#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
RELN	5649	hgsc.bcm.edu	37	7	103191534	103191534	+	Silent	SNP	A	A	G			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr7:103191534A>G	ENST00000428762.1	-	41	6441	c.6282T>C	c.(6280-6282)ttT>ttC	p.F2094F	RELN_ENST00000424685.2_Silent_p.F2094F|RELN_ENST00000343529.5_Silent_p.F2094F	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2094					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.F2094F(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		GCAGCTTCCCAAAGTGCACGA	0.547																																					p.F2094F	NSCLC(146;835 1944 15585 22231 52158)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T6282C	7						.						56.0	42.0	46.0					7																	103191534		2203	4300	6503	102978770	SO:0001819	synonymous_variant	5649	exon41				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.6282T>C	7.37:g.103191534A>G		Somatic		Capture	SOLID	Phase_I	102978770	NM_005045	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Silent	SNP	ENST00000428762.1	37	CCDS47680.1																																																																																				RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
NPY	4852	hgsc.bcm.edu	37	7	24324907	24324907	+	Silent	SNP	G	G	T			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr7:24324907G>T	ENST00000407573.1	+	3	338	c.48G>T	c.(46-48)ctG>ctT	p.L16L	NPY_ENST00000405982.1_Silent_p.L16L|NPY_ENST00000242152.2_Silent_p.L16L			P01303	NPY_HUMAN	neuropeptide Y	16					adult feeding behavior (GO:0008343)|behavior (GO:0007610)|blood circulation (GO:0008015)|calcium ion transport (GO:0006816)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|central nervous system neuron development (GO:0021954)|cerebral cortex development (GO:0021987)|digestion (GO:0007586)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of appetite (GO:0032100)|regulation of blood pressure (GO:0008217)|synaptic transmission (GO:0007268)	cell (GO:0005623)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|neuropeptide hormone activity (GO:0005184)|receptor binding (GO:0005102)	p.L16L(1)		breast(1)|kidney(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	9						CCCTCGCCCTGTCCCTGCTCG	0.657																																					p.L16L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G48T	7						.						93.0	77.0	82.0					7																	24324907		2203	4300	6503	24291432	SO:0001819	synonymous_variant	4852	exon2			K01911	CCDS5387.1	7p15.3	2013-02-26			ENSG00000122585	ENSG00000122585		"""Endogenous ligands"""	7955	protein-coding gene	gene with protein product	"""prepro-neuropeptide Y"""	162640					Standard	NM_000905		Approved	PYY4	uc003sww.2	P01303	OTTHUMG00000022973	ENST00000407573.1:c.48G>T	7.37:g.24324907G>T		Somatic		Capture	SOLID	Phase_I	24291432	NM_000905		Silent	SNP	ENST00000407573.1	37	CCDS5387.1																																																																																				NPY-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326748.1	NM_000905	
KBTBD2	25948	hgsc.bcm.edu	37	7	32909871	32909871	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr7:32909871T>C	ENST00000304056.4	-	4	1657	c.958A>G	c.(958-960)Ata>Gta	p.I320V	AVL9_ENST00000404479.1_Intron|KBTBD2_ENST00000485611.1_5'Flank	NM_015483.2	NP_056298.2	Q8IY47	KBTB2_HUMAN	kelch repeat and BTB (POZ) domain containing 2	320								p.I320V(1)		endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|urinary_tract(1)	17			GBM - Glioblastoma multiforme(11;0.0499)			CCCCCTGCTATGTAGATATCA	0.403																																					p.I320V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A958G	7						.						186.0	174.0	178.0					7																	32909871		2203	4300	6503	32876396	SO:0001583	missense	25948	exon4			AB040922	CCDS34614.1	7p14.3	2013-01-08	2003-12-12	2003-12-12	ENSG00000170852	ENSG00000170852		"""BTB/POZ domain containing"""	21751	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 1"""	BKLHD1		10819331	Standard	NM_015483		Approved	DKFZP566C134	uc003tdb.2	Q8IY47	OTTHUMG00000152984	ENST00000304056.4:c.958A>G	7.37:g.32909871T>C	ENSP00000302586:p.Ile320Val	Somatic		Capture	SOLID	Phase_I	32876396	NM_015483	A8K9T7|Q86Y62|Q9P239|Q9UFM7|Q9Y382	Missense_Mutation	SNP	ENST00000304056.4	37	CCDS34614.1	.	.	.	.	.	.	.	.	.	.	T	13.74	2.326967	0.41197	.	.	ENSG00000170852	ENST00000304056;ENST00000537125	T	0.62364	0.03	5.65	5.65	0.86999	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.60196	0.2250	L	0.47716	1.5	0.58432	D	0.999995	P	0.35745	0.518	P	0.44647	0.456	T	0.55786	-0.8086	10	0.02654	T	1	.	16.1594	0.81686	0.0:0.0:0.0:1.0	.	320	Q8IY47	KBTB2_HUMAN	V	320;127	ENSP00000302586:I320V	ENSP00000302586:I320V	I	-	1	0	KBTBD2	32876396	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	7.655000	0.83696	2.279000	0.76181	0.402000	0.26972	ATA		KBTBD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328890.1	XM_291224	
PPP1R9A	55607	hgsc.bcm.edu	37	7	94827698	94827698	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr7:94827698G>A	ENST00000433881.1	+	6	2324	c.1792G>A	c.(1792-1794)Gag>Aag	p.E598K	AC002429.5_ENST00000417881.2_RNA|PPP1R9A_ENST00000289495.5_Missense_Mutation_p.E598K|PPP1R9A_ENST00000433360.1_Missense_Mutation_p.E598K|PPP1R9A_ENST00000456331.2_Missense_Mutation_p.E598K|PPP1R9A_ENST00000424654.1_Missense_Mutation_p.E598K|PPP1R9A_ENST00000340694.4_Missense_Mutation_p.E598K			Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory subunit 9A	598	Interacts with TGN38. {ECO:0000250}.				actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|neuron projection development (GO:0031175)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|dendritic spine (GO:0043197)|filopodium (GO:0030175)|growth cone (GO:0030426)|synapse (GO:0045202)		p.E598K(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(11)|liver(2)|lung(22)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(8)|urinary_tract(5)	71	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)			ACAAGTGAGCGAGGTTGCCCA	0.463										HNSCC(28;0.073)																											p.E598K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1792A	7						.						102.0	100.0	101.0					7																	94827698		2203	4300	6503	94665634	SO:0001583	missense	55607	exon5			AB033048	CCDS34683.1, CCDS55127.1, CCDS55128.1	7q21.3	2013-01-10	2011-10-04		ENSG00000158528	ENSG00000158528		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Sterile alpha motif (SAM) domain containing"""	14946	protein-coding gene	gene with protein product		602468	"""protein phosphatase 1, regulatory (inhibitor) subunit 9A"""			10574462	Standard	NM_001166160		Approved	Neurabin-I, KIAA1222, FLJ20068	uc010lfj.3	Q9ULJ8	OTTHUMG00000155566	ENST00000433881.1:c.1792G>A	7.37:g.94827698G>A	ENSP00000398870:p.Glu598Lys	Somatic		Capture	SOLID	Phase_I	94665634	NM_001166163	A1L494|B2RWQ1|E9PCA0|E9PCK6|E9PDX1|F8W7J9|O76059|Q9NXT2	Missense_Mutation	SNP	ENST00000433881.1	37	CCDS34683.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.623980	0.87560	.	.	ENSG00000158528	ENST00000433360;ENST00000340694;ENST00000424654;ENST00000433881;ENST00000289495;ENST00000456331	T;T;T;T;T;T	0.21932	2.04;2.03;1.98;2.03;2.02;1.98	5.61	5.61	0.85477	PDZ/DHR/GLGF (1);	0.000000	0.85682	D	0.000000	T	0.50463	0.1617	M	0.76170	2.325	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.997;0.999;0.999;0.993;0.998	T	0.49679	-0.8914	10	0.87932	D	0	.	20.0173	0.97481	0.0:0.0:1.0:0.0	.	598;598;598;598;598	B7ZLX4;F8W7J9;E9PDX1;E9PCK6;Q9ULJ8	.;.;.;.;NEB1_HUMAN	K	598	ENSP00000405514:E598K;ENSP00000344524:E598K;ENSP00000411342:E598K;ENSP00000398870:E598K;ENSP00000289495:E598K;ENSP00000402893:E598K	ENSP00000289495:E598K	E	+	1	0	PPP1R9A	94665634	1.000000	0.71417	1.000000	0.80357	0.288000	0.27193	9.718000	0.98758	2.814000	0.96858	0.591000	0.81541	GAG		PPP1R9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340662.1	NM_001166160	
PTPRZ1	5803	hgsc.bcm.edu	37	7	121671604	121671604	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr7:121671604A>C	ENST00000393386.2	+	15	5568	c.5157A>C	c.(5155-5157)gaA>gaC	p.E1719D	PTPRZ1_ENST00000449182.1_Missense_Mutation_p.E859D	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	1719	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.E1719D(1)		NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						GGTTTACTGAAGAATTTGAGG	0.294																																					p.E1719D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A5157C	7						.						83.0	78.0	80.0					7																	121671604		2203	4299	6502	121458840	SO:0001583	missense	5803	exon15			M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.5157A>C	7.37:g.121671604A>C	ENSP00000377047:p.Glu1719Asp	Somatic		Capture	SOLID	Phase_I	121458840	NM_002851	A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	ENST00000393386.2	37	CCDS34740.1	.	.	.	.	.	.	.	.	.	.	A	15.26	2.779870	0.49891	.	.	ENSG00000106278	ENST00000393386;ENST00000449182	T;T	0.15017	2.46;2.46	5.91	5.91	0.95273	Protein-tyrosine phosphatase, receptor/non-receptor type (1);	0.073211	0.56097	D	0.000025	T	0.18425	0.0442	L	0.56124	1.755	0.37048	D	0.897477	B;B;B	0.19583	0.001;0.0;0.037	B;B;B	0.15484	0.001;0.001;0.013	T	0.05484	-1.0882	10	0.49607	T	0.09	.	11.4322	0.50047	0.8654:0.0:0.0:0.1346	.	858;859;1719	P23471-2;C9JFM0;P23471	.;.;PTPRZ_HUMAN	D	1719;859	ENSP00000377047:E1719D;ENSP00000410000:E859D	ENSP00000377047:E1719D	E	+	3	2	PTPRZ1	121458840	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.273000	0.33121	2.263000	0.75096	0.528000	0.53228	GAA		PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851	
TPX2	22974	hgsc.bcm.edu	37	20	30370134	30370134	+	Silent	SNP	G	G	T			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr20:30370134G>T	ENST00000300403.6	+	11	1665	c.1137G>T	c.(1135-1137)cgG>cgT	p.R379R	TPX2_ENST00000340513.4_Silent_p.R415R	NM_012112.4	NP_036244.2	Q9ULW0	TPX2_HUMAN	TPX2, microtubule-associated	379					activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|mitotic nuclear division (GO:0007067)|regulation of mitotic spindle organization (GO:0060236)	axon hillock (GO:0043203)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|protein kinase binding (GO:0019901)	p.R379R(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28			Epithelial(4;0.000771)|Colorectal(19;0.00306)|all cancers(5;0.004)|COAD - Colon adenocarcinoma(19;0.0347)|OV - Ovarian serous cystadenocarcinoma(3;0.0656)			ACCGTGCACGGGCTGTGACCT	0.502																																					p.R379R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1137T	20						.						113.0	113.0	113.0					20																	30370134		2203	4300	6503	29833795	SO:0001819	synonymous_variant	22974	exon11			AF098158	CCDS13190.1	20q11.2	2013-07-23	2013-07-23	2003-10-08	ENSG00000088325	ENSG00000088325			1249	protein-coding gene	gene with protein product		605917	"""chromosome 20 open reading frame 1"", ""TPX2, microtubule-associated, homolog (Xenopus laevis)"""	C20orf2, C20orf1		9207457, 10393424	Standard	NM_012112		Approved	p100, DIL-2	uc002wwp.1	Q9ULW0	OTTHUMG00000032190	ENST00000300403.6:c.1137G>T	20.37:g.30370134G>T		Somatic		Capture	SOLID	Phase_I	29833795	NM_012112	Q9H1R4|Q9NRA3|Q9UFN9|Q9UL00|Q9Y2M1	Silent	SNP	ENST00000300403.6	37	CCDS13190.1																																																																																				TPX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078569.2		
MMP9	4318	hgsc.bcm.edu	37	20	44644971	44644971	+	Silent	SNP	C	C	T	rs369032528		TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr20:44644971C>T	ENST00000372330.3	+	13	2107	c.2088C>T	c.(2086-2088)taC>taT	p.Y696Y	RP11-465L10.10_ENST00000535913.1_RNA	NM_004994.2	NP_004985.2	P14780	MMP9_HUMAN	matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)	696					collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|macrophage differentiation (GO:0030225)|negative regulation of cation channel activity (GO:2001258)|ossification (GO:0001503)|positive regulation of apoptotic process (GO:0043065)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of receptor binding (GO:1900122)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)|identical protein binding (GO:0042802)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.Y696Y(1)		breast(2)|endometrium(4)|large_intestine(14)|liver(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(3)	46		Myeloproliferative disorder(115;0.0122)			Captopril(DB01197)|Glucosamine(DB01296)|Marimastat(DB00786)|Minocycline(DB01017)	AAGTGGGCTACGTGACCTATG	0.592																																					p.Y696Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2088T	20						.	C		1,4405	2.1+/-5.4	0,1,2202	142.0	107.0	119.0		2088	-0.1	1.0	20		119	0,8600		0,0,4300	no	coding-synonymous	MMP9	NM_004994.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		696/708	44644971	1,13005	2203	4300	6503	44078378	SO:0001819	synonymous_variant	4318	exon13				CCDS13390.1	20q12-q13	2008-01-07	2005-08-08		ENSG00000100985	ENSG00000100985	3.4.24.35		7176	protein-coding gene	gene with protein product		120361	"""matrix metalloproteinase 9 (gelatinase B, 92kD gelatinase, 92kD type IV collagenase)"", ""matrix metalloproteinase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)"""	CLG4B		2158484	Standard	NM_004994		Approved		uc002xqz.3	P14780	OTTHUMG00000033044	ENST00000372330.3:c.2088C>T	20.37:g.44644971C>T		Somatic		Capture	SOLID	Phase_I	44078378	NM_004994	B2R7V9|Q3LR70|Q8N725|Q9H4Z1|Q9UCJ9|Q9UCL1|Q9UDK2	Silent	SNP	ENST00000372330.3	37	CCDS13390.1																																																																																				MMP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080337.1		
TSHZ2	128553	hgsc.bcm.edu	37	20	51589849	51589849	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr20:51589849A>T	ENST00000371497.5	+	1	904	c.17A>T	c.(16-18)cAg>cTg	p.Q6L		NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	6					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q6L(1)		NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			AGGAGAAAACAGCAGGCACCC	0.706																																					p.Q6L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A17T	20						.						31.0	30.0	30.0					20																	51589849		2000	3962	5962	51023256	SO:0001583	missense	128553	exon1			AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.17A>T	20.37:g.51589849A>T	ENSP00000360552:p.Gln6Leu	Somatic		Capture	SOLID	Phase_I	51023256	NM_173485	B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	SNP	ENST00000371497.5	37	CCDS33490.1	.	.	.	.	.	.	.	.	.	.	A	14.16	2.451222	0.43531	.	.	ENSG00000182463	ENST00000371497	T	0.14766	2.48	4.42	3.31	0.37934	.	0.648009	0.13913	N	0.354098	T	0.12646	0.0307	L	0.39898	1.24	0.80722	D	1	B	0.10296	0.003	B	0.08055	0.003	T	0.03898	-1.0994	10	0.56958	D	0.05	-10.5365	9.9666	0.41727	0.8478:0.0:0.0:0.1522	.	6	Q9NRE2	TSH2_HUMAN	L	6	ENSP00000360552:Q6L	ENSP00000360552:Q6L	Q	+	2	0	TSHZ2	51023256	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.292000	0.72725	0.704000	0.31869	0.448000	0.29417	CAG		TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	NM_173485	
AK7	122481	hgsc.bcm.edu	37	14	96924524	96924524	+	Silent	SNP	C	C	T	rs376162440		TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr14:96924524C>T	ENST00000267584.4	+	12	1376	c.1332C>T	c.(1330-1332)atC>atT	p.I444I		NM_152327.3	NP_689540.2	Q96M32	KAD7_HUMAN	adenylate kinase 7	444	Adenylate kinase.|NMPbind. {ECO:0000250}.				axoneme assembly (GO:0035082)|brain development (GO:0007420)|epithelial cilium movement (GO:0003351)|inflammatory response to antigenic stimulus (GO:0002437)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)	p.I444I(1)		breast(2)|cervix(2)|endometrium(3)|large_intestine(8)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	31		all_cancers(154;0.0482)|all_epithelial(191;0.128)|Melanoma(154;0.155)		Epithelial(152;0.134)|COAD - Colon adenocarcinoma(157;0.228)		TAGATGGCATCAAGGAGAGCA	0.483																																					p.I444I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1332T	14						.	C		0,4406		0,0,2203	117.0	97.0	104.0		1332	2.0	1.0	14		104	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	AK7	NM_152327.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		444/724	96924524	1,13005	2203	4300	6503	95994277	SO:0001819	synonymous_variant	122481	exon12			AK057426	CCDS9945.1	14q32.31	2012-08-15			ENSG00000140057	ENSG00000140057		"""Adenylate kinases"""	20091	protein-coding gene	gene with protein product		615364					Standard	NM_152327		Approved	FLJ32864	uc001yfn.3	Q96M32	OTTHUMG00000171421	ENST00000267584.4:c.1332C>T	14.37:g.96924524C>T		Somatic		Capture	SOLID	Phase_I	95994277	NM_152327	Q8IYP6	Silent	SNP	ENST00000267584.4	37	CCDS9945.1																																																																																				AK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413340.1		
CCT8L2	150160	hgsc.bcm.edu	37	22	17073367	17073367	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr22:17073367C>A	ENST00000359963.3	-	1	333	c.74G>T	c.(73-75)aGt>aTt	p.S25I		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	25					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)	p.S25I(1)		breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				CTCTTCTGGACTCCTCGGGCT	0.672																																					p.S25I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G74T	22						.						48.0	54.0	52.0					22																	17073367		2203	4300	6503	15453367	SO:0001583	missense	150160	exon1			AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.74G>T	22.37:g.17073367C>A	ENSP00000353048:p.Ser25Ile	Somatic		Capture	SOLID	Phase_I	15453367	NM_014406	A4QPH3|Q9UJS3	Missense_Mutation	SNP	ENST00000359963.3	37	CCDS13738.1	.	.	.	.	.	.	.	.	.	.	c	2.240	-0.374014	0.05034	.	.	ENSG00000198445	ENST00000359963	T	0.56776	0.44	1.81	0.64	0.17752	.	1.842030	0.03376	U	0.199630	T	0.31827	0.0809	N	0.08118	0	0.09310	N	1	B	0.24186	0.099	B	0.14578	0.011	T	0.18524	-1.0334	10	0.38643	T	0.18	0.4841	5.9635	0.19313	0.0:0.6692:0.3308:0.0	.	25	Q96SF2	TCPQM_HUMAN	I	25	ENSP00000353048:S25I	ENSP00000353048:S25I	S	-	2	0	CCT8L2	15453367	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	-0.196000	0.09532	0.088000	0.17205	0.393000	0.25936	AGT		CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280580.1		
NPHS1	4868	hgsc.bcm.edu	37	19	36322257	36322257	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr19:36322257C>T	ENST00000378910.5	-	26	3327	c.3328G>A	c.(3328-3330)Gtc>Atc	p.V1110I	NPHS1_ENST00000353632.6_Missense_Mutation_p.V1070I	NM_004646.3	NP_004637.1	O60500	NPHN_HUMAN	nephrosis 1, congenital, Finnish type (nephrin)	1110					cell adhesion (GO:0007155)|excretion (GO:0007588)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell development (GO:0072015)|JNK cascade (GO:0007254)|myoblast fusion (GO:0007520)|positive regulation of actin filament polymerization (GO:0030838)|regulation of excretion (GO:0044062)|skeletal muscle tissue development (GO:0007519)	cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)	myosin binding (GO:0017022)	p.V1110I(1)		NS(2)|breast(1)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(1)|lung(26)|ovary(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TCGTTCCTGACTCGGTCCTCT	0.612																																					p.V1110I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3328A	19						.						102.0	97.0	99.0					19																	36322257		2203	4300	6503	41014097	SO:0001583	missense	4868	exon26				CCDS32996.1	19q12-q13.1	2014-09-17				ENSG00000161270		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7908	protein-coding gene	gene with protein product		602716				9915943, 9660941	Standard	NM_004646		Approved	CNF, NPHN	uc002oby.3	O60500		ENST00000378910.5:c.3328G>A	19.37:g.36322257C>T	ENSP00000368190:p.Val1110Ile	Somatic		Capture	SOLID	Phase_I	41014097	NM_004646	A6NDH2|C3RX61	Missense_Mutation	SNP	ENST00000378910.5	37	CCDS32996.1	.	.	.	.	.	.	.	.	.	.	C	3.387	-0.125214	0.06795	.	.	ENSG00000161270	ENST00000378910;ENST00000353632	T;T	0.72725	-0.68;-0.66	5.18	0.35	0.16037	.	0.574722	0.18651	N	0.135013	T	0.44561	0.1299	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.15407	-1.0438	10	0.22109	T	0.4	-8.5462	3.9932	0.09546	0.0:0.5008:0.1739:0.3253	.	1110	O60500	NPHN_HUMAN	I	1110;1070	ENSP00000368190:V1110I;ENSP00000343634:V1070I	ENSP00000343634:V1070I	V	-	1	0	NPHS1	41014097	0.019000	0.18553	0.128000	0.21923	0.054000	0.15201	-0.040000	0.12104	0.006000	0.14734	0.442000	0.29010	GTC		NPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452553.1		
HAS1	3036	hgsc.bcm.edu	37	19	52217278	52217278	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr19:52217278G>T	ENST00000222115.1	-	5	1173	c.1139C>A	c.(1138-1140)tCc>tAc	p.S380Y	HAS1_ENST00000601714.1_Missense_Mutation_p.S387Y|HAS1_ENST00000540069.2_Missense_Mutation_p.S379Y|HAS1_ENST00000594621.1_Silent_p.V209V	NM_001523.2	NP_001514.2	Q92839	HYAS1_HUMAN	hyaluronan synthase 1	380					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|negative regulation of fibroblast migration (GO:0010764)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronan synthase activity (GO:0050501)	p.S380Y(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	40		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00102)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		GTACGACTTGGACCAGCGTGT	0.647																																					p.S380Y	NSCLC(132;636 2450 45807 47979)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1139A	19						.						50.0	32.0	38.0					19																	52217278		2202	4300	6502	56909090	SO:0001583	missense	3036	exon5			U59269	CCDS12838.1, CCDS74436.1	19q13.3-q13.4	2013-02-22			ENSG00000105509	ENSG00000105509	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4818	protein-coding gene	gene with protein product		601463		HAS		9169154	Standard	XM_005258834		Approved		uc002pxo.1	Q92839		ENST00000222115.1:c.1139C>A	19.37:g.52217278G>T	ENSP00000222115:p.Ser380Tyr	Somatic		Capture	SOLID	Phase_I	56909090	NM_001523	Q14470|Q9NS49	Missense_Mutation	SNP	ENST00000222115.1	37	CCDS12838.1	.	.	.	.	.	.	.	.	.	.	g	15.86	2.958051	0.53400	.	.	ENSG00000105509	ENST00000540069;ENST00000222115	T;T	0.40225	1.04;1.04	3.22	3.22	0.36961	.	0.135484	0.49916	U	0.000132	T	0.58708	0.2141	M	0.79475	2.455	0.40675	D	0.982257	P;D;D	0.53151	0.948;0.958;0.958	P;P;P	0.58780	0.673;0.845;0.845	T	0.67217	-0.5726	10	0.87932	D	0	-11.6399	12.2907	0.54817	0.0:0.0:1.0:0.0	.	379;380;379	G3V1S7;Q92839;Q8IYH3	.;HAS1_HUMAN;.	Y	379;380	ENSP00000445021:S379Y;ENSP00000222115:S380Y	ENSP00000222115:S380Y	S	-	2	0	HAS1	56909090	1.000000	0.71417	1.000000	0.80357	0.160000	0.22226	5.291000	0.65667	1.816000	0.52996	0.174000	0.16983	TCC		HAS1-005	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466953.1	NM_001523	
TNFRSF10D	8793	hgsc.bcm.edu	37	8	23003361	23003361	+	Missense_Mutation	SNP	C	C	A	rs564770894		TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr8:23003361C>A	ENST00000312584.3	-	5	650	c.556G>T	c.(556-558)Gcc>Tcc	p.A186S		NM_003840.4	NP_003831.2	Q9UBN6	TR10D_HUMAN	tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain	186					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)	p.A186S(1)		endometrium(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	9		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0147)|COAD - Colon adenocarcinoma(73;0.0612)		GTGGAACTGGCAGCTGATTCA	0.527																																					p.A186S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G556T	8						.						142.0	126.0	131.0					8																	23003361		2203	4300	6503	23059306	SO:0001583	missense	8793	exon5			AF029761	CCDS6038.1	8p21	2006-02-22			ENSG00000173530	ENSG00000173530		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11907	protein-coding gene	gene with protein product		603614				9382840, 9537512	Standard	NM_003840		Approved	DcR2, TRUNDD, TRAILR4, CD264	uc003xcz.2	Q9UBN6	OTTHUMG00000097845	ENST00000312584.3:c.556G>T	8.37:g.23003361C>A	ENSP00000310263:p.Ala186Ser	Somatic		Capture	SOLID	Phase_I	23059306	NM_003840	B2R8W0|Q9Y6Q4	Missense_Mutation	SNP	ENST00000312584.3	37	CCDS6038.1	.	.	.	.	.	.	.	.	.	.	c	3.996	-0.003512	0.07773	.	.	ENSG00000173530	ENST00000312584	T	0.35789	1.29	1.71	-1.1	0.09872	.	2587.460000	0.00166	N	0.000001	T	0.23249	0.0562	L	0.40543	1.245	0.09310	N	1	P	0.34864	0.473	B	0.28553	0.091	T	0.04607	-1.0939	10	0.14656	T	0.56	.	2.2428	0.04024	0.0:0.2318:0.3143:0.4539	.	186	Q9UBN6	TR10D_HUMAN	S	186	ENSP00000310263:A186S	ENSP00000310263:A186S	A	-	1	0	TNFRSF10D	23059306	0.007000	0.16637	0.001000	0.08648	0.003000	0.03518	0.053000	0.14184	-0.281000	0.09141	-0.379000	0.06801	GCC		TNFRSF10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215135.1		
TG	7038	hgsc.bcm.edu	37	8	133980166	133980166	+	Silent	SNP	C	C	A			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr8:133980166C>A	ENST00000220616.4	+	31	5854	c.5814C>A	c.(5812-5814)ggC>ggA	p.G1938G	TG_ENST00000542445.1_Silent_p.G308G|TG_ENST00000519543.1_Silent_p.G92G|TG_ENST00000377869.1_Silent_p.G1881G	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1938					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)		p.G1938G(1)		NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		ATGCCCAGGGCTGCAGACTGA	0.522																																					p.G1938G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C5814A	8						.						89.0	76.0	80.0					8																	133980166		2203	4300	6503	134049348	SO:0001819	synonymous_variant	7038	exon31			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.5814C>A	8.37:g.133980166C>A		Somatic		Capture	SOLID	Phase_I	134049348	NM_003235	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Silent	SNP	ENST00000220616.4	37	CCDS34944.1	.	.	.	.	.	.	.	.	.	.	C	2.745	-0.261392	0.05791	.	.	ENSG00000042832	ENST00000519178	.	.	.	5.65	3.85	0.44370	.	.	.	.	.	T	0.59865	0.2225	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55642	-0.8109	4	.	.	.	.	9.8174	0.40860	0.1583:0.6896:0.152:0.0	.	.	.	.	M	394	.	.	L	+	1	2	TG	134049348	0.999000	0.42202	0.996000	0.52242	0.253000	0.25986	0.492000	0.22435	0.859000	0.35456	-0.122000	0.15005	CTG		TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235	
OR6N1	128372	hgsc.bcm.edu	37	1	158735956	158735956	+	Missense_Mutation	SNP	G	G	A	rs150316932	byFrequency	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr1:158735956G>A	ENST00000335094.2	-	1	536	c.517C>T	c.(517-519)Cgc>Tgc	p.R173C		NM_001005185.1	NP_001005185.1	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N, member 1	173						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R173C(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_hematologic(112;0.0378)					TGCTGAATGCGATTGGGGCCA	0.463													G|||	2	0.000399361	0.0	0.0	5008	,	,		20633	0.001		0.0	False		,,,				2504	0.001				p.R173C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C517T	1						.	G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	89.0	92.0	91.0		517	4.8	1.0	1	dbSNP_134	91	2,8598	2.2+/-6.3	0,2,4298	yes	missense	OR6N1	NM_001005185.1	180	0,3,6500	AA,AG,GG		0.0233,0.0227,0.0231	probably-damaging	173/313	158735956	3,13003	2203	4300	6503	157002580	SO:0001583	missense	128372	exon1			BK004199	CCDS30905.1	1q23.1	2012-08-09			ENSG00000197403	ENSG00000197403		"""GPCR / Class A : Olfactory receptors"""	15034	protein-coding gene	gene with protein product							Standard	NM_001005185		Approved		uc010piq.2	Q8NGY5	OTTHUMG00000022774	ENST00000335094.2:c.517C>T	1.37:g.158735956G>A	ENSP00000335535:p.Arg173Cys	Somatic		Capture	SOLID	Phase_I	157002580	NM_001005185	Q5VUU8|Q96R35	Missense_Mutation	SNP	ENST00000335094.2	37	CCDS30905.1	.	.	.	.	.	.	.	.	.	.	G	15.25	2.777959	0.49786	2.27E-4	2.33E-4	ENSG00000197403	ENST00000335094	T	0.00058	8.79	4.78	4.78	0.61160	GPCR, rhodopsin-like superfamily (1);	0.700637	0.11921	N	0.516653	T	0.00109	0.0003	L	0.46670	1.46	0.29016	N	0.886589	D	0.63046	0.992	P	0.53549	0.729	T	0.53982	-0.8361	10	0.56958	D	0.05	-4.115	13.1198	0.59318	0.0:0.1623:0.8377:0.0	.	173	Q8NGY5	OR6N1_HUMAN	C	173	ENSP00000335535:R173C	ENSP00000335535:R173C	R	-	1	0	OR6N1	157002580	0.000000	0.05858	0.977000	0.42913	0.951000	0.60555	-0.293000	0.08320	2.454000	0.82982	0.655000	0.94253	CGC		OR6N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059067.1	NM_001005185	
BRINP2	57795	hgsc.bcm.edu	37	1	177249985	177249985	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr1:177249985A>G	ENST00000361539.4	+	8	1985	c.1673A>G	c.(1672-1674)aAg>aGg	p.K558R	BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	558					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)		p.K558R(1)									AAGAGCAACAAGTACAAGCCT	0.547																																					p.K558R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1673G	1						.						56.0	47.0	50.0					1																	177249985		2203	4300	6503	175516608	SO:0001583	missense	57795	exon8				CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.1673A>G	1.37:g.177249985A>G	ENSP00000354481:p.Lys558Arg	Somatic		Capture	SOLID	Phase_I	175516608	NM_021165	O95560|Q6ZWC1|Q7LCZ9|Q8N360	Missense_Mutation	SNP	ENST00000361539.4	37	CCDS1320.1	.	.	.	.	.	.	.	.	.	.	A	19.18	3.777938	0.70107	.	.	ENSG00000198797	ENST00000536589;ENST00000361539	T	0.17370	2.28	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.41073	0.1143	M	0.68317	2.08	0.80722	D	1	D;D	0.76494	0.999;0.993	D;D	0.85130	0.997;0.978	T	0.29427	-1.0012	10	0.72032	D	0.01	-27.5365	15.0226	0.71643	1.0:0.0:0.0:0.0	.	453;558	Q9C0B6-2;Q9C0B6	.;FAM5B_HUMAN	R	311;558	ENSP00000354481:K558R	ENSP00000354481:K558R	K	+	2	0	FAM5B	175516608	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.452000	0.80683	2.034000	0.60081	0.260000	0.18958	AAG		BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084599.1	NM_021165	
HMCN1	83872	hgsc.bcm.edu	37	1	186113778	186113778	+	Silent	SNP	A	A	C			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr1:186113778A>C	ENST00000271588.4	+	91	14438	c.14209A>C	c.(14209-14211)Agg>Cgg	p.R4737R	HMCN1_ENST00000367492.2_Silent_p.R4737R	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4737	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.R4737R(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GTATGGAGGAAGGAAATGCGA	0.512																																					p.R4737R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A14209C	1						.						127.0	118.0	121.0					1																	186113778		2203	4300	6503	184380401	SO:0001819	synonymous_variant	83872	exon91			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.14209A>C	1.37:g.186113778A>C		Somatic		Capture	SOLID	Phase_I	184380401	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	ENST00000271588.4	37	CCDS30956.1																																																																																				HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
NEK7	140609	hgsc.bcm.edu	37	1	198233321	198233321	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr1:198233321G>C	ENST00000367385.4	+	5	670	c.328G>C	c.(328-330)Gtt>Ctt	p.V110L	NEK7_ENST00000538004.1_Missense_Mutation_p.V110L	NM_133494.2	NP_598001.1	Q8TDX7	NEK7_HUMAN	NIMA-related kinase 7	110	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokinesis (GO:0000910)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle (GO:0007346)|spindle assembly (GO:0051225)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.V110L(1)		endometrium(3)|kidney(2)|large_intestine(5)|lung(2)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	21						ACTAAACATAGTTTTGGAACT	0.294																																					p.V110L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G328C	1						.						92.0	101.0	98.0					1																	198233321		2203	4298	6501	196499944	SO:0001583	missense	140609	exon5			AB062450	CCDS1394.1	1q31.3	2012-11-15	2012-11-15		ENSG00000151414	ENSG00000151414			13386	protein-coding gene	gene with protein product		606848	"""NIMA (never in mitosis gene a)-related kinase 7"""			11701951	Standard	NM_133494		Approved		uc001gun.4	Q8TDX7	OTTHUMG00000035658	ENST00000367385.4:c.328G>C	1.37:g.198233321G>C	ENSP00000356355:p.Val110Leu	Somatic		Capture	SOLID	Phase_I	196499944	NM_133494	A6NGT8	Missense_Mutation	SNP	ENST00000367385.4	37	CCDS1394.1	.	.	.	.	.	.	.	.	.	.	G	35	5.478572	0.96291	.	.	ENSG00000151414	ENST00000367385;ENST00000538004	T;T	0.54479	0.57;0.57	5.79	5.79	0.91817	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.62974	0.2472	L	0.33668	1.02	0.80722	D	1	D	0.59767	0.986	P	0.61328	0.887	T	0.63989	-0.6512	10	0.66056	D	0.02	.	20.0349	0.97554	0.0:0.0:1.0:0.0	.	110	Q8TDX7	NEK7_HUMAN	L	110	ENSP00000356355:V110L;ENSP00000444621:V110L	ENSP00000356355:V110L	V	+	1	0	NEK7	196499944	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.048000	0.93830	2.744000	0.94065	0.650000	0.86243	GTT		NEK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086550.2	NM_133494	
IL20	50604	hgsc.bcm.edu	37	1	207039839	207039839	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr1:207039839G>A	ENST00000367098.1	+	4	599	c.236G>A	c.(235-237)cGa>cAa	p.R79Q	IL20_ENST00000391930.2_Missense_Mutation_p.R79Q|IL20_ENST00000367096.3_Missense_Mutation_p.R79Q			Q9UHF5	IL17B_HUMAN	interleukin 20	0					cell-cell signaling (GO:0007267)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)	p.R79Q(1)		endometrium(2)|large_intestine(3)|lung(2)|pancreas(1)|urinary_tract(1)	9	Breast(84;0.201)			OV - Ovarian serous cystadenocarcinoma(81;0.00459)		CCTGCGAATCGATGCTGCCTC	0.517																																					p.R79Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G236A	1						.						287.0	299.0	295.0					1																	207039839		2203	4300	6503	205106462	SO:0001583	missense	50604	exon3			AF224266	CCDS1470.1	1q32	2008-02-05			ENSG00000162891	ENSG00000162891		"""Interleukins and interleukin receptors"""	6002	protein-coding gene	gene with protein product		605619				11163236	Standard	NM_018724		Approved	ZCYTO10, IL10D, IL-20	uc001her.3	Q9NYY1	OTTHUMG00000036456	ENST00000367098.1:c.236G>A	1.37:g.207039839G>A	ENSP00000356065:p.Arg79Gln	Somatic		Capture	SOLID	Phase_I	205106462	NM_018724	Q14CE5	Missense_Mutation	SNP	ENST00000367098.1	37	CCDS1470.1	.	.	.	.	.	.	.	.	.	.	G	10.09	1.254367	0.22965	.	.	ENSG00000162891	ENST00000367098;ENST00000367096;ENST00000391930	T;T;T	0.62788	-0.0;-0.0;2.23	5.18	-2.19	0.07015	Interleukin-10, conserved site (1);Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.338840	0.28883	N	0.013829	T	0.32852	0.0843	N	0.11756	0.17	0.09310	N	1	B;B	0.33000	0.341;0.393	B;B	0.21360	0.029;0.034	T	0.22347	-1.0219	10	0.25106	T	0.35	-1.7943	10.5247	0.44941	0.3875:0.0:0.6125:0.0	.	79;79	Q2THG6;Q9NYY1	.;IL20_HUMAN	Q	79	ENSP00000356065:R79Q;ENSP00000356063:R79Q;ENSP00000375796:R79Q	ENSP00000356063:R79Q	R	+	2	0	IL20	205106462	0.001000	0.12720	0.008000	0.14137	0.003000	0.03518	0.340000	0.19892	-0.303000	0.08856	-0.122000	0.15005	CGA		IL20-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088676.1	NM_018724	
EPHB2	2048	hgsc.bcm.edu	37	1	23236992	23236992	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr1:23236992G>A	ENST00000400191.3	+	14	2638	c.2620G>A	c.(2620-2622)Ggc>Agc	p.G874S	EPHB2_ENST00000374627.1_Missense_Mutation_p.G869S|EPHB2_ENST00000374630.3_Missense_Mutation_p.G874S|EPHB2_ENST00000374632.3_Missense_Mutation_p.G875S	NM_004442.6|NM_017449.3	NP_004433.2|NP_059145.2	P29323	EPHB2_HUMAN	EPH receptor B2	874	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|camera-type eye morphogenesis (GO:0048593)|central nervous system projection neuron axonogenesis (GO:0021952)|commissural neuron axon guidance (GO:0071679)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|ephrin receptor signaling pathway (GO:0048013)|inner ear morphogenesis (GO:0042472)|learning (GO:0007612)|negative regulation of axonogenesis (GO:0050771)|nervous system development (GO:0007399)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse assembly (GO:0051965)|regulation of body fluid levels (GO:0050878)|retinal ganglion cell axon guidance (GO:0031290)|urogenital system development (GO:0001655)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|protein tyrosine kinase activity (GO:0004713)|transmembrane-ephrin receptor activity (GO:0005005)	p.G874S(2)		NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(8)|stomach(1)|urinary_tract(1)	56		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		GCCCAAGTTCGGCCAAATTGT	0.627																																					p.G874S												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G2620A	1						.						109.0	81.0	90.0					1																	23236992		2203	4300	6503	23109579	SO:0001583	missense	2048	exon14			AF025304	CCDS229.2, CCDS230.1	1p36.1-p35	2014-09-17	2004-10-28		ENSG00000133216	ENSG00000133216	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3393	protein-coding gene	gene with protein product		600997	"""EphB2"""	DRT, ERK, EPHT3		1648701	Standard	NM_017449		Approved	Hek5, Tyro5	uc001bge.3	P29323	OTTHUMG00000002881	ENST00000400191.3:c.2620G>A	1.37:g.23236992G>A	ENSP00000383053:p.Gly874Ser	Somatic		Capture	SOLID	Phase_I	23109579	NM_017449	O43477|Q5T0U6|Q5T0U7|Q5T0U8	Missense_Mutation	SNP	ENST00000400191.3	37		.	.	.	.	.	.	.	.	.	.	G	6.868	0.529507	0.13127	.	.	ENSG00000133216	ENST00000374625;ENST00000374630;ENST00000400191;ENST00000374632;ENST00000374627	T;T;T;T	0.81330	-1.48;-1.48;-1.48;-1.48	4.55	3.62	0.41486	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.110120	0.64402	N	0.000007	T	0.48786	0.1519	N	0.01081	-1.03	0.80722	D	1	B;B;B;B	0.13594	0.006;0.008;0.001;0.0	B;B;B;B	0.14578	0.007;0.011;0.007;0.002	T	0.53899	-0.8373	10	0.02654	T	1	.	11.6165	0.51092	0.0886:0.0:0.9114:0.0	.	816;874;892;875	A6NJM0;P29323;Q4LE53;P29323-3	.;EPHB2_HUMAN;.;.	S	816;874;874;875;869	ENSP00000363761:G874S;ENSP00000383053:G874S;ENSP00000363763:G875S;ENSP00000363758:G869S	ENSP00000363755:G816S	G	+	1	0	EPHB2	23109579	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	6.204000	0.72143	1.272000	0.44329	0.485000	0.47835	GGC		EPHB2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000008060.2	NM_017449	
AGO1	26523	hgsc.bcm.edu	37	1	36372648	36372648	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr1:36372648C>T	ENST00000373204.4	+	12	1723	c.1510C>T	c.(1510-1512)Cgg>Tgg	p.R504W	AGO1_ENST00000373206.1_Missense_Mutation_p.R429W	NM_012199.2	NP_036331.1	Q9UL18	AGO1_HUMAN	argonaute RISC catalytic component 1	504					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|nuclear-transcribed mRNA catabolic process (GO:0000956)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.R504W(1)									GCCTATGTTCCGGCATCTCAA	0.532																																					p.R504W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1510T	1						.						132.0	107.0	115.0					1																	36372648		2203	4300	6503	36145235	SO:0001583	missense	26523	exon12			AF093097	CCDS398.1	1p34.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000092847	ENSG00000092847		"""Argonaute/PIWI family"""	3262	protein-coding gene	gene with protein product	"""argonaute 1"""	606228	"""eukaryotic translation initiation factor 2C, 1"""	EIF2C1		10534406, 12906857	Standard	NM_012199		Approved	hAGO1	uc001bzl.3	Q9UL18	OTTHUMG00000007381	ENST00000373204.4:c.1510C>T	1.37:g.36372648C>T	ENSP00000362300:p.Arg504Trp	Somatic		Capture	SOLID	Phase_I	36145235	NM_012199	Q5TA57|Q6P4S0	Missense_Mutation	SNP	ENST00000373204.4	37	CCDS398.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.689184	0.88735	.	.	ENSG00000092847	ENST00000373206;ENST00000373204	T;T	0.11385	2.79;2.78	5.58	5.58	0.84498	Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.34395	0.0896	M	0.86573	2.825	0.80722	D	1	D	0.58970	0.984	P	0.54401	0.751	T	0.29397	-1.0013	10	0.87932	D	0	-14.0389	19.5797	0.95461	0.0:1.0:0.0:0.0	.	504	Q9UL18	AGO1_HUMAN	W	429;504	ENSP00000362302:R429W;ENSP00000362300:R504W	ENSP00000362300:R504W	R	+	1	2	EIF2C1	36145235	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.357000	0.52277	2.623000	0.88846	0.650000	0.86243	CGG		AGO1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019337.3		
SMAP2	64744	hgsc.bcm.edu	37	1	40872452	40872452	+	5'UTR	SNP	C	C	T			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr1:40872452C>T	ENST00000539317.1	+	0	101					NM_001198980.1	NP_001185909.1	Q8WU79	SMAP2_HUMAN	small ArfGAP2						regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.R50*(1)		central_nervous_system(3)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(2)|upper_aerodigestive_tract(1)	24	Lung NSC(20;1.56e-05)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;1.04e-17)			CATCTGCATTCGATGTGCTGG	0.478																																					p.R45X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C133T	1						.						109.0	105.0	106.0					1																	40872452		2203	4300	6503	40645039	SO:0001623	5_prime_UTR_variant	64744	exon2			AL137764	CCDS451.1, CCDS55592.1, CCDS55593.1, CCDS72763.1	1p35.3-p34.1	2008-09-22	2008-09-05	2008-01-09	ENSG00000084070	ENSG00000084070		"""ADP-ribosylation factor GTPase activating proteins"""	25082	protein-coding gene	gene with protein product			"""stromal membrane-associated protein 1-like"", ""stromal membrane-associated GTPase-activating protein 2"""	SMAP1L		16571680	Standard	NM_001198978		Approved		uc001cfj.3	Q8WU79	OTTHUMG00000007301	ENST00000539317.1:c.-93C>T	1.37:g.40872452C>T		Somatic		Capture	SOLID	Phase_I	40645039	NM_001198979	B2R7T1|B7Z5B5|B7Z8V2|D3DPV2|Q5QPL2|Q96C93|Q9NST2|Q9UJL8	Nonsense_Mutation	SNP	ENST00000539317.1	37	CCDS55593.1	.	.	.	.	.	.	.	.	.	.	C	41	8.859304	0.98980	.	.	ENSG00000084070	ENST00000435168;ENST00000372718;ENST00000372708	.	.	.	6.06	6.06	0.98353	.	0.048984	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.999	18.1147	0.89549	0.0:1.0:0.0:0.0	.	.	.	.	X	50;50;20	.	ENSP00000361793:R20X	R	+	1	2	SMAP2	40645039	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.926000	0.63433	2.882000	0.98803	0.655000	0.94253	CGA		SMAP2-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_022733	
CACHD1	57685	hgsc.bcm.edu	37	1	65145385	65145385	+	Missense_Mutation	SNP	C	C	T	rs369700188		TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr1:65145385C>T	ENST00000371073.2	+	24	3352	c.3352C>T	c.(3352-3354)Cgc>Tgc	p.R1118C	CACHD1_ENST00000495994.1_3'UTR|CACHD1_ENST00000290039.5_Missense_Mutation_p.R1067C			Q5VU97	CAHD1_HUMAN	cache domain containing 1	1118					calcium ion transport (GO:0006816)	integral component of membrane (GO:0016021)		p.R1067C(1)		breast(4)|endometrium(3)|kidney(3)|large_intestine(20)|lung(14)|ovary(2)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						GTATGCCTACCGCCACCAGAT	0.557																																					p.R1067C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3199T	1						.	C	CYS/ARG	0,4406		0,0,2203	88.0	84.0	85.0		3199	6.1	1.0	1		85	1,8599	1.2+/-3.3	0,1,4299	no	missense	CACHD1	NM_020925.2	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	1067/1224	65145385	1,13005	2203	4300	6503	64917973	SO:0001583	missense	57685	exon24			AB046793	CCDS628.2	1p31.3	2008-02-05	2005-10-11	2005-10-11	ENSG00000158966	ENSG00000158966			29314	protein-coding gene	gene with protein product			"""von Willebrand factor type A and cache domain containing 1"""	VWCD1		10997877	Standard	NM_020925		Approved	KIAA1573	uc001dbo.1	Q5VU97	OTTHUMG00000009030	ENST00000371073.2:c.3352C>T	1.37:g.65145385C>T	ENSP00000360113:p.Arg1118Cys	Somatic		Capture	SOLID	Phase_I	64917973	NM_020925	Q49AE9|Q658T4|Q7Z3P2|Q9H7W4|Q9H9W3|Q9HCJ9	Missense_Mutation	SNP	ENST00000371073.2	37		.	.	.	.	.	.	.	.	.	.	C	26.0	4.698549	0.88830	0.0	1.16E-4	ENSG00000158966	ENST00000371073;ENST00000290039	T;T	0.50001	0.76;0.79	6.06	6.06	0.98353	.	0.044336	0.85682	D	0.000000	T	0.61640	0.2363	L	0.52905	1.665	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.61347	-0.7081	10	0.87932	D	0	-32.4367	20.6244	0.99512	0.0:1.0:0.0:0.0	.	1118	Q5VU97	CAHD1_HUMAN	C	1118;1067	ENSP00000360113:R1118C;ENSP00000290039:R1067C	ENSP00000290039:R1067C	R	+	1	0	CACHD1	64917973	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.439000	0.59968	2.879000	0.98667	0.650000	0.86243	CGC		CACHD1-201	KNOWN	basic	protein_coding	protein_coding		NM_020925	
USH2A	7399	hgsc.bcm.edu	37	1	216138718	216138718	+	Missense_Mutation	SNP	C	C	T	rs201386640		TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr1:216138718C>T	ENST00000307340.3	-	37	7447	c.7061G>A	c.(7060-7062)cGc>cAc	p.R2354H	USH2A_ENST00000366943.2_Missense_Mutation_p.R2354H	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2354	Fibronectin type-III 10. {ECO:0000255|PROSITE-ProRule:PRU00316}.		R -> H (in USH2A). {ECO:0000269|PubMed:17085681}.		hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.R2354H(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TCCATTAGGGCGAAAAGGTGC	0.403										HNSCC(13;0.011)			C|||	1	0.000199681	0.0	0.0	5008	,	,		16044	0.0		0.001	False		,,,				2504	0.0				p.R2354H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G7061A	1	GRCh37	CM065510	USH2A	M		.						151.0	149.0	150.0					1																	216138718		2203	4300	6503	214205341	SO:0001583	missense	7399	exon37			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.7061G>A	1.37:g.216138718C>T	ENSP00000305941:p.Arg2354His	Somatic		Capture	SOLID	Phase_I	214205341	NM_206933	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	9.917	1.211142	0.22289	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.53640	0.61;0.61	5.56	-5.71	0.02413	Fibronectin, type III (3);Immunoglobulin-like fold (1);	1.141870	0.06669	N	0.765866	T	0.13072	0.0317	N	0.00621	-1.32	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.21655	-1.0239	10	0.18276	T	0.48	.	5.5397	0.17031	0.0751:0.2583:0.1031:0.5634	.	2354	O75445	USH2A_HUMAN	H	2354	ENSP00000305941:R2354H;ENSP00000355910:R2354H	ENSP00000305941:R2354H	R	-	2	0	USH2A	214205341	0.095000	0.21747	0.000000	0.03702	0.490000	0.33462	0.145000	0.16157	-0.801000	0.04427	-0.136000	0.14681	CGC		USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
BIRC2	329	hgsc.bcm.edu	37	11	102233667	102233667	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr11:102233667G>T	ENST00000227758.2	+	4	2435	c.1036G>T	c.(1036-1038)Gat>Tat	p.D346Y	BIRC2_ENST00000527910.1_3'UTR|BIRC2_ENST00000532672.1_Missense_Mutation_p.D325Y|BIRC2_ENST00000530675.1_Missense_Mutation_p.D297Y	NM_001166.4|NM_001256163.1	NP_001157.1|NP_001243092.1	Q13490	BIRC2_HUMAN	baculoviral IAP repeat containing 2	346					apoptotic process (GO:0006915)|cell surface receptor signaling pathway (GO:0007166)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein K48-linked ubiquitination (GO:1902524)|positive regulation of protein K63-linked ubiquitination (GO:1902523)|positive regulation of protein monoubiquitination (GO:1902527)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cell cycle (GO:0051726)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|regulation of cysteine-type endopeptidase activity (GO:2000116)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of necroptotic process (GO:0060544)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|regulation of RIG-I signaling pathway (GO:0039535)|regulation of toll-like receptor signaling pathway (GO:0034121)|regulation of transcription, DNA-templated (GO:0006355)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|protein N-terminus binding (GO:0047485)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.D346Y(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|liver(2)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(8;0.00044)|all_epithelial(12;0.00348)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0093)	Lung(13;0.109)|Epithelial(9;0.11)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0144)		AGAGTTTGTTGATGAGATTCA	0.259																																					p.D346Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1036T	11						.						91.0	94.0	93.0					11																	102233667		2203	4299	6502	101738877	SO:0001583	missense	329	exon4			L49431	CCDS8316.1, CCDS58169.1	11q22	2011-01-25	2011-01-25		ENSG00000110330	ENSG00000110330		"""Baculoviral IAP repeat containing"", ""RING-type (C3HC4) zinc fingers"""	590	protein-coding gene	gene with protein product	"""NFR2-TRAF signalling complex protein"", ""apoptosis inhibitor 1"""	601712	"""baculoviral IAP repeat-containing 2"""	API1		8552191, 8548810	Standard	NM_001166		Approved	cIAP1, hiap-2, MIHB, RNF48, c-IAP1	uc010ruq.3	Q13490	OTTHUMG00000167325	ENST00000227758.2:c.1036G>T	11.37:g.102233667G>T	ENSP00000227758:p.Asp346Tyr	Somatic		Capture	SOLID	Phase_I	101738877	NM_001166	B4E026|Q16516|Q4TTG0	Missense_Mutation	SNP	ENST00000227758.2	37	CCDS8316.1	.	.	.	.	.	.	.	.	.	.	G	9.762	1.170243	0.21621	.	.	ENSG00000110330	ENST00000530675;ENST00000533742;ENST00000227758;ENST00000541741;ENST00000532672	T;T;T;T	0.08634	3.81;3.07;3.81;3.81	5.46	3.56	0.40772	Baculoviral inhibition of apoptosis protein repeat (1);	0.264525	0.45126	D	0.000386	T	0.06462	0.0166	L	0.44542	1.39	0.35238	D	0.777511	P	0.38395	0.629	B	0.31495	0.131	T	0.14980	-1.0453	10	0.49607	T	0.09	-21.8852	7.4647	0.27314	0.1334:0.1507:0.7159:0.0	.	346	Q13490	BIRC2_HUMAN	Y	297;8;346;346;325	ENSP00000431723:D297Y;ENSP00000433851:D8Y;ENSP00000227758:D346Y;ENSP00000434979:D325Y	ENSP00000227758:D346Y	D	+	1	0	BIRC2	101738877	1.000000	0.71417	1.000000	0.80357	0.214000	0.24535	1.057000	0.30492	2.568000	0.86640	0.561000	0.74099	GAT		BIRC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394170.1	NM_001166	
C11orf57	55216	hgsc.bcm.edu	37	11	111952723	111952723	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr11:111952723A>G	ENST00000280352.9	+	5	974	c.338A>G	c.(337-339)tAt>tGt	p.Y113C	C11orf57_ENST00000530104.1_3'UTR|C11orf57_ENST00000532163.1_Missense_Mutation_p.Y84C|C11orf57_ENST00000420986.2_Missense_Mutation_p.Y113C|C11orf57_ENST00000393047.3_Missense_Mutation_p.Y113C	NM_001082970.1|NM_018195.3	NP_001076439.1|NP_060665.3	Q6ZUT1	CK057_HUMAN	chromosome 11 open reading frame 57	113								p.Y113C(1)		autonomic_ganglia(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)	12		all_cancers(61;9.8e-15)|all_epithelial(67;6.57e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;3.6e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;7.01e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0521)		CACAGTGGTTATAAAGAGTTA	0.313																																					p.Y113C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A338G	11						.						92.0	89.0	90.0					11																	111952723		2201	4296	6497	111457933	SO:0001583	missense	55216	exon5			BX538107	CCDS8356.2, CCDS41715.1, CCDS73383.1	11q23.1	2006-03-09			ENSG00000150776	ENSG00000150776			25569	protein-coding gene	gene with protein product						12477932	Standard	NM_001082970		Approved	FLJ10726	uc001pmw.4	Q6ZUT1	OTTHUMG00000150213	ENST00000280352.9:c.338A>G	11.37:g.111952723A>G	ENSP00000339076:p.Tyr113Cys	Somatic		Capture	SOLID	Phase_I	111457933	NM_001082969	Q5RL41|Q6IN53|Q7Z357|Q8N2T3	Missense_Mutation	SNP	ENST00000280352.9	37	CCDS41715.1	.	.	.	.	.	.	.	.	.	.	A	18.31	3.596716	0.66332	.	.	ENSG00000150776	ENST00000420986;ENST00000532163;ENST00000280352;ENST00000393047;ENST00000525785;ENST00000531378	.	.	.	5.58	5.58	0.84498	.	0.058565	0.64402	D	0.000001	T	0.79155	0.4398	M	0.74881	2.28	0.40301	D	0.978603	D;D	0.89917	1.0;1.0	D;D	0.91635	0.994;0.999	T	0.82544	-0.0404	9	0.87932	D	0	.	15.7423	0.77910	1.0:0.0:0.0:0.0	.	113;113	Q6ZUT1-2;Q6ZUT1	.;CK057_HUMAN	C	113;84;113;113;84;67	.	ENSP00000339076:Y113C	Y	+	2	0	C11orf57	111457933	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.674000	0.68117	2.107000	0.64212	0.528000	0.53228	TAT		C11orf57-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000316852.1	NM_018195	
KMT2A	4297	hgsc.bcm.edu	37	11	118362633	118362633	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr11:118362633G>A	ENST00000389506.5	+	15	4985	c.4985G>A	c.(4984-4986)cGc>cAc	p.R1662H	KMT2A_ENST00000534358.1_Missense_Mutation_p.R1665H|KMT2A_ENST00000354520.4_Missense_Mutation_p.R1624H			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	1662					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)	p.R1662H(1)									CATTTGCTACGCTACCGGCAG	0.443																																					p.R1662H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4985A	11						.						35.0	35.0	35.0					11																	118362633		2200	4296	6496	117867843	SO:0001583	missense	4297	exon15			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.4985G>A	11.37:g.118362633G>A	ENSP00000374157:p.Arg1662His	Somatic		Capture	SOLID	Phase_I	117867843	NM_005933	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	ENST00000389506.5	37	CCDS31686.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.468485	0.84533	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	D;D;D	0.82619	-1.63;-1.63;-1.56	5.75	5.75	0.90469	Bromodomain (1);	0.000000	0.85682	D	0.000000	D	0.86916	0.6048	L	0.28274	0.84	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.83275	0.984;0.996	D	0.87120	0.2190	10	0.51188	T	0.08	.	19.9564	0.97221	0.0:0.0:1.0:0.0	.	1665;1662	E9PQG7;Q03164	.;MLL1_HUMAN	H	1665;1662;1624;572	ENSP00000436786:R1665H;ENSP00000374157:R1662H;ENSP00000346516:R1624H	ENSP00000346516:R1624H	R	+	2	0	MLL	117867843	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	7.671000	0.83941	2.708000	0.92522	0.650000	0.86243	CGC		KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933	
TECTA	7007	hgsc.bcm.edu	37	11	120983793	120983793	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr11:120983793C>A	ENST00000392793.1	+	5	770	c.499C>A	c.(499-501)Cag>Aag	p.Q167K	TECTA_ENST00000264037.2_Missense_Mutation_p.Q167K			O75443	TECTA_HUMAN	tectorin alpha	167	NIDO. {ECO:0000255|PROSITE- ProRule:PRU00570}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.Q167K(1)	TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		GAACACCTTCCAGGCCGTCCT	0.597											OREG0021430	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q167K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C499A	11						.						91.0	73.0	79.0					11																	120983793		2203	4299	6502	120489003	SO:0001583	missense	7007	exon4			AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.499C>A	11.37:g.120983793C>A	ENSP00000376543:p.Gln167Lys	Somatic	1508	Capture	SOLID	Phase_I	120489003	NM_005422		Missense_Mutation	SNP	ENST00000392793.1	37	CCDS8434.1	.	.	.	.	.	.	.	.	.	.	C	33	5.217965	0.95104	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	D;D	0.91464	-2.85;-2.85	5.26	5.26	0.73747	Nidogen, extracellular domain (3);	0.123890	0.56097	D	0.000035	D	0.97151	0.9069	H	0.96633	3.855	0.53688	D	0.999974	D	0.62365	0.991	D	0.74023	0.982	D	0.98147	1.0439	10	0.87932	D	0	.	19.0783	0.93171	0.0:1.0:0.0:0.0	.	167	O75443	TECTA_HUMAN	K	167	ENSP00000376543:Q167K;ENSP00000264037:Q167K	ENSP00000264037:Q167K	Q	+	1	0	TECTA	120489003	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.619000	0.83057	2.731000	0.93534	0.650000	0.86243	CAG		TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	NM_005422	
FAM111B	374393	hgsc.bcm.edu	37	11	58877121	58877121	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr11:58877121A>G	ENST00000343597.3	+	3	214	c.23A>G	c.(22-24)gAa>gGa	p.E8G	FAM111B_ENST00000529618.1_Intron|FAM111B_ENST00000411426.1_Intron	NM_198947.3	NP_945185.1	Q6SJ93	F111B_HUMAN	family with sequence similarity 111, member B	8							catalytic activity (GO:0003824)	p.E8G(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(12)|ovary(3)|pancreas(1)|skin(1)	40						AAGACTGAAGAAAACAAGTCA	0.373																																					p.E8G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A23G	11						.						101.0	91.0	94.0					11																	58877121		2201	4295	6496	58633697	SO:0001583	missense	374393	exon3			BC062456	CCDS7972.1, CCDS44611.1	11q12.1	2014-03-13			ENSG00000189057	ENSG00000189057			24200	protein-coding gene	gene with protein product		615584				24268661	Standard	NM_198947		Approved	CANP	uc001nnl.3	Q6SJ93	OTTHUMG00000167279	ENST00000343597.3:c.23A>G	11.37:g.58877121A>G	ENSP00000341565:p.Glu8Gly	Somatic		Capture	SOLID	Phase_I	58633697	NM_198947	B4E2G2|Q6P661	Missense_Mutation	SNP	ENST00000343597.3	37	CCDS7972.1	.	.	.	.	.	.	.	.	.	.	A	9.420	1.082693	0.20309	.	.	ENSG00000189057	ENST00000343597	T	0.40756	1.02	1.46	1.46	0.22682	.	.	.	.	.	T	0.27454	0.0674	L	0.44542	1.39	0.09310	N	0.999997	P	0.40731	0.728	B	0.31495	0.131	T	0.21827	-1.0234	9	0.72032	D	0.01	.	5.0706	0.14604	1.0:0.0:0.0:0.0	.	8	Q6SJ93	F111B_HUMAN	G	8	ENSP00000341565:E8G	ENSP00000341565:E8G	E	+	2	0	FAM111B	58633697	0.196000	0.23350	0.046000	0.18839	0.005000	0.04900	0.725000	0.25970	0.961000	0.38030	0.454000	0.30748	GAA		FAM111B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393974.1	NM_198947	
NTM	50863	hgsc.bcm.edu	37	11	132082037	132082037	+	Silent	SNP	C	C	A			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr11:132082037C>A	ENST00000374786.1	+	3	1001	c.522C>A	c.(520-522)ccC>ccA	p.P174P	NTM_ENST00000374784.1_Silent_p.P174P|NTM_ENST00000539799.1_Silent_p.P174P|NTM_ENST00000427481.2_Silent_p.P165P|NTM_ENST00000474900.1_3'UTR|NTM_ENST00000425719.2_Silent_p.P174P|NTM_ENST00000374791.3_Silent_p.P174P	NM_001144058.1|NM_016522.2	NP_001137530.1|NP_057606.1	Q9P121	NTRI_HUMAN	neurotrimin	174	Ig-like C2-type 2.				cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.P174P(2)		breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						ACATCTCTCCCAAAGGTAAGA	0.448																																					p.P174P												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C522A	11						.						150.0	150.0	150.0					11																	132082037		2201	4297	6498	131587247	SO:0001819	synonymous_variant	50863	exon3			AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374786.1:c.522C>A	11.37:g.132082037C>A		Somatic		Capture	SOLID	Phase_I	131587247	NM_001144058	A0MTT2|Q6UXJ3|Q86VJ9	Silent	SNP	ENST00000374786.1	37	CCDS8491.1																																																																																				NTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141937.1	NM_016522	
GJA1	2697	hgsc.bcm.edu	37	6	121768829	121768829	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr6:121768829C>T	ENST00000282561.3	+	2	993	c.836C>T	c.(835-837)tCg>tTg	p.S279L		NM_000165.3	NP_000156.1	P17302	CXA1_HUMAN	gap junction protein, alpha 1, 43kDa	279					adult heart development (GO:0007512)|apoptotic process (GO:0006915)|ATP transport (GO:0015867)|atrial cardiac muscle cell action potential (GO:0086014)|atrial ventricular junction remodeling (GO:0003294)|blood vessel morphogenesis (GO:0048514)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|cell-cell signaling (GO:0007267)|cellular response to mechanical stimulus (GO:0071260)|chronic inflammatory response (GO:0002544)|embryonic digit morphogenesis (GO:0042733)|endothelium development (GO:0003158)|epithelial cell maturation (GO:0002070)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lens development in camera-type eye (GO:0002088)|membrane organization (GO:0061024)|milk ejection (GO:0060156)|muscle contraction (GO:0006936)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of gene expression (GO:0010629)|neuron migration (GO:0001764)|neuron projection morphogenesis (GO:0048812)|osteoblast differentiation (GO:0001649)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of cell communication by chemical coupling (GO:0010652)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of gene expression (GO:0010628)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein oligomerization (GO:0051259)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of bone mineralization (GO:0030500)|regulation of bone remodeling (GO:0046850)|regulation of calcium ion transport (GO:0051924)|regulation of tight junction assembly (GO:2000810)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to fluid shear stress (GO:0034405)|response to peptide hormone (GO:0043434)|response to pH (GO:0009268)|signal transduction (GO:0007165)|skeletal muscle tissue regeneration (GO:0043403)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vascular transport (GO:0010232)	apical plasma membrane (GO:0016324)|connexon complex (GO:0005922)|contractile fiber (GO:0043292)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gap junction (GO:0005921)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial outer membrane (GO:0005741)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)|ion transmembrane transporter activity (GO:0015075)|signal transducer activity (GO:0004871)	p.S279L(1)		autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(2)|large_intestine(10)|liver(2)|lung(13)|ovary(2)	33				GBM - Glioblastoma multiforme(226;0.00252)	Carvedilol(DB01136)	GCTCCCCTCTCGCCTATGTCT	0.507																																					p.S279L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C836T	6						.						58.0	62.0	61.0					6																	121768829		2203	4300	6503	121810528	SO:0001583	missense	2697	exon2			BC026329	CCDS5123.1	6q22.31	2013-05-10	2007-01-16		ENSG00000152661	ENSG00000152661		"""Ion channels / Gap junction proteins (connexins)"""	4274	protein-coding gene	gene with protein product	"""oculodentodigital dysplasia (syndactyly type III)"", ""connexin 43"""	121014	"""gap junction protein, alpha-like"", ""gap junction protein, alpha 1, 43kDa (connexin 43)"""	ODDD, GJAL		10331943, 1646158	Standard	NM_000165		Approved	CX43, ODD, ODOD, SDTY3	uc003pyr.3	P17302	OTTHUMG00000015479	ENST00000282561.3:c.836C>T	6.37:g.121768829C>T	ENSP00000282561:p.Ser279Leu	Somatic		Capture	SOLID	Phase_I	121810528	NM_000165	B2R5U9|Q6FHU1|Q9Y5I8	Missense_Mutation	SNP	ENST00000282561.3	37	CCDS5123.1	.	.	.	.	.	.	.	.	.	.	C	8.078	0.771688	0.16051	.	.	ENSG00000152661	ENST00000440608;ENST00000282561	D	0.82255	-1.59	5.18	5.18	0.71444	.	0.398028	0.22775	N	0.055788	T	0.76919	0.4055	L	0.29908	0.895	0.48571	D	0.999671	D	0.60575	0.988	P	0.52598	0.703	T	0.75698	-0.3227	10	0.33141	T	0.24	.	17.0595	0.86543	0.0:1.0:0.0:0.0	.	279	P17302	CXA1_HUMAN	L	263;279	ENSP00000282561:S279L	ENSP00000282561:S279L	S	+	2	0	GJA1	121810528	1.000000	0.71417	0.552000	0.28243	0.038000	0.13279	5.064000	0.64338	2.694000	0.91930	0.585000	0.79938	TCG		GJA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042023.1	NM_000165	
UTRN	7402	hgsc.bcm.edu	37	6	144858824	144858824	+	Missense_Mutation	SNP	G	G	A	rs532277544		TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr6:144858824G>A	ENST00000367545.3	+	43	6340	c.6340G>A	c.(6340-6342)Gaa>Aaa	p.E2114K		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	2114					aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.E2114K(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		ATCAACCACCGAATTGGGAGA	0.408													G|||	1	0.000199681	0.0008	0.0	5008	,	,		13139	0.0		0.0	False		,,,				2504	0.0				p.E2114K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6340A	6						.						147.0	130.0	136.0					6																	144858824		2203	4300	6503	144900517	SO:0001583	missense	7402	exon43			AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.6340G>A	6.37:g.144858824G>A	ENSP00000356515:p.Glu2114Lys	Somatic		Capture	SOLID	Phase_I	144900517	NM_007124	Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	ENST00000367545.3	37	CCDS34547.1	.	.	.	.	.	.	.	.	.	.	G	12.26	1.883894	0.33255	.	.	ENSG00000152818	ENST00000367545	T	0.37235	1.21	4.77	2.97	0.34412	.	0.496999	0.18562	N	0.137589	T	0.08088	0.0202	N	0.19112	0.55	0.09310	N	0.999995	B	0.11235	0.004	B	0.04013	0.001	T	0.22695	-1.0209	10	0.30078	T	0.28	.	6.8938	0.24245	0.3011:0.0:0.6989:0.0	.	2114	P46939	UTRO_HUMAN	K	2114	ENSP00000356515:E2114K	ENSP00000356515:E2114K	E	+	1	0	UTRN	144900517	0.004000	0.15560	0.003000	0.11579	0.003000	0.03518	1.099000	0.31013	1.319000	0.45190	0.655000	0.94253	GAA		UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1		
FARS2	10667	hgsc.bcm.edu	37	6	5368874	5368874	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr6:5368874C>A	ENST00000324331.6	+	2	407	c.71C>A	c.(70-72)tCc>tAc	p.S24Y	FARS2_ENST00000274680.4_Missense_Mutation_p.S24Y			O95363	SYFM_HUMAN	phenylalanyl-tRNA synthetase 2, mitochondrial	24					gene expression (GO:0010467)|phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA aminoacylation for protein translation (GO:0006418)|tRNA processing (GO:0008033)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|phenylalanine-tRNA ligase activity (GO:0004826)|tRNA binding (GO:0000049)	p.S24Y(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(3)|prostate(1)|stomach(2)	15	Ovarian(93;0.11)	all_hematologic(90;0.0104)			L-Phenylalanine(DB00120)	AGTCACATCTCCAGAGGCCAT	0.572																																					p.S24Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C71A	6						.						66.0	63.0	64.0					6																	5368874		2203	4300	6503	5313873	SO:0001583	missense	10667	exon2			AF097441	CCDS4494.1	6p25.1	2011-07-01	2007-02-23	2004-12-03	ENSG00000145982	ENSG00000145982	6.1.1.20	"""Aminoacyl tRNA synthetases / Class II"""	21062	protein-coding gene	gene with protein product	"""phenylalanine tRNA ligase 2, mitochondrial"""	611592	"""phenylalanine-tRNA synthetase 1 (mitochondrial)"""	FARS1		10329163	Standard	NM_006567		Approved	dJ236A3.1	uc003mwr.2	O95363	OTTHUMG00000014178	ENST00000324331.6:c.71C>A	6.37:g.5368874C>A	ENSP00000316335:p.Ser24Tyr	Somatic		Capture	SOLID	Phase_I	5313873	NM_006567	B2R664|Q53F66|Q5TCS3|Q6FG29|Q9NPY7|Q9P062	Missense_Mutation	SNP	ENST00000324331.6	37	CCDS4494.1	.	.	.	.	.	.	.	.	.	.	C	7.624	0.677530	0.14841	.	.	ENSG00000145982	ENST00000274680;ENST00000324331	T;T	0.71103	-0.54;-0.54	5.45	0.292	0.15737	.	0.608263	0.17019	N	0.190201	T	0.21387	0.0515	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32666	-0.9898	10	0.02654	T	1	-11.682	5.5662	0.17173	0.1176:0.2202:0.5685:0.0938	.	24	O95363	SYFM_HUMAN	Y	24	ENSP00000274680:S24Y;ENSP00000316335:S24Y	ENSP00000274680:S24Y	S	+	2	0	FARS2	5313873	0.000000	0.05858	0.002000	0.10522	0.016000	0.09150	0.133000	0.15912	0.348000	0.23949	0.655000	0.94253	TCC		FARS2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467790.1	NM_006567	
F13A1	2162	hgsc.bcm.edu	37	6	6152175	6152175	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr6:6152175C>T	ENST00000264870.3	-	14	2181	c.1916G>A	c.(1915-1917)gGc>gAc	p.G639D		NM_000129.3	NP_000120.2	P00488	F13A_HUMAN	coagulation factor XIII, A1 polypeptide	639					blood coagulation (GO:0007596)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.G639D(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	62	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	TACCTGAGTGCCACGGACCTA	0.433																																					p.G639D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1916A	6						.						65.0	58.0	61.0					6																	6152175		2203	4300	6503	6097174	SO:0001583	missense	2162	exon14			M14539	CCDS4496.1	6p24.2-p23	2014-01-24			ENSG00000124491	ENSG00000124491		"""Transglutaminases"""	3531	protein-coding gene	gene with protein product		134570		F13A			Standard	NM_000129		Approved		uc003mwv.3	P00488	OTTHUMG00000014186	ENST00000264870.3:c.1916G>A	6.37:g.6152175C>T	ENSP00000264870:p.Gly639Asp	Somatic		Capture	SOLID	Phase_I	6097174	NM_000129	Q59HA7|Q8N6X2|Q96P24|Q9BX29	Missense_Mutation	SNP	ENST00000264870.3	37	CCDS4496.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.402046	0.83120	.	.	ENSG00000124491	ENST00000264870;ENST00000441301	T	0.69806	-0.43	5.37	5.37	0.77165	Transglutaminase, C-terminal (2);Immunoglobulin-like fold (1);	0.052849	0.85682	D	0.000000	T	0.82047	0.4952	M	0.87682	2.9	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.995	D	0.84438	0.0581	10	0.87932	D	0	.	16.6621	0.85243	0.0:1.0:0.0:0.0	.	576;639	F5H080;P00488	.;F13A_HUMAN	D	639;576	ENSP00000264870:G639D	ENSP00000264870:G639D	G	-	2	0	F13A1	6097174	0.965000	0.33210	0.796000	0.32109	0.955000	0.61496	4.293000	0.59037	2.788000	0.95919	0.650000	0.86243	GGC		F13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039756.3	NM_000129	
SLC35B3	51000	hgsc.bcm.edu	37	6	8417716	8417716	+	Silent	SNP	C	C	T	rs184112854	byFrequency	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr6:8417716C>T	ENST00000379660.4	-	8	1241	c.792G>A	c.(790-792)tcG>tcA	p.S264S		NM_001142540.1|NM_001142541.1|NM_015948.3	NP_001136012.1|NP_001136013.1|NP_057032.2	Q9H1N7	S35B3_HUMAN	solute carrier family 35 (adenosine 3'-phospho 5'-phosphosulfate transporter), member B3	264					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.S264S(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(1)|prostate(1)	15	Ovarian(93;0.0569)					CAATTGAATACGAATACAATA	0.328													C|||	3	0.000599042	0.0008	0.0	5008	,	,		15478	0.0		0.002	False		,,,				2504	0.0				p.S264S	Melanoma(83;700 1353 9357 11478 30548)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G792A	6						.						69.0	64.0	66.0					6																	8417716		2203	4295	6498	8362715	SO:0001819	synonymous_variant	51000	exon8			AF132953	CCDS4508.1	6p24.3	2013-07-17	2013-07-17	2003-09-10	ENSG00000124786	ENSG00000124786		"""Solute carriers"""	21601	protein-coding gene	gene with protein product	"""3' phosphoadenosine 5' phosphosulfate transporter 2"""	610845	"""chromosome 6 open reading frame 196"", ""solute carrier family 35, member B3"""	C6orf196		10810093	Standard	XM_005249156		Approved	CGI-19, dJ453H5.1, PAPST2	uc010joe.3	Q9H1N7	OTTHUMG00000014224	ENST00000379660.4:c.792G>A	6.37:g.8417716C>T		Somatic		Capture	SOLID	Phase_I	8362715	NM_001142541	A6NKX9|Q1XH11|Q6MZJ0|Q7Z662|Q9Y308	Silent	SNP	ENST00000379660.4	37	CCDS4508.1																																																																																				SLC35B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039802.1	NM_015948	
C6orf62	81688	hgsc.bcm.edu	37	6	24709124	24709124	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr6:24709124G>C	ENST00000378119.4	-	4	2612	c.445C>G	c.(445-447)Cat>Gat	p.H149D	C6orf62_ENST00000540769.1_Missense_Mutation_p.H91D|RP1-30M3.6_ENST00000606921.1_RNA|C6orf62_ENST00000378102.3_Missense_Mutation_p.H120D	NM_030939.4	NP_112201.1	Q9GZU0	CF062_HUMAN	chromosome 6 open reading frame 62	149						intracellular (GO:0005622)		p.H149D(1)		endometrium(2)|kidney(3)|large_intestine(2)|lung(3)	10						TCACCATGATGAAACTCAAAT	0.363																																					p.H149D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C445G	6						.						141.0	130.0	134.0					6																	24709124		2203	4300	6503	24817103	SO:0001583	missense	81688	exon4			AL136632	CCDS4559.1	6p22.1	2011-12-13			ENSG00000112308	ENSG00000112308			20998	protein-coding gene	gene with protein product	"""HBV X-transactivated protein 12"""					11230166	Standard	NM_030939		Approved	FLJ12619, DKFZP564G182, XTP12	uc003nel.3	Q9GZU0	OTTHUMG00000014361	ENST00000378119.4:c.445C>G	6.37:g.24709124G>C	ENSP00000367359:p.His149Asp	Somatic		Capture	SOLID	Phase_I	24817103	NM_030939	Q3LIB6|Q5JVZ2|Q5JVZ3|Q6IA63|Q9H1Z2	Missense_Mutation	SNP	ENST00000378119.4	37	CCDS4559.1	.	.	.	.	.	.	.	.	.	.	G	12.42	1.931312	0.34096	.	.	ENSG00000112308	ENST00000378119;ENST00000540769;ENST00000378102	T;T;T	0.26957	1.7;1.7;1.7	6.08	5.04	0.67666	.	0.087086	0.85682	D	0.000000	T	0.07279	0.0184	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.11842	-1.0571	10	0.30854	T	0.27	-16.4881	16.2862	0.82722	0.0729:0.0:0.9271:0.0	.	149	Q9GZU0	CF062_HUMAN	D	149;91;120	ENSP00000367359:H149D;ENSP00000446225:H91D;ENSP00000367342:H120D	ENSP00000367342:H120D	H	-	1	0	C6orf62	24817103	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.510000	0.67018	2.894000	0.99253	0.655000	0.94253	CAT		C6orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040017.1	NM_030939	
NT5E	4907	hgsc.bcm.edu	37	6	86201787	86201787	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr6:86201787G>C	ENST00000257770.3	+	8	1502	c.1453G>C	c.(1453-1455)Gac>Cac	p.D485H	NT5E_ENST00000369651.3_Missense_Mutation_p.D435H	NM_002526.3	NP_002517.1	P21589	5NTD_HUMAN	5'-nucleotidase, ecto (CD73)	485					adenosine biosynthetic process (GO:0046086)|AMP catabolic process (GO:0006196)|dephosphorylation (GO:0016311)|DNA metabolic process (GO:0006259)|negative regulation of inflammatory response (GO:0050728)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)	p.D485H(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(76;0.000215)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0427)		BRCA - Breast invasive adenocarcinoma(108;0.0417)	Cytarabine(DB00987)|Pentoxifylline(DB00806)	GCCCAGTTATGACCCTCTCAA	0.423																																					p.D485H	Melanoma(140;797 1765 2035 2752 18208)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1453C	6						.						168.0	159.0	162.0					6																	86201787		2203	4300	6503	86258506	SO:0001583	missense	4907	exon8			X55740	CCDS5002.1, CCDS56439.1	6q14-q21	2013-08-28	2002-04-18	2002-04-19	ENSG00000135318	ENSG00000135318	3.1.3.5	"""CD molecules"""	8021	protein-coding gene	gene with protein product		129190	"""5' nucleotidase (CD73)"""	NT5			Standard	NM_002526		Approved	CD73, eN, eNT, CALJA	uc003pko.4	P21589	OTTHUMG00000015139	ENST00000257770.3:c.1453G>C	6.37:g.86201787G>C	ENSP00000257770:p.Asp485His	Somatic		Capture	SOLID	Phase_I	86258506	NM_002526	B3KQI8|O75520|Q5W116	Missense_Mutation	SNP	ENST00000257770.3	37	CCDS5002.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.388|7.388	0.630201|0.630201	0.14257|0.14257	.|.	.|.	ENSG00000135318|ENSG00000135318	ENST00000257770;ENST00000369651|ENST00000416334	T;T|.	0.54675|.	0.56;0.56|.	5.66|5.66	3.82|3.82	0.43975|0.43975	5&apos (3);-Nucleotidase, C-terminal (3);|.	0.441395|.	0.27043|.	N|.	0.021208|.	T|T	0.15565|0.15565	0.0375|0.0375	N|N	0.20483|0.20483	0.58|0.58	0.26936|0.26936	N|N	0.966365|0.966365	B;B|.	0.06786|.	0.0;0.001|.	B;B|.	0.08055|.	0.0;0.003|.	T|T	0.23476|0.23476	-1.0187|-1.0187	10|5	0.46703|.	T|.	0.11|.	-11.8537|-11.8537	12.9463|12.9463	0.58373|0.58373	0.1038:0.0:0.8962:0.0|0.1038:0.0:0.8962:0.0	.|.	435;485|.	B3KQI8;P21589|.	.;5NTD_HUMAN|.	H|I	485;435|199	ENSP00000257770:D485H;ENSP00000358665:D435H|.	ENSP00000257770:D485H|.	D|M	+|+	1|3	0|0	NT5E|NT5E	86258506|86258506	1.000000|1.000000	0.71417|0.71417	0.617000|0.617000	0.29091|0.29091	0.006000|0.006000	0.05464|0.05464	4.329000|4.329000	0.59260|0.59260	0.802000|0.802000	0.34089|0.34089	-0.302000|-0.302000	0.09304|0.09304	GAC|ATG		NT5E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041388.1		
C6orf165	154313	hgsc.bcm.edu	37	6	88170863	88170863	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr6:88170863A>G	ENST00000507897.1	+	12	1701	c.1618A>G	c.(1618-1620)Aga>Gga	p.R540G	C6ORF165_ENST00000369562.4_Missense_Mutation_p.R540G|C6orf165_ENST00000506888.1_3'UTR			Q8IYR0	CF165_HUMAN	chromosome 6 open reading frame 165	540								p.R540G(1)		NS(1)|central_nervous_system(1)|large_intestine(5)|lung(8)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0419)		ATGGGAATTAAGAAGAAAAGC	0.299																																					p.R540G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1618G	6						.						67.0	60.0	63.0					6																	88170863		2203	4298	6501	88227582	SO:0001583	missense	154313	exon12			BC035083	CCDS34498.1	6q15	2012-02-07			ENSG00000213204	ENSG00000213204			21405	protein-coding gene	gene with protein product							Standard	NM_001031743		Approved	FLJ25974, dJ382I10.1	uc003plv.3	Q8IYR0	OTTHUMG00000015173	ENST00000507897.1:c.1618A>G	6.37:g.88170863A>G	ENSP00000426769:p.Arg540Gly	Somatic		Capture	SOLID	Phase_I	88227582	NM_001031743	A8K969|E1P507|Q8N9U4	Missense_Mutation	SNP	ENST00000507897.1	37	CCDS34498.1	.	.	.	.	.	.	.	.	.	.	A	19.63	3.863828	0.71949	.	.	ENSG00000213204	ENST00000369562	T	0.53423	0.62	5.39	4.15	0.48705	.	0.000000	0.85682	D	0.000000	T	0.66982	0.2845	M	0.90252	3.1	0.58432	D	0.99999	D	0.89917	1.0	D	0.91635	0.999	T	0.74512	-0.3641	10	0.87932	D	0	.	12.3017	0.54878	0.8588:0.1412:0.0:0.0	.	540	Q8IYR0	CF165_HUMAN	G	540	ENSP00000358575:R540G	ENSP00000358575:R540G	R	+	1	2	C6orf165	88227582	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.908000	0.48750	2.167000	0.68274	0.533000	0.62120	AGA		C6orf165-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000470406.1	NM_178823	
CNR1	1268	hgsc.bcm.edu	37	6	88854294	88854294	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr6:88854294C>T	ENST00000537554.1	-	2	4262	c.700G>A	c.(700-702)Gtg>Atg	p.V234M	CNR1_ENST00000428600.2_Missense_Mutation_p.V234M|CNR1_ENST00000362094.5_3'UTR|CNR1_ENST00000549716.1_Missense_Mutation_p.V173M|CNR1_ENST00000549890.1_Missense_Mutation_p.V234M|CNR1_ENST00000369501.2_Missense_Mutation_p.V234M|CNR1_ENST00000468898.1_Missense_Mutation_p.V201M|CNR1_ENST00000369499.2_Missense_Mutation_p.V234M|CNR1_ENST00000535130.1_Missense_Mutation_p.V234M	NM_001160226.1|NM_001160258.1	NP_001153698.1|NP_001153730.1	P21554	CNR1_HUMAN	cannabinoid receptor 1 (brain)	234					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|negative regulation of blood pressure (GO:0045776)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of mast cell activation (GO:0033004)|negative regulation of nitric-oxide synthase activity (GO:0051001)|positive regulation of acute inflammatory response to antigenic stimulus (GO:0002866)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood pressure (GO:0045777)|positive regulation of fever generation (GO:0031622)|positive regulation of neuron projection development (GO:0010976)|regulation of feeding behavior (GO:0060259)|regulation of insulin secretion (GO:0050796)|regulation of penile erection (GO:0060405)|regulation of synaptic transmission, GABAergic (GO:0032228)|regulation of synaptic transmission, glutamatergic (GO:0051966)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|sensory perception of pain (GO:0019233)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)|drug binding (GO:0008144)	p.V234M(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|prostate(1)|skin(10)|urinary_tract(1)	37		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.15)	Dronabinol(DB00470)|Nabilone(DB00486)|Rimonabant(DB06155)	AACGCCACCACGGCCTTGGGC	0.567																																					p.V234M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G700A	6						.						58.0	56.0	57.0					6																	88854294		2203	4300	6503	88911013	SO:0001583	missense	1268	exon2			AF107262	CCDS5015.1, CCDS5016.1, CCDS5016.2	6q14-q15	2012-08-08			ENSG00000118432	ENSG00000118432		"""GPCR / Class A : Cannabinoid receptors"""	2159	protein-coding gene	gene with protein product		114610		CNR			Standard	NM_016083		Approved	CB1K5, CB-R, CB1, CANN6, CB1A	uc003pmq.4	P21554	OTTHUMG00000015184	ENST00000537554.1:c.700G>A	6.37:g.88854294C>T	ENSP00000441046:p.Val234Met	Somatic		Capture	SOLID	Phase_I	88911013	NM_001160259	B2R9T4|E1P512|Q13949|Q495Z0|Q4PLI4|Q4VBM6|Q5JVL5|Q5UB37|Q9UNN0	Missense_Mutation	SNP	ENST00000537554.1	37	CCDS5015.1	.	.	.	.	.	.	.	.	.	.	C	14.64	2.595852	0.46318	.	.	ENSG00000118432	ENST00000369501;ENST00000535130;ENST00000537554;ENST00000369499;ENST00000549890;ENST00000468898;ENST00000428600;ENST00000549716	T;T;T;T;T;T;T;T	0.38887	1.11;1.11;1.11;1.11;1.11;1.11;1.11;1.11	5.9	5.9	0.94986	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.54175	0.1842	L	0.52573	1.65	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.67900	0.935;0.954	T	0.53683	-0.8404	10	0.72032	D	0.01	.	20.2861	0.98535	0.0:1.0:0.0:0.0	.	201;234	P21554-3;P21554	.;CNR1_HUMAN	M	234;234;234;234;234;201;234;173	ENSP00000358513:V234M;ENSP00000442689:V234M;ENSP00000441046:V234M;ENSP00000358511:V234M;ENSP00000446819:V234M;ENSP00000420188:V201M;ENSP00000412192:V234M;ENSP00000449549:V173M	ENSP00000358511:V234M	V	-	1	0	CNR1	88911013	1.000000	0.71417	0.966000	0.40874	0.056000	0.15407	7.818000	0.86416	2.800000	0.96347	0.655000	0.94253	GTG		CNR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354204.2		
SYNE1	23345	hgsc.bcm.edu	37	6	152639268	152639268	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr6:152639268A>C	ENST00000367255.5	-	86	17121	c.16520T>G	c.(16519-16521)cTt>cGt	p.L5507R	SYNE1_ENST00000423061.1_Missense_Mutation_p.L5436R|SYNE1_ENST00000356820.4_Missense_Mutation_p.L31R|SYNE1_ENST00000448038.1_Missense_Mutation_p.L5436R|SYNE1_ENST00000341594.5_Intron|SYNE1_ENST00000265368.4_Missense_Mutation_p.L5507R	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5507			L -> R (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.L5507R(3)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTGCTGGTGAAGTTCAGTCAG	0.453										HNSCC(10;0.0054)																											p.L31R												SYNE1,large_intestine,colon,Substitution - Missense,0	.	3	Substitution - Missense(3)	large_intestine(3)	c.T92G	6						.						266.0	234.0	245.0					6																	152639268		2203	4300	6503	152680961	SO:0001583	missense	23345	exon1			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.16520T>G	6.37:g.152639268A>C	ENSP00000356224:p.Leu5507Arg	Somatic		Capture	SOLID	Phase_I	152680961	NM_015293	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	A	18.71	3.683137	0.68157	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000356820	T;T;T;T;T	0.28895	1.59;1.59;1.59;1.59;1.59	5.66	5.66	0.87406	.	0.000000	0.56097	D	0.000039	T	0.37404	0.1002	M	0.68952	2.095	0.52099	D	0.999948	D;D;D;D	0.71674	0.998;0.997;0.997;0.998	D;D;D;D	0.71870	0.975;0.944;0.944;0.972	T	0.32693	-0.9897	10	0.08599	T	0.76	.	15.8861	0.79251	1.0:0.0:0.0:0.0	.	5507;5507;5507;5436	Q8NF91-7;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	R	5507;5436;5507;5436;31	ENSP00000356224:L5507R;ENSP00000396024:L5436R;ENSP00000265368:L5507R;ENSP00000390975:L5436R;ENSP00000349276:L31R	ENSP00000265368:L5507R	L	-	2	0	SYNE1	152680961	0.992000	0.36948	0.995000	0.50966	0.771000	0.43674	8.344000	0.90055	2.156000	0.67533	0.533000	0.62120	CTT		SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
MYOCD	93649	hgsc.bcm.edu	37	17	12608480	12608480	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr17:12608480G>T	ENST00000343344.4	+	2	91	c.91G>T	c.(91-93)Gaa>Taa	p.E31*	MYOCD_ENST00000425538.1_Nonsense_Mutation_p.E31*|AC005358.3_ENST00000445508.1_RNA			Q8IZQ8	MYCD_HUMAN	myocardin	31					cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.E31*(1)		breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		AAGGACCCAGGAACAACTGGC	0.388																																					p.E31X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G91T	17						.						131.0	104.0	113.0					17																	12608480		2203	4300	6503	12549205	SO:0001587	stop_gained	93649	exon2			AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.91G>T	17.37:g.12608480G>T	ENSP00000341835:p.Glu31*	Somatic		Capture	SOLID	Phase_I	12549205	NM_001146312	Q5UBU5|Q8N7Q1	Nonsense_Mutation	SNP	ENST00000343344.4	37	CCDS11163.1	.	.	.	.	.	.	.	.	.	.	G	34	5.402612	0.96030	.	.	ENSG00000141052	ENST00000425538;ENST00000343344	.	.	.	5.16	5.16	0.70880	.	0.055308	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	-33.8184	14.3489	0.66685	0.0:0.0:1.0:0.0	.	.	.	.	X	31	.	ENSP00000341835:E31X	E	+	1	0	MYOCD	12549205	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	5.784000	0.68990	2.840000	0.97914	0.655000	0.94253	GAA		MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129950.1	NM_153604	
SUPT6H	6830	hgsc.bcm.edu	37	17	27002497	27002497	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr17:27002497C>A	ENST00000314616.6	+	6	900	c.617C>A	c.(616-618)aCa>aAa	p.T206K	AC010761.13_ENST00000578819.1_RNA|SUPT6H_ENST00000347486.4_Missense_Mutation_p.T206K	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	206	Asp/Glu-rich.|Interaction with IWS1. {ECO:0000250}.|Interaction with PAAF1.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T206K(1)		NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					CCTGGATACACAGACGCGTGA	0.493																																					p.T206K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C617A	17						.						91.0	83.0	86.0					17																	27002497		2203	4300	6503	24026624	SO:0001583	missense	6830	exon6			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.617C>A	17.37:g.27002497C>A	ENSP00000319104:p.Thr206Lys	Somatic		Capture	SOLID	Phase_I	24026624	NM_003170	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	ENST00000314616.6	37	CCDS32596.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.135037	0.77662	.	.	ENSG00000109111	ENST00000314616;ENST00000347486	.	.	.	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.54581	0.1867	L	0.61387	1.9	0.80722	D	1	P	0.43024	0.798	B	0.37943	0.261	T	0.54193	-0.8330	9	0.10111	T	0.7	-9.4078	20.0953	0.97838	0.0:1.0:0.0:0.0	.	206	Q7KZ85	SPT6H_HUMAN	K	206	.	ENSP00000319104:T206K	T	+	2	0	SUPT6H	24026624	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.084000	0.76866	2.767000	0.95098	0.655000	0.94253	ACA		SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170	
TP53	7157	hgsc.bcm.edu	37	17	7577548	7577548	+	Missense_Mutation	SNP	C	C	T	rs28934575|rs397516437		TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr17:7577548C>T	ENST00000269305.4	-	7	922	c.733G>A	c.(733-735)Ggc>Agc	p.G245S	TP53_ENST00000445888.2_Missense_Mutation_p.G245S|TP53_ENST00000413465.2_Missense_Mutation_p.G245S|TP53_ENST00000455263.2_Missense_Mutation_p.G245S|TP53_ENST00000420246.2_Missense_Mutation_p.G245S|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.G245S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	245	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1978757}.|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2259385}.|G -> E (in a sporadic cancer; somatic mutation).|G -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|G -> L (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> R (in sporadic cancers; somatic mutation).|G -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934575). {ECO:0000269|PubMed:8829627}.|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2263646}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G245S(304)|p.G245C(59)|p.G245R(10)|p.G152S(8)|p.0?(8)|p.?(5)|p.G152C(4)|p.G244_M246>V(3)|p.G245N(2)|p.G245fs*2(2)|p.G245H(1)|p.G245L(1)|p.G244fs*17(1)|p.G245F(1)|p.C242_M246>L(1)|p.C238_M246delCNSSCMGGM(1)|p.G245fs*22(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.M243fs*18(1)|p.G151_M153>V(1)|p.G245del(1)|p.G245fs*14(1)|p.G245fs*17(1)|p.G245fs*16(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGGTTCATGCCGCCCATGCAG	0.577	G245S(LS1034_LARGE_INTESTINE)|G245S(NUGC2_STOMACH)|G245S(PANC0403_PANCREAS)|G245S(SKLMS1_SOFT_TISSUE)|G245S(SKMEL2_SKIN)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.G245S	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,central_nervous_system,brain,Substitution - Missense,0	.	420	Substitution - Missense(390)|Deletion - Frameshift(8)|Whole gene deletion(8)|Complex - deletion inframe(5)|Unknown(5)|Deletion - In frame(3)|Insertion - Frameshift(1)	large_intestine(119)|lung(51)|breast(38)|ovary(29)|central_nervous_system(27)|upper_aerodigestive_tract(25)|stomach(25)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(22)|urinary_tract(14)|skin(9)|liver(7)|prostate(7)|biliary_tract(5)|bone(5)|pancreas(4)|soft_tissue(3)|vulva(2)|endometrium(2)|kidney(1)|cervix(1)|salivary_gland(1)	c.G733A	17	GRCh37	CM010463|CM900210|CM920674	TP53	M	rs28934575	.	C	SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY	0,4406		0,0,2203	149.0	112.0	125.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	733,733,733,733,337,337,337	4.6	1.0	17	dbSNP_125	125	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	56,56,56,56,56,56,56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	245/394,245/394,245/347,245/342,113/262,113/210,113/215	7577548	1,13005	2203	4300	6503	7518273	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.733G>A	17.37:g.7577548C>T	ENSP00000269305:p.Gly245Ser	Somatic		Capture	SOLID	Phase_I	7518273	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	33	5.259904	0.95368	0.0	1.16E-4	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99894	-7.58;-7.58;-7.58;-7.58;-7.58;-7.58;-7.58;-7.58	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99878	0.9942	M	0.84585	2.705	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.976;0.992;0.999;0.999;1.0	D	0.96039	0.9023	10	0.87932	D	0	-19.4293	15.3618	0.74483	0.0:1.0:0.0:0.0	rs28934575	245;245;152;245;245;245	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	S	245;245;245;245;245;245;234;152;113;152	ENSP00000410739:G245S;ENSP00000352610:G245S;ENSP00000269305:G245S;ENSP00000398846:G245S;ENSP00000391127:G245S;ENSP00000391478:G245S;ENSP00000425104:G113S;ENSP00000423862:G152S	ENSP00000269305:G245S	G	-	1	0	TP53	7518273	1.000000	0.71417	0.965000	0.40720	0.974000	0.67602	7.609000	0.82925	2.564000	0.86499	0.462000	0.41574	GGC		TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
CA10	56934	hgsc.bcm.edu	37	17	49711002	49711002	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr17:49711002A>C	ENST00000285273.4	-	9	1910	c.799T>G	c.(799-801)Ttg>Gtg	p.L267V	CA10_ENST00000340813.6_Missense_Mutation_p.L273V|CA10_ENST00000442502.2_Missense_Mutation_p.L267V|CA10_ENST00000451037.2_Missense_Mutation_p.L267V|CA10_ENST00000571918.1_5'Flank|CA10_ENST00000570565.1_Missense_Mutation_p.L192V	NM_001082533.1	NP_001076002.1	Q9NS85	CAH10_HUMAN	carbonic anhydrase X	267					brain development (GO:0007420)			p.L267V(1)		cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|skin(3)|stomach(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)		Zonisamide(DB00909)	AGCAGGCGCAAGGAATGCATC	0.522																																					p.L267V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T799G	17						.						83.0	72.0	76.0					17																	49711002		2203	4300	6503	47066001	SO:0001583	missense	56934	exon8			AF288385	CCDS32684.1	17q21	2012-08-21			ENSG00000154975	ENSG00000154975		"""Carbonic anhydrases"""	1369	protein-coding gene	gene with protein product		604642				8673298, 9921901	Standard	NM_020178		Approved	CARPX, CA-RPX, HUCEP-15	uc002itx.4	Q9NS85	OTTHUMG00000177544	ENST00000285273.4:c.799T>G	17.37:g.49711002A>C	ENSP00000285273:p.Leu267Val	Somatic		Capture	SOLID	Phase_I	47066001	NM_020178	B2R7J0|B4DGL6	Missense_Mutation	SNP	ENST00000285273.4	37	CCDS32684.1	.	.	.	.	.	.	.	.	.	.	A	15.31	2.795766	0.50208	.	.	ENSG00000154975	ENST00000442502;ENST00000285273;ENST00000451037;ENST00000340813	T;T;T;T	0.75821	-0.97;-0.97;-0.97;-0.97	5.44	3.24	0.37175	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.075450	0.53938	D	0.000045	D	0.85522	0.5716	M	0.93375	3.41	0.45477	D	0.998443	P;P;P	0.51653	0.875;0.947;0.934	P;P;P	0.58210	0.737;0.822;0.835	D	0.85921	0.1446	10	0.66056	D	0.02	.	8.0823	0.30752	0.8331:0.0:0.1669:0.0	.	267;273;192	Q9NS85;Q68D28;B4DGL6	CAH10_HUMAN;.;.	V	267;267;267;273	ENSP00000390666:L267V;ENSP00000285273:L267V;ENSP00000405388:L267V;ENSP00000340363:L273V	ENSP00000285273:L267V	L	-	1	2	CA10	47066001	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.338000	0.43957	0.920000	0.36970	0.533000	0.62120	TTG		CA10-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000437480.1	NM_020178	
RBFOX1	54715	hgsc.bcm.edu	37	16	7629853	7629853	+	Silent	SNP	G	G	A			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr16:7629853G>A	ENST00000550418.1	+	6	1333	c.345G>A	c.(343-345)caG>caA	p.Q115Q	RBFOX1_ENST00000311745.5_Silent_p.Q135Q|RBFOX1_ENST00000535565.2_Intron|RBFOX1_ENST00000355637.4_Silent_p.Q135Q|RBFOX1_ENST00000547338.1_Silent_p.Q115Q|RBFOX1_ENST00000340209.4_Silent_p.Q120Q|RBFOX1_ENST00000436368.2_Silent_p.Q135Q|RBFOX1_ENST00000552089.1_Silent_p.Q150Q|RBFOX1_ENST00000553186.1_Silent_p.Q115Q|RBFOX1_ENST00000547372.1_Silent_p.Q158Q|RBFOX1_ENST00000422070.4_Silent_p.Q158Q	NM_018723.3	NP_061193.2	Q9NWB1	RFOX1_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 1	115					mRNA processing (GO:0006397)|neuromuscular process controlling balance (GO:0050885)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	nucleotide binding (GO:0000166)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)	p.Q135Q(2)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|lung(17)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)	55						ACAAGTCTCAGCCCAAGCGGC	0.517																																					p.Q135Q	Ovarian(157;934 2567 15163 39509)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G405A	16						.						140.0	127.0	131.0					16																	7629853		2197	4300	6497	7569854	SO:0001819	synonymous_variant	54715	exon3			AF107203	CCDS10531.1, CCDS10532.1, CCDS45405.1, CCDS55983.1, CCDS55984.1	16p13.3	2013-02-12			ENSG00000078328	ENSG00000078328		"""RNA binding motif (RRM) containing"""	18222	protein-coding gene	gene with protein product	"""ataxin 2-binding protein 1"", ""hexaribonucleotide binding protein 1"""	605104				10814712, 16260614	Standard	NM_018723		Approved	A2BP1, FOX-1, HRNBP1	uc002cyy.2	Q9NWB1	OTTHUMG00000129551	ENST00000550418.1:c.345G>A	16.37:g.7629853G>A		Somatic		Capture	SOLID	Phase_I	7569854	NM_145893	Q7Z7I7|Q8TAE3|Q8TAF2|Q8WYB2|Q9NS20	Silent	SNP	ENST00000550418.1	37	CCDS55983.1																																																																																				RBFOX1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409492.2	NM_145891	
SRCAP	10847	hgsc.bcm.edu	37	16	30748693	30748693	+	Silent	SNP	A	A	G			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr16:30748693A>G	ENST00000262518.4	+	34	7717	c.7332A>G	c.(7330-7332)cgA>cgG	p.R2444R	SRCAP_ENST00000395059.2_Silent_p.R2382R|SRCAP_ENST00000344771.4_Silent_p.R2286R	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	2444	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)	p.R2444R(1)		NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			ctaggcctcgacccactccag	0.592																																					p.R2444R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A7332G	16						.						111.0	85.0	94.0					16																	30748693		2197	4300	6497	30656194	SO:0001819	synonymous_variant	10847	exon34			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.7332A>G	16.37:g.30748693A>G		Somatic		Capture	SOLID	Phase_I	30656194	NM_006662	B0JZA6|O15026|Q7Z744|Q9Y5L9	Silent	SNP	ENST00000262518.4	37	CCDS10689.2																																																																																				SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
LAMA1	284217	hgsc.bcm.edu	37	18	6976065	6976065	+	Silent	SNP	C	C	T			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr18:6976065C>T	ENST00000389658.3	-	45	6453	c.6360G>A	c.(6358-6360)gtG>gtA	p.V2120V		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	2120	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.V2120V(1)		NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				TGTCTGCAGACACGGCGACTT	0.453																																					p.V2120V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G6360A	18						.						120.0	119.0	119.0					18																	6976065		2203	4300	6503	6966065	SO:0001819	synonymous_variant	284217	exon45			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.6360G>A	18.37:g.6976065C>T		Somatic		Capture	SOLID	Phase_I	6966065	NM_005559		Silent	SNP	ENST00000389658.3	37	CCDS32787.1																																																																																				LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
MAP3K13	9175	hgsc.bcm.edu	37	3	185146510	185146510	+	Silent	SNP	G	G	A			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr3:185146510G>A	ENST00000265026.3	+	2	475	c.141G>A	c.(139-141)caG>caA	p.Q47Q	MAP3K13_ENST00000446828.1_Intron|MAP3K13_ENST00000443863.1_Intron|MAP3K13_ENST00000424227.1_Silent_p.Q47Q|MAP3K13_ENST00000535426.1_Intron	NM_004721.4	NP_004712.1			mitogen-activated protein kinase kinase kinase 13									p.Q47Q(2)|p.E44_L56delEDQQEKGMVRTEL(1)		NS(1)|biliary_tract(1)|breast(3)|endometrium(3)|kidney(1)|large_intestine(13)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54	all_cancers(143;7.21e-11)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)			AGGACCAGCAGGAAAAGGGGA	0.527																																					p.Q47Q												.	.	3	Substitution - coding silent(2)|Deletion - In frame(1)	large_intestine(2)|breast(1)	c.G141A	3						.						84.0	71.0	76.0					3																	185146510		2203	4300	6503	186629204	SO:0001819	synonymous_variant	9175	exon2			BC031677	CCDS3270.1, CCDS56298.1	3q27	2011-06-09			ENSG00000073803	ENSG00000073803		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6852	protein-coding gene	gene with protein product	"""leucine zipper-bearing kinase"""	604915				9353328	Standard	NM_004721		Approved	LZK, MEKK13	uc003fpi.3	O43283	OTTHUMG00000156673	ENST00000265026.3:c.141G>A	3.37:g.185146510G>A		Somatic		Capture	SOLID	Phase_I	186629204	NM_004721		Silent	SNP	ENST00000265026.3	37	CCDS3270.1																																																																																				MAP3K13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345268.1	NM_004721	
CHL1	10752	hgsc.bcm.edu	37	3	424214	424214	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr3:424214C>G	ENST00000256509.2	+	18	2678	c.2036C>G	c.(2035-2037)aCc>aGc	p.T679S	CHL1_ENST00000397491.2_Missense_Mutation_p.T663S|CHL1-AS1_ENST00000417612.1_RNA	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.T679S(1)		NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		GAGGAACTGACCAGAGTCCAA	0.413																																					p.T679S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2036G	3						.						98.0	113.0	108.0					3																	424214		2203	4300	6503	399214	SO:0001583	missense	10752	exon18			AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.2036C>G	3.37:g.424214C>G	ENSP00000256509:p.Thr679Ser	Somatic		Capture	SOLID	Phase_I	399214	NM_006614	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000256509.2	37	CCDS2556.1	.	.	.	.	.	.	.	.	.	.	C	8.005	0.756182	0.15846	.	.	ENSG00000134121	ENST00000256509;ENST00000397491	T;T	0.57273	0.41;0.41	4.86	3.0	0.34707	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.567157	0.19880	N	0.103997	T	0.31358	0.0794	N	0.20807	0.61	0.09310	N	1	B;B;B	0.12013	0.005;0.0;0.002	B;B;B	0.24006	0.05;0.007;0.009	T	0.20538	-1.0272	10	0.08381	T	0.77	.	7.5534	0.27810	0.0:0.5929:0.2704:0.1366	.	663;663;679	B3KX75;O00533;O00533-2	.;CHL1_HUMAN;.	S	679;663	ENSP00000256509:T679S;ENSP00000380628:T663S	ENSP00000256509:T679S	T	+	2	0	CHL1	399214	0.000000	0.05858	0.038000	0.18304	0.751000	0.42716	0.368000	0.20399	1.130000	0.42092	0.591000	0.81541	ACC		CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207155.2	NM_006614	
ZNF35	7584	hgsc.bcm.edu	37	3	44701037	44701037	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr3:44701037G>C	ENST00000396056.2	+	4	1417	c.1182G>C	c.(1180-1182)gaG>gaC	p.E394D	RP11-944L7.4_ENST00000457331.1_RNA|ZNF35_ENST00000542250.1_Missense_Mutation_p.E234D|ZNF35_ENST00000296092.3_3'UTR	NM_003420.3	NP_003411.3	P13682	ZNF35_HUMAN	zinc finger protein 35	394					cellular response to retinoic acid (GO:0071300)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cell (GO:0005623)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E394D(1)		large_intestine(3)|liver(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	12		Ovarian(412;0.0228)		OV - Ovarian serous cystadenocarcinoma(275;2.49e-27)|KIRC - Kidney renal clear cell carcinoma(197;0.0475)|Kidney(197;0.0595)		AGTGTAAAGAGTGTGGGAAAG	0.453																																					p.E394D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1182C	3						.						95.0	103.0	100.0					3																	44701037		2203	4300	6503	44676041	SO:0001583	missense	7584	exon4			X07289	CCDS2718.2	3p21.32	2013-01-08	2006-05-11		ENSG00000169981	ENSG00000169981		"""Zinc fingers, C2H2-type"""	13099	protein-coding gene	gene with protein product		194533	"""zinc finger protein 35 (clone HF.10)"""			2108922, 1572646	Standard	NM_003420		Approved	HF.10, HF10, Zfp105	uc003cnq.3	P13682	OTTHUMG00000133091	ENST00000396056.2:c.1182G>C	3.37:g.44701037G>C	ENSP00000379368:p.Glu394Asp	Somatic		Capture	SOLID	Phase_I	44676041	NM_003420	B2RBU6|Q53Y54|Q96D01	Missense_Mutation	SNP	ENST00000396056.2	37	CCDS2718.2	.	.	.	.	.	.	.	.	.	.	G	15.58	2.875579	0.51695	.	.	ENSG00000169981	ENST00000396056;ENST00000542250	T;T	0.07567	3.18;3.18	5.29	2.3	0.28687	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.144445	0.32218	N	0.006410	T	0.05181	0.0138	N	0.16790	0.44	0.24866	N	0.992317	B	0.10296	0.003	B	0.17098	0.017	T	0.35699	-0.9778	10	0.35671	T	0.21	-22.656	8.5783	0.33612	0.1631:0.1332:0.7037:0.0	.	394	P13682	ZNF35_HUMAN	D	394;234	ENSP00000379368:E394D;ENSP00000443714:E234D	ENSP00000379368:E394D	E	+	3	2	ZNF35	44676041	0.000000	0.05858	1.000000	0.80357	0.998000	0.95712	-2.480000	0.00983	0.789000	0.33779	0.561000	0.74099	GAG		ZNF35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256749.4	NM_003420	
HRG	3273	hgsc.bcm.edu	37	3	186389446	186389446	+	Silent	SNP	G	G	A	rs137953854	byFrequency	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr3:186389446G>A	ENST00000232003.4	+	4	506	c.426G>A	c.(424-426)ccG>ccA	p.P142P		NM_000412.2	NP_000403.1	P04196	HRG_HUMAN	histidine-rich glycoprotein	142	Cystatin 2.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|chemotaxis (GO:0006935)|defense response to fungus (GO:0050832)|fibrinolysis (GO:0042730)|heme export (GO:0097037)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood vessel remodeling (GO:2000504)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of immune response to tumor cell (GO:0002839)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of platelet activation (GO:0010543)|regulation of protein complex assembly (GO:0043254)|regulation of transcription from RNA polymerase II promoter in response to iron (GO:0034395)|response to organic cyclic compound (GO:0014070)	blood microparticle (GO:0072562)|endolysosome (GO:0036019)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|phagolysosome membrane (GO:0061474)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|heme binding (GO:0020037)|heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)|immunoglobulin binding (GO:0019865)|metal ion binding (GO:0046872)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|zinc ion binding (GO:0008270)	p.P142P(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(12)|lung(13)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0683)		AAGATAGTCCGGTCCTCATAG	0.448																																					p.P142P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G426A	3						.	G		0,4406		0,0,2203	91.0	91.0	91.0		426	-10.4	0.0	3	dbSNP_134	91	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	HRG	NM_000412.2		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		142/526	186389446	2,13004	2203	4300	6503	187872140	SO:0001819	synonymous_variant	3273	exon4				CCDS3280.1	3q27	2008-07-18			ENSG00000113905	ENSG00000113905			5181	protein-coding gene	gene with protein product	"""histidine-proline rich glycoprotein"", ""thrombophilia due to elevated HRG"""	142640				1678514	Standard	NM_000412		Approved	HRGP, HPRG	uc003fqq.3	P04196	OTTHUMG00000156578	ENST00000232003.4:c.426G>A	3.37:g.186389446G>A		Somatic		Capture	SOLID	Phase_I	187872140	NM_000412	B9EK35|D3DNU7	Silent	SNP	ENST00000232003.4	37	CCDS3280.1																																																																																				HRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344655.1	NM_000412	
SLC12A6	9990	hgsc.bcm.edu	37	15	34536252	34536252	+	Silent	SNP	G	G	A			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr15:34536252G>A	ENST00000354181.3	-	16	2457	c.1965C>T	c.(1963-1965)ctC>ctT	p.L655L	SLC12A6_ENST00000558667.1_Silent_p.L655L|SLC12A6_ENST00000451844.2_Silent_p.L467L|SLC12A6_ENST00000558589.1_Silent_p.L646L|SLC12A6_ENST00000397702.2_Silent_p.L596L|SLC12A6_ENST00000458406.2_Silent_p.L596L|SLC12A6_ENST00000560611.1_Silent_p.L655L|SLC12A6_ENST00000290209.5_Silent_p.L604L|SLC12A6_ENST00000560164.1_Silent_p.L467L|SLC12A6_ENST00000397707.2_Silent_p.L640L			Q9UHW9	S12A6_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 6	655					angiogenesis (GO:0001525)|cellular hypotonic response (GO:0071476)|cellular hypotonic salinity response (GO:0071477)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|rubidium ion transport (GO:0035826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium ion transmembrane transporter activity (GO:0015079)|potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)|rubidium ion transmembrane transporter activity (GO:0035827)	p.L604L(1)		central_nervous_system(5)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|skin(3)	45		all_lung(180;2.78e-08)		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	Potassium Chloride(DB00761)	AGTTTACAAAGAGGTAACACA	0.383																																					p.L640L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1920T	15						.						120.0	115.0	116.0					15																	34536252		2201	4298	6499	32323544	SO:0001819	synonymous_variant	9990	exon14			AF108831	CCDS10036.1, CCDS42010.1, CCDS42011.1, CCDS42012.1, CCDS58352.1	15q13	2014-09-17	2013-07-18		ENSG00000140199	ENSG00000140199		"""Solute carriers"""	10914	protein-coding gene	gene with protein product		604878	"""agenesis of corpus callosum and peripheral neuropathy (Andermann syndrome)"""	KCC3, ACCPN		10187864, 10347194	Standard	NM_133647		Approved		uc001zhw.3	Q9UHW9	OTTHUMG00000129441	ENST00000354181.3:c.1965C>T	15.37:g.34536252G>A		Somatic		Capture	SOLID	Phase_I	32323544	NM_001042497	A0AV76|Q2VI00|Q7Z2E7|Q7Z4G5|Q8TDD4|Q9UFR2|Q9Y642|Q9Y665	Silent	SNP	ENST00000354181.3	37	CCDS58352.1																																																																																				SLC12A6-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000417991.1	NM_005135	
FBN1	2200	hgsc.bcm.edu	37	15	48703393	48703393	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr15:48703393A>G	ENST00000316623.5	-	66	8865	c.8410T>C	c.(8410-8412)Ttt>Ctt	p.F2804L	FBN1_ENST00000561429.1_5'Flank	NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	2804					extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.F2804L(1)		NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		TTGATTTTAAAGAAGCCATCT	0.413																																					p.F2804L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T8410C	15						.						149.0	144.0	145.0					15																	48703393		2198	4297	6495	46490685	SO:0001583	missense	2200	exon66			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.8410T>C	15.37:g.48703393A>G	ENSP00000325527:p.Phe2804Leu	Somatic		Capture	SOLID	Phase_I	46490685	NM_000138	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	ENST00000316623.5	37	CCDS32232.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.298512	0.81025	.	.	ENSG00000166147	ENST00000316623	D	0.85702	-2.02	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	D	0.91369	0.7277	M	0.78456	2.415	0.80722	D	1	P	0.52842	0.956	D	0.65010	0.931	D	0.91630	0.5318	10	0.49607	T	0.09	.	14.8921	0.70617	1.0:0.0:0.0:0.0	.	2804	P35555	FBN1_HUMAN	L	2804	ENSP00000325527:F2804L	ENSP00000325527:F2804L	F	-	1	0	FBN1	46490685	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.057000	0.93889	2.247000	0.74100	0.528000	0.53228	TTT		FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1		
CYP19A1	1588	hgsc.bcm.edu	37	15	51535087	51535087	+	Missense_Mutation	SNP	G	G	A	rs144803182		TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr15:51535087G>A	ENST00000396402.1	-	2	176	c.23C>T	c.(22-24)cCg>cTg	p.P8L	CYP19A1_ENST00000260433.2_Missense_Mutation_p.P8L|CYP19A1_ENST00000559878.1_Missense_Mutation_p.P8L|RP11-108K3.1_ENST00000559909.1_lincRNA|CYP19A1_ENST00000557858.1_Missense_Mutation_p.P8L|CYP19A1_ENST00000396404.4_Missense_Mutation_p.P8L|CYP19A1_ENST00000405913.3_Missense_Mutation_p.P8L|MIR4713_ENST00000582691.1_RNA	NM_000103.3	NP_000094.2	P11511	CP19A_HUMAN	cytochrome P450, family 19, subfamily A, polypeptide 1	8					androgen metabolic process (GO:0008209)|estrogen biosynthetic process (GO:0006703)|prostate gland growth (GO:0060736)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)	aromatase activity (GO:0070330)|electron carrier activity (GO:0009055)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)	p.P8L(2)		endometrium(1)|kidney(4)|large_intestine(9)|lung(11)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	33				all cancers(107;0.000372)|GBM - Glioblastoma multiforme(94;0.0128)	Aminoglutethimide(DB00357)|Anastrozole(DB01217)|Betamethasone(DB00443)|Bifonazole(DB04794)|Buserelin(DB06719)|Carbimazole(DB00389)|Chlorphenesin(DB00856)|Clomifene(DB00882)|Clotrimazole(DB00257)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Dexamethasone(DB01234)|Diethylstilbestrol(DB00255)|Dinoprostone(DB00917)|Drostanolone(DB00858)|Econazole(DB01127)|Edetic Acid(DB00974)|Etomidate(DB00292)|Exemestane(DB00990)|Ketoconazole(DB01026)|Letrozole(DB01006)|Levomethadyl Acetate(DB01227)|Levonorgestrel(DB00367)|Mefloquine(DB00358)|Melatonin(DB01065)|Methadone(DB00333)|Methyltestosterone(DB06710)|Miconazole(DB01110)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nicotine(DB00184)|Paclitaxel(DB01229)|Raloxifene(DB00481)|Sulfathiazole(DB06147)|Tamoxifen(DB00675)|Terbinafine(DB00857)|Testolactone(DB00894)|Testosterone(DB00624)|Tioconazole(DB01007)|Trastuzumab(DB00072)	ATAATGTATCGGGTTCAGCAT	0.473																																					p.P8L	Melanoma(142;1016 1807 39614 48966 51721)											.	.	2	Substitution - Missense(2)	large_intestine(1)|skin(1)	c.C23T	15						.						237.0	208.0	218.0					15																	51535087		2196	4293	6489	49322379	SO:0001583	missense	1588	exon3			D14473	CCDS10139.1	15q21	2009-01-26	2003-02-14	2003-02-28	ENSG00000137869	ENSG00000137869		"""Cytochrome P450s"""	2594	protein-coding gene	gene with protein product		107910	"""cytochrome P450, subfamily XIX (aromatization of androgens)"""	CYP19		8477708	Standard	NM_031226		Approved	ARO, P-450AROM, CPV1, ARO1, CYAR, aromatase	uc001zza.4	P11511	OTTHUMG00000131747	ENST00000396402.1:c.23C>T	15.37:g.51535087G>A	ENSP00000379683:p.Pro8Leu	Somatic		Capture	SOLID	Phase_I	49322379	NM_031226	Q16731|Q3B764|Q58FA0|Q8IYJ7	Missense_Mutation	SNP	ENST00000396402.1	37	CCDS10139.1	.	.	.	.	.	.	.	.	.	.	G	15.63	2.890464	0.52014	.	.	ENSG00000137869	ENST00000396402;ENST00000260433;ENST00000541721;ENST00000396404;ENST00000420301;ENST00000439712;ENST00000405913;ENST00000453807;ENST00000405011	T;T;T;T;T;T;T	0.79247	-0.54;-0.54;-0.54;1.86;-0.71;-0.67;-1.25	5.01	4.1	0.47936	.	0.338053	0.31589	N	0.007400	T	0.70500	0.3231	L	0.51914	1.62	0.58432	D	0.99999	B;B	0.30114	0.269;0.027	B;B	0.20184	0.028;0.012	T	0.70710	-0.4797	10	0.52906	T	0.07	-1.6078	13.4881	0.61377	0.0753:0.0:0.9247:0.0	.	8;8	Q8IYJ7;P11511	.;CP19A_HUMAN	L	8	ENSP00000379683:P8L;ENSP00000260433:P8L;ENSP00000379685:P8L;ENSP00000390614:P8L;ENSP00000383930:P8L;ENSP00000391139:P8L;ENSP00000384389:P8L	ENSP00000260433:P8L	P	-	2	0	CYP19A1	49322379	0.989000	0.36119	0.823000	0.32752	0.903000	0.53119	1.977000	0.40589	1.334000	0.45468	0.563000	0.77884	CCG		CYP19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254669.1		
IDH3A	3419	hgsc.bcm.edu	37	15	78454583	78454583	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr15:78454583A>C	ENST00000299518.2	+	6	568	c.485A>C	c.(484-486)gAt>gCt	p.D162A	IDH3A_ENST00000559205.1_Intron|IDH3A_ENST00000558535.1_3'UTR|IDH3A_ENST00000558554.1_Missense_Mutation_p.D127A|IDH3A_ENST00000441490.2_Missense_Mutation_p.D53A|IDH3A_ENST00000561366.1_5'Flank	NM_005530.2	NP_005521.1	P50213	IDH3A_HUMAN	isocitrate dehydrogenase 3 (NAD+) alpha	162					carbohydrate metabolic process (GO:0005975)|cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	isocitrate dehydrogenase (NAD+) activity (GO:0004449)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)	p.D162A(1)		endometrium(1)|large_intestine(5)|lung(5)|stomach(1)	12						CAGATTGTTGATGGAGTCGTG	0.542																																					p.D162A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A485C	15						.						128.0	100.0	110.0					15																	78454583		2196	4293	6489	76241638	SO:0001583	missense	3419	exon6				CCDS10297.1	15q25.1-q25.2	2008-07-18			ENSG00000166411	ENSG00000166411	1.1.1.41		5384	protein-coding gene	gene with protein product	"""H-IDH alpha"", ""isocitric dehydrogenase"", ""isocitrate dehydrogenase [NAD] subunit alpha, mitochondrial"", ""NAD+-specific ICDH"", ""NAD(H)-specific isocitrate dehydrogenase alpha subunit"", ""isocitrate dehydrogenase (NAD+) alpha chain"""	601149				8833160	Standard	NM_005530		Approved		uc002bdd.3	P50213	OTTHUMG00000143732	ENST00000299518.2:c.485A>C	15.37:g.78454583A>C	ENSP00000299518:p.Asp162Ala	Somatic		Capture	SOLID	Phase_I	76241638	NM_005530	D3DW83|Q9H3X0	Missense_Mutation	SNP	ENST00000299518.2	37	CCDS10297.1	.	.	.	.	.	.	.	.	.	.	A	15.31	2.796060	0.50208	.	.	ENSG00000166411	ENST00000299518;ENST00000441490	T;T	0.55930	0.49;0.49	5.78	5.78	0.91487	Isopropylmalate dehydrogenase-like domain (2);	0.090091	0.85682	D	0.000000	T	0.56746	0.2006	L	0.51853	1.615	0.80722	D	1	B;B;B	0.27166	0.17;0.009;0.075	B;B;B	0.39339	0.297;0.142;0.217	T	0.57740	-0.7759	10	0.56958	D	0.05	-27.3351	15.2907	0.73865	1.0:0.0:0.0:0.0	.	127;112;162	B4DSY4;B4DJB4;P50213	.;.;IDH3A_HUMAN	A	162;53	ENSP00000299518:D162A;ENSP00000387506:D53A	ENSP00000299518:D162A	D	+	2	0	IDH3A	76241638	1.000000	0.71417	0.993000	0.49108	0.224000	0.24922	9.063000	0.93927	2.210000	0.71456	0.482000	0.46254	GAT		IDH3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289799.4	NM_005530	
CHD2	1106	hgsc.bcm.edu	37	15	93498668	93498668	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr15:93498668T>C	ENST00000394196.4	+	15	2803	c.1735T>C	c.(1735-1737)Tgg>Cgg	p.W579R	CHD2_ENST00000557381.1_Missense_Mutation_p.W579R	NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	579	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)	p.W579R(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			GGAATATGAATGGATTCATTC	0.289																																					p.W579R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1735C	15						.						52.0	48.0	49.0					15																	93498668		2195	4297	6492	91299672	SO:0001583	missense	1106	exon15			AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.1735T>C	15.37:g.93498668T>C	ENSP00000377747:p.Trp579Arg	Somatic		Capture	SOLID	Phase_I	91299672	NM_001271	C6G482|Q96IP5	Missense_Mutation	SNP	ENST00000394196.4	37	CCDS10374.2	.	.	.	.	.	.	.	.	.	.	T	16.99	3.272771	0.59649	.	.	ENSG00000173575	ENST00000394196;ENST00000557381	D;D	0.92099	-2.97;-2.97	5.38	5.38	0.77491	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.32736	U	0.005704	D	0.93393	0.7893	L	0.38733	1.17	0.80722	D	1	B;D	0.62365	0.015;0.991	B;D	0.65684	0.021;0.937	D	0.94329	0.7560	10	0.87932	D	0	-9.935	15.3851	0.74691	0.0:0.0:0.0:1.0	.	579;579	O14647;O14647-2	CHD2_HUMAN;.	R	579	ENSP00000377747:W579R;ENSP00000451366:W579R	ENSP00000377747:W579R	W	+	1	0	CHD2	91299672	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.033000	0.88852	2.019000	0.59389	0.528000	0.53228	TGG		CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313528.3	NM_001271	
ZNF518B	85460	hgsc.bcm.edu	37	4	10446851	10446851	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr4:10446851C>T	ENST00000326756.3	-	3	1540	c.1102G>A	c.(1102-1104)Gaa>Aaa	p.E368K		NM_053042.2	NP_444270.2	Q9C0D4	Z518B_HUMAN	zinc finger protein 518B	368					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.E368K(1)		breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	42						CAATTATTTTCTTCCAGCGGA	0.418																																					p.E368K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1102A	4						.						143.0	147.0	145.0					4																	10446851		2203	4300	6503	10055949	SO:0001583	missense	85460	exon3			AB051516	CCDS33960.1	4p16.1	2007-12-07				ENSG00000178163		"""Zinc fingers, C2H2-type"""	29365	protein-coding gene	gene with protein product						11214970	Standard	XM_005248193		Approved	KIAA1729	uc003gmn.3	Q9C0D4		ENST00000326756.3:c.1102G>A	4.37:g.10446851C>T	ENSP00000317614:p.Glu368Lys	Somatic		Capture	SOLID	Phase_I	10055949	NM_053042	Q96LN8	Missense_Mutation	SNP	ENST00000326756.3	37	CCDS33960.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.171947	0.78452	.	.	ENSG00000178163	ENST00000326756	T	0.01998	4.51	6.17	6.17	0.99709	.	0.082701	0.49916	D	0.000124	T	0.11879	0.0289	M	0.64997	1.995	0.34629	D	0.719435	D	0.89917	1.0	D	0.79108	0.992	T	0.01245	-1.1407	10	0.38643	T	0.18	-30.3938	19.8676	0.96824	0.0:1.0:0.0:0.0	.	368	Q9C0D4	Z518B_HUMAN	K	368	ENSP00000317614:E368K	ENSP00000317614:E368K	E	-	1	0	ZNF518B	10055949	1.000000	0.71417	0.995000	0.50966	0.702000	0.40608	2.759000	0.47573	2.941000	0.99782	0.655000	0.94253	GAA		ZNF518B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359040.1	NM_053042	
ADAD1	132612	hgsc.bcm.edu	37	4	123301395	123301395	+	Splice_Site	SNP	G	G	A	rs373906340		TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr4:123301395G>A	ENST00000296513.2	+	3	356	c.171G>A	c.(169-171)acG>acA	p.T57T	ADAD1_ENST00000388724.2_Splice_Site_p.T57T|ADAD1_ENST00000388725.2_Splice_Site_p.T39T	NM_139243.3	NP_640336.1	Q96M93	ADAD1_HUMAN	adenosine deaminase domain containing 1 (testis-specific)	57					multicellular organismal development (GO:0007275)|RNA processing (GO:0006396)|spermatid development (GO:0007286)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)	p.T57T(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	35						CGCAAGTAACGGGTACGACTT	0.448																																					p.T57T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G171A	4						.						102.0	88.0	93.0					4																	123301395		2203	4300	6503	123520845	SO:0001630	splice_region_variant	132612	exon3			AK057303	CCDS34058.1, CCDS54800.1, CCDS54801.1	4q27	2007-05-31			ENSG00000164113	ENSG00000164113			30713	protein-coding gene	gene with protein product		614130				7543294, 9541871	Standard	NM_139243		Approved	Tenr	uc003iep.3	Q96M93	OTTHUMG00000150128	ENST00000296513.2:c.172+1G>A	4.37:g.123301395G>A		Somatic		Capture	SOLID	Phase_I	123520845	NM_139243	A6NKN4|B7WPB0|D3DNX2|Q8IWG6|Q8NA06	Silent	SNP	ENST00000296513.2	37	CCDS34058.1																																																																																				ADAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316452.1	NM_139243	Silent
ANAPC4	29945	hgsc.bcm.edu	37	4	25379130	25379130	+	Silent	SNP	C	C	T			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr4:25379130C>T	ENST00000315368.3	+	2	223	c.81C>T	c.(79-81)gtC>gtT	p.V27V	ANAPC4_ENST00000510092.1_Silent_p.V27V	NM_013367.2	NP_037499.2	Q9UJX5	APC4_HUMAN	anaphase promoting complex subunit 4	27					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)|ubiquitin-protein transferase activity (GO:0004842)	p.V27V(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)	27		Breast(46;0.0503)				TTTTCCTGGTCTGGTCGCCCA	0.642																																					p.V27V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C81T	4						.						36.0	36.0	36.0					4																	25379130		2203	4300	6503	24988228	SO:0001819	synonymous_variant	29945	exon2			AF191338	CCDS3434.1, CCDS68684.1	4p15.31	2011-06-15			ENSG00000053900	ENSG00000053900		"""Anaphase promoting complex subunits"""	19990	protein-coding gene	gene with protein product		606947				6180011	Standard	NM_013367		Approved	APC4	uc003gro.3	Q9UJX5	OTTHUMG00000097753	ENST00000315368.3:c.81C>T	4.37:g.25379130C>T		Somatic		Capture	SOLID	Phase_I	24988228	NM_013367	A8K8H1|E9PCR4|Q6PCC6|Q9NSH6	Silent	SNP	ENST00000315368.3	37	CCDS3434.1																																																																																				ANAPC4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214986.1	NM_013367	
KDR	3791	hgsc.bcm.edu	37	4	55968137	55968137	+	Silent	SNP	G	G	A	rs138304068	byFrequency	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr4:55968137G>A	ENST00000263923.4	-	15	2488	c.2193C>T	c.(2191-2193)gaC>gaT	p.D731D		NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	731	Ig-like C2-type 7.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.D731D(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	AGAGGCCTTCGTCCTCCTTCC	0.443			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																											p.D731D			Dom	yes		4	4q11-q12	3791	vascular endothelial growth factor receptor 2		E	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2193T	4						.	G		1,4405	2.1+/-5.4	0,1,2202	130.0	122.0	125.0		2193	-3.3	1.0	4	dbSNP_134	125	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	KDR	NM_002253.2		0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154		731/1357	55968137	2,13004	2203	4300	6503	55662894	SO:0001819	synonymous_variant	3791	exon15			AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.2193C>T	4.37:g.55968137G>A		Somatic		Capture	SOLID	Phase_I	55662894	NM_002253	A2RRS0|B5A925|C5IFA0|O60723|Q14178	Silent	SNP	ENST00000263923.4	37	CCDS3497.1																																																																																				KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250645.1		
MMRN1	22915	hgsc.bcm.edu	37	4	90874346	90874346	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr4:90874346G>T	ENST00000394980.1	+	9	3783	c.3464G>T	c.(3463-3465)aGt>aTt	p.S1155I	MMRN1_ENST00000508372.1_Missense_Mutation_p.S897I|MMRN1_ENST00000264790.2_Missense_Mutation_p.S1155I|MMRN1_ENST00000394981.1_Missense_Mutation_p.S458I			Q13201	MMRN1_HUMAN	multimerin 1	1155	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)		p.S1155I(1)		breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|liver(2)|lung(34)|ovary(5)|prostate(1)|skin(6)|stomach(1)|urinary_tract(2)	72		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		GAGTCATTTAGTGCTCATATT	0.343																																					p.S1155I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3464T	4						.						140.0	138.0	139.0					4																	90874346		2203	4300	6503	91093369	SO:0001583	missense	22915	exon8			U27109	CCDS3635.1	4q22	2008-02-05	2004-03-02	2004-03-02	ENSG00000138722	ENSG00000138722		"""EMI domain containing"""	7178	protein-coding gene	gene with protein product	"""glycoprotein Ia*"""	601456	"""multimerin"""	MMRN		7629143, 10828608	Standard	NM_007351		Approved	ECM, EMILIN4, GPIa*	uc003hst.3	Q13201	OTTHUMG00000130947	ENST00000394980.1:c.3464G>T	4.37:g.90874346G>T	ENSP00000378431:p.Ser1155Ile	Somatic		Capture	SOLID	Phase_I	91093369	NM_007351	Q4W5L1|Q6P3T8|Q6ZUL9	Missense_Mutation	SNP	ENST00000394980.1	37	CCDS3635.1	.	.	.	.	.	.	.	.	.	.	G	19.99	3.927905	0.73327	.	.	ENSG00000138722	ENST00000394980;ENST00000264790;ENST00000394981;ENST00000508372	D;D;D;D	0.86497	-2.13;-2.13;-2.13;-2.13	5.11	5.11	0.69529	Tumour necrosis factor-like (2);Complement C1q protein (4);	0.000000	0.85682	D	0.000000	D	0.93436	0.7906	M	0.79011	2.435	0.38299	D	0.942916	D;D	0.89917	0.998;1.0	D;D	0.91635	0.988;0.999	D	0.94691	0.7874	10	0.87932	D	0	.	17.6017	0.88027	0.0:0.0:1.0:0.0	.	458;1155	Q13201-2;Q13201	.;MMRN1_HUMAN	I	1155;1155;458;897	ENSP00000378431:S1155I;ENSP00000264790:S1155I;ENSP00000378432:S458I;ENSP00000426461:S897I	ENSP00000264790:S1155I	S	+	2	0	MMRN1	91093369	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	6.297000	0.72757	2.765000	0.95021	0.484000	0.47621	AGT		MMRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253546.2	NM_007351	
UNC5C	8633	hgsc.bcm.edu	37	4	96140209	96140209	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr4:96140209T>G	ENST00000453304.1	-	9	1904	c.1556A>C	c.(1555-1557)aAc>aCc	p.N519T	UNC5C_ENST00000506749.1_Missense_Mutation_p.N538T	NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)	519					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|brain development (GO:0007420)|positive regulation of apoptotic process (GO:0043065)|regulation of cell migration (GO:0030334)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)	p.N519T(1)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		TAGACTCTGGTTCTTCAGGCT	0.522																																					p.N519T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1556C	4						.						146.0	116.0	126.0					4																	96140209		2203	4300	6503	96359232	SO:0001583	missense	8633	exon9			AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168		"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""			9126742, 9782087	Standard	NM_003728		Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000453304.1:c.1556A>C	4.37:g.96140209T>G	ENSP00000406022:p.Asn519Thr	Somatic		Capture	SOLID	Phase_I	96359232	NM_003728	Q8IUT0	Missense_Mutation	SNP	ENST00000453304.1	37	CCDS3643.1	.	.	.	.	.	.	.	.	.	.	T	2.734	-0.263736	0.05754	.	.	ENSG00000182168	ENST00000453304;ENST00000331502;ENST00000513796;ENST00000506749	T;T;T	0.57107	0.73;0.42;0.47	5.45	3.05	0.35203	.	0.200947	0.50627	D	0.000105	T	0.21921	0.0528	N	0.02011	-0.69	0.80722	D	1	B;B;B	0.10296	0.001;0.003;0.001	B;B;B	0.11329	0.006;0.003;0.003	T	0.04900	-1.0919	10	0.10636	T	0.68	.	9.4215	0.38555	0.0:0.1434:0.0:0.8566	.	519;538;519	A8K385;E0CX15;O95185	.;.;UNC5C_HUMAN	T	519;478;538;538	ENSP00000406022:N519T;ENSP00000426924:N538T;ENSP00000426153:N538T	ENSP00000328673:N478T	N	-	2	0	UNC5C	96359232	0.961000	0.32948	0.993000	0.49108	0.173000	0.22820	0.964000	0.29306	0.387000	0.25024	0.533000	0.62120	AAC		UNC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253607.1	NM_003728	
SFRP2	6423	hgsc.bcm.edu	37	4	154702662	154702662	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr4:154702662G>C	ENST00000274063.4	-	3	1113	c.829C>G	c.(829-831)Cag>Gag	p.Q277E		NM_003013.2	NP_003004.1	Q96HF1	SFRP2_HUMAN	secreted frizzled-related protein 2	277	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				bone morphogenesis (GO:0060349)|brain development (GO:0007420)|cardiac left ventricle morphogenesis (GO:0003214)|cell-cell signaling (GO:0007267)|cellular response to extracellular stimulus (GO:0031668)|cellular response to X-ray (GO:0071481)|chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|convergent extension involved in axis elongation (GO:0060028)|digestive tract morphogenesis (GO:0048546)|embryonic digit morphogenesis (GO:0042733)|gonad development (GO:0008406)|hematopoietic stem cell proliferation (GO:0071425)|male gonad development (GO:0008584)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dermatome development (GO:0061185)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of gene expression (GO:0010629)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of mesodermal cell fate specification (GO:0042662)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of planar cell polarity pathway involved in axis elongation (GO:2000041)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-anal tail morphogenesis (GO:0036342)|regulation of stem cell division (GO:2000035)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|sclerotome development (GO:0061056)|vasculature development (GO:0001944)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	endopeptidase activator activity (GO:0061133)|fibronectin binding (GO:0001968)|integrin binding (GO:0005178)|metalloenzyme activator activity (GO:0010577)|PDZ domain binding (GO:0030165)|receptor agonist activity (GO:0048018)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.Q277E(1)		breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(1)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	16	all_hematologic(180;0.093)	Renal(120;0.117)				TGCCCCTTCTGCCACCGCTTC	0.607																																					p.Q277E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C829G	4						.						126.0	98.0	107.0					4																	154702662		2203	4300	6503	154922112	SO:0001583	missense	6423	exon3			AF017986	CCDS34082.1	4q31.3	2008-08-29			ENSG00000145423	ENSG00000145423		"""Secreted frizzled-related proteins"""	10777	protein-coding gene	gene with protein product		604157				9391078	Standard	NM_003013		Approved	SARP1, SDF-5, FRP-2	uc003inv.1	Q96HF1	OTTHUMG00000161559	ENST00000274063.4:c.829C>G	4.37:g.154702662G>C	ENSP00000274063:p.Gln277Glu	Somatic		Capture	SOLID	Phase_I	154922112	NM_003013	B3KQR2|O14778|Q9HAP5	Missense_Mutation	SNP	ENST00000274063.4	37	CCDS34082.1	.	.	.	.	.	.	.	.	.	.	G	17.07	3.294891	0.60086	.	.	ENSG00000145423	ENST00000274063	T	0.28666	1.6	5.95	5.95	0.96441	Tissue inhibitor of metalloproteinases-like, OB-fold (1);Netrin domain (1);Netrin module, non-TIMP type (2);	0.000000	0.85682	D	0.000000	T	0.33962	0.0881	L	0.43152	1.355	0.80722	D	1	B	0.28470	0.213	B	0.33960	0.173	T	0.03443	-1.1036	10	0.29301	T	0.29	.	20.3697	0.98890	0.0:0.0:1.0:0.0	.	277	Q96HF1	SFRP2_HUMAN	E	277	ENSP00000274063:Q277E	ENSP00000274063:Q277E	Q	-	1	0	SFRP2	154922112	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.000000	0.93564	2.811000	0.96726	0.655000	0.94253	CAG		SFRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365296.1		
DRP2	1821	hgsc.bcm.edu	37	X	100515538	100515538	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chrX:100515538G>T	ENST00000395209.3	+	24	3329	c.2802G>T	c.(2800-2802)atG>atT	p.M934I	DRP2_ENST00000541709.1_Missense_Mutation_p.M856I|DRP2_ENST00000402866.1_Missense_Mutation_p.M934I|DRP2_ENST00000538510.1_Missense_Mutation_p.M934I	NM_001939.2	NP_001930.2	Q13474	DRP2_HUMAN	dystrophin related protein 2	934					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)	p.M931I(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	31						AGGACATCATGGAGAAACTCC	0.493																																					p.M934I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2802T	X						.						226.0	185.0	199.0					X																	100515538		2203	4300	6503	100402194	SO:0001583	missense	1821	exon24			U43519	CCDS14480.2, CCDS55465.1	Xq22	2008-02-05			ENSG00000102385	ENSG00000102385			3032	protein-coding gene	gene with protein product		300052				8640231	Standard	NM_001939		Approved		uc004egz.2	Q13474	OTTHUMG00000022020	ENST00000395209.3:c.2802G>T	X.37:g.100515538G>T	ENSP00000378635:p.Met934Ile	Somatic		Capture	SOLID	Phase_I	100402194	NM_001939	A6ZKI5|A8K1B0|B1B1F3|B4DIZ0	Missense_Mutation	SNP	ENST00000395209.3	37	CCDS14480.2	.	.	.	.	.	.	.	.	.	.	G	14.30	2.494249	0.44352	.	.	ENSG00000102385	ENST00000402866;ENST00000395209;ENST00000541709;ENST00000538510	T;T;T;T	0.06142	3.42;3.42;3.34;3.42	5.05	5.05	0.67936	.	0.040904	0.85682	D	0.000000	T	0.19446	0.0467	M	0.62723	1.935	0.47276	D	0.999374	P	0.45126	0.851	P	0.55391	0.775	T	0.00273	-1.1858	10	0.48119	T	0.1	-14.9202	17.6118	0.88055	0.0:0.0:1.0:0.0	.	934	Q13474	DRP2_HUMAN	I	934;934;856;934	ENSP00000385038:M934I;ENSP00000378635:M934I;ENSP00000444752:M856I;ENSP00000441051:M934I	ENSP00000378635:M934I	M	+	3	0	DRP2	100402194	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.943000	0.63554	2.086000	0.62901	0.436000	0.28706	ATG		DRP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057522.3	NM_001939	
CHRDL1	91851	hgsc.bcm.edu	37	X	109922587	109922587	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chrX:109922587T>G	ENST00000372045.1	-	11	1330	c.1199A>C	c.(1198-1200)aAg>aCg	p.K400T	CHRDL1_ENST00000444321.2_Missense_Mutation_p.K407T|CHRDL1_ENST00000372042.1_Missense_Mutation_p.K408T|CHRDL1_ENST00000218054.4_Missense_Mutation_p.K406T|CHRDL1_ENST00000434224.1_Missense_Mutation_p.K327T|CHRDL1_ENST00000482160.1_Missense_Mutation_p.K328T|CHRDL1_ENST00000394797.4_Missense_Mutation_p.K406T			Q9BU40	CRDL1_HUMAN	chordin-like 1	400					BMP signaling pathway (GO:0030509)|cell differentiation (GO:0030154)|compound eye development (GO:0048749)|eye development (GO:0001654)|negative regulation of BMP signaling pathway (GO:0030514)|nervous system development (GO:0007399)|ossification (GO:0001503)	extracellular region (GO:0005576)		p.K406T(1)		endometrium(1)|large_intestine(12)|liver(1)|lung(15)|prostate(1)|skin(1)	31						GGTCACCAGCTTGAAGTGAGG	0.453																																					p.K408T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1223C	X						.						182.0	143.0	156.0					X																	109922587		2203	4300	6503	109809243	SO:0001583	missense	91851	exon11			AL049176	CCDS14553.1, CCDS48148.1, CCDS48149.1, CCDS48150.1, CCDS48148.2	Xq23	2014-01-31			ENSG00000101938	ENSG00000101938			29861	protein-coding gene	gene with protein product		300350	"""megalocornea 1 (X-linked)"""	MGC1		11441185, 11118896, 22284829	Standard	NM_001143981		Approved	NRLN1, CHL	uc004eow.3	Q9BU40	OTTHUMG00000022199	ENST00000372045.1:c.1199A>C	X.37:g.109922587T>G	ENSP00000361115:p.Lys400Thr	Somatic		Capture	SOLID	Phase_I	109809243	NM_001143981	B1AKD0|B4DMP3|D3DUY6|E9PGS5|Q539E4|Q9Y3H7	Missense_Mutation	SNP	ENST00000372045.1	37		.	.	.	.	.	.	.	.	.	.	T	17.48	3.400552	0.62177	.	.	ENSG00000101938	ENST00000372045;ENST00000434224;ENST00000218054;ENST00000394797;ENST00000372042;ENST00000482160;ENST00000444321	T;T;T;T;T;T;T	0.32753	2.18;1.44;2.18;2.18;2.44;1.44;2.18	5.03	5.03	0.67393	.	0.098405	0.64402	D	0.000002	T	0.41166	0.1147	L	0.27053	0.805	0.47183	D	0.999349	D;D;D;D;D;D	0.71674	0.994;0.998;0.998;0.998;0.998;0.998	D;D;D;D;D;D	0.76071	0.977;0.987;0.987;0.987;0.987;0.981	T	0.18935	-1.0321	9	.	.	.	-15.7162	14.3831	0.66923	0.0:0.0:0.0:1.0	.	328;407;387;400;408;327	B4DMP3;E9PGS5;Q59FB2;Q9BU40;D3DUY6;D3YTA8	.;.;.;CRDL1_HUMAN;.;.	T	400;327;406;406;408;328;407	ENSP00000361115:K400T;ENSP00000389627:K327T;ENSP00000218054:K406T;ENSP00000378276:K406T;ENSP00000361112:K408T;ENSP00000418443:K328T;ENSP00000399739:K407T	.	K	-	2	0	CHRDL1	109809243	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.766000	0.47629	1.932000	0.55993	0.481000	0.45027	AAG		CHRDL1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000057912.1	NM_145234	
OCRL	4952	hgsc.bcm.edu	37	X	128703310	128703310	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chrX:128703310T>G	ENST00000371113.4	+	15	1701	c.1536T>G	c.(1534-1536)aaT>aaG	p.N512K	OCRL_ENST00000357121.5_Missense_Mutation_p.N512K	NM_000276.3	NP_000267.2	Q01968	OCRL_HUMAN	oculocerebrorenal syndrome of Lowe	512	5-phosphatase.				cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)	p.N512K(1)		breast(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(24)|ovary(2)|upper_aerodigestive_tract(3)	48						ATCAGCTTAATTATCGGAGTC	0.418																																					p.N512K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1536G	X						.						175.0	161.0	166.0					X																	128703310		2203	4300	6503	128530991	SO:0001583	missense	4952	exon15			U57627	CCDS35393.1, CCDS35394.1	Xq25	2014-06-18			ENSG00000122126	ENSG00000122126			8108	protein-coding gene	gene with protein product		300535					Standard	NM_001587		Approved	OCRL1	uc004euq.3	Q01968	OTTHUMG00000022706	ENST00000371113.4:c.1536T>G	X.37:g.128703310T>G	ENSP00000360154:p.Asn512Lys	Somatic		Capture	SOLID	Phase_I	128530991	NM_001587	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Missense_Mutation	SNP	ENST00000371113.4	37	CCDS35393.1	.	.	.	.	.	.	.	.	.	.	T	4.294	0.053743	0.08291	.	.	ENSG00000122126	ENST00000371113;ENST00000357121	D;D	0.94966	-3.57;-3.57	5.82	0.354	0.16063	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);	0.534293	0.22268	N	0.062318	T	0.78175	0.4242	N	0.01761	-0.735	0.23820	N	0.996751	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.68872	-0.5294	10	0.06891	T	0.86	.	5.3404	0.15981	0.1478:0.4284:0.0:0.4238	.	512;512	Q01968-2;Q01968	.;OCRL_HUMAN	K	512	ENSP00000360154:N512K;ENSP00000349635:N512K	ENSP00000349635:N512K	N	+	3	2	OCRL	128530991	0.671000	0.27521	0.991000	0.47740	0.964000	0.63967	-0.181000	0.09740	0.022000	0.15160	0.407000	0.27541	AAT		OCRL-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058917.1	NM_000276	
PIR	8544	hgsc.bcm.edu	37	X	15509373	15509373	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chrX:15509373G>A	ENST00000380421.3	-	2	468	c.8C>T	c.(7-9)tCc>tTc	p.S3F	PIR_ENST00000380420.5_Missense_Mutation_p.S3F|PIR_ENST00000476381.1_5'Flank|BMX_ENST00000357607.2_Intron	NM_001018109.2|NM_003662.3	NP_001018119.1|NP_003653.1	O00625	PIR_HUMAN	pirin (iron-binding nuclear protein)	3					monocyte differentiation (GO:0030224)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|quercetin 2,3-dioxygenase activity (GO:0008127)|transcription cofactor activity (GO:0003712)	p.S3F(1)		endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	9	Hepatocellular(33;0.183)					TTTCTTGGAGGACCCCATATC	0.502																																					p.S3F	Ovarian(180;1587 2015 10555 34192 51653)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C8T	X						.						100.0	94.0	96.0					X																	15509373		2203	4300	6503	15419294	SO:0001583	missense	8544	exon2			Y07868	CCDS14167.1	Xp22.31	2008-02-05			ENSG00000087842	ENSG00000087842			30048	protein-coding gene	gene with protein product		300931				9079676	Standard	NM_003662		Approved		uc004cwv.3	O00625	OTTHUMG00000021176	ENST00000380421.3:c.8C>T	X.37:g.15509373G>A	ENSP00000369786:p.Ser3Phe	Somatic		Capture	SOLID	Phase_I	15419294	NM_003662	Q5U0G0|Q6FHD2	Missense_Mutation	SNP	ENST00000380421.3	37	CCDS14167.1	.	.	.	.	.	.	.	.	.	.	G	11.57	1.676642	0.29783	.	.	ENSG00000087842	ENST00000380420;ENST00000380421	T;T	0.46819	0.86;0.86	5.53	3.56	0.40772	Cupin, RmlC-type (1);	0.714054	0.14036	N	0.345792	T	0.39600	0.1084	L	0.56280	1.765	0.09310	N	1	B	0.33448	0.412	B	0.27887	0.084	T	0.32534	-0.9903	10	0.56958	D	0.05	-23.5092	8.4824	0.33052	0.0:0.152:0.6665:0.1815	.	3	O00625	PIR_HUMAN	F	3	ENSP00000369785:S3F;ENSP00000369786:S3F	ENSP00000369785:S3F	S	-	2	0	PIR	15419294	0.073000	0.21202	0.019000	0.16419	0.212000	0.24457	1.953000	0.40352	1.085000	0.41206	0.600000	0.82982	TCC		PIR-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055863.1	NM_003662	
PAGE1	8712	hgsc.bcm.edu	37	X	49454025	49454025	+	Silent	SNP	C	C	T	rs189247528		TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chrX:49454025C>T	ENST00000376150.3	-	5	546	c.414G>A	c.(412-414)gaG>gaA	p.E138E		NM_003785.3	NP_003776.2	O75459	PAGE1_HUMAN	P antigen family, member 1 (prostate associated)	138					cellular defense response (GO:0006968)			p.E138E(1)		endometrium(1)|large_intestine(2)|lung(2)|skin(1)|urinary_tract(1)	7	Ovarian(276;0.236)					GCCTACCTTCCTCAGGTGTTT	0.473																																					p.E138E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G414A	X						.						118.0	107.0	111.0					X																	49454025		2203	4300	6503	49340979	SO:0001819	synonymous_variant	8712	exon5			AF058989	CCDS14327.1	Xp11.23	2009-06-17	2005-01-26	2005-01-27	ENSG00000068985	ENSG00000068985			4107	protein-coding gene	gene with protein product		300288	"""G antigen, family B, 1 (prostate associated)"""	GAGEB1		9651357, 9724777	Standard	NM_003785		Approved	PAGE-1, GAGE-9, CT16.3	uc004dom.3	O75459	OTTHUMG00000033224	ENST00000376150.3:c.414G>A	X.37:g.49454025C>T		Somatic		Capture	SOLID	Phase_I	49340979	NM_003785	Q6FGM3|Q9BSS7	Silent	SNP	ENST00000376150.3	37	CCDS14327.1																																																																																				PAGE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081210.1		
GPR174	84636	hgsc.bcm.edu	37	X	78426546	78426546	+	Silent	SNP	T	T	C			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chrX:78426546T>C	ENST00000276077.1	+	1	78	c.42T>C	c.(40-42)aaT>aaC	p.N14N		NM_032553.1	NP_115942.1	Q9BXC1	GP174_HUMAN	G protein-coupled receptor 174	14						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.N14N(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(19)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	38						ATGGAGACAATACAGATTTTC	0.383										HNSCC(63;0.18)																											p.N14N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T42C	X						.						109.0	92.0	97.0					X																	78426546		2203	4300	6503	78313202	SO:0001819	synonymous_variant	84636	exon1			AF345567	CCDS14443.1	Xq13.3	2012-08-21			ENSG00000147138	ENSG00000147138		"""GPCR / Class A : Orphans"""	30245	protein-coding gene	gene with protein product		300903					Standard	NM_032553		Approved	FKSG79	uc004edg.1	Q9BXC1	OTTHUMG00000021898	ENST00000276077.1:c.42T>C	X.37:g.78426546T>C		Somatic		Capture	SOLID	Phase_I	78313202	NM_032553	Q2M3F7	Silent	SNP	ENST00000276077.1	37	CCDS14443.1																																																																																				GPR174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057327.1	NM_032553	
GPR101	83550	hgsc.bcm.edu	37	X	136112715	136112715	+	Silent	SNP	C	C	T			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chrX:136112715C>T	ENST00000298110.1	-	1	1118	c.1119G>A	c.(1117-1119)ccG>ccA	p.P373P		NM_054021.1	NP_473362.1	Q96P66	GP101_HUMAN	G protein-coupled receptor 101	373						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)	p.P373P(1)		autonomic_ganglia(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(18)|ovary(3)|skin(1)|urinary_tract(1)	42	Acute lymphoblastic leukemia(192;0.000127)					GGAGGCTCTCCGGGATGTTCA	0.507																																					p.P373P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1119A	X						.						218.0	174.0	189.0					X																	136112715		2203	4300	6503	135940381	SO:0001819	synonymous_variant	83550	exon1			AF411115	CCDS14662.1	Xq26.3	2014-01-30			ENSG00000165370	ENSG00000165370		"""GPCR / Class A : Orphans"""	14963	protein-coding gene	gene with protein product		300393				11574155	Standard	NM_054021		Approved		uc011mwh.2	Q96P66	OTTHUMG00000022521	ENST00000298110.1:c.1119G>A	X.37:g.136112715C>T		Somatic		Capture	SOLID	Phase_I	135940381	NM_054021	Q5JSM8|Q8NG93	Silent	SNP	ENST00000298110.1	37	CCDS14662.1																																																																																				GPR101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058519.1		
TMEM87B	84910	hgsc.bcm.edu	37	2	112839054	112839054	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr2:112839054T>A	ENST00000283206.4	+	8	1166	c.797T>A	c.(796-798)tTt>tAt	p.F266Y		NM_032824.2	NP_116213.1	Q96K49	TM87B_HUMAN	transmembrane protein 87B	266						integral component of membrane (GO:0016021)		p.F266Y(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(11)|ovary(1)	19						AAAGCAGTTTTTTATAGTGAA	0.363																																					p.F266Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T797A	2						.						110.0	119.0	116.0					2																	112839054		2201	4300	6501	112555525	SO:0001583	missense	84910	exon8			AC092645	CCDS33275.1	2q13	2008-02-05			ENSG00000153214	ENSG00000153214			25913	protein-coding gene	gene with protein product							Standard	NM_032824		Approved	FLJ14681	uc002thm.2	Q96K49	OTTHUMG00000153266	ENST00000283206.4:c.797T>A	2.37:g.112839054T>A	ENSP00000283206:p.Phe266Tyr	Somatic		Capture	SOLID	Phase_I	112555525	NM_032824	A8K2M9|Q1RLN2|Q53R54	Missense_Mutation	SNP	ENST00000283206.4	37	CCDS33275.1	.	.	.	.	.	.	.	.	.	.	T	17.74	3.464286	0.63513	.	.	ENSG00000153214	ENST00000283206	.	.	.	5.95	5.95	0.96441	.	0.094022	0.85682	N	0.000000	T	0.41419	0.1158	L	0.31420	0.93	0.58432	D	0.999997	B;P	0.36354	0.374;0.549	B;B	0.37346	0.094;0.247	T	0.41752	-0.9491	9	0.52906	T	0.07	-27.6191	9.6208	0.39721	0.1557:0.0:0.0:0.8443	.	265;266	Q96K49-2;Q96K49	.;TM87B_HUMAN	Y	266	.	ENSP00000283206:F266Y	F	+	2	0	TMEM87B	112555525	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.146000	0.71777	2.268000	0.75426	0.533000	0.62120	TTT		TMEM87B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330500.1	NM_032824	
LRP1B	53353	hgsc.bcm.edu	37	2	141135749	141135749	+	Splice_Site	SNP	C	C	G			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr2:141135749C>G	ENST00000389484.3	-	68	11609	c.10638G>C	c.(10636-10638)gaG>gaC	p.E3546D		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3546	LDL-receptor class A 26. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.E3546D(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AGATGCCTACCTCATCAGAGC	0.398										TSP Lung(27;0.18)																											p.E3546D	Colon(99;50 2074 2507 20106)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G10638C	2						.						97.0	88.0	91.0					2																	141135749		2203	4300	6503	140852219	SO:0001630	splice_region_variant	53353	exon68			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.10638+1G>C	2.37:g.141135749C>G		Somatic		Capture	SOLID	Phase_I	140852219	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.682768	0.88542	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.97811	-4.55	5.48	5.48	0.80851	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99342	0.9769	H	0.98646	4.29	0.58432	D	0.999998	D	0.69078	0.997	D	0.79108	0.992	D	0.98476	1.0603	9	.	.	.	.	19.3528	0.94395	0.0:1.0:0.0:0.0	.	3546	Q9NZR2	LRP1B_HUMAN	D	3546;3484	ENSP00000374135:E3546D	.	E	-	3	2	LRP1B	140852219	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	7.445000	0.80570	2.571000	0.86741	0.591000	0.81541	GAG		LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	Missense_Mutation
LRP1B	53353	hgsc.bcm.edu	37	2	141625248	141625248	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr2:141625248T>G	ENST00000389484.3	-	27	5461	c.4490A>C	c.(4489-4491)aAg>aCg	p.K1497T		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1497					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.K1497T(1)|p.K1497R(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CCCTGTCCACTTATTGGCTTT	0.488										TSP Lung(27;0.18)																											p.K1497T	Colon(99;50 2074 2507 20106)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A4490C	2						.						201.0	177.0	185.0					2																	141625248		2203	4300	6503	141341718	SO:0001583	missense	53353	exon27			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.4490A>C	2.37:g.141625248T>G	ENSP00000374135:p.Lys1497Thr	Somatic		Capture	SOLID	Phase_I	141341718	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.190659	0.78789	.	.	ENSG00000168702	ENST00000389484;ENST00000544579;ENST00000434794	D;D	0.91407	-2.84;-2.84	5.42	5.42	0.78866	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.96497	0.8857	M	0.93638	3.44	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.994	D	0.97481	1.0047	10	0.72032	D	0.01	.	15.4528	0.75285	0.0:0.0:0.0:1.0	.	680;1497	Q96NT6;Q9NZR2	.;LRP1B_HUMAN	T	1497;1435;642	ENSP00000374135:K1497T;ENSP00000413239:K642T	ENSP00000374135:K1497T	K	-	2	0	LRP1B	141341718	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.942000	0.87708	2.060000	0.61445	0.533000	0.62120	AAG		LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
AGPS	8540	hgsc.bcm.edu	37	2	178402821	178402821	+	Silent	SNP	A	A	G			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr2:178402821A>G	ENST00000264167.4	+	20	2021	c.1875A>G	c.(1873-1875)caA>caG	p.Q625Q	AGPS_ENST00000409888.1_Silent_p.Q156Q	NM_003659.3	NP_003650.1	O00116	ADAS_HUMAN	alkylglycerone phosphate synthase	625					cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|lipid biosynthetic process (GO:0008610)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	alkylglycerone-phosphate synthase activity (GO:0008609)|FAD binding (GO:0071949)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)	p.Q625Q(2)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0018)|Epithelial(96;0.00919)|all cancers(119;0.0358)			TACGGAAGCAATGGCTAAAGG	0.388																																					p.Q625Q												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.A1875G	2						.						130.0	127.0	128.0					2																	178402821		2203	4300	6503	178111067	SO:0001819	synonymous_variant	8540	exon20			Y09443	CCDS2275.1	2q	2008-02-05			ENSG00000018510	ENSG00000018510	2.5.1.26		327	protein-coding gene	gene with protein product		603051				9187299, 9553082	Standard	NM_003659		Approved	ADHAPS, ADAS, ALDHPSY, ADPS, ADAP-S	uc002ull.2	O00116	OTTHUMG00000132530	ENST00000264167.4:c.1875A>G	2.37:g.178402821A>G		Somatic		Capture	SOLID	Phase_I	178111067	NM_003659	A5D8U9|Q2TU35	Silent	SNP	ENST00000264167.4	37	CCDS2275.1																																																																																				AGPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255730.2		
TTN	7273	hgsc.bcm.edu	37	2	179640241	179640241	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr2:179640241T>C	ENST00000591111.1	-	28	6574	c.6350A>G	c.(6349-6351)aAa>aGa	p.K2117R	TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.K2117R|TTN_ENST00000359218.5_Missense_Mutation_p.K2071R|TTN_ENST00000460472.2_Missense_Mutation_p.K2071R|TTN_ENST00000360870.5_Missense_Mutation_p.K2117R|TTN_ENST00000342175.6_Missense_Mutation_p.K2071R|TTN_ENST00000589042.1_Missense_Mutation_p.K2117R|TTN-AS1_ENST00000584485.1_RNA|TTN-AS1_ENST00000585451.1_RNA|RP11-88L24.4_ENST00000582038.2_RNA			Q8WZ42	TITIN_HUMAN	titin	12805	Ig-like 10.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.K2071R(2)|p.K2117R(2)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCGTTCAATTTTGACACCATT	0.498																																					p.K2117R												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.A6350G	2						.						82.0	86.0	85.0					2																	179640241		2203	4300	6503	179348486	SO:0001583	missense	7273	exon28			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.6350A>G	2.37:g.179640241T>C	ENSP00000465570:p.Lys2117Arg	Somatic		Capture	SOLID	Phase_I	179348486	NM_133379	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	7.141	0.581913	0.13749	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31;-0.31	5.33	5.33	0.75918	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.55497	0.1924	N	0.16016	0.355	0.20638	N	0.999879	P;P;P;P;P	0.52316	0.669;0.669;0.669;0.669;0.952	B;B;B;B;B	0.43916	0.355;0.355;0.355;0.355;0.436	T	0.55309	-0.8161	9	0.87932	D	0	.	15.3078	0.74008	0.0:0.0:0.0:1.0	.	2071;2071;2071;2117;2117	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	R	2117;2071;2071;2071;2071;2117	ENSP00000343764:K2117R;ENSP00000434586:K2071R;ENSP00000340554:K2071R;ENSP00000352154:K2071R;ENSP00000354117:K2117R	ENSP00000340554:K2071R	K	-	2	0	TTN	179348486	1.000000	0.71417	0.853000	0.33588	0.554000	0.35429	2.531000	0.45650	2.025000	0.59659	0.533000	0.62120	AAA		TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
ZNF804A	91752	hgsc.bcm.edu	37	2	185802456	185802456	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr2:185802456C>A	ENST00000302277.6	+	4	2927	c.2333C>A	c.(2332-2334)tCt>tAt	p.S778Y		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	778							metal ion binding (GO:0046872)	p.S778Y(1)		NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						CATTCACATTCTTATTCTTCA	0.353																																					p.S778Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2333A	2						.						51.0	54.0	53.0					2																	185802456		2203	4300	6503	185510701	SO:0001583	missense	91752	exon4			AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.2333C>A	2.37:g.185802456C>A	ENSP00000303252:p.Ser778Tyr	Somatic		Capture	SOLID	Phase_I	185510701	NM_194250	A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	37	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	C	15.75	2.924549	0.52653	.	.	ENSG00000170396	ENST00000302277	T	0.11604	2.76	5.81	3.95	0.45737	.	0.111844	0.40728	N	0.001022	T	0.09905	0.0243	L	0.55481	1.735	0.28660	N	0.906208	B	0.24533	0.105	B	0.20384	0.029	T	0.19516	-1.0303	10	0.30078	T	0.28	-11.5196	5.7976	0.18396	0.1455:0.642:0.1399:0.0726	.	778	Q7Z570	Z804A_HUMAN	Y	778	ENSP00000303252:S778Y	ENSP00000303252:S778Y	S	+	2	0	ZNF804A	185510701	1.000000	0.71417	0.980000	0.43619	0.989000	0.77384	1.478000	0.35442	0.745000	0.32763	0.655000	0.94253	TCT		ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250	
FAM171B	165215	hgsc.bcm.edu	37	2	187627013	187627013	+	Silent	SNP	G	G	A			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr2:187627013G>A	ENST00000304698.5	+	8	2147	c.1944G>A	c.(1942-1944)tcG>tcA	p.S648S		NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	648						integral component of membrane (GO:0016021)	DNA binding (GO:0003677)	p.S648S(1)		NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						CATTTTCATCGGAACTTCAAG	0.502																																					p.S648S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1944A	2						.						103.0	113.0	110.0					2																	187627013		2203	4299	6502	187335258	SO:0001819	synonymous_variant	165215	exon8			AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.1944G>A	2.37:g.187627013G>A		Somatic		Capture	SOLID	Phase_I	187335258	NM_177454	Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Silent	SNP	ENST00000304698.5	37	CCDS33347.1																																																																																				FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334679.1	NM_177454	
BARD1	580	hgsc.bcm.edu	37	2	215593697	215593697	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr2:215593697C>A	ENST00000260947.4	-	11	2171	c.2037G>T	c.(2035-2037)ttG>ttT	p.L679F	BARD1_ENST00000449967.2_Missense_Mutation_p.C534F|BARD1_ENST00000432456.1_Missense_Mutation_p.L50F	NM_000465.2|NM_001282543.1|NM_001282545.1|NM_001282548.1	NP_000456.2|NP_001269472.1|NP_001269474.1|NP_001269477.1	Q99728	BARD1_HUMAN	BRCA1 associated RING domain 1	679	BRCT 2. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|negative regulation of mRNA 3'-end processing (GO:0031441)|negative regulation of protein export from nucleus (GO:0046826)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein catabolic process (GO:0045732)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of phosphorylation (GO:0042325)|tissue homeostasis (GO:0001894)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	kinase binding (GO:0019900)|ligase activity (GO:0016874)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.L679F(1)		NS(2)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(14)|prostate(4)|upper_aerodigestive_tract(1)	35		Renal(323;0.0243)		Epithelial(149;3.2e-06)|all cancers(144;0.000461)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		AGGTTCCCCACAAATAGAAGT	0.418									Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																												p.L679F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2037T	2						.						95.0	83.0	87.0					2																	215593697		2203	4300	6503	215301942	SO:0001583	missense	580	exon11	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease		CCDS2397.1, CCDS74645.1, CCDS74646.1, CCDS74647.1, CCDS74648.1	2q34-q35	2013-01-10			ENSG00000138376	ENSG00000138376		"""Ankyrin repeat domain containing"""	952	protein-coding gene	gene with protein product		601593				8944023, 9425226, 15159397	Standard	NM_001282548		Approved		uc002veu.2	Q99728	OTTHUMG00000133016	ENST00000260947.4:c.2037G>T	2.37:g.215593697C>A	ENSP00000260947:p.Leu679Phe	Somatic		Capture	SOLID	Phase_I	215301942	NM_000465	F6MDH7|F6MDH8|F6MDH9|O43574|Q53SS5	Missense_Mutation	SNP	ENST00000260947.4	37	CCDS2397.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	2.635|2.635	-0.285383|-0.285383	0.05605|0.05605	.|.	.|.	ENSG00000138376|ENSG00000138376	ENST00000449967|ENST00000260947;ENST00000432456	D|T;T	0.82619|0.80480	-1.63|2.68;-1.38	5.91|5.91	-2.13|-2.13	0.07144|0.07144	.|BRCT (3);	.|0.321975	.|0.33980	.|N	.|0.004366	T|T	0.54870|0.54870	0.1885|0.1885	N|N	0.12502|0.12502	0.225|0.225	0.24889|0.24889	N|N	0.992174|0.992174	B|B	0.02656|0.10296	0.0|0.003	B|B	0.01281|0.04013	0.0|0.001	T|T	0.45731|0.45731	-0.9241|-0.9241	8|10	.|0.07482	.|T	.|0.82	-4.8765|-4.8765	8.5623|8.5623	0.33518|0.33518	0.3404:0.479:0.1806:0.0|0.3404:0.479:0.1806:0.0	.|.	534|679	E7EUI3|Q99728	.|BARD1_HUMAN	F|F	534|679;50	ENSP00000406752:C534F|ENSP00000260947:L679F;ENSP00000405020:L50F	.|ENSP00000260947:L679F	C|L	-|-	2|3	0|2	BARD1|BARD1	215301942|215301942	0.144000|0.144000	0.22641|0.22641	0.710000|0.710000	0.30468|0.30468	0.781000|0.781000	0.44180|0.44180	-0.307000|-0.307000	0.08167|0.08167	-0.625000|-0.625000	0.05604|0.05604	0.655000|0.655000	0.94253|0.94253	TGT|TTG		BARD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256602.1	NM_000465	
PAX3	5077	hgsc.bcm.edu	37	2	223085004	223085004	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr2:223085004G>A	ENST00000350526.4	-	7	1164	c.1028C>T	c.(1027-1029)aCg>aTg	p.T343M	PAX3_ENST00000392070.2_Missense_Mutation_p.T343M|PAX3_ENST00000344493.4_Missense_Mutation_p.T343M|PAX3_ENST00000464706.1_5'UTR|PAX3_ENST00000336840.6_Missense_Mutation_p.T343M|PAX3_ENST00000409551.3_Missense_Mutation_p.T342M|PAX3_ENST00000392069.2_Missense_Mutation_p.T343M	NM_181457.3	NP_852122.1	P23760	PAX3_HUMAN	paired box 3	343					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|developmental pigmentation (GO:0048066)|heart development (GO:0007507)|mammary gland specification (GO:0060594)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|neuron fate commitment (GO:0048663)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of somitogenesis (GO:0014807)|sensory perception of sound (GO:0007605)|spinal cord association neuron differentiation (GO:0021527)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T343M(1)	PAX3/NCOA2(4)|PAX3/NCOA1(8)|PAX3/FOXO1(749)	NS(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(13)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	38		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGAAGGAATCGTGCTTTGGTG	0.537			T	"""FOXO1A, NCOA1"""	alveolar rhabdomyosarcoma		Waardenburg syndrome; craniofacial-deafness-hand syndrome																														p.T343M			Dom	yes		2	2q35	5077	paired box gene 3	yes	M	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1028T	2						.						262.0	215.0	231.0					2																	223085004		2203	4300	6503	222793248	SO:0001583	missense	5077	exon7				CCDS2449.1, CCDS2450.1, CCDS2451.1, CCDS42825.1, CCDS2448.1, CCDS42826.1, CCDS46522.1, CCDS46523.1	2q36.1	2011-06-20	2007-07-12		ENSG00000135903	ENSG00000135903		"""Paired boxes"", ""Homeoboxes / PRD class"""	8617	protein-coding gene	gene with protein product		606597	"""Waardenburg syndrome 1"", ""paired box gene 3 (Waardenburg syndrome 1)"""	WS1		1347149	Standard	NM_181461		Approved	HUP2	uc002vmt.2	P23760	OTTHUMG00000133157	ENST00000350526.4:c.1028C>T	2.37:g.223085004G>A	ENSP00000343052:p.Thr343Met	Somatic		Capture	SOLID	Phase_I	222793248	NM_181461	G5E9C1|Q16448|Q494Z3|Q494Z4|Q53T90|Q6GSJ9|Q86UQ2|Q86UQ3	Missense_Mutation	SNP	ENST00000350526.4	37	CCDS42826.1	.	.	.	.	.	.	.	.	.	.	G	12.32	1.901384	0.33535	.	.	ENSG00000135903	ENST00000392069;ENST00000344493;ENST00000350526;ENST00000392070;ENST00000336840;ENST00000409551;ENST00000464706;ENST00000555548	D;D;D;D;D;D	0.94280	-3.36;-3.39;-3.35;-3.34;-3.39;-3.34	5.68	4.78	0.61160	.	0.227351	0.44483	D	0.000447	D	0.89143	0.6631	N	0.03608	-0.345	0.80722	D	1	P;P;P;D;P	0.55385	0.918;0.768;0.954;0.971;0.954	B;B;P;P;P	0.54815	0.276;0.178;0.629;0.761;0.454	D	0.90262	0.4301	10	0.38643	T	0.18	.	15.0452	0.71822	0.0:0.4358:0.5642:0.0	.	343;342;343;343;343	P23760;Q494Z4;P23760-4;P23760-5;G5E9C1	PAX3_HUMAN;.;.;.;.	M	343;343;343;343;343;342;60;60	ENSP00000375921:T343M;ENSP00000342092:T343M;ENSP00000343052:T343M;ENSP00000375922:T343M;ENSP00000338767:T343M;ENSP00000386750:T342M	ENSP00000338767:T343M	T	-	2	0	PAX3	222793248	0.996000	0.38824	0.922000	0.36590	0.974000	0.67602	2.073000	0.41519	1.368000	0.46115	0.650000	0.86243	ACG		PAX3-006	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328670.1		
SOS1	6654	hgsc.bcm.edu	37	2	39278370	39278370	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr2:39278370A>G	ENST00000426016.1	-	7	865	c.779T>C	c.(778-780)cTg>cCg	p.L260P	SOS1_ENST00000395038.2_Missense_Mutation_p.L260P|SOS1_ENST00000428721.2_Missense_Mutation_p.L203P|SOS1_ENST00000402219.2_Missense_Mutation_p.L260P			Q07889	SOS1_HUMAN	son of sevenless homolog 1 (Drosophila)	260	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|Ras protein signal transduction (GO:0007265)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	DNA binding (GO:0003677)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.L260P(1)		autonomic_ganglia(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(29)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	75		all_hematologic(82;0.21)				TATATGGCCCAGTAACTTTAC	0.373									Noonan syndrome																												p.L260P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T779C	2						.						133.0	131.0	131.0					2																	39278370		2203	4300	6503	39131874	SO:0001583	missense	6654	exon6	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	L13857	CCDS1802.1	2p21	2014-09-17	2002-11-05		ENSG00000115904	ENSG00000115904		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11187	protein-coding gene	gene with protein product		182530	"""gingival fibromatosis, hereditary, 1"""	GINGF		8276400, 10995566	Standard	NM_005633		Approved	HGF, GF1	uc002rrk.4	Q07889	OTTHUMG00000102109	ENST00000426016.1:c.779T>C	2.37:g.39278370A>G	ENSP00000387784:p.Leu260Pro	Somatic		Capture	SOLID	Phase_I	39131874	NM_005633	A8K2G3|B4DXG2	Missense_Mutation	SNP	ENST00000426016.1	37	CCDS1802.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.472206	0.84533	.	.	ENSG00000115904	ENST00000426016;ENST00000402219;ENST00000395038;ENST00000263879;ENST00000428721	T;T;T;T	0.72282	-0.64;-0.64;-0.64;0.7	5.65	5.65	0.86999	Dbl homology (DH) domain (5);	0.077573	0.53938	D	0.000060	D	0.85164	0.5634	M	0.82323	2.585	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87350	0.2337	10	0.72032	D	0.01	.	15.541	0.76048	1.0:0.0:0.0:0.0	.	260	Q07889	SOS1_HUMAN	P	260;260;260;260;203	ENSP00000387784:L260P;ENSP00000384675:L260P;ENSP00000378479:L260P;ENSP00000399992:L203P	ENSP00000263879:L260P	L	-	2	0	SOS1	39131874	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.210000	0.95106	2.152000	0.67230	0.460000	0.39030	CTG		SOS1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219948.3	NM_005633	
SPTBN1	6711	hgsc.bcm.edu	37	2	54856136	54856136	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr2:54856136A>C	ENST00000356805.4	+	14	2146	c.1865A>C	c.(1864-1866)gAg>gCg	p.E622A	SPTBN1_ENST00000333896.5_Missense_Mutation_p.E609A	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	622					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)	p.E622A(1)		NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			TGTTATCAAGAGCTTTGCCAG	0.587																																					p.E622A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1865C	2						.						70.0	79.0	76.0					2																	54856136		2203	4300	6503	54709640	SO:0001583	missense	6711	exon14				CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.1865A>C	2.37:g.54856136A>C	ENSP00000349259:p.Glu622Ala	Somatic		Capture	SOLID	Phase_I	54709640	NM_003128	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Missense_Mutation	SNP	ENST00000356805.4	37	CCDS33198.1	.	.	.	.	.	.	.	.	.	.	A	17.69	3.451876	0.63290	.	.	ENSG00000115306	ENST00000356805;ENST00000389980;ENST00000333896	T;T;T	0.50548	0.74;0.74;0.74	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.53498	0.1800	L	0.52126	1.63	0.80722	D	1	P;P	0.44260	0.686;0.83	B;P	0.49085	0.367;0.6	T	0.52997	-0.8500	10	0.45353	T	0.12	.	15.8024	0.78463	1.0:0.0:0.0:0.0	.	609;622	Q01082-3;Q01082	.;SPTB2_HUMAN	A	622;622;609	ENSP00000349259:E622A;ENSP00000374630:E622A;ENSP00000334156:E609A	ENSP00000334156:E609A	E	+	2	0	SPTBN1	54709640	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.271000	0.95698	2.143000	0.66587	0.533000	0.62120	GAG		SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3		
ACKR3	57007	hgsc.bcm.edu	37	2	237489513	237489513	+	Silent	SNP	C	C	T			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr2:237489513C>T	ENST00000272928.3	+	2	715	c.405C>T	c.(403-405)ctC>ctT	p.L135L		NM_020311.2	NP_064707.1	P25106	ACKR3_HUMAN	atypical chemokine receptor 3	135					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|receptor internalization (GO:0031623)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell surface (GO:0009986)|coated pit (GO:0005905)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C-X-C chemokine binding (GO:0019958)|C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|scavenger receptor activity (GO:0005044)	p.L135L(1)									TTTTCTTCCTCACGTGCATGA	0.562																																					p.L135L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C405T	2						.						266.0	219.0	235.0					2																	237489513		2203	4300	6503	237154252	SO:0001819	synonymous_variant	57007	exon2			BC008459	CCDS2516.1	2q37.3	2013-07-17	2013-07-16	2013-07-16	ENSG00000144476	ENSG00000144476		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : Atypical"""	23692	protein-coding gene	gene with protein product		610376	"""chemokine orphan receptor 1"", ""chemokine (C-X-C motif) receptor 7"""	CMKOR1, CXCR7		16107333, 16148	Standard	NM_020311		Approved	RDC1, GPR159	uc002vwd.3	P25106	OTTHUMG00000133295	ENST00000272928.3:c.405C>T	2.37:g.237489513C>T		Somatic		Capture	SOLID	Phase_I	237154252	NM_020311	A8K6J4|Q53RV4|Q8NE10|Q92938|Q92986	Silent	SNP	ENST00000272928.3	37	CCDS2516.1																																																																																				ACKR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257079.2	NM_020311	
DNAI1	27019	hgsc.bcm.edu	37	9	34489429	34489429	+	Missense_Mutation	SNP	C	C	T	rs116938457	byFrequency	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr9:34489429C>T	ENST00000242317.4	+	5	541	c.370C>T	c.(370-372)Cgc>Tgc	p.R124C	DNAI1_ENST00000488369.1_3'UTR	NM_001281428.1|NM_012144.2	NP_001268357.1|NP_036276.1	Q9UI46	DNAI1_HUMAN	dynein, axonemal, intermediate chain 1	124					cell projection organization (GO:0030030)|epithelial cilium movement (GO:0003351)|metabolic process (GO:0008152)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	motor activity (GO:0003774)	p.R124C(1)		autonomic_ganglia(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(13)|prostate(1)|skin(2)|urinary_tract(1)	34	all_epithelial(49;0.244)		LUSC - Lung squamous cell carcinoma(29;0.0107)|STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.0222)		GCAGCATTACCGCGATGAATT	0.517									Kartagener syndrome				C|||	2	0.000399361	0.0	0.0	5008	,	,		17295	0.0		0.001	False		,,,				2504	0.001				p.R124C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C370T	9						.	C	CYS/ARG	0,4406		0,0,2203	136.0	117.0	123.0		370	6.1	1.0	9	dbSNP_132	123	3,8597	3.0+/-9.4	0,3,4297	yes	missense	DNAI1	NM_012144.2	180	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	probably-damaging	124/700	34489429	3,13003	2203	4300	6503	34479429	SO:0001583	missense	27019	exon5	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AF091619	CCDS6557.1, CCDS75829.1	9p13.3	2013-02-19	2006-09-04		ENSG00000122735	ENSG00000122735		"""Axonemal dyneins"", ""WD repeat domain containing"""	2954	protein-coding gene	gene with protein product		604366	"""dynein, axonemal, intermediate polypeptide 1"""			10577904, 21953912	Standard	NM_012144		Approved	DIC1, PCD, CILD1	uc003zum.3	Q9UI46	OTTHUMG00000019825	ENST00000242317.4:c.370C>T	9.37:g.34489429C>T	ENSP00000242317:p.Arg124Cys	Somatic		Capture	SOLID	Phase_I	34479429	NM_012144	B7Z7U1|Q5T8G7|Q8NHQ7|Q9UEZ8	Missense_Mutation	SNP	ENST00000242317.4	37	CCDS6557.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	17.28	3.350415	0.61183	0.0	3.49E-4	ENSG00000122735	ENST00000396929;ENST00000242317;ENST00000437363	T;D	0.81821	1.5;-1.54	6.08	6.08	0.98989	.	0.684347	0.14346	N	0.325391	D	0.85544	0.5721	M	0.67397	2.05	0.80722	D	1	D	0.61697	0.99	P	0.52343	0.696	D	0.85024	0.0913	10	0.56958	D	0.05	.	16.1635	0.81734	0.0:1.0:0.0:0.0	.	124	Q9UI46	DNAI1_HUMAN	C	113;124;113	ENSP00000242317:R124C;ENSP00000395396:R113C	ENSP00000242317:R124C	R	+	1	0	DNAI1	34479429	0.858000	0.29795	0.974000	0.42286	0.241000	0.25554	1.808000	0.38912	2.894000	0.99253	0.655000	0.94253	CGC		DNAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052192.1		
TNC	3371	hgsc.bcm.edu	37	9	117788933	117788933	+	Missense_Mutation	SNP	C	C	T	rs140573419	byFrequency	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr9:117788933C>T	ENST00000350763.4	-	26	6622	c.6211G>A	c.(6211-6213)Gag>Aag	p.E2071K	TNC_ENST00000542877.1_Missense_Mutation_p.E1708K|TNC_ENST00000535648.1_Missense_Mutation_p.E1616K|TNC_ENST00000537320.1_Missense_Mutation_p.E1434K|TNC_ENST00000341037.4_Missense_Mutation_p.E1889K|TNC_ENST00000340094.3_Missense_Mutation_p.E1707K|TNC_ENST00000346706.3_Missense_Mutation_p.E1525K|TNC_ENST00000423613.2_Missense_Mutation_p.E1798K|TNC_ENST00000345230.3_Missense_Mutation_p.E1434K	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	2071	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)	p.E2071K(1)		NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						ACCCGGAGCTCGTACTGCCCC	0.557																																					p.E2071K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6211A	9						.	C	LYS/GLU	0,4406		0,0,2203	74.0	62.0	66.0		6211	5.6	1.0	9	dbSNP_134	66	3,8597	2.2+/-6.3	0,3,4297	yes	missense	TNC	NM_002160.3	56	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	probably-damaging	2071/2202	117788933	3,13003	2203	4300	6503	116828754	SO:0001583	missense	3371	exon26				CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.6211G>A	9.37:g.117788933C>T	ENSP00000265131:p.Glu2071Lys	Somatic		Capture	SOLID	Phase_I	116828754	NM_002160	C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	ENST00000350763.4	37	CCDS6811.1	.	.	.	.	.	.	.	.	.	.	C	36	5.825201	0.96989	0.0	3.49E-4	ENSG00000041982	ENST00000340094;ENST00000535648;ENST00000346706;ENST00000345230;ENST00000350763;ENST00000341037;ENST00000423613;ENST00000537320;ENST00000542877	T;T;T;T;T;T;T;T;T	0.23147	1.92;1.92;1.92;1.92;1.92;1.92;1.92;1.92;1.92	5.61	5.61	0.85477	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.000000	0.85682	D	0.000000	T	0.54679	0.1873	M	0.73598	2.24	0.48901	D	0.999728	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.56426	-0.7981	10	0.72032	D	0.01	.	19.6248	0.95674	0.0:1.0:0.0:0.0	.	1798;2071	E9PC84;P24821	.;TENA_HUMAN	K	1707;1616;1525;1434;2071;1889;1798;1434;1708	ENSP00000344400:E1707K;ENSP00000438152:E1616K;ENSP00000344555:E1525K;ENSP00000345861:E1434K;ENSP00000265131:E2071K;ENSP00000339553:E1889K;ENSP00000411406:E1798K;ENSP00000443478:E1434K;ENSP00000442242:E1708K	ENSP00000344400:E1707K	E	-	1	0	TNC	116828754	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.487000	0.81328	2.631000	0.89168	0.655000	0.94253	GAG		TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055418.2	NM_002160	
METTL21C	196541	hgsc.bcm.edu	37	13	103346828	103346828	+	Silent	SNP	G	G	A	rs559397528		TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr13:103346828G>A	ENST00000267273.6	-	1	26	c.21C>T	c.(19-21)tcC>tcT	p.S7S		NM_001010977.1	NP_001010977.1	Q5VZV1	MT21C_HUMAN	methyltransferase like 21C	7					peptidyl-lysine methylation (GO:0018022)|protein methylation (GO:0006479)	nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)	p.S7S(1)		breast(1)|large_intestine(3)|lung(2)|skin(1)	7						GCTGCTGCGCGGAGCTCAGAC	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		9522	0.0		0.0	False		,,,				2504	0.001				p.S7S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C21T	13						.						14.0	16.0	15.0					13																	103346828		2201	4299	6500	102144829	SO:0001819	synonymous_variant	196541	exon1				CCDS32003.1	13q33.1	2011-03-03	2011-03-03	2011-03-03	ENSG00000139780	ENSG00000139780			33717	protein-coding gene	gene with protein product		615259	"""chromosome 13 open reading frame 39"""	C13orf39			Standard	NM_001010977		Approved	LOC196541	uc001vpj.4	Q5VZV1	OTTHUMG00000017304	ENST00000267273.6:c.21C>T	13.37:g.103346828G>A		Somatic		Capture	SOLID	Phase_I	102144829	NM_001010977		Silent	SNP	ENST00000267273.6	37	CCDS32003.1																																																																																				METTL21C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045682.2	NM_001010977	
BRCA2	675	hgsc.bcm.edu	37	13	32914956	32914956	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr13:32914956T>A	ENST00000380152.3	+	11	6697	c.6464T>A	c.(6463-6465)cTc>cAc	p.L2155H	BRCA2_ENST00000544455.1_Missense_Mutation_p.L2155H			P51587	BRCA2_HUMAN	breast cancer 2, early onset	2155					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)	p.L2155H(2)		NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TCTCCATATCTCTCTCAATTT	0.318			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											p.L2155H	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T6464A	13						.						39.0	41.0	40.0					13																	32914956		2203	4296	6499	31812956	SO:0001583	missense	675	exon11	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.6464T>A	13.37:g.32914956T>A	ENSP00000369497:p.Leu2155His	Somatic		Capture	SOLID	Phase_I	31812956	NM_000059	O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	ENST00000380152.3	37	CCDS9344.1	.	.	.	.	.	.	.	.	.	.	T	5.578	0.291472	0.10567	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	T;T	0.78595	-1.19;-1.19	4.57	-0.832	0.10785	.	0.909697	0.09164	N	0.839740	T	0.73984	0.3657	L	0.59436	1.845	0.09310	N	1	D	0.58620	0.983	P	0.46975	0.533	T	0.64110	-0.6484	10	0.66056	D	0.02	.	6.0256	0.19652	0.0:0.351:0.1485:0.5004	.	2155	P51587	BRCA2_HUMAN	H	2155	ENSP00000369497:L2155H;ENSP00000439902:L2155H	ENSP00000369497:L2155H	L	+	2	0	BRCA2	31812956	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.741000	0.04855	0.009000	0.14813	-0.353000	0.07706	CTC		BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059	
TRPC4	7223	hgsc.bcm.edu	37	13	38248466	38248466	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr13:38248466C>T	ENST00000379705.3	-	5	2130	c.1273G>A	c.(1273-1275)Gga>Aga	p.G425R	TRPC4_ENST00000355779.2_Missense_Mutation_p.G425R|TRPC4_ENST00000494529.1_5'UTR|TRPC4_ENST00000379681.3_Missense_Mutation_p.G425R|TRPC4_ENST00000338947.5_Missense_Mutation_p.G252R|TRPC4_ENST00000426868.2_Missense_Mutation_p.G425R|TRPC4_ENST00000358477.2_Missense_Mutation_p.G425R|TRPC4_ENST00000447043.1_Missense_Mutation_p.G425R|TRPC4_ENST00000379679.1_Missense_Mutation_p.G252R|TRPC4_ENST00000379673.2_Missense_Mutation_p.G425R			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	425					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.G425R(1)		NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		TCCTGAAGTCCGCCATCCCAC	0.333																																					p.G425R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1273A	13						.						102.0	99.0	100.0					13																	38248466		2202	4300	6502	37146466	SO:0001583	missense	7223	exon5			U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.1273G>A	13.37:g.38248466C>T	ENSP00000369027:p.Gly425Arg	Somatic		Capture	SOLID	Phase_I	37146466	NM_001135957	B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Missense_Mutation	SNP	ENST00000379705.3	37	CCDS9365.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.897469	0.91962	.	.	ENSG00000133107	ENST00000379705;ENST00000379681;ENST00000338947;ENST00000379679;ENST00000426868;ENST00000355779;ENST00000358477;ENST00000379673;ENST00000447043	D;D;D;D;D;D;D;D;D	0.98987	-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3	5.16	5.16	0.70880	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99351	0.9772	M	0.86178	2.8	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.99174	1.0865	10	0.87932	D	0	-26.1818	18.9997	0.92828	0.0:1.0:0.0:0.0	.	425;425;425;252;425;425	Q9UBN4-3;Q9UBN4-4;Q9UBN4-5;Q9UBN4-6;Q9UBN4-2;Q9UBN4	.;.;.;.;.;TRPC4_HUMAN	R	425;425;252;252;425;425;425;425;425	ENSP00000369027:G425R;ENSP00000369003:G425R;ENSP00000342580:G252R;ENSP00000369001:G252R;ENSP00000410133:G425R;ENSP00000348025:G425R;ENSP00000351264:G425R;ENSP00000368995:G425R;ENSP00000414316:G425R	ENSP00000342580:G252R	G	-	1	0	TRPC4	37146466	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	7.776000	0.85560	2.549000	0.85964	0.591000	0.81541	GGA		TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044574.2	NM_003306	
EDNRB	1910	hgsc.bcm.edu	37	13	78474662	78474662	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr13:78474662A>C	ENST00000334286.5	-	5	1315	c.1079T>G	c.(1078-1080)cTt>cGt	p.L360R	EDNRB_ENST00000446573.1_Missense_Mutation_p.L360R|EDNRB_ENST00000377211.4_Missense_Mutation_p.L450R	NM_000115.3|NM_001122659.2	NP_000106.1|NP_001116131.1	P24530	EDNRB_HUMAN	endothelin receptor type B	360					aging (GO:0007568)|cell surface receptor signaling pathway (GO:0007166)|cellular response to lipopolysaccharide (GO:0071222)|cGMP-mediated signaling (GO:0019934)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|enteric smooth muscle cell differentiation (GO:0035645)|epithelial fluid transport (GO:0042045)|macrophage chemotaxis (GO:0048246)|melanocyte differentiation (GO:0030318)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of neuron maturation (GO:0014043)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|peripheral nervous system development (GO:0007422)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|posterior midgut development (GO:0007497)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|regulation of fever generation (GO:0031620)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|response to organic cyclic compound (GO:0014070)|response to pain (GO:0048265)|sensory perception of pain (GO:0019233)|vasoconstriction (GO:0042310)|vasodilation (GO:0042311)|vein smooth muscle contraction (GO:0014826)	integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)	endothelin receptor activity (GO:0004962)|peptide hormone binding (GO:0017046)	p.L360R(2)		breast(2)|endometrium(2)|kidney(1)|large_intestine(18)|lung(16)|skin(3)	42		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0933)	Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	TTACCTCAAAAGTTCACATCT	0.413																																					p.L360R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T1079G	13						.						78.0	81.0	80.0					13																	78474662		2203	4300	6503	77372663	SO:0001583	missense	1910	exon5			L06623	CCDS9461.1, CCDS55902.1	13q22	2012-08-08			ENSG00000136160	ENSG00000136160		"""GPCR / Class A : Endothelin receptors"""	3180	protein-coding gene	gene with protein product		131244		HSCR2, HSCR		1659806, 9556633	Standard	NM_000115		Approved	ETB	uc001vkp.1	P24530	OTTHUMG00000017111	ENST00000334286.5:c.1079T>G	13.37:g.78474662A>C	ENSP00000335311:p.Leu360Arg	Somatic		Capture	SOLID	Phase_I	77372663	NM_001122659	A2A2Z8|A8K3T4|O15343|Q59GB1|Q5W0G9|Q8NHM6|Q8NHM7|Q8NHM8|Q8NHM9|Q9UD23|Q9UQK3	Missense_Mutation	SNP	ENST00000334286.5	37	CCDS9461.1	.	.	.	.	.	.	.	.	.	.	A	25.1	4.600478	0.87055	.	.	ENSG00000136160	ENST00000377211;ENST00000446573;ENST00000334286	T;T;T	0.73681	-0.77;-0.77;-0.77	5.62	5.62	0.85841	GPCR, rhodopsin-like superfamily (1);	0.113669	0.64402	D	0.000009	D	0.88955	0.6578	M	0.91406	3.205	0.58432	D	0.999996	D;B;D	0.89917	1.0;0.185;0.999	D;B;D	0.76575	0.978;0.205;0.988	D	0.91272	0.5045	10	0.72032	D	0.01	-8.8774	16.1323	0.81449	1.0:0.0:0.0:0.0	.	360;450;360	P24530-2;P24530-3;P24530	.;.;EDNRB_HUMAN	R	450;360;360	ENSP00000366416:L450R;ENSP00000403401:L360R;ENSP00000335311:L360R	ENSP00000335311:L360R	L	-	2	0	EDNRB	77372663	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.910000	0.92685	2.277000	0.76020	0.528000	0.53228	CTT		EDNRB-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276505.1		
FAM155A	728215	hgsc.bcm.edu	37	13	107823115	107823115	+	Silent	SNP	T	T	A			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr13:107823115T>A	ENST00000375915.2	-	3	1245	c.1107A>T	c.(1105-1107)ctA>ctT	p.L369L		NM_001080396.2	NP_001073865.1	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	369						integral component of membrane (GO:0016021)		p.L369L(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						CATCATTGGTTAGAAAGGTTT	0.423																																					p.L369L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1107T	13						.						143.0	118.0	126.0					13																	107823115		2203	4300	6503	106621116	SO:0001819	synonymous_variant	728215	exon3			L10374	CCDS32006.1	13q33.3	2008-04-15			ENSG00000204442	ENSG00000204442			33877	protein-coding gene	gene with protein product							Standard	NM_001080396		Approved		uc001vql.3	B1AL88	OTTHUMG00000017326	ENST00000375915.2:c.1107A>T	13.37:g.107823115T>A		Somatic		Capture	SOLID	Phase_I	106621116	NM_001080396	B2RUV1|B7Z334	Silent	SNP	ENST00000375915.2	37	CCDS32006.1																																																																																				FAM155A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045736.2	NM_001080396	
SORCS1	114815	hgsc.bcm.edu	37	10	108389026	108389026	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr10:108389026G>A	ENST00000263054.6	-	19	2603	c.2596C>T	c.(2596-2598)Cgt>Tgt	p.R866C	SORCS1_ENST00000369698.1_Missense_Mutation_p.R401C|SORCS1_ENST00000344440.6_Missense_Mutation_p.R866C	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	866	PKD. {ECO:0000255|PROSITE- ProRule:PRU00151}.				neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)	p.R866C(1)		breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		ACGGTCACACGGAAAATGCCC	0.478																																					p.R866C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2596T	10						.						161.0	116.0	131.0					10																	108389026		2203	4300	6503	108379016	SO:0001583	missense	114815	exon19			AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.2596C>T	10.37:g.108389026G>A	ENSP00000263054:p.Arg866Cys	Somatic		Capture	SOLID	Phase_I	108379016	NM_052918	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	ENST00000263054.6	37	CCDS7559.1	.	.	.	.	.	.	.	.	.	.	G	31	5.097514	0.94197	.	.	ENSG00000108018	ENST00000369698;ENST00000263054;ENST00000344440	T;T;T	0.61392	0.11;0.11;0.11	5.82	5.82	0.92795	PKD/Chitinase domain (1);PKD domain (4);	0.082822	0.51477	D	0.000086	T	0.74168	0.3681	L	0.60455	1.87	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.76071	0.987;0.977;0.982;0.987;0.982	T	0.70680	-0.4805	9	.	.	.	-10.1026	20.1001	0.97870	0.0:0.0:1.0:0.0	.	866;866;866;866;866	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	C	401;866;866	ENSP00000358712:R401C;ENSP00000263054:R866C;ENSP00000345964:R866C	.	R	-	1	0	SORCS1	108379016	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.332000	0.59279	2.760000	0.94817	0.655000	0.94253	CGT		SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918	
GPR158	57512	hgsc.bcm.edu	37	10	25701343	25701343	+	Silent	SNP	C	C	T			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr10:25701343C>T	ENST00000376351.3	+	4	1635	c.1276C>T	c.(1276-1278)Ctg>Ttg	p.L426L		NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	426					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.L426L(1)		breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						CTTCCAAGCCCTGTGTATGCT	0.512																																					p.L426L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1276T	10						.						234.0	200.0	212.0					10																	25701343		2203	4300	6503	25741349	SO:0001819	synonymous_variant	57512	exon4			AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.1276C>T	10.37:g.25701343C>T		Somatic		Capture	SOLID	Phase_I	25741349	NM_020752	Q6QR81|Q9ULT3	Silent	SNP	ENST00000376351.3	37	CCDS31166.1																																																																																				GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047248.2	XM_166110	
TNKS2	80351	hgsc.bcm.edu	37	10	93601073	93601073	+	Silent	SNP	T	T	C			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr10:93601073T>C	ENST00000371627.4	+	15	2086	c.1707T>C	c.(1705-1707)taT>taC	p.Y569Y		NM_025235.3	NP_079511.1	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2	569					multicellular organism growth (GO:0035264)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein polyubiquitination (GO:0000209)|regulation of multicellular organism growth (GO:0040014)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.Y569Y(1)		biliary_tract(1)|breast(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	48		Colorectal(252;0.162)				CATGTTCTTATGGACATTATG	0.318																																					p.Y569Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1707C	10						.						119.0	113.0	115.0					10																	93601073		2203	4300	6503	93591053	SO:0001819	synonymous_variant	80351	exon15			AF342982	CCDS7417.1	10q23.3	2013-01-10			ENSG00000107854	ENSG00000107854		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15677	protein-coding gene	gene with protein product		607128					Standard	NM_025235		Approved	TNKL, TANK2, PARP-5b, PARP-5c, PARP5B, PARP5C, pART6	uc001khp.3	Q9H2K2	OTTHUMG00000018747	ENST00000371627.4:c.1707T>C	10.37:g.93601073T>C		Somatic		Capture	SOLID	Phase_I	93591053	NM_025235	B2RBD3|Q9H8F2|Q9HAS4	Silent	SNP	ENST00000371627.4	37	CCDS7417.1																																																																																				TNKS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049374.1	NM_025235	
DNTT	1791	hgsc.bcm.edu	37	10	98092166	98092166	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr10:98092166G>T	ENST00000371174.2	+	9	1274	c.1172G>T	c.(1171-1173)aGc>aTc	p.S391I	DNTT_ENST00000419175.1_Missense_Mutation_p.S391I			P04053	TDT_HUMAN	DNA nucleotidylexotransferase	391	Mediates interaction with DNTTIP2.				DNA modification (GO:0006304)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA nucleotidylexotransferase activity (GO:0003912)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)	p.S391I(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	27		Colorectal(252;0.0815)|all_hematologic(284;0.224)		Epithelial(162;7.97e-08)|all cancers(201;1.89e-06)		AGGTTGCCTAGCAGGAAGGTT	0.423																																					p.S391I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1172T	10						.						113.0	111.0	112.0					10																	98092166		2203	4300	6503	98082156	SO:0001583	missense	1791	exon9			AB046378	CCDS7447.1	10q23-q24	2013-05-21	2013-05-21		ENSG00000107447	ENSG00000107447	2.7.7.31	"""DNA polymerases"""	2983	protein-coding gene	gene with protein product	"""Terminal deoxynucleotidyltransferase"""	187410	"""deoxynucleotidyltransferase, terminal"""				Standard	NM_004088		Approved	TDT	uc001kmf.3	P04053	OTTHUMG00000018832	ENST00000371174.2:c.1172G>T	10.37:g.98092166G>T	ENSP00000360216:p.Ser391Ile	Somatic		Capture	SOLID	Phase_I	98082156	NM_004088	Q53FH1|Q5W103|Q96E50	Missense_Mutation	SNP	ENST00000371174.2	37	CCDS7447.1	.	.	.	.	.	.	.	.	.	.	G	19.66	3.869009	0.72065	.	.	ENSG00000107447	ENST00000419175;ENST00000371174	T;T	0.42513	0.97;0.97	5.81	5.81	0.92471	DNA-directed DNA polymerase X (1);Nucleotidyl transferase domain (1);	0.090322	0.64402	D	0.000001	T	0.66268	0.2772	M	0.78916	2.43	0.45580	D	0.998521	D;D	0.89917	1.0;1.0	D;D	0.71870	0.958;0.975	T	0.67356	-0.5691	10	0.56958	D	0.05	-4.3136	17.5668	0.87922	0.0:0.0:1.0:0.0	.	391;391	P04053-2;P04053	.;TDT_HUMAN	I	391	ENSP00000401169:S391I;ENSP00000360216:S391I	ENSP00000360216:S391I	S	+	2	0	DNTT	98082156	1.000000	0.71417	0.998000	0.56505	0.848000	0.48234	5.823000	0.69272	2.750000	0.94351	0.655000	0.94253	AGC		DNTT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049607.1	NM_004088	
PLEKHA1	59338	hgsc.bcm.edu	37	10	124184459	124184459	+	Missense_Mutation	SNP	G	G	A	rs373796370		TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr10:124184459G>A	ENST00000368990.3	+	10	925	c.794G>A	c.(793-795)cGa>cAa	p.R265Q	PLEKHA1_ENST00000538022.1_Missense_Mutation_p.R265Q|PLEKHA1_ENST00000368988.1_Missense_Mutation_p.R265Q|PLEKHA1_ENST00000368989.2_Missense_Mutation_p.R265Q|PLEKHA1_ENST00000433307.1_Missense_Mutation_p.R265Q	NM_001001974.2	NP_001001974.1	Q9HB21	PKHA1_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1	265	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				androgen metabolic process (GO:0008209)|B cell receptor signaling pathway (GO:0050853)|cellular response to hydrogen peroxide (GO:0070301)|establishment of protein localization (GO:0045184)|estrogen metabolic process (GO:0008210)|face morphogenesis (GO:0060325)|Leydig cell differentiation (GO:0033327)|luteinization (GO:0001553)|multicellular organism growth (GO:0035264)|negative regulation of protein kinase B signaling (GO:0051898)|palate development (GO:0060021)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic development (GO:0009791)|ruffle organization (GO:0031529)|skeletal system morphogenesis (GO:0048705)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)	p.R265Q(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|urinary_tract(1)	13		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				ACAACGTCTCGAACTTTCTAT	0.308																																					p.R265Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G794A	10						.	G	GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	103.0	104.0	104.0		794,794,794	5.5	1.0	10		104	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	PLEKHA1	NM_001001974.2,NM_001195608.1,NM_021622.4	43,43,43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	265/405,265/335,265/405	124184459	1,13005	2203	4300	6503	124174449	SO:0001583	missense	59338	exon10			AF286160	CCDS7629.1, CCDS55730.1	10q26.3	2013-01-10	2002-01-14		ENSG00000107679	ENSG00000107679		"""Pleckstrin homology (PH) domain containing"""	14335	protein-coding gene	gene with protein product	"""tandem PH domain containing protein-1"""	607772	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 1"""			11001876, 15485858	Standard	NM_001001974		Approved	TAPP1	uc001lge.2	Q9HB21	OTTHUMG00000019184	ENST00000368990.3:c.794G>A	10.37:g.124184459G>A	ENSP00000357986:p.Arg265Gln	Somatic		Capture	SOLID	Phase_I	124174449	NM_001001974	B3KQ55|D3DRE2|Q9BVK0	Missense_Mutation	SNP	ENST00000368990.3	37	CCDS7629.1	.	.	.	.	.	.	.	.	.	.	G	35	5.449623	0.96205	0.0	1.16E-4	ENSG00000107679	ENST00000368990;ENST00000368989;ENST00000409427;ENST00000368988;ENST00000538022;ENST00000433307	T;T;T;T;T	0.16897	2.31;2.31;2.31;2.31;2.31	5.53	5.53	0.82687	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.48447	0.1500	M	0.84082	2.675	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.988;0.997	T	0.48917	-0.8992	10	0.59425	D	0.04	-12.2488	19.4339	0.94783	0.0:0.0:1.0:0.0	.	265;265	B3KQ55;Q9HB21	.;PKHA1_HUMAN	Q	265	ENSP00000357986:R265Q;ENSP00000357985:R265Q;ENSP00000357984:R265Q;ENSP00000438608:R265Q;ENSP00000394416:R265Q	ENSP00000357984:R265Q	R	+	2	0	PLEKHA1	124174449	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.203000	0.95033	2.755000	0.94549	0.650000	0.86243	CGA		PLEKHA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050783.1	NM_001001974	
SLCO4C1	353189	hgsc.bcm.edu	37	5	101599459	101599459	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr5:101599459T>A	ENST00000310954.6	-	4	1114	c.828A>T	c.(826-828)ttA>ttT	p.L276F		NM_180991.4	NP_851322.3			solute carrier organic anion transporter family, member 4C1									p.L276F(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	50		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)		TAGCAGGGCCTAAGATTGACA	0.368																																					p.L276F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A828T	5						.						144.0	137.0	140.0					5																	101599459		2203	4300	6503	101627358	SO:0001583	missense	353189	exon4			AY273896	CCDS34205.1	5q21	2013-05-22	2003-11-25		ENSG00000173930	ENSG00000173930		"""Solute carriers"""	23612	protein-coding gene	gene with protein product		609013					Standard	NM_180991		Approved	SLC21A20, OATP4C1, OATPX, OATP-H	uc003knm.3	Q6ZQN7	OTTHUMG00000162757	ENST00000310954.6:c.828A>T	5.37:g.101599459T>A	ENSP00000309741:p.Leu276Phe	Somatic		Capture	SOLID	Phase_I	101627358	NM_180991		Missense_Mutation	SNP	ENST00000310954.6	37	CCDS34205.1	.	.	.	.	.	.	.	.	.	.	T	13.13	2.146516	0.37923	.	.	ENSG00000173930	ENST00000310954	T	0.43294	0.95	5.24	-2.88	0.05682	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.122413	0.35495	N	0.003176	T	0.28599	0.0708	L	0.43923	1.385	0.27475	N	0.952762	B	0.17038	0.02	B	0.26310	0.068	T	0.18398	-1.0338	10	0.30078	T	0.28	.	7.34	0.26632	0.2542:0.5297:0.0:0.2161	.	276	Q6ZQN7	SO4C1_HUMAN	F	276	ENSP00000309741:L276F	ENSP00000309741:L276F	L	-	3	2	SLCO4C1	101627358	0.997000	0.39634	0.375000	0.26029	0.778000	0.44026	0.196000	0.17176	-0.436000	0.07254	-0.263000	0.10527	TTA		SLCO4C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370332.1	NM_180991	
APC	324	hgsc.bcm.edu	37	5	112137036	112137036	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr5:112137036C>T	ENST00000457016.1	+	8	1170	c.790C>T	c.(790-792)Caa>Taa	p.Q264*	APC_ENST00000257430.4_Nonsense_Mutation_p.Q264*|APC_ENST00000508376.2_Nonsense_Mutation_p.Q264*			P25054	APC_HUMAN	adenomatous polyposis coli	264	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Q264*(2)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GAATGAAGGTCAAGGAGTGGG	0.353		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Q246X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,colon,Substitution - Nonsense,0	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C736T	5	GRCh37	CM042289	APC	M		.						88.0	86.0	87.0					5																	112137036		2202	4300	6502	112164935	SO:0001587	stop_gained	324	exon6	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.790C>T	5.37:g.112137036C>T	ENSP00000413133:p.Gln264*	Somatic		Capture	SOLID	Phase_I	112164935	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	40	8.145105	0.98675	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.36	5.36	0.76844	.	0.458788	0.24864	N	0.034995	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-2.9982	19.0871	0.93209	0.0:1.0:0.0:0.0	.	.	.	.	X	264;246;264;264;264	.	ENSP00000257430:Q264X	Q	+	1	0	APC	112164935	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.677000	0.68142	2.504000	0.84457	0.585000	0.79938	CAA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
APC	324	hgsc.bcm.edu	37	5	112175235	112175235	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr5:112175235C>A	ENST00000457016.1	+	16	4324	c.3944C>A	c.(3943-3945)tCa>tAa	p.S1315*	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Nonsense_Mutation_p.S1315*|APC_ENST00000508376.2_Nonsense_Mutation_p.S1315*			P25054	APC_HUMAN	adenomatous polyposis coli	1315	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.S1315*(12)|p.S1315fs*3(2)|p.S1315L(1)|p.?(1)|p.K1192fs*3(1)|p.S1315fs*1(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GGAACTAGGTCAGCTGAAGAT	0.443		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.S1297X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,colon,Substitution - Nonsense,0	.	18	Substitution - Nonsense(12)|Insertion - Frameshift(2)|Deletion - Frameshift(2)|Unknown(1)|Substitution - Missense(1)	large_intestine(16)|soft_tissue(1)|skin(1)	c.C3890A	5	GRCh37	CM021066	APC	M		.						59.0	61.0	60.0					5																	112175235		2202	4300	6502	112203134	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3944C>A	5.37:g.112175235C>A	ENSP00000413133:p.Ser1315*	Somatic		Capture	SOLID	Phase_I	112203134	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	36	5.719660	0.96839	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.03	6.03	0.97812	.	0.642461	0.16403	N	0.215929	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-3.6185	20.1672	0.98154	0.0:1.0:0.0:0.0	.	.	.	.	X	1315	.	.	S	+	2	0	APC	112203134	0.319000	0.24607	0.010000	0.14722	0.068000	0.16541	4.424000	0.59868	2.861000	0.98227	0.655000	0.94253	TCA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
APC	324	hgsc.bcm.edu	37	5	112178847	112178847	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr5:112178847A>G	ENST00000457016.1	+	16	7936	c.7556A>G	c.(7555-7557)gAt>gGt	p.D2519G	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Missense_Mutation_p.D2519G|APC_ENST00000508376.2_Missense_Mutation_p.D2519G			P25054	APC_HUMAN	adenomatous polyposis coli	2519	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.D2519G(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GAGTATAATGATGGAAGACCA	0.473		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.D2501G	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	2	Substitution - Missense(1)|Unknown(1)	large_intestine(1)|skin(1)	c.A7502G	5						.						96.0	85.0	89.0					5																	112178847		2202	4299	6501	112206746	SO:0001583	missense	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.7556A>G	5.37:g.112178847A>G	ENSP00000413133:p.Asp2519Gly	Somatic		Capture	SOLID	Phase_I	112206746	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	A	14.44	2.534823	0.45073	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	D;D;D	0.84070	-1.8;-1.8;-1.8	6.07	6.07	0.98685	Adenomatous polyposis coli protein basic domain (1);	0.115400	0.64402	D	0.000016	D	0.82995	0.5158	L	0.44542	1.39	0.53005	D	0.999967	B;P	0.49783	0.008;0.928	B;P	0.53185	0.019;0.72	T	0.82014	-0.0667	9	.	.	.	-22.5307	10.8883	0.46981	0.9305:0.0:0.0695:0.0	.	2521;2519	Q4LE70;P25054	.;APC_HUMAN	G	2519	ENSP00000413133:D2519G;ENSP00000257430:D2519G;ENSP00000427089:D2519G	.	D	+	2	0	APC	112206746	1.000000	0.71417	0.998000	0.56505	0.900000	0.52787	7.425000	0.80255	2.326000	0.78906	0.533000	0.62120	GAT		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
TRIM36	55521	hgsc.bcm.edu	37	5	114462493	114462493	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr5:114462493G>C	ENST00000282369.3	-	10	2015	c.1894C>G	c.(1894-1896)Cca>Gca	p.P632A	TRIM36_ENST00000513154.1_Missense_Mutation_p.P620A|TRIM36_ENST00000514154.1_Missense_Mutation_p.P477A	NM_018700.3	NP_061170.2	Q9NQ86	TRI36_HUMAN	tripartite motif containing 36	632	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				acrosome reaction (GO:0007340)|regulation of cell cycle (GO:0051726)	acrosomal vesicle (GO:0001669)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P632A(1)		breast(3)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	37		all_cancers(142;0.00133)|all_epithelial(76;2.41e-05)|Prostate(80;0.00955)|Ovarian(225;0.0443)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;3.62e-08)|Epithelial(69;7.69e-08)|all cancers(49;9.33e-06)		AAGGTAAATGGTTGTGAAGAA	0.378																																					p.P632A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1894G	5						.						93.0	92.0	93.0					5																	114462493		2202	4300	6502	114490392	SO:0001583	missense	55521	exon10			AJ272269	CCDS4115.1, CCDS34211.1, CCDS34212.1, CCDS75287.1	5q22	2013-02-11	2011-01-25		ENSG00000152503	ENSG00000152503		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	16280	protein-coding gene	gene with protein product	"""zinc-binding protein Rbcc728"", ""tripartite motif protein 36"", ""RING finger protein 98"""	609317	"""tripartite motif-containing 36"""			11331580	Standard	XM_005272031		Approved	RBCC728, RNF98, HAPRIN	uc003kqs.3	Q9NQ86	OTTHUMG00000128892	ENST00000282369.3:c.1894C>G	5.37:g.114462493G>C	ENSP00000282369:p.Pro632Ala	Somatic		Capture	SOLID	Phase_I	114490392	NM_018700	A1L3Z1|A6NDD0|B7Z3V4|B7ZAV7|E9PFI8|Q0P5Z9	Missense_Mutation	SNP	ENST00000282369.3	37	CCDS4115.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.213714	0.79352	.	.	ENSG00000152503	ENST00000282369;ENST00000513154;ENST00000514154	T;T;T	0.67523	-0.27;-0.27;-0.27	5.37	5.37	0.77165	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.111231	0.64402	D	0.000007	T	0.77579	0.4151	L	0.45581	1.43	0.80722	D	1	D;D	0.63046	0.992;0.991	P;D	0.72075	0.883;0.976	T	0.74259	-0.3723	10	0.34782	T	0.22	.	19.4818	0.95013	0.0:0.0:1.0:0.0	.	620;632	E9PFI8;Q9NQ86	.;TRI36_HUMAN	A	632;620;477	ENSP00000282369:P632A;ENSP00000423934:P620A;ENSP00000424259:P477A	ENSP00000282369:P632A	P	-	1	0	TRIM36	114490392	1.000000	0.71417	0.253000	0.24343	0.902000	0.53008	9.203000	0.95033	2.658000	0.90341	0.591000	0.81541	CCA		TRIM36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250854.2	NM_018700	
PCDHA2	56146	hgsc.bcm.edu	37	5	140175607	140175607	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr5:140175607C>T	ENST00000526136.1	+	1	1058	c.1058C>T	c.(1057-1059)aCg>aTg	p.T353M	PCDHA2_ENST00000520672.2_Missense_Mutation_p.T353M|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000378132.1_Missense_Mutation_p.T353M	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	353	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.T353M(2)		NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTCTCAATAACGTCTCTCTCA	0.463																																					p.T353M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1058T	5						.						89.0	76.0	81.0					5																	140175607		2203	4300	6503	140155791	SO:0001583	missense	56146	exon1			AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.1058C>T	5.37:g.140175607C>T	ENSP00000431748:p.Thr353Met	Somatic		Capture	SOLID	Phase_I	140155791	NM_018905	O75287|Q9BTV3	Missense_Mutation	SNP	ENST00000526136.1	37	CCDS54914.1	.	.	.	.	.	.	.	.	.	.	c	12.78	2.040551	0.35989	.	.	ENSG00000204969	ENST00000520672;ENST00000378132;ENST00000526136	T;T;T	0.60040	0.22;0.22;0.22	3.92	2.03	0.26663	Cadherin (2);Cadherin-like (1);	0.182328	0.25714	U	0.028800	T	0.63885	0.2549	L	0.58101	1.795	0.09310	N	0.999999	D;P;D	0.58970	0.972;0.916;0.984	P;B;P	0.55011	0.686;0.341;0.766	T	0.58781	-0.7576	10	0.66056	D	0.02	.	12.0616	0.53566	0.4487:0.5513:0.0:0.0	.	353;353;353	Q9Y5H9-3;Q9Y5H9;Q9Y5H9-2	.;PCDA2_HUMAN;.	M	353	ENSP00000430584:T353M;ENSP00000367372:T353M;ENSP00000431748:T353M	ENSP00000367372:T353M	T	+	2	0	PCDHA2	140155791	0.000000	0.05858	0.169000	0.22859	0.928000	0.56348	0.209000	0.17435	0.383000	0.24910	0.650000	0.86243	ACG		PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372877.3	NM_018905	
PCDHB1	29930	hgsc.bcm.edu	37	5	140432201	140432201	+	Silent	SNP	C	C	T			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr5:140432201C>T	ENST00000306549.3	+	1	1223	c.1146C>T	c.(1144-1146)gtC>gtT	p.V382V		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	382	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V382V(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GAGGAAAAGTCACCTGCTTCC	0.502																																					p.V382V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1146T	5						.						111.0	104.0	106.0					5																	140432201		2203	4300	6503	140412385	SO:0001819	synonymous_variant	29930	exon1			AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.1146C>T	5.37:g.140432201C>T		Somatic		Capture	SOLID	Phase_I	140412385	NM_013340	Q2M257	Silent	SNP	ENST00000306549.3	37	CCDS4243.1																																																																																				PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251822.2	NM_013340	
SLC36A2	153201	hgsc.bcm.edu	37	5	150723758	150723758	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr5:150723758C>G	ENST00000335244.4	-	2	364	c.235G>C	c.(235-237)Gtg>Ctg	p.V79L	SLC36A2_ENST00000521967.1_Missense_Mutation_p.V79L	NM_181776.2	NP_861441.2	Q495M3	S36A2_HUMAN	solute carrier family 36 (proton/amino acid symporter), member 2	79					amino acid transport (GO:0006865)|ion transport (GO:0006811)|proline transmembrane transport (GO:0035524)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine transmembrane transporter activity (GO:0015187)|hydrogen:amino acid symporter activity (GO:0005280)|L-alanine transmembrane transporter activity (GO:0015180)|L-proline transmembrane transporter activity (GO:0015193)	p.V79L(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(14)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	33		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Cycloserine(DB00260)	GCGTTCTTCACAGCGAGGGGT	0.537																																					p.V79L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G235C	5						.						93.0	81.0	85.0					5																	150723758		2203	4300	6503	150703951	SO:0001583	missense	153201	exon2			AY162214	CCDS4315.1	5q33.1	2013-05-22			ENSG00000186335	ENSG00000186335		"""Solute carriers"""	18762	protein-coding gene	gene with protein product		608331				11959859	Standard	NM_181776		Approved	PAT2, tramdorin, TRAMD1	uc003lty.3	Q495M3	OTTHUMG00000130129	ENST00000335244.4:c.235G>C	5.37:g.150723758C>G	ENSP00000334223:p.Val79Leu	Somatic		Capture	SOLID	Phase_I	150703951	NM_181776	Q495M4|Q495M6|Q6ZWK5|Q7Z6B5	Missense_Mutation	SNP	ENST00000335244.4	37	CCDS4315.1	.	.	.	.	.	.	.	.	.	.	C	11.44	1.639229	0.29157	.	.	ENSG00000186335	ENST00000335244;ENST00000521967	T;T	0.02050	4.48;4.48	5.07	0.0823	0.14428	.	0.422514	0.25848	N	0.027914	T	0.02571	0.0078	L	0.53561	1.675	0.80722	D	1	B;B;B	0.19935	0.04;0.005;0.012	B;B;B	0.24006	0.05;0.03;0.033	T	0.46219	-0.9207	10	0.59425	D	0.04	-3.598	4.7318	0.12968	0.1421:0.4588:0.0:0.399	.	79;79;79	B4DMY0;E5RJJ5;Q495M3	.;.;S36A2_HUMAN	L	79	ENSP00000334223:V79L;ENSP00000430535:V79L	ENSP00000334223:V79L	V	-	1	0	SLC36A2	150703951	0.753000	0.28349	0.799000	0.32177	0.468000	0.32798	0.569000	0.23638	0.004000	0.14682	0.650000	0.86243	GTG		SLC36A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252437.1		
GABRA6	2559	hgsc.bcm.edu	37	5	161116331	161116331	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr5:161116331A>C	ENST00000274545.5	+	5	951	c.518A>C	c.(517-519)aAg>aCg	p.K173T	GABRA6_ENST00000523217.1_Missense_Mutation_p.K163T|RP11-348M17.2_ENST00000521984.1_RNA			Q16445	GBRA6_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 6	173					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.K173T(1)		breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|liver(2)|lung(22)|ovary(7)|skin(6)|urinary_tract(2)	57	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	TGTCCACTCAAGTTTGGGAGC	0.393										TCGA Ovarian(5;0.080)																											p.K173T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A518C	5						.						123.0	110.0	114.0					5																	161116331		2203	4300	6503	161048909	SO:0001583	missense	2559	exon5				CCDS4356.1	5q34	2012-06-22			ENSG00000145863	ENSG00000145863		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4080	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 6"""	137143				8020978	Standard	NM_000811		Approved		uc003lyu.2	Q16445	OTTHUMG00000130351	ENST00000274545.5:c.518A>C	5.37:g.161116331A>C	ENSP00000274545:p.Lys173Thr	Somatic		Capture	SOLID	Phase_I	161048909	NM_000811	A8K096|Q4VAV2	Missense_Mutation	SNP	ENST00000274545.5	37	CCDS4356.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	21.1|21.1	4.105012|4.105012	0.77096|0.77096	.|.	.|.	ENSG00000145863|ENSG00000145863	ENST00000274545;ENST00000523217;ENST00000517823;ENST00000523691|ENST00000520000	T;T;T;T|.	0.80566|.	-1.39;-1.39;-1.39;-1.39|.	5.74|5.74	5.74|5.74	0.90152|0.90152	Neurotransmitter-gated ion-channel ligand-binding (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.60843|0.60843	0.2300|0.2300	L|L	0.41356|0.41356	1.27|1.27	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	D|.	0.78314|.	0.991|.	T|T	0.57341|0.57341	-0.7828|-0.7828	10|5	0.87932|.	D|.	0|.	.|.	16.0395|16.0395	0.80654|0.80654	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	173|.	Q16445|.	GBRA6_HUMAN|.	T|R	173;163;120;68|113	ENSP00000274545:K173T;ENSP00000430527:K163T;ENSP00000430212:K120T;ENSP00000427989:K68T|.	ENSP00000274545:K173T|.	K|S	+|+	2|1	0|0	GABRA6|GABRA6	161048909|161048909	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	9.228000|9.228000	0.95250|0.95250	2.188000|2.188000	0.69820|0.69820	0.533000|0.533000	0.62120|0.62120	AAG|AGT		GABRA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252707.2		
MAP1B	4131	hgsc.bcm.edu	37	5	71492290	71492290	+	Silent	SNP	G	G	A	rs150527364		TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	.			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr5:71492290G>A	ENST00000296755.7	+	5	3406	c.3108G>A	c.(3106-3108)ccG>ccA	p.P1036P		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	1036					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)	p.P1036P(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		AATATGAGCCGGAAAAAATGG	0.517																																					p.P1036P	Melanoma(17;367 822 11631 31730 47712)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3108A	5						.	G		0,4406		0,0,2203	153.0	156.0	155.0		3108	-11.7	0.0	5	dbSNP_134	155	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	MAP1B	NM_005909.3		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		1036/2469	71492290	2,13004	2203	4300	6503	71528046	SO:0001819	synonymous_variant	4131	exon5			L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.3108G>A	5.37:g.71492290G>A		Somatic		Capture	SOLID	Phase_I	71528046	NM_005909	A2BDK5	Silent	SNP	ENST00000296755.7	37	CCDS4012.1																																																																																				MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	NM_005909	
PDE8B	8622	hgsc.bcm.edu	37	5	76646917	76646917	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr5:76646917C>T	ENST00000264917.5	+	9	1090	c.1045C>T	c.(1045-1047)Cgg>Tgg	p.R349W	PDE8B_ENST00000346042.3_Intron|PDE8B_ENST00000340978.3_Missense_Mutation_p.R302W|PDE8B_ENST00000342343.4_Missense_Mutation_p.R329W|PDE8B_ENST00000333194.4_Missense_Mutation_p.R349W	NM_003719.3	NP_003710.1	O95263	PDE8B_HUMAN	phosphodiesterase 8B	349					cAMP catabolic process (GO:0006198)|cyclic nucleotide metabolic process (GO:0009187)|negative regulation of insulin secretion (GO:0046676)|negative regulation of steroid hormone biosynthetic process (GO:0090032)|phosphorelay signal transduction system (GO:0000160)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.R349W(1)	GMDS/PDE8B(2)	NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(10)|lung(15)|ovary(1)|prostate(2)|skin(3)	40		all_lung(232;0.00043)|Lung NSC(167;0.00114)|Ovarian(174;0.0107)|Prostate(461;0.0605)		OV - Ovarian serous cystadenocarcinoma(54;2.21e-49)|Epithelial(54;5.82e-43)|all cancers(79;4.06e-38)	Caffeine(DB00201)|Ketotifen(DB00920)	CTATGCCAGACGGAAATCCGG	0.498																																					p.R349W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1045T	5						.						113.0	105.0	108.0					5																	76646917		2203	4300	6503	76682673	SO:0001583	missense	8622	exon9			AF079529	CCDS4037.1, CCDS34190.1, CCDS34191.1, CCDS34192.1, CCDS34193.1	5q14.1	2008-05-15			ENSG00000113231	ENSG00000113231	3.1.4.17	"""Phosphodiesterases"""	8794	protein-coding gene	gene with protein product		603390				9784418	Standard	NM_003719		Approved		uc003kfa.3	O95263	OTTHUMG00000102170	ENST00000264917.5:c.1045C>T	5.37:g.76646917C>T	ENSP00000264917:p.Arg349Trp	Somatic		Capture	SOLID	Phase_I	76682673	NM_003719	Q5J7V7|Q86XK8|Q8IUJ7|Q8IUJ8|Q8IUJ9|Q8IUK0|Q8N3T2	Missense_Mutation	SNP	ENST00000264917.5	37	CCDS4037.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.354992	0.82243	.	.	ENSG00000113231	ENST00000340978;ENST00000264917;ENST00000342343;ENST00000333194;ENST00000503963	T;D;D;D;D	0.99762	-1.4;-6.67;-6.67;-6.67;-6.67	5.39	4.44	0.53790	PAS (1);PAS fold (1);	0.532223	0.20288	N	0.095316	D	0.99829	0.9923	H	0.96604	3.85	0.80722	D	1	D;D;D;D	0.76494	0.999;0.998;0.999;0.999	D;D;D;D	0.72338	0.961;0.921;0.961;0.977	D	0.97450	1.0027	10	0.87932	D	0	.	10.418	0.44333	0.3792:0.6208:0.0:0.0	.	302;349;329;349	O95263-6;O95263-3;O95263-4;O95263	.;.;.;PDE8B_HUMAN	W	302;349;329;349;111	ENSP00000345446:R302W;ENSP00000264917:R349W;ENSP00000345646:R329W;ENSP00000331336:R349W;ENSP00000422861:R111W	ENSP00000264917:R349W	R	+	1	2	PDE8B	76682673	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.215000	0.65241	2.528000	0.85240	0.563000	0.77884	CGG		PDE8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000220015.3	NM_003719	
VCAN	1462	hgsc.bcm.edu	37	5	82816870	82816870	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr5:82816870A>C	ENST00000265077.3	+	7	3310	c.2745A>C	c.(2743-2745)caA>caC	p.Q915H	VCAN_ENST00000502527.2_Intron|VCAN_ENST00000512590.2_Missense_Mutation_p.Q867H|VCAN_ENST00000342785.4_Missense_Mutation_p.Q915H|VCAN_ENST00000343200.5_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	915	GAG-alpha (glucosaminoglycan attachment domain).				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)	p.Q915H(1)		NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	CTGAAGGCCAAGTTTATGCAA	0.428																																					p.Q915H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2745C	5						.						109.0	105.0	107.0					5																	82816870		2203	4300	6503	82852626	SO:0001583	missense	1462	exon7			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.2745A>C	5.37:g.82816870A>C	ENSP00000265077:p.Gln915His	Somatic		Capture	SOLID	Phase_I	82852626	NM_001164098	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	A	3.722	-0.057413	0.07317	.	.	ENSG00000038427	ENST00000265077;ENST00000342785;ENST00000512590	T;T;T	0.20332	2.08;2.08;2.08	5.57	-4.37	0.03633	.	1.862240	0.02458	N	0.086228	T	0.14227	0.0344	L	0.41236	1.265	0.09310	N	1	B;B	0.14805	0.006;0.011	B;B	0.12837	0.008;0.005	T	0.20638	-1.0269	10	0.37606	T	0.19	.	0.4586	0.00512	0.3303:0.1223:0.1894:0.358	.	915;915	P13611-3;P13611	.;CSPG2_HUMAN	H	915;915;867	ENSP00000265077:Q915H;ENSP00000342768:Q915H;ENSP00000425959:Q867H	ENSP00000265077:Q915H	Q	+	3	2	VCAN	82852626	0.000000	0.05858	0.000000	0.03702	0.622000	0.37654	-0.091000	0.11146	-0.495000	0.06659	0.533000	0.62120	CAA		VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
OR2Y1	134083	hgsc.bcm.edu	37	5	180166262	180166262	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3601-01A-01W-0833-10	TCGA-AG-3601-10A-01W-0833-10	g.chr5:180166262G>T	ENST00000307832.2	-	1	837	c.797C>A	c.(796-798)tCt>tAt	p.S266Y		NM_001001657.1	NP_001001657.1	Q8NGV0	OR2Y1_HUMAN	olfactory receptor, family 2, subfamily Y, member 1	266						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S266Y(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	all_cancers(89;1.25e-05)|all_epithelial(37;4.36e-06)|Renal(175;0.000159)|Lung NSC(126;0.00317)|all_lung(126;0.0041)|Breast(19;0.114)	all_cancers(40;0.0834)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTCACGCTCAGAATAATTGTG	0.423																																					p.S266Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C797A	5						.						89.0	101.0	97.0					5																	180166262		2203	4300	6503	180098868	SO:0001583	missense	134083	exon1			AB065676	CCDS34323.1	5q35	2012-08-09			ENSG00000174339	ENSG00000174339		"""GPCR / Class A : Olfactory receptors"""	14837	protein-coding gene	gene with protein product							Standard	NM_001001657		Approved		uc003mmf.1	Q8NGV0	OTTHUMG00000162237	ENST00000307832.2:c.797C>A	5.37:g.180166262G>T	ENSP00000312403:p.Ser266Tyr	Somatic		Capture	SOLID	Phase_I	180098868	NM_001001657	B9EIP1|Q6IFB1|Q96R16	Missense_Mutation	SNP	ENST00000307832.2	37	CCDS34323.1	.	.	.	.	.	.	.	.	.	.	g	14.24	2.476830	0.44044	.	.	ENSG00000174339	ENST00000307832	T	0.00277	8.34	4.41	3.53	0.40419	GPCR, rhodopsin-like superfamily (1);	0.743799	0.11539	N	0.553945	T	0.00754	0.0025	M	0.86097	2.795	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.47368	-0.9123	10	0.87932	D	0	.	10.5969	0.45343	0.0965:0.0:0.9035:0.0	.	266	Q8NGV0	OR2Y1_HUMAN	Y	266	ENSP00000312403:S266Y	ENSP00000312403:S266Y	S	-	2	0	OR2Y1	180098868	0.009000	0.17119	0.002000	0.10522	0.002000	0.02628	1.652000	0.37313	1.193000	0.43086	0.511000	0.50034	TCT		OR2Y1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368059.2	XM_068682	
