#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ITIH2	3698	broad.mit.edu	37	10	7791163	7791163	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr10:7791163G>T	ENST00000358415.4	+	21	2873	c.2707G>T	c.(2707-2709)Gac>Tac	p.D903Y	ITIH2_ENST00000379587.4_Missense_Mutation_p.D892Y	NM_002216.2	NP_002207.2	P19823	ITIH2_HUMAN	inter-alpha-trypsin inhibitor heavy chain 2	903					hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.D903Y(1)		NS(2)|breast(1)|endometrium(8)|kidney(1)|large_intestine(17)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64						CTTACAGAAAGACTACAGAAC	0.483																																					p.D903Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2707T	10						.						214.0	184.0	194.0					10																	7791163		2203	4300	6503	7831169	SO:0001583	missense	3698	exon21			X07173	CCDS31141.1	10p14	2011-10-26	2011-10-26		ENSG00000151655	ENSG00000151655			6167	protein-coding gene	gene with protein product		146640	"""inter-alpha (globulin) inhibitor, H2 polypeptide"""			1385302, 10100603	Standard	NM_002216		Approved	H2P	uc001ijs.3	P19823	OTTHUMG00000017633	ENST00000358415.4:c.2707G>T	10.37:g.7791163G>T	ENSP00000351190:p.Asp903Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	7831169	NM_002216	Q14659|Q15484|Q5T986	Missense_Mutation	SNP	ENST00000358415.4	37	CCDS31141.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.361829	0.82353	.	.	ENSG00000151655	ENST00000358415;ENST00000379587	T;T	0.14766	2.48;2.48	5.49	5.49	0.81192	Inter-alpha-trypsin inhibitor heavy chain, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.47930	0.1472	M	0.90595	3.13	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.57717	-0.7763	10	0.87932	D	0	-31.974	19.3745	0.94503	0.0:0.0:1.0:0.0	.	903	P19823	ITIH2_HUMAN	Y	903;892	ENSP00000351190:D903Y;ENSP00000368906:D892Y	ENSP00000351190:D903Y	D	+	1	0	ITIH2	7831169	1.000000	0.71417	1.000000	0.80357	0.788000	0.44548	9.414000	0.97362	2.573000	0.86826	0.561000	0.74099	GAC		ITIH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046678.2	NM_002216	
PROSER2	254427	broad.mit.edu	37	10	11894194	11894194	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr10:11894194C>T	ENST00000277570.5	+	2	272	c.118C>T	c.(118-120)Cgc>Tgc	p.R40C	PROSER2_ENST00000474155.1_3'UTR|PROSER2-AS1_ENST00000445498.1_RNA	NM_153256.3	NP_694988.3	Q86WR7	PRSR2_HUMAN	proline and serine rich 2	40	Ser-rich.							p.R40C(1)									CAGCAGCTCTCGCTCCAGAAG	0.537																																					p.R40C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C118T	10						.						66.0	48.0	54.0					10																	11894194		2203	4300	6503	11934200	SO:0001583	missense	254427	exon2			BC017269	CCDS7085.1	10p14	2014-02-19	2014-02-19	2012-12-05	ENSG00000148426	ENSG00000148426			23728	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 47"", ""proline and serine-rich protein 2"""	C10orf47		12477932	Standard	NM_153256		Approved	MGC35403	uc001ikx.3	Q86WR7	OTTHUMG00000017673	ENST00000277570.5:c.118C>T	10.37:g.11894194C>T	ENSP00000277570:p.Arg40Cys	Somatic		Capture	Illumina HiSeq	Phase_I	11934200	NM_153256	D3DRR8|Q5W0J9|Q5W0K0|Q5W0K1|Q5W0K2|Q6PJC8|Q8N317	Missense_Mutation	SNP	ENST00000277570.5	37	CCDS7085.1	.	.	.	.	.	.	.	.	.	.	C	13.51	2.257480	0.39896	.	.	ENSG00000148426	ENST00000379208;ENST00000277570;ENST00000379202;ENST00000444604	T	0.53423	0.62	5.51	3.52	0.40303	.	0.000000	0.38605	N	0.001621	T	0.56187	0.1968	L	0.43923	1.385	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.57751	-0.7757	10	0.87932	D	0	-5.4338	8.2661	0.31815	0.1787:0.6488:0.1724:0.0	.	40	Q86WR7	CJ047_HUMAN	C	40	ENSP00000277570:R40C	ENSP00000277570:R40C	R	+	1	0	C10orf47	11934200	0.998000	0.40836	0.381000	0.26106	0.049000	0.14656	1.972000	0.40540	1.306000	0.44926	-0.302000	0.09304	CGC		PROSER2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090189.2	NM_153256	
CXCL12	6387	broad.mit.edu	37	10	44874129	44874129	+	Silent	SNP	C	C	T	rs370748572		TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr10:44874129C>T	ENST00000374429.2	-	3	308	c.222G>A	c.(220-222)ccG>ccA	p.P74P	CXCL12_ENST00000374426.2_Silent_p.P74P|CXCL12_ENST00000395793.3_Intron|AL137026.1_ENST00000593376.1_Intron|CXCL12_ENST00000395794.2_Silent_p.P74P|CXCL12_ENST00000496375.1_5'UTR|CXCL12_ENST00000395795.4_Silent_p.P74P|CXCL12_ENST00000343575.6_Silent_p.P74P	NM_000609.5|NM_001277990.1	NP_000600.1|NP_001264919.1	P48061	SDF1_HUMAN	chemokine (C-X-C motif) ligand 12	74					adult locomotory behavior (GO:0008344)|ameboidal cell migration (GO:0001667)|blood circulation (GO:0008015)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cellular calcium ion homeostasis (GO:0006874)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|germ cell development (GO:0007281)|germ cell migration (GO:0008354)|immune response (GO:0006955)|induction of positive chemotaxis (GO:0050930)|motor neuron axon guidance (GO:0008045)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of leukocyte apoptotic process (GO:2000107)|negative regulation of leukocyte tethering or rolling (GO:1903237)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|patterning of blood vessels (GO:0001569)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell adhesion (GO:0045785)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of T cell migration (GO:2000406)|regulation of actin polymerization or depolymerization (GO:0008064)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|response to peptide hormone (GO:0043434)|response to radiation (GO:0009314)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation (GO:0042098)|telencephalon cell migration (GO:0022029)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	chemokine activity (GO:0008009)|chemokine receptor binding (GO:0042379)|CXCR chemokine receptor binding (GO:0045236)|receptor binding (GO:0005102)	p.P74P(2)		endometrium(1)|large_intestine(1)|lung(3)|skin(1)	6					Tinzaparin(DB06822)	ACTTTAGCTTCGGGTCAATGC	0.493																																					p.P74P												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G222A	10						.	C	,,,	0,4406		0,0,2203	214.0	174.0	187.0		222,222,222,222	-7.0	0.2	10		187	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	CXCL12	NM_000609.5,NM_001033886.2,NM_001178134.1,NM_199168.3	,,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,,	74/94,74/120,74/141,74/90	44874129	1,13005	2203	4300	6503	44194135	SO:0001819	synonymous_variant	6387	exon3			L36033	CCDS7207.1, CCDS31186.1, CCDS44373.1, CCDS53527.1, CCDS60518.1	10q11.1	2013-02-28	2010-05-11	2002-08-23	ENSG00000107562	ENSG00000107562		"""Endogenous ligands"""	10672	protein-coding gene	gene with protein product		600835	"""stromal cell-derived factor 1"""	SDF1A, SDF1B, SDF1		7490086	Standard	NM_001033886		Approved	SCYB12, SDF-1a, SDF-1b, PBSF, TLSF-a, TLSF-b, TPAR1	uc021ppm.1	P48061	OTTHUMG00000018054	ENST00000374429.2:c.222G>A	10.37:g.44874129C>T		Somatic		Capture	Illumina HiSeq	Phase_I	44194135	NM_001178134	B2R4G0|E7EVL0|H7BYN8|Q2L985|Q2L986|Q2L988|Q5IT36|Q6ICW0|Q9H554	Silent	SNP	ENST00000374429.2	37	CCDS44373.1																																																																																				CXCL12-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047738.2	NM_000609	
DKK1	22943	broad.mit.edu	37	10	54076187	54076187	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr10:54076187A>C	ENST00000373970.3	+	3	678	c.539A>C	c.(538-540)cAc>cCc	p.H180P	DKK1_ENST00000467359.1_3'UTR|PRKG1-AS1_ENST00000420193.1_RNA	NM_012242.2	NP_036374.1	O94907	DKK1_HUMAN	dickkopf WNT signaling pathway inhibitor 1	180					cell morphogenesis involved in differentiation (GO:0000904)|embryonic limb morphogenesis (GO:0030326)|endoderm formation (GO:0001706)|extracellular negative regulation of signal transduction (GO:1900116)|face morphogenesis (GO:0060325)|forebrain development (GO:0030900)|hair follicle development (GO:0001942)|mesoderm formation (GO:0001707)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of canonical Wnt signaling pathway involved in cardiac muscle cell fate commitment (GO:1901296)|negative regulation of cardiac muscle cell differentiation (GO:2000726)|negative regulation of mesodermal cell fate specification (GO:0042662)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of heart induction by negative regulation of canonical Wnt signaling pathway (GO:0090082)|regulation of endodermal cell fate specification (GO:0042663)|regulation of receptor internalization (GO:0002090)|response to retinoic acid (GO:0032526)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	extracellular space (GO:0005615)|plasma membrane (GO:0005886)	growth factor activity (GO:0008083)|low-density lipoprotein particle receptor binding (GO:0050750)|receptor antagonist activity (GO:0048019)|signal transducer activity (GO:0004871)	p.H180P(1)		kidney(2)|large_intestine(4)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	16						AAAATGTATCACACCAAAGGT	0.373																																					p.H180P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A539C	10						.						91.0	85.0	87.0					10																	54076187		2203	4300	6503	53746193	SO:0001583	missense	22943	exon3				CCDS7246.1	10q11.2	2013-05-15	2013-05-15		ENSG00000107984	ENSG00000107984			2891	protein-coding gene	gene with protein product		605189	"""dickkopf (Xenopus laevis) homolog 1"", ""dickkopf 1 homolog (Xenopus laevis)"""				Standard	NM_012242		Approved	SK, DKK-1	uc001jjr.3	O94907	OTTHUMG00000018247	ENST00000373970.3:c.539A>C	10.37:g.54076187A>C	ENSP00000363081:p.His180Pro	Somatic		Capture	Illumina HiSeq	Phase_I	53746193	NM_012242	B2RC19	Missense_Mutation	SNP	ENST00000373970.3	37	CCDS7246.1	.	.	.	.	.	.	.	.	.	.	A	7.542	0.660975	0.14645	.	.	ENSG00000107984	ENST00000373970	T	0.43688	0.94	5.09	5.09	0.68999	.	0.498801	0.21970	N	0.066474	T	0.32556	0.0833	N	0.17082	0.46	0.30031	N	0.813461	D	0.61697	0.99	P	0.53649	0.731	T	0.18493	-1.0335	10	0.23302	T	0.38	-6.3943	5.0436	0.14471	0.7507:0.0:0.0864:0.1629	.	180	O94907	DKK1_HUMAN	P	180	ENSP00000363081:H180P	ENSP00000363081:H180P	H	+	2	0	DKK1	53746193	1.000000	0.71417	1.000000	0.80357	0.615000	0.37417	2.090000	0.41682	2.225000	0.72522	0.459000	0.35465	CAC		DKK1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048100.1		
SLIT1	6585	broad.mit.edu	37	10	98802720	98802720	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr10:98802720G>T	ENST00000266058.4	-	20	2347	c.2102C>A	c.(2101-2103)cCt>cAt	p.P701H	ARHGAP19-SLIT1_ENST00000453547.2_3'UTR|SLIT1_ENST00000371070.4_Missense_Mutation_p.P701H	NM_003061.2	NP_003052.2	O75093	SLIT1_HUMAN	slit homolog 1 (Drosophila)	701	LRRCT 3.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|dorsal/ventral axon guidance (GO:0033563)|establishment of nucleus localization (GO:0040023)|forebrain morphogenesis (GO:0048853)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of synapse assembly (GO:0051964)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord development (GO:0021510)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)	p.P701H(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(37)|ovary(5)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	78		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		CAAAAAGTCAGGGTTCTGGCA	0.632																																					p.P701H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2102A	10						.						75.0	72.0	73.0					10																	98802720		2203	4300	6503	98792710	SO:0001583	missense	6585	exon20			AB011537	CCDS7453.1	10q23.3-q24	2008-08-01	2001-11-28		ENSG00000187122	ENSG00000187122			11085	protein-coding gene	gene with protein product		603742	"""slit (Drosophila) homolog 1"""	SLIL1		9693030, 9813312	Standard	NM_003061		Approved	slit1, MEGF4, Slit-1, SLIT3	uc001kmw.2	O75093	OTTHUMG00000018843	ENST00000266058.4:c.2102C>A	10.37:g.98802720G>T	ENSP00000266058:p.Pro701His	Somatic		Capture	Illumina HiSeq	Phase_I	98792710	NM_003061	Q5T0V1|Q8WWZ2|Q9UIL7	Missense_Mutation	SNP	ENST00000266058.4	37	CCDS7453.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.346152	0.82022	.	.	ENSG00000187122	ENST00000266058;ENST00000371057;ENST00000371070;ENST00000314867	D;D;D	0.93366	-3.21;-3.21;-3.21	4.63	4.63	0.57726	Cysteine-rich flanking region, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.97770	0.9268	H	0.95079	3.62	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99191	1.0870	10	0.87932	D	0	.	17.6676	0.88207	0.0:0.0:1.0:0.0	.	711;701	E7EWQ8;O75093	.;SLIT1_HUMAN	H	701;711;701;694	ENSP00000266058:P701H;ENSP00000360109:P701H;ENSP00000315005:P694H	ENSP00000266058:P701H	P	-	2	0	SLIT1	98792710	1.000000	0.71417	0.982000	0.44146	0.764000	0.43329	9.263000	0.95617	2.385000	0.81259	0.561000	0.74099	CCT		SLIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049636.1	NM_003061	
ERLIN1	10613	broad.mit.edu	37	10	101915906	101915906	+	Silent	SNP	G	G	T	rs543960752		TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr10:101915906G>T	ENST00000421367.2	-	9	3448	c.741C>A	c.(739-741)atC>atA	p.I247I	ERLIN1_ENST00000407654.3_Silent_p.I247I	NM_001100626.1|NM_006459.3	NP_001094096.1|NP_006450.2	O75477	ERLN1_HUMAN	ER lipid raft associated 1	245					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)		p.I245I(1)					Colorectal(252;0.234)		Epithelial(162;3.85e-10)|all cancers(201;3.25e-08)		ATGTACCTTCGATTTCAGAAA	0.468																																					p.I247I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C741A	10						.						133.0	112.0	119.0					10																	101915906		2203	4300	6503	101905896	SO:0001819	synonymous_variant	10613	exon10			AF064093	CCDS7487.2	10q24.31	2014-03-03	2007-01-26	2007-01-26	ENSG00000107566	ENSG00000107566			16947	protein-coding gene	gene with protein product	"""Band_7 23-211 Keo4 (Interim) similar to C.elegans protein C42C1.9"""	611604	"""chromosome 10 open reading frame 69"", ""SPFH domain family, member 1"""	C10orf69, SPFH1		11118313, 16835267, 24482476	Standard	NM_006459		Approved	KE04, Erlin-1, SPG62	uc001kqo.4	O75477	OTTHUMG00000018900	ENST00000421367.2:c.741C>A	10.37:g.101915906G>T		Somatic		Capture	Illumina HiSeq	Phase_I	101905896	NM_001100626	B0QZ42|Q53HV0	Silent	SNP	ENST00000421367.2	37	CCDS7487.2																																																																																				ERLIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049840.2	NM_006459	
FXYD6	53826	broad.mit.edu	37	11	117712537	117712537	+	Silent	SNP	G	G	A			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr11:117712537G>A	ENST00000526014.1	-	4	736	c.141C>T	c.(139-141)gtC>gtT	p.V47V	FXYD6_ENST00000583233.1_5'UTR|RP11-728F11.4_ENST00000581173.2_RNA|FXYD6_ENST00000584230.1_Silent_p.V47V|FXYD6_ENST00000527717.1_Silent_p.V47V|FXYD6_ENST00000524656.1_Silent_p.V47V|FXYD6_ENST00000540359.1_Silent_p.V47V|FXYD6_ENST00000527429.1_Silent_p.V47V|FXYD6_ENST00000530956.1_Silent_p.V47V|FXYD6_ENST00000539526.1_Silent_p.V47V|FXYD6_ENST00000529335.2_Silent_p.V46V|FXYD6_ENST00000584394.1_Silent_p.V47V|FXYD6-FXYD2_ENST00000532984.1_Silent_p.V47V|FXYD6_ENST00000260282.4_Silent_p.V47V	NM_022003.3	NP_071286.1	Q9H0Q3	FXYD6_HUMAN	FXYD domain containing ion transport regulator 6	47					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ion channel activity (GO:0005216)	p.V47V(1)		central_nervous_system(1)|large_intestine(5)|lung(1)|skin(1)	8	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|Breast(348;0.111)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.89e-05)|Epithelial(105;0.00122)		CCGAGAAGAGGACCACAGCGA	0.532																																					p.V47V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C141T	11						.						123.0	116.0	119.0					11																	117712537		2201	4296	6497	117217747	SO:0001819	synonymous_variant	53826	exon5			BC093040	CCDS8387.1	11q23.3	2010-04-14	2002-01-14		ENSG00000137726	ENSG00000137726			4030	protein-coding gene	gene with protein product	"""phosphohippolin"""	606683	"""FXYD domain-containing ion transport regulator 6"""			10950925	Standard	NM_022003		Approved			Q9H0Q3		ENST00000526014.1:c.141C>T	11.37:g.117712537G>A		Somatic		Capture	Illumina HiSeq	Phase_I	117217747	NM_001164837	A8K0R4|J3QLD2|Q6FIG9|Q6UW52	Silent	SNP	ENST00000526014.1	37	CCDS8387.1																																																																																				FXYD6-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392307.1	NM_022003	
HYOU1	10525	broad.mit.edu	37	11	118923367	118923367	+	Silent	SNP	G	G	A	rs376041557		TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr11:118923367G>A	ENST00000404233.3	-	9	1093	c.969C>T	c.(967-969)aaC>aaT	p.N323N	HYOU1_ENST00000525859.1_Silent_p.N323N|HYOU1_ENST00000543287.1_Silent_p.N236N|HYOU1_ENST00000529972.1_Silent_p.N323N	NM_001130991.1|NM_006389.3	NP_001124463.1|NP_006380.1	Q9Y4L1	HYOU1_HUMAN	hypoxia up-regulated 1	323					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|response to ischemia (GO:0002931)|response to stress (GO:0006950)	endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ATP binding (GO:0005524)	p.N323N(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(10)|prostate(1)|skin(2)	33	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)		TGTGGTCAGCGTTGGCACTGA	0.602																																					p.N323N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C969T	11						.	G	,	0,4400		0,0,2200	79.0	77.0	77.0		969,969	-9.7	0.2	11		77	1,8589	1.2+/-3.3	0,1,4294	no	coding-synonymous,coding-synonymous	HYOU1	NM_001130991.1,NM_006389.3	,	0,1,6494	AA,AG,GG		0.0116,0.0,0.0077	,	323/1000,323/1000	118923367	1,12989	2200	4295	6495	118428577	SO:0001819	synonymous_variant	10525	exon9			U65785	CCDS8408.1	11q23.1-q23.3	2011-09-02			ENSG00000149428	ENSG00000149428		"""Heat shock proteins / HSP70"""	16931	protein-coding gene	gene with protein product	"""glucose-regulated protein 170"""	601746				9020069, 10037731	Standard	XM_005271390		Approved	ORP150, HSP12A, Grp170	uc001pux.3	Q9Y4L1	OTTHUMG00000166354	ENST00000404233.3:c.969C>T	11.37:g.118923367G>A		Somatic		Capture	Illumina HiSeq	Phase_I	118428577	NM_006389	A8C1Z0|B7Z909|Q2I204|Q53H25	Silent	SNP	ENST00000404233.3	37	CCDS8408.1																																																																																				HYOU1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389353.1	NM_006389	
OR10G9	219870	broad.mit.edu	37	11	123894395	123894395	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr11:123894395C>T	ENST00000375024.1	+	1	676	c.676C>T	c.(676-678)Cgg>Tgg	p.R226W		NM_001001953.1	NP_001001953.1	Q8NGN4	O10G9_HUMAN	olfactory receptor, family 10, subfamily G, member 9	226						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R226W(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(33)|prostate(2)|skin(4)|stomach(8)|urinary_tract(1)	61		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		TTCCATCCTGCGGATCCACAC	0.522																																					p.R226W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C676T	11						.						168.0	146.0	153.0					11																	123894395		2201	4299	6500	123399605	SO:0001583	missense	219870	exon1			AB065756	CCDS31703.1	11q24.1	2012-08-09			ENSG00000236981	ENSG00000236981		"""GPCR / Class A : Olfactory receptors"""	15129	protein-coding gene	gene with protein product				OR10G10P			Standard	NM_001001953		Approved		uc010sad.2	Q8NGN4	OTTHUMG00000165967	ENST00000375024.1:c.676C>T	11.37:g.123894395C>T	ENSP00000364164:p.Arg226Trp	Somatic		Capture	Illumina HiSeq	Phase_I	123399605	NM_001001953		Missense_Mutation	SNP	ENST00000375024.1	37	CCDS31703.1	.	.	.	.	.	.	.	.	.	.	C	9.338	1.062308	0.19987	.	.	ENSG00000236981	ENST00000375024	T	0.00269	8.37	3.44	2.3	0.28687	GPCR, rhodopsin-like superfamily (1);	0.805161	0.10846	N	0.627629	T	0.00552	0.0018	M	0.91354	3.2	0.09310	N	1	D	0.65815	0.995	P	0.58077	0.832	T	0.40794	-0.9544	10	0.72032	D	0.01	.	9.0142	0.36159	0.8014:0.1986:0.0:0.0	.	226	Q8NGN4	O10G9_HUMAN	W	226	ENSP00000364164:R226W	ENSP00000364164:R226W	R	+	1	2	OR10G9	123399605	0.000000	0.05858	0.951000	0.38953	0.022000	0.10575	1.052000	0.30429	0.525000	0.28522	-0.271000	0.10264	CGG		OR10G9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387269.1	NM_001001953	
CDHR5	53841	broad.mit.edu	37	11	621883	621883	+	Missense_Mutation	SNP	C	C	T	rs114264092	byFrequency	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr11:621883C>T	ENST00000358353.3	-	5	656	c.334G>A	c.(334-336)Gtg>Atg	p.V112M	CDHR5_ENST00000397542.2_Missense_Mutation_p.V112M|CDHR5_ENST00000529337.1_5'Flank|CDHR5_ENST00000349570.7_Missense_Mutation_p.V112M			Q9HBB8	CDHR5_HUMAN	cadherin-related family member 5	112	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043, ECO:0000305}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)	p.V112M(1)		NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(2)	23						AGCACTGACACGAACACCCTT	0.627													C|||	5	0.000998403	0.0023	0.0	5008	,	,		16975	0.0		0.002	False		,,,				2504	0.0				p.V112M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G334A	11						.	C	MET/VAL,MET/VAL,MET/VAL	7,4399	12.9+/-30.5	0,7,2196	82.0	62.0	69.0		334,334,334	3.7	0.1	11	dbSNP_132	69	18,8582	13.3+/-46.6	0,18,4282	yes	missense,missense,missense	CDHR5	NM_001171968.1,NM_021924.4,NM_031264.3	21,21,21	0,25,6478	TT,TC,CC		0.2093,0.1589,0.1922	probably-damaging,probably-damaging,probably-damaging	112/840,112/846,112/652	621883	25,12981	2203	4300	6503	611883	SO:0001583	missense	53841	exon4			AF258675	CCDS7707.1, CCDS7708.1	11p15.5	2011-07-01	2010-01-25	2010-01-25	ENSG00000099834	ENSG00000099834		"""Cadherins / Cadherin-related"""	7521	protein-coding gene	gene with protein product		606839	"""mucin and cadherin-like"", ""mucin-like protocadherin"""	MUCDHL, MUPCDH		11031102, 10801787	Standard	NM_021924		Approved	FLJ20219, MU-PCDH	uc001lqj.3	Q9HBB8	OTTHUMG00000132018	ENST00000358353.3:c.334G>A	11.37:g.621883C>T	ENSP00000351118:p.Val112Met	Somatic		Capture	Illumina HiSeq	Phase_I	611883	NM_031264	C9J7X1|Q9H746|Q9HAU3|Q9HBB5|Q9HBB6|Q9HBB7|Q9NX86|Q9NXI9	Missense_Mutation	SNP	ENST00000358353.3	37	CCDS7707.1	4	0.0018315018315018315	2	0.0040650406504065045	0	0.0	0	0.0	2	0.002638522427440633	C	20.2	3.945419	0.73672	0.001589	0.002093	ENSG00000099834	ENST00000397542;ENST00000358353;ENST00000326366;ENST00000349570	T;T;T	0.71103	-0.54;-0.54;-0.54	3.65	3.65	0.41850	Cadherin (3);Cadherin conserved site (1);	.	.	.	.	D	0.87406	0.6169	M	0.93854	3.465	0.09310	N	0.999993	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.78685	-0.2108	9	0.87932	D	0	-30.1933	13.2202	0.59883	0.0:1.0:0.0:0.0	.	112;112;112	Q9HBB8-4;Q9HBB8-2;Q9HBB8	.;.;CDHR5_HUMAN	M	112	ENSP00000380676:V112M;ENSP00000351118:V112M;ENSP00000345726:V112M	ENSP00000326527:V112M	V	-	1	0	CDHR5	611883	0.779000	0.28652	0.057000	0.19452	0.636000	0.38137	2.027000	0.41078	2.051000	0.60960	0.491000	0.48974	GTG		CDHR5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255023.2	NM_021924	
UBQLN3	50613	broad.mit.edu	37	11	5528825	5528825	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr11:5528825G>A	ENST00000311659.4	-	2	2111	c.1964C>T	c.(1963-1965)tCg>tTg	p.S655L	HBG2_ENST00000380259.2_Intron|AC104389.28_ENST00000415970.1_RNA|HBE1_ENST00000380237.1_5'Flank|HBG2_ENST00000380252.1_5'Flank	NM_017481.2	NP_059509.1	Q9H347	UBQL3_HUMAN	ubiquilin 3	655	UBA. {ECO:0000255|PROSITE- ProRule:PRU00212}.							p.S655L(1)		NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|prostate(1)|skin(2)	39		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGGCTCCTACGACTGTCTCAG	0.488																																					p.S655L	Ovarian(72;684 1260 12332 41642 52180)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1964T	11						.						88.0	90.0	89.0					11																	5528825		2200	4297	6497	5485401	SO:0001583	missense	50613	exon2			AF230481	CCDS7758.1	11p15	2013-02-12			ENSG00000175520	ENSG00000175520		"""Ubiquilin family"""	12510	protein-coding gene	gene with protein product		605473				10831842	Standard	NM_017481		Approved	TUP-1	uc001may.1	Q9H347	OTTHUMG00000066886	ENST00000311659.4:c.1964C>T	11.37:g.5528825G>A	ENSP00000347997:p.Ser655Leu	Somatic		Capture	Illumina HiSeq	Phase_I	5485401	NM_017481	Q9NRE0	Missense_Mutation	SNP	ENST00000311659.4	37	CCDS7758.1	.	.	.	.	.	.	.	.	.	.	G	12.70	2.015903	0.35606	.	.	ENSG00000175520	ENST00000311659	T	0.48836	0.8	5.02	0.987	0.19790	Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (1);UBA-like (1);	0.569936	0.14870	N	0.293573	T	0.37376	0.1001	L	0.46670	1.46	0.09310	N	1	B	0.12013	0.005	B	0.06405	0.002	T	0.34129	-0.9841	10	0.87932	D	0	-0.6305	7.1579	0.25647	0.3802:0.0:0.6197:0.0	.	655	Q9H347	UBQL3_HUMAN	L	655	ENSP00000347997:S655L	ENSP00000347997:S655L	S	-	2	0	UBQLN3	5485401	0.047000	0.20315	0.000000	0.03702	0.001000	0.01503	0.897000	0.28390	0.089000	0.17243	-0.150000	0.13652	TCG		UBQLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143348.1	NM_017481	
OR10A4	283297	broad.mit.edu	37	11	6898566	6898566	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr11:6898566C>T	ENST00000379829.2	+	1	711	c.688C>T	c.(688-690)Ccg>Tcg	p.P230S		NM_207186.2	NP_997069.2	Q9H209	O10A4_HUMAN	olfactory receptor, family 10, subfamily A, member 4	230					axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P230S(1)		kidney(1)|large_intestine(2)|liver(2)|lung(20)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	31		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		CTTCAGGATGCCGTCAGCTGA	0.517																																					p.P230S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C688T	11						.						203.0	151.0	169.0					11																	6898566		2201	4296	6497	6855142	SO:0001583	missense	283297	exon1			AF209506	CCDS7774.1	11p15.4	2012-08-09	2002-11-13	2004-03-10	ENSG00000170782	ENSG00000170782		"""GPCR / Class A : Olfactory receptors"""	15130	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily A, member 4 pseudogene"""	OR10A4P			Standard	NM_207186		Approved		uc010rat.2	Q9H209	OTTHUMG00000165740	ENST00000379829.2:c.688C>T	11.37:g.6898566C>T	ENSP00000369157:p.Pro230Ser	Somatic		Capture	Illumina HiSeq	Phase_I	6855142	NM_207186	B2RNP5|B9EH36|Q96R20	Missense_Mutation	SNP	ENST00000379829.2	37	CCDS7774.1	.	.	.	.	.	.	.	.	.	.	c	11.29	1.596388	0.28445	.	.	ENSG00000170782	ENST00000379829	T	0.36878	1.23	4.59	3.67	0.42095	GPCR, rhodopsin-like superfamily (1);	0.157221	0.30093	N	0.010432	T	0.30103	0.0754	L	0.37507	1.11	0.23563	N	0.997409	B	0.14805	0.011	B	0.28139	0.086	T	0.23868	-1.0176	10	0.41790	T	0.15	.	10.7154	0.46008	0.0:0.9055:0.0:0.0945	.	230	Q9H209	O10A4_HUMAN	S	230	ENSP00000369157:P230S	ENSP00000369157:P230S	P	+	1	0	OR10A4	6855142	0.008000	0.16893	0.995000	0.50966	0.791000	0.44710	0.533000	0.23082	1.276000	0.44395	0.651000	0.88453	CCG		OR10A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385985.1	NM_207186	
GRM5	2915	broad.mit.edu	37	11	88242036	88242036	+	Silent	SNP	G	G	A			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr11:88242036G>A	ENST00000305447.4	-	9	3512	c.3363C>T	c.(3361-3363)atC>atT	p.I1121I	GRM5-AS1_ENST00000526448.1_RNA|GRM5-AS1_ENST00000531994.1_RNA|GRM5_ENST00000305432.5_Silent_p.I1089I|GRM5_ENST00000393297.1_Intron|GRM5_ENST00000455756.2_Silent_p.I1089I|GRM5_ENST00000418177.2_Silent_p.I1121I	NM_001143831.2	NP_001137303.1	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5	1121					activation of MAPKKK activity (GO:0000185)|cognition (GO:0050890)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of locomotion (GO:0040013)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)	p.I1089I(1)|p.I1121I(1)		NS(1)|breast(5)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(18)|lung(40)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)|Rufinamide(DB06201)	CCGTGACTTCGATGGCCGGCA	0.731																																					p.I1089I												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C3267T	11						.						8.0	10.0	9.0					11																	88242036		2192	4287	6479	87881684	SO:0001819	synonymous_variant	2915	exon9			D28538	CCDS8283.1, CCDS44694.1	11q14.3	2014-06-12			ENSG00000168959	ENSG00000168959		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4597	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 86"""	604102				7908515	Standard	NM_001143831		Approved	MGLUR5, GPRC1E, mGlu5, PPP1R86	uc001pcq.3	P41594	OTTHUMG00000134306	ENST00000305447.4:c.3363C>T	11.37:g.88242036G>A		Somatic		Capture	Illumina HiSeq	Phase_I	87881684	NM_000842	Q6J164	Silent	SNP	ENST00000305447.4	37	CCDS44694.1																																																																																				GRM5-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259226.1	NM_000842	
OR10G8	219869	broad.mit.edu	37	11	123901253	123901253	+	Silent	SNP	T	T	G			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr11:123901253T>G	ENST00000431524.1	+	1	957	c.924T>G	c.(922-924)tcT>tcG	p.S308S		NM_001004464.1	NP_001004464.1	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G, member 8	308						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S308S(1)		breast(1)|endometrium(7)|large_intestine(2)|lung(21)|ovary(1)|prostate(5)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	44		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		TAGCACATTCTCAGAGCAAat	0.433																																					p.S308S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T924G	11						.						69.0	63.0	65.0					11																	123901253		2201	4299	6500	123406463	SO:0001819	synonymous_variant	219869	exon1			AB065755	CCDS31704.1	11q24.1	2012-08-09			ENSG00000234560	ENSG00000234560		"""GPCR / Class A : Olfactory receptors"""	14845	protein-coding gene	gene with protein product							Standard	NM_001004464		Approved		uc001pzp.1	Q8NGN5	OTTHUMG00000165968	ENST00000431524.1:c.924T>G	11.37:g.123901253T>G		Somatic		Capture	Illumina HiSeq	Phase_I	123406463	NM_001004464	B2RNJ3|Q6IEV2	Silent	SNP	ENST00000431524.1	37	CCDS31704.1																																																																																				OR10G8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387270.1	NM_001004464	
KCNA5	3741	broad.mit.edu	37	12	5153809	5153809	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr12:5153809G>T	ENST00000252321.3	+	1	725	c.496G>T	c.(496-498)Gac>Tac	p.D166Y		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	166					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)	p.D166N(1)|p.D166Y(1)		NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	GTACTTCTTCGACCGCAACCG	0.667																																					p.D166Y												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G496T	12						.						38.0	41.0	40.0					12																	5153809		2203	4300	6503	5024070	SO:0001583	missense	3741	exon1			M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.496G>T	12.37:g.5153809G>T	ENSP00000252321:p.Asp166Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	5024070	NM_002234	Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Missense_Mutation	SNP	ENST00000252321.3	37	CCDS8536.1	.	.	.	.	.	.	.	.	.	.	G	18.42	3.620928	0.66787	.	.	ENSG00000130037	ENST00000252321	D	0.85773	-2.03	4.7	3.8	0.43715	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.64402	U	0.000001	D	0.95749	0.8617	H	0.99545	4.62	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97103	0.9799	10	0.87932	D	0	.	13.9798	0.64297	0.0:0.1527:0.8473:0.0	.	166	P22460	KCNA5_HUMAN	Y	166	ENSP00000252321:D166Y	ENSP00000252321:D166Y	D	+	1	0	KCNA5	5024070	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.580000	0.98207	1.182000	0.42928	0.511000	0.50034	GAC		KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398925.2	NM_002234	
CHD4	1108	broad.mit.edu	37	12	6701583	6701583	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr12:6701583C>T	ENST00000357008.2	-	19	3087	c.2924G>A	c.(2923-2925)cGt>cAt	p.R975H	CHD4_ENST00000309577.6_Missense_Mutation_p.R975H|CHD4_ENST00000544040.1_Missense_Mutation_p.R968H|CHD4_ENST00000544484.1_Missense_Mutation_p.R972H	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	975					ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)	p.R975H(10)		central_nervous_system(2)	2						CAGCTCCACACGCACAATTAG	0.517																																					p.R975H	Colon(32;586 792 4568 16848 45314)											.	.	10	Substitution - Missense(10)	endometrium(8)|large_intestine(2)	c.G2924A	12						.						88.0	82.0	84.0					12																	6701583		2203	4300	6503	6571844	SO:0001583	missense	1108	exon19			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.2924G>A	12.37:g.6701583C>T	ENSP00000349508:p.Arg975His	Somatic		Capture	Illumina HiSeq	Phase_I	6571844	NM_001273	Q8IXZ5	Missense_Mutation	SNP	ENST00000357008.2	37	CCDS8552.1	.	.	.	.	.	.	.	.	.	.	C	33	5.253892	0.95336	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	T;T;T;T	0.75821	-0.97;-0.97;-0.97;-0.97	5.4	5.4	0.78164	SNF2-related (1);	0.000000	0.85682	D	0.000000	T	0.82024	0.4947	L	0.37630	1.12	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	0.997;1.0;0.994	D	0.83812	0.0242	10	0.87932	D	0	.	19.1812	0.93623	0.0:1.0:0.0:0.0	.	975;975;968	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	H	972;968;975;975;949	ENSP00000440392:R972H;ENSP00000440542:R968H;ENSP00000312419:R975H;ENSP00000349508:R975H	ENSP00000312419:R975H	R	-	2	0	CHD4	6571844	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.743000	0.85020	2.530000	0.85305	0.563000	0.77884	CGT		CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001273	
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12D	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0 	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35A	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	12.37:g.25398284C>T	ENSP00000256078:p.Gly12Asp	Somatic		Capture	Illumina HiSeq	Phase_I	25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
FGFR1OP2	26127	broad.mit.edu	37	12	27110640	27110640	+	Silent	SNP	G	G	A	rs533480644		TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr12:27110640G>A	ENST00000229395.3	+	4	702	c.360G>A	c.(358-360)ccG>ccA	p.P120P	FGFR1OP2_ENST00000546072.1_Silent_p.P120P|FGFR1OP2_ENST00000327214.5_Silent_p.P120P	NM_015633.2	NP_056448.1	Q9NVK5	FGOP2_HUMAN	FGFR1 oncogene partner 2	120					wound healing (GO:0042060)	cytosol (GO:0005829)		p.P120P(1)		cervix(1)|large_intestine(4)|lung(1)|prostate(2)	8	Colorectal(261;0.0847)					AAGATGATCCGGGTATAATAA	0.378																																					p.P120P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G360A	12						.						81.0	84.0	83.0					12																	27110640		2203	4300	6503	27001907	SO:0001819	synonymous_variant	26127	exon4			AF161472	CCDS8709.1, CCDS53766.1, CCDS53767.1	12p12.1	2014-01-28			ENSG00000111790	ENSG00000111790			23098	protein-coding gene	gene with protein product		608858				15034873	Standard	NM_015633		Approved	DKFZp564O1863	uc001rhm.3	Q9NVK5		ENST00000229395.3:c.360G>A	12.37:g.27110640G>A		Somatic		Capture	Illumina HiSeq	Phase_I	27001907	NM_001171888	Q6R955|Q8N5L7|Q9P034|Q9UFK8	Silent	SNP	ENST00000229395.3	37	CCDS8709.1																																																																																				FGFR1OP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402961.1	NM_015633	
ACVR1B	91	broad.mit.edu	37	12	52374818	52374818	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr12:52374818G>A	ENST00000257963.4	+	4	723	c.646G>A	c.(646-648)Ggt>Agt	p.G216S	ACVR1B_ENST00000542485.1_Missense_Mutation_p.G164S|ACVR1B_ENST00000415850.2_Missense_Mutation_p.G216S|ACVR1B_ENST00000541224.1_Missense_Mutation_p.G216S|ACVR1B_ENST00000426655.2_Missense_Mutation_p.G216S	NM_004302.4|NM_020328.3	NP_004293.1|NP_064733.3	P36896	ACV1B_HUMAN	activin A receptor, type IB	216	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|central nervous system development (GO:0007417)|development of primary female sexual characteristics (GO:0046545)|extrinsic apoptotic signaling pathway (GO:0097191)|G1/S transition of mitotic cell cycle (GO:0000082)|hair follicle development (GO:0001942)|in utero embryonic development (GO:0001701)|negative regulation of cell growth (GO:0030308)|nodal signaling pathway (GO:0038092)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of trophoblast cell migration (GO:1901165)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|inhibin binding (GO:0034711)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|ubiquitin protein ligase binding (GO:0031625)	p.G216S(2)		breast(5)|endometrium(4)|kidney(5)|large_intestine(12)|lung(10)|ovary(1)|pancreas(6)|prostate(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.104)	Adenosine triphosphate(DB00171)	TATTGGCAAGGGTCGGTTTGG	0.512											OREG0021829	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G164S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G490A	12						.						74.0	75.0	75.0					12																	52374818		2203	4300	6503	50661085	SO:0001583	missense	91	exon4				CCDS8816.1, CCDS44893.1, CCDS44894.1, CCDS44893.2, CCDS44894.2	12q13	2006-11-09			ENSG00000135503	ENSG00000135503			172	protein-coding gene	gene with protein product		601300		ACVRLK4		8397373	Standard	NM_020327		Approved	ALK4, SKR2, ActRIB	uc010snn.2	P36896	OTTHUMG00000167920	ENST00000257963.4:c.646G>A	12.37:g.52374818G>A	ENSP00000257963:p.Gly216Ser	Somatic	984	Capture	Illumina HiSeq	Phase_I	50661085	NM_020327	B7Z5L8|B7Z5W5|Q15479|Q15480|Q15481|Q15482	Missense_Mutation	SNP	ENST00000257963.4	37	CCDS8816.1	.	.	.	.	.	.	.	.	.	.	G	36	5.701250	0.96812	.	.	ENSG00000135503	ENST00000257963;ENST00000541224;ENST00000426655;ENST00000415850;ENST00000542485	D;D;D;D;D	0.96334	-3.98;-3.98;-3.98;-3.98;-3.98	5.12	5.12	0.69794	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.98972	0.9650	H	0.98178	4.165	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.999;0.999	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.99316	1.0905	10	0.87932	D	0	.	18.9637	0.92687	0.0:0.0:1.0:0.0	.	216;216;216;216	P36896-4;P36896;P36896-2;P36896-3	.;ACV1B_HUMAN;.;.	S	216;216;216;216;164	ENSP00000257963:G216S;ENSP00000442656:G216S;ENSP00000390477:G216S;ENSP00000397550:G216S;ENSP00000442885:G164S	ENSP00000257963:G216S	G	+	1	0	ACVR1B	50661085	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.869000	0.99810	2.563000	0.86464	0.650000	0.86243	GGT		ACVR1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397000.1	NM_020328	
CCER1	196477	broad.mit.edu	37	12	91348043	91348043	+	Silent	SNP	C	C	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr12:91348043C>T	ENST00000358859.2	-	1	910	c.477G>A	c.(475-477)ccG>ccA	p.P159P	CCER1_ENST00000548187.1_Intron	NM_152638.2	NP_689851.1	Q8TC90	CCER1_HUMAN	coiled-coil glutamate-rich protein 1	159								p.P159P(3)									GCGGGCTCCGCGGGTAGGAGT	0.706																																					p.P159P												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.G477A	12						.						21.0	24.0	23.0					12																	91348043		2198	4295	6493	89872174	SO:0001819	synonymous_variant	196477	exon1			BC024183	CCDS9036.1	12q21.33	2012-05-30	2012-05-30	2012-05-30	ENSG00000197651	ENSG00000197651			28373	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 12"""	C12orf12		17967063	Standard	NM_152638		Approved	MGC26598	uc001tbj.3	Q8TC90	OTTHUMG00000170070	ENST00000358859.2:c.477G>A	12.37:g.91348043C>T		Somatic		Capture	Illumina HiSeq	Phase_I	89872174	NM_152638	Q8TC47	Silent	SNP	ENST00000358859.2	37	CCDS9036.1																																																																																				CCER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407142.2	NM_152638	
NOS1	4842	broad.mit.edu	37	12	117710316	117710316	+	Silent	SNP	G	G	A	rs200268741		TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr12:117710316G>A	ENST00000338101.4	-	9	1717	c.1713C>T	c.(1711-1713)gcC>gcT	p.A571A	NOS1_ENST00000344089.3_3'UTR|NOS1_ENST00000317775.6_Silent_p.A571A			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)	p.A571A(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		TGTTGGACACGGCGGGGAGGC	0.622													G|||	1	0.000199681	0.0	0.0	5008	,	,		17504	0.0		0.001	False		,,,				2504	0.0				p.A571A	Esophageal Squamous(162;1748 2599 51982 52956)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1713T	12						.						52.0	58.0	56.0					12																	117710316		2181	4298	6479	116194699	SO:0001819	synonymous_variant	4842	exon10				CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.1713C>T	12.37:g.117710316G>A		Somatic		Capture	Illumina HiSeq	Phase_I	116194699	NM_000620		Silent	SNP	ENST00000338101.4	37	CCDS55890.1																																																																																				NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1		
FRY	10129	broad.mit.edu	37	13	32868604	32868604	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr13:32868604T>C	ENST00000380250.3	+	60	9176	c.8680T>C	c.(8680-8682)Tcc>Ccc	p.S2894P	FRY_ENST00000380217.1_Missense_Mutation_p.S76P|FRY_ENST00000542859.1_Missense_Mutation_p.S264P	NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	2894						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.S2894P(1)		NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		CGGCGCGTGGTCCGAGCCCAC	0.552																																					p.S2894P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T8680C	13						.						71.0	75.0	73.0					13																	32868604		2037	4199	6236	31766604	SO:0001583	missense	10129	exon60			AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.8680T>C	13.37:g.32868604T>C	ENSP00000369600:p.Ser2894Pro	Somatic		Capture	Illumina HiSeq	Phase_I	31766604	NM_023037	Q9Y3N6	Missense_Mutation	SNP	ENST00000380250.3	37	CCDS41875.1	.	.	.	.	.	.	.	.	.	.	T	10.03	1.238954	0.22711	.	.	ENSG00000073910	ENST00000380250;ENST00000542859;ENST00000380217	T	0.24538	1.85	5.5	-4.18	0.03846	.	0.499688	0.22338	N	0.061368	T	0.09949	0.0244	N	0.11756	0.17	0.26735	N	0.970517	B	0.02656	0.0	B	0.04013	0.001	T	0.24693	-1.0153	10	0.21540	T	0.41	.	7.8812	0.29623	0.0:0.1551:0.4158:0.429	.	2894	Q5TBA9	FRY_HUMAN	P	2894;264;76	ENSP00000369600:S2894P	ENSP00000369565:S76P	S	+	1	0	FRY	31766604	0.572000	0.26668	0.240000	0.24138	0.226000	0.24999	-0.112000	0.10791	-0.570000	0.06022	0.528000	0.53228	TCC		FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044405.1	NM_023037	
ING1	3621	broad.mit.edu	37	13	111372025	111372025	+	Nonsense_Mutation	SNP	C	C	T	rs368239053		TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr13:111372025C>T	ENST00000375774.3	+	2	1477	c.1015C>T	c.(1015-1017)Cga>Tga	p.R339*	ING1_ENST00000375775.3_Nonsense_Mutation_p.R127*|ING1_ENST00000338450.7_Nonsense_Mutation_p.R152*|ING1_ENST00000333219.7_Nonsense_Mutation_p.R196*	NM_005537.4	NP_005528.3	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1	339					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell death (GO:0010941)	nucleus (GO:0005634)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.R196*(3)|p.R339*(1)|p.R152*(1)		endometrium(4)|large_intestine(6)|lung(1)|ovary(1)	12	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			CAAGGCGGAGCGAGAGGCGTC	0.627																																					p.R196X												.	.	5	Substitution - Nonsense(5)	endometrium(3)|large_intestine(2)	c.C586T	13						.						102.0	71.0	81.0					13																	111372025		2203	4300	6503	110170026	SO:0001587	stop_gained	3621	exon2				CCDS9515.1, CCDS9516.1, CCDS9517.1, CCDS9518.1	13q34	2013-01-28			ENSG00000153487	ENSG00000153487		"""Zinc fingers, PHD-type"""	6062	protein-coding gene	gene with protein product	"""inhibitor of growth 1"", ""tumor suppressor ING1"", ""growth inhibitor ING1"", ""growth inhibitory protein ING1"""	601566				8944021, 9186514	Standard	NM_198219		Approved	p33ING1, p33ING1b, p24ING1c, p33, p47, p47ING1a	uc001vri.3	Q9UK53	OTTHUMG00000017346	ENST00000375774.3:c.1015C>T	13.37:g.111372025C>T	ENSP00000364929:p.Arg339*	Somatic		Capture	Illumina HiSeq	Phase_I	110170026	NM_198219	O00532|O43658|Q53ZR3|Q5T9G8|Q5T9G9|Q5T9H0|Q5T9H1|Q9H007|Q9HD98|Q9HD99|Q9NS83|Q9P0U6|Q9UBC6|Q9UIJ1|Q9UIJ2|Q9UIJ3|Q9UIJ4|Q9UK52	Nonsense_Mutation	SNP	ENST00000375774.3	37	CCDS9517.1	.	.	.	.	.	.	.	.	.	.	C	17.73	3.461577	0.63513	.	.	ENSG00000153487	ENST00000338450;ENST00000333219;ENST00000375775;ENST00000375774	.	.	.	5.41	-4.77	0.03219	.	0.047098	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-45.0616	23.0881	0.99979	0.1965:0.8034:0.0:0.0	.	.	.	.	X	152;196;127;339	.	ENSP00000328436:R196X	R	+	1	2	ING1	110170026	0.974000	0.33945	0.853000	0.33588	0.380000	0.30137	0.240000	0.18042	-1.095000	0.03050	-0.500000	0.04577	CGA		ING1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045770.2	NM_005537	
OR4K15	81127	broad.mit.edu	37	14	20444383	20444383	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr14:20444383C>A	ENST00000305051.5	+	1	781	c.706C>A	c.(706-708)Ctc>Atc	p.L236I		NM_001005486.1	NP_001005486.1	Q8NH41	OR4KF_HUMAN	olfactory receptor, family 4, subfamily K, member 15	236						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L236I(1)		endometrium(3)|kidney(2)|large_intestine(6)|lung(23)|ovary(1)|prostate(2)|skin(1)|stomach(1)	39	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;3.58e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GAGTTCCTTTCTCCTCTTGGT	0.463																																					p.L236I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C706A	14						.						123.0	119.0	121.0					14																	20444383		2203	4298	6501	19514223	SO:0001583	missense	81127	exon1				CCDS32026.1	14q11.2	2013-09-23			ENSG00000169488	ENSG00000169488		"""GPCR / Class A : Olfactory receptors"""	15353	protein-coding gene	gene with protein product							Standard	NM_001005486		Approved	OR4K15Q	uc010tkx.2	Q8NH41	OTTHUMG00000170635	ENST00000305051.5:c.706C>A	14.37:g.20444383C>A	ENSP00000304077:p.Leu236Ile	Somatic		Capture	Illumina HiSeq	Phase_I	19514223	NM_001005486	B9EIL3|Q6IEZ4	Missense_Mutation	SNP	ENST00000305051.5	37	CCDS32026.1	.	.	.	.	.	.	.	.	.	.	.	0.005	-2.126083	0.00342	.	.	ENSG00000169488	ENST00000305051	T	0.38401	1.14	4.08	3.13	0.36017	GPCR, rhodopsin-like superfamily (1);	0.000000	0.45606	D	0.000354	T	0.16557	0.0398	N	0.20328	0.56	0.09310	N	1	B	0.16802	0.019	B	0.21360	0.034	T	0.30621	-0.9972	10	0.05833	T	0.94	.	4.9413	0.13967	0.2104:0.6787:0.0:0.1109	.	236	Q8NH41	OR4KF_HUMAN	I	236	ENSP00000304077:L236I	ENSP00000304077:L236I	L	+	1	0	OR4K15	19514223	0.000000	0.05858	0.483000	0.27378	0.284000	0.27059	-1.150000	0.03178	2.093000	0.63338	0.585000	0.79938	CTC		OR4K15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409883.1		
EAPP	55837	broad.mit.edu	37	14	34985538	34985538	+	Missense_Mutation	SNP	T	T	C	rs149923274		TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr14:34985538T>C	ENST00000250454.3	-	6	917	c.836A>G	c.(835-837)aAt>aGt	p.N279S		NM_018453.3	NP_060923.2	Q56P03	EAPP_HUMAN	E2F-associated phosphoprotein	279					negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)		p.N279S(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|urinary_tract(2)	12	Breast(36;0.0473)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00342)|Epithelial(34;0.18)	GBM - Glioblastoma multiforme(112;0.0196)		TGCTAAAACATTGAAAAAATG	0.403													T|||	1	0.000199681	0.0	0.0	5008	,	,		19676	0.0		0.001	False		,,,				2504	0.0				p.N279S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A836G	14						.	T	SER/ASN	2,3846		0,2,1922	125.0	120.0	122.0		836	5.2	1.0	14	dbSNP_134	122	0,8266		0,0,4133	no	missense	EAPP	NM_018453.3	46	0,2,6055	CC,CT,TT		0.0,0.052,0.0165	probably-damaging	279/286	34985538	2,12112	1924	4133	6057	34055289	SO:0001583	missense	55837	exon6			AF217512	CCDS41941.1	14q13	2007-03-26	2007-03-26	2007-03-26		ENSG00000129518			19312	protein-coding gene	gene with protein product		609486	"""chromosome 14 open reading frame 11"""	C14orf11		15716352	Standard	NM_018453		Approved	BM036, FLJ20578	uc001wsd.1	Q56P03		ENST00000250454.3:c.836A>G	14.37:g.34985538T>C	ENSP00000250454:p.Asn279Ser	Somatic		Capture	Illumina HiSeq	Phase_I	34055289	NM_018453	Q9BVF4|Q9NWV5|Q9NZ86	Missense_Mutation	SNP	ENST00000250454.3	37	CCDS41941.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	T	21.0	4.075383	0.76415	5.2E-4	0.0	ENSG00000129518	ENST00000250454	T	0.53640	0.61	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.50446	0.1616	M	0.65975	2.015	0.80722	D	1	B	0.23442	0.085	B	0.27076	0.076	T	0.53373	-0.8448	10	0.72032	D	0.01	-26.341	15.4478	0.75243	0.0:0.0:0.0:1.0	.	279	Q56P03	EAPP_HUMAN	S	279	ENSP00000250454:N279S	ENSP00000250454:N279S	N	-	2	0	EAPP	34055289	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	7.047000	0.76599	2.112000	0.64535	0.528000	0.53228	AAT		EAPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409847.1	NM_018453	
PCNX	22990	broad.mit.edu	37	14	71568792	71568792	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr14:71568792C>T	ENST00000304743.2	+	31	6121	c.5675C>T	c.(5674-5676)gCc>gTc	p.A1892V	PCNX_ENST00000556272.1_3'UTR|PCNX_ENST00000238570.5_Missense_Mutation_p.A1820V|PCNX_ENST00000439984.3_Missense_Mutation_p.A1781V	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	1892						integral component of membrane (GO:0016021)		p.A1892V(1)		NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		CTCGTAATAGCCCATGAAGGG	0.443																																					p.A1892V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5675T	14						.						100.0	101.0	101.0					14																	71568792		2203	4300	6503	70638545	SO:0001583	missense	22990	exon31			AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.5675C>T	14.37:g.71568792C>T	ENSP00000304192:p.Ala1892Val	Somatic		Capture	Illumina HiSeq	Phase_I	70638545	NM_014982	B2RTR6|O94897|Q96AI7|Q9Y2J9	Missense_Mutation	SNP	ENST00000304743.2	37	CCDS9806.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.9|27.9	4.870253|4.870253	0.91587|0.91587	.|.	.|.	ENSG00000100731|ENSG00000100731	ENST00000304743;ENST00000238570;ENST00000439984|ENST00000554691	T;T;T|.	0.42513|.	0.97;0.97;0.97|.	5.56|5.56	4.64|4.64	0.57946|0.57946	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.43411|0.43411	0.1246|0.1246	N|N	0.22421|0.22421	0.69|0.69	0.32381|0.32381	N|N	0.554504|0.554504	D;P;D|.	0.76494|.	0.986;0.933;0.999|.	P;P;D|.	0.74023|.	0.778;0.796;0.982|.	T|T	0.48958|0.48958	-0.8988|-0.8988	10|5	0.44086|.	T|.	0.13|.	.|.	16.5122|16.5122	0.84288|0.84288	0.0:0.8697:0.1303:0.0|0.0:0.8697:0.1303:0.0	.|.	1820;1781;1892|.	Q96RV3-3;B2RTR6;Q96RV3|.	.;.;PCX1_HUMAN|.	V|S	1892;1820;1781|879	ENSP00000304192:A1892V;ENSP00000238570:A1820V;ENSP00000396617:A1781V|.	ENSP00000238570:A1820V|.	A|P	+|+	2|1	0|0	PCNX|PCNX	70638545|70638545	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.836000|0.836000	0.47400|0.47400	7.445000|7.445000	0.80570|0.80570	2.627000|2.627000	0.88993|0.88993	0.655000|0.655000	0.94253|0.94253	GCC|CCC		PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412479.1	NM_014982	
NOXRED1	122945	broad.mit.edu	37	14	77873984	77873984	+	Silent	SNP	C	C	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr14:77873984C>T	ENST00000380835.2	-	3	520	c.354G>A	c.(352-354)gaG>gaA	p.E118E	NOXRED1_ENST00000298358.3_Silent_p.E118E	NM_001113475.2	NP_001106946.1	Q6NXP6	NXRD1_HUMAN	NADP-dependent oxidoreductase domain containing 1	118					proline biosynthetic process (GO:0006561)		pyrroline-5-carboxylate reductase activity (GO:0004735)	p.E118E(2)		NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	9						GCTTCTGGAGCTCACCTGGGA	0.468																																					p.E118E												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G354A	14						.						80.0	71.0	74.0					14																	77873984		2203	4300	6503	76943737	SO:0001819	synonymous_variant	122945	exon3			AK057371	CCDS45142.1	14q24.3	2011-09-30	2011-09-30	2011-09-30	ENSG00000165555	ENSG00000165555			20487	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 148"""	C14orf148			Standard	NM_001113475		Approved	FLJ32809	uc001xtr.3	Q6NXP6	OTTHUMG00000171554	ENST00000380835.2:c.354G>A	14.37:g.77873984C>T		Somatic		Capture	Illumina HiSeq	Phase_I	76943737	NM_138791	B3KQ47|O95435	Silent	SNP	ENST00000380835.2	37	CCDS45142.1																																																																																				NOXRED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414103.1	NM_138791	
MAGEL2	54551	broad.mit.edu	37	15	23890893	23890894	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	-	-	-	-	-	-	Unknown	Wildtype	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr15:23890893_23890894insG	ENST00000532292.1	-	1	281_282	c.187_188insC	c.(187-189)cagfs	p.Q63fs		NM_019066.4	NP_061939.3	Q9UJ55	MAGL2_HUMAN	MAGE-like 2	0					Arp2/3 complex-mediated actin nucleation (GO:0034314)|protein K63-linked ubiquitination (GO:0070534)|retrograde transport, endosome to Golgi (GO:0042147)	endosome (GO:0005768)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		CTGGGCCTGCTGGGGGGGTAGC	0.703																																					p.Q666fs												.	.	0			c.1997_1998insC	15						.																																			21441987	SO:0001589	frameshift_variant	54551	exon1			AJ243531	CCDS73700.1	15q11-q12	2008-07-18				ENSG00000254585			6814	protein-coding gene	gene with protein product		605283		NDNL1		10556298	Standard	NM_019066		Approved	nM15	uc001ywj.4	Q9UJ55		ENST00000532292.1:c.188dupC	15.37:g.23890900_23890900dupG	ENSP00000433433:p.Gln63fs	None		Capture	Illumina HiSeq	Phase_I	21441986	NM_019066		Frame_Shift_Ins	INS	ENST00000532292.1	37																																																																																					MAGEL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395182.2	NM_019066	
SEMA6D	80031	broad.mit.edu	37	15	48057209	48057209	+	Silent	SNP	C	C	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr15:48057209C>T	ENST00000316364.5	+	13	1822	c.1383C>T	c.(1381-1383)aaC>aaT	p.N461N	SEMA6D_ENST00000354744.4_Silent_p.N461N|SEMA6D_ENST00000389432.2_Silent_p.N461N|SEMA6D_ENST00000389433.2_Silent_p.N461N|SEMA6D_ENST00000536845.2_Silent_p.N461N|SEMA6D_ENST00000389425.3_Silent_p.N461N|SEMA6D_ENST00000355997.3_Silent_p.N461N|SEMA6D_ENST00000389428.3_Silent_p.N461N|SEMA6D_ENST00000537942.1_Silent_p.N461N|SEMA6D_ENST00000358066.4_Silent_p.N461N|SEMA6D_ENST00000558014.1_Silent_p.N461N|SEMA6D_ENST00000558816.1_Silent_p.N461N	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	461	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.N461N(1)		biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		TCTCTTTGAACGACAGCGTAT	0.448																																					p.N461N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1383T	15						.						129.0	114.0	119.0					15																	48057209		2198	4297	6495	45844501	SO:0001819	synonymous_variant	80031	exon13			AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.1383C>T	15.37:g.48057209C>T		Somatic		Capture	Illumina HiSeq	Phase_I	45844501	NM_153619	A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Silent	SNP	ENST00000316364.5	37	CCDS32225.1																																																																																				SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416868.1	NM_024966	
SHC4	399694	broad.mit.edu	37	15	49254870	49254870	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr15:49254870G>A	ENST00000332408.4	-	1	771	c.343C>T	c.(343-345)Cct>Tct	p.P115S		NM_203349.3	NP_976224.3	Q6S5L8	SHC4_HUMAN	SHC (Src homology 2 domain containing) family, member 4	115	CH2.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of cell proliferation (GO:0008284)|regulation of gene expression (GO:0010468)|stem cell differentiation (GO:0048863)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)		p.P115S(2)		breast(1)|endometrium(2)|large_intestine(8)|lung(11)|ovary(3)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	29		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)		TTCAGCCGAGGCACCTCTTTG	0.597																																					p.P115S												.	.	2	Substitution - Missense(2)	large_intestine(1)|skin(1)	c.C343T	15						.						47.0	51.0	49.0					15																	49254870		2197	4295	6492	47042162	SO:0001583	missense	399694	exon1			AY358250	CCDS10130.1	15q21.1-q21.2	2013-02-14			ENSG00000185634	ENSG00000185634		"""SH2 domain containing"""	16743	protein-coding gene	gene with protein product	"""rai-like protein"""						Standard	NM_203349		Approved	RaLP	uc001zxb.1	Q6S5L8	OTTHUMG00000131513	ENST00000332408.4:c.343C>T	15.37:g.49254870G>A	ENSP00000329668:p.Pro115Ser	Somatic		Capture	Illumina HiSeq	Phase_I	47042162	NM_203349	Q6UXQ3|Q8IYW3	Missense_Mutation	SNP	ENST00000332408.4	37	CCDS10130.1	.	.	.	.	.	.	.	.	.	.	G	11.32	1.603271	0.28534	.	.	ENSG00000185634	ENST00000332408	T	0.05199	3.48	4.67	3.74	0.42951	.	0.316169	0.25964	N	0.027173	T	0.05044	0.0135	N	0.17082	0.46	0.80722	D	1	B	0.10296	0.003	B	0.04013	0.001	T	0.38757	-0.9646	10	0.36615	T	0.2	-15.4115	14.1207	0.65184	0.0:0.0:0.8492:0.1508	.	115	Q6S5L8	SHC4_HUMAN	S	115	ENSP00000329668:P115S	ENSP00000329668:P115S	P	-	1	0	SHC4	47042162	1.000000	0.71417	0.991000	0.47740	0.994000	0.84299	4.548000	0.60718	1.162000	0.42619	0.655000	0.94253	CCT		SHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254371.1	NM_203349	
CIITA	4261	broad.mit.edu	37	16	11001864	11001864	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr16:11001864C>T	ENST00000324288.8	+	11	2648	c.2515C>T	c.(2515-2517)Cgc>Tgc	p.R839C	CIITA_ENST00000537380.1_Intron|CIITA_ENST00000381835.5_Intron	NM_000246.3	NP_000237	P33076	C2TA_HUMAN	class II, major histocompatibility complex, transactivator	839					aging (GO:0007568)|cellular response to electrical stimulus (GO:0071257)|cellular response to exogenous dsRNA (GO:0071360)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to antibiotic (GO:0046677)|response to interferon-gamma (GO:0034341)|transcription, DNA-templated (GO:0006351)	cell surface (GO:0009986)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|kinase activity (GO:0016301)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transferase activity, transferring acyl groups (GO:0016746)	p.R839C(1)		central_nervous_system(1)|large_intestine(7)|ovary(1)|skin(1)|stomach(2)	12						TCTGGGCACCCGCCTCACGCC	0.662			T	"""FLJ27352, CD274, CD273, RALGDS, RUNDC2A, C16orf75, BCL6"""	"""PMBL, Hodgkin Lymphona, """																																p.R839C			Dom	yes		16	16p13	4261	"""class II, major histocompatibility complex, transactivator"""		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2515T	16						.						26.0	29.0	28.0					16																	11001864		2196	4300	6496	10909365	SO:0001583	missense	4261	exon11			U18259	CCDS10544.1, CCDS66943.1, CCDS73826.1	16p13	2014-09-17	2005-08-12	2005-08-12	ENSG00000179583	ENSG00000179583		"""Nucleotide-binding domain and leucine rich repeat containing"""	7067	protein-coding gene	gene with protein product	"""NLR family, acid domain containing"", ""nucleotide-binding oligomerization domain, leucine rich repeat and acid domain containing"""	600005	"""MHC class II transactivator"""	MHC2TA		8402893	Standard	NM_000246		Approved	C2TA, NLRA	uc002dai.4	P33076	OTTHUMG00000129753	ENST00000324288.8:c.2515C>T	16.37:g.11001864C>T	ENSP00000316328:p.Arg839Cys	Somatic		Capture	Illumina HiSeq	Phase_I	10909365	NM_000246	A0N0N9|D3DUG0|E9PFE0|Q29675|Q8SNB8|Q96KL4	Missense_Mutation	SNP	ENST00000324288.8	37	CCDS10544.1	.	.	.	.	.	.	.	.	.	.	C	10.81	1.455410	0.26161	.	.	ENSG00000179583	ENST00000324288;ENST00000388910	T	0.53857	0.6	5.0	4.05	0.47172	.	0.133715	0.34386	N	0.004009	T	0.64538	0.2607	M	0.68952	2.095	0.20307	N	0.999918	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.964;0.962;0.989;0.997	T	0.56559	-0.7959	10	0.72032	D	0.01	.	4.2956	0.10899	0.1578:0.6024:0.1532:0.0866	.	839;839;791;839	A0N0N9;P33076;F2Z2G8;Q96KL4	.;C2TA_HUMAN;.;.	C	839;791	ENSP00000316328:R839C	ENSP00000316328:R839C	R	+	1	0	CIITA	10909365	0.497000	0.26067	0.974000	0.42286	0.022000	0.10575	1.435000	0.34969	1.093000	0.41377	-0.150000	0.13652	CGC		CIITA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251966.2	NM_000246	
PHKB	5257	broad.mit.edu	37	16	47549477	47549477	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr16:47549477T>G	ENST00000323584.5	+	6	583	c.559T>G	c.(559-561)Tcc>Gcc	p.S187A	PHKB_ENST00000567402.1_3'UTR|PHKB_ENST00000566044.1_Missense_Mutation_p.S180A|PHKB_ENST00000455779.1_Missense_Mutation_p.S180A|PHKB_ENST00000299167.8_Missense_Mutation_p.S187A	NM_000293.2	NP_000284.1	Q93100	KPBB_HUMAN	phosphorylase kinase, beta	187					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)	p.S187A(2)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|liver(1)|lung(18)|ovary(1)|skin(1)	41		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				GGAAATGATTTCCTCAGGACT	0.313																																					p.S180A												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T538G	16						.						131.0	122.0	125.0					16																	47549477		2201	4297	6498	46106978	SO:0001583	missense	5257	exon7				CCDS10729.1, CCDS42161.1	16q12-q13	2009-07-10			ENSG00000102893	ENSG00000102893	2.7.11.19		8927	protein-coding gene	gene with protein product		172490					Standard	NM_000293		Approved		uc002eev.4	Q93100	OTTHUMG00000133102	ENST00000323584.5:c.559T>G	16.37:g.47549477T>G	ENSP00000313504:p.Ser187Ala	Somatic		Capture	Illumina HiSeq	Phase_I	46106978	NM_001031835	Q8N4T5	Missense_Mutation	SNP	ENST00000323584.5	37	CCDS10729.1	.	.	.	.	.	.	.	.	.	.	T	12.19	1.863057	0.32884	.	.	ENSG00000102893	ENST00000299167;ENST00000455779;ENST00000323584	D;D	0.92805	-3.11;-3.11	5.73	4.6	0.57074	Six-hairpin glycosidase-like (1);Glycoside hydrolase 15-related (1);	0.051246	0.85682	D	0.000000	T	0.80276	0.4593	N	0.11201	0.11	0.40250	D	0.978059	P;B;P	0.39480	0.675;0.056;0.649	B;B;B	0.36845	0.127;0.062;0.234	T	0.79514	-0.1772	10	0.02654	T	1	-19.6438	12.1819	0.54216	0.0:0.0:0.143:0.857	.	180;187;180	B4DQ16;Q93100;Q93100-4	.;KPBB_HUMAN;.	A	180;180;187	ENSP00000414345:S180A;ENSP00000313504:S187A	ENSP00000299167:S180A	S	+	1	0	PHKB	46106978	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.580000	0.60942	1.052000	0.40392	0.533000	0.62120	TCC		PHKB-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000430413.1		
BRD7	29117	broad.mit.edu	37	16	50367525	50367525	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr16:50367525T>C	ENST00000394688.3	-	8	1130	c.971A>G	c.(970-972)gAa>gGa	p.E324G	BRD7_ENST00000394689.2_Missense_Mutation_p.E324G			Q9NPI1	BRD7_HUMAN	bromodomain containing 7	324					cell cycle (GO:0007049)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.E324G(1)		autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|prostate(2)|urinary_tract(2)	22		all_cancers(37;0.0127)				TCCTCCAGATTCCTTCACGAT	0.403																																					p.E324G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A971G	16						.						201.0	205.0	204.0					16																	50367525		2198	4300	6498	48925026	SO:0001583	missense	29117	exon8			AF213969	CCDS10742.1, CCDS54007.1	16q12.1	2008-11-18	2002-01-14		ENSG00000166164	ENSG00000166164			14310	protein-coding gene	gene with protein product			"""bromodomain-containing 7"""			10526152, 18809673	Standard	NM_013263		Approved	CELTIX1, BP75	uc002ege.2	Q9NPI1	OTTHUMG00000133170	ENST00000394688.3:c.971A>G	16.37:g.50367525T>C	ENSP00000378180:p.Glu324Gly	Somatic		Capture	Illumina HiSeq	Phase_I	48925026	NM_013263	Q4VC09|Q8N2L9|Q96KA4|Q9BV48|Q9UH59	Missense_Mutation	SNP	ENST00000394688.3	37	CCDS10742.1	.	.	.	.	.	.	.	.	.	.	T	18.91	3.723275	0.68959	.	.	ENSG00000166164	ENST00000394688;ENST00000394689	T;T	0.57107	0.42;0.42	5.24	5.24	0.73138	.	0.044862	0.85682	D	0.000000	T	0.70928	0.3280	M	0.71581	2.175	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.78314	0.991;0.984	T	0.72606	-0.4242	10	0.48119	T	0.1	-15.7535	15.439	0.75168	0.0:0.0:0.0:1.0	.	324;324	Q9NPI1;Q9NPI1-2	BRD7_HUMAN;.	G	324	ENSP00000378180:E324G;ENSP00000378181:E324G	ENSP00000378180:E324G	E	-	2	0	BRD7	48925026	1.000000	0.71417	0.839000	0.33178	0.287000	0.27160	6.640000	0.74319	2.104000	0.64026	0.482000	0.46254	GAA		BRD7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256874.3	NM_013263	
HYDIN	54768	broad.mit.edu	37	16	71061731	71061731	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr16:71061731C>T	ENST00000393567.2	-	20	2966	c.2816G>A	c.(2815-2817)cGg>cAg	p.R939Q	HYDIN_ENST00000448089.2_Missense_Mutation_p.R939Q|HYDIN_ENST00000448691.1_Missense_Mutation_p.R939Q|HYDIN_ENST00000321489.5_Missense_Mutation_p.R939Q	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	939					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.R939Q(6)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				CTGTTGGATCCGACGTCCCTT	0.498																																					p.R939Q												.	.	6	Substitution - Missense(6)	large_intestine(6)	c.G2816A	16						.						4.0	3.0	3.0					16																	71061731		1548	3175	4723	69619232	SO:0001583	missense	54768	exon20			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.2816G>A	16.37:g.71061731C>T	ENSP00000377197:p.Arg939Gln	Somatic		Capture	Illumina HiSeq	Phase_I	69619232	NM_032821	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	C	35	5.433403	0.96150	.	.	ENSG00000157423	ENST00000393567;ENST00000316490;ENST00000448089;ENST00000448691;ENST00000321489	T;T;T;T	0.07327	3.2;3.2;3.2;3.2	5.07	5.07	0.68467	.	0.000000	0.31020	U	0.008406	T	0.33323	0.0859	M	0.85373	2.75	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.10314	-1.0635	10	0.29301	T	0.29	.	18.0946	0.89485	0.0:1.0:0.0:0.0	.	939;939	Q4G0P3-5;F8WD23	.;.	Q	939	ENSP00000377197:R939Q;ENSP00000398544:R939Q;ENSP00000394826:R939Q;ENSP00000314736:R939Q	ENSP00000313052:R939Q	R	-	2	0	HYDIN	69619232	1.000000	0.71417	0.990000	0.47175	0.947000	0.59692	4.720000	0.61944	2.400000	0.81607	0.499000	0.49734	CGG		HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
GIT1	28964	broad.mit.edu	37	17	27902867	27902867	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr17:27902867G>A	ENST00000225394.3	-	16	1963	c.1715C>T	c.(1714-1716)cCg>cTg	p.P572L	GIT1_ENST00000579937.1_Missense_Mutation_p.P572L|GIT1_ENST00000581348.1_Intron|GIT1_ENST00000394869.3_Missense_Mutation_p.P581L|RP11-68I3.2_ENST00000581474.1_RNA	NM_014030.3	NP_054749.2	Q9Y2X7	GIT1_HUMAN	G protein-coupled receptor kinase interacting ArfGAP 1	572					regulation of ARF GTPase activity (GO:0032312)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.P572L(1)		large_intestine(2)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				READ - Rectum adenocarcinoma(3;0.0419)|Colorectal(3;0.069)		GGACAGCAGCGGGGAGGAGGG	0.662																																					p.P572L	Colon(81;41 1719 20078 35068)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1715T	17						.						75.0	80.0	78.0					17																	27902867		2199	4298	6497	24926993	SO:0001583	missense	28964	exon16			AF124490	CCDS11250.1, CCDS42290.1	17p11.2	2013-01-10	2008-09-05		ENSG00000108262	ENSG00000108262		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	4272	protein-coding gene	gene with protein product		608434	"""G protein-coupled receptor kinase interactor 1"""			9826657, 10896954	Standard	NM_014030		Approved		uc002heg.2	Q9Y2X7	OTTHUMG00000132730	ENST00000225394.3:c.1715C>T	17.37:g.27902867G>A	ENSP00000225394:p.Pro572Leu	Somatic		Capture	Illumina HiSeq	Phase_I	24926993	NM_014030	B4DGU9|B4DSV3|Q86SS0|Q9BRJ4	Missense_Mutation	SNP	ENST00000225394.3	37	CCDS11250.1	.	.	.	.	.	.	.	.	.	.	G	17.10	3.301926	0.60195	.	.	ENSG00000108262	ENST00000225394;ENST00000394869	T;T	0.69040	-0.3;-0.37	4.9	4.9	0.64082	.	0.254676	0.39341	N	0.001382	T	0.57917	0.2086	L	0.34521	1.04	0.80722	D	1	B;B;B	0.17268	0.021;0.012;0.005	B;B;B	0.15052	0.012;0.005;0.003	T	0.51756	-0.8665	10	0.30078	T	0.28	.	18.6552	0.91450	0.0:0.0:1.0:0.0	.	581;581;572	Q9Y2X7-3;B4DGU9;Q9Y2X7	.;.;GIT1_HUMAN	L	572;581	ENSP00000225394:P572L;ENSP00000378338:P581L	ENSP00000225394:P572L	P	-	2	0	GIT1	24926993	1.000000	0.71417	0.996000	0.52242	0.918000	0.54935	6.105000	0.71505	2.728000	0.93425	0.462000	0.41574	CCG		GIT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256073.1	NM_014030	
CCL7	6354	broad.mit.edu	37	17	32598269	32598269	+	Missense_Mutation	SNP	C	C	T	rs149253093		TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr17:32598269C>T	ENST00000378569.2	+	2	251	c.181C>T	c.(181-183)Cgg>Tgg	p.R61W	CCL7_ENST00000200307.4_Missense_Mutation_p.R71W|CCL7_ENST00000394630.3_Intron|CCL7_ENST00000394627.1_Silent_p.P78P	NM_006273.2	NP_006264.2	P80098	CCL7_HUMAN	chemokine (C-C motif) ligand 7	61					cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|cellular response to ethanol (GO:0071361)|chemotaxis (GO:0006935)|cytoskeleton organization (GO:0007010)|eosinophil chemotaxis (GO:0048245)|immune response (GO:0006955)|inflammatory response (GO:0006954)|monocyte chemotaxis (GO:0002548)|positive regulation of cell migration (GO:0030335)|positive regulation of natural killer cell chemotaxis (GO:2000503)|regulation of cell shape (GO:0008360)|response to gamma radiation (GO:0010332)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	CCR1 chemokine receptor binding (GO:0031726)|chemokine activity (GO:0008009)|heparin binding (GO:0008201)	p.R61W(1)		autonomic_ganglia(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	7	Breast(3;0.00224)	Breast(31;0.151)|Ovarian(249;0.17)		BRCA - Breast invasive adenocarcinoma(366;0.155)		CCACTGTCCCCGGGAAGCTGT	0.488																																					p.R61W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C181T	17						.	C	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	99.0	104.0	102.0		181	-8.9	0.0	17	dbSNP_134	102	0,8600		0,0,4300	no	missense	CCL7	NM_006273.2	101	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	61/100	32598269	1,13005	2203	4300	6503	29622382	SO:0001583	missense	6354	exon2			AF043338	CCDS11278.1	17q11.2-q12	2013-02-25	2002-08-22	2002-08-23	ENSG00000108688	ENSG00000108688		"""Chemokine ligands"", ""Endogenous ligands"""	10634	protein-coding gene	gene with protein product	"""monocyte chemoattractant protein 3"", ""monocyte chemotactic protein 3"""	158106	"""small inducible cytokine A7 (monocyte chemotactic protein 3)"""	SCYA6, SCYA7		8461011	Standard	NM_006273		Approved	MCP-3, NC28, FIC, MARC, MCP3	uc002hhz.4	P80098	OTTHUMG00000132889	ENST00000378569.2:c.181C>T	17.37:g.32598269C>T	ENSP00000367832:p.Arg61Trp	Somatic		Capture	Illumina HiSeq	Phase_I	29622382	NM_006273	Q569J6	Missense_Mutation	SNP	ENST00000378569.2	37	CCDS11278.1	.	.	.	.	.	.	.	.	.	.	C	8.736	0.917856	0.17982	2.27E-4	0.0	ENSG00000108688	ENST00000378569;ENST00000200307	.	.	.	4.43	-8.85	0.00799	CC chemokine, conserved site (1);Chemokine interleukin-8-like domain (3);	1.628260	0.03756	N	0.257354	T	0.25306	0.0615	.	.	.	0.09310	N	1	B	0.18610	0.029	B	0.15484	0.013	T	0.16867	-1.0388	8	0.44086	T	0.13	.	6.9345	0.24459	0.6083:0.1171:0.0:0.2746	.	61	P80098	CCL7_HUMAN	W	71;61	.	ENSP00000200307:R61W	R	+	1	2	CCL7	29622382	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.917000	0.00695	-2.052000	0.00902	-0.890000	0.02929	CGG		CCL7-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256386.2	NM_006273	
UNC45B	146862	broad.mit.edu	37	17	33513328	33513328	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr17:33513328G>T	ENST00000268876.5	+	20	2643	c.2546G>T	c.(2545-2547)tGg>tTg	p.W849L	UNC45B_ENST00000433649.1_Missense_Mutation_p.W847L|UNC45B_ENST00000591048.1_Missense_Mutation_p.W768L|RP11-799D4.2_ENST00000590144.1_RNA|UNC45B_ENST00000394570.2_Missense_Mutation_p.W847L|UNC45B_ENST00000378449.1_Missense_Mutation_p.W768L	NM_173167.2	NP_775259.1	Q8IWX7	UN45B_HUMAN	unc-45 homolog B (C. elegans)	849					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.W849L(1)		breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(10)|lung(24)|ovary(3)|prostate(2)|skin(1)|stomach(1)|urinary_tract(3)	59		Ovarian(249;0.17)				ACAACCCAGTGGTTGGAGATC	0.562																																					p.W849L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2546T	17						.						78.0	79.0	79.0					17																	33513328		2203	4300	6503	30537441	SO:0001583	missense	146862	exon20			AW755253	CCDS11292.1, CCDS45648.1	17q12	2008-02-05	2005-11-17	2005-11-17	ENSG00000141161	ENSG00000141161			14304	protein-coding gene	gene with protein product		611220	"""cardiomyopathy associated 4"""	CMYA4		12356907	Standard	NM_001267052		Approved	UNC45	uc002hja.3	Q8IWX7	OTTHUMG00000132931	ENST00000268876.5:c.2546G>T	17.37:g.33513328G>T	ENSP00000268876:p.Trp849Leu	Somatic		Capture	Illumina HiSeq	Phase_I	30537441	NM_173167	Q495Q8|Q495Q9	Missense_Mutation	SNP	ENST00000268876.5	37	CCDS11292.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.040580	0.75732	.	.	ENSG00000141161	ENST00000394570;ENST00000268876;ENST00000433649;ENST00000378449	T;T;T	0.40756	3.98;1.93;1.02	6.02	6.02	0.97574	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.71443	0.3340	M	0.86502	2.82	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.996;0.999;0.999	T	0.73972	-0.3814	10	0.62326	D	0.03	-16.3262	19.5289	0.95219	0.0:0.0:1.0:0.0	.	768;847;849	Q8IWX7-2;Q8IWX7-3;Q8IWX7	.;.;UN45B_HUMAN	L	849;849;847;768	ENSP00000268876:W849L;ENSP00000412840:W847L;ENSP00000367710:W768L	ENSP00000268876:W849L	W	+	2	0	UNC45B	30537441	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.674000	0.98633	2.865000	0.98341	0.655000	0.94253	TGG		UNC45B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256458.2	NM_173167	
CAMTA2	23125	broad.mit.edu	37	17	4883119	4883119	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr17:4883119G>T	ENST00000348066.3	-	9	1621	c.1498C>A	c.(1498-1500)Ccc>Acc	p.P500T	CAMTA2_ENST00000414043.3_Missense_Mutation_p.P523T|CAMTA2_ENST00000381311.5_Missense_Mutation_p.P502T|CAMTA2_ENST00000572543.1_Missense_Mutation_p.P505T|CAMTA2_ENST00000571831.1_5'Flank|CAMTA2_ENST00000358183.4_Missense_Mutation_p.P500T|CAMTA2_ENST00000361571.5_Missense_Mutation_p.P499T	NM_015099.3	NP_055914.2	O94983	CMTA2_HUMAN	calmodulin binding transcription activator 2	500					cardiac muscle hypertrophy in response to stress (GO:0014898)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|transcription factor binding (GO:0008134)	p.P500T(1)		breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						AGACTGAAGGGCTCCAGTTCA	0.587																																					p.P500T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1498A	17						.						124.0	123.0	123.0					17																	4883119		2203	4300	6503	4823843	SO:0001583	missense	23125	exon9			AB020716	CCDS11063.1, CCDS54071.1, CCDS54072.1, CCDS54073.1	17p13.3	2004-09-01			ENSG00000108509	ENSG00000108509			18807	protein-coding gene	gene with protein product		611508				11925432	Standard	NM_015099		Approved	KIAA0909	uc010cku.2	O94983	OTTHUMG00000099417	ENST00000348066.3:c.1498C>A	17.37:g.4883119G>T	ENSP00000321813:p.Pro500Thr	Somatic		Capture	Illumina HiSeq	Phase_I	4823843	NM_015099	B9EGL0|D3DTL5|E7EWU5|Q7Z6M8|Q8N3V0|Q8NDG4|Q96G17	Missense_Mutation	SNP	ENST00000348066.3	37	CCDS11063.1	.	.	.	.	.	.	.	.	.	.	G	7.925	0.739449	0.15642	.	.	ENSG00000108509	ENST00000414043;ENST00000381311;ENST00000361571;ENST00000358183;ENST00000348066	T;T;T;T;T	0.31510	2.71;1.73;1.49;1.74;1.51	5.09	4.07	0.47477	.	0.151604	0.41605	D	0.000849	T	0.31199	0.0789	N	0.12182	0.205	0.29628	N	0.845679	B;B;B;B;D	0.76494	0.002;0.01;0.021;0.012;0.999	B;B;B;B;D	0.80764	0.005;0.007;0.019;0.008;0.994	T	0.05273	-1.0895	10	0.10902	T	0.67	-16.743	12.557	0.56258	0.0:0.0:0.8239:0.1761	.	476;523;502;500;499	B7ZM30;E7EWU5;O94983-3;O94983;O94983-4	.;.;.;CMTA2_HUMAN;.	T	523;502;499;500;500	ENSP00000412886:P523T;ENSP00000370712:P502T;ENSP00000354828:P499T;ENSP00000350910:P500T;ENSP00000321813:P500T	ENSP00000321813:P500T	P	-	1	0	CAMTA2	4823843	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.561000	0.53770	2.653000	0.90120	0.655000	0.94253	CCC		CAMTA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216876.1	NM_015099	
GJC1	10052	broad.mit.edu	37	17	42882168	42882168	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr17:42882168G>A	ENST00000426548.1	-	3	1287	c.1018C>T	c.(1018-1020)Cgg>Tgg	p.R340W	GJC1_ENST00000592524.1_Missense_Mutation_p.R340W|GJC1_ENST00000330514.4_Missense_Mutation_p.R340W|GJC1_ENST00000590758.1_Missense_Mutation_p.R340W	NM_001080383.1|NM_005497.3	NP_001073852.1|NP_005488.2	P36383	CXG1_HUMAN	gap junction protein, gamma 1, 45kDa	340					atrial cardiac muscle cell action potential (GO:0086014)|cardiac muscle tissue development (GO:0048738)|cell development (GO:0048468)|cell-cell junction assembly (GO:0007043)|gap junction assembly (GO:0016264)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vasculogenesis (GO:0001570)|visual perception (GO:0007601)	connexon complex (GO:0005922)|endoplasmic reticulum membrane (GO:0005789)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)|ion channel activity (GO:0005216)	p.R340W(1)		NS(1)|kidney(1)|large_intestine(5)|liver(1)|lung(10)|prostate(1)	19		Prostate(33;0.0959)				CTGATCTCCCGCTGCAGAGCC	0.567																																					p.R340W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1018T	17						.						174.0	159.0	164.0					17																	42882168		2203	4300	6503	40237694	SO:0001583	missense	10052	exon3			U03493	CCDS11487.1	17q21.31	2008-02-04	2007-11-06	2007-11-06		ENSG00000182963		"""Ion channels / Gap junction proteins (connexins)"""	4280	protein-coding gene	gene with protein product	"""connexin 45"""	608655	"""gap junction protein, alpha 7, 45kDa"""	GJA7		7966354	Standard	NM_005497		Approved	CX45	uc002ihl.3	P36383		ENST00000426548.1:c.1018C>T	17.37:g.42882168G>A	ENSP00000411528:p.Arg340Trp	Somatic		Capture	Illumina HiSeq	Phase_I	40237694	NM_005497	B3KW68|Q4VAY0	Missense_Mutation	SNP	ENST00000426548.1	37	CCDS11487.1	.	.	.	.	.	.	.	.	.	.	G	15.85	2.954209	0.53293	.	.	ENSG00000182963	ENST00000426548;ENST00000330514	D;D	0.98178	-4.77;-4.77	5.48	0.784	0.18578	.	0.285327	0.33040	N	0.005356	D	0.97383	0.9144	L	0.27053	0.805	0.42529	D	0.993033	D	0.89917	1.0	D	0.65684	0.937	D	0.96484	0.9358	10	0.87932	D	0	.	14.7235	0.69326	0.0:0.0:0.3819:0.6181	.	340	P36383	CXG1_HUMAN	W	340	ENSP00000411528:R340W;ENSP00000333193:R340W	ENSP00000333193:R340W	R	-	1	2	GJC1	40237694	1.000000	0.71417	0.996000	0.52242	0.980000	0.70556	3.127000	0.50484	0.222000	0.20900	0.655000	0.94253	CGG		GJC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448661.1	NM_005497	
ABCA10	10349	broad.mit.edu	37	17	67150043	67150043	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr17:67150043C>A	ENST00000269081.4	-	33	4803	c.3894G>T	c.(3892-3894)atG>atT	p.M1298I	ABCA10_ENST00000519732.1_5'UTR|ABCA10_ENST00000416101.2_3'UTR	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	1298	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.M1298I(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					AGTGCTCTTTCATTGTAAGCT	0.483																																					p.M1298I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3894T	17						.						137.0	133.0	134.0					17																	67150043		2203	4300	6503	64661638	SO:0001583	missense	10349	exon33			AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.3894G>T	17.37:g.67150043C>A	ENSP00000269081:p.Met1298Ile	Somatic		Capture	Illumina HiSeq	Phase_I	64661638	NM_080282	C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Missense_Mutation	SNP	ENST00000269081.4	37	CCDS11684.1	.	.	.	.	.	.	.	.	.	.	C	13.88	2.369599	0.42003	.	.	ENSG00000154263	ENST00000269081	D	0.92752	-3.1	3.74	1.47	0.22746	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.554954	0.13275	U	0.400199	T	0.77232	0.4100	N	0.01464	-0.85	0.58432	D	0.999999	B;B	0.15473	0.002;0.013	B;B	0.19666	0.017;0.026	T	0.66716	-0.5853	10	0.30078	T	0.28	.	8.9825	0.35974	0.0:0.7457:0.1549:0.0994	.	290;1298	B4DPV2;Q8WWZ4	.;ABCAA_HUMAN	I	1298	ENSP00000269081:M1298I	ENSP00000269081:M1298I	M	-	3	0	ABCA10	64661638	0.000000	0.05858	0.001000	0.08648	0.302000	0.27658	-0.065000	0.11617	0.734000	0.32515	0.563000	0.77884	ATG		ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379881.4	NM_080282	
PGS1	9489	broad.mit.edu	37	17	76399861	76399861	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr17:76399861G>T	ENST00000262764.6	+	7	1119	c.1093G>T	c.(1093-1095)Gat>Tat	p.D365Y	PGS1_ENST00000329897.7_Missense_Mutation_p.D230Y|PGS1_ENST00000588281.1_3'UTR	NM_024419.3	NP_077733.3	Q32NB8	PGPS1_HUMAN	phosphatidylglycerophosphate synthase 1	365					cardiolipin biosynthetic process (GO:0032049)|diacylglycerol metabolic process (GO:0046339)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity (GO:0008444)	p.D365Y(1)		cervix(2)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	10			BRCA - Breast invasive adenocarcinoma(99;0.00144)|OV - Ovarian serous cystadenocarcinoma(97;0.031)			GATTCAAATCGATGAGATTGT	0.547																																					p.D365Y	Esophageal Squamous(45;182 1126 10685 43198)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1093T	17						.						90.0	94.0	93.0					17																	76399861		2032	4198	6230	73911456	SO:0001583	missense	9489	exon7				CCDS42391.1	17q25.3	2006-02-09							30029	protein-coding gene	gene with protein product		614942				9880566	Standard	XR_243691		Approved	DKFZP762M186	uc002jvm.3	Q32NB8		ENST00000262764.6:c.1093G>T	17.37:g.76399861G>T	ENSP00000262764:p.Asp365Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	73911456	NM_024419	B7ZA32|Q8IYK9|Q8TA85|Q96A75|Q9H7G9|Q9NPW7	Missense_Mutation	SNP	ENST00000262764.6	37	CCDS42391.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.130579	0.77549	.	.	ENSG00000087157	ENST00000262764;ENST00000329897;ENST00000335081	D;D	0.92348	-3.02;-3.02	5.59	5.59	0.84812	.	0.110534	0.64402	D	0.000013	D	0.96753	0.8940	M	0.87758	2.905	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97057	0.9768	10	0.87932	D	0	-19.3675	19.5827	0.95475	0.0:0.0:1.0:0.0	.	365	Q32NB8	PGPS1_HUMAN	Y	365;230;230	ENSP00000262764:D365Y;ENSP00000330039:D230Y	ENSP00000262764:D365Y	D	+	1	0	PGS1	73911456	1.000000	0.71417	0.758000	0.31321	0.681000	0.39784	9.410000	0.97335	2.629000	0.89072	0.563000	0.77884	GAT		PGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437301.1	NM_024419	
SOX9	6662	broad.mit.edu	37	17	70120265	70120265	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr17:70120265delT	ENST00000245479.2	+	3	1639	c.1267delT	c.(1267-1269)ttcfs	p.F423fs		NM_000346.3	NP_000337.1	P48436	SOX9_HUMAN	SRY (sex determining region Y)-box 9	423					astrocyte fate commitment (GO:0060018)|branching involved in ureteric bud morphogenesis (GO:0001658)|cAMP-mediated signaling (GO:0019933)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cell fate specification (GO:0001708)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to heparin (GO:0071504)|cellular response to interleukin-1 (GO:0071347)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|chondrocyte hypertrophy (GO:0003415)|chromatin remodeling (GO:0006338)|cochlea morphogenesis (GO:0090103)|cytoskeleton organization (GO:0007010)|endocardial cushion morphogenesis (GO:0003203)|endocrine pancreas development (GO:0031018)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation involved in prostatic bud elongation (GO:0060517)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|heart valve development (GO:0003170)|heart valve formation (GO:0003188)|heart valve morphogenesis (GO:0003179)|intestinal epithelial structure maintenance (GO:0060729)|intrahepatic bile duct development (GO:0035622)|limb bud formation (GO:0060174)|lung epithelial cell differentiation (GO:0060487)|male germ-line sex determination (GO:0019100)|male gonad development (GO:0008584)|mammary gland development (GO:0030879)|metanephric nephron tubule formation (GO:0072289)|morphogenesis of a branching epithelium (GO:0061138)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biomineral tissue development (GO:0070168)|negative regulation of bone mineralization (GO:0030502)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of immune system process (GO:0002683)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of ossification (GO:0030279)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell development (GO:0014032)|notochord development (GO:0030903)|nucleosome assembly (GO:0006334)|oligodendrocyte differentiation (GO:0048709)|ossification (GO:0001503)|otic vesicle formation (GO:0030916)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation involved in heart morphogenesis (GO:2000138)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of extracellular matrix assembly (GO:1901203)|positive regulation of kidney development (GO:0090184)|positive regulation of male gonad development (GO:2000020)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein complex assembly (GO:0006461)|protein kinase B signaling (GO:0043491)|regulation of apoptotic process (GO:0042981)|regulation of branching involved in lung morphogenesis (GO:0061046)|regulation of cell adhesion (GO:0030155)|regulation of cell cycle process (GO:0010564)|regulation of cell proliferation (GO:0042127)|regulation of cell proliferation involved in tissue homeostasis (GO:0060784)|regulation of epithelial cell proliferation involved in lung morphogenesis (GO:2000794)|renal vesicle induction (GO:0072034)|retina development in camera-type eye (GO:0060041)|retinal rod cell differentiation (GO:0060221)|Sertoli cell development (GO:0060009)|Sertoli cell differentiation (GO:0060008)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|spermatogenesis (GO:0007283)|tissue homeostasis (GO:0001894)|transcription from RNA polymerase II promoter (GO:0006366)|ureter morphogenesis (GO:0072197)|ureter smooth muscle cell differentiation (GO:0072193)|ureter urothelium development (GO:0072190)	nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|enhancer binding (GO:0035326)|enhancer sequence-specific DNA binding (GO:0001158)|pre-mRNA intronic binding (GO:0097157)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase activity (GO:0004672)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.F423fs*47(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(5)|pancreas(1)|upper_aerodigestive_tract(2)	26		Colorectal(1115;0.245)	STAD - Stomach adenocarcinoma(260;0.119)			CTACAGCCCCTTCAACCTCCC	0.637																																					p.F423fs	Pancreas(42;83 1041 2320 35205 39456)											.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1267delT	17						.						248.0	224.0	232.0					17																	70120265		2203	4300	6503	67631860	SO:0001589	frameshift_variant	6662	exon3			S74506	CCDS11689.1	17q24.3	2013-10-17	2008-07-31		ENSG00000125398	ENSG00000125398		"""SRY (sex determining region Y)-boxes"""	11204	protein-coding gene	gene with protein product		608160	"""campomelic dysplasia, autosomal sex-reversal"""	CMD1, CMPD1		8348155	Standard	NM_000346		Approved	SRA1	uc002jiw.3	P48436	OTTHUMG00000166300	ENST00000245479.2:c.1267delT	17.37:g.70120265delT	ENSP00000245479:p.Phe423fs	Somatic		Capture	Illumina HiSeq	Phase_I	67631860	NM_000346	Q53Y80	Frame_Shift_Del	DEL	ENST00000245479.2	37	CCDS11689.1																																																																																				SOX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389032.1	NM_000346	
RPTOR	57521	broad.mit.edu	37	17	78796012	78796012	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr17:78796012G>A	ENST00000306801.3	+	8	1264	c.902G>A	c.(901-903)cGc>cAc	p.R301H	RPTOR_ENST00000575542.1_3'UTR|RPTOR_ENST00000544334.2_Missense_Mutation_p.R301H|RPTOR_ENST00000537330.1_Missense_Mutation_p.R116H|RPTOR_ENST00000570891.1_Missense_Mutation_p.R301H	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	301					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.R301H(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						ATCCCTGGCCGCCTGAACGAC	0.602																																					p.R301H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G902A	17						.						207.0	214.0	211.0					17																	78796012		2203	4300	6503	76410607	SO:0001583	missense	57521	exon8				CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.902G>A	17.37:g.78796012G>A	ENSP00000307272:p.Arg301His	Somatic		Capture	Illumina HiSeq	Phase_I	76410607	NM_020761	B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Missense_Mutation	SNP	ENST00000306801.3	37	CCDS11773.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.431572	0.83776	.	.	ENSG00000141564	ENST00000537330;ENST00000306801;ENST00000544334	T;T	0.47177	0.85;0.87	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.68933	0.3055	M	0.69823	2.125	0.58432	D	0.999999	D;D;D	0.76494	0.999;0.983;0.999	D;P;P	0.77004	0.989;0.497;0.815	T	0.70389	-0.4885	10	0.51188	T	0.08	.	18.7126	0.91662	0.0:0.0:1.0:0.0	.	301;116;301	F5H7J5;F5GXV9;Q8N122	.;.;RPTOR_HUMAN	H	116;301;301	ENSP00000307272:R301H;ENSP00000442479:R301H	ENSP00000307272:R301H	R	+	2	0	RPTOR	76410607	1.000000	0.71417	1.000000	0.80357	0.409000	0.31022	9.230000	0.95299	2.422000	0.82143	0.591000	0.81541	CGC		RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438125.1	NM_020761	
CETN1	1068	broad.mit.edu	37	18	580537	580537	+	Silent	SNP	C	C	T	rs144514549		TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr18:580537C>T	ENST00000327228.3	+	1	171	c.129C>T	c.(127-129)gaC>gaT	p.D43D		NM_004066.1	NP_004057.1	Q12798	CETN1_HUMAN	centrin, EF-hand protein, 1	43	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cellular response to heat (GO:0034605)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|photoreceptor connecting cilium (GO:0032391)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|calcium ion binding (GO:0005509)|nucleic acid binding (GO:0003676)	p.D43D(2)		breast(2)|cervix(1)|endometrium(3)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(2)	25						TCGACGTGGACGGAAGTGGGA	0.562													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16870	0.0		0.0	False		,,,				2504	0.0				p.D43D												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C129T	18						.	C		11,4395	20.2+/-43.8	0,11,2192	77.0	59.0	65.0		129	-2.1	0.0	18	dbSNP_134	65	0,8600		0,0,4300	no	coding-synonymous	CETN1	NM_004066.1		0,11,6492	TT,TC,CC		0.0,0.2497,0.0846		43/173	580537	11,12995	2203	4300	6503	570537	SO:0001819	synonymous_variant	1068	exon1			U03270	CCDS11820.1	18p11.32	2013-01-10			ENSG00000177143	ENSG00000177143		"""EF-hand domain containing"""	1866	protein-coding gene	gene with protein product		603187		CETN		8175926	Standard	NM_004066		Approved	CEN1	uc002kko.1	Q12798	OTTHUMG00000131471	ENST00000327228.3:c.129C>T	18.37:g.580537C>T		Somatic		Capture	Illumina HiSeq	Phase_I	570537	NM_004066	B2R536	Silent	SNP	ENST00000327228.3	37	CCDS11820.1																																																																																				CETN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254314.2	NM_004066	
CFAP53	220136	broad.mit.edu	37	18	47753972	47753972	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr18:47753972G>A	ENST00000398545.4	-	8	1441	c.1324C>T	c.(1324-1326)Cgt>Tgt	p.R442C		NM_145020.3	NP_659457.2												p.R442C(1)		endometrium(1)|kidney(4)|large_intestine(6)|lung(6)|ovary(1)|pancreas(1)|skin(1)	20				STAD - Stomach adenocarcinoma(97;2.66e-05)|Colorectal(21;7.57e-05)|Lung(128;0.00932)|READ - Rectum adenocarcinoma(32;0.164)		TGGGCTAAACGTTGGCGTCTA	0.373																																					p.R442C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1324T	18						.						177.0	167.0	171.0					18																	47753972		1914	4136	6050	46007970	SO:0001583	missense	220136	exon8																														ENST00000398545.4:c.1324C>T	18.37:g.47753972G>A	ENSP00000381553:p.Arg442Cys	Somatic		Capture	Illumina HiSeq	Phase_I	46007970	NM_145020		Missense_Mutation	SNP	ENST00000398545.4	37	CCDS11940.2	.	.	.	.	.	.	.	.	.	.	G	12.78	2.039692	0.35989	.	.	ENSG00000172361	ENST00000398545	T	0.10192	2.9	5.5	-11.0	0.00169	.	2.891430	0.00961	N	0.003101	T	0.04048	0.0113	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.33879	-0.9851	10	0.56958	D	0.05	21.8414	1.6502	0.02770	0.1564:0.2326:0.3121:0.2989	.	442	Q96M91	CCD11_HUMAN	C	442	ENSP00000381553:R442C	ENSP00000381553:R442C	R	-	1	0	CCDC11	46007970	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-2.318000	0.01121	-2.485000	0.00520	-1.899000	0.00529	CGT		CCDC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255922.3		
PDE4A	5141	broad.mit.edu	37	19	10577591	10577591	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr19:10577591C>T	ENST00000352831.6	+	15	2065	c.1955C>T	c.(1954-1956)cCa>cTa	p.P652L	PDE4A_ENST00000592685.1_Missense_Mutation_p.P630L|PDE4A_ENST00000380702.2_Missense_Mutation_p.P630L|PDE4A_ENST00000293683.5_Missense_Mutation_p.P626L|PDE4A_ENST00000440014.2_Missense_Mutation_p.P591L|PDE4A_ENST00000344979.3_Missense_Mutation_p.P413L	NM_001111307.1	NP_001104777.1	P27815	PDE4A_HUMAN	phosphodiesterase 4A, cAMP-specific	652	Catalytic.				cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|metal ion binding (GO:0046872)	p.P413L(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Caffeine(DB00201)|Dipyridamole(DB00975)|Drotaverine(DB06751)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theophylline(DB00277)|Tofisopam(DB08811)	ATTGTGCACCCATTGTGGGAG	0.542																																					p.P591L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1772T	19						.						61.0	68.0	65.0					19																	10577591		2203	4300	6503	10438591	SO:0001583	missense	5141	exon15				CCDS12238.1, CCDS45961.1, CCDS45962.1, CCDS45963.1, CCDS58649.1	19p13.2	2010-06-24	2010-06-24			ENSG00000065989	3.1.4.17	"""Phosphodiesterases"""	8780	protein-coding gene	gene with protein product	"""phosphodiesterase E2 dunce homolog (Drosophila)"""	600126	"""phosphodiesterase 4A, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E2)"""	DPDE2		8009369	Standard	NM_006202		Approved		uc002moj.2	P27815		ENST00000352831.6:c.1955C>T	19.37:g.10577591C>T	ENSP00000270474:p.Pro652Leu	Somatic		Capture	Illumina HiSeq	Phase_I	10438591	NM_001111309	O75522|O76092|Q16255|Q16691|Q5DM53|Q6PMT2|Q8IVA7|Q8WUQ3|Q9H3H2	Missense_Mutation	SNP	ENST00000352831.6	37	CCDS45961.1	.	.	.	.	.	.	.	.	.	.	c	26.8	4.770309	0.90108	.	.	ENSG00000065989	ENST00000419866;ENST00000380702;ENST00000352831;ENST00000293683;ENST00000440014;ENST00000344979	T;T;T;T;T	0.79845	-1.31;-1.31;-1.31;-1.31;-1.31	4.87	4.87	0.63330	5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.105079	0.64402	D	0.000003	D	0.93318	0.7870	H	0.97440	4.005	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.95521	0.8594	10	0.87932	D	0	.	15.8874	0.79261	0.0:1.0:0.0:0.0	.	413;591;626;652	P27815-4;P27815-6;P27815-2;P27815	.;.;.;PDE4A_HUMAN	L	94;630;652;626;591;413	ENSP00000370078:P630L;ENSP00000270474:P652L;ENSP00000293683:P626L;ENSP00000394754:P591L;ENSP00000341007:P413L	ENSP00000293683:P626L	P	+	2	0	PDE4A	10438591	1.000000	0.71417	0.981000	0.43875	0.865000	0.49528	7.773000	0.85462	2.427000	0.82271	0.550000	0.68814	CCA		PDE4A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451244.1		
ZNF101	94039	broad.mit.edu	37	19	19790274	19790274	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr19:19790274G>A	ENST00000592502.1	+	4	586	c.476G>A	c.(475-477)cGc>cAc	p.R159H	ZNF101_ENST00000444249.2_3'UTR|ZNF101_ENST00000415784.2_Missense_Mutation_p.R39H			Q8IZC7	ZN101_HUMAN	zinc finger protein 101	159					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R159H(2)		breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(4)|ovary(2)|prostate(1)	17						GGTGCACGGCGCACAGTAACA	0.478																																					p.R159H												.	.	2	Substitution - Missense(2)	large_intestine(1)|breast(1)	c.G476A	19						.						94.0	95.0	95.0					19																	19790274		2203	4300	6503	19651274	SO:0001583	missense	94039	exon4			AK097169	CCDS32971.1	19p13.11	2013-01-08	2004-02-10		ENSG00000181896	ENSG00000181896		"""Zinc fingers, C2H2-type"", ""-"""	12881	protein-coding gene	gene with protein product		603983	"""zinc finger protein 101 (Y2)"""			11441184	Standard	XM_005260165		Approved	HZF12, DKFZp570I0164	uc002nni.2	Q8IZC7	OTTHUMG00000167736	ENST00000592502.1:c.476G>A	19.37:g.19790274G>A	ENSP00000468049:p.Arg159His	Somatic		Capture	Illumina HiSeq	Phase_I	19651274	NM_033204	C9JU83|Q0VDG9	Missense_Mutation	SNP	ENST00000592502.1	37	CCDS32971.1	.	.	.	.	.	.	.	.	.	.	G	0	-2.587963	0.00128	.	.	ENSG00000181896	ENST00000318110;ENST00000415440;ENST00000415784	T;T	0.07800	3.16;3.16	0.235	-0.47	0.12131	.	.	.	.	.	T	0.03011	0.0089	N	0.08118	0	0.23138	N	0.998238	B	0.02656	0.0	B	0.01281	0.0	T	0.44907	-0.9297	9	0.02654	T	1	.	5.548	0.17076	0.7377:0.0:0.2623:0.0	.	159	Q8IZC7	ZN101_HUMAN	H	159;159;39	ENSP00000319716:R159H;ENSP00000400952:R39H	ENSP00000319716:R159H	R	+	2	0	ZNF101	19651274	0.000000	0.05858	0.009000	0.14445	0.009000	0.06853	-1.475000	0.02335	-1.768000	0.01298	-1.745000	0.00682	CGC		ZNF101-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460559.1	NM_033204	
PLIN4	729359	broad.mit.edu	37	19	4512245	4512245	+	Missense_Mutation	SNP	G	G	A	rs528441447	byFrequency	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr19:4512245G>A	ENST00000301286.3	-	3	1684	c.1685C>T	c.(1684-1686)gCg>gTg	p.A562V		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	562	27 X 33 AA approximate tandem repeat.					cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)		p.A490V(1)		NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						GGCCACATTCGCTGCCCCCGT	0.622													g|||	4	0.000798722	0.0	0.0	5008	,	,		22184	0.0		0.0	False		,,,				2504	0.0041				p.A562V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1685T	19						.						131.0	145.0	140.0					19																	4512245		2084	4202	6286	4463245	SO:0001583	missense	729359	exon3			AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.1685C>T	19.37:g.4512245G>A	ENSP00000301286:p.Ala562Val	Somatic		Capture	Illumina HiSeq	Phase_I	4463245	NM_001080400	A6NEI2	Missense_Mutation	SNP	ENST00000301286.3	37	CCDS45927.1	.	.	.	.	.	.	.	.	.	.	g	0.820	-0.749075	0.03065	.	.	ENSG00000167676	ENST00000301286	T	0.02863	4.13	5.15	-0.74	0.11115	.	1.568620	0.03870	N	0.275422	T	0.01287	0.0042	N	0.01277	-0.915	0.09310	N	1	B	0.17852	0.024	B	0.10450	0.005	T	0.46005	-0.9222	10	0.10111	T	0.7	.	9.302	0.37851	0.5396:0.0:0.4604:0.0	.	562	Q96Q06	PLIN4_HUMAN	V	562	ENSP00000301286:A562V	ENSP00000301286:A562V	A	-	2	0	PLIN4	4463245	.	.	0.000000	0.03702	0.001000	0.01503	.	.	-0.234000	0.09782	-0.378000	0.06908	GCG		PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395095.1	XM_170901	
ZNF99	7652	broad.mit.edu	37	19	22951200	22951200	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr19:22951200T>A	ENST00000596209.1	-	3	223	c.133A>T	c.(133-135)Atc>Ttc	p.I45F	ZNF99_ENST00000397104.3_Missense_Mutation_p.I66F	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	45	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.I66F(2)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				GAGACAGCGATACCTGtttta	0.338																																					p.I66F												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.A196T	19						.						44.0	44.0	44.0					19																	22951200		2134	4275	6409	22743040	SO:0001583	missense	7652	exon3			BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.133A>T	19.37:g.22951200T>A	ENSP00000472969:p.Ile45Phe	Somatic		Capture	Illumina HiSeq	Phase_I	22743040	NM_001080409	M0R335	Missense_Mutation	SNP	ENST00000596209.1	37	CCDS59369.1	.	.	.	.	.	.	.	.	.	.	t	1.268	-0.613814	0.03690	.	.	ENSG00000213973	ENST00000397104	T	0.00792	5.69	0.428	-0.855	0.10700	Krueppel-associated box (3);	.	.	.	.	T	0.00637	0.0021	L	0.31845	0.965	0.09310	N	1	B	0.27316	0.175	B	0.27170	0.077	T	0.45527	-0.9255	8	0.10902	T	0.67	.	.	.	.	.	66	A8MXY4	ZNF99_HUMAN	F	66	ENSP00000380293:I66F	ENSP00000380293:I66F	I	-	1	0	ZNF99	22743040	0.003000	0.15002	0.004000	0.12327	0.003000	0.03518	-0.142000	0.10311	-0.599000	0.05798	-0.636000	0.03981	ATC		ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124	
LRRC4B	94030	broad.mit.edu	37	19	51021275	51021275	+	Silent	SNP	G	G	A	rs367866872		TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr19:51021275G>A	ENST00000599957.1	-	3	1892	c.1695C>T	c.(1693-1695)ctC>ctT	p.L565L	LRRC4B_ENST00000389201.3_Silent_p.L565L			Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B	565					positive regulation of synapse assembly (GO:0051965)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.L565L(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(1)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	30		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		CCAGGTCCTTGAGGGCGTTCT	0.632																																					p.L565L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1695T	19						.						47.0	51.0	50.0					19																	51021275		2158	4269	6427	55713087	SO:0001819	synonymous_variant	94030	exon3			BC032460	CCDS42595.1	19q13.33	2014-01-30	2004-06-14	2004-06-16	ENSG00000131409	ENSG00000131409		"""Immunoglobulin superfamily / I-set domain containing"", ""Endogenous ligands"""	25042	protein-coding gene	gene with protein product	"""netrin-G3 ligand"""		"""leucine-rich repeats and immunoglobulin-like domains 4"""	LRIG4		11441184	Standard	NM_001080457		Approved	DKFZp761A179, HSM	uc002pss.3	Q9NT99		ENST00000599957.1:c.1695C>T	19.37:g.51021275G>A		Somatic		Capture	Illumina HiSeq	Phase_I	55713087	NM_001080457	Q3ZCQ4|Q58F20	Silent	SNP	ENST00000599957.1	37	CCDS42595.1																																																																																				LRRC4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464907.1	NM_001080457	
ZNF175	7728	broad.mit.edu	37	19	52091376	52091376	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr19:52091376G>A	ENST00000262259.2	+	5	2150	c.1792G>A	c.(1792-1794)Ggc>Agc	p.G598S	ZNF175_ENST00000436511.2_Intron	NM_007147.2	NP_009078.1	Q9Y473	ZN175_HUMAN	zinc finger protein 175	598					defense response to virus (GO:0051607)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G598S(1)		NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000426)|OV - Ovarian serous cystadenocarcinoma(262;0.0257)		GGCCTTCAACGGCAGGTCAAA	0.433																																					p.G598S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1792A	19						.						105.0	113.0	111.0					19																	52091376		2203	4300	6503	56783188	SO:0001583	missense	7728	exon5			D50419	CCDS12837.1	19q13.4	2013-01-08			ENSG00000105497	ENSG00000105497		"""Zinc fingers, C2H2-type"", ""-"""	12964	protein-coding gene	gene with protein product		601139				8838321	Standard	NM_007147		Approved	OTK18	uc002pxb.3	Q9Y473	OTTHUMG00000167771	ENST00000262259.2:c.1792G>A	19.37:g.52091376G>A	ENSP00000262259:p.Gly598Ser	Somatic		Capture	Illumina HiSeq	Phase_I	56783188	NM_007147	A8K9H2	Missense_Mutation	SNP	ENST00000262259.2	37	CCDS12837.1	.	.	.	.	.	.	.	.	.	.	G	5.612	0.297578	0.10622	.	.	ENSG00000105497	ENST00000262259	T	0.07216	3.21	2.48	1.43	0.22495	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02083	0.0065	N	0.01464	-0.85	0.09310	N	0.999999	D	0.53312	0.959	B	0.36922	0.236	T	0.32640	-0.9899	9	0.19590	T	0.45	.	4.5905	0.12304	0.3125:0.0:0.6875:0.0	.	598	Q9Y473	ZN175_HUMAN	S	598	ENSP00000262259:G598S	ENSP00000262259:G598S	G	+	1	0	ZNF175	56783188	0.000000	0.05858	0.013000	0.15412	0.911000	0.54048	-1.627000	0.02033	0.605000	0.29947	0.655000	0.94253	GGC		ZNF175-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396205.1	NM_007147	
COL5A3	50509	broad.mit.edu	37	19	10088142	10088142	+	Missense_Mutation	SNP	G	G	A	rs571460759		TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr19:10088142G>A	ENST00000264828.3	-	43	3218	c.3133C>T	c.(3133-3135)Cgt>Tgt	p.R1045C		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	1045	Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)	p.R1045C(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			GGGGGGCCACGTTCTCCCTGT	0.667													G|||	1	0.000199681	0.0	0.0	5008	,	,		16032	0.0		0.0	False		,,,				2504	0.001				p.R1045C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3133T	19						.						38.0	47.0	44.0					19																	10088142		2201	4299	6500	9949142	SO:0001583	missense	50509	exon43			AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.3133C>T	19.37:g.10088142G>A	ENSP00000264828:p.Arg1045Cys	Somatic		Capture	Illumina HiSeq	Phase_I	9949142	NM_015719	Q9NZQ6	Missense_Mutation	SNP	ENST00000264828.3	37	CCDS12222.1	.	.	.	.	.	.	.	.	.	.	G	18.61	3.661819	0.67700	.	.	ENSG00000080573	ENST00000264828	D	0.96522	-4.04	5.34	3.02	0.34903	.	0.292806	0.28724	N	0.014342	D	0.96775	0.8947	L	0.53249	1.67	0.35297	D	0.782657	D	0.89917	1.0	D	0.74348	0.983	D	0.98171	1.0452	10	0.62326	D	0.03	.	10.7194	0.46032	0.0:0.0:0.5246:0.4754	.	1045	P25940	CO5A3_HUMAN	C	1045	ENSP00000264828:R1045C	ENSP00000264828:R1045C	R	-	1	0	COL5A3	9949142	1.000000	0.71417	0.986000	0.45419	0.808000	0.45660	4.110000	0.57831	1.203000	0.43233	0.563000	0.77884	CGT		COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315788.1	NM_015719	
LILRA6	79168	broad.mit.edu	37	19	54746125	54746125	+	Silent	SNP	G	G	A	rs376860386	byFrequency	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr19:54746125G>A	ENST00000396365.2	-	3	171	c.132C>T	c.(130-132)ccC>ccT	p.P44P	LILRB3_ENST00000407860.2_Silent_p.P44P|LILRA6_ENST00000440558.2_Silent_p.P44P|LILRA6_ENST00000245621.5_Silent_p.P44P|LILRA6_ENST00000391735.3_Silent_p.P44P|LILRA6_ENST00000270464.5_Silent_p.P44P|LILRA6_ENST00000419410.2_Silent_p.P44P	NM_024318.2	NP_077294	Q6PI73	LIRA6_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6	44					immune system process (GO:0002376)	integral component of membrane (GO:0016021)		p.P44P(2)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(20)|ovary(3)|skin(2)|urinary_tract(2)	38	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		AGATGGTCACGGGGCTCCCCC	0.597													.|||	5	0.000998403	0.0008	0.0029	5008	,	,		28097	0.0		0.002	False		,,,				2504	0.0				p.P44P												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C132T	19						.	G		1,4405		0,1,2202	113.0	120.0	118.0		132	-3.9	0.0	19		118	0,8600		0,0,4300	no	coding-synonymous	LILRA6	NM_024318.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		44/482	54746125	1,13005	2203	4300	6503	59437937	SO:0001819	synonymous_variant	11025	exon3			AF041262	CCDS42610.1	19q13.4	2013-01-11	2005-05-17	2005-05-17	ENSG00000244482	ENSG00000244482		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15495	protein-coding gene	gene with protein product			"""leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 6"""	LILRB6		10941842	Standard	NM_024318		Approved	ILT8, CD85b		Q6PI73	OTTHUMG00000066635	ENST00000396365.2:c.132C>T	19.37:g.54746125G>A		Somatic		Capture	Illumina HiSeq	Phase_I	59437937	NM_024318		Silent	SNP	ENST00000396365.2	37	CCDS42610.1																																																																																				LILRA6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313725.1	NM_024318	
CLCN6	1185	broad.mit.edu	37	1	11898421	11898421	+	Silent	SNP	C	C	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr1:11898421C>T	ENST00000346436.6	+	21	2377	c.2325C>T	c.(2323-2325)gcC>gcT	p.A775A	CLCN6_ENST00000376487.3_Silent_p.A753A|NPPA-AS1_ENST00000446542.1_RNA|CLCN6_ENST00000312413.6_3'UTR|CLCN6_ENST00000376496.3_Silent_p.A775A	NM_001286.3	NP_001277	P51797	CLCN6_HUMAN	chloride channel, voltage-sensitive 6	775					cell volume homeostasis (GO:0006884)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|response to mechanical stimulus (GO:0009612)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|voltage-gated chloride channel activity (GO:0005247)	p.A775A(1)		cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(4)	36	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000816)|KIRC - Kidney renal clear cell carcinoma(229;0.00268)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		TCTCCTATGCCGAGATGGCCG	0.662											OREG0013104	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A775A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2325T	1						.						65.0	64.0	64.0					1																	11898421		2202	4300	6502	11821008	SO:0001819	synonymous_variant	1185	exon21			X83378	CCDS138.1, CCDS57972.1	1p36	2012-09-26	2012-02-23		ENSG00000011021	ENSG00000011021		"""Ion channels / Chloride channels : Voltage-sensitive"""	2024	protein-coding gene	gene with protein product		602726	"""chloride channel 6"""			8543009	Standard	NM_001286		Approved	CLC-6, KIAA0046, ClC-6	uc001ate.5	P51797	OTTHUMG00000002299	ENST00000346436.6:c.2325C>T	1.37:g.11898421C>T		Somatic	675	Capture	Illumina HiSeq	Phase_I	11821008	NM_001286	A8K1T4|B4DGT7|F8W9R3|O60818|O60819|O60820|O60821|P78520|P78521|Q17R81|Q5SNW2|Q5SNW3|Q5SNX1|Q5SNX2|Q5SNX3|Q99427|Q99428|Q99429	Silent	SNP	ENST00000346436.6	37	CCDS138.1																																																																																				CLCN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006639.2	NM_001286	
SLC6A17	388662	broad.mit.edu	37	1	110737250	110737250	+	Missense_Mutation	SNP	C	C	T	rs201181747		TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr1:110737250C>T	ENST00000331565.4	+	9	1834	c.1349C>T	c.(1348-1350)aCg>aTg	p.T450M	SLC6A17_ENST00000465159.1_3'UTR	NM_001010898.2	NP_001010898.1	Q9H1V8	S6A17_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 17	450					alanine transport (GO:0032328)|glycine transport (GO:0015816)|leucine transport (GO:0015820)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	neurotransmitter:sodium symporter activity (GO:0005328)	p.T450M(1)		breast(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)		GAGGCCATGACGCACTTCCCC	0.627													C|||	1	0.000199681	0.0	0.0	5008	,	,		18560	0.001		0.0	False		,,,				2504	0.0				p.T450M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1349T	1						.						168.0	120.0	136.0					1																	110737250		2203	4300	6503	110538773	SO:0001583	missense	388662	exon9				CCDS30799.1	1p13.2	2013-07-19	2013-07-19		ENSG00000197106	ENSG00000197106		"""Solute carriers"""	31399	protein-coding gene	gene with protein product		610299	"""solute carrier family 6 (neurotransmitter transporter), member 17"", ""solute carrier family 6, member 17"""				Standard	NM_001010898		Approved		uc009wfq.3	Q9H1V8	OTTHUMG00000011761	ENST00000331565.4:c.1349C>T	1.37:g.110737250C>T	ENSP00000330199:p.Thr450Met	Somatic		Capture	Illumina HiSeq	Phase_I	110538773	NM_001010898	A6NEA8|A8K1R7|B9EIR5|Q5T5Q9	Missense_Mutation	SNP	ENST00000331565.4	37	CCDS30799.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	28.5	4.928527	0.92389	.	.	ENSG00000197106	ENST00000331565;ENST00000450985	T	0.77358	-1.09	4.97	4.97	0.65823	.	0.088737	0.85682	D	0.000000	D	0.90779	0.7105	H	0.94385	3.53	0.58432	D	0.999999	D	0.89917	1.0	D	0.83275	0.996	D	0.93041	0.6457	10	0.72032	D	0.01	.	18.5633	0.91108	0.0:1.0:0.0:0.0	.	450	Q9H1V8	S6A17_HUMAN	M	450	ENSP00000330199:T450M	ENSP00000330199:T450M	T	+	2	0	SLC6A17	110538773	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.776000	0.85560	2.475000	0.83589	0.655000	0.94253	ACG		SLC6A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032550.2	XM_371280	
ATAD3A	55210	broad.mit.edu	37	1	1459704	1459704	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr1:1459704G>A	ENST00000378755.5	+	11	1379	c.1285G>A	c.(1285-1287)Gtg>Atg	p.V429M	ATAD3A_ENST00000378756.3_Missense_Mutation_p.V381M|ATAD3A_ENST00000536055.1_Missense_Mutation_p.V302M	NM_018188.3	NP_060658.3	Q9NVI7	ATD3A_HUMAN	ATPase family, AAA domain containing 3A	429					cell growth (GO:0016049)|negative regulation of apoptotic process (GO:0043066)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)	p.V429M(1)		endometrium(4)|kidney(6)|large_intestine(1)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	20	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.12e-36)|OV - Ovarian serous cystadenocarcinoma(86;2.18e-22)|Colorectal(212;0.000164)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00233)|BRCA - Breast invasive adenocarcinoma(365;0.00469)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0347)|Lung(427;0.147)		AGGCGGGGACGTGGCCCCCAT	0.637																																					p.V429M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1285A	1						.						61.0	49.0	53.0					1																	1459704		2202	4296	6498	1449567	SO:0001583	missense	55210	exon11			AK025865	CCDS31.1, CCDS53259.1, CCDS53260.1	1p36.33	2010-04-21		2007-02-08	ENSG00000197785	ENSG00000197785		"""ATPases / AAA-type"""	25567	protein-coding gene	gene with protein product		612316				12477932	Standard	NM_018188		Approved	FLJ10709	uc001afz.2	Q9NVI7	OTTHUMG00000000575	ENST00000378755.5:c.1285G>A	1.37:g.1459704G>A	ENSP00000368030:p.Val429Met	Somatic		Capture	Illumina HiSeq	Phase_I	1449567	NM_018188	B3KPB3|D2K8Q1|G3V1I6|Q5SV23|Q8N275|Q96A50	Missense_Mutation	SNP	ENST00000378755.5	37	CCDS31.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	23.7|23.7	4.449377|4.449377	0.84101|0.84101	.|.	.|.	ENSG00000197785|ENSG00000197785	ENST00000339113|ENST00000378756;ENST00000378755;ENST00000378759;ENST00000536055;ENST00000400830	.|T;T;T	.|0.78924	.|-1.22;-1.22;-1.22	4.94|4.94	4.94|4.94	0.65067|0.65067	.|ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.88644|0.88644	0.6492|0.6492	M|M	0.86028|0.86028	2.79|2.79	0.80722|0.80722	D|D	1|1	.|D;D	.|0.76494	.|0.998;0.999	.|P;D	.|0.65684	.|0.826;0.937	D|D	0.90640|0.90640	0.4574|0.4574	5|10	.|0.72032	.|D	.|0.01	.|.	17.2291|17.2291	0.86979|0.86979	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|381;429	.|D2K8Q1;Q9NVI7	.|.;ATD3A_HUMAN	H|M	366|381;429;32;302;18	.|ENSP00000368031:V381M;ENSP00000368030:V429M;ENSP00000439290:V302M	.|ENSP00000368030:V429M	R|V	+|+	2|1	0|0	ATAD3A|ATAD3A	1449567|1449567	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.827000|0.827000	0.46813|0.46813	9.402000|9.402000	0.97298|0.97298	2.308000|2.308000	0.77769|0.77769	0.556000|0.556000	0.70494|0.70494	CGT|GTG		ATAD3A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000001365.1	NM_018188	
PDE4DIP	9659	broad.mit.edu	37	1	144868060	144868060	+	Silent	SNP	G	G	A			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr1:144868060G>A	ENST00000369354.3	-	33	5568	c.5379C>T	c.(5377-5379)acC>acT	p.T1793T	PDE4DIP_ENST00000369356.4_Silent_p.T1793T|PDE4DIP_ENST00000313382.9_Silent_p.T1687T|PDE4DIP_ENST00000369359.4_Silent_p.T1929T|PDE4DIP_ENST00000530740.1_Silent_p.T1878T|PDE4DIP_ENST00000524974.1_5'UTR|RP4-791M13.4_ENST00000532137.1_RNA			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	1793					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)	p.T1793T(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CCAGTTCTATGGTGCCCCTTG	0.552			T	PDGFRB	MPD																																p.T1687T			Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C5061T	1						.						193.0	200.0	198.0					1																	144868060		2203	4296	6499	143579417	SO:0001819	synonymous_variant	9659	exon35			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.5379C>T	1.37:g.144868060G>A		Somatic		Capture	Illumina HiSeq	Phase_I	143579417	NM_001198832	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Silent	SNP	ENST00000369354.3	37	CCDS30824.1																																																																																				PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359	
FLG	2312	broad.mit.edu	37	1	152279766	152279766	+	Silent	SNP	C	C	T	rs142026832	byFrequency	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr1:152279766C>T	ENST00000368799.1	-	3	7631	c.7596G>A	c.(7594-7596)tcG>tcA	p.S2532S	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2532	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.S2532S(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CATGGTGACGCGACCCTGAGT	0.592									Ichthyosis																												p.S2532S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G7596A	1						.	C		1,4405	2.1+/-5.4	0,1,2202	264.0	273.0	270.0		7596	-3.7	0.0	1	dbSNP_134	270	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	FLG	NM_002016.1		0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154		2532/4062	152279766	2,13004	2203	4300	6503	150546390	SO:0001819	synonymous_variant	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.7596G>A	1.37:g.152279766C>T		Somatic		Capture	Illumina HiSeq	Phase_I	150546390	NM_002016	Q01720|Q5T583|Q9UC71	Silent	SNP	ENST00000368799.1	37	CCDS30860.1																																																																																				FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
HSPA6	3310	broad.mit.edu	37	1	161496071	161496071	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr1:161496071A>C	ENST00000309758.4	+	1	2036	c.1623A>C	c.(1621-1623)aaA>aaC	p.K541N	RP11-25K21.6_ENST00000537821.2_RNA	NM_002155.3	NP_002146.2	P17066	HSP76_HUMAN	heat shock 70kDa protein 6 (HSP70B')	541					ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|centriole (GO:0005814)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|enzyme binding (GO:0019899)|heat shock protein binding (GO:0031072)|unfolded protein binding (GO:0051082)	p.K541N(1)		endometrium(3)|large_intestine(5)|lung(9)|prostate(2)|skin(2)	21	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			TGGCTGCCAAAAACTCGCTGG	0.547																																					p.K541N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1623C	1						.						29.0	28.0	29.0					1																	161496071		2203	4299	6502	159762695	SO:0001583	missense	3310	exon1				CCDS1231.1	1q23.3	2011-09-02	2002-08-29		ENSG00000173110	ENSG00000173110		"""Heat shock proteins / HSP70"""	5239	protein-coding gene	gene with protein product		140555	"""heat shock 70kD protein 6 (HSP70B')"""			1346391	Standard	NM_002155		Approved		uc001gaq.3	P17066	OTTHUMG00000034461	ENST00000309758.4:c.1623A>C	1.37:g.161496071A>C	ENSP00000310219:p.Lys541Asn	Somatic		Capture	Illumina HiSeq	Phase_I	159762695	NM_002155	Q1HBA8|Q8IYK7|Q9BT95	Missense_Mutation	SNP	ENST00000309758.4	37	CCDS1231.1	.	.	.	.	.	.	.	.	.	.	.	8.278	0.814818	0.16607	.	.	ENSG00000173110	ENST00000309758;ENST00000545155	T	0.19105	2.17	3.45	2.27	0.28462	.	0.194046	0.24384	U	0.039000	T	0.18509	0.0444	H	0.95114	3.625	0.39236	D	0.963771	B	0.27264	0.173	B	0.25506	0.061	T	0.20571	-1.0271	10	0.87932	D	0	.	3.6517	0.08206	0.6957:0.0:0.3043:0.0	.	541	P17066	HSP76_HUMAN	N	541;517	ENSP00000310219:K541N	ENSP00000310219:K541N	K	+	3	2	HSPA6	159762695	1.000000	0.71417	0.991000	0.47740	0.198000	0.23893	1.408000	0.34668	1.407000	0.46875	0.482000	0.46254	AAA		HSPA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083308.1	NM_002155	
FASLG	356	broad.mit.edu	37	1	172635029	172635029	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr1:172635029C>T	ENST00000367721.2	+	4	903	c.719C>T	c.(718-720)gCc>gTc	p.A240V	FASLG_ENST00000340030.3_3'UTR	NM_000639.1	NP_000630.1	P48023	TNFL6_HUMAN	Fas ligand (TNF superfamily, member 6)	240					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell-cell signaling (GO:0007267)|cellular chloride ion homeostasis (GO:0030644)|endosomal lumen acidification (GO:0048388)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|immune response (GO:0006955)|inflammatory cell apoptotic process (GO:0006925)|necroptotic process (GO:0070266)|necroptotic signaling pathway (GO:0097527)|negative regulation of angiogenesis (GO:0016525)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to growth factor (GO:0070848)|response to lipopolysaccharide (GO:0032496)|retinal cell programmed cell death (GO:0046666)|signal transduction (GO:0007165)|T cell apoptotic process (GO:0070231)|transcription, DNA-templated (GO:0006351)	caveola (GO:0005901)|cytoplasmic membrane-bounded vesicle (GO:0016023)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	receptor binding (GO:0005102)	p.A240V(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(12)|prostate(1)|skin(1)	19						CAGATGTGGGCCCGCAGCAGC	0.498																																					p.A240V	Ovarian(28;486 876 30334 44033)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C719T	1						.						95.0	92.0	93.0					1																	172635029		2203	4300	6503	170901652	SO:0001583	missense	356	exon4			U11821	CCDS1304.1	1q23	2014-09-17	2005-01-07	2005-01-07	ENSG00000117560	ENSG00000117560		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"", ""Endogenous ligands"""	11936	protein-coding gene	gene with protein product		134638	"""tumor necrosis factor (ligand) superfamily, member 6"""	APT1LG1, TNFSF6		7826947, 9022072	Standard	NM_000639		Approved	FasL, CD178	uc001gis.3	P48023	OTTHUMG00000034841	ENST00000367721.2:c.719C>T	1.37:g.172635029C>T	ENSP00000356694:p.Ala240Val	Somatic		Capture	Illumina HiSeq	Phase_I	170901652	NM_000639	Q9BZP9	Missense_Mutation	SNP	ENST00000367721.2	37	CCDS1304.1	.	.	.	.	.	.	.	.	.	.	C	17.82	3.483197	0.63962	.	.	ENSG00000117560	ENST00000367721	D	0.94184	-3.37	5.34	5.34	0.76211	Tumour necrosis factor (3);Tumour necrosis factor-like (2);	0.195053	0.43919	D	0.000517	D	0.86940	0.6054	L	0.29908	0.895	0.80722	D	1	P	0.43788	0.817	P	0.47744	0.556	D	0.85264	0.1052	10	0.17369	T	0.5	-18.33	13.3767	0.60743	0.0:0.8419:0.1581:0.0	.	240	P48023	TNFL6_HUMAN	V	240	ENSP00000356694:A240V	ENSP00000356694:A240V	A	+	2	0	FASLG	170901652	0.983000	0.35010	0.995000	0.50966	0.976000	0.68499	2.524000	0.45589	2.513000	0.84729	0.650000	0.86243	GCC		FASLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084276.1		
PARP1	142	broad.mit.edu	37	1	226553729	226553729	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr1:226553729C>T	ENST00000366794.5	-	18	2574	c.2431G>A	c.(2431-2433)Gcc>Acc	p.A811T	PARP1_ENST00000490921.1_5'UTR	NM_001618.3	NP_001609.2	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase 1	811	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				base-excision repair (GO:0006284)|cellular response to insulin stimulus (GO:0032869)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|gene expression (GO:0010467)|macrophage differentiation (GO:0030225)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein ADP-ribosylation (GO:0006471)|protein autoprocessing (GO:0016540)|protein poly-ADP-ribosylation (GO:0070212)|regulation of growth rate (GO:0040009)|signal transduction involved in regulation of gene expression (GO:0023019)|telomere maintenance (GO:0000723)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NAD binding (GO:0051287)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.A811T(1)		breast(2)|endometrium(4)|kidney(4)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	44	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)		ATGATCTCGGCTTCTTCAGAA	0.463								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA																													p.A811T												PARP1,breast,NS,Substitution - coding silent,+2 	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2431A	1						.						147.0	112.0	124.0					1																	226553729		2203	4300	6503	224620352	SO:0001583	missense	142	exon18			BC037545	CCDS1554.1	1q41-q42	2010-02-16	2008-07-28	2004-08-26	ENSG00000143799	ENSG00000143799	2.4.2.30	"""Poly (ADP-ribose) polymerases"""	270	protein-coding gene	gene with protein product		173870	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)"", ""poly (ADP-ribose) polymerase family, member 1"""	PPOL, ADPRT		10964595	Standard	NM_001618		Approved	PARP	uc001hqd.4	P09874	OTTHUMG00000037556	ENST00000366794.5:c.2431G>A	1.37:g.226553729C>T	ENSP00000355759:p.Ala811Thr	Somatic		Capture	Illumina HiSeq	Phase_I	224620352	NM_001618	B1ANJ4|Q8IUZ9	Missense_Mutation	SNP	ENST00000366794.5	37	CCDS1554.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.292911	0.80914	.	.	ENSG00000143799	ENST00000366794	T	0.13778	2.56	5.68	5.68	0.88126	Poly(ADP-ribose) polymerase, catalytic domain (2);	0.046390	0.85682	D	0.000000	T	0.18467	0.0443	L	0.53249	1.67	0.80722	D	1	P	0.36483	0.555	B	0.39258	0.295	T	0.00679	-1.1613	10	0.62326	D	0.03	.	14.6149	0.68541	0.1457:0.8543:0.0:0.0	.	811	P09874	PARP1_HUMAN	T	811	ENSP00000355759:A811T	ENSP00000355759:A811T	A	-	1	0	PARP1	224620352	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.211000	0.65219	2.695000	0.91970	0.650000	0.86243	GCC		PARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091519.1	NM_001618	
HTR1D	3352	broad.mit.edu	37	1	23519913	23519913	+	Missense_Mutation	SNP	G	G	A	rs376034704		TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr1:23519913G>A	ENST00000374619.1	-	1	1309	c.800C>T	c.(799-801)tCg>tTg	p.S267L	HTR1D_ENST00000314113.3_Missense_Mutation_p.S267L	NM_000864.4	NP_000855.1	P28221	5HT1D_HUMAN	5-hydroxytryptamine (serotonin) receptor 1D, G protein-coupled	267					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|intestine smooth muscle contraction (GO:0014827)|regulation of behavior (GO:0050795)|regulation of locomotion (GO:0040012)|response to toxic substance (GO:0009636)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.S267L(1)		NS(1)|large_intestine(3)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	9		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000779)|all_lung(284;0.00135)|Breast(348;0.0385)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0561)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;4.69e-27)|Colorectal(126;4.86e-08)|COAD - Colon adenocarcinoma(152;2.86e-06)|GBM - Glioblastoma multiforme(114;0.00012)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(1967;0.00122)|STAD - Stomach adenocarcinoma(196;0.0123)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.083)|LUSC - Lung squamous cell carcinoma(448;0.185)	Almotriptan(DB00918)|Amitriptyline(DB00321)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Clozapine(DB00363)|Dihydroergotamine(DB00320)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Frovatriptan(DB00998)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Naratriptan(DB00952)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Quetiapine(DB01224)|Risperidone(DB00734)|Rizatriptan(DB00953)|Ropinirole(DB00268)|Sumatriptan(DB00669)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	GGAGCCAGCCGAGTGCGAGTG	0.582																																					p.S267L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C800T	1						.	G	LEU/SER	0,4406		0,0,2203	56.0	62.0	60.0		800	1.8	0.0	1		60	1,8599	1.2+/-3.3	0,1,4299	no	missense	HTR1D	NM_000864.4	145	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	267/378	23519913	1,13005	2203	4300	6503	23392500	SO:0001583	missense	3352	exon1			M89955	CCDS231.1	1p36.3-p34.3	2012-08-08	2012-02-03		ENSG00000179546	ENSG00000179546		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5289	protein-coding gene	gene with protein product		182133	"""5-hydroxytryptamine (serotonin) receptor 1D"""	HTRL		2541503, 1662665	Standard	NM_000864		Approved	RDC4, HT1DA, 5-HT1D	uc001bgn.3	P28221	OTTHUMG00000003235	ENST00000374619.1:c.800C>T	1.37:g.23519913G>A	ENSP00000363748:p.Ser267Leu	Somatic		Capture	Illumina HiSeq	Phase_I	23392500	NM_000864		Missense_Mutation	SNP	ENST00000374619.1	37	CCDS231.1	.	.	.	.	.	.	.	.	.	.	G	4.484	0.089643	0.08632	0.0	1.16E-4	ENSG00000179546	ENST00000314113;ENST00000374619	T;T	0.70516	-0.49;-0.49	4.69	1.82	0.25136	GPCR, rhodopsin-like superfamily (1);	0.697753	0.13963	N	0.350718	T	0.56031	0.1958	L	0.31926	0.97	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.39078	-0.9631	10	0.25751	T	0.34	.	9.3517	0.38142	0.2351:0.0:0.7649:0.0	.	267	P28221	5HT1D_HUMAN	L	267	ENSP00000313661:S267L;ENSP00000363748:S267L	ENSP00000313661:S267L	S	-	2	0	HTR1D	23392500	0.878000	0.30173	0.000000	0.03702	0.381000	0.30169	4.681000	0.61663	0.229000	0.21039	-0.254000	0.11334	TCG		HTR1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008924.1	NM_000864	
ZMYM6	9204	broad.mit.edu	37	1	35452998	35452998	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr1:35452998C>T	ENST00000357182.4	-	16	3912	c.3685G>A	c.(3685-3687)Gac>Aac	p.D1229N	ZMYM6_ENST00000373340.2_Intron|ZMYM6NB_ENST00000373337.3_5'Flank|ZMYM6_ENST00000487874.1_Intron|ZMYM6_ENST00000493328.1_5'UTR|RP11-244H3.1_ENST00000417456.1_RNA	NM_007167.3	NP_009098.3	O95789	ZMYM6_HUMAN	zinc finger, MYM-type 6	1229					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.D1229N(1)		breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(10)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	44		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				TCTTCGAAGTCGGTGAGATTA	0.358																																					p.D1229N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3685A	1						.						86.0	85.0	85.0					1																	35452998		1824	4082	5906	35225585	SO:0001583	missense	9204	exon16			AF055470	CCDS387.2	1p34.2	2014-05-12	2005-09-12	2005-09-12	ENSG00000163867	ENSG00000163867		"""Zinc fingers, MYM type"", ""Zinc fingers, BED-type"""	13050	protein-coding gene	gene with protein product	"""zinc finger, BED-type containing 7"""	613567	"""zinc finger protein 258"", ""zinc finger, MYM-type containing 6"""	ZNF258		10486218, 23533661	Standard	NM_007167		Approved	ZNF198L4, MYM, Buster2, ZBED7	uc001byh.3	O95789	OTTHUMG00000004163	ENST00000357182.4:c.3685G>A	1.37:g.35452998C>T	ENSP00000349708:p.Asp1229Asn	Somatic		Capture	Illumina HiSeq	Phase_I	35225585	NM_007167	B4DRJ6|Q32Q23|Q4G108|Q5SVZ9|Q5SW00|Q69YL4|Q96IY0|Q9NWF1|Q9P2J4	Missense_Mutation	SNP	ENST00000357182.4	37	CCDS387.2	.	.	.	.	.	.	.	.	.	.	C	3.263	-0.150742	0.06585	.	.	ENSG00000163867	ENST00000357182	T	0.22743	1.94	4.85	-0.343	0.12632	Ribonuclease H-like (1);	0.713642	0.13989	N	0.348918	T	0.12732	0.0309	L	0.40543	1.245	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.33675	-0.9859	10	0.17832	T	0.49	0.7728	4.4912	0.11815	0.0:0.4237:0.3108:0.2655	.	1229	O95789	ZMYM6_HUMAN	N	1229	ENSP00000349708:D1229N	ENSP00000349708:D1229N	D	-	1	0	ZMYM6	35225585	0.000000	0.05858	0.000000	0.03702	0.889000	0.51656	-0.416000	0.07097	-0.121000	0.11787	-0.894000	0.02916	GAC		ZMYM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011999.1	NM_007167	
ALG6	29929	broad.mit.edu	37	1	63879780	63879780	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr1:63879780A>C	ENST00000371108.4	+	10	1170	c.865A>C	c.(865-867)Aag>Cag	p.K289Q	ALG6_ENST00000263440.4_Missense_Mutation_p.K291Q	NM_013339.3	NP_037471.2	Q9Y672	ALG6_HUMAN	ALG6, alpha-1,3-glucosyltransferase	289					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucosyltransferase activity (GO:0046527)	p.K289Q(1)		endometrium(1)|large_intestine(4)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13						TCTGAAGATTAAGGATATTTT	0.284																																					p.K289Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A865C	1						.						104.0	109.0	107.0					1																	63879780		2203	4299	6502	63652368	SO:0001583	missense	29929	exon10			AF063604	CCDS30735.1	1p31.3	2013-03-01	2013-03-01		ENSG00000088035	ENSG00000088035	2.4.1.267		23157	protein-coding gene	gene with protein product	"""dolichyl-P-Glc:Man(9)GlcNAc(2)-PP-dolichol alpha- 1->3-glucosyltransferase"""	604566	"""asparagine-linked glycosylation 6 homolog (yeast, alpha-1,3-glucosyltransferase)"", ""asparagine-linked glycosylation 6, alpha-1,3-glucosyltransferase homolog (S. cerevisiae)"""			10359825, 11875054	Standard	NM_013339		Approved		uc021oof.1	Q9Y672	OTTHUMG00000009140	ENST00000371108.4:c.865A>C	1.37:g.63879780A>C	ENSP00000360149:p.Lys289Gln	Somatic		Capture	Illumina HiSeq	Phase_I	63652368	NM_013339	B3KMU2|Q5SXR9|Q9H3I0	Missense_Mutation	SNP	ENST00000371108.4	37	CCDS30735.1	.	.	.	.	.	.	.	.	.	.	A	18.57	3.651757	0.67472	.	.	ENSG00000088035	ENST00000371108;ENST00000263440;ENST00000423077	D;D	0.84370	-1.84;-1.84	4.43	4.43	0.53597	.	0.216632	0.47093	D	0.000249	D	0.85639	0.5743	M	0.77616	2.38	0.47547	D	0.999451	P;P	0.47106	0.89;0.544	P;P	0.53988	0.739;0.595	D	0.84279	0.0493	10	0.22109	T	0.4	-12.1913	13.9983	0.64416	1.0:0.0:0.0:0.0	.	88;291	B4DHV8;A2A2G4	.;.	Q	289;291;88	ENSP00000360149:K289Q;ENSP00000263440:K291Q	ENSP00000263440:K291Q	K	+	1	0	ALG6	63652368	1.000000	0.71417	0.998000	0.56505	0.738000	0.42128	8.350000	0.90069	1.756000	0.51951	0.533000	0.62120	AAG		ALG6-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000025330.2	NM_013339	
PTGER3	5733	broad.mit.edu	37	1	71512938	71512938	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr1:71512938G>T	ENST00000306666.5	-	1	533	c.323C>A	c.(322-324)cCg>cAg	p.P108Q	PTGER3_ENST00000414819.1_Missense_Mutation_p.P108Q|PTGER3_ENST00000370932.2_Missense_Mutation_p.P108Q|PTGER3_ENST00000460330.1_Missense_Mutation_p.P108Q|PTGER3_ENST00000354608.5_Missense_Mutation_p.P108Q|PTGER3_ENST00000370924.4_Missense_Mutation_p.P108Q|ZRANB2-AS1_ENST00000450461.1_RNA|PTGER3_ENST00000356595.4_Missense_Mutation_p.P108Q|PTGER3_ENST00000370931.3_Missense_Mutation_p.P108Q|PTGER3_ENST00000351052.5_Missense_Mutation_p.P108Q	NM_198719.1	NP_942012.1	P43115	PE2R3_HUMAN	prostaglandin E receptor 3 (subtype EP3)	108					cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of fever generation (GO:0031622)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|prostaglandin E receptor activity (GO:0004957)	p.P108Q(3)		endometrium(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25					Bimatoprost(DB00905)|Dinoprostone(DB00917)|Misoprostol(DB00929)	GATGACGACCGGGGTGGTGAG	0.647																																					p.P108Q												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.C323A	1						.						38.0	38.0	38.0					1																	71512938		2196	4293	6489	71285526	SO:0001583	missense	5733	exon1			X83863	CCDS652.1, CCDS655.1, CCDS656.1, CCDS657.1, CCDS658.1	1p31.2	2012-08-08			ENSG00000050628	ENSG00000050628		"""GPCR / Class A : Prostanoid receptors"""	9595	protein-coding gene	gene with protein product		176806				7759114, 9073510	Standard	NM_001126044		Approved	EP3	uc001dfo.3	P43115	OTTHUMG00000009399	ENST00000306666.5:c.323C>A	1.37:g.71512938G>T	ENSP00000302313:p.Pro108Gln	Somatic		Capture	Illumina HiSeq	Phase_I	71285526	NM_198715	B0AZN4|B1AK19|B5BUP5|O00326|Q12943|Q12944|Q12945|Q16546|Q5CZ59|Q5CZ61|Q5CZ62|Q5CZ63|Q5CZ64	Missense_Mutation	SNP	ENST00000306666.5	37	CCDS657.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.712579	0.89112	.	.	ENSG00000050628	ENST00000370931;ENST00000370932;ENST00000351052;ENST00000460330;ENST00000370934;ENST00000354608;ENST00000356595;ENST00000414819;ENST00000306666;ENST00000370924	T;T;T;T;T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67	4.56	4.56	0.56223	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.68833	0.3044	M	0.87180	2.865	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	T	0.76154	-0.3063	10	0.87932	D	0	-37.2222	17.5174	0.87778	0.0:0.0:1.0:0.0	.	108;108;108;108;108;108;108;108	Q147U0;Q6TTN3;F5H821;B1AK19;Q147X8;P43115-3;P43115-4;P43115	.;.;.;.;.;.;.;PE2R3_HUMAN	Q	108	ENSP00000359969:P108Q;ENSP00000359970:P108Q;ENSP00000280208:P108Q;ENSP00000418073:P108Q;ENSP00000346624:P108Q;ENSP00000349003:P108Q;ENSP00000401423:P108Q;ENSP00000302313:P108Q;ENSP00000359962:P108Q	ENSP00000302313:P108Q	P	-	2	0	PTGER3	71285526	1.000000	0.71417	0.979000	0.43373	0.858000	0.48976	9.401000	0.97294	2.373000	0.80994	0.462000	0.41574	CCG		PTGER3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000026076.1	NM_000957	
DPYD	1806	broad.mit.edu	37	1	97981462	97981462	+	Missense_Mutation	SNP	T	T	G	rs138979515		TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr1:97981462T>G	ENST00000370192.3	-	13	1660	c.1560A>C	c.(1558-1560)gaA>gaC	p.E520D		NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase	520					beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)	p.E520D(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	AGAGGGGTAGTTCAGGCTTGG	0.383																																					p.E520D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1560C	1						.						68.0	63.0	65.0					1																	97981462		2203	4299	6502	97754050	SO:0001583	missense	1806	exon13			U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.1560A>C	1.37:g.97981462T>G	ENSP00000359211:p.Glu520Asp	Somatic		Capture	Illumina HiSeq	Phase_I	97754050	NM_000110	A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	Missense_Mutation	SNP	ENST00000370192.3	37	CCDS30777.1	.	.	.	.	.	.	.	.	.	.	T	8.766	0.924712	0.18056	.	.	ENSG00000188641	ENST00000370192	D	0.92199	-2.99	5.2	-3.86	0.04230	.	0.215179	0.47455	D	0.000227	T	0.81531	0.4842	L	0.49126	1.545	0.80722	D	1	B	0.09022	0.002	B	0.08055	0.003	T	0.63189	-0.6693	10	0.40728	T	0.16	-6.8957	15.4362	0.75149	0.0:0.6739:0.0:0.3261	.	520	Q12882	DPYD_HUMAN	D	520	ENSP00000359211:E520D	ENSP00000359211:E520D	E	-	3	2	DPYD	97754050	0.997000	0.39634	0.001000	0.08648	0.008000	0.06430	0.564000	0.23563	-0.529000	0.06358	-0.361000	0.07541	GAA		DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095698.3	NM_000110	
PGBD5	79605	broad.mit.edu	37	1	230513278	230513278	+	Silent	SNP	G	G	A			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr1:230513278G>A	ENST00000525115.1	-	1	113	c.90C>T	c.(88-90)ccC>ccT	p.P30P	PGBD5_ENST00000391860.1_Intron|PGBD5_ENST00000321327.2_Silent_p.P30P			Q8N414	PGBD5_HUMAN	piggyBac transposable element derived 5	30						integral component of membrane (GO:0016021)		p.P30P(1)		biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(2)|skin(1)	33	Breast(184;0.0397)	Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;0.201)		GATCCCGGCCGGGCACTATGC	0.527																																					p.P30P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C90T	1						.						63.0	54.0	57.0					1																	230513278		2203	4300	6503	228579901	SO:0001819	synonymous_variant	79605	exon1			AK021475		1q42.13	2008-02-05			ENSG00000177614	ENSG00000177614			19405	protein-coding gene	gene with protein product							Standard	NM_001258311		Approved	DKFZp761A0620, FLJ11413	uc031psq.1	Q8N414	OTTHUMG00000037759	ENST00000525115.1:c.90C>T	1.37:g.230513278G>A		Somatic		Capture	Illumina HiSeq	Phase_I	228579901	NM_024554	A0PJF3|B9EK58|Q5SR37|Q6PJN2	Silent	SNP	ENST00000525115.1	37																																																																																					PGBD5-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000382617.1	NM_024554	
CD93	22918	broad.mit.edu	37	20	23065956	23065956	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr20:23065956G>C	ENST00000246006.4	-	1	1021	c.874C>G	c.(874-876)Cgg>Ggg	p.R292G		NM_012072.3	NP_036204.2	Q9NPY3	C1QR1_HUMAN	CD93 molecule	292	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				macrophage activation (GO:0042116)|phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|receptor activity (GO:0004872)	p.R292G(1)		NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)					TCCAGCAGCCGGAATCCTGGT	0.627																																					p.R292G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C874G	20						.						70.0	78.0	75.0					20																	23065956		2203	4300	6503	23013956	SO:0001583	missense	22918	exon1			U94333	CCDS13149.1	20p11.21	2009-01-29	2006-03-28	2006-02-22	ENSG00000125810	ENSG00000125810		"""CD molecules"""	15855	protein-coding gene	gene with protein product		120577	"""matrix-remodelling associated 4"", ""complement component 1, q subcomponent, receptor 1"", ""CD93 antigen"""	MXRA4, C1QR1		9047234, 10648005	Standard	NM_012072		Approved	C1qRP, C1qR(P), dJ737E23.1, CDw93, ECSM3	uc002wsv.3	Q9NPY3	OTTHUMG00000032058	ENST00000246006.4:c.874C>G	20.37:g.23065956G>C	ENSP00000246006:p.Arg292Gly	Somatic		Capture	Illumina HiSeq	Phase_I	23013956	NM_012072	O00274	Missense_Mutation	SNP	ENST00000246006.4	37	CCDS13149.1	.	.	.	.	.	.	.	.	.	.	G	16.30	3.084826	0.55861	.	.	ENSG00000125810	ENST00000246006;ENST00000413585	D	0.87412	-2.25	5.51	3.52	0.40303	Epidermal growth factor-like (1);EGF-like region, conserved site (1);	0.368951	0.22983	N	0.053290	D	0.89546	0.6746	M	0.89163	3.01	0.30454	N	0.774943	D	0.54207	0.965	P	0.47603	0.551	D	0.87279	0.2291	10	0.56958	D	0.05	-42.1424	8.8426	0.35151	0.0:0.2451:0.4849:0.27	.	292	Q9NPY3	C1QR1_HUMAN	G	292	ENSP00000246006:R292G	ENSP00000246006:R292G	R	-	1	2	CD93	23013956	0.119000	0.22226	0.998000	0.56505	0.859000	0.49053	0.456000	0.21859	0.753000	0.32945	0.650000	0.86243	CGG		CD93-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078312.2	NM_012072	
PHACTR3	116154	broad.mit.edu	37	20	58318189	58318189	+	Missense_Mutation	SNP	G	G	A	rs143288140		TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr20:58318189G>A	ENST00000371015.1	+	2	613	c.146G>A	c.(145-147)cGt>cAt	p.R49H	PHACTR3_ENST00000395639.4_Missense_Mutation_p.R8H|PHACTR3_ENST00000359926.3_Missense_Mutation_p.R46H|PHACTR3_ENST00000355648.4_Missense_Mutation_p.R8H|PHACTR3_ENST00000395636.2_Missense_Mutation_p.R8H|PHACTR3_ENST00000541461.1_Missense_Mutation_p.R8H|PHACTR3_ENST00000361300.4_Missense_Mutation_p.R8H	NM_001281507.1|NM_080672.3	NP_001268436.1|NP_542403.1	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3	49						nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)	p.R49H(3)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|liver(2)|lung(32)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	59	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			CCCCCGGCGCGTCCTGAATAT	0.567													G|||	1	0.000199681	0.0	0.0	5008	,	,		18499	0.001		0.0	False		,,,				2504	0.0				p.R49H												.	.	3	Substitution - Missense(3)	ovary(1)|lung(1)|large_intestine(1)	c.G146A	20						.	G	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	86.0	95.0	91.0		137,23,146,23,23	4.4	0.1	20	dbSNP_134	91	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense,missense,missense,missense	PHACTR3	NM_001199505.1,NM_001199506.1,NM_080672.3,NM_183244.1,NM_183246.1	29,29,29,29,29	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	46/557,8/519,49/560,8/519,8/449	58318189	2,13004	2203	4300	6503	57751584	SO:0001583	missense	116154	exon2			AJ311122	CCDS13480.1, CCDS13481.1, CCDS42895.1, CCDS56202.1	20q13.32-q13.33	2014-06-13	2004-05-20	2004-05-20	ENSG00000087495	ENSG00000087495		"""Phosphatase and actin regulators"""	15833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 123"""	608725	"""chromosome 20 open reading frame 101"""	C20orf101		15107502	Standard	NM_001199505		Approved	PPP1R123	uc002yau.3	Q96KR7	OTTHUMG00000032869	ENST00000371015.1:c.146G>A	20.37:g.58318189G>A	ENSP00000360054:p.Arg49His	Somatic		Capture	Illumina HiSeq	Phase_I	57751584	NM_080672	B1AKX0|B1AN68|B1AN69|B2RB46|Q32P33|Q707P6|Q9H4T4	Missense_Mutation	SNP	ENST00000371015.1	37	CCDS13480.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	13.84	2.357583	0.41801	0.0	2.33E-4	ENSG00000087495	ENST00000359926;ENST00000371015;ENST00000395639;ENST00000541461;ENST00000355648;ENST00000395636;ENST00000361300	T;T;T;T;T;T;T	0.45668	1.58;1.68;0.89;1.27;1.27;1.27;0.89	4.4	4.4	0.53042	.	0.105543	0.64402	D	0.000003	T	0.31857	0.0810	L	0.43152	1.355	0.54753	D	0.999982	B;P;P	0.46395	0.026;0.53;0.877	B;B;B	0.32022	0.016;0.085;0.139	T	0.32348	-0.9910	10	0.48119	T	0.1	-14.0518	15.9499	0.79827	0.0:0.0:1.0:0.0	.	8;49;46	Q96KR7-3;Q96KR7;B1AKX0	.;PHAR3_HUMAN;.	H	46;49;8;8;8;8;8	ENSP00000353002:R46H;ENSP00000360054:R49H;ENSP00000379001:R8H;ENSP00000442483:R8H;ENSP00000347866:R8H;ENSP00000378998:R8H;ENSP00000354555:R8H	ENSP00000347866:R8H	R	+	2	0	PHACTR3	57751584	1.000000	0.71417	0.077000	0.20336	0.558000	0.35554	4.878000	0.63093	1.988000	0.58038	0.455000	0.32223	CGT		PHACTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079923.3	NM_080672	
ZNF512B	57473	broad.mit.edu	37	20	62597614	62597614	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr20:62597614G>A	ENST00000450537.1	-	5	974	c.914C>T	c.(913-915)cCg>cTg	p.P305L	ZNF512B_ENST00000217130.3_Missense_Mutation_p.P305L|ZNF512B_ENST00000369888.1_Missense_Mutation_p.P305L			Q96KM6	Z512B_HUMAN	zinc finger protein 512B	305					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P305L(1)		NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					GACTGTCACCGGCTTGCTGAC	0.567																																					p.P305L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C914T	20						.						151.0	140.0	143.0					20																	62597614		2203	4300	6503	62068058	SO:0001583	missense	57473	exon5			AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.914C>T	20.37:g.62597614G>A	ENSP00000393795:p.Pro305Leu	Somatic		Capture	Illumina HiSeq	Phase_I	62068058	NM_020713	Q08AK9|Q9ULM4	Missense_Mutation	SNP	ENST00000450537.1	37	CCDS13548.1	.	.	.	.	.	.	.	.	.	.	G	14.50	2.554221	0.45487	.	.	ENSG00000196700	ENST00000369888;ENST00000450537;ENST00000217130	T;T;T	0.27402	1.67;1.67;1.67	5.01	4.0	0.46444	.	0.713692	0.12731	N	0.443839	T	0.31451	0.0797	L	0.61218	1.895	0.46981	D	0.999273	B	0.25809	0.135	B	0.17722	0.019	T	0.13602	-1.0503	10	0.87932	D	0	-6.8267	10.0818	0.42395	0.1081:0.0:0.8919:0.0	.	305	Q96KM6	Z512B_HUMAN	L	305	ENSP00000358904:P305L;ENSP00000393795:P305L;ENSP00000217130:P305L	ENSP00000217130:P305L	P	-	2	0	ZNF512B	62068058	0.978000	0.34361	0.839000	0.33178	0.922000	0.55478	2.607000	0.46300	1.204000	0.43247	0.585000	0.79938	CCG		ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080246.1	NM_020713	
PCNT	5116	broad.mit.edu	37	21	47775371	47775371	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr21:47775371G>A	ENST00000359568.5	+	12	1873	c.1766G>A	c.(1765-1767)aGc>aAc	p.S589N	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	589	Glu-rich.				brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)		p.S589N(1)		NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					CTGTAGGAGAGCCTGCCACGC	0.562																																					p.S589N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1766A	21						.						55.0	56.0	55.0					21																	47775371		2203	4300	6503	46599799	SO:0001583	missense	5116	exon12			AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.1766G>A	21.37:g.47775371G>A	ENSP00000352572:p.Ser589Asn	Somatic		Capture	Illumina HiSeq	Phase_I	46599799	NM_006031	O43152|Q7Z7C9	Missense_Mutation	SNP	ENST00000359568.5	37	CCDS33592.1	.	.	.	.	.	.	.	.	.	.	G	2.754	-0.259448	0.05791	.	.	ENSG00000160299	ENST00000359568;ENST00000337772	T	0.01505	4.82	3.79	2.84	0.33178	.	.	.	.	.	T	0.01523	0.0049	N	0.22421	0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.47636	-0.9102	9	0.36615	T	0.2	.	5.7725	0.18261	0.2829:0.0:0.7171:0.0	.	471;589	O95613-2;O95613	.;PCNT_HUMAN	N	589;576	ENSP00000352572:S589N	ENSP00000338675:S576N	S	+	2	0	PCNT	46599799	0.665000	0.27466	0.240000	0.24138	0.010000	0.07245	0.801000	0.27055	0.600000	0.29862	0.491000	0.48974	AGC		PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031	
TOM1	10043	broad.mit.edu	37	22	35726356	35726356	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr22:35726356G>A	ENST00000449058.2	+	8	907	c.782G>A	c.(781-783)tGc>tAc	p.C261Y	TOM1_ENST00000447733.1_Missense_Mutation_p.C228Y|TOM1_ENST00000382034.5_Missense_Mutation_p.C194Y|TOM1_ENST00000411850.1_Missense_Mutation_p.C261Y|TOM1_ENST00000425375.1_Missense_Mutation_p.C216Y|TOM1_ENST00000436462.2_Missense_Mutation_p.C223Y	NM_005488.2	NP_005479.1	O60784	TOM1_HUMAN	target of myb1 (chicken)	261	GAT. {ECO:0000255|PROSITE- ProRule:PRU00373}.				endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	clathrin binding (GO:0030276)	p.C261Y(1)		NS(1)|breast(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(2)	19						AACCGCACGTGCCGAGCCATG	0.542																																					p.C216Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G647A	22						.						125.0	103.0	110.0					22																	35726356		2203	4300	6503	34056356	SO:0001583	missense	10043	exon7			AJ006973	CCDS13913.1, CCDS46696.1, CCDS46697.1, CCDS46698.1	22q13.1	2011-01-31	2001-11-28		ENSG00000100284	ENSG00000100284			11982	protein-coding gene	gene with protein product		604700	"""target of myb1 (chicken) homolog"""			10329004, 15047686	Standard	NM_005488		Approved		uc003anp.3	O60784	OTTHUMG00000150958	ENST00000449058.2:c.782G>A	22.37:g.35726356G>A	ENSP00000394466:p.Cys261Tyr	Somatic		Capture	Illumina HiSeq	Phase_I	34056356	NM_001135730	B4DEL9|B4DNA1|Q5TIJ6|Q86X74	Missense_Mutation	SNP	ENST00000449058.2	37	CCDS13913.1	.	.	.	.	.	.	.	.	.	.	g	33	5.279441	0.95489	.	.	ENSG00000100284	ENST00000447733;ENST00000456128;ENST00000449058;ENST00000411850;ENST00000425375;ENST00000451197;ENST00000436462;ENST00000382034	T;T;T;T;T;T;T	0.60672	0.17;0.17;0.17;0.17;0.17;0.17;0.17	5.31	5.31	0.75309	GAT (2);	0.087723	0.85682	D	0.000000	T	0.81607	0.4858	M	0.89785	3.06	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.998;1.0;0.998;0.999;0.998	D	0.85251	0.1044	10	0.87932	D	0	1.1759	19.3815	0.94540	0.0:0.0:1.0:0.0	.	216;223;270;261;261	O60784-3;E7EPD0;B4DKQ5;O60784-2;O60784	.;.;.;.;TOM1_HUMAN	Y	228;255;261;261;216;270;223;194	ENSP00000398876:C228Y;ENSP00000393714:C255Y;ENSP00000394466:C261Y;ENSP00000413697:C261Y;ENSP00000394924:C216Y;ENSP00000402556:C223Y;ENSP00000371465:C194Y	ENSP00000371465:C194Y	C	+	2	0	TOM1	34056356	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.751000	0.98889	2.644000	0.89710	0.645000	0.84053	TGC		TOM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000320641.1	NM_005488	
FBLN1	2192	broad.mit.edu	37	22	45959116	45959116	+	Intron	SNP	G	G	C			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr22:45959116G>C	ENST00000327858.6	+	15	1792				FBLN1_ENST00000262722.7_Missense_Mutation_p.K674N|FBLN1_ENST00000442170.2_Intron|FBLN1_ENST00000348697.2_Intron|FBLN1_ENST00000402984.3_Missense_Mutation_p.K712N	NM_006486.2	NP_006477	P23142	FBLN1_HUMAN	fibulin 1						embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|viral process (GO:0016032)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|peptidase activator activity (GO:0016504)	p.K674N(1)		biliary_tract(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	30		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		TTGTGGCCAAGCTTTTCATCT	0.597																																					p.K674N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2022C	22						.						74.0	71.0	72.0					22																	45959116		2203	4300	6503	44337780	SO:0001627	intron_variant	2192	exon15				CCDS14067.1, CCDS14068.1, CCDS14069.1, CCDS43028.1	22q13.31	2010-06-15			ENSG00000077942	ENSG00000077942		"""Fibulins"""	3600	protein-coding gene	gene with protein product		135820				2269669, 1400330	Standard	NM_006485		Approved	FBLN	uc003bgj.1	P23142	OTTHUMG00000151340	ENST00000327858.6:c.1698-11275G>C	22.37:g.45959116G>C		Somatic		Capture	Illumina HiSeq	Phase_I	44337780	NM_001996	B0QY42|B1AHL4|P23143|P23144|P37888|Q5TIC4|Q8TBH8|Q9HBQ5|Q9UC21|Q9UGR4|Q9UH41	Missense_Mutation	SNP	ENST00000327858.6	37	CCDS14067.1	.	.	.	.	.	.	.	.	.	.	G	10.29	1.309749	0.23821	.	.	ENSG00000077942	ENST00000402984;ENST00000262722	D;D	0.86956	-2.19;-2.05	4.72	3.68	0.42216	.	.	.	.	.	D	0.83571	0.5283	M	0.73217	2.22	0.80722	D	1	B;B	0.09022	0.002;0.002	B;B	0.09377	0.003;0.004	T	0.77341	-0.2624	9	0.19590	T	0.45	.	9.7075	0.40225	0.162:0.0:0.838:0.0	.	712;674	B1AHL2;P23142-4	.;.	N	712;674	ENSP00000385521:K712N;ENSP00000262722:K674N	ENSP00000262722:K674N	K	+	3	2	FBLN1	44337780	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.326000	0.33735	2.167000	0.68274	0.467000	0.42956	AAG		FBLN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322287.1	NM_006486	
TBC1D8	11138	broad.mit.edu	37	2	101624548	101624548	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr2:101624548G>A	ENST00000376840.4	-	20	3157	c.3158C>T	c.(3157-3159)cCt>cTt	p.P1053L	RPL31_ENST00000409650.1_Intron|RPL31_ENST00000409028.4_Intron|RPL31_ENST00000409038.1_Intron|TBC1D8_ENST00000409318.1_Missense_Mutation_p.P1068L			O95759	TBCD8_HUMAN	TBC1 domain family, member 8 (with GRAM domain)	1053					blood circulation (GO:0008015)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)	p.P1053L(1)|p.P1068L(1)		breast(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	32						CTCAGGAGAAGGAGCTGAAGC	0.622																																					p.P1053L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C3158T	2						.						37.0	39.0	38.0					2																	101624548		1990	4159	6149	100990980	SO:0001583	missense	11138	exon20			AB024057	CCDS46375.1	2q12.1	2011-11-30			ENSG00000204634	ENSG00000204634			17791	protein-coding gene	gene with protein product	"""BUB2-like protein 1"", ""vascular Rab-GAP/TBC-containing protein"""					10373574	Standard	NM_001102426		Approved	HBLP1, VRP, AD3	uc010fiv.3	O95759	OTTHUMG00000153040	ENST00000376840.4:c.3158C>T	2.37:g.101624548G>A	ENSP00000366036:p.Pro1053Leu	Somatic		Capture	Illumina HiSeq	Phase_I	100990980	NM_001102426	A6NDL4|A8K9W1|B9A6K4|Q53SQ4|Q9UQ32	Missense_Mutation	SNP	ENST00000376840.4	37	CCDS46375.1	.	.	.	.	.	.	.	.	.	.	G	13.84	2.358391	0.41801	.	.	ENSG00000204634	ENST00000376840;ENST00000409318	T;T	0.03212	4.01;4.01	5.33	4.42	0.53409	.	0.444160	0.21372	N	0.075617	T	0.02494	0.0076	N	0.08118	0	0.39200	D	0.963122	B	0.02656	0.0	B	0.04013	0.001	T	0.52830	-0.8523	10	0.23302	T	0.38	-2.1804	13.1917	0.59715	0.0798:0.0:0.9202:0.0	.	1053	O95759	TBCD8_HUMAN	L	1053;1068	ENSP00000366036:P1053L;ENSP00000386856:P1068L	ENSP00000366036:P1053L	P	-	2	0	TBC1D8	100990980	0.830000	0.29337	0.708000	0.30435	0.952000	0.60782	3.797000	0.55514	1.147000	0.42369	0.655000	0.94253	CCT		TBC1D8-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376092.1	NM_007063	
ST6GAL2	84620	broad.mit.edu	37	2	107423243	107423243	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr2:107423243C>T	ENST00000409382.3	-	6	2091	c.1481G>A	c.(1480-1482)cGc>cAc	p.R494H	ST6GAL2_ENST00000361686.4_Missense_Mutation_p.R494H	NM_001142351.1	NP_001135823.1	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide alpha-2,6-sialyltranferase 2	494					growth (GO:0040007)|multicellular organismal development (GO:0007275)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,6-sialyltransferase activity (GO:0003835)	p.R494H(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(30)|ovary(5)|pancreas(6)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	65						CATGTTCAGGCGCTGCACCAG	0.622																																					p.R494H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1481A	2						.						95.0	81.0	86.0					2																	107423243		2203	4300	6503	106789675	SO:0001583	missense	84620	exon6			AB059555	CCDS2073.1, CCDS46380.1	2q11-q12	2008-02-05	2005-02-07	2005-02-07	ENSG00000144057	ENSG00000144057	2.4.99.2		10861	protein-coding gene	gene with protein product		608472	"""sialyltransferase 2 (monosialoganglioside sialyltransferase)"""	SIAT2			Standard	NM_032528		Approved	KIAA1877, St6gal2, St6GalII	uc002tdr.3	Q96JF0	OTTHUMG00000130923	ENST00000409382.3:c.1481G>A	2.37:g.107423243C>T	ENSP00000386942:p.Arg494His	Somatic		Capture	Illumina HiSeq	Phase_I	106789675	NM_001142351	D3DVK3|Q53QP4|Q86Y44|Q8IUG7|Q96HE4	Missense_Mutation	SNP	ENST00000409382.3	37	CCDS2073.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.284295	0.80803	.	.	ENSG00000144057	ENST00000361686;ENST00000409382	T;T	0.33438	1.41;1.41	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.41096	0.1144	M	0.73962	2.25	0.80722	D	1	P	0.42584	0.784	B	0.41646	0.362	T	0.25916	-1.0118	10	0.37606	T	0.19	-40.0616	19.0512	0.93046	0.0:1.0:0.0:0.0	.	494	Q96JF0	SIAT2_HUMAN	H	494	ENSP00000355273:R494H;ENSP00000386942:R494H	ENSP00000355273:R494H	R	-	2	0	ST6GAL2	106789675	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	5.985000	0.70556	2.735000	0.93741	0.655000	0.94253	CGC		ST6GAL2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330065.1	NM_032528	
OTOF	9381	broad.mit.edu	37	2	26698274	26698274	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr2:26698274C>T	ENST00000272371.2	-	25	3205	c.3079G>A	c.(3079-3081)Gac>Aac	p.D1027N	OTOF_ENST00000339598.3_Missense_Mutation_p.D280N|OTOF_ENST00000338581.6_Missense_Mutation_p.D280N|OTOF_ENST00000402415.3_Missense_Mutation_p.D337N|OTOF_ENST00000403946.3_Missense_Mutation_p.D1027N	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	1027	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)	p.D280N(1)|p.D1027N(1)		NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGCGGATCGTCCCTCAGCTCA	0.572																																					p.D280N	GBM(102;732 1451 20652 24062 31372)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G838A	2						.						108.0	89.0	95.0					2																	26698274		2203	4300	6503	26551778	SO:0001583	missense	9381	exon8			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.3079G>A	2.37:g.26698274C>T	ENSP00000272371:p.Asp1027Asn	Somatic		Capture	Illumina HiSeq	Phase_I	26551778	NM_194323	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	ENST00000272371.2	37	CCDS1725.1	.	.	.	.	.	.	.	.	.	.	C	14.22	2.469977	0.43839	.	.	ENSG00000115155	ENST00000338581;ENST00000339598;ENST00000402415;ENST00000272371;ENST00000403946	T;T;T;T;T	0.80393	-1.13;-1.13;-1.1;-1.37;-1.37	5.64	4.77	0.60923	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.085098	0.85682	N	0.000000	T	0.73164	0.3552	L	0.38838	1.175	0.80722	D	1	B;B;B;B	0.13594	0.005;0.002;0.008;0.0	B;B;B;B	0.19148	0.024;0.005;0.009;0.005	T	0.67707	-0.5601	10	0.34782	T	0.22	-20.7613	14.5516	0.68070	0.0:0.9285:0.0:0.0715	.	1027;280;337;280	Q9HC10;Q9HC10-2;Q9HC10-3;Q9HC10-4	OTOF_HUMAN;.;.;.	N	280;280;337;1027;1027	ENSP00000345137:D280N;ENSP00000344521:D280N;ENSP00000383906:D337N;ENSP00000272371:D1027N;ENSP00000385255:D1027N	ENSP00000272371:D1027N	D	-	1	0	OTOF	26551778	1.000000	0.71417	0.905000	0.35620	0.246000	0.25737	4.058000	0.57463	1.397000	0.46682	0.462000	0.41574	GAC		OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3		
CLIP4	79745	broad.mit.edu	37	2	29366687	29366687	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr2:29366687C>T	ENST00000320081.5	+	7	1016	c.761C>T	c.(760-762)gCg>gTg	p.A254V	CLIP4_ENST00000401605.1_Missense_Mutation_p.A254V|CLIP4_ENST00000404424.1_Missense_Mutation_p.A254V|CLIP4_ENST00000401617.2_Missense_Mutation_p.A147V	NM_024692.4	NP_078968.3	Q8N3C7	CLIP4_HUMAN	CAP-GLY domain containing linker protein family, member 4	254								p.A254V(2)		endometrium(4)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|prostate(1)|skin(1)	26	Acute lymphoblastic leukemia(172;0.155)					CTTCTAGATGCGGTGCCTCTG	0.502																																					p.A254V												.	.	2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	c.C761T	2						.						170.0	153.0	159.0					2																	29366687		2203	4300	6503	29220191	SO:0001583	missense	79745	exon7			AK024722	CCDS1770.1, CCDS74502.1	2p23	2013-01-10	2007-01-04	2007-01-04	ENSG00000115295	ENSG00000115295		"""Ankyrin repeat domain containing"""	26108	protein-coding gene	gene with protein product			"""restin-like 2"""	RSNL2			Standard	XM_005264562		Approved	FLJ21069	uc002rmv.3	Q8N3C7	OTTHUMG00000097837	ENST00000320081.5:c.761C>T	2.37:g.29366687C>T	ENSP00000327009:p.Ala254Val	Somatic		Capture	Illumina HiSeq	Phase_I	29220191	NM_024692	A0AV10|B2RMQ3|B7Z7N8|Q7Z4U3|Q96BR7|Q96MA5|Q9H7C0	Missense_Mutation	SNP	ENST00000320081.5	37	CCDS1770.1	.	.	.	.	.	.	.	.	.	.	C	18.15	3.558807	0.65538	.	.	ENSG00000115295	ENST00000401605;ENST00000401617;ENST00000404424;ENST00000402240;ENST00000320081;ENST00000379543;ENST00000530644	T;T;T;T	0.77750	-1.12;-0.84;-0.79;-0.79	5.64	5.64	0.86602	Cytoskeleton-associated protein, Gly-rich domain (1);	0.113685	0.64402	D	0.000015	D	0.82305	0.5008	M	0.70275	2.135	0.58432	D	0.999999	D;D	0.60160	0.987;0.987	P;P	0.47864	0.536;0.559	D	0.84531	0.0633	10	0.66056	D	0.02	.	19.6883	0.95987	0.0:1.0:0.0:0.0	.	254;254	A8K6D0;Q8N3C7	.;CLIP4_HUMAN	V	254;147;254;254;254;255;236	ENSP00000384242:A254V;ENSP00000385148:A147V;ENSP00000385594:A254V;ENSP00000327009:A254V	ENSP00000327009:A254V	A	+	2	0	CLIP4	29220191	1.000000	0.71417	0.046000	0.18839	0.034000	0.12701	4.550000	0.60733	2.654000	0.90174	0.650000	0.86243	GCG		CLIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215123.2	NM_024692	
POLR1A	25885	broad.mit.edu	37	2	86258599	86258599	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr2:86258599C>T	ENST00000263857.6	-	30	4810	c.4432G>A	c.(4432-4434)Gcc>Acc	p.A1478T	POLR1A_ENST00000409681.1_Intron			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	1478					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)	p.A1478T(1)		NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						GTCAGGAGGGCGGGAAGGGAC	0.652																																					p.A1478T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4432A	2						.						137.0	147.0	143.0					2																	86258599		2039	4157	6196	86112110	SO:0001583	missense	25885	exon30			AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.4432G>A	2.37:g.86258599C>T	ENSP00000263857:p.Ala1478Thr	Somatic		Capture	Illumina HiSeq	Phase_I	86112110	NM_015425	B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Missense_Mutation	SNP	ENST00000263857.6	37	CCDS42706.1	.	.	.	.	.	.	.	.	.	.	C	10.57	1.386817	0.25031	.	.	ENSG00000068654	ENST00000263857	T	0.66995	-0.24	2.91	-4.38	0.03622	RNA polymerase Rpb1, domain 5 (1);	3.737930	0.01441	N	0.015085	T	0.44829	0.1312	L	0.27053	0.805	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.13308	-1.0514	10	0.13853	T	0.58	.	1.0907	0.01662	0.157:0.2228:0.3607:0.2595	.	1478	O95602	RPA1_HUMAN	T	1478	ENSP00000263857:A1478T	ENSP00000263857:A1478T	A	-	1	0	POLR1A	86112110	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-1.240000	0.02914	-0.451000	0.07097	-0.300000	0.09419	GCC		POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329830.2	NM_015425	
LCT	3938	broad.mit.edu	37	2	136575378	136575378	+	Missense_Mutation	SNP	G	G	A	rs192524573		TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr2:136575378G>A	ENST00000264162.2	-	6	1250	c.1240C>T	c.(1240-1242)Cgc>Tgc	p.R414C	AC011893.3_ENST00000437007.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	414	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)	p.R414C(1)		breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	AGGGGCCTGCGTGGATCCCAG	0.637													G|||	1	0.000199681	0.0	0.0	5008	,	,		17144	0.0		0.001	False		,,,				2504	0.0				p.R414C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1240T	2						.						69.0	68.0	68.0					2																	136575378		2203	4300	6503	136291848	SO:0001583	missense	3938	exon6			X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.1240C>T	2.37:g.136575378G>A	ENSP00000264162:p.Arg414Cys	Somatic		Capture	Illumina HiSeq	Phase_I	136291848	NM_002299	Q4ZG58	Missense_Mutation	SNP	ENST00000264162.2	37	CCDS2178.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	16.07	3.019405	0.54576	.	.	ENSG00000115850	ENST00000264162	T	0.34072	1.38	5.77	-4.52	0.03472	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.711842	0.14645	N	0.306944	T	0.20088	0.0483	N	0.03608	-0.345	0.09310	N	1	P	0.47962	0.903	P	0.48677	0.586	T	0.37957	-0.9683	10	0.62326	D	0.03	2.6789	11.7896	0.52061	0.7987:0.102:0.0993:0.0	.	414	P09848	LPH_HUMAN	C	414	ENSP00000264162:R414C	ENSP00000264162:R414C	R	-	1	0	LCT	136291848	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.182000	0.16900	-0.593000	0.05844	-1.083000	0.02208	CGC		LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299	
TGFBR2	7048	broad.mit.edu	37	3	30713643	30713643	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr3:30713643T>C	ENST00000295754.5	+	4	1350	c.968T>C	c.(967-969)cTg>cCg	p.L323P	TGFBR2_ENST00000359013.4_Missense_Mutation_p.L348P	NM_003242.5	NP_003233.4	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II (70/80kDa)	323	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|aging (GO:0007568)|apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|cartilage development (GO:0051216)|common-partner SMAD protein phosphorylation (GO:0007182)|digestive tract development (GO:0048565)|embryo implantation (GO:0007566)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic hemopoiesis (GO:0035162)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lens development in camera-type eye (GO:0002088)|lens fiber cell apoptotic process (GO:1990086)|lung lobe morphogenesis (GO:0060463)|mammary gland morphogenesis (GO:0060443)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell tolerance induction (GO:0002663)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of tolerance induction to self antigen (GO:0002651)|protein phosphorylation (GO:0006468)|receptor-mediated endocytosis (GO:0006898)|regulation of cell proliferation (GO:0042127)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|smoothened signaling pathway (GO:0007224)|trachea formation (GO:0060440)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|wound healing (GO:0042060)	caveola (GO:0005901)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|glycosaminoglycan binding (GO:0005539)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type II (GO:0005026)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|type I transforming growth factor beta receptor binding (GO:0034713)|type III transforming growth factor beta receptor binding (GO:0034714)	p.L323P(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(15)|lung(10)|ovary(3)|pancreas(12)|skin(1)|stomach(5)|upper_aerodigestive_tract(2)	53						CAATACTGGCTGATCACCGCC	0.577																																					p.L323P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T968C	3						.						92.0	81.0	84.0					3																	30713643		2203	4300	6503	30688647	SO:0001583	missense	7048	exon4				CCDS2648.1, CCDS33727.1	3p22	2014-09-17	2002-08-29		ENSG00000163513	ENSG00000163513			11773	protein-coding gene	gene with protein product		190182	"""transforming growth factor, beta receptor II (70-80kD)"""	MFS2		1319842, 15235604	Standard	NM_001024847		Approved		uc003cen.3	P37173	OTTHUMG00000130569	ENST00000295754.5:c.968T>C	3.37:g.30713643T>C	ENSP00000295754:p.Leu323Pro	Somatic		Capture	Illumina HiSeq	Phase_I	30688647	NM_003242	B4DTV5|Q15580|Q6DKT6|Q99474	Missense_Mutation	SNP	ENST00000295754.5	37	CCDS2648.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.056500	0.76074	.	.	ENSG00000163513	ENST00000295754;ENST00000359013;ENST00000439925	T;T	0.71341	-0.56;-0.56	4.85	4.85	0.62838	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.074020	0.56097	D	0.000028	D	0.88764	0.6525	H	0.96015	3.755	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.92271	0.5825	10	0.87932	D	0	.	14.4493	0.67374	0.0:0.0:0.0:1.0	.	323;348	P37173;D2JYI1	TGFR2_HUMAN;.	P	323;348;153	ENSP00000295754:L323P;ENSP00000351905:L348P	ENSP00000295754:L323P	L	+	2	0	TGFBR2	30688647	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	8.036000	0.88901	1.813000	0.52934	0.533000	0.62120	CTG		TGFBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252994.2		
UBA3	9039	broad.mit.edu	37	3	69105768	69105768	+	Silent	SNP	T	T	G			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr3:69105768T>G	ENST00000361055.4	-	14	1132	c.1078A>C	c.(1078-1080)Aga>Cga	p.R360R	UBA3_ENST00000415609.2_Silent_p.R319R|UBA3_ENST00000540295.1_Silent_p.R183R|UBA3_ENST00000349511.4_Silent_p.R346R|CTD-2013N24.2_ENST00000595925.1_RNA	NM_003968.3	NP_003959.3	Q8TBC4	UBA3_HUMAN	ubiquitin-like modifier activating enzyme 3	360					cellular protein modification process (GO:0006464)|endomitotic cell cycle (GO:0007113)|protein neddylation (GO:0045116)|proteolysis (GO:0006508)|regulation of cell cycle (GO:0051726)	cytosol (GO:0005829)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|NEDD8 activating enzyme activity (GO:0019781)|protein heterodimerization activity (GO:0046982)	p.R360R(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	19		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;7.98e-05)|Epithelial(33;0.000363)|LUSC - Lung squamous cell carcinoma(21;0.012)|Lung(16;0.0191)|KIRC - Kidney renal clear cell carcinoma(39;0.206)|Kidney(39;0.241)		CTAACCTTTCTTTCTGCTTCA	0.284																																					p.R346R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1036C	3						.						107.0	107.0	107.0					3																	69105768		2201	4293	6494	69188458	SO:0001819	synonymous_variant	9039	exon13			AB012190	CCDS2909.1, CCDS2910.1	3p14.1	2013-09-26	2007-11-30	2007-11-30	ENSG00000144744	ENSG00000144744		"""Ubiquitin-like modifier activating enzymes"""	12470	protein-coding gene	gene with protein product	"""NEDD8-activating enzyme E1 catalytic subunit"", ""NEDD8-activating enzyme E1 subunit 2"""	603172	"""ubiquitin-activating enzyme E1C (homologous to yeast UBA3)"", ""ubiquitin-activating enzyme E1C (UBA3 homolog, yeast)"""	UBE1C		9694792	Standard	NM_003968		Approved	hUba3, NAE2	uc003dno.3	Q8TBC4	OTTHUMG00000154325	ENST00000361055.4:c.1078A>C	3.37:g.69105768T>G		Somatic		Capture	Illumina HiSeq	Phase_I	69188458	NM_198195	A6NLB5|A8K027|O76088|Q9NTU3	Silent	SNP	ENST00000361055.4	37	CCDS2909.1																																																																																				UBA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334839.1	NM_198195	
ADCY5	111	broad.mit.edu	37	3	123166282	123166282	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr3:123166282delG	ENST00000462833.1	-	1	2323	c.1111delC	c.(1111-1113)cagfs	p.Q371fs		NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	371					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)	p.Q371fs*6(1)		breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		AACTGGTCCTGGGCGTTGGTG	0.687																																					p.Q371fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1111delC	3						.						17.0	18.0	17.0					3																	123166282		2201	4298	6499	124648972	SO:0001589	frameshift_variant	111	exon1			U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.1111delC	3.37:g.123166282delG	ENSP00000419361:p.Gln371fs	Somatic		Capture	Illumina HiSeq	Phase_I	124648972	NM_183357	B7Z8A6|Q7RTV7|Q8NFM3	Frame_Shift_Del	DEL	ENST00000462833.1	37	CCDS3022.1																																																																																				ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355889.4	XM_171048	
PIK3CA	5290	broad.mit.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.E545K	Colon(199;1504 1750 3362 26421 31210 32040)		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA,urinary_tract,bladder,Substitution - Missense,0 	.	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)	c.G1633A	3						.						61.0	60.0	60.0					3																	178936091		1813	4072	5885	180418785	SO:0001583	missense	5290	exon10				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	Somatic		Capture	Illumina HiSeq	Phase_I	180418785	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG		PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
MANBA	4126	broad.mit.edu	37	4	103560994	103560994	+	Silent	SNP	G	G	C			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr4:103560994G>C	ENST00000226578.4	-	14	1989	c.1890C>G	c.(1888-1890)gtC>gtG	p.V630V	MANBA_ENST00000505239.1_Silent_p.V573V	NM_005908.3	NP_005899.3	O00462	MANBA_HUMAN	mannosidase, beta A, lysosomal	630					cellular protein modification process (GO:0006464)|glycoprotein catabolic process (GO:0006516)|mannan catabolic process (GO:0046355)	intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)	beta-mannosidase activity (GO:0004567)|mannose binding (GO:0005537)	p.V630V(1)		cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;4.44e-08)		TTTCTGTTTTGACACACTGGG	0.458																																					p.V630V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1890G	4						.						117.0	101.0	107.0					4																	103560994		2203	4300	6503	103780042	SO:0001819	synonymous_variant	4126	exon14				CCDS3658.1	4q24	2013-09-20			ENSG00000109323	ENSG00000109323	3.2.1.25		6831	protein-coding gene	gene with protein product		609489				7876128	Standard	NM_005908		Approved		uc003hwg.3	O00462	OTTHUMG00000131123	ENST00000226578.4:c.1890C>G	4.37:g.103560994G>C		Somatic		Capture	Illumina HiSeq	Phase_I	103780042	NM_005908	Q96BC3|Q9NYX9	Silent	SNP	ENST00000226578.4	37	CCDS3658.1																																																																																				MANBA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253803.2		
CASP6	839	broad.mit.edu	37	4	110618909	110618909	+	Silent	SNP	C	C	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr4:110618909C>T	ENST00000265164.2	-	3	176	c.99G>A	c.(97-99)ccG>ccA	p.P33P	CASP6_ENST00000352981.3_Intron|CASP6_ENST00000505486.1_Silent_p.P33P	NM_001226.3	NP_001217.2	P55212	CASP6_HUMAN	caspase 6, apoptosis-related cysteine peptidase	33					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|epithelial cell differentiation (GO:0030855)|proteolysis (GO:0006508)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|identical protein binding (GO:0042802)	p.P33P(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	8		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000171)		ACTTTTCTGCCGGATCAAACA	0.393																																					p.P33P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G99A	4						.						139.0	134.0	136.0					4																	110618909		2203	4300	6503	110838358	SO:0001819	synonymous_variant	839	exon3			U20536	CCDS3684.1, CCDS3685.1	4q25	2008-02-05	2005-08-17		ENSG00000138794	ENSG00000138794		"""Caspases"""	1507	protein-coding gene	gene with protein product		601532	"""caspase 6, apoptosis-related cysteine protease"""			8780721, 7796396	Standard	XM_005263271		Approved	MCH2	uc003hzn.1	P55212	OTTHUMG00000131914	ENST00000265164.2:c.99G>A	4.37:g.110618909C>T		Somatic		Capture	Illumina HiSeq	Phase_I	110838358	NM_001226	Q9BQE7	Silent	SNP	ENST00000265164.2	37	CCDS3684.1																																																																																				CASP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254866.1	NM_001226	
FBXW7	55294	broad.mit.edu	37	4	153249384	153249384	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr4:153249384C>T	ENST00000281708.4	-	9	2623	c.1394G>A	c.(1393-1395)cGt>cAt	p.R465H	FBXW7_ENST00000263981.5_Missense_Mutation_p.R385H|FBXW7_ENST00000603841.1_Missense_Mutation_p.R465H|FBXW7_ENST00000393956.3_Missense_Mutation_p.R289H|FBXW7_ENST00000296555.5_Missense_Mutation_p.R347H|FBXW7_ENST00000603548.1_Missense_Mutation_p.R465H	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	465			R -> C (in a acute lymphoblastic leukemia cell line). {ECO:0000269|PubMed:11565033}.|R -> H (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.R465H(69)|p.R385H(16)|p.R226H(16)|p.R465L(4)|p.R347H(4)|p.R465Y(2)|p.?(1)|p.R385L(1)|p.R226L(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				ATGCATACAACGCACAGTGGA	0.408			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																p.R385H			Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	FBXW7,large_intestine,NS,Substitution - Missense,0 	.	114	Substitution - Missense(113)|Unknown(1)	haematopoietic_and_lymphoid_tissue(40)|large_intestine(39)|endometrium(24)|lung(5)|ovary(4)|cervix(1)|biliary_tract(1)	c.G1154A	4						.						253.0	218.0	230.0					4																	153249384		2203	4300	6503	153468834	SO:0001583	missense	55294	exon8			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1394G>A	4.37:g.153249384C>T	ENSP00000281708:p.Arg465His	Somatic		Capture	Illumina HiSeq	Phase_I	153468834	NM_018315	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	ENST00000281708.4	37	CCDS3777.1	.	.	.	.	.	.	.	.	.	.	C	32	5.178201	0.94846	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	6.05	6.05	0.98169	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.63827	0.2544	L	0.56124	1.755	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;1.0	T	0.62469	-0.6848	10	0.87932	D	0	-17.2313	20.6013	0.99457	0.0:1.0:0.0:0.0	.	289;465;347;385	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	H	465;347;385;289	ENSP00000281708:R465H;ENSP00000296555:R347H;ENSP00000263981:R385H;ENSP00000377528:R289H	ENSP00000263981:R385H	R	-	2	0	FBXW7	153468834	1.000000	0.71417	0.960000	0.40013	0.996000	0.88848	7.818000	0.86416	2.878000	0.98634	0.650000	0.86243	CGT		FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1		
ZNF721	170960	broad.mit.edu	37	4	437166	437166	+	Nonsense_Mutation	SNP	C	C	A	rs202144739		TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr4:437166C>A	ENST00000338977.5	-	2	1102	c.1054G>T	c.(1054-1056)Gaa>Taa	p.E352*	ABCA11P_ENST00000451020.2_RNA|ZNF721_ENST00000507078.1_Intron|ZNF721_ENST00000511833.2_Nonsense_Mutation_p.E364*|ZNF721_ENST00000506646.1_Intron			Q8TF20	ZN721_HUMAN	zinc finger protein 721	352					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E364*(1)|p.E134*(1)		endometrium(2)|kidney(2)|large_intestine(15)|lung(6)|ovary(1)|skin(1)|stomach(5)|urinary_tract(1)	33						CCACAGTCTTCGCATTTGTAA	0.433																																					p.E364X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.G1090T	4						.						98.0	105.0	103.0					4																	437166		2156	4277	6433	427166	SO:0001587	stop_gained	170960	exon3			AK092362	CCDS46991.1	4p16.3	2013-01-08			ENSG00000182903	ENSG00000182903		"""Zinc fingers, C2H2-type"", ""-"""	29425	protein-coding gene	gene with protein product						11853319	Standard	NM_133474		Approved	KIAA1982	uc003gag.4	Q8TF20		ENST00000338977.5:c.1054G>T	4.37:g.437166C>A	ENSP00000340524:p.Glu352*	Somatic		Capture	Illumina HiSeq	Phase_I	427166	NM_133474	Q69YG7	Nonsense_Mutation	SNP	ENST00000338977.5	37		.	.	.	.	.	.	.	.	.	.	C	10.74	1.435936	0.25813	.	.	ENSG00000182903	ENST00000338977;ENST00000511833	.	.	.	0.71	-1.42	0.08913	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06757	T	0.87	.	2.5148	0.04666	0.2338:0.2171:0.0:0.5491	.	.	.	.	X	352;364	.	ENSP00000340524:E352X	E	-	1	0	ZNF721	427166	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-4.078000	0.00299	-1.222000	0.02587	-1.038000	0.02383	GAA		ZNF721-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000357939.1	NM_133474	
YTHDC1	91746	broad.mit.edu	37	4	69203142	69203142	+	Silent	SNP	A	A	C			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr4:69203142A>C	ENST00000344157.4	-	4	821	c.486T>G	c.(484-486)cgT>cgG	p.R162R	YTHDC1_ENST00000355665.3_Silent_p.R162R|YTHDC1_ENST00000579690.1_Silent_p.R162R	NM_001031732.2	NP_001026902.1	Q96MU7	YTDC1_HUMAN	YTH domain containing 1	162					mRNA splice site selection (GO:0006376)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.R162R(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	30						ATCTGCTTGCACGTCTATCCA	0.438																																					p.R162R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T486G	4						.						83.0	76.0	78.0					4																	69203142		2203	4300	6503	68885737	SO:0001819	synonymous_variant	91746	exon4			AK098515	CCDS3522.2, CCDS33992.1	4q13.3	2009-01-14			ENSG00000083896	ENSG00000083896			30626	protein-coding gene	gene with protein product						12368078, 10564280	Standard	XM_005265706		Approved	YT521, KIAA1966, YT521-B	uc003hdx.3	Q96MU7	OTTHUMG00000129306	ENST00000344157.4:c.486T>G	4.37:g.69203142A>C		Somatic		Capture	Illumina HiSeq	Phase_I	68885737	NM_001031732	Q4W5Q3|Q7Z622|Q8TF35	Silent	SNP	ENST00000344157.4	37	CCDS33992.1																																																																																				YTHDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251437.1	NM_133370	
PDHA2	5161	broad.mit.edu	37	4	96761325	96761325	+	Silent	SNP	C	C	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr4:96761325C>T	ENST00000295266.4	+	1	87	c.24C>T	c.(22-24)cgC>cgT	p.R8R		NM_005390.4	NP_005381.1	P29803	ODPAT_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 2	8					glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)	p.R8R(1)		NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(23)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	46		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)		TCATCTCCCGCGTGTTGAGGC	0.562																																					p.R8R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C24T	4						.						45.0	44.0	44.0					4																	96761325		2203	4300	6503	96980348	SO:0001819	synonymous_variant	5161	exon1				CCDS3644.1	4q22-q23	2009-11-09			ENSG00000163114	ENSG00000163114	1.2.4.1		8807	protein-coding gene	gene with protein product		179061		PDHAL			Standard	NM_005390		Approved		uc003htr.4	P29803	OTTHUMG00000130990	ENST00000295266.4:c.24C>T	4.37:g.96761325C>T		Somatic		Capture	Illumina HiSeq	Phase_I	96980348	NM_005390	B2R9Q3|Q0VDI5|Q4VC02|Q6NXQ1	Silent	SNP	ENST00000295266.4	37	CCDS3644.1																																																																																				PDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253608.1		
DCHS2	54798	broad.mit.edu	37	4	155157988	155157988	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr4:155157988G>T	ENST00000357232.4	-	25	6450	c.6451C>A	c.(6451-6453)Cat>Aat	p.H2151N		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2151	Cadherin 19. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.H2151N(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TATTCTGAATGAAAGAACTTA	0.398																																					p.H2151N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C6451A	4						.						87.0	86.0	86.0					4																	155157988		2203	4300	6503	155377438	SO:0001583	missense	54798	exon25			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.6451C>A	4.37:g.155157988G>T	ENSP00000349768:p.His2151Asn	Somatic		Capture	Illumina HiSeq	Phase_I	155377438	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	37	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	G	0.016	-1.533863	0.00951	.	.	ENSG00000197410	ENST00000357232	T	0.50813	0.73	5.95	2.22	0.28083	Cadherin (4);Cadherin-like (1);	1.189030	0.05860	N	0.622874	T	0.32941	0.0846	N	0.14661	0.345	0.09310	N	1	B	0.32101	0.356	B	0.33295	0.161	T	0.29852	-0.9998	10	0.27785	T	0.31	.	9.5856	0.39514	0.1356:0.4125:0.4519:0.0	.	2151	Q6V1P9	PCD23_HUMAN	N	2151	ENSP00000349768:H2151N	ENSP00000349768:H2151N	H	-	1	0	DCHS2	155377438	0.002000	0.14202	0.000000	0.03702	0.150000	0.21749	1.382000	0.34374	0.098000	0.17522	-0.253000	0.11424	CAT		DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
APC	324	broad.mit.edu	37	5	112173704	112173704	+	Nonsense_Mutation	SNP	C	C	T	rs587779783		TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr5:112173704C>T	ENST00000457016.1	+	16	2793	c.2413C>T	c.(2413-2415)Cga>Tga	p.R805*	APC_ENST00000508376.2_Nonsense_Mutation_p.R805*|APC_ENST00000257430.4_Nonsense_Mutation_p.R805*|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	805	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R805*(10)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TGACACCAATCGACATGATGA	0.373		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R787X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,right,Substitution - Nonsense,0 	.	11	Substitution - Nonsense(10)|Unknown(1)	large_intestine(10)|skin(1)	c.C2359T	5	GRCh37	CM960067	APC	M		.						77.0	78.0	78.0					5																	112173704		2202	4300	6502	112201603	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2413C>T	5.37:g.112173704C>T	ENSP00000413133:p.Arg805*	Somatic		Capture	Illumina HiSeq	Phase_I	112201603	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	36	5.853935	0.97030	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	6.16	4.36	0.52297	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	-10.8016	14.7295	0.69372	0.4961:0.5038:0.0:0.0	.	.	.	.	X	805;787;805;805;805	.	ENSP00000257430:R805X	R	+	1	2	APC	112201603	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.615000	0.36922	0.896000	0.36366	-0.188000	0.12872	CGA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
APC	324	broad.mit.edu	37	5	112175639	112175639	+	Nonsense_Mutation	SNP	C	C	T	rs121913332		TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr5:112175639C>T	ENST00000457016.1	+	16	4728	c.4348C>T	c.(4348-4350)Cga>Tga	p.R1450*	APC_ENST00000508376.2_Nonsense_Mutation_p.R1450*|APC_ENST00000257430.4_Nonsense_Mutation_p.R1450*|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	1450	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R1450*(153)|p.?(1)|p.P1424fs*19(1)|p.K1192fs*3(1)|p.R1450fs*22(1)|p.S1436fs*22(1)|p.R1450fs*5(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TCAAACCAAGCGAGAAGTACC	0.478	R1450*(LS123_LARGE_INTESTINE)|R1450*(MKN74_STOMACH)|R1450*(SW1417_LARGE_INTESTINE)|R1450*(SW837_LARGE_INTESTINE)	12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R1432X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,rectum,Substitution - Nonsense,0 	.	159	Substitution - Nonsense(153)|Deletion - Frameshift(4)|Unknown(1)|Insertion - Frameshift(1)	large_intestine(136)|stomach(13)|soft_tissue(4)|small_intestine(3)|endometrium(1)|skin(1)|pancreas(1)	c.C4294T	5	GRCh37	CM930030	APC	M	rs121913332	.						102.0	90.0	94.0					5																	112175639		2202	4300	6502	112203538	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4348C>T	5.37:g.112175639C>T	ENSP00000413133:p.Arg1450*	Somatic		Capture	Illumina HiSeq	Phase_I	112203538	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	41	8.651223	0.98901	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.17	4.2	0.49525	.	0.600559	0.18052	N	0.153248	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-1.0649	14.037	0.64651	0.426:0.574:0.0:0.0	.	.	.	.	X	1450	.	.	R	+	1	2	APC	112203538	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.171000	0.50824	1.564000	0.49628	0.655000	0.94253	CGA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
FBN2	2201	broad.mit.edu	37	5	127673797	127673797	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr5:127673797G>A	ENST00000508053.1	-	33	4464	c.3490C>T	c.(3490-3492)Cgt>Tgt	p.R1164C	FBN2_ENST00000262464.4_Missense_Mutation_p.R1164C|FBN2_ENST00000508989.1_Missense_Mutation_p.R1131C|FBN2_ENST00000507835.1_Missense_Mutation_p.R14C			P35556	FBN2_HUMAN	fibrillin 2	1164	EGF-like 17; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.R1164C(1)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		AGAGGGTTACGTTCACATTCG	0.473																																					p.R1164C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3490T	5						.						75.0	67.0	70.0					5																	127673797		2203	4300	6503	127701696	SO:0001583	missense	2201	exon27			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.3490C>T	5.37:g.127673797G>A	ENSP00000424571:p.Arg1164Cys	Somatic		Capture	Illumina HiSeq	Phase_I	127701696	NM_001999	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	G	19.83	3.900935	0.72754	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000507835;ENST00000508989	D;D;D;D	0.92249	-3.0;-3.0;-3.0;-3.0	4.89	4.89	0.63831	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.072279	0.56097	D	0.000034	D	0.95159	0.8431	M	0.70903	2.155	0.58432	D	0.999994	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.986	D	0.95075	0.8208	10	0.72032	D	0.01	.	13.5668	0.61824	0.0:0.0:0.8447:0.1553	.	1131;1164	D6RJI3;P35556	.;FBN2_HUMAN	C	1164;1164;14;1131	ENSP00000262464:R1164C;ENSP00000424571:R1164C;ENSP00000426839:R14C;ENSP00000425596:R1131C	ENSP00000262464:R1164C	R	-	1	0	FBN2	127701696	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.955000	0.70306	2.712000	0.92718	0.650000	0.86243	CGT		FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
SLC4A9	83697	broad.mit.edu	37	5	139742606	139742606	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr5:139742606C>A	ENST00000230993.6	+	7	1024	c.989C>A	c.(988-990)aCa>aAa	p.T330K	SLC4A9_ENST00000507527.1_Missense_Mutation_p.T330K|SLC4A9_ENST00000506757.2_Missense_Mutation_p.T306K|SLC4A9_ENST00000506545.1_Missense_Mutation_p.T306K|SLC4A9_ENST00000432095.2_Missense_Mutation_p.T306K	NM_001258428.1	NP_001245357.1	Q96Q91	B3A4_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 9	330					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)	p.T304K(1)		endometrium(4)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGGACCCAACAGCCCGGATT	0.582											OREG0016461	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T306K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C917A	5						.						82.0	86.0	85.0					5																	139742606		1970	4142	6112	139722790	SO:0001583	missense	83697	exon7			AF313465	CCDS47278.1, CCDS58973.1, CCDS58974.1, CCDS58975.1	5q31.3	2013-05-22			ENSG00000113073	ENSG00000113073		"""Solute carriers"""	11035	protein-coding gene	gene with protein product		610207				11305939	Standard	NM_031467		Approved	AE4	uc003lfk.2	Q96Q91	OTTHUMG00000163352	ENST00000230993.6:c.989C>A	5.37:g.139742606C>A	ENSP00000230993:p.Thr330Lys	Somatic	1651	Capture	Illumina HiSeq	Phase_I	139722790	NM_031467	B7ZL63|D3DQD4|D3DQD5|D3DQD6|E9PDK1|Q96RM5|Q9BXF2|Q9BXN3	Missense_Mutation	SNP	ENST00000230993.6	37	CCDS58973.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.032881	0.75504	.	.	ENSG00000113073	ENST00000230993;ENST00000506757;ENST00000432095;ENST00000506545;ENST00000507527	T;T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16;-1.16	5.13	5.13	0.70059	Bicarbonate transporter, cytoplasmic (1);Phosphotransferase/anion transporter (1);	0.078604	0.51477	D	0.000092	D	0.83876	0.5349	L	0.49126	1.545	0.48135	D	0.999597	D;D;D;D	0.69078	0.98;0.997;0.996;0.996	P;D;D;D	0.70016	0.894;0.967;0.923;0.923	T	0.82295	-0.0528	10	0.37606	T	0.19	.	15.4371	0.75155	0.0:0.8511:0.1489:0.0	.	306;330;306;306	E9PDK1;Q96Q91;Q96Q91-2;Q96Q91-3	.;B3A4_HUMAN;.;.	K	330;306;306;306;330	ENSP00000230993:T330K;ENSP00000424424:T306K;ENSP00000410056:T306K;ENSP00000422855:T306K;ENSP00000427661:T330K	ENSP00000230993:T330K	T	+	2	0	SLC4A9	139722790	0.775000	0.28604	0.999000	0.59377	0.948000	0.59901	2.625000	0.46452	2.667000	0.90743	0.462000	0.41574	ACA		SLC4A9-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000372823.1	NM_031467	
PCDHAC1	56135	broad.mit.edu	37	5	140307018	140307018	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr5:140307018G>A	ENST00000253807.2	+	1	541	c.541G>A	c.(541-543)Gaa>Aaa	p.E181K	PCDHAC1_ENST00000409700.3_Missense_Mutation_p.E181K|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron	NM_018898.3	NP_061721.2	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1	181	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.E181K(1)		NS(2)|breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|liver(2)|lung(13)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	65			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGACGGCAGCGAATACCCGGA	0.612																																					p.E181K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G541A	5						.						66.0	72.0	70.0					5																	140307018		2203	4300	6503	140287202	SO:0001583	missense	56135	exon1			AF152473	CCDS4241.1	5q31	2010-11-26			ENSG00000248383	ENSG00000248383		"""Cadherins / Protocadherins : Clustered"""	8676	other	complex locus constituent	"""PCDH-ALPHA-C1"""	606320				10380929	Standard	NM_018898		Approved			Q9H158	OTTHUMG00000129603	ENST00000253807.2:c.541G>A	5.37:g.140307018G>A	ENSP00000253807:p.Glu181Lys	Somatic		Capture	Illumina HiSeq	Phase_I	140287202	NM_031882	Q9Y5F5|Q9Y5I5	Missense_Mutation	SNP	ENST00000253807.2	37	CCDS4241.1	.	.	.	.	.	.	.	.	.	.	G	0.013	-1.611189	0.00835	.	.	ENSG00000248383	ENST00000409700;ENST00000253807	T;T	0.19669	2.13;2.13	5.7	-1.95	0.07548	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.02848	0.0085	N	0.00064	-2.31	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.04013	0.0;0.001	T	0.43212	-0.9405	9	0.02654	T	1	.	8.7749	0.34756	0.2895:0.4864:0.2241:0.0	.	181;181	Q9H158;Q9H158-2	PCDC1_HUMAN;.	K	181	ENSP00000386356:E181K;ENSP00000253807:E181K	ENSP00000253807:E181K	E	+	1	0	PCDHAC1	140287202	0.000000	0.05858	0.050000	0.19076	0.387000	0.30353	0.314000	0.19432	-0.347000	0.08299	-0.304000	0.09214	GAA		PCDHAC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251798.1	NM_018898	
PCDHGA3	56112	broad.mit.edu	37	5	140723779	140723779	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr5:140723779C>T	ENST00000253812.6	+	1	179	c.179C>T	c.(178-180)gCg>gTg	p.A60V	PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	60	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A60V(1)		breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGGAGCTGGCGGAGCGCGGA	0.612											OREG0016855	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A60V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C179T	5						.						80.0	96.0	91.0					5																	140723779		2160	4287	6447	140703963	SO:0001583	missense	56112	exon1			AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.179C>T	5.37:g.140723779C>T	ENSP00000253812:p.Ala60Val	Somatic	1658	Capture	Illumina HiSeq	Phase_I	140703963	NM_018916	Q9Y5D4	Missense_Mutation	SNP	ENST00000253812.6	37	CCDS47290.1	.	.	.	.	.	.	.	.	.	.	.	5.254	0.232303	0.09969	.	.	ENSG00000254245	ENST00000253812	T	0.41065	1.01	5.65	0.77	0.18497	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	1.170020	0.06993	U	0.821912	T	0.41766	0.1173	M	0.73753	2.245	0.09310	N	1	B;B	0.31989	0.047;0.35	B;B	0.28139	0.052;0.086	T	0.36065	-0.9763	10	0.59425	D	0.04	.	6.8453	0.23984	0.0:0.4049:0.3397:0.2555	.	60;60	Q9Y5H0-2;Q9Y5H0	.;PCDG3_HUMAN	V	60	ENSP00000253812:A60V	ENSP00000253812:A60V	A	+	2	0	PCDHGA3	140703963	0.000000	0.05858	0.638000	0.29380	0.050000	0.14768	-1.722000	0.01868	-0.081000	0.12662	-0.211000	0.12701	GCG		PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377017.1	NM_018916	
WWC1	23286	broad.mit.edu	37	5	167882424	167882424	+	Missense_Mutation	SNP	C	C	T	rs549137219		TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr5:167882424C>T	ENST00000265293.4	+	19	3224	c.2722C>T	c.(2722-2724)Cgg>Tgg	p.R908W	WWC1_ENST00000522140.1_3'UTR|WWC1_ENST00000521089.1_Missense_Mutation_p.R908W	NM_001161661.1|NM_001161662.1|NM_015238.2	NP_001155133.1|NP_001155134.1|NP_056053.1	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1	908	Interaction with histone H3.				cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|hippo signaling (GO:0035329)|negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of MAPK cascade (GO:0043410)|regulation of hippo signaling (GO:0035330)|regulation of intracellular transport (GO:0032386)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)|transcription coactivator activity (GO:0003713)	p.R908W(1)		breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(1)|skin(4)	43	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		ACCTAAGGACCGGAGAGTGGG	0.622																																					p.R908W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2722T	5						.						102.0	109.0	107.0					5																	167882424		2203	4300	6503	167815002	SO:0001583	missense	23286	exon19			AF506799	CCDS4366.1, CCDS54945.1	5q34	2014-06-13	2006-11-09		ENSG00000113645	ENSG00000113645		"""WW, C2 and coiled-coil domain containing"""	29435	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 168"""	610533	"""WW, C2 and coiled-coil domain containing 1"""			10048485, 12559952	Standard	NM_001161661		Approved	KIBRA, KIAA0869, PPP1R168	uc011den.2	Q8IX03	OTTHUMG00000130408	ENST00000265293.4:c.2722C>T	5.37:g.167882424C>T	ENSP00000265293:p.Arg908Trp	Somatic		Capture	Illumina HiSeq	Phase_I	167815002	NM_001161661	B4DK05|O94946|Q6MZX4|Q6Y2F8|Q7Z4G8|Q8WVM4|Q9BT29	Missense_Mutation	SNP	ENST00000265293.4	37	CCDS4366.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.27|13.27	2.188448|2.188448	0.38609|0.38609	.|.	.|.	ENSG00000113645|ENSG00000113645	ENST00000393895;ENST00000524228|ENST00000265293;ENST00000521089;ENST00000524038	.|T;T;T	.|0.56611	.|0.45;0.45;0.45	5.46|5.46	2.48|2.48	0.30137|0.30137	.|.	.|0.217727	.|0.37012	.|N	.|0.002294	T|T	0.63486|0.63486	0.2515|0.2515	M|M	0.64080|0.64080	1.96|1.96	0.43683|0.43683	D|D	0.996124|0.996124	.|D;B	.|0.76494	.|0.999;0.171	.|D;B	.|0.65140	.|0.932;0.021	T|T	0.63510|0.63510	-0.6621|-0.6621	5|10	.|0.66056	.|D	.|0.02	.|.	9.0996|9.0996	0.36660|0.36660	0.5364:0.3538:0.1097:0.0|0.5364:0.3538:0.1097:0.0	.|.	.|908;908	.|Q8IX03-2;Q8IX03	.|.;KIBRA_HUMAN	L|W	869;684|908;908;234	.|ENSP00000265293:R908W;ENSP00000427772:R908W;ENSP00000428084:R234W	.|ENSP00000265293:R908W	P|R	+|+	2|1	0|2	WWC1|WWC1	167815002|167815002	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.606000|0.606000	0.37113|0.37113	2.503000|2.503000	0.45407|0.45407	0.632000|0.632000	0.30432|0.30432	0.655000|0.655000	0.94253|0.94253	CCG|CGG		WWC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252791.2	NM_015238	
ASCC3	10973	broad.mit.edu	37	6	101099444	101099444	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr6:101099444G>T	ENST00000369162.2	-	19	3411	c.3067C>A	c.(3067-3069)Caa>Aaa	p.Q1023K		NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3	1023	SEC63 1.				cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)	p.Q1023K(1)		breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		ACCTTAATTTGATCAAATTCT	0.299																																					p.Q1023K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3067A	6						.						84.0	85.0	84.0					6																	101099444		2203	4292	6495	101206165	SO:0001583	missense	10973	exon19			AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.3067C>A	6.37:g.101099444G>T	ENSP00000358159:p.Gln1023Lys	Somatic		Capture	Illumina HiSeq	Phase_I	101206165	NM_006828	E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Missense_Mutation	SNP	ENST00000369162.2	37	CCDS5046.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.608533	0.87258	.	.	ENSG00000112249	ENST00000369162	T	0.61040	0.14	5.88	5.88	0.94601	Sec63 domain (3);	0.000000	0.85682	D	0.000000	T	0.74589	0.3736	M	0.87827	2.91	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.73164	-0.4069	10	0.33141	T	0.24	.	17.1725	0.86833	0.0:0.1258:0.8742:0.0	.	1023	Q8N3C0	HELC1_HUMAN	K	1023	ENSP00000358159:Q1023K	ENSP00000358159:Q1023K	Q	-	1	0	ASCC3	101206165	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.124000	0.71620	2.780000	0.95670	0.655000	0.94253	CAA		ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041632.2	NM_006828	
HACE1	57531	broad.mit.edu	37	6	105239396	105239396	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr6:105239396T>C	ENST00000262903.4	-	11	1333	c.1057A>G	c.(1057-1059)Aga>Gga	p.R353G	HACE1_ENST00000369125.2_Missense_Mutation_p.R353G	NM_020771.3	NP_065822.2	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1	353					cell cycle (GO:0007049)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|Rac protein signal transduction (GO:0016601)|regulation of cell migration (GO:0030334)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Rab GTPase binding (GO:0017137)|Rac GTPase binding (GO:0048365)|ubiquitin-protein transferase activity (GO:0004842)	p.R353G(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	44		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		ACCTGGCTTCTTGGAGTTTTA	0.388																																					p.R353G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1057G	6						.						168.0	161.0	163.0					6																	105239396		2203	4300	6503	105346089	SO:0001583	missense	57531	exon11			BC034982	CCDS5050.1	6q21	2013-01-10	2012-02-23		ENSG00000085382	ENSG00000085382		"""Ankyrin repeat domain containing"""	21033	protein-coding gene	gene with protein product		610876				10718198	Standard	NM_020771		Approved	KIAA1320	uc003pqu.1	Q8IYU2	OTTHUMG00000015287	ENST00000262903.4:c.1057A>G	6.37:g.105239396T>C	ENSP00000262903:p.Arg353Gly	Somatic		Capture	Illumina HiSeq	Phase_I	105346089	NM_020771	A8K6U5|B3KY89|B4DFM6|B4DTQ4|B7Z9X6|E9PGP0|Q5VU99|Q5VUA0|Q8ND12|Q9P2M6	Missense_Mutation	SNP	ENST00000262903.4	37	CCDS5050.1	.	.	.	.	.	.	.	.	.	.	T	16.59	3.166423	0.57476	.	.	ENSG00000085382	ENST00000262903;ENST00000369125	T;T	0.41400	1.05;1.0	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.33702	0.0872	N	0.24115	0.695	0.80722	D	1	D;D	0.54601	0.967;0.967	D;D	0.63597	0.916;0.916	T	0.16719	-1.0393	10	0.26408	T	0.33	.	12.1225	0.53900	0.0:0.0:0.143:0.857	.	353;353	E9PGP0;Q8IYU2	.;HACE1_HUMAN	G	353	ENSP00000262903:R353G;ENSP00000358121:R353G	ENSP00000262903:R353G	R	-	1	2	HACE1	105346089	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.022000	0.64078	2.230000	0.72887	0.528000	0.53228	AGA		HACE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041643.2	XM_045095	
TAAR2	9287	broad.mit.edu	37	6	132938932	132938932	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr6:132938932G>A	ENST00000367931.1	-	2	412	c.413C>T	c.(412-414)gCc>gTc	p.A138V	TAAR2_ENST00000275191.2_Missense_Mutation_p.A93V|TAAR2_ENST00000537809.1_Missense_Mutation_p.A93V			Q9P1P5	TAAR2_HUMAN	trace amine associated receptor 2	138					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)	p.A138V(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(1)	23	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00608)|GBM - Glioblastoma multiforme(226;0.0151)		TCTATCAATGGCCACTGAGCA	0.353																																					p.A138V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C413T	6						.						68.0	68.0	68.0					6																	132938932		2203	4300	6503	132980625	SO:0001583	missense	9287	exon2			AF112460	CCDS34541.1, CCDS5157.1	6q24	2012-08-08	2005-02-23	2005-02-24	ENSG00000146378	ENSG00000146378		"""GPCR / Class A : Trace amine associated receptors"""	4514	protein-coding gene	gene with protein product		604849	"""G protein-coupled receptor 58"""	GPR58		10684976, 15718104	Standard	NM_014626		Approved		uc003qdl.1	Q9P1P5	OTTHUMG00000015585	ENST00000367931.1:c.413C>T	6.37:g.132938932G>A	ENSP00000356908:p.Ala138Val	Somatic		Capture	Illumina HiSeq	Phase_I	132980625	NM_001033080	Q5QD02|Q6NWS1|Q6NWS2|Q6NWS3	Missense_Mutation	SNP	ENST00000367931.1	37	CCDS34541.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.595453	0.86953	.	.	ENSG00000146378	ENST00000275191;ENST00000367931;ENST00000537809	T;T;T	0.77620	-1.11;-1.11;-1.11	6.0	6.0	0.97389	GPCR, rhodopsin-like superfamily (1);	0.063358	0.64402	D	0.000009	D	0.90875	0.7133	M	0.92412	3.305	0.52099	D	0.999946	D	0.89917	1.0	D	0.97110	1.0	D	0.91752	0.5413	10	0.87932	D	0	-33.0793	20.4945	0.99205	0.0:0.0:1.0:0.0	.	138	Q9P1P5	TAAR2_HUMAN	V	93;138;93	ENSP00000275191:A93V;ENSP00000356908:A138V;ENSP00000441263:A93V	ENSP00000275191:A93V	A	-	2	0	TAAR2	132980625	1.000000	0.71417	0.972000	0.41901	0.759000	0.43091	9.734000	0.98822	2.846000	0.97976	0.650000	0.86243	GCC		TAAR2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390735.1	NM_014626	
TIAM2	26230	broad.mit.edu	37	6	155450370	155450370	+	Missense_Mutation	SNP	G	G	A	rs551467133		TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr6:155450370G>A	ENST00000461783.3	+	6	1286	c.13G>A	c.(13-15)Gac>Aac	p.D5N	TIAM2_ENST00000318981.5_Missense_Mutation_p.D5N|TIAM2_ENST00000367174.2_5'UTR|TIAM2_ENST00000456144.1_Missense_Mutation_p.D5N|TIAM2_ENST00000360366.4_Missense_Mutation_p.D5N|TIAM2_ENST00000529824.2_Missense_Mutation_p.D5N			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	5					apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.D5N(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		GGGCAACTCCGACAGTCAGTA	0.383																																					p.D5N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G13A	6						.						56.0	53.0	54.0					6																	155450370		2203	4300	6503	155492062	SO:0001583	missense	26230	exon3				CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.13G>A	6.37:g.155450370G>A	ENSP00000437188:p.Asp5Asn	Somatic		Capture	Illumina HiSeq	Phase_I	155492062	NM_012454	B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Missense_Mutation	SNP	ENST00000461783.3	37	CCDS34558.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.079280	0.76528	.	.	ENSG00000146426	ENST00000461783;ENST00000528928;ENST00000545347;ENST00000538270;ENST00000535231;ENST00000528535;ENST00000456144;ENST00000318981;ENST00000535583;ENST00000360366;ENST00000529824	T;T;T;T;T;T	0.05081	3.62;3.5;3.56;3.62;3.61;3.56	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.02193	0.0068	N	0.08118	0	0.80722	D	1	B	0.15930	0.015	B	0.13407	0.009	T	0.48927	-0.8991	10	0.87932	D	0	.	17.8509	0.88747	0.0:0.0:1.0:0.0	.	5	Q8IVF5	TIAM2_HUMAN	N	5;251;5;5;5;5;5;5;5;5;5	ENSP00000437188:D5N;ENSP00000434901:D5N;ENSP00000407746:D5N;ENSP00000327315:D5N;ENSP00000353528:D5N;ENSP00000433348:D5N	ENSP00000327315:D5N	D	+	1	0	TIAM2	155492062	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.020000	0.93667	2.659000	0.90383	0.561000	0.74099	GAC		TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000387980.2	NM_012454	
DUSP22	56940	broad.mit.edu	37	6	311894	311894	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr6:311894G>T	ENST00000344450.5	+	3	513	c.70G>T	c.(70-72)Gaa>Taa	p.E24*	DUSP22_ENST00000605863.1_Intron|DUSP22_ENST00000605035.1_5'UTR|DUSP22_ENST00000419235.2_Nonsense_Mutation_p.E24*|DUSP22_ENST00000603453.1_Intron|DUSP22_ENST00000605315.1_Intron	NM_020185.3	NP_064570.1	Q9NRW4	DUS22_HUMAN	dual specificity phosphatase 22	24					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of JNK cascade (GO:0046330)|protein dephosphorylation (GO:0006470)|regulation of cell proliferation (GO:0042127)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.E24K(1)|p.E24*(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(2)	26	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)		CAGAGACGCGGAACAATTGAG	0.453																																					p.E24X												.	.	2	Substitution - Missense(1)|Substitution - Nonsense(1)	large_intestine(1)|skin(1)	c.G70T	6						.						142.0	111.0	122.0					6																	311894		2203	4300	6503	256894	SO:0001587	stop_gained	56940	exon3			AF165519	CCDS4468.1, CCDS69035.1	6p25.3	2013-09-19			ENSG00000112679	ENSG00000112679		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	16077	protein-coding gene	gene with protein product						9205128, 11717427	Standard	NM_001286555		Approved	MKPX, JSP1, JKAP, VHX	uc003msx.3	Q9NRW4	OTTHUMG00000014113	ENST00000344450.5:c.70G>T	6.37:g.311894G>T	ENSP00000345281:p.Glu24*	Somatic		Capture	Illumina HiSeq	Phase_I	256894	NM_020185	B4DK56|Q59GW2|Q5VWR2|Q96AR1	Nonsense_Mutation	SNP	ENST00000344450.5	37	CCDS4468.1	.	.	.	.	.	.	.	.	.	.	G	38	6.807723	0.97853	.	.	ENSG00000112679	ENST00000344450	.	.	.	5.99	5.99	0.97316	.	0.197912	0.37261	N	0.002166	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	15.9778	0.80083	0.0:0.0:1.0:0.0	.	.	.	.	X	24	.	ENSP00000345281:E24X	E	+	1	0	DUSP22	256894	1.000000	0.71417	0.994000	0.49952	0.050000	0.14768	5.831000	0.69330	2.840000	0.97914	0.655000	0.94253	GAA		DUSP22-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000039621.1	NM_020185	
OR10C1	442194	broad.mit.edu	37	6	29408447	29408447	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr6:29408447C>T	ENST00000444197.2	+	1	1365	c.655C>T	c.(655-657)Cgt>Tgt	p.R219C	OR11A1_ENST00000377149.1_Intron	NM_013941.3	NP_039229.3	Q96KK4	O10C1_HUMAN	olfactory receptor, family 10, subfamily C, member 1 (gene/pseudogene)	219						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R219C(1)		NS(1)|breast(2)|kidney(1)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						CTCCTACGGGCGTATCCTCGT	0.582																																					p.R219C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C655T	6						.						199.0	213.0	208.0					6																	29408447		1511	2708	4219	29516426	SO:0001583	missense	442194	exon1				CCDS34364.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000206474	ENSG00000206474		"""GPCR / Class A : Olfactory receptors"""	8165	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily C, member 2"", ""olfactory receptor, family 10, subfamily C, member 1"""	OR10C2			Standard	NM_013941		Approved	hs6M1-17, OR10C1P	uc011dlp.2	Q96KK4	OTTHUMG00000031207	ENST00000444197.2:c.655C>T	6.37:g.29408447C>T	ENSP00000419119:p.Arg219Cys	Somatic		Capture	Illumina HiSeq	Phase_I	29516426	NM_013941	Q5SUN7|Q96R18	Missense_Mutation	SNP	ENST00000444197.2	37	CCDS34364.1	.	.	.	.	.	.	.	.	.	.	C	9.759	1.169627	0.21621	.	.	ENSG00000206474	ENST00000444197	T	0.00099	8.73	3.49	-5.94	0.02247	GPCR, rhodopsin-like superfamily (1);	1.341410	0.05509	N	0.559845	T	0.00073	0.0002	N	0.25825	0.765	0.09310	N	1	D	0.59767	0.986	P	0.58970	0.849	T	0.47774	-0.9091	10	0.39692	T	0.17	.	2.9172	0.05756	0.4162:0.3432:0.0982:0.1424	.	219	Q96KK4	O10C1_HUMAN	C	219	ENSP00000419119:R219C	ENSP00000419119:R219C	R	+	1	0	OR10C1	29516426	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-2.039000	0.01418	-0.784000	0.04528	0.603000	0.83216	CGT		OR10C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076415.2		
ZNF318	24149	broad.mit.edu	37	6	43322421	43322421	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr6:43322421C>T	ENST00000361428.2	-	4	2728	c.2651G>A	c.(2650-2652)cGt>cAt	p.R884H	ZNF318_ENST00000318149.3_Missense_Mutation_p.R884H	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	884					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.R884H(1)		autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			CTGGGAAGCACGGTTCTTCTC	0.438																																					p.R884H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2651A	6						.						97.0	101.0	100.0					6																	43322421		2203	4300	6503	43430399	SO:0001583	missense	24149	exon4			AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.2651G>A	6.37:g.43322421C>T	ENSP00000354964:p.Arg884His	Somatic		Capture	Illumina HiSeq	Phase_I	43430399	NM_014345	O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Missense_Mutation	SNP	ENST00000361428.2	37	CCDS4895.2	.	.	.	.	.	.	.	.	.	.	C	18.57	3.651498	0.67472	.	.	ENSG00000171467	ENST00000318149;ENST00000361428	T;T	0.39056	1.1;2.35	5.65	5.65	0.86999	.	0.200842	0.44902	D	0.000406	T	0.45975	0.1369	L	0.27053	0.805	0.38414	D	0.945993	D	0.89917	1.0	D	0.87578	0.998	T	0.50783	-0.8787	10	0.72032	D	0.01	-2.7396	17.9168	0.88954	0.0:1.0:0.0:0.0	.	884	Q5VUA4	ZN318_HUMAN	H	884	ENSP00000323032:R884H;ENSP00000354964:R884H	ENSP00000323032:R884H	R	-	2	0	ZNF318	43430399	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.757000	0.55212	2.678000	0.91216	0.655000	0.94253	CGT		ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040601.2	NM_014345	
LMBRD1	55788	broad.mit.edu	37	6	70410688	70410688	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr6:70410688C>T	ENST00000370577.3	-	12	1386	c.1157G>A	c.(1156-1158)cGa>cAa	p.R386Q	LMBRD1_ENST00000370570.1_Missense_Mutation_p.R313Q	NM_018368.3	NP_060838.3	Q9NUN5	LMBD1_HUMAN	LMBR1 domain containing 1	386					cobalamin metabolic process (GO:0009235)|insulin receptor internalization (GO:0038016)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein kinase B signaling (GO:0051898)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	clathrin-coated endocytic vesicle (GO:0045334)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cobalamin binding (GO:0031419)	p.R386Q(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)	31						GCCAATATTTCGAATTCCTGC	0.239																																					p.R386Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1157A	6						.						16.0	17.0	17.0					6																	70410688		2144	4227	6371	70467409	SO:0001583	missense	55788	exon12			AF113224	CCDS4969.1	6q13	2011-05-12	2005-07-25	2005-07-25	ENSG00000168216	ENSG00000168216			23038	protein-coding gene	gene with protein product		612625	"""chromosome 6 open reading frame 209"""	C6orf209		19136951	Standard	NM_018368		Approved	FLJ11240, bA810I22.1, cblF	uc003pfa.3	Q9NUN5	OTTHUMG00000014985	ENST00000370577.3:c.1157G>A	6.37:g.70410688C>T	ENSP00000359609:p.Arg386Gln	Somatic		Capture	Illumina HiSeq	Phase_I	70467409	NM_018368	A8K204|E1P531|Q5VUN6|Q86Y70|Q96FW4|Q9BY56|Q9NZD6	Missense_Mutation	SNP	ENST00000370577.3	37	CCDS4969.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.257517	0.80246	.	.	ENSG00000168216	ENST00000370577;ENST00000370570	T;T	0.18810	2.19;2.19	5.23	5.23	0.72850	.	.	.	.	.	T	0.27278	0.0669	L	0.55834	1.745	0.80722	D	1	D	0.76494	0.999	P	0.58970	0.849	T	0.00986	-1.1490	9	0.23891	T	0.37	-5.7188	18.8289	0.92130	0.0:1.0:0.0:0.0	.	386	Q9NUN5	LMBD1_HUMAN	Q	386;313	ENSP00000359609:R386Q;ENSP00000359602:R313Q	ENSP00000359602:R313Q	R	-	2	0	LMBRD1	70467409	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.800000	0.85949	2.447000	0.82792	0.591000	0.81541	CGA		LMBRD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041124.1	NM_018368	
COL12A1	1303	broad.mit.edu	37	6	75833051	75833051	+	Missense_Mutation	SNP	C	C	G	rs374405599		TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr6:75833051C>G	ENST00000322507.8	-	43	7250	c.6941G>C	c.(6940-6942)cGg>cCg	p.R2314P	COL12A1_ENST00000345356.6_Missense_Mutation_p.R1150P|COL12A1_ENST00000416123.2_Missense_Mutation_p.R2314P|COL12A1_ENST00000483888.2_Missense_Mutation_p.R2314P	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	2314					cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)	p.R2314P(1)		breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						CTTACCATCCCGGGCTGGTGG	0.413																																					p.R2314P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6941C	6						.						45.0	45.0	45.0					6																	75833051		1847	4094	5941	75889771	SO:0001583	missense	1303	exon43			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.6941G>C	6.37:g.75833051C>G	ENSP00000325146:p.Arg2314Pro	Somatic		Capture	Illumina HiSeq	Phase_I	75889771	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	37	CCDS43482.1	.	.	.	.	.	.	.	.	.	.	C	19.24	3.789644	0.70337	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888	T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03	5.42	5.42	0.78866	.	0.076371	0.56097	D	0.000038	D	0.82430	0.5035	L	0.51422	1.61	0.41817	D	0.990007	D;D	0.71674	0.998;0.998	D;P	0.65010	0.931;0.898	T	0.82321	-0.0515	10	0.54805	T	0.06	.	19.5998	0.95557	0.0:1.0:0.0:0.0	.	1150;2314	Q99715-2;Q99715	.;COCA1_HUMAN	P	2314;2314;1150;2314;2314	ENSP00000325146:R2314P;ENSP00000305147:R1150P;ENSP00000412864:R2314P;ENSP00000421216:R2314P	ENSP00000325146:R2314P	R	-	2	0	COL12A1	75889771	0.997000	0.39634	0.994000	0.49952	0.988000	0.76386	3.068000	0.50018	2.717000	0.92951	0.655000	0.94253	CGG		COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
SNX14	57231	broad.mit.edu	37	6	86257096	86257096	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr6:86257096G>A	ENST00000314673.3	-	11	1108	c.932C>T	c.(931-933)cCg>cTg	p.P311L	SNX14_ENST00000346348.3_Missense_Mutation_p.P267L|SNX14_ENST00000505648.1_Missense_Mutation_p.P259L|SNX14_ENST00000369627.2_Missense_Mutation_p.P311L|SNX14_ENST00000508980.1_5'UTR|SNX14_ENST00000513865.1_Missense_Mutation_p.P311L	NM_153816.3	NP_722523.1	Q9Y5W7	SNX14_HUMAN	sorting nexin 14	311					protein transport (GO:0015031)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	integral component of membrane (GO:0016021)	phosphatidylinositol binding (GO:0035091)	p.P311L(1)		NS(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(11)|skin(1)	22		all_cancers(76;4.83e-07)|Acute lymphoblastic leukemia(125;3.3e-08)|Prostate(29;2.55e-07)|all_hematologic(105;3.66e-05)|all_epithelial(107;0.000695)|Lung NSC(302;0.197)|all_lung(197;0.24)		BRCA - Breast invasive adenocarcinoma(108;0.0423)		AGGAGAAGCCGGTTCAGTTGC	0.323																																					p.P267L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C800T	6						.						49.0	52.0	51.0					6																	86257096		2202	4299	6501	86313815	SO:0001583	missense	57231	exon9			AF121863	CCDS5003.1, CCDS5004.1, CCDS75490.1	6q15	2008-10-22			ENSG00000135317	ENSG00000135317		"""Sorting nexins"""	14977	protein-coding gene	gene with protein product						11485546, 11736640	Standard	XM_005248738		Approved	RGS-PX2	uc003pkr.3	Q9Y5W7	OTTHUMG00000015140	ENST00000314673.3:c.932C>T	6.37:g.86257096G>A	ENSP00000313121:p.Pro311Leu	Somatic		Capture	Illumina HiSeq	Phase_I	86313815	NM_020468	B4DI55|Q4VBR3|Q5TCF9|Q5TCG0|Q6NUI7|Q6PI37|Q9BSD1	Missense_Mutation	SNP	ENST00000314673.3	37	CCDS5004.1	.	.	.	.	.	.	.	.	.	.	G	15.71	2.913275	0.52439	.	.	ENSG00000135317	ENST00000346348;ENST00000314673;ENST00000513865;ENST00000505648;ENST00000369627;ENST00000515216	T;T;T;T;T;T	0.33865	1.78;1.77;1.39;1.78;1.77;1.77	5.39	4.49	0.54785	.	0.050625	0.85682	N	0.000000	T	0.13072	0.0317	L	0.29908	0.895	0.80722	D	1	B;P;B;B	0.47191	0.018;0.891;0.006;0.01	B;B;B;B	0.39094	0.012;0.29;0.004;0.009	T	0.02893	-1.1097	10	0.25106	T	0.35	-2.8606	13.2687	0.60150	0.0791:0.0:0.9209:0.0	.	311;267;311;259	Q9Y5W7-4;Q9Y5W7-2;Q9Y5W7;Q9Y5W7-3	.;.;SNX14_HUMAN;.	L	267;311;311;259;311;238	ENSP00000257769:P267L;ENSP00000313121:P311L;ENSP00000420938:P311L;ENSP00000427380:P259L;ENSP00000358641:P311L;ENSP00000425630:P238L	ENSP00000313121:P311L	P	-	2	0	SNX14	86313815	1.000000	0.71417	0.858000	0.33744	0.975000	0.68041	7.348000	0.79366	1.208000	0.43306	0.655000	0.94253	CCG		SNX14-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041393.2	NM_153816	
FNDC1	84624	broad.mit.edu	37	6	159653955	159653955	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr6:159653955C>T	ENST00000297267.9	+	11	2611	c.2411C>T	c.(2410-2412)aCg>aTg	p.T804M	FNDC1_ENST00000340366.6_Missense_Mutation_p.T741M	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	804					cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.T804M(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		GCGGAGGCCACGGCCCAGACG	0.632																																					p.T804M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2411T	6						.						18.0	21.0	20.0					6																	159653955		2018	4160	6178	159573945	SO:0001583	missense	84624	exon11			AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.2411C>T	6.37:g.159653955C>T	ENSP00000297267:p.Thr804Met	Somatic		Capture	Illumina HiSeq	Phase_I	159573945	NM_032532	A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Missense_Mutation	SNP	ENST00000297267.9	37	CCDS47512.1	.	.	.	.	.	.	.	.	.	.	C	14.31	2.498442	0.44455	.	.	ENSG00000164694	ENST00000297267;ENST00000340366	T;T	0.08807	3.05;3.78	4.57	4.57	0.56435	.	0.977268	0.08393	N	0.952555	T	0.08088	0.0202	L	0.29908	0.895	0.09310	N	1	D;D	0.89917	1.0;0.989	D;P	0.63113	0.911;0.649	T	0.38045	-0.9679	10	0.72032	D	0.01	-5.7894	8.7361	0.34530	0.0:0.8946:0.0:0.1054	.	741;804	Q4ZHG4-2;Q4ZHG4	.;FNDC1_HUMAN	M	804;741	ENSP00000297267:T804M;ENSP00000342460:T741M	ENSP00000297267:T804M	T	+	2	0	FNDC1	159573945	0.004000	0.15560	0.000000	0.03702	0.204000	0.24138	1.962000	0.40442	2.071000	0.62044	0.655000	0.94253	ACG		FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042897.3	NM_032532	
AMZ1	155185	broad.mit.edu	37	7	2742436	2742436	+	Missense_Mutation	SNP	G	G	A	rs371188824		TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr7:2742436G>A	ENST00000312371.4	+	3	753	c.385G>A	c.(385-387)Gtc>Atc	p.V129I	AMZ1_ENST00000407112.1_Missense_Mutation_p.V129I|AMZ1_ENST00000489665.1_3'UTR	NM_133463.1	NP_597720.1	Q400G9	AMZ1_HUMAN	archaelysin family metallopeptidase 1	129							metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.V129I(1)		breast(2)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	16		Ovarian(82;0.0779)		OV - Ovarian serous cystadenocarcinoma(56;5.03e-14)		GGGCCTGCGCGTCAAGTGCCT	0.687																																					p.V129I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G385A	7						.	G	ILE/VAL	0,4336		0,0,2168	20.0	19.0	20.0		385	5.2	0.7	7		20	1,8475		0,1,4237	no	missense	AMZ1	NM_133463.1	29	0,1,6405	AA,AG,GG		0.0118,0.0,0.0078	probably-damaging	129/499	2742436	1,12811	2168	4238	6406	2708962	SO:0001583	missense	155185	exon3			AB075830	CCDS34589.1, CCDS64582.1	7p22.3	2008-01-17			ENSG00000174945	ENSG00000174945			22231	protein-coding gene	gene with protein product	"""archaemetzincin-1"""	615168				15972818	Standard	NM_133463		Approved	KIAA1950	uc003smr.1	Q400G9	OTTHUMG00000152111	ENST00000312371.4:c.385G>A	7.37:g.2742436G>A	ENSP00000308149:p.Val129Ile	Somatic		Capture	Illumina HiSeq	Phase_I	2708962	NM_133463	B3KRS0|Q8TF51	Missense_Mutation	SNP	ENST00000312371.4	37	CCDS34589.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.464866	0.84425	0.0	1.18E-4	ENSG00000174945	ENST00000312371;ENST00000407112	T;T	0.21361	2.01;2.01	5.2	5.2	0.72013	.	0.000000	0.64402	D	0.000014	T	0.52500	0.1738	M	0.82823	2.61	0.47153	D	0.999338	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.982	T	0.59595	-0.7425	10	0.87932	D	0	-61.5671	18.7537	0.91825	0.0:0.0:1.0:0.0	.	129;129	B3KRS0;Q400G9	.;AMZ1_HUMAN	I	129	ENSP00000308149:V129I;ENSP00000386020:V129I	ENSP00000308149:V129I	V	+	1	0	AMZ1	2708962	1.000000	0.71417	0.714000	0.30535	0.575000	0.36095	5.716000	0.68437	2.411000	0.81874	0.655000	0.94253	GTC		AMZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325244.1	NM_133463	
RSPH10B2	728194	broad.mit.edu	37	7	6797489	6797489	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr7:6797489C>T	ENST00000403107.1	+	2	568	c.181C>T	c.(181-183)Cgc>Tgc	p.R61C	RSPH10B2_ENST00000404077.1_Missense_Mutation_p.R61C|RSPH10B2_ENST00000433859.2_Missense_Mutation_p.R61C|RSPH10B2_ENST00000297186.3_Missense_Mutation_p.R61C|RSPH10B2_ENST00000359718.3_5'UTR			B2RC85	R10B2_HUMAN	radial spoke head 10 homolog B2 (Chlamydomonas)	61								p.R61C(2)		breast(3)|endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|skin(2)	15						CAAAAAAGACCGCCAAAACGT	0.488																																					p.R61C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C181T	7						.						107.0	121.0	116.0					7																	6797489		2156	4264	6420	6764014	SO:0001583	missense	222967	exon3				CCDS43552.1	7p22.1	2008-07-04			ENSG00000169402	ENSG00000169402			34385	protein-coding gene	gene with protein product							Standard	NM_001099697		Approved		uc003sqw.1	B2RC85	OTTHUMG00000151856	ENST00000403107.1:c.181C>T	7.37:g.6797489C>T	ENSP00000384766:p.Arg61Cys	Somatic		Capture	Illumina HiSeq	Phase_I	6764014	NM_173565	A6NMW7|B2RXI4|B2RXJ0|Q86ST9|Q8NE68	Missense_Mutation	SNP	ENST00000403107.1	37	CCDS43552.1	.	.	.	.	.	.	.	.	.	.	C	8.599	0.886413	0.17540	.	.	ENSG00000169402	ENST00000403107;ENST00000404077;ENST00000297186;ENST00000433859	T;T;T;T	0.52983	0.64;0.64;0.64;0.64	2.09	-0.881	0.10607	.	32.676400	0.00166	U	0.000004	T	0.21921	0.0528	N	0.08118	0	0.09310	N	0.999999	P	0.35348	0.496	B	0.14578	0.011	T	0.15037	-1.0451	10	0.56958	D	0.05	.	2.3758	0.04342	0.0:0.2442:0.2925:0.4632	.	61	B2RC85	R10B2_HUMAN	C	61	ENSP00000384766:R61C;ENSP00000386102:R61C;ENSP00000297186:R61C;ENSP00000416710:R61C	ENSP00000297186:R61C	R	+	1	0	RSPH10B2	6764014	0.000000	0.05858	0.000000	0.03702	0.061000	0.15899	-0.204000	0.09425	-0.194000	0.10399	0.392000	0.25879	CGC		RSPH10B2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324184.4	NM_001099697	
KIAA1324L	222223	broad.mit.edu	37	7	86568140	86568140	+	Silent	SNP	G	G	A			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr7:86568140G>A	ENST00000450689.2	-	7	1169	c.984C>T	c.(982-984)gaC>gaT	p.D328D	KIAA1324L_ENST00000444627.1_Silent_p.D328D|KIAA1324L_ENST00000416314.1_Silent_p.D161D|KIAA1324L_ENST00000297222.6_Silent_p.D88D	NM_001142749.2	NP_001136221.1	A8MWY0	K132L_HUMAN	KIAA1324-like	328						integral component of membrane (GO:0016021)		p.D88D(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(14)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44	Esophageal squamous(14;0.0058)					ATTGAGAGTCGTCTTTACACC	0.383																																					p.D161D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C483T	7						.						155.0	151.0	153.0					7																	86568140		2203	4300	6503	86406076	SO:0001819	synonymous_variant	222223	exon6			AK055902	CCDS34677.1, CCDS47632.1, CCDS34677.2	7q21.12	2008-09-18			ENSG00000164659	ENSG00000164659			21945	protein-coding gene	gene with protein product	"""EIG121-like"""	614048					Standard	NM_001142749		Approved	FLJ31340, EIG121L	uc011kha.2	A8MWY0	OTTHUMG00000153995	ENST00000450689.2:c.984C>T	7.37:g.86568140G>A		Somatic		Capture	Illumina HiSeq	Phase_I	86406076	NM_152748	A4D1C9|B4DJV3|Q17RI6|Q96DP2	Silent	SNP	ENST00000450689.2	37	CCDS47632.1	.	.	.	.	.	.	.	.	.	.	G	7.596	0.671737	0.14776	.	.	ENSG00000164659	ENST00000423294	.	.	.	5.3	0.142	0.14816	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	1.8882	0.03242	0.1371:0.442:0.1364:0.2845	.	.	.	.	X	289	.	.	R	-	1	2	KIAA1324L	86406076	0.998000	0.40836	0.958000	0.39756	0.967000	0.64934	0.498000	0.22530	0.333000	0.23563	-0.232000	0.12228	CGA		KIAA1324L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333372.3	NM_152748	
TMEM168	64418	broad.mit.edu	37	7	112424765	112424765	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr7:112424765A>T	ENST00000312814.6	-	2	676	c.116T>A	c.(115-117)tTa>tAa	p.L39*	TMEM168_ENST00000454074.1_Nonsense_Mutation_p.L39*	NM_022484.4	NP_071929.3	Q9H0V1	TM168_HUMAN	transmembrane protein 168	39						integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)		p.L39*(1)|p.L39S(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(10)|lung(12)|ovary(1)|prostate(2)|stomach(1)	32						GATTCTGGCTAAATAGCCAAG	0.338																																					p.L39X												.	.	2	Substitution - Nonsense(1)|Substitution - Missense(1)	large_intestine(1)|endometrium(1)	c.T116A	7						.						46.0	46.0	46.0					7																	112424765		2203	4300	6503	112212001	SO:0001587	stop_gained	64418	exon2				CCDS5757.1	7q31.32	2006-08-08			ENSG00000146802	ENSG00000146802			25826	protein-coding gene	gene with protein product						12477932	Standard	XM_005250527		Approved	DKFZp564C012,FLJ13576	uc003vgn.3	Q9H0V1	OTTHUMG00000155188	ENST00000312814.6:c.116T>A	7.37:g.112424765A>T	ENSP00000323068:p.Leu39*	Somatic		Capture	Illumina HiSeq	Phase_I	112212001	NM_022484	A4D0T9|B4DDS0|Q8NEK4|Q9H8J2	Nonsense_Mutation	SNP	ENST00000312814.6	37	CCDS5757.1	.	.	.	.	.	.	.	.	.	.	A	40	8.171096	0.98688	.	.	ENSG00000146802	ENST00000312814;ENST00000454074	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.659	15.8645	0.79055	1.0:0.0:0.0:0.0	.	.	.	.	X	39	.	ENSP00000323068:L39X	L	-	2	0	TMEM168	112212001	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.339000	0.96797	2.147000	0.66899	0.528000	0.53228	TTA		TMEM168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338696.4	NM_022484	
MYOM2	9172	broad.mit.edu	37	8	2092892	2092892	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr8:2092892C>T	ENST00000262113.4	+	37	4526	c.4385C>T	c.(4384-4386)gCg>gTg	p.A1462V	MYOM2_ENST00000520298.1_3'UTR|MYOM2_ENST00000523438.1_Missense_Mutation_p.A887V	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	1462					muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)	p.A1462V(1)		autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		TCTGCCTCAGCGGCAGGCCAG	0.582																																					p.A1462V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4385T	8						.						46.0	44.0	44.0					8																	2092892		2203	4300	6503	2080299	SO:0001583	missense	9172	exon37				CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.4385C>T	8.37:g.2092892C>T	ENSP00000262113:p.Ala1462Val	Somatic		Capture	Illumina HiSeq	Phase_I	2080299	NM_003970	Q7Z3Y2	Missense_Mutation	SNP	ENST00000262113.4	37	CCDS5957.1	.	.	.	.	.	.	.	.	.	.	C	11.99	1.802554	0.31869	.	.	ENSG00000036448	ENST00000262113;ENST00000523438	T;T	0.54279	0.58;0.76	4.98	-0.0133	0.13985	.	1.226220	0.05815	N	0.614731	T	0.28830	0.0715	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.15037	-1.0451	10	0.41790	T	0.15	.	2.4554	0.04528	0.1174:0.4587:0.2075:0.2164	.	1462	P54296	MYOM2_HUMAN	V	1462;887	ENSP00000262113:A1462V;ENSP00000428396:A887V	ENSP00000262113:A1462V	A	+	2	0	MYOM2	2080299	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.808000	0.27154	-0.258000	0.09446	-0.136000	0.14681	GCG		MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251249.1	NM_003970	
DLC1	10395	broad.mit.edu	37	8	12947789	12947789	+	Missense_Mutation	SNP	G	G	A	rs139251311	byFrequency	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr8:12947789G>A	ENST00000276297.4	-	15	4455	c.4046C>T	c.(4045-4047)tCg>tTg	p.S1349L	DLC1_ENST00000358919.2_Missense_Mutation_p.S912L|DLC1_ENST00000520226.1_Missense_Mutation_p.S838L|DLC1_ENST00000510318.1_5'UTR|DLC1_ENST00000512044.2_Missense_Mutation_p.S946L	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	1349	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)	p.S1349L(1)		NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						AGCCTGCTCCGAAGTGGAGTA	0.502													G|||	3	0.000599042	0.0	0.0	5008	,	,		19039	0.0		0.003	False		,,,				2504	0.0				p.S1349L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4046T	8						.	G	LEU/SER,LEU/SER,LEU/SER	3,4403	6.2+/-15.9	0,3,2200	75.0	76.0	76.0		2513,2735,4046	5.1	0.1	8	dbSNP_134	76	17,8583	12.6+/-44.7	0,17,4283	yes	missense,missense,missense	DLC1	NM_001164271.1,NM_006094.4,NM_182643.2	145,145,145	0,20,6483	AA,AG,GG		0.1977,0.0681,0.1538	benign,benign,benign	838/1018,912/1092,1349/1529	12947789	20,12986	2203	4300	6503	12992160	SO:0001583	missense	10395	exon15			AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.4046C>T	8.37:g.12947789G>A	ENSP00000276297:p.Ser1349Leu	Somatic		Capture	Illumina HiSeq	Phase_I	12992160	NM_182643	B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Missense_Mutation	SNP	ENST00000276297.4	37	CCDS5989.1	3	0.0013736263736263737	0	0.0	0	0.0	0	0.0	3	0.00395778364116095	G	9.448	1.089770	0.20390	6.81E-4	0.001977	ENSG00000164741	ENST00000276297;ENST00000358919;ENST00000510318;ENST00000512044;ENST00000520226	T;T;T;T	0.79554	-1.28;-1.28;-1.28;-1.28	5.06	5.06	0.68205	Lipid-binding START (3);START-like domain (1);	0.119358	0.64402	D	0.000013	T	0.70343	0.3213	L	0.37630	1.12	0.80722	D	1	B;B;P	0.35774	0.003;0.098;0.519	B;B;B	0.27170	0.008;0.064;0.077	T	0.68119	-0.5493	10	0.15066	T	0.55	.	19.0004	0.92830	0.0:0.0:1.0:0.0	.	1349;946;912	Q96QB1;E9PDZ8;Q96QB1-1	RHG07_HUMAN;.;.	L	1349;912;288;946;838	ENSP00000276297:S1349L;ENSP00000351797:S912L;ENSP00000422595:S946L;ENSP00000428028:S838L	ENSP00000276297:S1349L	S	-	2	0	DLC1	12992160	1.000000	0.71417	0.138000	0.22173	0.732000	0.41865	5.411000	0.66386	2.809000	0.96659	0.555000	0.69702	TCG		DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207632.2	NM_182643, NM_006094	
GSR	2936	broad.mit.edu	37	8	30538424	30538424	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr8:30538424T>G	ENST00000221130.5	-	12	1506	c.1416A>C	c.(1414-1416)gaA>gaC	p.E472D	GSR_ENST00000414019.1_Missense_Mutation_p.E429D|GSR_ENST00000541648.1_Missense_Mutation_p.E419D|GSR_ENST00000537535.1_Missense_Mutation_p.E390D|GSR_ENST00000546342.1_Missense_Mutation_p.E443D	NM_000637.3|NM_001195102.1|NM_001195103.1	NP_000628.2|NP_001182031.1|NP_001182032.1	P00390	GSHR_HUMAN	glutathione reductase	472					cell redox homeostasis (GO:0045454)|glutathione metabolic process (GO:0006749)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|glutathione-disulfide reductase activity (GO:0004362)|NADP binding (GO:0050661)	p.E472D(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(2)	23				KIRC - Kidney renal clear cell carcinoma(542;0.105)|Kidney(114;0.125)	Carmustine(DB00262)|Flavin adenine dinucleotide(DB03147)|Glutathione(DB00143)	TCCTTACCTTTTCTTCCTTGT	0.428																																					p.E443D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1329C	8						.						303.0	273.0	283.0					8																	30538424		2202	4300	6502	30657966	SO:0001583	missense	2936	exon11				CCDS34877.1, CCDS56530.1, CCDS56531.1, CCDS56532.1	8p21.1	2012-10-02			ENSG00000104687	ENSG00000104687	1.8.1.7		4623	protein-coding gene	gene with protein product		138300					Standard	NM_000637		Approved		uc003xih.2	P00390	OTTHUMG00000163946	ENST00000221130.5:c.1416A>C	8.37:g.30538424T>G	ENSP00000221130:p.Glu472Asp	Somatic		Capture	Illumina HiSeq	Phase_I	30657966	NM_001195102	C8KIL8|C8KIL9|C8KIM0|D3DSV3|Q7Z5C9|Q9NP63	Missense_Mutation	SNP	ENST00000221130.5	37	CCDS34877.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.329922	0.81690	.	.	ENSG00000104687	ENST00000221130;ENST00000414019;ENST00000546342;ENST00000541648;ENST00000537535	D;D;D;D;D	0.92348	-3.02;-3.02;-3.02;-3.02;-3.02	5.35	-4.16	0.03869	FAD/NAD-linked reductase, dimerisation (1);Pyridine nucleotide-disulphide oxidoreductase, dimerisation (2);	0.047678	0.85682	D	0.000000	D	0.91452	0.7302	L	0.37697	1.125	0.44523	D	0.997474	D	0.58268	0.982	D	0.65684	0.937	D	0.88372	0.2995	10	0.44086	T	0.13	-8.6625	14.3053	0.66380	0.0:0.6496:0.0:0.3504	.	472	P00390	GSHR_HUMAN	D	472;429;443;419;390	ENSP00000221130:E472D;ENSP00000390065:E429D;ENSP00000445516:E443D;ENSP00000444559:E419D;ENSP00000438845:E390D	ENSP00000221130:E472D	E	-	3	2	GSR	30657966	0.198000	0.23374	0.872000	0.34217	0.917000	0.54804	-0.509000	0.06336	-0.599000	0.05798	0.529000	0.55759	GAA		GSR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376519.1		
RP1	6101	broad.mit.edu	37	8	55533673	55533673	+	Silent	SNP	C	C	T	rs571521776		TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr8:55533673C>T	ENST00000220676.1	+	2	295	c.147C>T	c.(145-147)ggC>ggT	p.G49G		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	49	Doublecortin 1. {ECO:0000255|PROSITE- ProRule:PRU00072}.				axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)	p.G49G(1)		NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			CCCAATTCGGCGGGGTCAGGG	0.547																																					p.G49G	Colon(91;1014 1389 7634 14542 40420)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C147T	8						.						105.0	92.0	96.0					8																	55533673		2203	4300	6503	55696226	SO:0001819	synonymous_variant	6101	exon2			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.147C>T	8.37:g.55533673C>T		Somatic		Capture	Illumina HiSeq	Phase_I	55696226	NM_006269		Silent	SNP	ENST00000220676.1	37	CCDS6160.1																																																																																				RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
FAM110B	90362	broad.mit.edu	37	8	59059719	59059719	+	Silent	SNP	C	C	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr8:59059719C>T	ENST00000361488.3	+	5	1810	c.930C>T	c.(928-930)agC>agT	p.S310S	FAM110B_ENST00000520369.1_Intron	NM_147189.2	NP_671722.1	Q8TC76	F110B_HUMAN	family with sequence similarity 110, member B	310						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.S310S(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(9)|skin(2)	26		all_epithelial(80;0.025)|all_lung(136;0.0274)|Lung NSC(129;0.0355)				ACTTCCGCAGCGCAAGCATGA	0.483																																					p.S310S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C930T	8						.						80.0	77.0	78.0					8																	59059719		2203	4300	6503	59222273	SO:0001819	synonymous_variant	90362	exon5			U79298	CCDS6170.1	8q12.1	2007-06-21	2007-03-21	2007-03-21		ENSG00000169122			28587	protein-coding gene	gene with protein product		611394	"""chromosome 8 open reading frame 72"""	C8orf72		8619474, 9110174, 17499476	Standard	XM_005251324		Approved	MGC39325	uc003xtj.1	Q8TC76		ENST00000361488.3:c.930C>T	8.37:g.59059719C>T		Somatic		Capture	Illumina HiSeq	Phase_I	59222273	NM_147189	Q5BM08|Q9Y4K2	Silent	SNP	ENST00000361488.3	37	CCDS6170.1																																																																																				FAM110B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378095.2	NM_147189	
ZFHX4	79776	broad.mit.edu	37	8	77761759	77761759	+	Silent	SNP	T	T	C			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr8:77761759T>C	ENST00000521891.2	+	8	4105	c.3657T>C	c.(3655-3657)tgT>tgC	p.C1219C	ZFHX4_ENST00000518282.1_Silent_p.C1193C|ZFHX4_ENST00000455469.2_Silent_p.C1174C|ZFHX4_ENST00000050961.6_Silent_p.C1174C	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	1174					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.C1219C(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TCTATCAATGTCCTTATTGTA	0.408										HNSCC(33;0.089)																											p.C1219C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T3657C	8						.						121.0	115.0	117.0					8																	77761759		1920	4134	6054	77924314	SO:0001819	synonymous_variant	79776	exon8				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.3657T>C	8.37:g.77761759T>C		Somatic		Capture	Illumina HiSeq	Phase_I	77924314	NM_024721	G3V138|Q18PS0|Q6ZN20	Silent	SNP	ENST00000521891.2	37	CCDS47878.2																																																																																				ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
ASTN2	23245	broad.mit.edu	37	9	119976946	119976946	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr9:119976946G>A	ENST00000313400.4	-	3	806	c.706C>T	c.(706-708)Cgt>Tgt	p.R236C	ASTN2_ENST00000361209.2_Missense_Mutation_p.R236C|ASTN2_ENST00000361477.3_5'UTR|ASTN2_ENST00000373996.3_Missense_Mutation_p.R236C			O75129	ASTN2_HUMAN	astrotactin 2	236					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)		p.R236C(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						ATGCGGCGACGCTTCTGCCAA	0.637																																					p.R236C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C706T	9						.						52.0	49.0	50.0					9																	119976946		2203	4300	6503	119016767	SO:0001583	missense	23245	exon3			AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.706C>T	9.37:g.119976946G>A	ENSP00000314038:p.Arg236Cys	Somatic		Capture	Illumina HiSeq	Phase_I	119016767	NM_014010	A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	ENST00000313400.4	37		.	.	.	.	.	.	.	.	.	.	G	24.6	4.550883	0.86127	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000361209	T;T;T	0.15718	2.46;2.46;2.4	5.51	4.61	0.57282	.	0.000000	0.64402	D	0.000002	T	0.27169	0.0666	L	0.27053	0.805	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	P;P;D	0.67103	0.855;0.72;0.949	T	0.02307	-1.1179	9	.	.	.	-10.8852	15.3539	0.74412	0.0:0.0:0.8591:0.1409	.	236;236;236	O75129-2;O75129;O75129-3	.;ASTN2_HUMAN;.	C	236	ENSP00000314038:R236C;ENSP00000363108:R236C;ENSP00000354504:R236C	.	R	-	1	0	ASTN2	119016767	1.000000	0.71417	0.993000	0.49108	0.852000	0.48524	6.600000	0.74132	1.314000	0.45095	-0.182000	0.12963	CGT		ASTN2-201	KNOWN	basic	protein_coding	protein_coding		NM_014010	
TSC1	7248	broad.mit.edu	37	9	135779191	135779191	+	Silent	SNP	T	T	C			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr9:135779191T>C	ENST00000298552.3	-	17	2276	c.2055A>G	c.(2053-2055)tcA>tcG	p.S685S	TSC1_ENST00000545250.1_Silent_p.S634S|TSC1_ENST00000440111.2_Silent_p.S685S	NM_000368.4|NM_001162426.1|NM_001162427.1	NP_000359.1|NP_001155898.1|NP_001155899.1	Q92574	TSC1_HUMAN	tuberous sclerosis 1	685					activation of Rho GTPase activity (GO:0032862)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|insulin receptor signaling pathway (GO:0008286)|kidney development (GO:0001822)|myelination (GO:0042552)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of translation (GO:0017148)|neural tube closure (GO:0001843)|positive regulation of focal adhesion assembly (GO:0051894)|potassium ion transport (GO:0006813)|protein heterooligomerization (GO:0051291)|protein stabilization (GO:0050821)|regulation of cell cycle (GO:0051726)|regulation of cell-matrix adhesion (GO:0001952)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of protein kinase activity (GO:0045859)|regulation of stress fiber assembly (GO:0051492)|regulation of translation (GO:0006417)|response to insulin (GO:0032868)|rRNA export from nucleus (GO:0006407)|synapse organization (GO:0050808)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|lamellipodium (GO:0030027)|membrane (GO:0016020)|protein complex (GO:0043234)|TSC1-TSC2 complex (GO:0033596)	chaperone binding (GO:0051087)|GTPase regulator activity (GO:0030695)|protein N-terminus binding (GO:0047485)	p.S685S(1)|p.?(1)		NS(1)|bone(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(9)|lung(20)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	65				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		GGATCTCATCTGAAGGAGGAG	0.512			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.S684S		yes	Rec		Tuberous sclerosis 1	9	9q34	7248	tuberous sclerosis 1 gene		"""E, O"""	.	.	2	Unknown(1)|Substitution - coding silent(1)	large_intestine(1)|bone(1)	c.A2052G	9						.						74.0	74.0	74.0					9																	135779191		2203	4300	6503	134769012	SO:0001819	synonymous_variant	7248	exon17	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	AF013168	CCDS6956.1, CCDS55350.1	9q34	2014-09-17			ENSG00000165699	ENSG00000165699			12362	protein-coding gene	gene with protein product		605284		TSC		9242607, 10806479	Standard	NM_000368		Approved	KIAA0243, LAM, hamartin	uc004cca.2	Q92574	OTTHUMG00000020844	ENST00000298552.3:c.2055A>G	9.37:g.135779191T>C		Somatic		Capture	Illumina HiSeq	Phase_I	134769012	NM_001162426	B7Z897|Q5VVN5	Silent	SNP	ENST00000298552.3	37	CCDS6956.1																																																																																				TSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054799.1		
PCSK5	5125	broad.mit.edu	37	9	78773967	78773967	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr9:78773967G>A	ENST00000545128.1	+	12	2037	c.1499G>A	c.(1498-1500)cGc>cAc	p.R500H	PCSK5_ENST00000376752.4_Missense_Mutation_p.R500H|PCSK5_ENST00000376767.3_Missense_Mutation_p.R500H	NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	500					anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)	p.R500H(3)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						AACCCCAACCGCCATGTCAAC	0.562																																					p.R500H												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.G1499A	9						.						164.0	143.0	150.0					9																	78773967		2203	4300	6503	77963787	SO:0001583	missense	5125	exon12				CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.1499G>A	9.37:g.78773967G>A	ENSP00000446280:p.Arg500His	Somatic		Capture	Illumina HiSeq	Phase_I	77963787	NM_001190482	F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	ENST00000545128.1	37	CCDS55320.1	.	.	.	.	.	.	.	.	.	.	G	8.645	0.896830	0.17686	.	.	ENSG00000099139	ENST00000545128;ENST00000376754;ENST00000376767;ENST00000396108;ENST00000376752;ENST00000424854	T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01	6.16	3.71	0.42584	.	0.222920	0.53938	N	0.000048	T	0.23846	0.0577	N	0.00771	-1.2	0.36629	D	0.876205	B;B	0.09022	0.0;0.002	B;B	0.06405	0.0;0.002	T	0.31280	-0.9949	10	0.02654	T	1	-23.0924	7.9328	0.29912	0.7975:0.0:0.2025:0.0	.	500;500	Q92824-2;B1AMG5	.;.	H	500;203;500;500;500;173	ENSP00000446280:R500H;ENSP00000365958:R500H;ENSP00000365943:R500H;ENSP00000411654:R173H	ENSP00000365943:R500H	R	+	2	0	PCSK5	77963787	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.455000	0.60075	0.494000	0.27859	0.650000	0.86243	CGC		PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
SLC28A3	64078	broad.mit.edu	37	9	86907662	86907662	+	Splice_Site	SNP	A	A	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr9:86907662A>T	ENST00000376238.4	-	10	993	c.944T>A	c.(943-945)gTt>gAt	p.V315D	RP11-380F14.2_ENST00000419815.1_RNA|SLC28A3_ENST00000537648.1_Splice_Site_p.V246D	NM_001199633.1|NM_022127.2	NP_001186562.1|NP_071410.1	Q9HAS3	S28A3_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 3	315					pyrimidine nucleoside transport (GO:0015864)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|purine-specific nucleoside:sodium symporter activity (GO:0015390)|pyrimidine- and adenine-specific:sodium symporter activity (GO:0015389)	p.V315D(1)		endometrium(2)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31					Adenosine(DB00640)|Cladribine(DB00242)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Mercaptopurine(DB01033)|Ribavirin(DB00811)	GATCCATCCAACCTAAAAGGA	0.353																																					p.V315D	Ovarian(106;425 1539 34835 42413 43572)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T944A	9						.						78.0	69.0	72.0					9																	86907662		2203	4300	6503	86097482	SO:0001630	splice_region_variant	64078	exon11			AF305210	CCDS6670.1	9q21.33	2013-07-17	2013-07-17		ENSG00000197506	ENSG00000197506		"""Solute carriers"""	16484	protein-coding gene	gene with protein product		608269	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 3"""			11032837	Standard	NM_001199633		Approved	CNT3	uc010mpz.3	Q9HAS3	OTTHUMG00000020117	ENST00000376238.4:c.943-1T>A	9.37:g.86907662A>T		Somatic		Capture	Illumina HiSeq	Phase_I	86097482	NM_022127	A8K9Y4|B1AML0|B2RA51|B4E2S8|F5GYE3	Missense_Mutation	SNP	ENST00000376238.4	37	CCDS6670.1	.	.	.	.	.	.	.	.	.	.	A	26.6	4.751558	0.89753	.	.	ENSG00000197506	ENST00000376238;ENST00000537648	T;T	0.34472	1.36;1.36	5.98	5.98	0.97165	Nucleoside recognition (1);	0.245861	0.41294	D	0.000907	T	0.60728	0.2291	M	0.85197	2.74	0.80722	D	1	P;D	0.54601	0.941;0.967	P;P	0.56865	0.808;0.808	T	0.67601	-0.5629	10	0.87932	D	0	-9.95	16.4728	0.84119	1.0:0.0:0.0:0.0	.	246;315	B4E2S8;Q9HAS3	.;S28A3_HUMAN	D	315;246	ENSP00000365413:V315D;ENSP00000446438:V246D	ENSP00000365413:V315D	V	-	2	0	SLC28A3	86097482	1.000000	0.71417	0.990000	0.47175	0.831000	0.47069	8.571000	0.90752	2.296000	0.77279	0.482000	0.46254	GTT		SLC28A3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052874.1	NM_022127	Missense_Mutation
ANAPC2	29882	broad.mit.edu	37	9	140075363	140075363	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chr9:140075363C>T	ENST00000323927.2	-	8	1491	c.1487G>A	c.(1486-1488)cGg>cAg	p.R496Q		NM_013366.3	NP_037498.1	Q9UJX6	ANC2_HUMAN	anaphase promoting complex subunit 2	496					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)		p.R496L(1)|p.R496Q(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)		CGATGAACGCCGCTTGGAGCT	0.652																																					p.R496Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G1487A	9						.						115.0	103.0	107.0					9																	140075363		2203	4300	6503	139195184	SO:0001583	missense	29882	exon8			AB037827	CCDS7033.1	9q34.3	2011-06-15			ENSG00000176248	ENSG00000176248		"""Anaphase promoting complex subunits"""	19989	protein-coding gene	gene with protein product		606946				11739784	Standard	NM_013366		Approved	APC2, KIAA1406	uc004clr.1	Q9UJX6	OTTHUMG00000020983	ENST00000323927.2:c.1487G>A	9.37:g.140075363C>T	ENSP00000314004:p.Arg496Gln	Somatic		Capture	Illumina HiSeq	Phase_I	139195184	NM_013366	Q5VSG1|Q96DG5|Q96GG4|Q9P2E1	Missense_Mutation	SNP	ENST00000323927.2	37	CCDS7033.1	.	.	.	.	.	.	.	.	.	.	c	15.58	2.874182	0.51695	.	.	ENSG00000176248	ENST00000323927	T	0.73575	-0.76	5.41	4.52	0.55395	Cullin, N-terminal (1);	0.111229	0.64402	D	0.000006	T	0.72455	0.3462	L	0.47716	1.5	0.50467	D	0.99987	D;D	0.63880	0.993;0.992	P;P	0.50405	0.64;0.507	T	0.68424	-0.5412	10	0.14252	T	0.57	-21.7778	14.1286	0.65238	0.0:0.8483:0.1517:0.0	.	496;493	Q9UJX6;Q9UJX6-2	ANC2_HUMAN;.	Q	496	ENSP00000314004:R496Q	ENSP00000314004:R496Q	R	-	2	0	ANAPC2	139195184	1.000000	0.71417	0.998000	0.56505	0.002000	0.02628	7.282000	0.78630	1.300000	0.44818	-0.217000	0.12591	CGG		ANAPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055315.1	NM_013366	
ARMCX1	51309	broad.mit.edu	37	X	100808347	100808347	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chrX:100808347C>A	ENST00000372829.3	+	4	805	c.434C>A	c.(433-435)cCa>cAa	p.P145Q		NM_016608.1	NP_057692.1	Q9P291	ARMX1_HUMAN	armadillo repeat containing, X-linked 1	145						integral component of membrane (GO:0016021)		p.P145Q(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(2)|ovary(3)|pancreas(1)|urinary_tract(1)	19						TTACCCTGCCCAGGAGGCAGG	0.607																																					p.P145Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C434A	X						.						56.0	55.0	55.0					X																	100808347		2202	4299	6501	100695003	SO:0001583	missense	51309	exon4			AB039670	CCDS14487.1	Xq21.33-q22.2	2014-03-21			ENSG00000126947	ENSG00000126947		"""Armadillo repeat containing"""	18073	protein-coding gene	gene with protein product		300362				11162520, 16221301, 22569362	Standard	NM_016608		Approved	ALEX1, GASP7	uc004ehv.3	Q9P291	OTTHUMG00000022033	ENST00000372829.3:c.434C>A	X.37:g.100808347C>A	ENSP00000361917:p.Pro145Gln	Somatic		Capture	Illumina HiSeq	Phase_I	100695003	NM_016608	Q53HK2|Q9H2Q0	Missense_Mutation	SNP	ENST00000372829.3	37	CCDS14487.1	.	.	.	.	.	.	.	.	.	.	c	16.69	3.191961	0.58017	.	.	ENSG00000126947	ENST00000372829	T	0.37058	1.22	3.86	3.86	0.44501	.	0.548049	0.15277	N	0.270939	T	0.41373	0.1156	N	0.24115	0.695	0.31637	N	0.64835	D	0.69078	0.997	D	0.63488	0.915	T	0.45571	-0.9252	10	0.87932	D	0	-8.0833	10.1908	0.43026	0.0:1.0:0.0:0.0	.	145	Q9P291	ARMX1_HUMAN	Q	145	ENSP00000361917:P145Q	ENSP00000361917:P145Q	P	+	2	0	ARMCX1	100695003	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.012000	0.29924	2.160000	0.67779	0.556000	0.70494	CCA		ARMCX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057561.1	NM_016608	
TENM1	10178	broad.mit.edu	37	X	124028201	124028201	+	Splice_Site	SNP	C	C	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chrX:124028201C>T	ENST00000371130.3	-	3	542	c.479G>A	c.(478-480)gGt>gAt	p.G160D	TENM1_ENST00000422452.2_Splice_Site_p.G160D	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	160	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.G160D(1)									GAATTTGAAACCTGTAACAGT	0.373																																					p.G160D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G479A	X						.						128.0	119.0	122.0					X																	124028201		2203	4300	6503	123855882	SO:0001630	splice_region_variant	10178	exon3			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.479-1G>A	X.37:g.124028201C>T		Somatic		Capture	Illumina HiSeq	Phase_I	123855882	NM_014253	B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	c	11.94	1.788389	0.31685	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	T;T	0.53640	0.61;0.61	3.77	3.77	0.43336	Teneurin intracellular, N-terminal (2);	0.170267	0.36555	N	0.002526	T	0.40272	0.1110	N	0.03608	-0.345	0.41058	D	0.985357	D;D;B	0.69078	0.997;0.997;0.262	D;D;B	0.74023	0.982;0.982;0.27	T	0.36504	-0.9745	10	0.30078	T	0.28	.	10.0989	0.42493	0.0:1.0:0.0:0.0	.	160;160;160	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	D	160	ENSP00000360171:G160D;ENSP00000403954:G160D	ENSP00000360171:G160D	G	-	2	0	ODZ1	123855882	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	3.015000	0.49599	2.136000	0.66102	0.530000	0.56133	GGT		TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253	Missense_Mutation
ENOX2	10495	broad.mit.edu	37	X	129799652	129799652	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chrX:129799652G>A	ENST00000370927.1	-	7	1087	c.1066C>T	c.(1066-1068)Cgg>Tgg	p.R356W	ENOX2_ENST00000338144.3_Missense_Mutation_p.R356W|ENOX2_ENST00000370935.1_Missense_Mutation_p.R327W|ENOX2_ENST00000394363.1_Missense_Mutation_p.R327W			Q16206	ENOX2_HUMAN	ecto-NOX disulfide-thiol exchanger 2	356					cell growth (GO:0016049)|oxidation-reduction process (GO:0055114)|regulation of growth (GO:0040008)|ultradian rhythm (GO:0007624)	cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|protein disulfide oxidoreductase activity (GO:0015035)	p.R356W(2)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(3)	33						ATGTTCTTCCGCTGGGCTTTT	0.483																																					p.R356W	Ovarian(101;828 1506 2951 9500 35258)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1066T	X						.						106.0	69.0	81.0					X																	129799652		2203	4300	6503	129627333	SO:0001583	missense	10495	exon10			AF207881	CCDS14626.1, CCDS14627.1	Xq25	2013-02-12	2007-03-23	2007-03-23	ENSG00000165675	ENSG00000165675		"""RNA binding motif (RRM) containing"""	2259	protein-coding gene	gene with protein product		300282	"""cytosolic ovarian carcinoma antigen 1"""	COVA1		8150545, 11888291	Standard	NM_006375		Approved	APK1, tNOX	uc004evw.3	Q16206	OTTHUMG00000022401	ENST00000370927.1:c.1066C>T	X.37:g.129799652G>A	ENSP00000359965:p.Arg356Trp	Somatic		Capture	Illumina HiSeq	Phase_I	129627333	NM_182314	A8K197|A8K1C2|Q5VTJ1|Q5VTJ2|Q8WUX0|Q9NTP6|Q9UH82	Missense_Mutation	SNP	ENST00000370927.1	37	CCDS14626.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.022392	0.75275	.	.	ENSG00000165675	ENST00000538435;ENST00000370935;ENST00000338144;ENST00000394363;ENST00000350369;ENST00000370927;ENST00000432489	T;T	0.31247	1.5;1.5	5.44	4.57	0.56435	.	0.117298	0.64402	D	0.000015	T	0.54159	0.1841	M	0.78637	2.42	0.50632	D	0.999887	D;D	0.89917	1.0;1.0	D;D	0.72338	0.977;0.977	T	0.56619	-0.7949	9	.	.	.	-5.478	12.2059	0.54353	0.0:0.0:0.829:0.171	.	356;384	Q16206;A4QPE1	ENOX2_HUMAN;.	W	327;327;356;327;384;356;327	ENSP00000337146:R356W;ENSP00000359965:R356W	.	R	-	1	2	ENOX2	129627333	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.371000	0.79600	1.257000	0.44085	0.594000	0.82650	CGG		ENOX2-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058277.1	NM_182314	
GPR112	139378	broad.mit.edu	37	X	135480102	135480102	+	Silent	SNP	C	C	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chrX:135480102C>T	ENST00000394143.1	+	20	8538	c.8247C>T	c.(8245-8247)acC>acT	p.T2749T	GPR112_ENST00000287534.4_Silent_p.T2502T|GPR112_ENST00000394141.1_Silent_p.T2544T|GPR112_ENST00000412101.1_Silent_p.T2544T|GPR112_ENST00000370652.1_Silent_p.T2749T	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	2749					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.T2749T(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					TAACATACACCGGATGTGGAA	0.398																																					p.T2749T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C8247T	X						.						182.0	148.0	159.0					X																	135480102		2203	4300	6503	135307768	SO:0001819	synonymous_variant	139378	exon20			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.8247C>T	X.37:g.135480102C>T		Somatic		Capture	Illumina HiSeq	Phase_I	135307768	NM_153834	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Silent	SNP	ENST00000394143.1	37	CCDS35409.1																																																																																				GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1		
MXRA5	25878	broad.mit.edu	37	X	3228955	3228955	+	Missense_Mutation	SNP	G	G	A	rs376795964		TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chrX:3228955G>A	ENST00000217939.6	-	7	7443	c.7289C>T	c.(7288-7290)aCg>aTg	p.T2430M		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	2430	Ig-like C2-type 8.					extracellular vesicular exosome (GO:0070062)		p.T2430M(2)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				AATCCACACCGTCTTCCTATC	0.562																																					p.T2430M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C7289T	X						.	G	MET/THR	0,3835		0,0,0,1632,571	108.0	62.0	77.0		7289	-1.6	0.0	X		77	1,6727		0,0,1,2428,1871	no	missense	MXRA5	NM_015419.3	81	0,0,1,4060,2442	AA,AG,A,GG,G		0.0149,0.0,0.0095	benign	2430/2829	3228955	1,10562	2203	4300	6503	3238955	SO:0001583	missense	25878	exon7			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.7289C>T	X.37:g.3228955G>A	ENSP00000217939:p.Thr2430Met	Somatic		Capture	Illumina HiSeq	Phase_I	3238955	NM_015419	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	G	2.993	-0.207707	0.06180	0.0	1.49E-4	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.69040	-0.37	3.78	-1.61	0.08399	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.446490	0.04903	N	0.451622	T	0.52933	0.1765	L	0.43757	1.38	0.09310	N	1	B	0.32717	0.381	B	0.26770	0.073	T	0.22871	-1.0204	10	0.23891	T	0.37	.	7.0451	0.25040	0.7433:0.1434:0.1133:0.0	.	2430	Q9NR99	MXRA5_HUMAN	M	2430	ENSP00000217939:T2430M	ENSP00000217939:T2430M	T	-	2	0	MXRA5	3238955	0.001000	0.12720	0.000000	0.03702	0.067000	0.16453	1.092000	0.30927	-0.835000	0.04234	0.597000	0.82753	ACG		MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419	
PTCHD1	139411	broad.mit.edu	37	X	23410663	23410663	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chrX:23410663G>T	ENST00000379361.4	+	3	1888	c.1028G>T	c.(1027-1029)gGg>gTg	p.G343V		NM_173495.2	NP_775766.2	Q96NR3	PTHD1_HUMAN	patched domain containing 1	343	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				cognition (GO:0050890)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hedgehog receptor activity (GO:0008158)	p.G238V(1)		NS(1)|breast(4)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(4)|skin(2)|urinary_tract(2)	42						GGATTATATGGGACTTTTGAA	0.403																																					p.G343V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1028T	X						.						66.0	60.0	62.0					X																	23410663		2203	4300	6503	23320584	SO:0001583	missense	139411	exon3			AK054858	CCDS35215.2	Xp22.13	2008-02-05			ENSG00000165186	ENSG00000165186			26392	protein-coding gene	gene with protein product		300828					Standard	NM_173495		Approved	FLJ30296	uc004dal.4	Q96NR3	OTTHUMG00000021251	ENST00000379361.4:c.1028G>T	X.37:g.23410663G>T	ENSP00000368666:p.Gly343Val	Somatic		Capture	Illumina HiSeq	Phase_I	23320584	NM_173495	B4DQH0|Q0IJ60|Q6P6B8	Missense_Mutation	SNP	ENST00000379361.4	37	CCDS35215.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.29|15.29	2.790656|2.790656	0.50102|0.50102	.|.	.|.	ENSG00000165186|ENSG00000165186	ENST00000379361|ENST00000456522	D|.	0.85411|.	-1.98|.	4.82|4.82	4.82|4.82	0.62117|0.62117	Sterol-sensing domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.68805|0.68805	0.3041|0.3041	L|L	0.50333|0.50333	1.59|1.59	0.80722|0.80722	D|D	1|1	P|.	0.44309|.	0.832|.	P|.	0.61533|.	0.89|.	T|T	0.66834|0.66834	-0.5823|-0.5823	10|5	0.87932|.	D|.	0|.	.|.	17.2886|17.2886	0.87149|0.87149	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	343|.	Q96NR3|.	PTHD1_HUMAN|.	V|C	343|58	ENSP00000368666:G343V|.	ENSP00000368666:G343V|.	G|W	+|+	2|3	0|0	PTCHD1|PTCHD1	23320584|23320584	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.208000|9.208000	0.95075|0.95075	2.352000|2.352000	0.79861|0.79861	0.600000|0.600000	0.82982|0.82982	GGG|TGG		PTCHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056047.2	NM_173495	
CLCN5	1184	broad.mit.edu	37	X	49851065	49851065	+	Silent	SNP	C	C	A			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chrX:49851065C>A	ENST00000307367.2	+	8	1176	c.885C>A	c.(883-885)atC>atA	p.I295I	CLCN5_ENST00000376091.3_Silent_p.I365I|CLCN5_ENST00000376088.3_Silent_p.I365I|CLCN5_ENST00000376108.3_Silent_p.I295I			P51795	CLCN5_HUMAN	chloride channel, voltage-sensitive 5	295					chloride transmembrane transport (GO:1902476)|endocytosis (GO:0006897)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)	p.I295I(1)		central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)	30	Ovarian(276;0.236)					TACGCTCCATCAATCCATTTG	0.468																																					p.I365I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1095A	X						.						97.0	76.0	83.0					X																	49851065		2203	4300	6503	49737805	SO:0001819	synonymous_variant	1184	exon11			X91906	CCDS14328.1, CCDS48115.1, CCDS69763.1	Xp11.23-p11.22	2012-09-26	2012-02-23		ENSG00000171365	ENSG00000171365		"""Ion channels / Chloride channels : Voltage-sensitive"""	2023	protein-coding gene	gene with protein product	"""Dent disease"""	300008	"""nephrolithiasis 2, X-linked"", ""nephrolithiasis 1 (X-linked)"", ""chloride channel 5"""	NPHL2, NPHL1		7874126, 8111383, 8099916, 8559248, 9602200	Standard	NM_001272102		Approved	DENTS, XLRH, hClC-K2, hCIC-K2, CLC5, XRN, ClC-5	uc004doq.1	P51795	OTTHUMG00000021514	ENST00000307367.2:c.885C>A	X.37:g.49851065C>A		Somatic		Capture	Illumina HiSeq	Phase_I	49737805	NM_001127899	A1L475|B3KPN6|Q5JQD5|Q7RTN8	Silent	SNP	ENST00000307367.2	37	CCDS14328.1																																																																																				CLCN5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056544.1		
GDPD2	54857	broad.mit.edu	37	X	69649807	69649807	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chrX:69649807C>T	ENST00000374382.3	+	12	1452	c.1201C>T	c.(1201-1203)Cgg>Tgg	p.R401W	GDPD2_ENST00000538649.1_Missense_Mutation_p.R322W|GDPD2_ENST00000453994.2_Missense_Mutation_p.R401W|GDPD2_ENST00000472623.1_3'UTR|GDPD2_ENST00000536730.1_Missense_Mutation_p.R322W	NM_017711.3	NP_060181.2	Q9HCC8	GDPD2_HUMAN	glycerophosphodiester phosphodiesterase domain containing 2	401	GP-PDE.				glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|glycerophosphoinositol inositolphosphodiesterase activity (GO:0047394)|metal ion binding (GO:0046872)	p.R401W(1)		NS(1)|breast(1)|cervix(1)|endometrium(6)|large_intestine(8)|lung(3)|ovary(2)	22	Renal(35;0.156)					TGTCCAACGACGGGCACCTGG	0.537																																					p.R322W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C964T	X						.						82.0	66.0	71.0					X																	69649807		2203	4300	6503	69566532	SO:0001583	missense	54857	exon11			AK000214	CCDS14402.1, CCDS55437.1, CCDS55438.1	Xq13.1	2011-01-25			ENSG00000130055	ENSG00000130055			25974	protein-coding gene	gene with protein product	"""osteoblast differentiation promoting factor"""					12975309	Standard	NM_017711		Approved	OBDPF, FLJ20207, GDE3	uc011mpk.2	Q9HCC8	OTTHUMG00000021776	ENST00000374382.3:c.1201C>T	X.37:g.69649807C>T	ENSP00000363503:p.Arg401Trp	Somatic		Capture	Illumina HiSeq	Phase_I	69566532	NM_001171193	B4DRH4|B4DVC9|Q9NXJ6	Missense_Mutation	SNP	ENST00000374382.3	37	CCDS14402.1	.	.	.	.	.	.	.	.	.	.	C	16.24	3.067495	0.55539	.	.	ENSG00000130055	ENST00000453994;ENST00000536730;ENST00000538649;ENST00000374382	T;T;T;T	0.12672	2.66;2.73;2.73;2.73	5.05	4.17	0.49024	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);	0.310895	0.30244	N	0.010075	T	0.20618	0.0496	L	0.43152	1.355	0.34471	D	0.702834	D;D	0.76494	0.999;0.991	P;P	0.56088	0.791;0.549	T	0.21415	-1.0246	9	.	.	.	-15.4818	9.9059	0.41375	0.3693:0.6307:0.0:0.0	.	401;401	B4DVC9;Q9HCC8	.;GDPD2_HUMAN	W	401;322;322;401	ENSP00000414019:R401W;ENSP00000445982:R322W;ENSP00000444601:R322W;ENSP00000363503:R401W	.	R	+	1	2	GDPD2	69566532	0.840000	0.29493	0.989000	0.46669	0.775000	0.43874	1.123000	0.31308	0.900000	0.36469	0.292000	0.19580	CGG		GDPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057070.1	NM_017711	
TAF1	6872	broad.mit.edu	37	X	70598796	70598796	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chrX:70598796A>T	ENST00000373790.4	+	8	1323	c.1272A>T	c.(1270-1272)aaA>aaT	p.K424N	TAF1_ENST00000449580.1_Missense_Mutation_p.K424N|TAF1_ENST00000423759.1_Missense_Mutation_p.K445N|TAF1_ENST00000276072.3_Missense_Mutation_p.K445N	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	424					cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.K424N(1)		breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				TCAAACACAAAGGGACAAAAC	0.502																																					p.K424N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1272T	X						.						241.0	180.0	201.0					X																	70598796		2203	4300	6503	70515521	SO:0001583	missense	6872	exon8				CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.1272A>T	X.37:g.70598796A>T	ENSP00000362895:p.Lys424Asn	Somatic		Capture	Illumina HiSeq	Phase_I	70515521	NM_138923	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Missense_Mutation	SNP	ENST00000373790.4	37	CCDS35325.1	.	.	.	.	.	.	.	.	.	.	.	22.1	4.237890	0.79800	.	.	ENSG00000147133	ENST00000373790;ENST00000449580;ENST00000423759;ENST00000276072	T;T;T;T	0.17054	2.3;2.38;2.42;2.37	5.95	4.78	0.61160	.	0.000000	0.85682	D	0.000000	T	0.34221	0.0890	L	0.59436	1.845	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.85130	0.993;0.997	T	0.03121	-1.1070	10	0.51188	T	0.08	.	8.2654	0.31810	0.8465:0.0:0.1535:0.0	.	424;445	P21675;P21675-2	TAF1_HUMAN;.	N	424;424;445;445	ENSP00000362895:K424N;ENSP00000389000:K424N;ENSP00000406549:K445N;ENSP00000276072:K445N	ENSP00000276072:K445N	K	+	3	2	TAF1	70515521	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.278000	0.58946	0.853000	0.35312	0.417000	0.27973	AAA		TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058995.2	NM_004606	
ATP7A	538	broad.mit.edu	37	X	77289307	77289307	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chrX:77289307G>A	ENST00000341514.6	+	17	3654	c.3499G>A	c.(3499-3501)Gcc>Acc	p.A1167T	ATP7A_ENST00000343533.5_Missense_Mutation_p.A1089T|ATP7A_ENST00000350425.4_Missense_Mutation_p.A170T	NM_000052.5	NP_000043.4	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide	1167					blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cartilage development (GO:0051216)|catecholamine metabolic process (GO:0006584)|cellular copper ion homeostasis (GO:0006878)|central nervous system neuron development (GO:0021954)|cerebellar Purkinje cell differentiation (GO:0021702)|collagen fibril organization (GO:0030199)|copper ion export (GO:0060003)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|dendrite morphogenesis (GO:0048813)|detoxification of copper ion (GO:0010273)|dopamine metabolic process (GO:0042417)|elastic fiber assembly (GO:0048251)|elastin biosynthetic process (GO:0051542)|epinephrine metabolic process (GO:0042414)|extracellular matrix organization (GO:0030198)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|lung alveolus development (GO:0048286)|mitochondrion organization (GO:0007005)|negative regulation of metalloenzyme activity (GO:0048553)|negative regulation of neuron apoptotic process (GO:0043524)|neuron projection morphogenesis (GO:0048812)|norepinephrine biosynthetic process (GO:0042421)|norepinephrine metabolic process (GO:0042415)|peptidyl-lysine modification (GO:0018205)|pigmentation (GO:0043473)|positive regulation of catalytic activity (GO:0043085)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of oxidoreductase activity (GO:0051353)|pyramidal neuron development (GO:0021860)|regulation of gene expression (GO:0010468)|regulation of oxidative phosphorylation (GO:0002082)|release of cytochrome c from mitochondria (GO:0001836)|removal of superoxide radicals (GO:0019430)|response to iron(III) ion (GO:0010041)|response to zinc ion (GO:0010043)|serotonin metabolic process (GO:0042428)|skin development (GO:0043588)|T-helper cell differentiation (GO:0042093)|transmembrane transport (GO:0055085)|tryptophan metabolic process (GO:0006568)|tyrosine metabolic process (GO:0006570)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper ion transmembrane transporter activity (GO:0005375)|copper-dependent protein binding (GO:0032767)|copper-exporting ATPase activity (GO:0004008)|superoxide dismutase copper chaperone activity (GO:0016532)	p.A1167T(1)		breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(26)|pancreas(1)|prostate(1)|urinary_tract(1)	53					Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	GATTATTGATGCCCAGATCTC	0.348																																					p.A1167T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3499A	X						.						102.0	95.0	97.0					X																	77289307		2203	4296	6499	77175963	SO:0001583	missense	538	exon17			L06133	CCDS35339.1, CCDS75997.1	Xq21.1	2012-10-22	2008-07-31		ENSG00000165240	ENSG00000165240	3.6.3.4	"""ATPases / P-type"""	869	protein-coding gene	gene with protein product	"""copper pump 1"", ""copper-transporting ATPase 1"""	300011	"""Menkes syndrome"""	MNK		10079817	Standard	NM_000052		Approved		uc004ecx.4	Q04656	OTTHUMG00000021885	ENST00000341514.6:c.3499G>A	X.37:g.77289307G>A	ENSP00000345728:p.Ala1167Thr	Somatic		Capture	Illumina HiSeq	Phase_I	77175963	NM_000052	B1AT72|O00227|O00745|Q9BYY8	Missense_Mutation	SNP	ENST00000341514.6	37	CCDS35339.1	.	.	.	.	.	.	.	.	.	.	G	11.18	1.563675	0.27915	.	.	ENSG00000165240	ENST00000343533;ENST00000350425;ENST00000341514	D;D;D	0.97279	-3.94;-4.32;-3.94	5.27	3.5	0.40072	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);	0.621035	0.16745	N	0.201269	D	0.89511	0.6736	N	0.08118	0	0.33112	D	0.540601	B	0.06786	0.001	B	0.04013	0.001	D	0.83543	0.0097	10	0.15066	T	0.55	-6.7551	5.8767	0.18832	0.2172:0.0:0.6465:0.1362	.	1167	Q04656	ATP7A_HUMAN	T	1089;170;1167	ENSP00000343026:A1089T;ENSP00000343678:A170T;ENSP00000345728:A1167T	ENSP00000345728:A1167T	A	+	1	0	ATP7A	77175963	1.000000	0.71417	0.926000	0.36857	0.944000	0.59088	3.027000	0.49697	0.519000	0.28406	0.600000	0.82982	GCC		ATP7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057306.1	NM_000052	
PCDH11X	27328	broad.mit.edu	37	X	91091032	91091032	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chrX:91091032G>A	ENST00000373094.1	+	1	1374	c.529G>A	c.(529-531)Gaa>Aaa	p.E177K	PCDH11X_ENST00000406881.1_Missense_Mutation_p.E177K|PCDH11X_ENST00000373097.1_Missense_Mutation_p.E177K|PCDH11X_ENST00000298274.8_Missense_Mutation_p.E177K|PCDH11X_ENST00000504220.2_Missense_Mutation_p.E177K|PCDH11X_ENST00000395337.2_Missense_Mutation_p.E177K|PCDH11X_ENST00000361655.2_Missense_Mutation_p.E177K|PCDH11X_ENST00000373088.1_Missense_Mutation_p.E177K|PCDH11X_ENST00000361724.1_Missense_Mutation_p.E177K	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	177	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E177K(2)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						TCAAAACTACGAACTAATTAA	0.303																																					p.E177K	NSCLC(38;925 1092 2571 38200 45895)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G529A	X						.						31.0	32.0	32.0					X																	91091032		2199	4294	6493	90977688	SO:0001583	missense	27328	exon1			AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.529G>A	X.37:g.91091032G>A	ENSP00000362186:p.Glu177Lys	Somatic		Capture	Illumina HiSeq	Phase_I	90977688	NM_032968	A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	ENST00000373094.1	37	CCDS14461.1	.	.	.	.	.	.	.	.	.	.	G	12.70	2.016987	0.35606	.	.	ENSG00000102290	ENST00000395337;ENST00000373094;ENST00000373097;ENST00000361724;ENST00000373088;ENST00000504220;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T;T;T;T	0.51071	0.72;0.72;0.72;0.72;0.72;0.72;0.72;0.72;0.72	4.44	2.5	0.30297	Cadherin (4);Cadherin-like (1);	0.121119	0.53938	D	0.000051	T	0.34424	0.0897	N	0.25332	0.735	0.40337	D	0.978994	B;B;B;B;B;B;B;B	0.25521	0.027;0.024;0.105;0.105;0.105;0.128;0.027;0.011	B;B;B;B;B;B;B;B	0.24848	0.019;0.005;0.033;0.033;0.033;0.056;0.019;0.019	T	0.34428	-0.9829	10	0.72032	D	0.01	.	11.9937	0.53189	0.0:0.415:0.585:0.0	.	177;177;177;177;177;177;177;177	Q9BZA7-6;Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7;Q9BZA7-7;Q9BZA7-2	.;.;.;.;.;PC11X_HUMAN;.;.	K	177	ENSP00000378746:E177K;ENSP00000362186:E177K;ENSP00000362189:E177K;ENSP00000355040:E177K;ENSP00000362180:E177K;ENSP00000423762:E177K;ENSP00000355105:E177K;ENSP00000384758:E177K;ENSP00000298274:E177K	ENSP00000298274:E177K	E	+	1	0	PCDH11X	90977688	1.000000	0.71417	0.999000	0.59377	0.619000	0.37552	3.465000	0.53064	0.983000	0.38602	-0.329000	0.08387	GAA		PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969	
GABRA3	2556	broad.mit.edu	37	X	151514067	151514067	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-AA-A03F-01A-11W-A096-10	TCGA-AA-A03F-11A-12W-A096-10	g.chrX:151514067C>T	ENST00000370314.4	-	3	486	c.248G>A	c.(247-249)cGa>cAa	p.R83Q	GABRA3_ENST00000535043.1_Missense_Mutation_p.R83Q	NM_000808.3	NP_000799.1	P34903	GBRA3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 3	83					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.R83Q(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(6)	37	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	AAGCCCAGGTCGCAGCCGGTT	0.453																																					p.R83Q	NSCLC(142;2578 2613 10251 16743)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G248A	X						.						109.0	99.0	103.0					X																	151514067		2203	4300	6503	151264723	SO:0001583	missense	2556	exon3				CCDS14706.1	Xq28	2012-06-22			ENSG00000011677	ENSG00000011677		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4077	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 3"""	305660					Standard	NM_000808		Approved		uc010ntk.1	P34903	OTTHUMG00000024183	ENST00000370314.4:c.248G>A	X.37:g.151514067C>T	ENSP00000359337:p.Arg83Gln	Somatic		Capture	Illumina HiSeq	Phase_I	151264723	NM_000808	Q8TAF9	Missense_Mutation	SNP	ENST00000370314.4	37	CCDS14706.1	.	.	.	.	.	.	.	.	.	.	C	32	5.191828	0.94923	.	.	ENSG00000011677	ENST00000370314;ENST00000370311;ENST00000535043	D;D;D	0.82803	-1.65;-1.65;-1.65	5.71	5.71	0.89125	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.94341	0.8181	H	0.97315	3.98	0.50632	D	0.99988	D	0.69078	0.997	D	0.72982	0.979	D	0.96157	0.9112	10	0.87932	D	0	.	16.1044	0.81212	0.0:1.0:0.0:0.0	.	83	P34903	GBRA3_HUMAN	Q	83	ENSP00000359337:R83Q;ENSP00000359334:R83Q;ENSP00000443527:R83Q	ENSP00000359334:R83Q	R	-	2	0	GABRA3	151264723	1.000000	0.71417	0.990000	0.47175	0.957000	0.61999	7.078000	0.76821	2.404000	0.81709	0.509000	0.49947	CGA		GABRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060921.1	NM_000808	
