0					20																	41419951		1966	4165	6131	40853365	SO:0001583	missense	11122	exon3			AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.370G>A	20.37:g.41419951C>T	ENSP00000362283:p.Val124Met	Somatic		Capture	Illumina HiSeq	Phase_I	40853365	NM_133170	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	ENST00000373187.1	37	CCDS42874.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.441403	0.83993	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	T;T;T;T;T;T;T	0.02787	4.16;4.16;4.16;4.16;4.16;4.16;4.16	5.67	5.67	0.87782	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	0.085201	0.56097	D	0.000036	T	0.16685	0.0401	M	0.79614	2.46	0.52099	D	0.999948	D;D	0.69078	0.997;0.996	D;D	0.67900	0.923;0.954	T	0.00037	-1.2252	10	0.87932	D	0	.	19.7626	0.96329	0.0:1.0:0.0:0.0	.	124;124	O14522-1;O14522	.;PTPRT_HUMAN	M	124	ENSP00000362286:V124M;ENSP00000362283:V124M;ENSP00000362289:V124M;ENSP00000348408:V124M;ENSP00000362294:V124M;ENSP00000362280:V124M;ENSP00000362297:V124M	ENSP00000348408:V124M	V	-	1	0	PTPRT	40853365	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	2.867000	0.48428	2.676000	0.91093	0.561000	0.74099	GTG		PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1		
TP53TG5	27296	broad.mit.edu	37	20	44003755	44003755	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr20:44003755G>T	ENST00000372726.3	-	4	848	c.692C>A	c.(691-693)aCc>aAc	p.T231N	SYS1-DBNDD2_ENST00000452133.1_Intron|TP53TG5_ENST00000494455.1_5'Flank|SYS1_ENST00000426004.1_3'UTR|TP53TG5_ENST00000537995.1_Missense_Mutation_p.T215N|SYS1-DBNDD2_ENST00000475242.1_Intron	NM_014477.2	NP_055292.1	Q9Y2B4	T53G5_HUMAN	TP53 target 5	231					intracellular signal transduction (GO:0035556)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.T231N(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|prostate(2)|upper_aerodigestive_tract(1)	12						CCAACGCAGGGTGGAGGATCT	0.592																																					p.T231N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C692A	20						.						67.0	65.0	66.0					20																	44003755		2203	4300	6503	43437169	SO:0001583	missense	27296	exon4			AB017802	CCDS13352.1	20q13.12	2008-09-18	2008-09-18	2008-09-18	ENSG00000124251	ENSG00000124251			15856	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 10"""	C20orf10			Standard	NM_014477		Approved	CLG01, dJ453C12.5	uc002xny.3	Q9Y2B4	OTTHUMG00000032582	ENST00000372726.3:c.692C>A	20.37:g.44003755G>T	ENSP00000361811:p.Thr231Asn	Somatic		Capture	Illumina HiSeq	Phase_I	43437169	NM_014477		Missense_Mutation	SNP	ENST00000372726.3	37	CCDS13352.1	.	.	.	.	.	.	.	.	.	.	G	13.22	2.171604	0.38315	.	.	ENSG00000124251	ENST00000372726;ENST00000537995	T;T	0.15834	2.39;2.39	5.99	1.6	0.23607	.	0.956215	0.08753	N	0.898893	T	0.22205	0.0535	L	0.34521	1.04	0.09310	N	1	D	0.59767	0.986	P	0.53035	0.716	T	0.26189	-1.0110	10	0.62326	D	0.03	-0.0137	9.7029	0.40198	0.0:0.202:0.5449:0.2531	.	231	Q9Y2B4	T53G5_HUMAN	N	231;215	ENSP00000361811:T231N;ENSP00000438374:T215N	ENSP00000361811:T231N	T	-	2	0	TP53TG5	43437169	0.149000	0.22717	0.000000	0.03702	0.336000	0.28762	1.312000	0.33574	0.066000	0.16515	0.655000	0.94253	ACC		TP53TG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079460.1	NM_014477	
ZNF335	63925	broad.mit.edu	37	20	44592431	44592431	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr20:44592431A>G	ENST00000322927.2	-	8	1401	c.1301T>C	c.(1300-1302)cTg>cCg	p.L434P	ZNF335_ENST00000426788.1_Missense_Mutation_p.L279P	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	434					brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)	p.L434P(1)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				GCGCCGGGGCAGAGTGTCATG	0.617																																					p.L434P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1301C	20						.						107.0	104.0	105.0					20																	44592431		2203	4300	6503	44025838	SO:0001583	missense	63925	exon8			AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.1301T>C	20.37:g.44592431A>G	ENSP00000325326:p.Leu434Pro	Somatic		Capture	Illumina HiSeq	Phase_I	44025838	NM_022095	B4DLG7|Q548D0|Q9H684	Missense_Mutation	SNP	ENST00000322927.2	37	CCDS13389.1	.	.	.	.	.	.	.	.	.	.	A	0.144	-1.098521	0.01843	.	.	ENSG00000198026	ENST00000322927;ENST00000243961;ENST00000426788	T;T	0.08896	3.2;3.04	5.02	-3.09	0.05331	.	0.829732	0.11302	N	0.578159	T	0.03348	0.0097	N	0.04880	-0.145	0.18873	N	0.999988	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.41840	-0.9486	10	0.31617	T	0.26	-1.3961	6.9081	0.24321	0.5036:0.0:0.382:0.1144	.	279;434	Q9H4Z2-2;Q9H4Z2	.;ZN335_HUMAN	P	434;211;279	ENSP00000325326:L434P;ENSP00000397098:L279P	ENSP00000243961:L211P	L	-	2	0	ZNF335	44025838	0.002000	0.14202	0.000000	0.03702	0.025000	0.11179	0.390000	0.20768	-0.785000	0.04522	-1.070000	0.02257	CTG		ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079553.1	NM_022095	
APCDD1L	164284	broad.mit.edu	37	20	57036200	57036200	+	Silent	SNP	G	G	C			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr20:57036200G>C	ENST00000371149.3	-	4	1382	c.1152C>G	c.(1150-1152)gcC>gcG	p.A384A	APCDD1L_ENST00000439429.1_Silent_p.A395A|APCDD1L_ENST00000491015.1_5'UTR	NM_153360.1	NP_699191.1	Q8NCL9	APCDL_HUMAN	adenomatosis polyposis coli down-regulated 1-like	384						integral component of membrane (GO:0016021)		p.A384A(1)		large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(1)	18	Lung NSC(12;0.000856)|all_lung(29;0.0025)		BRCA - Breast invasive adenocarcinoma(13;5.6e-11)|Epithelial(14;1.67e-07)|all cancers(14;1.48e-06)			CCATGGACCAGGCCCCCGCAC	0.627																																					p.A384A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1152G	20						.						52.0	59.0	56.0					20																	57036200		2203	4300	6503	56469606	SO:0001819	synonymous_variant	164284	exon4			AK074647	CCDS13467.1	20q13.32	2006-07-07			ENSG00000198768	ENSG00000198768			26892	protein-coding gene	gene with protein product							Standard	NM_153360		Approved	FLJ90166	uc002xze.1	Q8NCL9	OTTHUMG00000032845	ENST00000371149.3:c.1152C>G	20.37:g.57036200G>C		Somatic		Capture	Illumina HiSeq	Phase_I	56469606	NM_153360		Silent	SNP	ENST00000371149.3	37	CCDS13467.1																																																																																				APCDD1L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000079881.2	NM_153360	
C20orf195	79025	broad.mit.edu	37	20	62187653	62187654	+	Missense_Mutation	DNP	GA	GA	CG			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	GA	GA					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr20:62187653_62187654GA>CG	ENST00000370098.3	+	2	729_730	c.637_638GA>CG	c.(637-639)GAc>CGc	p.D213R	C20orf195_ENST00000370097.1_Missense_Mutation_p.D213R	NM_024059.2	NP_076964.1	Q9BVV2	CT195_HUMAN	chromosome 20 open reading frame 195	213	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					extracellular vesicular exosome (GO:0070062)		p.D213>?(1)		large_intestine(3)|lung(4)	7	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)			TGTCGTGTTTGACCGAAAGGCG	0.624																																					.												.	.	1	Complex(1)	large_intestine(1)	c.637_638CG	20						.																																			61658098	SO:0001583	missense	79025	exon2				CCDS13526.1	20q13.33	2014-02-12			ENSG00000125531	ENSG00000125531			28764	protein-coding gene	gene with protein product						12477932	Standard	NM_024059		Approved	MGC5356	uc002yfj.3	Q9BVV2	OTTHUMG00000032980	Exception_encountered	20.37:g.62187653_62187654delinsCG	ENSP00000359116:p.Asp213Arg	Somatic		Capture	Illumina HiSeq	Phase_I	61658097	NM_024059		Missense_Mutation	DNP	ENST00000370098.3	37	CCDS13526.1																																																																																				C20orf195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080155.1	NM_024059	
SON	6651	broad.mit.edu	37	21	34923165	34923165	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr21:34923165C>T	ENST00000356577.4	+	3	2103	c.1628C>T	c.(1627-1629)aCg>aTg	p.T543M	SON_ENST00000381679.4_Missense_Mutation_p.T543M|SON_ENST00000300278.4_Missense_Mutation_p.T543M|SON_ENST00000381692.2_Intron|SON_ENST00000290239.6_Missense_Mutation_p.T543M	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	543					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.T543M(2)		breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						CCTGAGGCAACGATGGTGCTG	0.632																																					p.T543M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1628T	21						.						89.0	90.0	90.0					21																	34923165		2203	4300	6503	33845035	SO:0001583	missense	6651	exon3			AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.1628C>T	21.37:g.34923165C>T	ENSP00000348984:p.Thr543Met	Somatic		Capture	Illumina HiSeq	Phase_I	33845035	NM_032195	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	De_novo_Start_OutOfFrame	SNP	ENST00000356577.4	37	CCDS13629.1	.	.	.	.	.	.	.	.	.	.	C	14.91	2.676635	0.47886	.	.	ENSG00000159140	ENST00000356577;ENST00000290239;ENST00000300278;ENST00000381679	T;T;T;T	0.12879	2.83;2.82;2.81;2.64	4.83	4.83	0.62350	.	0.524554	0.17737	N	0.163713	T	0.20659	0.0497	N	0.24115	0.695	0.23669	N	0.997151	D;D;D	0.69078	0.997;0.996;0.996	P;P;P	0.57548	0.67;0.823;0.823	T	0.05435	-1.0885	10	0.62326	D	0.03	.	16.2124	0.82170	0.0:1.0:0.0:0.0	.	543;543;543	P18583;P18583-3;P18583-6	SON_HUMAN;.;.	M	543	ENSP00000348984:T543M;ENSP00000290239:T543M;ENSP00000300278:T543M;ENSP00000371095:T543M	ENSP00000290239:T543M	T	+	2	0	SON	33845035	0.008000	0.16893	0.426000	0.26672	0.991000	0.79684	1.489000	0.35562	2.610000	0.88304	0.484000	0.47621	ACG		SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927	
PCNT	5116	broad.mit.edu	37	21	47847590	47847591	+	Missense_Mutation	DNP	GA	GA	CT			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	GA	GA					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr21:47847590_47847591GA>CT	ENST00000359568.5	+	34	7482_7483	c.7375_7376GA>CT	c.(7375-7377)GAg>CTg	p.E2459L	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	2459					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)		p.E2459>?(1)		NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					GGTTGTGCAAGAGGCCTTTGAA	0.589																																					.												.	.	1	Complex(1)	large_intestine(1)	c.7375_7376CT	21						.																																			46672019	SO:0001583	missense	5116	exon34			AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	Exception_encountered	21.37:g.47847590_47847591delinsCT	ENSP00000352572:p.Glu2459Leu	Somatic		Capture	Illumina HiSeq	Phase_I	46672018	NM_006031	O43152|Q7Z7C9	Missense_Mutation	DNP	ENST00000359568.5	37	CCDS33592.1																																																																																				PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031	
CABIN1	23523	broad.mit.edu	37	22	24459580	24459580	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr22:24459580T>A	ENST00000398319.2	+	14	2240	c.1855T>A	c.(1855-1857)Tgg>Agg	p.W619R	CABIN1_ENST00000405822.2_Missense_Mutation_p.W569R|CABIN1_ENST00000263119.5_Missense_Mutation_p.W619R	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	619					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						CCGTGTTTACTGGCTGAAGGC	0.592																																					p.W619R												.	.	0			c.T1855A	22						.						216.0	182.0	193.0					22																	24459580		2203	4300	6503	22789580	SO:0001583	missense	23523	exon14			AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.1855T>A	22.37:g.24459580T>A	ENSP00000381364:p.Trp619Arg	None		Capture	Illumina HiSeq	Phase_I	22789580	NM_001199281	G5E9F3|Q6PHY0|Q9Y460	Missense_Mutation	SNP	ENST00000398319.2	37	CCDS13823.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.488255	0.84854	.	.	ENSG00000099991	ENST00000263119;ENST00000405822;ENST00000398319	T;T;T	0.34072	1.38;1.38;1.38	4.78	4.78	0.61160	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.59945	0.2231	M	0.74881	2.28	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.996	T	0.65220	-0.6221	10	0.87932	D	0	.	14.2558	0.66051	0.0:0.0:0.0:1.0	.	569;619	G5E9F3;Q9Y6J0	.;CABIN_HUMAN	R	619;569;619	ENSP00000263119:W619R;ENSP00000384694:W569R;ENSP00000381364:W619R	ENSP00000263119:W619R	W	+	1	0	CABIN1	22789580	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.599000	0.82757	2.114000	0.64651	0.529000	0.55759	TGG		CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320161.2	NM_012295	
FOXRED2	80020	broad.mit.edu	37	22	36900412	36900412	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr22:36900412G>A	ENST00000397224.4	-	4	875	c.782C>T	c.(781-783)gCc>gTc	p.A261V	FOXRED2_ENST00000216187.6_Missense_Mutation_p.A261V|FOXRED2_ENST00000397223.4_Missense_Mutation_p.A261V	NM_001102371.1	NP_001095841.1	Q8IWF2	FXRD2_HUMAN	FAD-dependent oxidoreductase domain containing 2	261					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	endoplasmic reticulum lumen (GO:0005788)	flavin adenine dinucleotide binding (GO:0050660)|glycoprotein binding (GO:0001948)|oxidoreductase activity (GO:0016491)	p.A261V(1)		breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						ATTGTTGATGGCTCTGAGCCC	0.602																																					p.A261V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C782T	22						.						41.0	38.0	39.0					22																	36900412		2203	4300	6503	35230358	SO:0001583	missense	80020	exon4			BC027716	CCDS13929.1	22q12.3	2006-07-05			ENSG00000100350	ENSG00000100350			26264	protein-coding gene	gene with protein product		613777				12477932	Standard	NM_024955		Approved	FLJ23322	uc003app.4	Q8IWF2	OTTHUMG00000044614	ENST00000397224.4:c.782C>T	22.37:g.36900412G>A	ENSP00000380401:p.Ala261Val	Somatic		Capture	Illumina HiSeq	Phase_I	35230358	NM_001102371	B2RDI4|Q8N378|Q96BD1|Q9H5L5|Q9H6M8	Missense_Mutation	SNP	ENST00000397224.4	37	CCDS13929.1	.	.	.	.	.	.	.	.	.	.	G	33	5.267817	0.95399	.	.	ENSG00000100350	ENST00000397224;ENST00000216187;ENST00000397223	T;T;T	0.18174	2.23;2.23;2.23	5.54	5.54	0.83059	Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.52125	0.1715	M	0.89715	3.055	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.60167	-0.7316	10	0.59425	D	0.04	-35.7463	19.48	0.95005	0.0:0.0:1.0:0.0	.	261	Q8IWF2	FXRD2_HUMAN	V	261	ENSP00000380401:A261V;ENSP00000216187:A261V;ENSP00000380400:A261V	ENSP00000216187:A261V	A	-	2	0	FOXRED2	35230358	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	8.769000	0.91742	2.606000	0.88127	0.655000	0.94253	GCC		FOXRED2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104098.2	NM_024955	
SMARCB1	6598	broad.mit.edu	37	22	24133964	24133966	+	In_Frame_Del	DEL	TTC	TTC	-			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	TTC	TTC					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr22:24133964_24133966delTTC	ENST00000263121.7	+	2	311_313	c.115_117delTTC	c.(115-117)ttcdel	p.F39del	SMARCB1_ENST00000407082.3_In_Frame_Del_p.F39del|SMARCB1_ENST00000344921.6_In_Frame_Del_p.F39del|SMARCB1_ENST00000407422.3_In_Frame_Del_p.F39del	NM_003073.3	NP_003064.2	Q12824	SNF5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1	39					ATP-dependent chromatin remodeling (GO:0043044)|blastocyst hatching (GO:0001835)|cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|DNA integration (GO:0015074)|DNA repair (GO:0006281)|mitotic cell cycle phase transition (GO:0044772)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	p53 binding (GO:0002039)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)	p.?(2)|p.L36fs*13(1)|p.F39delF(1)		bone(4)|central_nervous_system(198)|endometrium(4)|haematopoietic_and_lymphoid_tissue(25)|kidney(3)|large_intestine(5)|liver(2)|lung(5)|meninges(5)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|soft_tissue(194)	458		Medulloblastoma(6;2.2e-09)|all_neural(6;2.73e-05)				CCTCCGTATGTTCCGAGGTTCTC	0.498			"""D, N, F, S"""		malignant rhabdoid	malignant rhabdoid																															p.39_39del		yes	Rec	yes	Rhabdoid predisposition syndrome	22	22q11	6598	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1"""		M	.	.	4	Unknown(2)|Deletion - In frame(1)|Deletion - Frameshift(1)	soft_tissue(3)|large_intestine(1)	c.115_117del	22						.																																			22463966	SO:0001651	inframe_deletion	6598	exon2			U04847	CCDS13817.1, CCDS46671.1	22q11.23	2014-09-17			ENSG00000099956	ENSG00000099956			11103	protein-coding gene	gene with protein product	"""sucrose nonfermenting, yeast, homolog-like 1"", ""integrase interactor 1"", ""malignant rhabdoid tumor suppressor"", ""protein phosphatase 1, regulatory subunit 144"""	601607		SNF5L1		7801128, 10319872, 10365963	Standard	NM_003073		Approved	BAF47, Ini1, Snr1, hSNFS, Sfh1p, RDT, PPP1R144	uc002zyb.3	Q12824	OTTHUMG00000150737	ENST00000263121.7:c.115_117delTTC	22.37:g.24133964_24133966delTTC	ENSP00000263121:p.Phe39del	Somatic		Capture	Illumina HiSeq	Phase_I	22463964	NM_003073	O75784|O95474|Q17S11|Q38GA1|Q76N08|Q9UBH2	In_Frame_Del	DEL	ENST00000263121.7	37	CCDS13817.1																																																																																				SMARCB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319872.1	NM_003073	
MICALL1	85377	broad.mit.edu	37	22	38327926	38327926	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr22:38327926C>G	ENST00000215957.6	+	10	2128	c.2002C>G	c.(2002-2004)Ctc>Gtc	p.L668V	MICALL1_ENST00000402631.1_3'UTR	NM_033386.3	NP_203744.1	Q8N3F8	MILK1_HUMAN	MICAL-like 1	668	RAB-binding domain (RBD); mediates the interaction with RAB13 and RAB35 and intramolecular interaction with the CH domain.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|neuron projection development (GO:0031175)|protein localization to endosome (GO:0036010)|protein targeting to membrane (GO:0006612)|receptor-mediated endocytosis (GO:0006898)|retrograde transport, endosome to plasma membrane (GO:1990126)|slow endocytic recycling (GO:0032458)	extrinsic component of membrane (GO:0019898)|late endosome (GO:0005770)|recycling endosome membrane (GO:0055038)	identical protein binding (GO:0042802)|phosphatidic acid binding (GO:0070300)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)	p.L668V(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	24	Melanoma(58;0.045)					CGGCTTTCCACTCATCAAACG	0.622																																					p.L668V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2002G	22						.						67.0	70.0	69.0					22																	38327926		2203	4300	6503	36657872	SO:0001583	missense	85377	exon10			BK000466	CCDS13961.1	22q13.1	2006-11-24			ENSG00000100139	ENSG00000100139			29804	protein-coding gene	gene with protein product	"""molecule interacting with Rab13"""					11258795, 12110185	Standard	NM_033386		Approved	MIRAB13, KIAA1668, MICAL-L1	uc003aui.3	Q8N3F8	OTTHUMG00000150670	ENST00000215957.6:c.2002C>G	22.37:g.38327926C>G	ENSP00000215957:p.Leu668Val	Somatic		Capture	Illumina HiSeq	Phase_I	36657872	NM_033386	Q5TI16|Q7RTP5|Q8N3N8|Q9BVL9|Q9BY92|Q9UH43|Q9UH44|Q9UH45	Missense_Mutation	SNP	ENST00000215957.6	37	CCDS13961.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.01|17.01	3.280111|3.280111	0.59758|0.59758	.|.	.|.	ENSG00000100139|ENSG00000100139	ENST00000215957;ENST00000402631|ENST00000454685	T;T|.	0.58060|.	0.36;1.76|.	5.55|5.55	5.55|5.55	0.83447|0.83447	.|.	0.000000|.	0.56097|.	D|.	0.000027|.	T|T	0.73969|0.73969	0.3655|0.3655	M|M	0.76002|0.76002	2.32|2.32	0.53005|0.53005	D|D	0.999969|0.999969	D|.	0.67145|.	0.996|.	P|.	0.60117|.	0.869|.	T|T	0.74228|0.74228	-0.3733|-0.3733	10|5	0.28530|.	T|.	0.3|.	.|.	13.7595|13.7595	0.62956|0.62956	0.0:0.9266:0.0:0.0734|0.0:0.9266:0.0:0.0734	.|.	668|.	Q8N3F8|.	MILK1_HUMAN|.	V|S	668;95|243	ENSP00000215957:L668V;ENSP00000384608:L95V|.	ENSP00000215957:L668V|.	L|T	+|+	1|2	0|0	MICALL1|MICALL1	36657872|36657872	1.000000|1.000000	0.71417|0.71417	0.985000|0.985000	0.45067|0.45067	0.642000|0.642000	0.38348|0.38348	5.379000|5.379000	0.66196|0.66196	2.616000|2.616000	0.88540|0.88540	0.591000|0.591000	0.81541|0.81541	CTC|ACT		MICALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319545.4	NM_033386	
ATP6V1C2	245973	broad.mit.edu	37	2	10904521	10904521	+	Silent	SNP	G	G	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr2:10904521G>A	ENST00000272238.4	+	5	457	c.348G>A	c.(346-348)ccG>ccA	p.P116P	ATP6V1C2_ENST00000381661.3_Silent_p.P116P	NM_001039362.1	NP_001034451.1	Q8NEY4	VATC2_HUMAN	ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2	116					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of Wnt signaling pathway (GO:0030177)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)|protein dimerization activity (GO:0046983)	p.P116P(2)		endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.15)|OV - Ovarian serous cystadenocarcinoma(76;0.152)		TCAAGCAGCCGCTCGTGAGTG	0.522																																					p.P116P	NSCLC(188;1042 2136 10807 16813 47705)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G348A	2						.						141.0	125.0	130.0					2																	10904521		2203	4300	6503	10821972	SO:0001819	synonymous_variant	245973	exon5			AY039759	CCDS1674.1, CCDS42653.1	2p25.1	2010-04-21	2006-01-13		ENSG00000143882	ENSG00000143882		"""ATPases / V-type"""	18264	protein-coding gene	gene with protein product			"""ATPase, H+ transporting, lysosomal 42kD, V1 subunit C isoform 2"", ""ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C isoform 2"""			12384298	Standard	XR_426949		Approved	VMA5, ATP6C2	uc002ras.3	Q8NEY4	OTTHUMG00000090459	ENST00000272238.4:c.348G>A	2.37:g.10904521G>A		Somatic		Capture	Illumina HiSeq	Phase_I	10821972	NM_001039362	Q96EL8	Silent	SNP	ENST00000272238.4	37	CCDS42653.1																																																																																				ATP6V1C2-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000323555.1	NM_144583	
LRP1B	53353	broad.mit.edu	37	2	141680593	141680593	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr2:141680593C>A	ENST00000389484.3	-	21	4231	c.3260G>T	c.(3259-3261)gGt>gTt	p.G1087V		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1087	LDL-receptor class A 8. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.G1087V(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ACCATTGCAACCTTTTTCATC	0.433										TSP Lung(27;0.18)																											p.G1087V	Colon(99;50 2074 2507 20106)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3260T	2						.						246.0	215.0	226.0					2																	141680593		2203	4300	6503	141397063	SO:0001583	missense	53353	exon21			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.3260G>T	2.37:g.141680593C>A	ENSP00000374135:p.Gly1087Val	Somatic		Capture	Illumina HiSeq	Phase_I	141397063	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	16.15	3.040602	0.55003	.	.	ENSG00000168702	ENST00000389484;ENST00000544579;ENST00000434794	D;D	0.95447	-3.71;-3.71	5.19	4.3	0.51218	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.306119	0.31531	U	0.007488	D	0.96793	0.8953	M	0.73319	2.225	0.58432	D	0.999993	B;D	0.69078	0.434;0.997	B;D	0.78314	0.405;0.991	D	0.95656	0.8711	10	0.36615	T	0.2	.	11.349	0.49577	0.1425:0.7202:0.1373:0.0	.	270;1087	Q96NT6;Q9NZR2	.;LRP1B_HUMAN	V	1087;1025;232	ENSP00000374135:G1087V;ENSP00000413239:G232V	ENSP00000374135:G1087V	G	-	2	0	LRP1B	141397063	0.972000	0.33761	0.976000	0.42696	0.990000	0.78478	1.419000	0.34793	1.149000	0.42402	0.557000	0.71058	GGT		LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
TTN	7273	broad.mit.edu	37	2	179596188	179596188	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr2:179596188C>A	ENST00000591111.1	-	57	16578	c.16354G>T	c.(16354-16356)Gaa>Taa	p.E5452*	TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Nonsense_Mutation_p.E5769*|TTN_ENST00000342992.6_Nonsense_Mutation_p.E4525*|TTN-AS1_ENST00000582847.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12271	Ig-like 35.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.E4525*(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCAGTGATTTCATCGCTGTCT	0.488																																					p.E4525X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G13573T	2						.						97.0	91.0	93.0					2																	179596188		1921	4138	6059	179304433	SO:0001587	stop_gained	7273	exon56			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.16354G>T	2.37:g.179596188C>A	ENSP00000465570:p.Glu5452*	Somatic		Capture	Illumina HiSeq	Phase_I	179304433	NM_133378	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	55	24.132677	0.99959	.	.	ENSG00000155657	ENST00000342992	.	.	.	5.59	5.59	0.84812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.5963	0.95541	0.0:1.0:0.0:0.0	.	.	.	.	X	4525	.	ENSP00000343764:E4525X	E	-	1	0	TTN	179304433	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	3.292000	0.51772	2.648000	0.89879	0.561000	0.74099	GAA		TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	broad.mit.edu	37	2	179665380	179665380	+	Nonsense_Mutation	SNP	G	G	A	rs150954246		TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr2:179665380G>A	ENST00000591111.1	-	4	549	c.325C>T	c.(325-327)Cga>Tga	p.R109*	TTN_ENST00000360870.5_Nonsense_Mutation_p.R109*|TTN_ENST00000342175.6_Nonsense_Mutation_p.R109*|TTN_ENST00000359218.5_Nonsense_Mutation_p.R109*|TTN_ENST00000460472.2_Nonsense_Mutation_p.R109*|TTN_ENST00000589042.1_Nonsense_Mutation_p.R109*|TTN_ENST00000342992.6_Nonsense_Mutation_p.R109*			Q8WZ42	TITIN_HUMAN	titin	32727	Ig-like 2.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R109*(5)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTCTGCAGTCGTTGAACGAAG	0.507																																					p.R109X												.	.	5	Substitution - Nonsense(5)	large_intestine(5)	c.C325T	2						.	G	stop/ARG,stop/ARG,stop/ARG,stop/ARG,stop/ARG	0,4406		0,0,2203	129.0	105.0	113.0		325,325,325,325,325	3.8	1.0	2	dbSNP_134	113	1,8599	1.2+/-3.3	0,1,4299	yes	stop-gained,stop-gained,stop-gained,stop-gained,stop-gained	TTN	NM_003319.4,NM_133378.4,NM_133379.3,NM_133432.3,NM_133437.3	,,,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,,,	109/26927,109/33424,109/5605,109/27052,109/27119	179665380	1,13005	2203	4300	6503	179373625	SO:0001587	stop_gained	7273	exon4			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.325C>T	2.37:g.179665380G>A	ENSP00000465570:p.Arg109*	Somatic		Capture	Illumina HiSeq	Phase_I	179373625	NM_133379	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	36	5.802729	0.96960	0.0	1.16E-4	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	.	.	.	5.78	3.8	0.43715	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	14.0515	0.64739	0.0:0.0:0.6747:0.3253	.	.	.	.	X	109	.	ENSP00000340554:R109X	R	-	1	2	TTN	179373625	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	4.137000	0.58010	2.744000	0.94065	0.563000	0.77884	CGA		TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
OTOF	9381	broad.mit.edu	37	2	26684995	26684995	+	Silent	SNP	G	G	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr2:26684995G>A	ENST00000272371.2	-	42	5373	c.5247C>T	c.(5245-5247)gaC>gaT	p.D1749D	OTOF_ENST00000402415.3_Silent_p.D1059D|OTOF_ENST00000403946.3_Silent_p.D1749D|OTOF_ENST00000338581.6_Silent_p.D982D|OTOF_ENST00000339598.3_Silent_p.D982D	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	1749					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)	p.D982D(1)|p.D1749D(1)		NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGAAGAAGTCGTCGTCCTCCA	0.617																																					p.D982D	GBM(102;732 1451 20652 24062 31372)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C2946T	2						.						181.0	164.0	170.0					2																	26684995		2203	4300	6503	26538499	SO:0001819	synonymous_variant	9381	exon25			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.5247C>T	2.37:g.26684995G>A		Somatic		Capture	Illumina HiSeq	Phase_I	26538499	NM_194323	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Silent	SNP	ENST00000272371.2	37	CCDS1725.1																																																																																				OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3		
PTCD3	55037	broad.mit.edu	37	2	86362013	86362013	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr2:86362013A>T	ENST00000254630.7	+	21	1747	c.1681A>T	c.(1681-1683)Agc>Tgc	p.S561C	SNORD94_ENST00000386037.1_RNA	NM_017952.5	NP_060422.4	Q96EY7	PTCD3_HUMAN	pentatricopeptide repeat domain 3	561					mitochondrial translation (GO:0032543)|regulation of translation (GO:0006417)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|rRNA binding (GO:0019843)	p.S561C(1)		NS(1)|breast(2)|endometrium(3)|kidney(4)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)	22						TGCGTATGAAAGCCAACCCAT	0.478																																					p.S561C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1681T	2						.						146.0	153.0	151.0					2																	86362013		2203	4300	6503	86215524	SO:0001583	missense	55037	exon21				CCDS33235.1	2p11.2	2014-02-12	2012-02-24		ENSG00000132300	ENSG00000132300			24717	protein-coding gene	gene with protein product		614918				8889548	Standard	NM_017952		Approved	FLJ20758, DKFZp666K071	uc002sqw.2	Q96EY7	OTTHUMG00000153168	ENST00000254630.7:c.1681A>T	2.37:g.86362013A>T	ENSP00000254630:p.Ser561Cys	Somatic		Capture	Illumina HiSeq	Phase_I	86215524	NM_017952	A6NHD2|D6W5M1|Q597H0|Q658Y9|Q9BUZ8|Q9NWL0	Missense_Mutation	SNP	ENST00000254630.7	37	CCDS33235.1	.	.	.	.	.	.	.	.	.	.	A	12.32	1.902860	0.33628	.	.	ENSG00000132300	ENST00000254630	T	0.32515	1.45	5.71	3.15	0.36227	.	0.746815	0.14346	N	0.325427	T	0.39835	0.1093	L	0.60455	1.87	0.09310	N	0.999993	D;D	0.57899	0.981;0.964	P;P	0.55303	0.773;0.502	T	0.15235	-1.0444	10	0.54805	T	0.06	0.0572	6.3372	0.21302	0.6091:0.2508:0.1401:0.0	.	152;561	Q96EY7-2;Q96EY7	.;PTCD3_HUMAN	C	561	ENSP00000254630:S561C	ENSP00000254630:S561C	S	+	1	0	PTCD3	86215524	0.480000	0.25933	0.254000	0.24359	0.040000	0.13550	1.026000	0.30103	0.942000	0.37525	0.533000	0.62120	AGC		PTCD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329854.1	NM_017952	
ZNF142	7701	broad.mit.edu	37	2	219514160	219514161	+	Missense_Mutation	DNP	CT	CT	GG			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	CT	CT					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr2:219514160_219514161CT>GG	ENST00000449707.1	-	6	891_892	c.470_471AG>CC	c.(469-471)gAG>gCC	p.E157A	ZNF142_ENST00000411696.2_Missense_Mutation_p.E157A	NM_001105537.1	NP_001099007.1	P52746	ZN142_HUMAN	zinc finger protein 142	157					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E157>?(1)		breast(7)|endometrium(7)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38		Renal(207;0.0474)		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		TGAAGAGGGACTCGGTGCCAGA	0.520											OREG0015202	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.	Colon(170;867 1942 8995 15834 18053)											.	.	1	Complex(1)	large_intestine(1)	c.470_471CC	2						.																																			219222405	SO:0001583	missense	7701	exon6			U09849	CCDS42817.1	2q35	2013-01-08	2006-06-13		ENSG00000115568	ENSG00000115568		"""Zinc fingers, C2H2-type"""	12927	protein-coding gene	gene with protein product		604083	"""zinc finger protein 142 (clone pHZ-49)"""				Standard	NM_001105537		Approved	KIAA0236, pHZ-49	uc002vin.4	P52746	OTTHUMG00000154736	ENST00000449707.1:c.470_471delinsGG	2.37:g.219514160_219514161delinsGG	ENSP00000408643:p.Glu157Ala	Somatic	2259	Capture	Illumina HiSeq	Phase_I	219222404	NM_001105537	Q92510	Missense_Mutation	DNP	ENST00000449707.1	37	CCDS42817.1																																																																																				ZNF142-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336833.1	NM_005081	
FGD5	152273	broad.mit.edu	37	3	14861356	14861356	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr3:14861356G>T	ENST00000285046.5	+	1	888	c.778G>T	c.(778-780)Gcc>Tcc	p.A260S	FGD5_ENST00000543601.1_Missense_Mutation_p.A19S	NM_152536.3	NP_689749.3	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	260	Glu-rich.				actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(2)|breast(2)|endometrium(3)|kidney(5)|large_intestine(10)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(1)	54						GGAGGAGCTGGCCGGGGTCCA	0.627																																					p.A260S												.	.	0			c.G778T	3						.						20.0	25.0	23.0					3																	14861356		2075	4215	6290	14836360	SO:0001583	missense	152273	exon1			AK097276	CCDS46767.1	3p25.1	2013-01-10			ENSG00000154783	ENSG00000154783		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19117	protein-coding gene	gene with protein product		614788					Standard	NM_152536		Approved	ZFYVE23, FLJ39957, FLJ00274	uc003bzc.3	Q6ZNL6	OTTHUMG00000155556	ENST00000285046.5:c.778G>T	3.37:g.14861356G>T	ENSP00000285046:p.Ala260Ser	None		Capture	Illumina HiSeq	Phase_I	14836360	NM_152536	B3KVQ3|Q6MZY1|Q7Z303|Q8IYP3|Q8N861|Q8N8G4	Missense_Mutation	SNP	ENST00000285046.5	37	CCDS46767.1	.	.	.	.	.	.	.	.	.	.	G	11.63	1.696433	0.30142	.	.	ENSG00000154783	ENST00000285046;ENST00000543601	T;T	0.75821	-0.97;-0.78	4.91	1.76	0.24704	.	1.044160	0.07561	N	0.917044	T	0.52933	0.1765	N	0.17082	0.46	0.09310	N	1	P;P	0.35077	0.483;0.483	B;B	0.24974	0.057;0.057	T	0.46569	-0.9182	10	0.51188	T	0.08	-5.2816	4.6539	0.12608	0.0997:0.1385:0.5855:0.1763	.	19;260	B7ZM68;Q6ZNL6	.;FGD5_HUMAN	S	260;19	ENSP00000285046:A260S;ENSP00000445949:A19S	ENSP00000285046:A260S	A	+	1	0	FGD5	14836360	0.003000	0.15002	0.002000	0.10522	0.002000	0.02628	1.295000	0.33377	0.613000	0.30089	0.591000	0.81541	GCC		FGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340628.1	NM_152536	
FGD5	152273	broad.mit.edu	37	3	14861441	14861441	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr3:14861441G>T	ENST00000285046.5	+	1	973	c.863G>T	c.(862-864)gGg>gTg	p.G288V	FGD5_ENST00000543601.1_Missense_Mutation_p.G47V	NM_152536.3	NP_689749.3	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	288	Glu-rich.				actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(2)|breast(2)|endometrium(3)|kidney(5)|large_intestine(10)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(1)	54						GTCACAGGTGGGGAACAGGTT	0.602																																					p.G288V												.	.	0			c.G863T	3						.						43.0	48.0	46.0					3																	14861441		2092	4220	6312	14836445	SO:0001583	missense	152273	exon1			AK097276	CCDS46767.1	3p25.1	2013-01-10			ENSG00000154783	ENSG00000154783		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19117	protein-coding gene	gene with protein product		614788					Standard	NM_152536		Approved	ZFYVE23, FLJ39957, FLJ00274	uc003bzc.3	Q6ZNL6	OTTHUMG00000155556	ENST00000285046.5:c.863G>T	3.37:g.14861441G>T	ENSP00000285046:p.Gly288Val	None		Capture	Illumina HiSeq	Phase_I	14836445	NM_152536	B3KVQ3|Q6MZY1|Q7Z303|Q8IYP3|Q8N861|Q8N8G4	Missense_Mutation	SNP	ENST00000285046.5	37	CCDS46767.1	.	.	.	.	.	.	.	.	.	.	G	15.48	2.846250	0.51164	.	.	ENSG00000154783	ENST00000285046;ENST00000543601	T;T	0.75589	-0.95;-0.79	5.25	0.704	0.18121	.	1.009930	0.07986	N	0.986353	T	0.55242	0.1908	N	0.24115	0.695	0.09310	N	0.999996	B;B	0.34372	0.451;0.451	B;B	0.28139	0.086;0.086	T	0.40403	-0.9565	10	0.36615	T	0.2	-1.8927	5.5646	0.17163	0.4114:0.0:0.4616:0.1269	.	47;288	B7ZM68;Q6ZNL6	.;FGD5_HUMAN	V	288;47	ENSP00000285046:G288V;ENSP00000445949:G47V	ENSP00000285046:G288V	G	+	2	0	FGD5	14836445	0.000000	0.05858	0.002000	0.10522	0.360000	0.29518	0.027000	0.13621	0.048000	0.15891	0.591000	0.81541	GGG		FGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340628.1	NM_152536	
GRM7	2917	broad.mit.edu	37	3	7620629	7620629	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr3:7620629G>A	ENST00000357716.4	+	8	2310	c.2036G>A	c.(2035-2037)cGg>cAg	p.R679Q	GRM7_ENST00000403881.1_Missense_Mutation_p.R679Q|GRM7_ENST00000389336.4_Missense_Mutation_p.R679Q|GRM7_ENST00000402647.2_Missense_Mutation_p.R679Q|GRM7_ENST00000486284.1_Missense_Mutation_p.R679Q|GRM7_ENST00000458641.2_3'UTR	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7	679					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)	p.R679Q(2)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						AAAACAAATCGGATTTATCGC	0.443																																					p.R679Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2036A	3						.						101.0	89.0	93.0					3																	7620629		2203	4300	6503	7595629	SO:0001583	missense	2917	exon8			U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.2036G>A	3.37:g.7620629G>A	ENSP00000350348:p.Arg679Gln	Somatic		Capture	Illumina HiSeq	Phase_I	7595629	NM_000844	Q8NFS2|Q8NFS3|Q8NFS4	Missense_Mutation	SNP	ENST00000357716.4	37	CCDS43042.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.347946	0.82022	.	.	ENSG00000196277	ENST00000357716;ENST00000486284;ENST00000389336;ENST00000403881;ENST00000525747;ENST00000402647;ENST00000413492	D;D;D;D;D	0.90004	-2.6;-2.6;-2.6;-2.6;-2.6	6.17	6.17	0.99709	GPCR, family 3, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.95815	0.8638	M	0.89601	3.045	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.998;0.999;0.997;1.0	D;D;D;D;D	0.87578	0.982;0.986;0.994;0.979;0.998	D	0.95668	0.8721	10	0.72032	D	0.01	.	19.4432	0.94831	0.0:0.0:1.0:0.0	.	679;679;434;679;679	B7ZKK0;Q14831-5;Q59G95;Q14831;Q14831-2	.;.;.;GRM7_HUMAN;.	Q	679	ENSP00000350348:R679Q;ENSP00000417536:R679Q;ENSP00000373987:R679Q;ENSP00000385664:R679Q;ENSP00000384585:R679Q	ENSP00000350348:R679Q	R	+	2	0	GRM7	7595629	1.000000	0.71417	1.000000	0.80357	0.353000	0.29299	9.869000	0.99810	2.941000	0.99782	0.655000	0.94253	CGG		GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246895.3	NM_000844	
DCLK3	85443	broad.mit.edu	37	3	36778801	36778801	+	Silent	SNP	C	C	T	rs528794239		TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr3:36778801C>T	ENST00000416516.2	-	2	1840	c.1350G>A	c.(1348-1350)ccG>ccA	p.P450P		NM_033403.1	NP_208382.1	Q9C098	DCLK3_HUMAN	doublecortin-like kinase 3	450	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.P450P(1)		breast(3)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	48						CATCGGGCTCCGGGAACTTCA	0.512													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19604	0.0		0.0	False		,,,				2504	0.0				p.P450P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1350A	3						.						125.0	119.0	121.0					3																	36778801		2013	4199	6212	36753805	SO:0001819	synonymous_variant	85443	exon2			AB051552	CCDS43064.1	3p22.3	2007-04-02	2007-04-02	2007-04-02	ENSG00000163673	ENSG00000163673			19005	protein-coding gene	gene with protein product		613167	"""doublecortin and CaM kinase-like 3"""	DCAMKL3		11214970, 16869982	Standard	NM_033403		Approved	KIAA1765, DCDC3C	uc003cgi.2	Q9C098	OTTHUMG00000155805	ENST00000416516.2:c.1350G>A	3.37:g.36778801C>T		Somatic		Capture	Illumina HiSeq	Phase_I	36753805	NM_033403		Silent	SNP	ENST00000416516.2	37	CCDS43064.1																																																																																				DCLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341727.1	XM_047355	
UBA7	7318	broad.mit.edu	37	3	49850520	49850521	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	CC	CC					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr3:49850520_49850521CC>AA	ENST00000333486.3	-	4	599_600	c.441_442GG>TT	c.(439-444)ctGGcg>ctTTcg	p.A148S	UBA7_ENST00000494212.1_5'UTR	NM_003335.2	NP_003326.2	P41226	UBA7_HUMAN	ubiquitin-like modifier activating enzyme 7	148	2 approximate repeats.				cellular protein modification process (GO:0006464)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|modification-dependent protein catabolic process (GO:0019941)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ISG15 activating enzyme activity (GO:0019782)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)	p.L147>?(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(15)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;3.58e-06)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		GTGTCAGCCGCCAGAAAGCAAA	0.584																																					.												.	.	1	Complex(1)	large_intestine(1)	c.441_442TT	3						.																																			49825525	SO:0001583	missense	7318	exon4			BC006378	CCDS2805.1	3p21	2007-11-30	2007-11-30	2007-11-30	ENSG00000182179	ENSG00000182179		"""Ubiquitin-like modifier activating enzymes"""	12471	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog B (yeast)"", ""UBA7, ubiquitin-activating enzyme E1"""	191325	"""ubiquitin-activating enzyme E1-like"""	UBE1L		8327486	Standard	NM_003335		Approved	D8, UBE2, UBA1B	uc003cxr.3	P41226	OTTHUMG00000158267	ENST00000333486.3:c.441_442delinsAA	3.37:g.49850520_49850521delinsAA	ENSP00000333266:p.Ala148Ser	Somatic		Capture	Illumina HiSeq	Phase_I	49825524	NM_003335	Q9BRB2	Missense_Mutation	DNP	ENST00000333486.3	37	CCDS2805.1																																																																																				UBA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350503.1	NM_003335	
DNASE1L3	1776	broad.mit.edu	37	3	58196588	58196588	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr3:58196588G>A	ENST00000394549.2	-	1	362	c.46C>T	c.(46-48)Cac>Tac	p.H16Y	DNASE1L3_ENST00000318316.3_Missense_Mutation_p.H16Y|DNASE1L3_ENST00000483681.1_Missense_Mutation_p.H16Y|DNASE1L3_ENST00000486455.1_Missense_Mutation_p.H16Y	NM_004944.3	NP_004935.1	Q13609	DNSL3_HUMAN	deoxyribonuclease I-like 3	16					apoptotic DNA fragmentation (GO:0006309)|developmental programmed cell death (GO:0010623)|DNA metabolic process (GO:0006259)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)|deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)	p.H16Y(1)		breast(2)|large_intestine(4)|lung(6)	12				BRCA - Breast invasive adenocarcinoma(55;0.00021)|KIRC - Kidney renal clear cell carcinoma(284;0.0445)|Kidney(284;0.0556)|OV - Ovarian serous cystadenocarcinoma(275;0.202)		AGGGCGCTGTGGATGGAGAGG	0.567																																					p.H16Y	Esophageal Squamous(96;1069 1424 4841 43466 52325)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C46T	3						.						136.0	121.0	126.0					3																	58196588		2203	4300	6503	58171628	SO:0001583	missense	1776	exon3			AF047354	CCDS2886.1, CCDS58836.1	3p14.3	2008-05-15			ENSG00000163687	ENSG00000163687			2959	protein-coding gene	gene with protein product	"""DNase gamma"""	602244				9205125, 9714828, 14646506	Standard	NM_004944		Approved	DNAS1L3, LSD	uc003djo.2	Q13609	OTTHUMG00000159153	ENST00000394549.2:c.46C>T	3.37:g.58196588G>A	ENSP00000378053:p.His16Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	58171628	NM_004944	B2R8B1|B7Z707|O75803	Missense_Mutation	SNP	ENST00000394549.2	37	CCDS2886.1	.	.	.	.	.	.	.	.	.	.	G	0.954	-0.705408	0.03255	.	.	ENSG00000163687	ENST00000486455;ENST00000450710;ENST00000318316;ENST00000483681;ENST00000394549;ENST00000461914;ENST00000460422	T;T;T;T;T;T	0.56941	0.43;0.43;0.43;0.43;0.43;0.43	5.49	-1.37	0.09056	.	1.633470	0.02947	N	0.141253	T	0.40694	0.1127	L	0.44542	1.39	0.09310	N	1	B;B;B	0.28971	0.229;0.229;0.229	B;B;B	0.25759	0.063;0.063;0.04	T	0.21075	-1.0256	10	0.06099	T	0.92	.	9.7789	0.40637	0.0:0.2849:0.3075:0.4076	.	16;16;16	B7Z707;E9PES0;Q13609	.;.;DNSL3_HUMAN	Y	16	ENSP00000419052:H16Y;ENSP00000316193:H16Y;ENSP00000417047:H16Y;ENSP00000378053:H16Y;ENSP00000418113:H16Y;ENSP00000418509:H16Y	ENSP00000316193:H16Y	H	-	1	0	DNASE1L3	58171628	0.000000	0.05858	0.000000	0.03702	0.096000	0.18686	-0.358000	0.07641	-0.121000	0.11787	0.655000	0.94253	CAC		DNASE1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353533.1	NM_004944	
SMC4	10051	broad.mit.edu	37	3	160138642	160138642	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr3:160138642C>T	ENST00000357388.3	+	13	2423	c.1972C>T	c.(1972-1974)Ctt>Ttt	p.L658F	RP11-432B6.3_ENST00000483754.1_Intron|SMC4_ENST00000462787.1_Missense_Mutation_p.L658F|SMC4_ENST00000469762.1_Missense_Mutation_p.L633F|SMC4_ENST00000344722.5_Missense_Mutation_p.L658F|SMC4_ENST00000360111.2_Missense_Mutation_p.L658F	NM_001002800.1	NP_001002800.1	Q9NTJ3	SMC4_HUMAN	structural maintenance of chromosomes 4	658	Flexible hinge.				kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)|mitotic sister chromatid segregation (GO:0000070)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(15)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			TGTAAACTTCCTTAAAAGACA	0.333																																					p.L658F												.	.	0			c.C1972T	3						.						101.0	94.0	96.0					3																	160138642		2203	4300	6503	161621336	SO:0001583	missense	10051	exon13			AF092564	CCDS3189.1, CCDS75046.1	3q26.1	2006-07-06	2006-07-06	2006-07-06	ENSG00000113810	ENSG00000113810		"""Structural maintenance of chromosomes proteins"""	14013	protein-coding gene	gene with protein product		605575	"""SMC4 (structural maintenance of chromosomes 4, yeast)-like 1"", ""SMC4 structural maintenance of chromosomes 4-like 1 (yeast)"""	SMC4L1		9789013, 10319587	Standard	NM_005496		Approved	hCAP-C, CAP-C	uc003fdh.3	Q9NTJ3	OTTHUMG00000159006	ENST00000357388.3:c.1972C>T	3.37:g.160138642C>T	ENSP00000349961:p.Leu658Phe	None		Capture	Illumina HiSeq	Phase_I	161621336	NM_001002800	A6NLT9|D3DNL8|O95752|Q8NDL4|Q9UNT9	Missense_Mutation	SNP	ENST00000357388.3	37	CCDS3189.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.515833	0.85495	.	.	ENSG00000113810	ENST00000357388;ENST00000360111;ENST00000469762;ENST00000462787;ENST00000344722;ENST00000545277	D;D;D;D;D	0.89681	-2.55;-2.55;-2.55;-2.55;-2.55	5.43	5.43	0.79202	SMCs flexible hinge (3);RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	D	0.95971	0.8688	H	0.96996	3.92	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.999;0.999;1.0	D	0.96407	0.9301	10	0.87932	D	0	-14.5928	10.4037	0.44243	0.0:0.8797:0.0:0.1203	.	658;633;633;658	Q9NTJ3-2;B3KXX5;E9PD53;Q9NTJ3	.;.;.;SMC4_HUMAN	F	658;658;633;658;658;252	ENSP00000349961:L658F;ENSP00000353225:L658F;ENSP00000417964:L633F;ENSP00000420734:L658F;ENSP00000341382:L658F	ENSP00000341382:L658F	L	+	1	0	SMC4	161621336	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.064000	0.41432	2.530000	0.85305	0.544000	0.68410	CTT		SMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352862.1		
BANK1	55024	broad.mit.edu	37	4	102791708	102791708	+	Silent	SNP	C	C	T	rs139390646		TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr4:102791708C>T	ENST00000322953.4	+	5	1084	c.810C>T	c.(808-810)atC>atT	p.I270I	BANK1_ENST00000428908.1_Silent_p.I137I|BANK1_ENST00000444316.2_Silent_p.I240I|BANK1_ENST00000508653.1_Silent_p.I137I|BANK1_ENST00000504592.1_Silent_p.I255I	NM_017935.4	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	270	DBB. {ECO:0000255|PROSITE- ProRule:PRU00707}.				B cell activation (GO:0042113)			p.I270I(1)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|liver(2)|lung(16)|ovary(2)|skin(2)|urinary_tract(1)	44		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		GTGATGGAATCGTTAAAGCTA	0.398													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17554	0.0		0.0	False		,,,				2504	0.0				p.I270I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C810T	4						.	C	,,	1,4405	2.1+/-5.4	0,1,2202	141.0	128.0	132.0		720,411,810	1.9	0.0	4	dbSNP_134	132	8,8592	6.4+/-24.3	0,8,4292	no	coding-synonymous,coding-synonymous,coding-synonymous	BANK1	NM_001083907.2,NM_001127507.2,NM_017935.4	,,	0,9,6494	TT,TC,CC		0.093,0.0227,0.0692	,,	240/756,137/653,270/786	102791708	9,12997	2203	4300	6503	103010731	SO:0001819	synonymous_variant	55024	exon5			AB063170	CCDS34038.1, CCDS47115.1, CCDS47116.1	4q23	2013-01-11						"""Ankyrin repeat domain containing"""	18233	protein-coding gene	gene with protein product		610292				11782428, 21208380, 21480188	Standard	NM_017935		Approved	BANK, FLJ20706	uc003hvy.4	Q8NDB2		ENST00000322953.4:c.810C>T	4.37:g.102791708C>T		Somatic		Capture	Illumina HiSeq	Phase_I	103010731	NM_017935	A8K7W8|B0F3S2|Q8N5K8|Q8NB56|Q8WYN5|Q9NWP2	Silent	SNP	ENST00000322953.4	37	CCDS34038.1																																																																																				BANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363161.1	NM_017935	
ZNF827	152485	broad.mit.edu	37	4	146770591	146770591	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr4:146770591G>A	ENST00000508784.1	-	6	2331	c.2104C>T	c.(2104-2106)Cga>Tga	p.R702*	ZNF827_ENST00000379448.4_Nonsense_Mutation_p.R702*|ZNF827_ENST00000511534.1_5'UTR|ZNF827_ENST00000513320.1_Nonsense_Mutation_p.R352*			Q17R98	ZN827_HUMAN	zinc finger protein 827	702					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R702*(2)		NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	all_hematologic(180;0.151)					GTTTTCTCTCGCCCGATTAAA	0.502																																					p.R702X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C2104T	4						.						130.0	135.0	133.0					4																	146770591		2203	4300	6503	146990041	SO:0001587	stop_gained	152485	exon6			AK091130	CCDS34072.1	4q31.22	2013-01-08			ENSG00000151612	ENSG00000151612		"""Zinc fingers, C2H2-type"""	27193	protein-coding gene	gene with protein product						12477932	Standard	NM_178835		Approved		uc003ikm.3	Q17R98	OTTHUMG00000161362	ENST00000508784.1:c.2104C>T	4.37:g.146770591G>A	ENSP00000421863:p.Arg702*	Somatic		Capture	Illumina HiSeq	Phase_I	146990041	NM_178835	B7ZL52|Q7Z4S7|Q8N279	Nonsense_Mutation	SNP	ENST00000508784.1	37		.	.	.	.	.	.	.	.	.	.	G	40	8.450699	0.98817	.	.	ENSG00000151612	ENST00000508784;ENST00000513320;ENST00000379448;ENST00000281318;ENST00000440280	.	.	.	5.7	4.86	0.63082	.	0.167131	0.53938	D	0.000041	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	-6.9996	14.7328	0.69393	0.0695:0.0:0.9305:0.0	.	.	.	.	X	702;352;702;701;352	.	ENSP00000281318:R701X	R	-	1	2	ZNF827	146990041	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.524000	0.45589	1.410000	0.46936	0.655000	0.94253	CGA		ZNF827-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000364654.2	NM_178835	
ADAM29	11086	broad.mit.edu	37	4	175897169	175897169	+	Missense_Mutation	SNP	G	G	A	rs555477715		TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr4:175897169G>A	ENST00000359240.3	+	5	1163	c.493G>A	c.(493-495)Gga>Aga	p.G165R	ADAM29_ENST00000514159.1_Missense_Mutation_p.G165R|ADAM29_ENST00000404450.4_Missense_Mutation_p.G165R|ADAM29_ENST00000445694.1_Missense_Mutation_p.G165R|RP13-577H12.2_ENST00000507525.1_RNA	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	165					spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.G165R(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		CATGAGATCCGGATTTATGCA	0.378													G|||	1	0.000199681	0.0	0.0	5008	,	,		19665	0.0		0.0	False		,,,				2504	0.001				p.G165R	Ovarian(140;1727 1835 21805 25838 41440)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G493A	4						.						87.0	89.0	88.0					4																	175897169		2203	4300	6503	176133744	SO:0001583	missense	11086	exon3			AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.493G>A	4.37:g.175897169G>A	ENSP00000352177:p.Gly165Arg	Somatic		Capture	Illumina HiSeq	Phase_I	176133744	NM_001130705	Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Missense_Mutation	SNP	ENST00000359240.3	37	CCDS3823.1	.	.	.	.	.	.	.	.	.	.	G	14.95	2.687703	0.48097	.	.	ENSG00000168594	ENST00000359240;ENST00000445694;ENST00000404450;ENST00000514159	T;T;T;T	0.02216	4.39;4.39;4.39;4.39	3.84	2.6	0.31112	.	0.469554	0.15310	U	0.269124	T	0.04272	0.0118	L	0.58510	1.815	0.09310	N	1	D	0.58970	0.984	P	0.49561	0.615	T	0.38023	-0.9680	9	.	.	.	.	5.8301	0.18577	0.205:0.0:0.795:0.0	.	165	Q9UKF5	ADA29_HUMAN	R	165	ENSP00000352177:G165R;ENSP00000414544:G165R;ENSP00000384229:G165R;ENSP00000423517:G165R	.	G	+	1	0	ADAM29	176133744	0.028000	0.19301	0.001000	0.08648	0.003000	0.03518	2.393000	0.44442	0.825000	0.34637	0.643000	0.83706	GGA		ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding			
ADAM29	11086	broad.mit.edu	37	4	175897884	175897884	+	Missense_Mutation	SNP	G	G	A	rs150047888		TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr4:175897884G>A	ENST00000359240.3	+	5	1878	c.1208G>A	c.(1207-1209)gGt>gAt	p.G403D	ADAM29_ENST00000514159.1_Missense_Mutation_p.G403D|ADAM29_ENST00000404450.4_Missense_Mutation_p.G403D|ADAM29_ENST00000445694.1_Missense_Mutation_p.G403D|RP13-577H12.2_ENST00000507525.1_RNA	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	403	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.		G -> D (in a cutaneous metastatic melanoma sample; somatic mutation). {ECO:0000269|PubMed:21618342}.		spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.G403D(3)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		TGTGGGAATGGTGTTGTTGAA	0.413																																					p.G403D	Ovarian(140;1727 1835 21805 25838 41440)											.	.	3	Substitution - Missense(3)	skin(2)|large_intestine(1)	c.G1208A	4						.						245.0	235.0	239.0					4																	175897884		2203	4300	6503	176134459	SO:0001583	missense	11086	exon3			AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.1208G>A	4.37:g.175897884G>A	ENSP00000352177:p.Gly403Asp	Somatic		Capture	Illumina HiSeq	Phase_I	176134459	NM_001130705	Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Missense_Mutation	SNP	ENST00000359240.3	37	CCDS3823.1	.	.	.	.	.	.	.	.	.	.	G	6.736	0.504481	0.12822	.	.	ENSG00000168594	ENST00000359240;ENST00000445694;ENST00000404450;ENST00000514159	T;T;T;T	0.03065	4.06;4.06;4.06;4.06	3.6	3.6	0.41247	Blood coagulation inhibitor, Disintegrin (1);	0.234835	0.21298	U	0.076851	T	0.19046	0.0457	M	0.91818	3.245	0.20307	N	0.999916	D	0.89917	1.0	D	0.75020	0.985	T	0.04307	-1.0961	9	.	.	.	.	7.0961	0.25311	0.1216:0.0:0.8784:0.0	.	403	Q9UKF5	ADA29_HUMAN	D	403	ENSP00000352177:G403D;ENSP00000414544:G403D;ENSP00000384229:G403D;ENSP00000423517:G403D	.	G	+	2	0	ADAM29	176134459	0.005000	0.15991	0.514000	0.27761	0.005000	0.04900	0.886000	0.28241	2.303000	0.77524	0.579000	0.79373	GGT		ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding			
ATP10D	57205	broad.mit.edu	37	4	47559844	47559844	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr4:47559844T>C	ENST00000273859.3	+	12	2257	c.1988T>C	c.(1987-1989)tTt>tCt	p.F663S	AC092597.3_ENST00000508081.1_RNA	NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	663					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						CTCCCTCTCTTTAGTCGAATG	0.522																																					p.F663S												.	.	0			c.T1988C	4						.						83.0	87.0	86.0					4																	47559844		2203	4300	6503	47254601	SO:0001583	missense	57205	exon12			AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.1988T>C	4.37:g.47559844T>C	ENSP00000273859:p.Phe663Ser	None		Capture	Illumina HiSeq	Phase_I	47254601	NM_020453	A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	ENST00000273859.3	37	CCDS3476.1	.	.	.	.	.	.	.	.	.	.	T	12.62	1.992635	0.35131	.	.	ENSG00000145246	ENST00000273859	T	0.36878	1.23	4.95	4.95	0.65309	HAD-like domain (1);	0.432090	0.27302	N	0.019986	T	0.34687	0.0906	M	0.65498	2.005	0.80722	D	1	B	0.30236	0.274	B	0.30401	0.115	T	0.13899	-1.0492	10	0.07644	T	0.81	-23.855	13.9512	0.64118	0.0:0.0:0.0:1.0	.	663	Q9P241	AT10D_HUMAN	S	663	ENSP00000273859:F663S	ENSP00000273859:F663S	F	+	2	0	ATP10D	47254601	1.000000	0.71417	0.620000	0.29132	0.031000	0.12232	4.431000	0.59915	2.085000	0.62840	0.459000	0.35465	TTT		ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216900.1	NM_020453	
UGT2B11	10720	broad.mit.edu	37	4	70079942	70079942	+	Silent	SNP	G	G	T	rs148268917		TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr4:70079942G>T	ENST00000446444.1	-	1	507	c.499C>A	c.(499-501)Cgg>Agg	p.R167R	RP11-704M14.1_ENST00000504301.1_RNA|RP11-704M14.1_ENST00000505646.1_RNA	NM_001073.1	NP_001064.1	O75310	UDB11_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B11	167					estrogen metabolic process (GO:0008210)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)	p.R167R(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	42						TACACAAACCGTATGTTAAGT	0.418																																					p.R167R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C499A	4						.						132.0	127.0	129.0					4																	70079942		2203	4299	6502	70114531	SO:0001819	synonymous_variant	10720	exon1			AF016492	CCDS3527.1	4q13.3	2008-02-05	2005-07-20		ENSG00000213759	ENSG00000213759		"""UDP glucuronosyltransferases"""	12545	protein-coding gene	gene with protein product		603064	"""UDP glycosyltransferase 2 family, polypeptide B11"""			9675083	Standard	NM_001073		Approved		uc003heh.3	O75310	OTTHUMG00000129395	ENST00000446444.1:c.499C>A	4.37:g.70079942G>T		Somatic		Capture	Illumina HiSeq	Phase_I	70114531	NM_001073	Q3KNV9	Silent	SNP	ENST00000446444.1	37	CCDS3527.1																																																																																				UGT2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251551.2	NM_001073	
ANKRD17	26057	broad.mit.edu	37	4	73951160	73951160	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr4:73951160A>T	ENST00000358602.4	-	30	7081	c.6965T>A	c.(6964-6966)aTt>aAt	p.I2322N	ANKRD17_ENST00000509867.2_Missense_Mutation_p.I2209N|ANKRD17_ENST00000330838.6_Missense_Mutation_p.I2071N	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	2322					blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.I2322N(1)		NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CATATTGACAATACCTATAAT	0.353																																					p.I2071N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T6212A	4						.						59.0	59.0	59.0					4																	73951160		2203	4300	6503	74170024	SO:0001583	missense	26057	exon29			AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.6965T>A	4.37:g.73951160A>T	ENSP00000351416:p.Ile2322Asn	Somatic		Capture	Illumina HiSeq	Phase_I	74170024	NM_198889	E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Missense_Mutation	SNP	ENST00000358602.4	37	CCDS34004.1	.	.	.	.	.	.	.	.	.	.	A	16.05	3.013781	0.54468	.	.	ENSG00000132466	ENST00000358602;ENST00000426990;ENST00000330838;ENST00000509867;ENST00000426917	T;T;T	0.68181	-0.31;-0.26;-0.17	5.81	5.81	0.92471	.	0.000000	0.64402	D	0.000002	T	0.69441	0.3111	L	0.34521	1.04	0.39352	D	0.965763	P;D;P;P	0.54207	0.936;0.965;0.894;0.826	P;P;P;B	0.54312	0.667;0.748;0.467;0.367	T	0.74355	-0.3692	10	0.87932	D	0	.	16.4563	0.84015	1.0:0.0:0.0:0.0	.	2321;2071;2322;2209	O75179-2;G5E964;O75179;E7EUV3	.;.;ANR17_HUMAN;.	N	2322;1729;2071;2209;706	ENSP00000351416:I2322N;ENSP00000332265:I2071N;ENSP00000427151:I2209N	ENSP00000332265:I2071N	I	-	2	0	ANKRD17	74170024	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.683000	0.74533	2.343000	0.79666	0.533000	0.62120	ATT		ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362475.1	NM_032217	
AGA	175	broad.mit.edu	37	4	178359909	178359910	+	Missense_Mutation	DNP	TT	TT	GA			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	TT	TT					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr4:178359909_178359910TT>GA	ENST00000264595.2	-	4	623_624	c.496_497AA>TC	c.(496-498)AAt>TCt	p.N166S	AGA_ENST00000506853.1_5'UTR	NM_000027.3|NM_001171988.1	NP_000018.2|NP_001165459.1	P20933	ASPG_HUMAN	aspartylglucosaminidase	166					protein deglycosylation (GO:0006517)|protein maturation (GO:0051604)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	N4-(beta-N-acetylglucosaminyl)-L-asparaginase activity (GO:0003948)|peptidase activity (GO:0008233)	p.N166>?(1)		endometrium(1)|kidney(2)|large_intestine(6)|lung(5)|skin(2)	16		all_lung(41;1.27e-09)|Lung NSC(41;1.1e-08)|Breast(14;6.27e-05)|Melanoma(52;0.00102)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Hepatocellular(41;0.148)|all_neural(102;0.164)|Colorectal(36;0.245)		all cancers(43;1.37e-22)|Epithelial(43;3.86e-20)|OV - Ovarian serous cystadenocarcinoma(60;3.8e-11)|Colorectal(24;6.98e-05)|GBM - Glioblastoma multiforme(59;0.000362)|COAD - Colon adenocarcinoma(29;0.000462)|STAD - Stomach adenocarcinoma(60;0.0029)|LUSC - Lung squamous cell carcinoma(193;0.0328)|READ - Rectum adenocarcinoma(43;0.163)		CCTCCAATAATTTGGCTGGCAA	0.396																																					.												.	.	1	Complex(1)	large_intestine(1)	c.496_497TC	4						.																																			178596904	SO:0001583	missense	175	exon4			X55330	CCDS3829.1	4q34.3	2014-06-23			ENSG00000038002	ENSG00000038002	3.5.1.26		318	protein-coding gene	gene with protein product	"""glycosylasparaginase"", ""N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase"""	613228					Standard	NM_000027		Approved	ASRG	uc003iuu.2	P20933	OTTHUMG00000160723	ENST00000264595.2:c.496_497delinsGA	4.37:g.178359909_178359910delinsGA	ENSP00000264595:p.Asn166Ser	Somatic		Capture	Illumina HiSeq	Phase_I	178596903	NM_001171988	B2R7H2|D3DP47|Q4W5Q2|Q6FHN6|Q9UCK6|Q9UCK7|Q9UCK8	Missense_Mutation	DNP	ENST00000264595.2	37	CCDS3829.1																																																																																				AGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361916.1	NM_000027	
APC	324	broad.mit.edu	37	5	112173917	112173917	+	Nonsense_Mutation	SNP	C	C	T	rs121913333		TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr5:112173917C>T	ENST00000457016.1	+	16	3006	c.2626C>T	c.(2626-2628)Cga>Tga	p.R876*	APC_ENST00000257430.4_Nonsense_Mutation_p.R876*|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Nonsense_Mutation_p.R876*			P25054	APC_HUMAN	adenomatous polyposis coli	876	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R876*(38)|p.S874_R876>*(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TTCTTCAAAGCGAGGTTTGCA	0.463		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R858X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,NS,Substitution - Nonsense,0 	.	40	Substitution - Nonsense(38)|Unknown(1)|Complex - deletion inframe(1)	large_intestine(37)|lung(1)|breast(1)|skin(1)	c.C2572T	5	GRCh37	CM942020	APC	M	rs121913333	.						70.0	72.0	71.0					5																	112173917		2202	4300	6502	112201816	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2626C>T	5.37:g.112173917C>T	ENSP00000413133:p.Arg876*	Somatic		Capture	Illumina HiSeq	Phase_I	112201816	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	37	6.588996	0.97688	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.92	4.09	0.47781	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.2738	14.8639	0.70401	0.3912:0.6088:0.0:0.0	.	.	.	.	X	876;858;876;876;876	.	ENSP00000257430:R876X	R	+	1	2	APC	112201816	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	1.385000	0.34408	0.785000	0.33685	0.557000	0.71058	CGA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
APC	324	broad.mit.edu	37	5	112175411	112175411	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr5:112175411G>T	ENST00000457016.1	+	16	4500	c.4120G>T	c.(4120-4122)Gaa>Taa	p.E1374*	APC_ENST00000257430.4_Nonsense_Mutation_p.E1374*|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Nonsense_Mutation_p.E1374*			P25054	APC_HUMAN	adenomatous polyposis coli	1374	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.E1374*(6)|p.E1374K(2)|p.E1374fs*2(1)|p.?(1)|p.K1192fs*3(1)|p.P1373fs*41(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AAGTCCACCTGAACACTATGT	0.453		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.E1356X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,pancreas,NS,Substitution - coding silent,-2 	.	12	Substitution - Nonsense(6)|Substitution - Missense(2)|Deletion - Frameshift(2)|Unknown(1)|Insertion - Frameshift(1)	large_intestine(8)|urinary_tract(1)|pancreas(1)|soft_tissue(1)|skin(1)	c.G4066T	5						.						84.0	81.0	82.0					5																	112175411		2202	4300	6502	112203310	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4120G>T	5.37:g.112175411G>T	ENSP00000413133:p.Glu1374*	Somatic		Capture	Illumina HiSeq	Phase_I	112203310	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	G	41	8.982164	0.99025	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-18.9189	20.4898	0.99202	0.0:0.0:1.0:0.0	.	.	.	.	X	1374	.	.	E	+	1	0	APC	112203310	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	9.476000	0.97823	2.941000	0.99782	0.655000	0.94253	GAA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
PCDHB5	26167	broad.mit.edu	37	5	140516096	140516096	+	Silent	SNP	G	G	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr5:140516096G>A	ENST00000231134.5	+	1	1297	c.1080G>A	c.(1078-1080)ccG>ccA	p.P360P		NM_015669.2	NP_056484.1	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5	360	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P360P(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|kidney(1)|large_intestine(18)|lung(25)|ovary(3)|prostate(6)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	81			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AAAATGCCCCGGAAACTGTAG	0.502																																					p.P360P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1080A	5						.						81.0	88.0	86.0					5																	140516096		2203	4300	6503	140496280	SO:0001819	synonymous_variant	26167	exon1			AF152498	CCDS4247.1	5q31	2010-01-26			ENSG00000113209	ENSG00000113209		"""Cadherins / Protocadherins : Clustered"""	8690	other	protocadherin		606331				10380929	Standard	NM_015669		Approved	DKFZp586B0217, PCDH-BETA5	uc003liq.3	Q9Y5E4	OTTHUMG00000129616	ENST00000231134.5:c.1080G>A	5.37:g.140516096G>A		Somatic		Capture	Illumina HiSeq	Phase_I	140496280	NM_015669	Q549F4|Q9UFU9	Silent	SNP	ENST00000231134.5	37	CCDS4247.1																																																																																				PCDHB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251811.1	NM_015669	
PCDHB7	56129	broad.mit.edu	37	5	140554104	140554104	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr5:140554104A>T	ENST00000231137.3	+	1	1862	c.1688A>T	c.(1687-1689)tAc>tTc	p.Y563F		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	563					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Y563F(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTCGTGCTGTACCCGCTGCAG	0.736																																					p.Y563F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1688T	5						.						27.0	32.0	31.0					5																	140554104		2181	4287	6468	140534288	SO:0001583	missense	56129	exon1			AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.1688A>T	5.37:g.140554104A>T	ENSP00000231137:p.Tyr563Phe	Somatic		Capture	Illumina HiSeq	Phase_I	140534288	NM_018940	A1L3Y8	Missense_Mutation	SNP	ENST00000231137.3	37	CCDS4249.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	20.7|20.7	4.031654|4.031654	0.75504|0.75504	.|.	.|.	ENSG00000113212|ENSG00000113212	ENST00000543636|ENST00000231137	.|T	.|0.60548	.|0.18	4.3|4.3	4.3|4.3	0.51218|0.51218	.|Cadherin-like (1);	.|.	.|.	.|.	.|.	T|T	0.72653|0.72653	0.3487|0.3487	M|M	0.61703|0.61703	1.905|1.905	0.31754|0.31754	N|N	0.634221|0.634221	.|D	.|0.89917	.|1.0	.|D	.|0.87578	.|0.998	T|T	0.77046|0.77046	-0.2733|-0.2733	6|9	0.56958|0.87932	D|D	0.05|0	.|.	13.4597|13.4597	0.61221|0.61221	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|563	.|Q9Y5E2	.|PCDB7_HUMAN	S|F	346|563	.|ENSP00000231137:Y563F	ENSP00000440828:T346S|ENSP00000231137:Y563F	T|Y	+|+	1|2	0|0	PCDHB7|PCDHB7	140534288|140534288	0.381000|0.381000	0.25140|0.25140	1.000000|1.000000	0.80357|0.80357	0.946000|0.946000	0.59487|0.59487	2.543000|2.543000	0.45752|0.45752	1.705000|1.705000	0.51264|0.51264	0.369000|0.369000	0.22263|0.22263	ACC|TAC		PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940	
PCDHB13	56123	broad.mit.edu	37	5	140595709	140595709	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr5:140595709C>A	ENST00000341948.4	+	1	2201	c.2014C>A	c.(2014-2016)Cct>Act	p.P672T		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	672					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P672T(1)		NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCCCTACCTGCCTCTCCCGGA	0.682																																					p.P672T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2014A	5						.						50.0	57.0	55.0					5																	140595709		2131	4180	6311	140575893	SO:0001583	missense	56123	exon1			AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.2014C>A	5.37:g.140595709C>A	ENSP00000345491:p.Pro672Thr	Somatic		Capture	Illumina HiSeq	Phase_I	140575893	NM_018933	A8K9V6	Missense_Mutation	SNP	ENST00000341948.4	37	CCDS4255.1	.	.	.	.	.	.	.	.	.	.	-	15.41	2.826241	0.50739	.	.	ENSG00000187372	ENST00000341948;ENST00000430318;ENST00000419217	T	0.48836	0.8	3.3	0.0053	0.14062	.	.	.	.	.	T	0.56292	0.1975	H	0.95679	3.705	0.09310	N	1	B	0.27229	0.172	B	0.21708	0.036	T	0.56032	-0.8046	9	0.59425	D	0.04	.	8.125	0.30992	0.0:0.6095:0.2969:0.0936	.	672	Q9Y5F0	PCDBD_HUMAN	T	672;672;618	ENSP00000345491:P672T	ENSP00000345491:P672T	P	+	1	0	PCDHB13	140575893	0.000000	0.05858	0.398000	0.26321	0.151000	0.21798	-1.577000	0.02127	0.030000	0.15379	0.298000	0.19748	CCT		PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251810.1	NM_018933	
NDST1	3340	broad.mit.edu	37	5	149914445	149914445	+	Silent	SNP	C	C	T	rs139282708	byFrequency	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr5:149914445C>T	ENST00000261797.6	+	5	1615	c.1113C>T	c.(1111-1113)gaC>gaT	p.D371D	NDST1_ENST00000523767.1_Silent_p.D371D	NM_001543.4	NP_001534.1	P52848	NDST1_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1	371	Heparan sulfate N-deacetylase 1.				carbohydrate metabolic process (GO:0005975)|embryonic neurocranium morphogenesis (GO:0048702)|embryonic viscerocranium morphogenesis (GO:0048703)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|inflammatory response (GO:0006954)|MAPK cascade (GO:0000165)|midbrain development (GO:0030901)|polysaccharide biosynthetic process (GO:0000271)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)	p.D371D(2)		breast(2)|central_nervous_system(3)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	34		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ATGCTGAGGACGCTGGGGATG	0.592																																					p.D371D												.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.C1113T	5						.	C		3,4403	6.2+/-15.9	0,3,2200	213.0	190.0	198.0		1113	-8.3	0.1	5	dbSNP_134	198	0,8600		0,0,4300	no	coding-synonymous	NDST1	NM_001543.4		0,3,6500	TT,TC,CC		0.0,0.0681,0.0231		371/883	149914445	3,13003	2203	4300	6503	149894638	SO:0001819	synonymous_variant	3340	exon5			U18918	CCDS34277.1, CCDS75358.1	5q33.1	2008-02-05				ENSG00000070614		"""Sulfotransferases, membrane-bound"""	7680	protein-coding gene	gene with protein product		600853		HSST		7601448, 9230113	Standard	NM_001543		Approved	NST1	uc003lsk.4	P52848		ENST00000261797.6:c.1113C>T	5.37:g.149914445C>T		Somatic		Capture	Illumina HiSeq	Phase_I	149894638	NM_001543	Q96E57	Silent	SNP	ENST00000261797.6	37	CCDS34277.1																																																																																				NDST1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374314.2	NM_001543	
TULP4	56995	broad.mit.edu	37	6	158923752	158923753	+	Frame_Shift_Ins	INS	-	-	G	rs369044012		TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr6:158923752_158923753insG	ENST00000367097.3	+	13	4414_4415	c.3057_3058insG	c.(3058-3060)gggfs	p.G1020fs	TULP4_ENST00000367094.2_Intron	NM_020245.4	NP_064630.2	Q9NRJ4	TULP4_HUMAN	tubby like protein 4	1020					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V1022fs*80(1)		endometrium(7)|kidney(2)|large_intestine(15)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		AGGGCGGGCCCGGGGGGGTGGT	0.723																																					p.P1019fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.3057_3058insG	6						.																																			158843741	SO:0001589	frameshift_variant	56995	exon13				CCDS34561.1, CCDS34562.1	6q25-q26	2013-01-10			ENSG00000130338	ENSG00000130338		"""WD repeat domain containing"""	15530	protein-coding gene	gene with protein product						11595174	Standard	NM_020245		Approved	TUSP, KIAA1397	uc003qrf.3	Q9NRJ4	OTTHUMG00000015910	ENST00000367097.3:c.3064dupG	6.37:g.158923759_158923759dupG	ENSP00000356064:p.Gly1020fs	Somatic		Capture	Illumina HiSeq	Phase_I	158843740	NM_020245	Q5T3M2|Q5T3M3|Q9HD22|Q9P2F0	Frame_Shift_Ins	INS	ENST00000367097.3	37	CCDS34561.1																																																																																				TULP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042869.1	NM_020245	
GFOD1	54438	broad.mit.edu	37	6	13365679	13365680	+	Missense_Mutation	DNP	CC	CC	TA			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	CC	CC					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr6:13365679_13365680CC>TA	ENST00000379287.3	-	2	1132_1133	c.468_469GG>TA	c.(466-471)ctGGgc>ctTAgc	p.G157S	GFOD1_ENST00000379284.1_Missense_Mutation_p.G54S	NM_018988.3	NP_061861.1	Q9NXC2	GFOD1_HUMAN	glucose-fructose oxidoreductase domain containing 1	157						extracellular region (GO:0005576)	oxidoreductase activity (GO:0016491)	p.L156>?(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)	18	Breast(50;0.0296)|Ovarian(93;0.0454)	all_hematologic(90;0.135)	Epithelial(50;0.0348)|BRCA - Breast invasive adenocarcinoma(129;0.1)|all cancers(50;0.108)			TACTTCTTGCCCAGCAGGCTGC	0.653																																					.												.	.	1	Complex(1)	large_intestine(1)	c.468_469TA	6						.																																			13473659	SO:0001583	missense	54438	exon2			AK000337	CCDS4524.1, CCDS56397.1, CCDS64351.1	6p24.1-p23	2013-09-19			ENSG00000145990	ENSG00000145990			21096	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 114"""	C6orf114			Standard	NM_018988		Approved	FLJ20330, ADG-90	uc003nat.2	Q9NXC2	OTTHUMG00000014276	ENST00000379287.3:c.468_469delinsTA	6.37:g.13365679_13365680delinsTA	ENSP00000368589:p.Gly157Ser	Somatic		Capture	Illumina HiSeq	Phase_I	13473658	NM_018988	A8E4L6|Q5T058|Q96JD4|Q9H5K2	Missense_Mutation	DNP	ENST00000379287.3	37	CCDS4524.1																																																																																				GFOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039902.1	NM_018988	
SOGA3	387104	broad.mit.edu	37	6	127797321	127797321	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr6:127797321G>A	ENST00000525778.1	-	6	2595	c.1850C>T	c.(1849-1851)gCg>gTg	p.A617V	SOGA3_ENST00000481848.2_Missense_Mutation_p.A617V|SOGA3_ENST00000368268.2_Missense_Mutation_p.A617V|SOGA3_ENST00000556132.1_Missense_Mutation_p.A617V|SOGA3_ENST00000465909.2_Missense_Mutation_p.A617V|SOGA3_ENST00000474293.2_5'Flank			Q5TF21	SOGA3_HUMAN	SOGA family member 3	617					regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)		p.A617V(1)									GTCCAGTTCCGCCTTCAGGCC	0.612																																					p.A617V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1850T	6						.						156.0	168.0	164.0					6																	127797321		2154	4249	6403	127839014	SO:0001583	missense	387104	exon6			AK096490	CCDS43505.1	6q22.33	2013-03-28	2012-02-27	2012-02-27	ENSG00000214338	ENSG00000214338			21494	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 174"""	C6orf174			Standard	NM_001012279		Approved	dJ403A15.3	uc003qbd.3	Q5TF21	OTTHUMG00000166438	ENST00000525778.1:c.1850C>T	6.37:g.127797321G>A	ENSP00000434570:p.Ala617Val	Somatic		Capture	Illumina HiSeq	Phase_I	127839014	NM_001012279		Missense_Mutation	SNP	ENST00000525778.1	37	CCDS43505.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.368126	0.82463	.	.	ENSG00000214338	ENST00000556132;ENST00000368268;ENST00000525778;ENST00000465909	T;T;T;T	0.39056	1.1;1.1;1.1;1.1	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.61311	0.2337	M	0.74647	2.275	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.65113	-0.6247	10	0.72032	D	0.01	-15.6718	19.1651	0.93553	0.0:0.0:1.0:0.0	.	617	Q5TF21	CF174_HUMAN	V	617	ENSP00000451768:A617V;ENSP00000357251:A617V;ENSP00000434570:A617V;ENSP00000435559:A617V	ENSP00000435559:A617V	A	-	2	0	C6orf174	127839014	1.000000	0.71417	0.988000	0.46212	0.989000	0.77384	7.580000	0.82523	2.543000	0.85770	0.555000	0.69702	GCG		SOGA3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388246.1	NM_001012279	
PRRC2A	7916	broad.mit.edu	37	6	31595696	31595696	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr6:31595696G>A	ENST00000376033.2	+	12	1679	c.1445G>A	c.(1444-1446)cGc>cAc	p.R482H	PRRC2A_ENST00000376007.4_Missense_Mutation_p.R482H	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	482	2 X type B repeats.|4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.R482H(1)		breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						CAAGAAGAGCGCCGGGCAGCC	0.632																																					p.R482H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1445A	6						.						78.0	88.0	85.0					6																	31595696		1511	2709	4220	31703675	SO:0001583	missense	7916	exon12			M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.1445G>A	6.37:g.31595696G>A	ENSP00000365201:p.Arg482His	Somatic		Capture	Illumina HiSeq	Phase_I	31703675	NM_004638	B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Missense_Mutation	SNP	ENST00000376033.2	37	CCDS4708.1	.	.	.	.	.	.	.	.	.	.	G	15.29	2.790153	0.50102	.	.	ENSG00000204469	ENST00000424184;ENST00000435052;ENST00000376007;ENST00000376033	T;T	0.15834	2.39;2.39	4.38	4.38	0.52667	.	0.000000	0.49305	D	0.000154	T	0.32224	0.0822	M	0.67397	2.05	0.53005	D	0.99996	D	0.89917	1.0	D	0.80764	0.994	T	0.08889	-1.0700	10	0.87932	D	0	-8.4093	16.2187	0.82244	0.0:0.0:1.0:0.0	.	482	P48634	PRC2A_HUMAN	H	482;471;482;482	ENSP00000365175:R482H;ENSP00000365201:R482H	ENSP00000365175:R482H	R	+	2	0	PRRC2A	31703675	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.050000	0.93843	2.453000	0.82957	0.561000	0.74099	CGC		PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259319.1	NM_080686	
GPR110	266977	broad.mit.edu	37	6	46977477	46977477	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr6:46977477T>G	ENST00000371253.2	-	11	1909	c.1694A>C	c.(1693-1695)cAc>cCc	p.H565P	GPR110_ENST00000283297.5_Missense_Mutation_p.H368P|GPR110_ENST00000449332.2_5'UTR	NM_153840.2	NP_722582.2	Q5T601	GP110_HUMAN	G protein-coupled receptor 110	565	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.H565P(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	29						GGAGGTCAAGTGAGTACATTG	0.463																																					p.H565P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1694C	6						.						146.0	126.0	133.0					6																	46977477		2203	4300	6503	47085436	SO:0001583	missense	266977	exon11			AB083618	CCDS4920.1, CCDS34471.1	6p21.1	2014-08-08			ENSG00000153292	ENSG00000153292		"""-"", ""GPCR / Class B : Orphans"""	18990	protein-coding gene	gene with protein product						12435584, 14623098	Standard	XM_005249006		Approved	hGPCR36, PGR19	uc003oyt.3	Q5T601	OTTHUMG00000014795	ENST00000371253.2:c.1694A>C	6.37:g.46977477T>G	ENSP00000360299:p.His565Pro	Somatic		Capture	Illumina HiSeq	Phase_I	47085436	NM_153840	Q5KU15|Q5T5Z9|Q5T600|Q86SM1|Q8IXE3|Q8IZF8|Q96DQ1|Q9H615	Missense_Mutation	SNP	ENST00000371253.2	37	CCDS34471.1	.	.	.	.	.	.	.	.	.	.	T	17.11	3.306449	0.60305	.	.	ENSG00000153292	ENST00000371252;ENST00000371253;ENST00000283297	D;D	0.83755	-1.76;-1.76	5.76	5.76	0.90799	GPS domain (3);	0.000000	0.64402	D	0.000008	D	0.92126	0.7504	M	0.94021	3.485	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93098	0.6506	10	0.48119	T	0.1	-16.7519	15.2674	0.73672	0.0:0.0:0.0:1.0	.	565	Q5T601	GP110_HUMAN	P	565;565;368	ENSP00000360299:H565P;ENSP00000283297:H368P	ENSP00000283297:H368P	H	-	2	0	GPR110	47085436	1.000000	0.71417	1.000000	0.80357	0.752000	0.42762	5.724000	0.68500	2.197000	0.70478	0.454000	0.30748	CAC		GPR110-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040810.2	NM_153840	
SYNE1	23345	broad.mit.edu	37	6	152642948	152642948	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr6:152642948G>T	ENST00000367255.5	-	83	16592	c.15991C>A	c.(15991-15993)Cag>Aag	p.Q5331K	SYNE1_ENST00000341594.5_Missense_Mutation_p.Q5004K|SYNE1_ENST00000448038.1_Missense_Mutation_p.Q5260K|SYNE1_ENST00000265368.4_Missense_Mutation_p.Q5331K|SYNE1_ENST00000423061.1_Missense_Mutation_p.Q5260K	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5331					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.Q5331K(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GAATTGATCTGAGTCTCCACC	0.388										HNSCC(10;0.0054)																											p.Q5260K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C15778A	6						.						170.0	162.0	165.0					6																	152642948		2203	4300	6503	152684641	SO:0001583	missense	23345	exon82			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.15991C>A	6.37:g.152642948G>T	ENSP00000356224:p.Gln5331Lys	Somatic		Capture	Illumina HiSeq	Phase_I	152684641	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	G	10.97	1.502690	0.26949	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.52983	0.76;0.76;0.67;0.76;0.64	5.53	2.53	0.30540	.	1.028740	0.07739	N	0.946597	T	0.11410	0.0278	L	0.29908	0.895	0.20307	N	0.999913	B;B;B;B	0.06786	0.001;0.0;0.0;0.001	B;B;B;B	0.04013	0.001;0.001;0.001;0.001	T	0.31336	-0.9947	10	0.06494	T	0.89	.	5.9587	0.19287	0.0811:0.2567:0.5532:0.109	.	5331;5331;5331;5260	Q8NF91-7;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	K	5331;5260;5331;5260;5004	ENSP00000356224:Q5331K;ENSP00000396024:Q5260K;ENSP00000265368:Q5331K;ENSP00000390975:Q5260K;ENSP00000341887:Q5004K	ENSP00000265368:Q5331K	Q	-	1	0	SYNE1	152684641	0.762000	0.28451	0.135000	0.22099	0.972000	0.66771	2.704000	0.47118	1.313000	0.45069	0.655000	0.94253	CAG		SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
METTL2B	55798	broad.mit.edu	37	7	128141917	128141917	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr7:128141917C>T	ENST00000262432.8	+	9	1121	c.1084C>T	c.(1084-1086)Cgg>Tgg	p.R362W	METTL2B_ENST00000480046.1_Missense_Mutation_p.R297W	NM_018396.2	NP_060866.2	Q6P1Q9	MET2B_HUMAN	methyltransferase like 2B	362					tRNA methylation (GO:0030488)		tRNA (cytosine) methyltransferase activity (GO:0016427)			breast(1)|cervix(1)|large_intestine(2)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						GACAATGTACCGGGTTTGGAT	0.542																																					p.R362W												.	.	0			c.C1084T	7						.						156.0	157.0	156.0					7																	128141917		2203	4300	6503	127929153	SO:0001583	missense	55798	exon9			AK002212	CCDS5803.2	7q32.2	2012-06-12	2006-02-09	2006-02-09	ENSG00000165055	ENSG00000165055			18272	protein-coding gene	gene with protein product		607846	"""methyltransferase like 2"""	METTL2		11738826	Standard	NM_018396		Approved	METL, FLJ11350	uc003vnf.3	Q6P1Q9	OTTHUMG00000143738	ENST00000262432.8:c.1084C>T	7.37:g.128141917C>T	ENSP00000262432:p.Arg362Trp	None		Capture	Illumina HiSeq	Phase_I	127929153	NM_018396	B4DZ68|Q0IJ54|Q3B7J1	Missense_Mutation	SNP	ENST00000262432.8	37	CCDS5803.2	.	.	.	.	.	.	.	.	.	.	C	16.99	3.274922	0.59649	.	.	ENSG00000165055	ENST00000262432;ENST00000480046	T;T	0.04502	3.61;3.61	3.44	3.44	0.39384	.	0.000000	0.85682	D	0.000000	T	0.32763	0.0840	H	0.97491	4.015	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.54016	-0.8356	10	0.87932	D	0	-0.1491	12.7326	0.57206	0.0:1.0:0.0:0.0	.	297;362	Q6P1Q9-2;Q6P1Q9	.;MTL2B_HUMAN	W	362;297	ENSP00000262432:R362W;ENSP00000418402:R297W	ENSP00000262432:R362W	R	+	1	2	METTL2B	127929153	1.000000	0.71417	0.996000	0.52242	0.858000	0.48976	3.467000	0.53078	1.903000	0.55091	0.195000	0.17529	CGG		METTL2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289817.1	NM_018396	
TRIM24	8805	broad.mit.edu	37	7	138269647	138269647	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr7:138269647C>T	ENST00000343526.4	+	19	3319	c.3104C>T	c.(3103-3105)cCc>cTc	p.P1035L	TRIM24_ENST00000415680.2_Missense_Mutation_p.P1001L			O15164	TIF1A_HUMAN	tripartite motif containing 24	1035					calcium ion homeostasis (GO:0055074)|cellular response to estrogen stimulus (GO:0071391)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of protein stability (GO:0031647)|regulation of signal transduction by p53 class mediator (GO:1901796)|regulation of vitamin D receptor signaling pathway (GO:0070562)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nuclear euchromatin (GO:0005719)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)	chromatin binding (GO:0003682)|estrogen response element binding (GO:0034056)|ligase activity (GO:0016874)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P1001L(1)|p.P1035L(1)		breast(2)|central_nervous_system(5)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(12)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	40						TTTGTACAGCCCCGGAAGAAA	0.363																																					p.P1001L	Pancreas(179;936 2074 16128 47811 50326)|Colon(136;168 1735 9344 12243 52014)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C3002T	7						.						59.0	60.0	60.0					7																	138269647		2202	4300	6502	137920187	SO:0001583	missense	8805	exon19			AF009353	CCDS5847.1, CCDS47720.1	7q32-q34	2013-01-28	2011-01-25	2005-06-02	ENSG00000122779	ENSG00000122779		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	11812	protein-coding gene	gene with protein product		603406	"""transcriptional intermediary factor 1"", ""tripartite motif-containing 24"""	TIF1		9115274, 9191165	Standard	NM_003852		Approved	hTIF1, Tif1a, RNF82, TIF1A	uc003vuc.3	O15164	OTTHUMG00000155820	ENST00000343526.4:c.3104C>T	7.37:g.138269647C>T	ENSP00000340507:p.Pro1035Leu	Somatic		Capture	Illumina HiSeq	Phase_I	137920187	NM_003852	A4D1R7|A4D1R8|O95854	Missense_Mutation	SNP	ENST00000343526.4	37	CCDS5847.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.522660	0.85600	.	.	ENSG00000122779	ENST00000343526;ENST00000452999;ENST00000536822;ENST00000415680	T;T	0.79454	-1.24;-1.27	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	D	0.87517	0.6197	M	0.64404	1.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	D	0.87671	0.2541	10	0.87932	D	0	-11.0784	19.7588	0.96306	0.0:1.0:0.0:0.0	.	1035;1001	O15164;O15164-2	TIF1A_HUMAN;.	L	1035;427;946;1001	ENSP00000340507:P1035L;ENSP00000390829:P1001L	ENSP00000340507:P1035L	P	+	2	0	TRIM24	137920187	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	6.780000	0.75063	2.761000	0.94854	0.650000	0.86243	CCC		TRIM24-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341814.1	NM_015905	
OR6V1	346517	broad.mit.edu	37	7	142749823	142749823	+	Missense_Mutation	SNP	G	G	A	rs201116298	byFrequency	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr7:142749823G>A	ENST00000418316.1	+	1	407	c.386G>A	c.(385-387)cGc>cAc	p.R129H		NM_001001667.1	NP_001001667.1	Q8N148	OR6V1_HUMAN	olfactory receptor, family 6, subfamily V, member 1	129						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R129H(2)		endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|upper_aerodigestive_tract(1)	20	Melanoma(164;0.059)					CACCCACTGCGCTATGGCACT	0.592													g|||	3	0.000599042	0.0	0.0014	5008	,	,		19490	0.0		0.002	False		,,,				2504	0.0				p.R129H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G386A	7						.	A	HIS/ARG	0,4338		0,0,2169	85.0	90.0	88.0		386	-2.8	0.0	7		88	11,8547		0,11,4268	yes	missense	OR6V1	NM_001001667.1	29	0,11,6437	AA,AG,GG		0.1285,0.0,0.0853	benign	129/314	142749823	11,12885	2169	4279	6448	142459945	SO:0001583	missense	346517	exon1				CCDS47728.1	7q34	2014-05-06			ENSG00000225781	ENSG00000225781		"""GPCR / Class A : Olfactory receptors"""	15090	protein-coding gene	gene with protein product						12732197	Standard	NM_001001667		Approved	GPR138	uc011ksv.2	Q8N148	OTTHUMG00000158385	ENST00000418316.1:c.386G>A	7.37:g.142749823G>A	ENSP00000396085:p.Arg129His	Somatic		Capture	Illumina HiSeq	Phase_I	142459945	NM_001001667	A4D2I0|B9EH48|Q6IF70	Missense_Mutation	SNP	ENST00000418316.1	37	CCDS47728.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	g	0.966	-0.701585	0.03255	0.0	0.001285	ENSG00000225781	ENST00000418316	T	0.02258	4.37	4.53	-2.81	0.05805	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.01387	0.0045	N	0.17082	0.46	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47736	-0.9094	9	0.02654	T	1	.	11.2127	0.48808	0.6796:0.0:0.3204:0.0	.	129	Q8N148	OR6V1_HUMAN	H	129	ENSP00000396085:R129H	ENSP00000396085:R129H	R	+	2	0	OR6V1	142459945	0.000000	0.05858	0.018000	0.16275	0.967000	0.64934	-0.935000	0.03950	-0.886000	0.03966	-0.713000	0.03633	CGC		OR6V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350860.1		
SDK1	221935	broad.mit.edu	37	7	4088991	4088992	+	Missense_Mutation	DNP	CC	CC	AG			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	CC	CC					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr7:4088991_4088992CC>AG	ENST00000404826.2	+	18	2753_2754	c.2614_2615CC>AG	c.(2614-2616)CCc>AGc	p.P872S	SDK1_ENST00000389531.3_Missense_Mutation_p.P872S	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	872	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.P872>?(1)		NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		GCCCACCGCGCCCCCGCAGAAC	0.569																																					.												.	.	1	Complex(1)	large_intestine(1)	c.2614_2615AG	7						.																																			4055518	SO:0001583	missense	221935	exon18			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	Exception_encountered	7.37:g.4088991_4088992delinsAG	ENSP00000385899:p.Pro872Ser	Somatic		Capture	Illumina HiSeq	Phase_I	4055517	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	DNP	ENST00000404826.2	37	CCDS34590.1																																																																																				SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
KLHL7	55975	broad.mit.edu	37	7	23145763	23145763	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr7:23145763C>T	ENST00000339077.5	+	1	361	c.118C>T	c.(118-120)Cag>Tag	p.Q40*	KLHL7_ENST00000322231.7_5'UTR|KLHL7_ENST00000409689.1_5'Flank|KLHL7_ENST00000545771.1_5'Flank|KLHL7_ENST00000322275.5_Nonsense_Mutation_p.Q40*|KLHL7_ENST00000539124.1_5'UTR|KLHL7_ENST00000479288.1_3'UTR|KLHL7_ENST00000542558.1_5'UTR|KLHL7_ENST00000410047.1_5'Flank|KLHL7-AS1_ENST00000419813.1_lincRNA	NM_001031710.2	NP_001026880.2	Q8IXQ5	KLHL7_HUMAN	kelch-like family member 7	40					protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.Q40*(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						CATGCGGAAACAGGTACCGCC	0.612																																					p.Q40X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C118T	7						.						49.0	41.0	44.0					7																	23145763		2201	4298	6499	23112288	SO:0001587	stop_gained	55975	exon1				CCDS5378.1, CCDS34609.1, CCDS5378.2, CCDS55095.1	7p15.3	2013-01-30	2013-01-30		ENSG00000122550	ENSG00000122550		"""Kelch-like"", ""BTB/POZ domain containing"""	15646	protein-coding gene	gene with protein product	"""retinitis pigmentosa 42"""	611119	"""kelch-like 7 (Drosophila)"""			19520207	Standard	NM_001031710		Approved	KLHL6, SBBI26, RP42	uc003svs.4	Q8IXQ5	OTTHUMG00000094813	ENST00000339077.5:c.118C>T	7.37:g.23145763C>T	ENSP00000343273:p.Gln40*	Somatic		Capture	Illumina HiSeq	Phase_I	23112288	NM_001031710	A4D144|B7Z5I9|G5E9G3|Q7Z765|Q96MV2|Q9BQF8|Q9UDQ9	Nonsense_Mutation	SNP	ENST00000339077.5	37	CCDS34609.1	.	.	.	.	.	.	.	.	.	.	C	39	7.793367	0.98492	.	.	ENSG00000122550	ENST00000538858;ENST00000536369;ENST00000339077;ENST00000322275	.	.	.	4.8	3.91	0.45181	.	0.134385	0.52532	D	0.000067	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	.	13.7357	0.62815	0.0:0.8457:0.1543:0.0	.	.	.	.	X	40	.	ENSP00000323270:Q40X	Q	+	1	0	KLHL7	23112288	1.000000	0.71417	0.999000	0.59377	0.876000	0.50452	3.841000	0.55850	1.345000	0.45676	0.591000	0.81541	CAG		KLHL7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326860.3	NM_018846	
PKD1L1	168507	broad.mit.edu	37	7	47971562	47971562	+	Missense_Mutation	SNP	C	C	T	rs149658004	byFrequency	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr7:47971562C>T	ENST00000289672.2	-	5	540	c.490G>A	c.(490-492)Gca>Aca	p.A164T		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	164					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.A164T(1)	BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						GTGCTGTCTGCGGTCCCAGTA	0.522													C|||	15	0.00299521	0.0106	0.0014	5008	,	,		16983	0.0		0.0	False		,,,				2504	0.0				p.A164T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G490A	7						.	C	THR/ALA	43,4363	46.0+/-80.4	1,41,2161	80.0	89.0	86.0		490	0.5	0.0	7	dbSNP_134	86	1,8599	1.2+/-3.3	0,1,4299	yes	missense	PKD1L1	NM_138295.3	58	1,42,6460	TT,TC,CC		0.0116,0.9759,0.3383	benign	164/2850	47971562	44,12962	2203	4300	6503	47938087	SO:0001583	missense	168507	exon5			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.490G>A	7.37:g.47971562C>T	ENSP00000289672:p.Ala164Thr	Somatic		Capture	Illumina HiSeq	Phase_I	47938087	NM_138295	Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	37	CCDS34633.1	3	0.0013736263736263737	3	0.006097560975609756	0	0.0	0	0.0	0	0.0	C	7.520	0.656514	0.14580	0.009759	1.16E-4	ENSG00000158683	ENST00000289672	T	0.23754	1.89	3.38	0.526	0.17078	.	2.453540	0.02373	N	0.078086	T	0.10465	0.0256	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.20940	-1.0260	10	0.32370	T	0.25	-0.193	7.4721	0.27355	0.0:0.7465:0.0:0.2535	.	164	Q8TDX9	PK1L1_HUMAN	T	164	ENSP00000289672:A164T	ENSP00000289672:A164T	A	-	1	0	PKD1L1	47938087	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.511000	0.06321	-0.025000	0.13918	-0.904000	0.02843	GCA		PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295	
POM121	9883	broad.mit.edu	37	7	72413677	72413677	+	Missense_Mutation	SNP	G	G	A	rs373696639		TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr7:72413677G>A	ENST00000434423.2	+	11	3145	c.3145G>A	c.(3145-3147)Gct>Act	p.A1049T	POM121_ENST00000446813.1_Missense_Mutation_p.A784T|POM121_ENST00000358357.3_Missense_Mutation_p.A784T|POM121_ENST00000395270.1_Missense_Mutation_p.A784T|POM121_ENST00000257622.4_Missense_Mutation_p.A784T			Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin	1049	Pore side. {ECO:0000255}.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)		p.A784T(1)		NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)				GGCCTTCGGCGCTCCCGCCAG	0.657																																					p.A784T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2350A	7						.	G	THR/ALA	0,4404		0,0,2202	33.0	36.0	35.0		2350	-5.7	0.0	7		35	1,8591	1.2+/-3.3	0,1,4295	no	missense	POM121	NM_172020.2	58	0,1,6497	AA,AG,GG		0.0116,0.0,0.0077	benign	784/985	72413677	1,12995	2202	4296	6498	72051613	SO:0001583	missense	9883	exon13			AB014518	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313		"""-"""	19702	protein-coding gene	gene with protein product		615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""			8335683, 9734811, 17900573	Standard	NM_172020		Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	Q96HA1	OTTHUMG00000023527	ENST00000434423.2:c.3145G>A	7.37:g.72413677G>A	ENSP00000405562:p.Ala1049Thr	Somatic		Capture	Illumina HiSeq	Phase_I	72051613	NM_172020	A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	Missense_Mutation	SNP	ENST00000434423.2	37		.	.	.	.	.	.	.	.	.	.	G	0.004	-2.347981	0.00219	0.0	1.16E-4	ENSG00000196313	ENST00000446813;ENST00000257622;ENST00000395270;ENST00000358357;ENST00000434423	T;T;T;T;T	0.04406	3.63;3.66;3.63;3.66;3.88	2.87	-5.74	0.02391	.	0.817013	0.10270	N	0.694854	T	0.01222	0.0040	N	0.01493	-0.835	0.09310	N	1	B;B	0.19073	0.033;0.001	B;B	0.10450	0.005;0.001	T	0.36939	-0.9727	10	0.02654	T	1	.	6.0495	0.19777	0.2602:0.0:0.6172:0.1226	.	784;1049	A8MXF9;Q96HA1	.;P121A_HUMAN	T	784;784;784;784;1049	ENSP00000393020:A784T;ENSP00000257622:A784T;ENSP00000378687:A784T;ENSP00000351124:A784T;ENSP00000405562:A1049T	ENSP00000257622:A784T	A	+	1	0	POM121	72051613	0.015000	0.18098	0.007000	0.13788	0.087000	0.18053	-0.504000	0.06375	-2.007000	0.00956	-1.169000	0.01745	GCT		POM121-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000347344.1		
C7orf62	219557	broad.mit.edu	37	7	88423665	88423665	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr7:88423665C>T	ENST00000297203.2	-	2	777	c.592G>A	c.(592-594)Gat>Aat	p.D198N	ZNF804B_ENST00000333190.4_Intron	NM_152706.3	NP_689919.1	Q8TBZ9	CG062_HUMAN	chromosome 7 open reading frame 62	198								p.D198N(2)		NS(1)|breast(1)|endometrium(3)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	30						TGTAAGTTATCGCCTGGTCCT	0.423																																					p.D198N												.	.	2	Substitution - Missense(2)	large_intestine(1)|skin(1)	c.G592A	7						.						199.0	161.0	174.0					7																	88423665		2203	4300	6503	88261601	SO:0001583	missense	219557	exon2			BC028365	CCDS34678.1	7q21.13	2013-10-11			ENSG00000164645	ENSG00000164645			22402	protein-coding gene	gene with protein product						12690205	Standard	NM_152706		Approved	MGC26647	uc003ujv.3	Q8TBZ9	OTTHUMG00000153859	ENST00000297203.2:c.592G>A	7.37:g.88423665C>T	ENSP00000297203:p.Asp198Asn	Somatic		Capture	Illumina HiSeq	Phase_I	88261601	NM_152706		Missense_Mutation	SNP	ENST00000297203.2	37	CCDS34678.1	.	.	.	.	.	.	.	.	.	.	C	17.96	3.515374	0.64634	.	.	ENSG00000164645	ENST00000297203	T	0.24723	1.84	5.91	5.03	0.67393	.	0.262333	0.36101	N	0.002792	T	0.29288	0.0729	M	0.74881	2.28	0.38929	D	0.957903	B	0.28439	0.212	B	0.22880	0.042	T	0.17137	-1.0379	10	0.62326	D	0.03	-0.699	11.0043	0.47624	0.0:0.9153:0.0:0.0847	.	198	Q8TBZ9	CG062_HUMAN	N	198	ENSP00000297203:D198N	ENSP00000297203:D198N	D	-	1	0	C7orf62	88261601	0.988000	0.35896	0.903000	0.35520	0.410000	0.31052	2.402000	0.44521	1.509000	0.48786	-0.136000	0.14681	GAT		C7orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332714.1	NM_152706	
ASIC3	9311	broad.mit.edu	37	7	150746492	150746492	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr7:150746492G>T	ENST00000349064.5	+	1	718	c.520G>T	c.(520-522)Gag>Tag	p.E174*	ASIC3_ENST00000357922.4_Nonsense_Mutation_p.E174*|ASIC3_ENST00000297512.8_Nonsense_Mutation_p.E174*	NM_004769.3|NM_020321.3	NP_004760.1|NP_064717.1	Q9UHC3	ASIC3_HUMAN	acid-sensing (proton-gated) ion channel 3	174					cation transmembrane transport (GO:0098655)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ion transmembrane transport (GO:0034220)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|response to heat (GO:0009408)|sensory perception (GO:0007600)|sensory perception of sour taste (GO:0050915)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|enterobactin transporter activity (GO:0042931)|ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)	p.E174*(2)									TTGTGGGCCTGAGAACTTCAC	0.612																																					p.E174X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.G520T	7						.						73.0	74.0	74.0					7																	150746492		2203	4300	6503	150377425	SO:0001587	stop_gained	9311	exon1			AB010575	CCDS5914.1, CCDS5915.1, CCDS5916.1	7q35	2012-02-23	2012-02-22	2012-02-22	ENSG00000213199	ENSG00000213199		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	101	protein-coding gene	gene with protein product	"""testis sodium channel 1"""	611741	"""amiloride-sensitive cation channel 3, testis"", ""amiloride-sensitive cation channel 3"""	ACCN3		9571199, 9744806	Standard	NM_004769		Approved	TNaC1, DRASIC	uc003wio.3	Q9UHC3	OTTHUMG00000158685	ENST00000349064.5:c.520G>T	7.37:g.150746492G>T	ENSP00000344838:p.Glu174*	Somatic		Capture	Illumina HiSeq	Phase_I	150377425	NM_020321	B2R9V0|O60263|O75906|Q59FN9|Q9UER8|Q9UHC4	Nonsense_Mutation	SNP	ENST00000349064.5	37	CCDS5916.1	.	.	.	.	.	.	.	.	.	.	G	40	8.202921	0.98704	.	.	ENSG00000213199	ENST00000357922;ENST00000349064;ENST00000297512	.	.	.	5.29	5.29	0.74685	.	0.429622	0.16671	U	0.204356	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	-22.7872	16.7985	0.85608	0.0:0.0:1.0:0.0	.	.	.	.	X	174	.	ENSP00000297512:E174X	E	+	1	0	ACCN3	150377425	0.059000	0.20769	0.961000	0.40146	0.802000	0.45316	0.830000	0.27462	2.651000	0.90000	0.561000	0.74099	GAG		ASIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351725.1	NM_004769	
TRIM35	23087	broad.mit.edu	37	8	27145145	27145146	+	Frame_Shift_Ins	INS	-	-	C	rs144341265		TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr8:27145145_27145146insC	ENST00000305364.4	-	6	1486_1487	c.1403_1404insG	c.(1402-1404)ggtfs	p.G468fs		NM_171982.3	NP_741983.2	Q9UPQ4	TRI35_HUMAN	tripartite motif containing 35	468	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				apoptotic process (GO:0006915)|innate immune response (GO:0045087)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of apoptotic process (GO:0043065)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|endometrium(6)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	14		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0213)|Epithelial(17;9.34e-10)|Colorectal(74;0.141)		CGCCCCGTGCACCCCCCAGGTA	0.658																																					p.G468fs												.	.	0			c.1404_1405insG	8						.																																			27201063	SO:0001589	frameshift_variant	23087	exon6			AB029021	CCDS6056.2	8p21.2	2013-01-09	2011-01-25		ENSG00000104228	ENSG00000104228		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16285	protein-coding gene	gene with protein product			"""tripartite motif-containing 35"""			11331580, 14662771, 12692137	Standard	XM_005273451		Approved	KIAA1098, MAIR, HLS5	uc003xfl.1	Q9UPQ4	OTTHUMG00000102047	ENST00000305364.4:c.1404dupG	8.37:g.27145151_27145151dupC	ENSP00000301924:p.Gly468fs	None		Capture	Illumina HiSeq	Phase_I	27201062	NM_171982	Q86XQ0|Q8WVA4	Frame_Shift_Ins	INS	ENST00000305364.4	37	CCDS6056.2																																																																																				TRIM35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219848.2	NM_171982	
USP17L2	377630	broad.mit.edu	37	8	11994886	11994886	+	Missense_Mutation	SNP	T	T	C	rs76415856		TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr8:11994886T>C	ENST00000333796.3	-	1	1700	c.1384A>G	c.(1384-1386)Aac>Gac	p.N462D	FAM66D_ENST00000434078.2_RNA	NM_001256869.1|NM_001256871.1|NM_001256872.1|NM_001256873.1|NM_001256874.1|NM_201402.2	NP_001243798.1|NP_001243800.1|NP_001243801.1|NP_001243802.1|NP_001243803.1|NP_958804.2	Q6R6M4	U17L2_HUMAN	ubiquitin specific peptidase 17-like family member 2	462	Mediates interaction with SUDS3.			N -> D (in Ref. 1; AAR91701). {ECO:0000305}.	apoptotic process (GO:0006915)|CAAX-box protein processing (GO:0071586)|cell cycle checkpoint (GO:0000075)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of histone deacetylation (GO:0031064)|negative regulation of protein processing (GO:0010955)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of Ras GTPase activity (GO:0034261)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of RIG-I signaling pathway (GO:1900246)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of apoptotic process (GO:0042981)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of defense response to virus by host (GO:0050691)|regulation of ruffle assembly (GO:1900027)|ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.N462D(1)		central_nervous_system(1)|kidney(1)|large_intestine(11)|liver(1)|lung(8)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	29						ACAAGTACGTTGGGAGGCAGG	0.478																																					p.N462D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1384G	8						.						60.0	65.0	63.0					8																	11994886		1363	2982	4345	12032295	SO:0001583	missense	377630	exon1			BC156290	CCDS43713.1	8p23.1	2012-10-09	2012-10-09		ENSG00000223443	ENSG00000223443			34434	protein-coding gene	gene with protein product	"""deubiquitinating enzyme 3"""	610186	"""ubiquitin specific peptidase 17-like 2"""				Standard	NM_201402		Approved	DUB3	uc003wvc.1	Q6R6M4	OTTHUMG00000165295	ENST00000333796.3:c.1384A>G	8.37:g.11994886T>C	ENSP00000333329:p.Asn462Asp	Somatic		Capture	Illumina HiSeq	Phase_I	12032295	NM_201402		Missense_Mutation	SNP	ENST00000333796.3	37	CCDS43713.1	.	.	.	.	.	.	.	.	.	.	T	0.010	-1.771641	0.00645	.	.	ENSG00000223443	ENST00000333796	T	0.09911	2.93	0.745	0.745	0.18359	.	1.332320	0.05841	N	0.619344	T	0.04815	0.0130	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.42616	-0.9441	10	0.12430	T	0.62	.	3.8607	0.08994	0.0:0.0:0.0:1.0	.	462	Q6R6M4	U17L2_HUMAN	D	462	ENSP00000333329:N462D	ENSP00000333329:N462D	N	-	1	0	USP17L2	12032295	0.016000	0.18221	0.014000	0.15608	0.017000	0.09413	-0.271000	0.08572	0.611000	0.30052	0.386000	0.25728	AAC		USP17L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383303.2	NM_201402	
PHF20L1	51105	broad.mit.edu	37	8	133854967	133854967	+	Silent	SNP	G	G	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr8:133854967G>A	ENST00000395386.2	+	19	2894	c.2595G>A	c.(2593-2595)aaG>aaA	p.K865K	AF230666.2_ENST00000608375.1_RNA|AF230666.2_ENST00000429151.1_RNA|PHF20L1_ENST00000395390.2_Silent_p.K840K|PHF20L1_ENST00000220847.7_Silent_p.K252K	NM_016018.4	NP_057102.4	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1	865							zinc ion binding (GO:0008270)	p.K839K(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(10)|ovary(2)	15	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			GCTATCAAAAGCCACAAAGTT	0.393																																					p.K865K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2595A	8						.						80.0	76.0	77.0					8																	133854967		1863	4111	5974	133924149	SO:0001819	synonymous_variant	51105	exon19			AF230666	CCDS6367.2, CCDS6368.1, CCDS75791.1	8q24.22	2014-03-24			ENSG00000129292	ENSG00000129292		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24280	protein-coding gene	gene with protein product	"""tudor domain containing 20B"""					10810093, 24492612	Standard	NM_016018		Approved	CGI-72, FLJ13649, MGC64923, FLJ21615, TDRD20B	uc003ytt.3	A8MW92	OTTHUMG00000148656	ENST00000395386.2:c.2595G>A	8.37:g.133854967G>A		Somatic		Capture	Illumina HiSeq	Phase_I	133924149	NM_016018	A8MZC9|Q86U89|Q86W43|Q96BT0|Q9H702|Q9HBK3|Q9NYR3|Q9Y381	Silent	SNP	ENST00000395386.2	37	CCDS6367.2																																																																																				PHF20L1-008	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308949.3	NM_016018	
TG	7038	broad.mit.edu	37	8	133899131	133899131	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr8:133899131G>A	ENST00000220616.4	+	9	1554	c.1514G>A	c.(1513-1515)gGt>gAt	p.G505D	TG_ENST00000377869.1_Missense_Mutation_p.G505D	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	505					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		CAGCAACTTGGTCTTGCAAGC	0.448																																					p.G505D												.	.	0			c.G1514A	8						.						55.0	58.0	57.0					8																	133899131		2203	4300	6503	133968313	SO:0001583	missense	7038	exon9			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.1514G>A	8.37:g.133899131G>A	ENSP00000220616:p.Gly505Asp	None		Capture	Illumina HiSeq	Phase_I	133968313	NM_003235	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	ENST00000220616.4	37	CCDS34944.1	.	.	.	.	.	.	.	.	.	.	G	15.03	2.712563	0.48517	.	.	ENSG00000042832	ENST00000377869;ENST00000220616;ENST00000535932	T;T	0.64991	-0.13;-0.12	5.29	5.29	0.74685	.	0.476071	0.21087	N	0.080391	T	0.61464	0.2349	M	0.62723	1.935	0.41859	D	0.990214	P	0.38992	0.653	B	0.37047	0.24	T	0.65512	-0.6150	10	0.49607	T	0.09	.	16.4644	0.84074	0.0:0.0:1.0:0.0	.	505	P01266	THYG_HUMAN	D	505	ENSP00000367100:G505D;ENSP00000220616:G505D	ENSP00000220616:G505D	G	+	2	0	TG	133968313	1.000000	0.71417	0.899000	0.35326	0.745000	0.42441	4.223000	0.58587	2.752000	0.94435	0.557000	0.71058	GGT		TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235	
COL22A1	169044	broad.mit.edu	37	8	139606310	139606310	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr8:139606310C>T	ENST00000303045.6	-	63	5011	c.4565G>A	c.(4564-4566)cGt>cAt	p.R1522H	COL22A1_ENST00000435777.1_Missense_Mutation_p.R1502H|COL22A1_ENST00000341807.4_5'UTR	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1522	Collagen-like 15.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.R1522H(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CTGCCCAGGACGACCTGGCTC	0.652										HNSCC(7;0.00092)																											p.R1522H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4565A	8						.						31.0	34.0	33.0					8																	139606310		2203	4300	6503	139675492	SO:0001583	missense	169044	exon63			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.4565G>A	8.37:g.139606310C>T	ENSP00000303153:p.Arg1522His	Somatic		Capture	Illumina HiSeq	Phase_I	139675492	NM_152888	B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	37	CCDS6376.1	.	.	.	.	.	.	.	.	.	.	C	16.93	3.258527	0.59321	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.93712	-3.27;-3.27	5.92	4.12	0.48240	.	0.145061	0.30879	N	0.008697	D	0.88411	0.6429	L	0.28192	0.835	0.27155	N	0.9613	P;P	0.48694	0.824;0.914	P;B	0.49502	0.613;0.413	T	0.79729	-0.1681	10	0.13853	T	0.58	.	6.7033	0.23236	0.1435:0.71:0.0:0.1464	.	1502;1522	Q8NFW1-2;Q8NFW1	.;COMA1_HUMAN	H	1522;1502;1215	ENSP00000303153:R1522H;ENSP00000387655:R1502H	ENSP00000303153:R1522H	R	-	2	0	COL22A1	139675492	0.000000	0.05858	0.640000	0.29408	0.897000	0.52465	1.050000	0.30404	1.523000	0.49018	0.650000	0.86243	CGT		COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
NEIL2	252969	broad.mit.edu	37	8	11643500	11643500	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr8:11643500delC	ENST00000284503.6	+	5	1316	c.717delC	c.(715-717)tacfs	p.Y239fs	NEIL2_ENST00000528323.1_Frame_Shift_Del_p.Y123fs|NEIL2_ENST00000455213.2_Frame_Shift_Del_p.Y239fs|NEIL2_ENST00000403422.3_Frame_Shift_Del_p.Y178fs|NEIL2_ENST00000436750.3_Frame_Shift_Del_p.Y239fs	NM_145043.2	NP_659480.1	Q969S2	NEIL2_HUMAN	nei endonuclease VIII-like 2 (E. coli)	239					base-excision repair (GO:0006284)|nucleotide-excision repair (GO:0006289)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	damaged DNA binding (GO:0003684)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	10	all_epithelial(15;0.103)		STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.166)		AAGCCTTGTACAGAGCTGGGA	0.522								Base excision repair (BER), DNA glycosylases																													p.Y123X												.	.	0			c.369delC	8						.						192.0	207.0	202.0					8																	11643500		2203	4300	6503	11680909	SO:0001589	frameshift_variant	252969	exon5			AK056206	CCDS5984.1, CCDS47802.1, CCDS47803.1	8p23.1	2010-04-27	2010-04-27		ENSG00000154328	ENSG00000154328			18956	protein-coding gene	gene with protein product		608933	"""nei like 2 (E. coli)"""			12097317, 17686777	Standard	NM_145043		Approved	NEH2, FLJ31644, MGC2832, MGC4505	uc003wue.2	Q969S2	OTTHUMG00000090753	ENST00000284503.6:c.717delC	8.37:g.11643500delC	ENSP00000284503:p.Tyr239fs	None		Capture	Illumina HiSeq	Phase_I	11680909	NM_001135748	B4DFR7|Q7Z3Q7|Q8N842|Q8NG52	Frame_Shift_Del	DEL	ENST00000284503.6	37	CCDS5984.1																																																																																				NEIL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207583.3	NM_145043	
WWP1	11059	broad.mit.edu	37	8	87450899	87450899	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr8:87450899C>T	ENST00000517970.1	+	17	2142	c.1835C>T	c.(1834-1836)gCg>gTg	p.A612V	WWP1_ENST00000265428.4_Missense_Mutation_p.A612V|WWP1_ENST00000349423.2_Missense_Mutation_p.A394V|WWP1_ENST00000341922.2_Missense_Mutation_p.A482V	NM_007013.3	NP_008944.1	Q9H0M0	WWP1_HUMAN	WW domain containing E3 ubiquitin protein ligase 1	612	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				central nervous system development (GO:0007417)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.A612V(1)		endometrium(3)|kidney(2)|large_intestine(9)|liver(4)|lung(10)|prostate(2)|urinary_tract(1)	31						GGTGGCCTAGCGAGGTAAAAT	0.303																																					p.A612V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1835T	8						.						71.0	72.0	72.0					8																	87450899		2203	4298	6501	87520015	SO:0001583	missense	11059	exon17			AY043361	CCDS6242.1	8q21.3	2013-07-22			ENSG00000123124	ENSG00000123124			17004	protein-coding gene	gene with protein product		602307				9169421, 9647693	Standard	NM_007013		Approved	AIP5, DKFZP434D2111	uc003ydt.3	Q9H0M0	OTTHUMG00000163690	ENST00000517970.1:c.1835C>T	8.37:g.87450899C>T	ENSP00000427793:p.Ala612Val	Somatic		Capture	Illumina HiSeq	Phase_I	87520015	NM_007013	O00307|Q5YLC1|Q96BP4	Missense_Mutation	SNP	ENST00000517970.1	37	CCDS6242.1	.	.	.	.	.	.	.	.	.	.	C	32	5.121118	0.94385	.	.	ENSG00000123124	ENST00000517970;ENST00000265428;ENST00000341922;ENST00000349423	T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03	5.0	5.0	0.66597	HECT (3);	0.000000	0.85682	D	0.000000	D	0.88085	0.6342	M	0.74467	2.265	0.80722	D	1	D;D	0.89917	0.979;1.0	P;D	0.78314	0.474;0.991	D	0.89475	0.3746	10	0.87932	D	0	.	18.6585	0.91463	0.0:1.0:0.0:0.0	.	394;612	Q9H0M0-6;Q9H0M0	.;WWP1_HUMAN	V	612;612;482;394	ENSP00000427793:A612V;ENSP00000265428:A612V;ENSP00000340564:A482V;ENSP00000342665:A394V	ENSP00000265428:A612V	A	+	2	0	WWP1	87520015	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.432000	0.80349	2.463000	0.83235	0.650000	0.86243	GCG		WWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374755.1	NM_007013	
DCAF4L2	138009	broad.mit.edu	37	8	88885206	88885206	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr8:88885206C>T	ENST00000319675.3	-	1	1090	c.994G>A	c.(994-996)Gtg>Atg	p.V332M		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	332								p.V332M(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						TCCTGGCCCACGGCCGCCACG	0.567																																					p.V332M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G994A	8						.						76.0	81.0	79.0					8																	88885206		2203	4300	6503	88954322	SO:0001583	missense	138009	exon1			AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.994G>A	8.37:g.88885206C>T	ENSP00000316496:p.Val332Met	Somatic		Capture	Illumina HiSeq	Phase_I	88954322	NM_152418		Missense_Mutation	SNP	ENST00000319675.3	37	CCDS6245.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.256728	0.80246	.	.	ENSG00000176566	ENST00000319675	T	0.58652	0.32	1.49	1.49	0.22878	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.71256	0.3318	M	0.76838	2.35	0.40378	D	0.979411	D	0.89917	1.0	D	0.91635	0.999	T	0.72181	-0.4368	10	0.59425	D	0.04	.	8.5134	0.33231	0.0:1.0:0.0:0.0	.	332	Q8NA75	DC4L2_HUMAN	M	332	ENSP00000316496:V332M	ENSP00000316496:V332M	V	-	1	0	DCAF4L2	88954322	1.000000	0.71417	0.494000	0.27515	0.718000	0.41266	4.894000	0.63206	0.809000	0.34255	0.467000	0.42956	GTG		DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375302.1	NM_152418	
CYC1	1537	broad.mit.edu	37	8	145151348	145151348	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr8:145151348G>A	ENST00000318911.4	+	4	635	c.562G>A	c.(562-564)Gcc>Acc	p.A188T		NM_001916.3	NP_001907	P08574	CY1_HUMAN	cytochrome c-1	188	Cytochrome c.				cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|response to glucagon (GO:0033762)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|respiratory chain (GO:0070469)	electron transporter, transferring electrons from CoQH2-cytochrome c reductase complex and cytochrome c oxidase complex activity (GO:0045155)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.A188T(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(2)	15	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;8.71e-40)|all cancers(56;3e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TGCTCGAGCTGCCAACAACGG	0.587											OREG0019052	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A188T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G562A	8						.						119.0	115.0	116.0					8																	145151348		2203	4300	6503	145223336	SO:0001583	missense	1537	exon4			BC001006	CCDS6415.1	8q24	2011-07-04			ENSG00000179091	ENSG00000179091		"""Mitochondrial respiratory chain complex / Complex III"""	2579	protein-coding gene	gene with protein product		123980					Standard	NM_001916		Approved	UQCR4	uc003zaz.4	P08574	OTTHUMG00000165242	ENST00000318911.4:c.562G>A	8.37:g.145151348G>A	ENSP00000317159:p.Ala188Thr	Somatic	1692	Capture	Illumina HiSeq	Phase_I	145223336	NM_001916	Q5U062|Q6FHS7	Missense_Mutation	SNP	ENST00000318911.4	37	CCDS6415.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.908602	0.92107	.	.	ENSG00000179091	ENST00000318911	T	0.50001	0.76	4.58	4.58	0.56647	Cytochrome c domain (2);	0.000000	0.85682	D	0.000000	T	0.72740	0.3498	H	0.95950	3.745	0.80722	D	1	D	0.57257	0.979	P	0.56434	0.798	T	0.81908	-0.0717	10	0.87932	D	0	-19.0955	12.7536	0.57321	0.0:0.0:1.0:0.0	.	188	P08574	CY1_HUMAN	T	188	ENSP00000317159:A188T	ENSP00000317159:A188T	A	+	1	0	CYC1	145223336	1.000000	0.71417	0.908000	0.35775	0.524000	0.34500	6.952000	0.75989	2.384000	0.81235	0.561000	0.74099	GCC		CYC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382895.1	NM_001916	
TMEM215	401498	broad.mit.edu	37	9	32784389	32784389	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr9:32784389C>A	ENST00000342743.5	+	2	573	c.208C>A	c.(208-210)Cca>Aca	p.P70T		NM_212558.2	NP_997723.2	Q68D42	TM215_HUMAN	transmembrane protein 215	70						integral component of membrane (GO:0016021)		p.P70T(1)		endometrium(4)|kidney(1)|large_intestine(3)|lung(2)|prostate(2)	12						CACCAAGTGGCCAGAGAACGA	0.592																																					p.P70T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C208A	9						.						88.0	77.0	81.0					9																	32784389		2203	4300	6503	32774389	SO:0001583	missense	401498	exon2				CCDS6530.1	9p21.1	2008-08-08			ENSG00000188133	ENSG00000188133			33816	protein-coding gene	gene with protein product							Standard	NM_212558		Approved		uc003zri.4	Q68D42	OTTHUMG00000129521	ENST00000342743.5:c.208C>A	9.37:g.32784389C>A	ENSP00000345468:p.Pro70Thr	Somatic		Capture	Illumina HiSeq	Phase_I	32774389	NM_212558	Q6ZUU2	Missense_Mutation	SNP	ENST00000342743.5	37	CCDS6530.1	.	.	.	.	.	.	.	.	.	.	C	9.667	1.145705	0.21288	.	.	ENSG00000188133	ENST00000342743	.	.	.	5.18	5.18	0.71444	.	0.000000	0.64402	D	0.000001	T	0.65739	0.2720	L	0.27053	0.805	0.54753	D	0.999989	D	0.89917	1.0	D	0.87578	0.998	T	0.70055	-0.4977	9	0.87932	D	0	-11.9317	16.1743	0.81842	0.0:1.0:0.0:0.0	.	70	Q68D42	TM215_HUMAN	T	70	.	ENSP00000345468:P70T	P	+	1	0	TMEM215	32774389	1.000000	0.71417	0.997000	0.53966	0.098000	0.18820	5.731000	0.68554	2.413000	0.81919	0.561000	0.74099	CCA		TMEM215-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251701.1	NM_212558	
RPP25L	138716	broad.mit.edu	37	9	34610866	34610866	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr9:34610866C>T	ENST00000297613.4	-	2	708	c.428G>A	c.(427-429)gGt>gAt	p.G143D	RPP25L_ENST00000378959.4_Missense_Mutation_p.G143D|DCTN3_ENST00000479399.1_5'Flank	NM_148179.2	NP_680545.1	Q8N5L8	RP25L_HUMAN	ribonuclease P/MRP 25kDa subunit-like	143						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.G143D(1)									GGGCATGGAACCCAGGCCAGG	0.657																																					p.G143D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G428A	9						.						42.0	49.0	47.0					9																	34610866		2203	4299	6502	34600866	SO:0001583	missense	138716	exon2			BC032136	CCDS6559.1	9p11.2	2012-03-06	2012-03-06	2012-03-06	ENSG00000164967	ENSG00000164967			19909	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 23"""	C9orf23		16998185	Standard	NM_148178		Approved	bA296L22.5, MGC29635	uc003zuv.3	Q8N5L8	OTTHUMG00000000443	ENST00000297613.4:c.428G>A	9.37:g.34610866C>T	ENSP00000297613:p.Gly143Asp	Somatic		Capture	Illumina HiSeq	Phase_I	34600866	NM_148178	D3DRM5	Missense_Mutation	SNP	ENST00000297613.4	37	CCDS6559.1	.	.	.	.	.	.	.	.	.	.	C	13.28	2.190132	0.38707	.	.	ENSG00000164967	ENST00000378959;ENST00000297613	.	.	.	3.86	3.86	0.44501	.	0.121144	0.64402	D	0.000013	T	0.35451	0.0932	N	0.02011	-0.69	0.39036	D	0.960034	D	0.76494	0.999	D	0.68621	0.959	T	0.25537	-1.0129	9	0.13108	T	0.6	-13.3003	11.6319	0.51181	0.0:1.0:0.0:0.0	.	143	Q8N5L8	CI023_HUMAN	D	143	.	ENSP00000297613:G143D	G	-	2	0	C9orf23	34600866	0.892000	0.30473	0.978000	0.43139	0.881000	0.50899	5.064000	0.64338	2.448000	0.82819	0.643000	0.83706	GGT		RPP25L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001130.1	NM_148179	
FBXO10	26267	broad.mit.edu	37	9	37537815	37537815	+	Silent	SNP	G	G	A	rs371415820		TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chr9:37537815G>A	ENST00000432825.2	-	3	759	c.711C>T	c.(709-711)aaC>aaT	p.N237N	FBXO10_ENST00000543968.1_5'Flank|FBXO10_ENST00000541829.1_Intron|RP11-613M10.8_ENST00000544475.1_5'UTR	NM_012166.2	NP_036298.2	Q9UK96	FBX10_HUMAN	F-box protein 10	237					apoptotic process (GO:0006915)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.N237N(1)		breast(1)|endometrium(5)|large_intestine(11)|lung(15)|prostate(1)|upper_aerodigestive_tract(1)	34				GBM - Glioblastoma multiforme(29;0.0107)		ACAGGGGCACGTTGTGCAGGA	0.498																																					p.N237N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C711T	9						.	G		1,3901		0,1,1950	71.0	72.0	72.0		711	-6.9	0.9	9		72	0,8272		0,0,4136	no	coding-synonymous	FBXO10	NM_012166.2		0,1,6086	AA,AG,GG		0.0,0.0256,0.0082		237/957	37537815	1,12173	1951	4136	6087	37527815	SO:0001819	synonymous_variant	26267	exon3			AF174598	CCDS47966.1	9p13.1	2014-01-29	2004-06-15		ENSG00000147912	ENSG00000147912		"""F-boxes /  ""other"""""	13589	protein-coding gene	gene with protein product		609092	"""F-box only protein 10"""			10531035, 10531037, 19300908	Standard	NM_012166		Approved	FBX10	uc004aab.3	Q9UK96	OTTHUMG00000019926	ENST00000432825.2:c.711C>T	9.37:g.37537815G>A		Somatic		Capture	Illumina HiSeq	Phase_I	37527815	NM_012166	Q08AL3|Q08AL4|Q5JRT8|Q9UKC3	Silent	SNP	ENST00000432825.2	37	CCDS47966.1																																																																																				FBXO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052472.3		
CLCN4	1183	broad.mit.edu	37	X	10188915	10188915	+	Silent	SNP	C	C	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chrX:10188915C>T	ENST00000380833.4	+	12	2581	c.2190C>T	c.(2188-2190)agC>agT	p.S730S	CLCN4_ENST00000421085.2_Silent_p.S636S|CLCN4_ENST00000380829.1_Silent_p.S699S	NM_001256944.1|NM_001830.3	NP_001243873.1|NP_001821.2	P51793	CLCN4_HUMAN	chloride channel, voltage-sensitive 4	730	CBS 2. {ECO:0000255|PROSITE- ProRule:PRU00703}.				chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)	p.S730S(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(11)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						TGACGCGGAGCGGGTGAGTAG	0.562																																					p.S730S	Melanoma(74;1050 1296 1576 30544 38374)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2190T	X						.						70.0	61.0	64.0					X																	10188915		2203	4300	6503	10148915	SO:0001819	synonymous_variant	1183	exon12			X77197	CCDS14137.1, CCDS59159.1	Xp22.3	2012-09-26	2012-02-23		ENSG00000073464	ENSG00000073464		"""Ion channels / Chloride channels : Voltage-sensitive"""	2022	protein-coding gene	gene with protein product		302910	"""chloride channel 4"""			8069296	Standard	NM_001830		Approved	CLC4, ClC-4	uc004csy.4	P51793	OTTHUMG00000021125	ENST00000380833.4:c.2190C>T	X.37:g.10188915C>T		Somatic		Capture	Illumina HiSeq	Phase_I	10148915	NM_001830	A1L3U1|B7Z5Z4|Q9UBU1	Silent	SNP	ENST00000380833.4	37	CCDS14137.1																																																																																				CLCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055730.1		
PLCXD1	55344	broad.mit.edu	37	X	205423	205423	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chrX:205423T>G	ENST00000381657.2	+	3	665	c.151T>G	c.(151-153)Tgc>Ggc	p.C51G	PLCXD1_ENST00000381663.3_Missense_Mutation_p.C51G|PLCXD1_ENST00000484611.2_3'UTR|PLCXD1_ENST00000399012.1_Missense_Mutation_p.C51G	NM_018390.3	NP_060860.1	Q9NUJ7	PLCX1_HUMAN	phosphatidylinositol-specific phospholipase C, X domain containing 1	51	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				lipid metabolic process (GO:0006629)		phosphoric diester hydrolase activity (GO:0008081)	p.C51G(1)		endometrium(3)|large_intestine(1)|lung(7)	11		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GATGACGTACTGCCTGAACAA	0.622																																					p.C51G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T151G	X						.						352.0	274.0	301.0					X																	205423		2203	4296	6499	145423	SO:0001583	missense	55344	exon3			AK002185	CCDS14103.1	Xp22.33 and Yp11.32	2010-07-28			ENSG00000182378	ENSG00000182378		"""Pseudoautosomal regions / PAR1"""	23148	protein-coding gene	gene with protein product							Standard	NM_018390		Approved	FLJ11323	uc004cpc.3	Q9NUJ7	OTTHUMG00000022693	ENST00000381657.2:c.151T>G	X.37:g.205423T>G	ENSP00000371073:p.Cys51Gly	Somatic		Capture	Illumina HiSeq	Phase_I	145423	NM_018390	A2BH51|A2BH52	Missense_Mutation	SNP	ENST00000381657.2	37	CCDS14103.1	.	.	.	.	.	.	.	.	.	.	.	3.703	-0.061107	0.07317	.	.	ENSG00000182378	ENST00000399012;ENST00000430923;ENST00000445062;ENST00000381657;ENST00000429181;ENST00000381663;ENST00000443019;ENST00000415337;ENST00000447472;ENST00000448477	.	.	.	1.79	0.301	0.15781	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (1);	0.048662	0.85682	D	0.000000	T	0.48021	0.1477	.	.	.	0.09310	N	1	D	0.89917	1.0	D	0.78314	0.991	T	0.38373	-0.9664	8	0.25106	T	0.35	-36.8575	3.9249	0.09259	0.324:0.0:0.0:0.676	.	51	Q9NUJ7	PLCX1_HUMAN	G	51	.	ENSP00000371073:C51G	C	+	1	0	PLCXD1	145423	1.000000	0.71417	0.229000	0.23960	0.677000	0.39632	4.298000	0.59067	-0.362000	0.08113	0.320000	0.21374	TGC		PLCXD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058879.2	NM_018390	
SH2D1A	4068	broad.mit.edu	37	X	123480594	123480594	+	Silent	SNP	C	C	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chrX:123480594C>T	ENST00000371139.4	+	1	401	c.102C>T	c.(100-102)agC>agT	p.S34S	SH2D1A_ENST00000477673.2_Silent_p.S34S|SH2D1A_ENST00000491950.1_3'UTR|SH2D1A_ENST00000360027.4_Silent_p.S34S|STAG2_ENST00000469481.1_Intron	NM_001114937.2|NM_002351.4	NP_001108409.1|NP_002342.1	O60880	SH21A_HUMAN	SH2 domain containing 1A	34	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|humoral immune response (GO:0006959)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)	SH3/SH2 adaptor activity (GO:0005070)	p.S34S(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	10						TGAGGGACAGCGAGAGCGTGC	0.602																																					p.S34S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C102T	X						.						158.0	118.0	131.0					X																	123480594		2203	4300	6503	123308275	SO:0001819	synonymous_variant	4068	exon1			AL023657	CCDS14608.1, CCDS48162.1	Xq25	2014-09-17	2010-04-21		ENSG00000183918	ENSG00000183918		"""SH2 domain containing"""	10820	protein-coding gene	gene with protein product	"""Duncan's disease"""	300490	"""lymphoproliferative syndrome"", ""SH2 domain protein 1A"""	IMD5, LYP		9771704, 9774102	Standard	NM_001114937		Approved	XLP, MTCP1, DSHP, XLPD, EBVS, SAP	uc004euf.4	O60880	OTTHUMG00000022344	ENST00000371139.4:c.102C>T	X.37:g.123480594C>T		Somatic		Capture	Illumina HiSeq	Phase_I	123308275	NM_001114937	A8MSW0|O95383|O95384|O95385|O95386|Q6FGS6|Q9UNR0	Silent	SNP	ENST00000371139.4	37	CCDS14608.1																																																																																				SH2D1A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058174.1	NM_002351	
GABRQ	55879	broad.mit.edu	37	X	151821392	151821392	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chrX:151821392G>C	ENST00000370306.2	+	9	1567	c.1547G>C	c.(1546-1548)gGg>gCg	p.G516A		NM_018558.2	NP_061028.3	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) A receptor, theta	516					neurotransmitter transport (GO:0006836)|signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|neurotransmitter transporter activity (GO:0005326)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(9)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	52	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GGCCCCAGTGGGAAGCCCATG	0.557																																					p.G516A												.	.	0			c.G1547C	X						.						80.0	68.0	72.0					X																	151821392		2203	4300	6503	151572048	SO:0001583	missense	55879	exon9			U47334	CCDS14707.1	Xq28	2012-06-22	2012-02-03		ENSG00000147402	ENSG00000268089		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	14454	protein-coding gene	gene with protein product	"""GABA(A) receptor, theta"""	300349	"""gamma-aminobutyric acid (GABA) receptor, theta"""			10804200, 10449790	Standard	NM_018558		Approved	THETA	uc004ffp.1	Q9UN88	OTTHUMG00000022649	ENST00000370306.2:c.1547G>C	X.37:g.151821392G>C	ENSP00000359329:p.Gly516Ala	None		Capture	Illumina HiSeq	Phase_I	151572048	NM_018558	A6NFN1|Q32MB4|Q9NZK8	Missense_Mutation	SNP	ENST00000370306.2	37	CCDS14707.1	.	.	.	.	.	.	.	.	.	.	G	11.47	1.647850	0.29336	.	.	ENSG00000147402	ENST00000370306	D	0.85484	-1.99	4.56	1.85	0.25348	Neurotransmitter-gated ion-channel transmembrane domain (2);	.	.	.	.	T	0.78710	0.4326	L	0.43152	1.355	0.09310	N	1	B	0.29481	0.245	B	0.31946	0.138	T	0.69087	-0.5238	9	0.87932	D	0	.	5.7426	0.18102	0.3464:0.0:0.6536:0.0	.	516	Q9UN88	GBRT_HUMAN	A	516	ENSP00000359329:G516A	ENSP00000359329:G516A	G	+	2	0	GABRQ	151572048	0.008000	0.16893	0.000000	0.03702	0.119000	0.20118	0.258000	0.18387	0.264000	0.21851	0.529000	0.55759	GGG		GABRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058763.2	NM_018558	
NLGN4X	57502	broad.mit.edu	37	X	5821546	5821546	+	Silent	SNP	C	C	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chrX:5821546C>T	ENST00000381095.3	-	5	1800	c.1173G>A	c.(1171-1173)acG>acA	p.T391T	NLGN4X_ENST00000538097.1_Silent_p.T391T|NLGN4X_ENST00000381092.1_Silent_p.T391T|NLGN4X_ENST00000275857.6_Silent_p.T391T|NLGN4X_ENST00000381093.2_Silent_p.T411T	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	391					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)	p.T391T(1)		breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						AGTCGTTGGGCGTCACACCGT	0.532																																					p.T391T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1173A	X						.						10.0	10.0	10.0					X																	5821546		2166	4204	6370	5831546	SO:0001819	synonymous_variant	57502	exon5			AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.1173G>A	X.37:g.5821546C>T		Somatic		Capture	Illumina HiSeq	Phase_I	5831546	NM_020742	Q6UX10|Q9ULG0	Silent	SNP	ENST00000381095.3	37	CCDS14126.1																																																																																				NLGN4X-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055673.1	NM_020742	
DMD	1756	broad.mit.edu	37	X	31496310	31496310	+	Silent	SNP	C	C	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chrX:31496310C>T	ENST00000357033.4	-	59	9056	c.8850G>A	c.(8848-8850)ctG>ctA	p.L2950L	DMD_ENST00000378707.3_Silent_p.L490L|DMD_ENST00000378677.2_Silent_p.L2946L|DMD_ENST00000541735.1_Silent_p.L490L|DMD_ENST00000343523.2_Silent_p.L490L|DMD_ENST00000359836.1_Silent_p.L490L|DMD_ENST00000445312.1_5'Flank|DMD_ENST00000474231.1_Silent_p.L490L	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2950					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.L490L(1)|p.L2945L(1)|p.L2946L(1)|p.L1609L(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CAGCTTGGCGCAGCTTGAGGT	0.532																																					p.L490L												.	.	4	Substitution - coding silent(4)	large_intestine(4)	c.G1470A	X						.						65.0	52.0	56.0					X																	31496310		2202	4300	6502	31406231	SO:0001819	synonymous_variant	1756	exon16			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.8850G>A	X.37:g.31496310C>T		Somatic		Capture	Illumina HiSeq	Phase_I	31406231	NM_004021	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Silent	SNP	ENST00000357033.4	37	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	C	7.449	0.642308	0.14451	.	.	ENSG00000198947	ENST00000465285	.	.	.	5.4	-6.46	0.01908	.	.	.	.	.	T	0.46698	0.1406	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47471	-0.9115	4	.	.	.	.	6.686	0.23146	0.0777:0.3893:0.0764:0.4567	.	.	.	.	T	679	.	.	A	-	1	0	DMD	31406231	0.011000	0.17503	0.478000	0.27316	0.996000	0.88848	-0.983000	0.03759	-1.749000	0.01330	0.529000	0.55759	GCG		DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
FOXO4	4303	broad.mit.edu	37	X	70320753	70320753	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chrX:70320753G>A	ENST00000374259.3	+	2	1005	c.673G>A	c.(673-675)Ggt>Agt	p.G225S	FOXO4_ENST00000341558.3_Missense_Mutation_p.G170S	NM_001170931.1|NM_005938.3	NP_001164402.1|NP_005929.2	P98177	FOXO4_HUMAN	forkhead box O4	225					cell cycle arrest (GO:0007050)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|mitotic G2 DNA damage checkpoint (GO:0007095)|muscle organ development (GO:0007517)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of smooth muscle cell differentiation (GO:0051151)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|stem cell differentiation (GO:0048863)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.G225S(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(1)	18	Renal(35;0.156)					TCCACCCGAAGGTGCCACTCC	0.632											OREG0019856	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G170S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G508A	X						.						24.0	25.0	24.0					X																	70320753		1973	4144	6117	70237478	SO:0001583	missense	4303	exon3				CCDS43969.1, CCDS55440.1	Xq13.1	2008-02-05	2007-05-02	2007-05-02	ENSG00000184481	ENSG00000184481		"""Forkhead boxes"""	7139	protein-coding gene	gene with protein product		300033	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 7"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 7"""	MLLT7		7529552	Standard	NM_005938		Approved	AFX1	uc004dys.2	P98177	OTTHUMG00000021789	ENST00000374259.3:c.673G>A	X.37:g.70320753G>A	ENSP00000363377:p.Gly225Ser	Somatic	1121	Capture	Illumina HiSeq	Phase_I	70237478	NM_001170931	B7WPJ7|O43821|Q13720|Q3KPF1|Q8TDK9	Missense_Mutation	SNP	ENST00000374259.3	37	CCDS43969.1	.	.	.	.	.	.	.	.	.	.	G	9.877	1.200470	0.22121	.	.	ENSG00000184481	ENST00000374259;ENST00000341558	D;D	0.95554	-3.53;-3.74	5.11	5.11	0.69529	.	0.270733	0.34002	N	0.004341	D	0.87692	0.6241	N	0.04508	-0.205	0.58432	D	0.999998	B;P;B	0.41673	0.416;0.759;0.0	B;B;B	0.34652	0.064;0.187;0.005	D	0.89238	0.3582	10	0.39692	T	0.17	-19.2827	16.6203	0.84928	0.0:0.0:1.0:0.0	.	225;170;225	B4DTB6;P98177-2;P98177	.;.;FOXO4_HUMAN	S	225;170	ENSP00000363377:G225S;ENSP00000342209:G170S	ENSP00000342209:G170S	G	+	1	0	FOXO4	70237478	1.000000	0.71417	0.998000	0.56505	0.133000	0.20885	6.255000	0.72466	2.387000	0.81309	0.519000	0.50382	GGT		FOXO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057115.1	NM_005938	
KIAA2022	340533	broad.mit.edu	37	X	73961847	73961847	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chrX:73961847C>T	ENST00000055682.6	-	3	3156	c.2545G>A	c.(2545-2547)Gaa>Aaa	p.E849K		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	849					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)	p.E849K(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						AATGATTTTTCGGTTTGAGTG	0.453																																					p.E849K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2545A	X						.						128.0	92.0	104.0					X																	73961847		2203	4300	6503	73878572	SO:0001583	missense	340533	exon3				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.2545G>A	X.37:g.73961847C>T	ENSP00000055682:p.Glu849Lys	Somatic		Capture	Illumina HiSeq	Phase_I	73878572	NM_001008537	A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	ENST00000055682.6	37	CCDS35337.1	.	.	.	.	.	.	.	.	.	.	C	15.86	2.958123	0.53400	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.37584	1.19;1.19	5.26	4.4	0.53042	.	0.160935	0.53938	D	0.000051	T	0.23649	0.0572	N	0.25647	0.755	0.50813	D	0.999893	B	0.31640	0.333	B	0.22880	0.042	T	0.03077	-1.1075	10	0.27785	T	0.31	-15.8358	13.0644	0.59025	0.0:0.9204:0.0:0.0796	.	849	Q5QGS0	K2022_HUMAN	K	849	ENSP00000362567:E849K;ENSP00000055682:E849K	ENSP00000055682:E849K	E	-	1	0	KIAA2022	73878572	1.000000	0.71417	0.896000	0.35187	0.916000	0.54674	5.731000	0.68554	1.006000	0.39211	0.529000	0.55759	GAA		KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2	NM_001008537	
L1CAM	3897	broad.mit.edu	37	X	153136382	153136382	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A02W-01A-01W-A00E-09	TCGA-AA-A02W-10A-01W-A00E-09	g.chrX:153136382G>A	ENST00000370060.1	-	7	746	c.557C>T	c.(556-558)aCg>aTg	p.T186M	L1CAM_ENST00000538883.1_Missense_Mutation_p.T188M|L1CAM_ENST00000361699.4_Missense_Mutation_p.T186M|L1CAM_ENST00000370055.1_Missense_Mutation_p.T181M|L1CAM_ENST00000543994.1_Missense_Mutation_p.T188M|L1CAM_ENST00000361981.3_Missense_Mutation_p.T181M|L1CAM_ENST00000370057.3_Missense_Mutation_p.T186M	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	186	Ig-like C2-type 2.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)	p.T186M(2)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CTGGCCCATCGTCACCCGCTC	0.607																																					p.T181M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C542T	X						.						227.0	156.0	180.0					X																	153136382		2203	4300	6503	152789576	SO:0001583	missense	3897	exon5			M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.557C>T	X.37:g.153136382G>A	ENSP00000359077:p.Thr186Met	Somatic		Capture	Illumina HiSeq	Phase_I	152789576	NM_001143963	A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Missense_Mutation	SNP	ENST00000370060.1	37	CCDS14733.1	.	.	.	.	.	.	.	.	.	.	G	13.42	2.233009	0.39498	.	.	ENSG00000198910	ENST00000370060;ENST00000543994;ENST00000370057;ENST00000538883;ENST00000361981;ENST00000540065;ENST00000370055;ENST00000361699	T;T;T;T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11;-1.11;-1.11;-1.11	4.57	4.57	0.56435	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.211607	0.32703	N	0.005742	T	0.74884	0.3775	L	0.52011	1.625	0.29094	N	0.881934	P;P;P	0.40230	0.66;0.66;0.708	B;B;B	0.41917	0.254;0.254;0.37	T	0.72587	-0.4248	10	0.37606	T	0.19	.	15.4841	0.75551	0.0:0.0:1.0:0.0	.	181;186;186	G3XAF4;P32004-2;P32004	.;.;L1CAM_HUMAN	M	186;188;186;188;181;56;181;186	ENSP00000359077:T186M;ENSP00000438430:T188M;ENSP00000359074:T186M;ENSP00000439645:T188M;ENSP00000354712:T181M;ENSP00000359072:T181M;ENSP00000355380:T186M	ENSP00000355380:T186M	T	-	2	0	L1CAM	152789576	0.038000	0.19896	0.814000	0.32528	0.715000	0.41141	1.932000	0.40143	2.253000	0.74438	0.436000	0.28706	ACG		L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061094.2	NM_024003	
