#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ZAN	7455	broad.mit.edu	37	7	100371476	100371477	+	RNA	INS	-	-	G	rs148800656|rs200325383|rs372381708	byFrequency	TCGA-AG-3999-01	TCGA-AG-3999-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr7:100371476_100371477insG	ENST00000348028.3	+	0	5932_5933				ZAN_ENST00000546292.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000421100.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.?(1)		NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			GCTGCTCCGTTTCGGGCCTCAG	0.624													G|-|G|deletion	2230	0.445288	0.2133	0.5418	5008	,	,		17915	0.7867		0.3419	False		,,,				2504	0.4448				p.F1923fs												.	.	1	Unknown(1)	upper_aerodigestive_tract(1)	c.5767_5768insG	7						.		,	906,2950		139,628,1161					,	4.6	0.9		dbSNP_134	33	2934,5018		557,1820,1599	no	frameshift,frameshift	ZAN	NM_173059.1,NM_003386.1	,	696,2448,2760	A1A1,A1R,RR		36.8964,23.4959,32.5203	,	,		3840,7968				100209413			7455	exon31			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100371476_100371477insG		Somatic		Unspecified	Illumina	Phase_I	100209412	NM_173059	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Splice_Site	INS	ENST00000348028.3	37																																																																																					ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386	
KCNQ1	3784	broad.mit.edu	37	11	2869088	2869089	+	Frame_Shift_Ins	INS	-	-	C	rs397508105|rs397508104|rs397508102		TCGA-AG-3999-01	TCGA-AG-3999-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr11:2869088_2869089insC	ENST00000155840.5	+	16	1994_1995	c.1886_1887insC	c.(1885-1890)ggccccfs	p.GP629fs	KCNQ1_ENST00000526095.1_3'UTR|KCNQ1_ENST00000335475.5_Frame_Shift_Ins_p.GP502fs|KCNQ1-AS1_ENST00000440887.2_RNA	NM_000218.2	NP_000209.2	P51787	KCNQ1_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 1	629				LHGGSTPGSGGPPREGGAHITQPCGS -> MQQGGPTCNSR SQVVASNE (in Ref. 4; AAM94040). {ECO:0000305}.	atrial cardiac muscle cell action potential (GO:0086014)|cardiac muscle contraction (GO:0060048)|cardiovascular system development (GO:0072358)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|gene silencing (GO:0016458)|male gonad development (GO:0008584)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of insulin secretion (GO:0046676)|positive regulation of gastric acid secretion (GO:0060454)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	basolateral plasma membrane (GO:0016323)|early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated potassium channel complex (GO:0008076)|zymogen granule membrane (GO:0042589)	calmodulin binding (GO:0005516)|delayed rectifier potassium channel activity (GO:0005251)|ion channel binding (GO:0044325)|outward rectifier potassium channel activity (GO:0015271)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|protein phosphatase 1 binding (GO:0008157)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)|voltage-gated potassium channel activity involved in cardiac muscle cell action potential repolarization (GO:0086008)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)	21		all_epithelial(84;3.26e-05)|Breast(177;0.001)|Medulloblastoma(188;0.00111)|Ovarian(85;0.00158)|all_neural(188;0.00725)|all_lung(207;0.11)|Lung NSC(207;0.159)		BRCA - Breast invasive adenocarcinoma(625;0.00251)|Lung(200;0.131)	Bepridil(DB01244)|Indapamide(DB00808)	GGCAGCGGCGGCCCCCCCAGAG	0.703																																					p.G502fs												.	.	0			c.1505_1506insC	11						.																																			2825665	SO:0001589	frameshift_variant	3784	exon16			AF000571	CCDS7736.1	11p15.5	2014-09-17			ENSG00000053918	ENSG00000053918		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6294	protein-coding gene	gene with protein product	"""Jervell and Lange-Nielsen syndrome 1"""	607542		LQT, KCNA9		8528244, 16382104	Standard	NM_181798		Approved	Kv7.1, KCNA8, KVLQT1, JLNS1, LQT1	uc001lwn.3	P51787	OTTHUMG00000009900	ENST00000155840.5:c.1893dupC	11.37:g.2869095_2869095dupC	ENSP00000155840:p.Gly629fs	Somatic		Unspecified	Illumina	Phase_I	2825664	NM_181798	O00347|O60607|O94787|Q14D14|Q7Z6G9|Q92960|Q9UMN8|Q9UMN9	Frame_Shift_Ins	INS	ENST00000155840.5	37	CCDS7736.1																																																																																				KCNQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027382.2	NM_000218	
ZNF142	7701	broad.mit.edu	37	2	219515221	219515222	+	Frame_Shift_Ins	INS	-	-	TC			TCGA-AG-3999-01	TCGA-AG-3999-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr2:219515221_219515222insTC	ENST00000449707.1	-	5	729_730	c.308_309insGA	c.(307-309)gaafs	p.E103fs	ZNF142_ENST00000411696.2_Frame_Shift_Ins_p.E103fs	NM_001105537.1	NP_001099007.1	P52746	ZN142_HUMAN	zinc finger protein 142	103					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P104fs*21(1)		breast(7)|endometrium(7)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38		Renal(207;0.0474)		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		CCTGTGAAGGTTCTCTCTCTCC	0.465																																					p.E103fs	Colon(170;867 1942 8995 15834 18053)											.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.309_310insGA	2						.																																			219223466	SO:0001589	frameshift_variant	7701	exon5			U09849	CCDS42817.1	2q35	2013-01-08	2006-06-13		ENSG00000115568	ENSG00000115568		"""Zinc fingers, C2H2-type"""	12927	protein-coding gene	gene with protein product		604083	"""zinc finger protein 142 (clone pHZ-49)"""				Standard	NM_001105537		Approved	KIAA0236, pHZ-49	uc002vin.4	P52746	OTTHUMG00000154736	ENST00000449707.1:c.307_308dupGA	2.37:g.219515230_219515231dupTC	ENSP00000408643:p.Glu103fs	Somatic		Unspecified	Illumina	Phase_I	219223465	NM_001105537	Q92510	Frame_Shift_Ins	INS	ENST00000449707.1	37	CCDS42817.1																																																																																				ZNF142-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336833.1	NM_005081	
NPC1L1	29881	broad.mit.edu	37	7	44578579	44578579	+	Missense_Mutation	SNP	C	C	T	rs201421514		TCGA-AG-3999-01	TCGA-AG-3999-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr7:44578579C>T	ENST00000289547.4	-	2	1472	c.1417G>A	c.(1417-1419)Gcc>Acc	p.A473T	NPC1L1_ENST00000381160.3_Missense_Mutation_p.A473T|NPC1L1_ENST00000423141.1_Missense_Mutation_p.A473T|NPC1L1_ENST00000546276.1_Missense_Mutation_p.A473T	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	473					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)	p.A473T(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	TTGAGGGGGGCGTAGCAGATG	0.592																																					p.A473T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1417A	7						.						124.0	108.0	114.0					7																	44578579		2203	4300	6503	44545104	SO:0001583	missense	29881	exon2				CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.1417G>A	7.37:g.44578579C>T	ENSP00000289547:p.Ala473Thr	Somatic		Unspecified	Illumina	Phase_I	44545104	NM_013389	A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Missense_Mutation	SNP	ENST00000289547.4	37	CCDS5491.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	c	19.51	3.842100	0.71488	.	.	ENSG00000015520	ENST00000289547;ENST00000381160;ENST00000546276;ENST00000423141	D;D;D;D	0.88277	-2.36;-2.36;-2.36;-2.36	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	D	0.94716	0.8295	M	0.88640	2.97	0.58432	D	0.999994	D;D;D;D	0.76494	0.999;0.999;0.998;0.998	D;P;D;P	0.66084	0.922;0.823;0.941;0.878	D	0.94775	0.7948	10	0.45353	T	0.12	-30.816	15.9151	0.79508	0.0:1.0:0.0:0.0	.	473;473;473;473	B7ZLE6;Q9UHC9-3;Q17RV5;D3DVK9	.;.;.;.	T	473	ENSP00000289547:A473T;ENSP00000370552:A473T;ENSP00000438033:A473T;ENSP00000404670:A473T	ENSP00000289547:A473T	A	-	1	0	NPC1L1	44545104	1.000000	0.71417	0.487000	0.27428	0.424000	0.31475	7.160000	0.77495	2.353000	0.79882	0.407000	0.27541	GCC		NPC1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251256.1	NM_013389	
POM121	9883	broad.mit.edu	37	7	72413423	72413423	+	Missense_Mutation	SNP	C	C	T	rs71554686	byFrequency	TCGA-AG-3999-01	TCGA-AG-3999-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr7:72413423C>T	ENST00000434423.2	+	11	2891	c.2891C>T	c.(2890-2892)cCg>cTg	p.P964L	POM121_ENST00000358357.3_Missense_Mutation_p.P699L|POM121_ENST00000446813.1_Missense_Mutation_p.P699L|POM121_ENST00000395270.1_Missense_Mutation_p.P699L|POM121_ENST00000257622.4_Missense_Mutation_p.P699L			Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin	964	Pore side. {ECO:0000255}.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)		p.P699L(1)		NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)				CCATCATATCCGGGAGCCAAC	0.647																																					p.P699L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2096T	7						.						9.0	12.0	11.0					7																	72413423		1897	3928	5825	72051359	SO:0001583	missense	9883	exon13			AB014518	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313		"""-"""	19702	protein-coding gene	gene with protein product		615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""			8335683, 9734811, 17900573	Standard	NM_172020		Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	Q96HA1	OTTHUMG00000023527	ENST00000434423.2:c.2891C>T	7.37:g.72413423C>T	ENSP00000405562:p.Pro964Leu	Somatic		Unspecified	Illumina	Phase_I	72051359	NM_172020	A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	Missense_Mutation	SNP	ENST00000434423.2	37		.	.	.	.	.	.	.	.	.	.	C	11.06	1.528404	0.27299	.	.	ENSG00000196313	ENST00000446813;ENST00000257622;ENST00000395270;ENST00000358357;ENST00000434423	T;T;T;T;T	0.06371	3.31;3.34;3.31;3.34;3.52	2.33	2.33	0.28932	.	0.532332	0.14207	N	0.334357	T	0.16938	0.0407	L	0.55481	1.735	0.30006	P	0.815588	D;P	0.89917	1.0;0.839	D;B	0.91635	0.999;0.287	T	0.16778	-1.0391	9	0.28530	T	0.3	.	10.1668	0.42886	0.0:1.0:0.0:0.0	.	699;964	A8MXF9;Q96HA1	.;P121A_HUMAN	L	699;699;699;699;964	ENSP00000393020:P699L;ENSP00000257622:P699L;ENSP00000378687:P699L;ENSP00000351124:P699L;ENSP00000405562:P964L	ENSP00000257622:P699L	P	+	2	0	POM121	72051359	0.041000	0.20044	0.365000	0.25901	0.077000	0.17291	2.433000	0.44793	1.309000	0.44985	0.173000	0.16961	CCG		POM121-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000347344.1		
PCLO	27445	broad.mit.edu	37	7	82583572	82583572	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3999-01	TCGA-AG-3999-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr7:82583572G>A	ENST00000333891.9	-	5	7034	c.6697C>T	c.(6697-6699)Cca>Tca	p.P2233S	PCLO_ENST00000423517.2_Missense_Mutation_p.P2233S	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.P2233S(2)|p.P2164S(1)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						ATGCTGCCTGGAAAATAAGTT	0.378																																					p.P2233S												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.C6697T	7						.						53.0	50.0	51.0					7																	82583572		1824	4092	5916	82421508	SO:0001583	missense	27445	exon5			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.6697C>T	7.37:g.82583572G>A	ENSP00000334319:p.Pro2233Ser	Somatic		Unspecified	Illumina	Phase_I	82421508	NM_033026		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	G	11.62	1.692862	0.30052	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.15487	2.42;2.42	5.77	5.77	0.91146	.	.	.	.	.	T	0.30978	0.0782	L	0.44542	1.39	0.80722	D	1	D;D	0.63046	0.992;0.992	P;P	0.54544	0.755;0.755	T	0.00722	-1.1594	9	0.87932	D	0	.	19.9785	0.97317	0.0:0.0:1.0:0.0	.	2233;2233	Q9Y6V0-5;Q9Y6V0-6	.;.	S	2164;2233;2233	ENSP00000334319:P2233S;ENSP00000388393:P2233S	ENSP00000334319:P2233S	P	-	1	0	PCLO	82421508	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.336000	0.65935	2.724000	0.93272	0.650000	0.86243	CCA		PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
PCLO	27445	broad.mit.edu	37	7	82583669	82583669	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3999-01	TCGA-AG-3999-01	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr7:82583669A>C	ENST00000333891.9	-	5	6937	c.6600T>G	c.(6598-6600)atT>atG	p.I2200M	PCLO_ENST00000423517.2_Missense_Mutation_p.I2200M	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.I2200M(2)|p.I2131M(1)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CCAGGGTAGTAATGGGTGAAG	0.428																																					p.I2200M												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.T6600G	7						.						98.0	93.0	94.0					7																	82583669		1946	4156	6102	82421605	SO:0001583	missense	27445	exon5			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.6600T>G	7.37:g.82583669A>C	ENSP00000334319:p.Ile2200Met	Somatic		Unspecified	Illumina	Phase_I	82421605	NM_033026		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	A	3.327	-0.137463	0.06711	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.17854	2.25;2.26	5.77	0.232	0.15381	.	.	.	.	.	T	0.12987	0.0315	L	0.44542	1.39	0.53688	D	0.999978	P;P	0.36909	0.573;0.573	B;B	0.37692	0.256;0.256	T	0.11179	-1.0598	9	0.87932	D	0	.	3.6635	0.08247	0.4123:0.0:0.2611:0.3266	.	2200;2200	Q9Y6V0-5;Q9Y6V0-6	.;.	M	2131;2200;2200	ENSP00000334319:I2200M;ENSP00000388393:I2200M	ENSP00000334319:I2200M	I	-	3	3	PCLO	82421605	0.009000	0.17119	0.455000	0.27031	0.710000	0.40934	-0.034000	0.12225	-0.203000	0.10251	0.528000	0.53228	ATT		PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
NUP205	23165	broad.mit.edu	37	7	135300734	135300734	+	Silent	SNP	C	C	T	rs367706530		TCGA-AG-3999-01	TCGA-AG-3999-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr7:135300734C>T	ENST00000285968.6	+	24	3407	c.3381C>T	c.(3379-3381)acC>acT	p.T1127T		NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	1127					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)	p.T1127T(1)		breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						TAAGGGTAACCTCTCTGAATC	0.393																																					p.T1127T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3381T	7						.						140.0	126.0	131.0					7																	135300734		2203	4300	6503	134951274	SO:0001819	synonymous_variant	23165	exon24			D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.3381C>T	7.37:g.135300734C>T		Somatic		Unspecified	Illumina	Phase_I	134951274	NM_015135	A6H8X3|Q86YC1	Silent	SNP	ENST00000285968.6	37	CCDS34759.1																																																																																				NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340358.1		
TGM6	343641	broad.mit.edu	37	20	2397899	2397899	+	Missense_Mutation	SNP	T	T	G	rs201300991		TCGA-AG-3999-01	TCGA-AG-3999-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr20:2397899T>G	ENST00000202625.2	+	10	1419	c.1358T>G	c.(1357-1359)gTg>gGg	p.V453G	TGM6_ENST00000381423.1_Missense_Mutation_p.V453G	NM_198994.2	NP_945345.2	O95932	TGM3L_HUMAN	transglutaminase 6	453					cell death (GO:0008219)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.V453G(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(2)|lung(32)|ovary(4)|prostate(1)|skin(4)	52					L-Glutamine(DB00130)	GAGAGGCAGGTGTACAGCAAG	0.592																																					p.V453G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1358G	20						.						27.0	25.0	26.0					20																	2397899		2203	4299	6502	2345899	SO:0001583	missense	343641	exon10			AF540970	CCDS13025.1, CCDS58761.1	20p13	2010-12-19	2004-07-05	2004-07-07	ENSG00000166948	ENSG00000166948		"""Transglutaminases"""	16255	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 35"""	613900	"""transglutaminase 3-like"""	TGM3L		11390390, 21106500	Standard	NM_198994		Approved	dJ734P14.3, TGY, SCA35	uc002wfy.1	O95932	OTTHUMG00000031692	ENST00000202625.2:c.1358T>G	20.37:g.2397899T>G	ENSP00000202625:p.Val453Gly	Somatic		Unspecified	Illumina	Phase_I	2345899	NM_198994	Q5JXU4|Q5JXU5|Q719M2|Q719M3|Q9Y4U8	Missense_Mutation	SNP	ENST00000202625.2	37	CCDS13025.1	.	.	.	.	.	.	.	.	.	.	T	18.07	3.540895	0.65085	.	.	ENSG00000166948	ENST00000202625;ENST00000381423	D;D	0.96104	-3.91;-3.91	4.54	4.54	0.55810	.	0.291192	0.31145	N	0.008179	D	0.97393	0.9147	M	0.85542	2.76	0.58432	D	0.999993	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.99	D	0.97675	1.0169	10	0.87932	D	0	-15.9169	10.201	0.43084	0.0:0.0:0.0:1.0	.	453;453	O95932-2;O95932	.;TGM3L_HUMAN	G	453	ENSP00000202625:V453G;ENSP00000370831:V453G	ENSP00000202625:V453G	V	+	2	0	TGM6	2345899	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	2.730000	0.47335	1.919000	0.55581	0.460000	0.39030	GTG		TGM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077581.2	NM_198994	
CCM2L	140706	broad.mit.edu	37	20	30605881	30605881	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3999-01	TCGA-AG-3999-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr20:30605881C>G	ENST00000300415.8	+	4	395	c.382C>G	c.(382-384)Ctc>Gtc	p.L128V	CCM2L_ENST00000262659.8_Missense_Mutation_p.L128V			Q9NUG4	CCM2L_HUMAN	cerebral cavernous malformation 2-like	128								p.L128V(2)									CAATGAAGAGCTCATTCTGCG	0.662																																					p.L128V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C382G	20						.						29.0	27.0	28.0					20																	30605881		2203	4300	6503	30069542	SO:0001583	missense	140706	exon4			AL031658	CCDS13195.1	20q11.21	2012-10-30	2012-10-30	2012-10-30	ENSG00000101331	ENSG00000101331			16153	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 160"""	C20orf160			Standard	NM_080625		Approved	dJ310O13.5	uc002wxf.2	Q9NUG4	OTTHUMG00000032197	ENST00000300415.8:c.382C>G	20.37:g.30605881C>G	ENSP00000300415:p.Leu128Val	Somatic		Unspecified	Illumina	Phase_I	30069542	NM_080625	Q5JYR9|Q8N5F1|Q8N6G8|Q96MD5	Missense_Mutation	SNP	ENST00000300415.8	37		.	.	.	.	.	.	.	.	.	.	C	14.46	2.541162	0.45280	.	.	ENSG00000101331	ENST00000300415;ENST00000339619;ENST00000262659	T;T	0.37235	1.21;1.21	4.8	4.8	0.61643	.	0.076801	0.56097	D	0.000039	T	0.52403	0.1732	M	0.70275	2.135	0.47476	D	0.99943	D	0.56035	0.974	P	0.53450	0.726	T	0.58634	-0.7602	10	0.66056	D	0.02	-32.5857	16.7764	0.85551	0.0:1.0:0.0:0.0	.	128	Q9NUG4-2	.	V	128	ENSP00000300415:L128V;ENSP00000262659:L128V	ENSP00000262659:L128V	L	+	1	0	C20orf160	30069542	1.000000	0.71417	1.000000	0.80357	0.259000	0.26198	2.390000	0.44416	2.366000	0.80165	0.305000	0.20034	CTC		CCM2L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_080625	
PCNA	5111	broad.mit.edu	37	20	5098192	5098192	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3999-01	TCGA-AG-3999-01	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr20:5098192A>C	ENST00000379160.3	-	5	748	c.506T>G	c.(505-507)tTt>tGt	p.F169C	PCNA_ENST00000379143.5_Missense_Mutation_p.F169C	NM_002592.2	NP_002583.1	P12004	PCNA_HUMAN	proliferating cell nuclear antigen	169					base-excision repair (GO:0006284)|cell proliferation (GO:0008283)|DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|epithelial cell differentiation (GO:0030855)|G1/S transition of mitotic cell cycle (GO:0000082)|heart development (GO:0007507)|leading strand elongation (GO:0006272)|mismatch repair (GO:0006298)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of deoxyribonuclease activity (GO:0032077)|regulation of DNA replication (GO:0006275)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|response to cadmium ion (GO:0046686)|response to lipid (GO:0033993)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)|translesion synthesis (GO:0019985)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|DNA replication factor C complex (GO:0005663)|extracellular vesicular exosome (GO:0070062)|nuclear replication fork (GO:0043596)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCNA complex (GO:0043626)|PCNA-p21 complex (GO:0070557)	dinucleotide insertion or deletion binding (GO:0032139)|DNA polymerase binding (GO:0070182)|DNA polymerase processivity factor activity (GO:0030337)|identical protein binding (GO:0042802)|MutLalpha complex binding (GO:0032405)|purine-specific mismatch base pair DNA N-glycosylase activity (GO:0000701)|receptor tyrosine kinase binding (GO:0030971)	p.F169C(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(2)	9						ACTTGCAGAAAATTTCACTCC	0.378								DNA polymerases (catalytic subunits)																													p.F169C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T506G	20						.						89.0	89.0	89.0					20																	5098192		2203	4300	6503	5046192	SO:0001583	missense	5111	exon5			J04718	CCDS13087.1	20p13-p12.3	2013-09-19			ENSG00000132646	ENSG00000132646			8729	protein-coding gene	gene with protein product		176740				2565339	Standard	NM_002592		Approved		uc002wlp.3	P12004	OTTHUMG00000031798	ENST00000379160.3:c.506T>G	20.37:g.5098192A>C	ENSP00000368458:p.Phe169Cys	Somatic		Unspecified	Illumina	Phase_I	5046192	NM_002592	B2R897|D3DW02	Missense_Mutation	SNP	ENST00000379160.3	37	CCDS13087.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.384817	0.82792	.	.	ENSG00000132646	ENST00000379143;ENST00000379160	.	.	.	5.4	5.4	0.78164	Proliferating cell nuclear antigen, PCNA, C-terminal (1);	0.043746	0.85682	D	0.000000	D	0.87947	0.6306	H	0.97516	4.02	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91968	0.5584	9	0.87932	D	0	-14.8375	14.2529	0.66031	1.0:0.0:0.0:0.0	.	169	P12004	PCNA_HUMAN	C	169	.	ENSP00000368438:F169C	F	-	2	0	PCNA	5046192	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.165000	0.94761	2.055000	0.61198	0.379000	0.24179	TTT		PCNA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077852.2		
PTPRT	11122	broad.mit.edu	37	20	40714387	40714387	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3999-01	TCGA-AG-3999-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr20:40714387C>T	ENST00000373187.1	-	28	3952	c.3953G>A	c.(3952-3954)cGc>cAc	p.R1318H	PTPRT_ENST00000356100.2_Missense_Mutation_p.R1327H|PTPRT_ENST00000373193.3_Missense_Mutation_p.R1321H|PTPRT_ENST00000373190.1_Missense_Mutation_p.R1317H|PTPRT_ENST00000373198.4_Missense_Mutation_p.R1337H|PTPRT_ENST00000373184.1_Missense_Mutation_p.R1328H|PTPRT_ENST00000373201.1_Missense_Mutation_p.R1308H			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	1318	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)	p.R1340H(1)		NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				GTTACAGATGCGGAATATTCT	0.592																																					p.R1337H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4010A	20						.						77.0	82.0	80.0					20																	40714387		1997	4160	6157	40147801	SO:0001583	missense	11122	exon29			AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.3953G>A	20.37:g.40714387C>T	ENSP00000362283:p.Arg1318His	Somatic		Unspecified	Illumina	Phase_I	40147801	NM_133170	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	ENST00000373187.1	37	CCDS42874.1	.	.	.	.	.	.	.	.	.	.	C	35	5.422801	0.96111	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	D;D;D;D;D;D;D	0.83755	-1.76;-1.76;-1.76;-1.76;-1.76;-1.76;-1.76	5.31	5.31	0.75309	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.057867	0.64402	D	0.000002	D	0.89588	0.6758	L	0.56124	1.755	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.988;0.993	D	0.90045	0.4145	10	0.87932	D	0	.	19.1694	0.93570	0.0:1.0:0.0:0.0	.	1340;1318	O14522-1;O14522	.;PTPRT_HUMAN	H	1317;1318;1321;1327;1340;1328;1308	ENSP00000362286:R1317H;ENSP00000362283:R1318H;ENSP00000362289:R1321H;ENSP00000348408:R1327H;ENSP00000362294:R1340H;ENSP00000362280:R1328H;ENSP00000362297:R1308H	ENSP00000348408:R1327H	R	-	2	0	PTPRT	40147801	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.570000	0.82390	2.765000	0.95021	0.655000	0.94253	CGC		PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1		
DIDO1	11083	broad.mit.edu	37	20	61511660	61511660	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3999-01	TCGA-AG-3999-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr20:61511660C>A	ENST00000266070.4	-	16	5973	c.5648G>T	c.(5647-5649)gGc>gTc	p.G1883V	DIDO1_ENST00000395343.1_Missense_Mutation_p.G1883V	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	1883	Pro-rich.				apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.G1883V(1)		NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					AGGCGCGCCGCCTCTGCTTCC	0.647																																					p.G1883V	Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5648T	20						.						34.0	39.0	37.0					20																	61511660		2202	4292	6494	60982105	SO:0001583	missense	11083	exon16			AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.5648G>T	20.37:g.61511660C>A	ENSP00000266070:p.Gly1883Val	Somatic		Unspecified	Illumina	Phase_I	60982105	NM_001193369	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	ENST00000266070.4	37	CCDS33506.1	.	.	.	.	.	.	.	.	.	.	C	12.33	1.906692	0.33628	.	.	ENSG00000101191	ENST00000266070;ENST00000395343	T;T	0.10099	2.91;2.91	4.6	3.64	0.41730	.	0.000000	0.38897	U	0.001539	T	0.29061	0.0722	M	0.64997	1.995	0.80722	D	1	D	0.76494	0.999	D	0.75020	0.985	T	0.02307	-1.1179	10	0.87932	D	0	-23.8276	13.9595	0.64170	0.0:0.7106:0.2894:0.0	.	1883	Q9BTC0	DIDO1_HUMAN	V	1883	ENSP00000266070:G1883V;ENSP00000378752:G1883V	ENSP00000266070:G1883V	G	-	2	0	DIDO1	60982105	0.697000	0.27767	0.019000	0.16419	0.009000	0.06853	3.158000	0.50723	0.880000	0.35969	0.561000	0.74099	GGC		DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796	
NPAS3	64067	broad.mit.edu	37	14	34269530	34269530	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3999-01	TCGA-AG-3999-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr14:34269530A>C	ENST00000356141.4	+	12	2017	c.2017A>C	c.(2017-2019)Atc>Ctc	p.I673L	NPAS3_ENST00000551492.1_Missense_Mutation_p.I678L|NPAS3_ENST00000346562.2_Missense_Mutation_p.I641L|NPAS3_ENST00000548645.1_Missense_Mutation_p.I643L|NPAS3_ENST00000357798.5_Missense_Mutation_p.I660L			Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3	673					locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|positive regulation of transcription, DNA-templated (GO:0045893)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)	p.I660L(1)|p.I641L(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	40	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		CAACCGGGAGATCTCCAGGAA	0.637																																					p.I641L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A1921C	14						.						71.0	74.0	73.0					14																	34269530		2203	4300	6503	33339281	SO:0001583	missense	64067	exon11			AF164438	CCDS9645.1, CCDS53891.1, CCDS53892.1, CCDS55912.1	14q13.1	2013-08-23			ENSG00000151322	ENSG00000151322		"""Basic helix-loop-helix proteins"""	19311	protein-coding gene	gene with protein product		609430					Standard	NM_022123		Approved	MOP6, PASD6, bHLHe12	uc001wru.3	Q8IXF0	OTTHUMG00000140215	ENST00000356141.4:c.2017A>C	14.37:g.34269530A>C	ENSP00000348460:p.Ile673Leu	Somatic		Unspecified	Illumina	Phase_I	33339281	NM_022123	Q86US6|Q86US7|Q8IXF2|Q9BY81|Q9H323|Q9Y4L8	Missense_Mutation	SNP	ENST00000356141.4	37	CCDS53891.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.942620	0.73672	.	.	ENSG00000151322	ENST00000551634;ENST00000551492;ENST00000346562;ENST00000548645;ENST00000356141;ENST00000357798	T;T;T;T;T;T	0.70399	-0.48;2.96;2.98;2.97;2.96;2.83	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	T	0.56352	0.1979	L	0.27053	0.805	0.80722	D	1	P;B;P;P	0.37101	0.582;0.447;0.582;0.582	B;B;B;B	0.31686	0.134;0.063;0.134;0.134	T	0.58819	-0.7569	10	0.37606	T	0.19	.	15.0046	0.71501	1.0:0.0:0.0:0.0	.	643;673;641;660	Q8IXF0-2;Q8IXF0;Q8IXF0-4;Q8IXF0-3	.;NPAS3_HUMAN;.;.	L	647;678;641;643;673;660	ENSP00000448373:I647L;ENSP00000450392:I678L;ENSP00000319610:I641L;ENSP00000448916:I643L;ENSP00000348460:I673L;ENSP00000350446:I660L	ENSP00000319610:I641L	I	+	1	0	NPAS3	33339281	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.059000	0.76684	1.925000	0.55765	0.454000	0.30748	ATC		NPAS3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276645.1		
RALGAPA1	253959	broad.mit.edu	37	14	36197692	36197692	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3999-01	TCGA-AG-3999-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr14:36197692T>C	ENST00000389698.3	-	13	2002	c.1612A>G	c.(1612-1614)Ata>Gta	p.I538V	RALGAPA1_ENST00000382366.3_Missense_Mutation_p.I538V|RALGAPA1_ENST00000554704.1_5'UTR|RALGAPA1_ENST00000258840.6_Missense_Mutation_p.I538V|RALGAPA1_ENST00000307138.6_Missense_Mutation_p.I538V	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)	538					activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)	p.I538V(2)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						AGAAGAAATATATTTGATGAG	0.299																																					p.I538V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A1612G	14						.						29.0	31.0	30.0					14																	36197692		2196	4271	6467	35267443	SO:0001583	missense	253959	exon13			AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.1612A>G	14.37:g.36197692T>C	ENSP00000374348:p.Ile538Val	Somatic		Unspecified	Illumina	Phase_I	35267443	NM_194301	A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Missense_Mutation	SNP	ENST00000389698.3	37	CCDS32065.1	.	.	.	.	.	.	.	.	.	.	T	6.009	0.370152	0.11352	.	.	ENSG00000174373	ENST00000389698;ENST00000307138;ENST00000335518;ENST00000258840;ENST00000382366;ENST00000553892	T;T;T;T;T	0.72835	-0.69;-0.69;-0.69;-0.69;-0.69	5.24	5.24	0.73138	.	0.049575	0.85682	D	0.000000	T	0.49270	0.1547	N	0.11364	0.135	0.42075	D	0.991228	B;B;B;B;B	0.14805	0.004;0.002;0.011;0.001;0.002	B;B;B;B;B	0.20184	0.015;0.004;0.028;0.012;0.004	T	0.49495	-0.8934	10	0.02654	T	1	-18.7682	15.4304	0.75092	0.0:0.0:0.0:1.0	.	538;538;538;538;538	Q6GYQ0-6;B9EK38;Q6GYQ0-3;Q6GYQ0-2;Q6GYQ0	.;.;.;.;RGPA1_HUMAN	V	538	ENSP00000374348:I538V;ENSP00000302647:I538V;ENSP00000258840:I538V;ENSP00000371803:I538V;ENSP00000451877:I538V	ENSP00000258840:I538V	I	-	1	0	RALGAPA1	35267443	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.408000	0.59761	2.086000	0.62901	0.460000	0.39030	ATA		RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409829.1	XM_210022	
NEMF	9147	broad.mit.edu	37	14	50280749	50280749	+	Silent	SNP	A	A	C	rs146062067		TCGA-AG-3999-01	TCGA-AG-3999-01	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr14:50280749A>C	ENST00000298310.5	-	18	2150	c.1701T>G	c.(1699-1701)gcT>gcG	p.A567A	NEMF_ENST00000556925.1_5'UTR|NEMF_ENST00000545773.1_Silent_p.A525A|NEMF_ENST00000546046.1_Intron			O60524	NEMF_HUMAN	nuclear export mediator factor	567					nuclear export (GO:0051168)	nucleus (GO:0005634)		p.A567A(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(13)|liver(1)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	36						CATGAAGATCAGCATGTACAT	0.289																																					p.A567A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1701G	14						.						63.0	64.0	64.0					14																	50280749		2203	4299	6502	49350499	SO:0001819	synonymous_variant	9147	exon18			AF039687	CCDS9694.1	14q21.3	2012-11-19	2011-01-31	2011-01-31	ENSG00000165525	ENSG00000165525			10663	protein-coding gene	gene with protein product		608378	"""serologically defined colon cancer antigen 1"""	SDCCAG1		9610721, 10575219	Standard	XR_429334		Approved	NY-CO-1, FLJ10051	uc001wxc.3	O60524	OTTHUMG00000170857	ENST00000298310.5:c.1701T>G	14.37:g.50280749A>C		Somatic		Unspecified	Illumina	Phase_I	49350499	NM_004713	A0JLQ3|B3KSK1|B4DDL3|B4DHA9|B4E3F3|Q32Q66|Q8WW70|Q9NWG1	Silent	SNP	ENST00000298310.5	37	CCDS9694.1																																																																																				NEMF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410798.1	NM_004713	
AHNAK2	113146	broad.mit.edu	37	14	105410178	105410178	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3999-01	TCGA-AG-3999-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr14:105410178T>G	ENST00000333244.5	-	7	11729	c.11610A>C	c.(11608-11610)aaA>aaC	p.K3870N	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3870						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.K3870N(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CCTCCAGGAGTTTCATGTCCA	0.612																																					p.K3870N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A11610C	14						.						130.0	138.0	135.0					14																	105410178		1965	4151	6116	104481223	SO:0001583	missense	113146	exon7			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.11610A>C	14.37:g.105410178T>G	ENSP00000353114:p.Lys3870Asn	Somatic		Unspecified	Illumina	Phase_I	104481223	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	t	13.02	2.113670	0.37339	.	.	ENSG00000185567	ENST00000333244	T	0.01599	4.74	3.67	-2.53	0.06326	.	.	.	.	.	T	0.02610	0.0079	M	0.66378	2.025	0.09310	N	1	P	0.47762	0.9	P	0.47645	0.553	T	0.32587	-0.9901	9	0.25106	T	0.35	.	1.0517	0.01581	0.1601:0.227:0.3018:0.3111	.	3870	Q8IVF2	AHNK2_HUMAN	N	3870	ENSP00000353114:K3870N	ENSP00000353114:K3870N	K	-	3	2	AHNAK2	104481223	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-6.088000	0.00081	-0.467000	0.06932	-0.366000	0.07423	AAA		AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
ZDHHC8	29801	broad.mit.edu	37	22	20127024	20127024	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3999-01	TCGA-AG-3999-01	G	G	G	G	G	G	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr22:20127024G>C	ENST00000334554.7	+	3	391	c.250G>C	c.(250-252)Gac>Cac	p.D84H	ZDHHC8_ENST00000468112.1_Intron|ZDHHC8_ENST00000320602.7_Missense_Mutation_p.D84H|ZDHHC8_ENST00000405930.3_Missense_Mutation_p.D84H	NM_013373.3	NP_037505.1	Q9ULC8	ZDHC8_HUMAN	zinc finger, DHHC-type containing 8	84					locomotory behavior (GO:0007626)|protein palmitoylation (GO:0018345)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(3)|endometrium(1)|kidney(3)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	20	Colorectal(54;0.0993)					GGACAAGGAGGACGACTTCCG	0.612																																					p.D84H												.	.	0			c.G250C	22						.						75.0	73.0	73.0					22																	20127024		2202	4299	6501	18507024	SO:0001583	missense	29801	exon3			AB033118	CCDS13776.1, CCDS54502.1	22q11.21	2009-10-06		2003-02-28	ENSG00000099904	ENSG00000099904		"""Zinc fingers, DHHC-type"""	18474	protein-coding gene	gene with protein product		608784				10574462, 15184899	Standard	NM_013373		Approved	ZNF378, KIAA1292	uc002zrr.2	Q9ULC8	OTTHUMG00000150499	ENST00000334554.7:c.250G>C	22.37:g.20127024G>C	ENSP00000334490:p.Asp84His	None		Unspecified	Illumina	Phase_I	18507024	NM_013373	Q2TGE9|Q6ICL1|Q6ZNF5|Q7Z6L9	Missense_Mutation	SNP	ENST00000334554.7	37	CCDS13776.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.529147	0.85706	.	.	ENSG00000099904	ENST00000436518;ENST00000334554;ENST00000320602;ENST00000405930	D;D;D;D	0.97575	-4.44;-4.44;-4.44;-4.44	4.44	4.44	0.53790	.	0.000000	0.85682	D	0.000000	D	0.98498	0.9499	M	0.86740	2.835	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.98	D	0.98760	1.0724	10	0.39692	T	0.17	.	17.4133	0.87493	0.0:0.0:1.0:0.0	.	84;84	Q9ULC8-3;Q9ULC8	.;ZDHC8_HUMAN	H	73;84;84;84	ENSP00000412807:D73H;ENSP00000334490:D84H;ENSP00000317804:D84H;ENSP00000384716:D84H	ENSP00000317804:D84H	D	+	1	0	ZDHHC8	18507024	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.366000	0.97143	2.174000	0.68829	0.462000	0.41574	GAC		ZDHHC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318564.1	NM_013373	
PI4KA	5297	broad.mit.edu	37	22	21119206	21119206	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3999-01	TCGA-AG-3999-01	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr22:21119206G>C	ENST00000572273.1	-	22	2663	c.2433C>G	c.(2431-2433)atC>atG	p.I811M	PI4KA_ENST00000466162.1_5'UTR|PI4KA_ENST00000255882.6_Missense_Mutation_p.I869M			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	811					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)	p.I811M(2)		breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			CCAGCAGGTTGATGATAGTGC	0.602																																					p.I811M	GBM(136;1332 1831 3115 23601 50806)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2433G	22						.						73.0	65.0	68.0					22																	21119206		2203	4300	6503	19449206	SO:0001583	missense	5297	exon22			L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.2433C>G	22.37:g.21119206G>C	ENSP00000458238:p.Ile811Met	Somatic		Unspecified	Illumina	Phase_I	19449206	NM_058004	Q7Z625|Q9UPG2	Missense_Mutation	SNP	ENST00000572273.1	37		.	.	.	.	.	.	.	.	.	.	G	15.04	2.715985	0.48622	.	.	ENSG00000241973	ENST00000255882	.	.	.	5.58	5.58	0.84498	.	0.272982	0.39759	N	0.001264	T	0.57227	0.2039	L	0.40543	1.245	0.80722	D	1	B	0.20550	0.046	B	0.29598	0.104	T	0.54589	-0.8271	9	0.48119	T	0.1	-17.662	15.0461	0.71827	0.0:0.0:0.793:0.207	.	811	P42356	PI4KA_HUMAN	M	811	.	ENSP00000255882:I811M	I	-	3	3	PI4KA	19449206	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	2.895000	0.48648	2.621000	0.88768	0.650000	0.86243	ATC		PI4KA-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_058004	
PI4KA	5297	broad.mit.edu	37	22	21119493	21119493	+	Silent	SNP	G	G	A			TCGA-AG-3999-01	TCGA-AG-3999-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr22:21119493G>A	ENST00000572273.1	-	21	2525	c.2295C>T	c.(2293-2295)gtC>gtT	p.V765V	PI4KA_ENST00000466162.1_5'UTR|PI4KA_ENST00000255882.6_Silent_p.V823V			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	765					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)	p.V765V(2)		breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			CTATTTCACAGACCCCCTCGT	0.507																																					p.V765V	GBM(136;1332 1831 3115 23601 50806)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C2295T	22						.						115.0	119.0	117.0					22																	21119493		2203	4300	6503	19449493	SO:0001819	synonymous_variant	5297	exon21			L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.2295C>T	22.37:g.21119493G>A		Somatic		Unspecified	Illumina	Phase_I	19449493	NM_058004	Q7Z625|Q9UPG2	Silent	SNP	ENST00000572273.1	37																																																																																					PI4KA-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_058004	
VPREB3	29802	broad.mit.edu	37	22	24095278	24095278	+	Missense_Mutation	SNP	C	C	T	rs143409128		TCGA-AG-3999-01	TCGA-AG-3999-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr22:24095278C>T	ENST00000248948.3	-	2	261	c.157G>A	c.(157-159)Ggt>Agt	p.G53S	ZNF70_ENST00000341976.3_5'Flank|VPREB3_ENST00000398465.3_Missense_Mutation_p.G37S	NM_013378.2	NP_037510.1	Q9UKI3	VPRE3_HUMAN	pre-B lymphocyte 3	53	Ig-like.					endoplasmic reticulum (GO:0005783)		p.G53S(1)		large_intestine(1)|lung(1)|skin(1)	3		Medulloblastoma(6;7.87e-06)|all_neural(6;0.00334)				CAGGACACACCGTAGTCCCTG	0.637													C|||	1	0.000199681	0.0	0.0	5008	,	,		18713	0.0		0.001	False		,,,				2504	0.0				p.G53S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G157A	22						.	C	SER/GLY	2,4404	4.2+/-10.8	0,2,2201	95.0	71.0	79.0		157	-0.4	0.0	22	dbSNP_134	79	0,8600		0,0,4300	yes	missense	VPREB3	NM_013378.2	56	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	benign	53/124	24095278	2,13004	2203	4300	6503	22425278	SO:0001583	missense	29802	exon2				CCDS13813.1	22q11.23	2013-01-11	2008-09-12		ENSG00000128218	ENSG00000128218		"""Immunoglobulin superfamily / V-set domain containing"""	12710	protein-coding gene	gene with protein product		605017				10702669, 14670953	Standard	NM_013378		Approved	8HS20	uc002zxt.3	Q9UKI3	OTTHUMG00000150738	ENST00000248948.3:c.157G>A	22.37:g.24095278C>T	ENSP00000248948:p.Gly53Ser	Somatic		Unspecified	Illumina	Phase_I	22425278	NM_013378	B2R587	Missense_Mutation	SNP	ENST00000248948.3	37	CCDS13813.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	13.68	2.309109	0.40895	4.54E-4	0.0	ENSG00000128218	ENST00000398465;ENST00000248948	T;T	0.62941	-0.01;-0.01	5.57	-0.428	0.12306	Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin V-set, subgroup (1);Immunoglobulin-like fold (1);	0.488214	0.17443	N	0.174058	T	0.57592	0.2064	N	0.21282	0.65	0.09310	N	1	D	0.89917	1.0	D	0.83275	0.996	T	0.50145	-0.8862	10	0.22109	T	0.4	.	5.1186	0.14849	0.2417:0.458:0.234:0.0662	.	53	Q9UKI3	VPRE3_HUMAN	S	37;53	ENSP00000381483:G37S;ENSP00000248948:G53S	ENSP00000248948:G53S	G	-	1	0	VPREB3	22425278	0.005000	0.15991	0.000000	0.03702	0.002000	0.02628	1.801000	0.38843	-0.101000	0.12219	-0.187000	0.12897	GGT		VPREB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319879.2	NM_013378	
C19orf66	55337	broad.mit.edu	37	19	10202907	10202907	+	Silent	SNP	C	C	T			TCGA-AG-3999-01	TCGA-AG-3999-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr19:10202907C>T	ENST00000253110.11	+	8	1103	c.805C>T	c.(805-807)Ctg>Ttg	p.L269L	CTD-2240E14.4_ENST00000589622.1_RNA|C19orf66_ENST00000397881.3_Silent_p.L218L|C19orf66_ENST00000591813.1_Silent_p.L233L	NM_018381.2	NP_060851.2	Q9NUL5	CS066_HUMAN	chromosome 19 open reading frame 66	269	Asp/Glu-rich (acidic).							p.L269L(1)		large_intestine(3)|skin(1)	4						CAACCTCATCCTGGAGGACCT	0.622																																					p.L269L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C805T	19						.						26.0	31.0	29.0					19																	10202907		2031	4185	6216	10063907	SO:0001819	synonymous_variant	55337	exon8				CCDS45957.1	19p13.2	2012-10-26			ENSG00000130813	ENSG00000130813			25649	protein-coding gene	gene with protein product						12477932	Standard	NM_018381		Approved	FLJ11286	uc002mmu.4	Q9NUL5		ENST00000253110.11:c.805C>T	19.37:g.10202907C>T		Somatic		Unspecified	Illumina	Phase_I	10063907	NM_018381	A8MQT9|Q4G188|Q8IYH6|Q8N8V1	Silent	SNP	ENST00000253110.11	37	CCDS45957.1																																																																																				C19orf66-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451129.1	NM_018381	
CYP4F3	4051	broad.mit.edu	37	19	15770102	15770102	+	Silent	SNP	C	C	T	rs144943990		TCGA-AG-3999-01	TCGA-AG-3999-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr19:15770102C>T	ENST00000221307.8	+	13	1517	c.1470C>T	c.(1468-1470)cgC>cgT	p.R490R	CYP4F3_ENST00000591058.1_Silent_p.R490R|CYP4F3_ENST00000586182.2_Silent_p.R490R|CYP4F3_ENST00000585846.1_Silent_p.R490R	NM_000896.2	NP_000887.2	Q08477	CP4F3_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 3	490					arachidonic acid metabolic process (GO:0019369)|icosanoid metabolic process (GO:0006690)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-tocopherol omega-hydroxylase activity (GO:0052871)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)|monooxygenase activity (GO:0004497)	p.R490R(1)		endometrium(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|stomach(1)	34						TGCGCTTCCGCGTCCTGCCTG	0.672													.|||	1	0.000199681	0.0	0.0	5008	,	,		15483	0.0		0.001	False		,,,				2504	0.0				p.R490R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1470T	19						.	C	,,	0,4404		0,0,2202	26.0	27.0	27.0		1470,1470,1470	-7.0	0.2	19	dbSNP_134	27	2,8598		0,2,4298	no	coding-synonymous,coding-synonymous,coding-synonymous	CYP4F3	NM_000896.2,NM_001199208.1,NM_001199209.1	,,	0,2,6500	TT,TC,CC		0.0233,0.0,0.0154	,,	490/521,490/521,490/521	15770102	2,13002	2202	4300	6502	15631102	SO:0001819	synonymous_variant	4051	exon13			AB002454	CCDS12332.1, CCDS59362.1	19p13.12	2013-02-21	2003-01-14		ENSG00000186529	ENSG00000186529		"""Cytochrome P450s"""	2646	protein-coding gene	gene with protein product		601270	"""cytochrome P450, subfamily IVF, polypeptide 3 (leukotriene B4 omega hydroxylase)"""	LTB4H		8486631, 9539102	Standard	NM_000896		Approved	CYP4F	uc010xol.2	Q08477	OTTHUMG00000182374	ENST00000221307.8:c.1470C>T	19.37:g.15770102C>T		Somatic		Unspecified	Illumina	Phase_I	15631102	NM_001199209	B7Z8Z3|O60634|Q5U740	Silent	SNP	ENST00000221307.8	37	CCDS12332.1																																																																																				CYP4F3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460819.3	NM_000896	
CACTIN	58509	broad.mit.edu	37	19	3612375	3612375	+	Missense_Mutation	SNP	C	C	T	rs371228649		TCGA-AG-3999-01	TCGA-AG-3999-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr19:3612375C>T	ENST00000429344.2	-	10	1875	c.1823G>A	c.(1822-1824)cGg>cAg	p.R608Q	CACTIN-AS1_ENST00000592274.1_RNA|CACTIN_ENST00000221899.3_Missense_Mutation_p.R540Q|CACTIN_ENST00000248420.5_Missense_Mutation_p.R608Q	NM_001080543.1	NP_001074012.1	Q8WUQ7	CATIN_HUMAN	cactin, spliceosome C complex subunit	608					cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.R608Q(1)|p.R540Q(1)									CTTGGCCCGCCGGAAGAAGAT	0.711																																					p.R608Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1823A	19						.	C	GLN/ARG,GLN/ARG	1,4291		0,1,2145	19.0	22.0	21.0		1823,1823	3.9	1.0	19		21	0,8496		0,0,4248	no	missense,missense	C19orf29	NM_001080543.1,NM_021231.1	43,43	0,1,6393	TT,TC,CC		0.0,0.0233,0.0078	possibly-damaging,possibly-damaging	608/759,608/759	3612375	1,12787	2146	4248	6394	3563375	SO:0001583	missense	58509	exon10			BC019848	CCDS45920.1	19p13.3	2012-06-08	2012-06-08	2012-06-08	ENSG00000105298	ENSG00000105298			29938	protein-coding gene	gene with protein product	"""NY REN 24 antigen"", ""functional spliceosome-associated protein c"", ""cactin homolog (Drosophila)"""		"""chromosome 19 open reading frame 29"""	C19orf29		8619474, 9110174, 21429463, 20829348	Standard	NM_001080543		Approved	NY-REN-24, fSAPc, cactin	uc002lyh.3	Q8WUQ7		ENST00000429344.2:c.1823G>A	19.37:g.3612375C>T	ENSP00000415078:p.Arg608Gln	Somatic		Unspecified	Illumina	Phase_I	3563375	NM_021231	A6NNA9|A9UL12|O75229|Q7LE08|Q9BTA6|Q9Y5A4	Missense_Mutation	SNP	ENST00000429344.2	37	CCDS45920.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.10|18.10	3.548869|3.548869	0.65311|0.65311	2.33E-4|2.33E-4	0.0|0.0	ENSG00000226800|ENSG00000105298	ENST00000447295|ENST00000429344;ENST00000248420;ENST00000221899	.|.	.|.	.|.	3.88|3.88	3.88|3.88	0.44766|0.44766	.|.	.|0.125578	.|0.56097	.|D	.|0.000039	T|T	0.53562|0.53562	0.1804|0.1804	L|L	0.59436|0.59436	1.845|1.845	0.80722|0.80722	D|D	1|1	.|P;P	.|0.50819	.|0.939;0.745	.|B;B	.|0.41440	.|0.357;0.07	T|T	0.59075|0.59075	-0.7522|-0.7522	5|9	.|0.37606	.|T	.|0.19	.|.	14.9374|14.9374	0.70967|0.70967	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|608;608	.|Q8WUQ7-2;Q8WUQ7	.|.;CS029_HUMAN	L|Q	216|608;608;540	.|.	.|ENSP00000221899:R540Q	P|R	+|-	2|2	0|0	C19orf29OS|C19orf29	3563375|3563375	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.543000|0.543000	0.35085|0.35085	7.211000|7.211000	0.77933|0.77933	2.166000|2.166000	0.68216|0.68216	0.549000|0.549000	0.68633|0.68633	CCG|CGG		CACTIN-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457370.2		
ZNF208	7757	broad.mit.edu	37	19	22155008	22155008	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3999-01	TCGA-AG-3999-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr19:22155008T>G	ENST00000397126.4	-	4	2976	c.2828A>C	c.(2827-2829)aAa>aCa	p.K943T	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	943					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.K843T(2)|p.K943T(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				TTTGTAGAATTTCTCTCCAGC	0.363																																					p.K943T												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.A2828C	19						.						43.0	46.0	45.0					19																	22155008		2028	4195	6223	21946848	SO:0001583	missense	7757	exon4			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.2828A>C	19.37:g.22155008T>G	ENSP00000380315:p.Lys943Thr	Somatic		Unspecified	Illumina	Phase_I	21946848	NM_007153		Missense_Mutation	SNP	ENST00000397126.4	37	CCDS54240.1	.	.	.	.	.	.	.	.	.	.	T	13.70	2.315414	0.40996	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.24908	1.83	2.84	1.78	0.24846	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.44138	0.1279	.	.	.	0.21290	N	0.999739	D	0.57899	0.981	D	0.85130	0.997	T	0.11299	-1.0593	8	0.72032	D	0.01	.	6.3689	0.21471	0.0:0.1359:0.0:0.8641	.	843	O43345	ZN208_HUMAN	T	943;843	ENSP00000380315:K943T	ENSP00000380315:K943T	K	-	2	0	ZNF208	21946848	0.001000	0.12720	0.015000	0.15790	0.256000	0.26092	-0.103000	0.10940	0.970000	0.38263	0.102000	0.15555	AAA		ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153	
PRKD2	25865	broad.mit.edu	37	19	47197331	47197331	+	Silent	SNP	C	C	T	rs61739905		TCGA-AG-3999-01	TCGA-AG-3999-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr19:47197331C>T	ENST00000291281.4	-	10	1602	c.1377G>A	c.(1375-1377)ccG>ccA	p.P459P	PRKD2_ENST00000595515.1_Silent_p.P459P|PRKD2_ENST00000600194.1_Silent_p.P302P|PRKD2_ENST00000433867.1_Silent_p.P459P|PRKD2_ENST00000601806.1_Silent_p.P302P			Q9BZL6	KPCD2_HUMAN	protein kinase D2	459	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)	p.P459P(1)		central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	41		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		TGGTGCCCGGCGGCACAAGGC	0.622													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17635	0.0		0.0	False		,,,				2504	0.0				p.P459P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1377A	19						.	C	,,,	1,4405	2.1+/-5.4	0,1,2202	61.0	51.0	54.0		1377,1377,906,1377	-9.5	0.1	19	dbSNP_129	54	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PRKD2	NM_001079880.1,NM_001079881.1,NM_001079882.1,NM_016457.4	,,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,,	459/879,459/879,302/722,459/879	47197331	1,13005	2203	4300	6503	51889171	SO:0001819	synonymous_variant	25865	exon11			AF151021	CCDS12689.1, CCDS59401.1	19q13.2	2013-01-10				ENSG00000105287		"""Pleckstrin homology (PH) domain containing"""	17293	protein-coding gene	gene with protein product		607074				11042152, 11062248	Standard	NM_001079880		Approved	PKD2, HSPC187, DKFZP586E0820	uc002pfj.3	Q9BZL6		ENST00000291281.4:c.1377G>A	19.37:g.47197331C>T		Somatic		Unspecified	Illumina	Phase_I	51889171	NM_001079881	Q8TB08|Q9P0T6|Q9Y3X8	Silent	SNP	ENST00000291281.4	37	CCDS12689.1																																																																																				PRKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466591.1	NM_016457	
MEIS3	56917	broad.mit.edu	37	19	47912429	47912429	+	Missense_Mutation	SNP	C	C	T	rs563242031		TCGA-AG-3999-01	TCGA-AG-3999-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr19:47912429C>T	ENST00000558555.1	-	8	972	c.785G>A	c.(784-786)cGa>cAa	p.R262Q	MEIS3_ENST00000560253.1_5'UTR|MEIS3_ENST00000561096.1_Missense_Mutation_p.R350Q|MEIS3_ENST00000441740.2_Missense_Mutation_p.R245Q|MEIS3_ENST00000331559.5_Missense_Mutation_p.R245Q|MEIS3_ENST00000561293.1_Missense_Mutation_p.R262Q|MEIS3_ENST00000559524.1_Missense_Mutation_p.R262Q			Q99687	MEIS3_HUMAN	Meis homeobox 3	262					negative regulation of apoptotic signaling pathway (GO:2001234)|positive regulation of protein kinase B signaling (GO:0051897)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)	p.R262Q(1)		breast(1)|large_intestine(5)|lung(11)|prostate(1)|skin(2)	20		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;0.000198)|OV - Ovarian serous cystadenocarcinoma(262;0.000439)|Epithelial(262;0.0113)|GBM - Glioblastoma multiforme(486;0.0223)		CTTCTTGTTTCGCCGTCGCTC	0.617													c|||	1	0.000199681	0.0	0.0	5008	,	,		18368	0.0		0.0	False		,,,				2504	0.001				p.R262Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G785A	19						.						96.0	74.0	82.0					19																	47912429		2203	4300	6503	52604241	SO:0001583	missense	56917	exon8			BC025404	CCDS33064.1, CCDS46132.1, CCDS74406.1	19q13.32	2012-10-02	2007-02-15		ENSG00000105419	ENSG00000105419		"""Homeoboxes / TALE class"""	29537	protein-coding gene	gene with protein product			"""Meis1, myeloid ecotropic viral integration site 1 homolog 3 (mouse)"""			8950991	Standard	NM_020160		Approved	MRG2, DKFZp547H236	uc002pgt.4	Q99687	OTTHUMG00000172280	ENST00000558555.1:c.785G>A	19.37:g.47912429C>T	ENSP00000454073:p.Arg262Gln	Somatic		Unspecified	Illumina	Phase_I	52604241	NM_020160	A8K1N5|Q6NT73|Q8TC66|Q9NPW2	Missense_Mutation	SNP	ENST00000558555.1	37		.	.	.	.	.	.	.	.	.	.	C	13.40	2.225961	0.39300	.	.	ENSG00000105419	ENST00000331559;ENST00000441740	D	0.83837	-1.77	3.96	2.91	0.33838	Homeodomain-related (1);Homeobox (2);Homeodomain-like (1);	0.217385	0.38217	N	0.001778	D	0.85796	0.5780	L	0.44542	1.39	0.40923	D	0.98432	B;B;D;D;B	0.76494	0.041;0.398;0.987;0.999;0.006	B;B;P;D;B	0.77557	0.003;0.042;0.63;0.99;0.002	D	0.86060	0.1531	10	0.62326	D	0.03	-27.5691	10.3134	0.43723	0.0:0.8998:0.0:0.1002	.	154;262;245;262;137	Q8TCW1;Q99687;Q99687-3;Q99687-2;Q59FK5	.;MEIS3_HUMAN;.;.;.	Q	262;245	ENSP00000388667:R245Q	ENSP00000333552:R262Q	R	-	2	0	MEIS3	52604241	0.901000	0.30685	1.000000	0.80357	0.968000	0.65278	2.215000	0.42862	1.227000	0.43598	0.655000	0.94253	CGA		MEIS3-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000417642.1	XM_085929	
GRIN2D	2906	broad.mit.edu	37	19	48908432	48908432	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3999-01	TCGA-AG-3999-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr19:48908432G>A	ENST00000263269.3	+	3	995	c.907G>A	c.(907-909)Ggg>Agg	p.G303R		NM_000836.2	NP_000827.2	O15399	NMDE4_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	303					adult locomotory behavior (GO:0008344)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|regulation of sensory perception of pain (GO:0051930)|signal transduction (GO:0007165)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)	p.G303R(1)		autonomic_ganglia(1)|breast(6)|endometrium(2)|large_intestine(9)|lung(12)|ovary(5)|pancreas(1)|prostate(1)	37		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CCTGCCTGCCGGGCTGTTTGC	0.731																																					p.G303R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G907A	19						.						8.0	11.0	10.0					19																	48908432		2162	4204	6366	53600244	SO:0001583	missense	2906	exon3			U77783	CCDS12719.1	19q13.33	2012-08-29			ENSG00000105464	ENSG00000105464		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4588	protein-coding gene	gene with protein product	"""N-methyl-d-aspartate receptor subunit 2D"""	602717		NMDAR2D		9480759, 9418891	Standard	NM_000836		Approved	GluN2D, EB11, NR2D	uc002pjc.4	O15399		ENST00000263269.3:c.907G>A	19.37:g.48908432G>A	ENSP00000263269:p.Gly303Arg	Somatic		Unspecified	Illumina	Phase_I	53600244	NM_000836		Missense_Mutation	SNP	ENST00000263269.3	37	CCDS12719.1	.	.	.	.	.	.	.	.	.	.	G	18.85	3.710640	0.68730	.	.	ENSG00000105464	ENST00000263269	T	0.08807	3.05	4.45	4.45	0.53987	Extracellular ligand-binding receptor (1);	0.211955	0.37136	N	0.002222	T	0.24122	0.0584	L	0.49126	1.545	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.00989	-1.1489	10	0.72032	D	0.01	.	16.2466	0.82448	0.0:0.0:1.0:0.0	.	303	O15399	NMDE4_HUMAN	R	303	ENSP00000263269:G303R	ENSP00000263269:G303R	G	+	1	0	GRIN2D	53600244	1.000000	0.71417	0.882000	0.34594	0.364000	0.29643	9.117000	0.94347	2.199000	0.70637	0.561000	0.74099	GGG		GRIN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466121.1		
OR7G1	125962	broad.mit.edu	37	19	9226075	9226075	+	Missense_Mutation	SNP	C	C	T	rs140073167	byFrequency	TCGA-AG-3999-01	TCGA-AG-3999-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr19:9226075C>T	ENST00000541538.1	-	1	364	c.365G>A	c.(364-366)cGc>cAc	p.R122H	OR7G1_ENST00000293614.1_Missense_Mutation_p.R122H	NM_001005192.2	NP_001005192.2	Q8NGA0	OR7G1_HUMAN	olfactory receptor, family 7, subfamily G, member 1	122						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R122H(1)		breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|skin(2)	20						GGCCACATAGCGGTCGTAGGC	0.483													C|||	2	0.000399361	0.0008	0.0	5008	,	,		19063	0.0		0.0	False		,,,				2504	0.001				p.R122H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G365A	19						.	C	HIS/ARG	3,4403	8.1+/-20.4	0,3,2200	121.0	120.0	120.0		365	2.7	0.4	19	dbSNP_134	120	0,8600		0,0,4300	yes	missense	OR7G1	NM_001005192.2	29	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	possibly-damaging	122/312	9226075	3,13003	2203	4300	6503	9087075	SO:0001583	missense	125962	exon1				CCDS32898.1, CCDS32898.2	19p13.2	2013-09-24			ENSG00000161807	ENSG00000161807		"""GPCR / Class A : Olfactory receptors"""	8465	protein-coding gene	gene with protein product				OR7G1P			Standard	NM_001005192		Approved	OR19-15	uc021uoi.1	Q8NGA0	OTTHUMG00000168067	ENST00000541538.1:c.365G>A	19.37:g.9226075C>T	ENSP00000444134:p.Arg122His	Somatic		Unspecified	Illumina	Phase_I	9087075	NM_001005192	Q6IFJ5|Q96RA1	Missense_Mutation	SNP	ENST00000541538.1	37	CCDS32898.2	2	9.157509157509158E-4	1	0.0020325203252032522	0	0.0	0	0.0	1	0.0013192612137203166	c	12.65	2.000534	0.35320	6.81E-4	0.0	ENSG00000161807	ENST00000293614;ENST00000541538	T;T	0.77489	-1.1;-1.1	3.78	2.71	0.32032	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39146	U	0.001442	T	0.81259	0.4785	M	0.93328	3.405	0.27687	N	0.946241	B	0.31256	0.316	B	0.26969	0.075	T	0.77443	-0.2586	10	0.72032	D	0.01	.	12.6859	0.56948	0.0:0.8313:0.1687:0.0	.	122	Q8NGA0	OR7G1_HUMAN	H	122	ENSP00000293614:R122H;ENSP00000444134:R122H	ENSP00000293614:R122H	R	-	2	0	OR7G1	9087075	0.966000	0.33281	0.374000	0.26016	0.265000	0.26407	5.008000	0.63991	0.903000	0.36546	0.501000	0.49751	CGC		OR7G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397912.1		
SIGLEC11	114132	broad.mit.edu	37	19	50461734	50461734	+	Missense_Mutation	SNP	C	C	T	rs200767146		TCGA-AG-3999-01	TCGA-AG-3999-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr19:50461734C>T	ENST00000447370.2	-	8	1547	c.1457G>A	c.(1456-1458)cGc>cAc	p.R486H	CTC-326K19.6_ENST00000451973.1_5'Flank|SIGLEC11_ENST00000426971.2_Intron	NM_052884.2	NP_443116.2	Q96RL6	SIG11_HUMAN	sialic acid binding Ig-like lectin 11	486					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.R474H(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(6)|pancreas(1)|prostate(1)|skin(1)	32		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)		AAGCCACCAGCGCAGAGAGGG	0.706																																					p.R486H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1457A	19						.						11.0	13.0	12.0					19																	50461734		2185	4258	6443	55153546	SO:0001583	missense	114132	exon8			AF337818	CCDS12790.2, CCDS46150.1	19q13.3	2013-01-29			ENSG00000161640	ENSG00000161640		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15622	protein-coding gene	gene with protein product		607157				11986327	Standard	NM_052884		Approved		uc010ybi.2	Q96RL6	OTTHUMG00000157077	ENST00000447370.2:c.1457G>A	19.37:g.50461734C>T	ENSP00000412361:p.Arg486His	Somatic		Unspecified	Illumina	Phase_I	55153546	NM_052884		Missense_Mutation	SNP	ENST00000447370.2	37	CCDS12790.2	.	.	.	.	.	.	.	.	.	.	C	9.279	1.047774	0.19827	.	.	ENSG00000161640	ENST00000447370	D	0.86297	-2.1	2.86	1.79	0.24919	.	0.594677	0.16362	N	0.217735	T	0.81370	0.4808	L	0.35723	1.085	0.80722	D	1	D	0.54207	0.965	P	0.47470	0.548	T	0.74931	-0.3496	9	.	.	.	.	6.3602	0.21425	0.0:0.8425:0.0:0.1575	.	486	Q96RL6	SIG11_HUMAN	H	486	ENSP00000412361:R486H	.	R	-	2	0	SIGLEC11	55153546	0.022000	0.18835	0.628000	0.29241	0.012000	0.07955	-0.950000	0.03889	0.486000	0.27676	0.556000	0.70494	CGC		SIGLEC11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347382.1	NM_052884	
NUGGC	389643	broad.mit.edu	37	8	27898660	27898660	+	Missense_Mutation	SNP	C	C	T	rs199622602		TCGA-AG-3999-01	TCGA-AG-3999-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr8:27898660C>T	ENST00000413272.2	-	13	1661	c.1519G>A	c.(1519-1521)Gca>Aca	p.A507T	NUGGC_ENST00000341513.6_Missense_Mutation_p.A507T	NM_001010906.1	NP_001010906.1	Q68CJ6	SLIP_HUMAN	nuclear GTPase, germinal center associated	507					cellular response to DNA damage stimulus (GO:0006974)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.A507T(1)									AAGCACTGTGCGATGGCCTTC	0.542													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18025	0.0		0.0	False		,,,				2504	0.0				p.A507T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1519A	8						.	C	THR/ALA	6,4192		0,6,2093	48.0	50.0	50.0		1519	1.9	0.0	8		50	2,8430		0,2,4214	yes	missense	C8orf80	NM_001010906.1	58	0,8,6307	TT,TC,CC		0.0237,0.1429,0.0633	benign	507/797	27898660	8,12622	2099	4216	6315	27954579	SO:0001583	missense	389643	exon13			AB075870	CCDS47833.1	8p21.1	2012-06-07	2012-06-07	2012-06-07	ENSG00000189233	ENSG00000189233			33550	protein-coding gene	gene with protein product	"""speckled-like pattern in the germinal center"""		"""chromosome 8 open reading frame 80"""	C8orf80		19734146	Standard	NM_001010906		Approved	HMFN0672, SLIP-GC	uc003xgm.4	Q68CJ6	OTTHUMG00000155970	ENST00000413272.2:c.1519G>A	8.37:g.27898660C>T	ENSP00000408697:p.Ala507Thr	Somatic		Unspecified	Illumina	Phase_I	27954579	NM_001010906	Q6ZP73	Missense_Mutation	SNP	ENST00000413272.2	37	CCDS47833.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	2.552	-0.303799	0.05495	0.001429	2.37E-4	ENSG00000189233	ENST00000413272;ENST00000341513	T;T	0.29397	1.57;1.57	5.65	1.92	0.25849	.	0.646882	0.15899	N	0.239164	T	0.13243	0.0321	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33420	-0.9869	10	0.14656	T	0.56	-4.7309	7.8611	0.29509	0.0:0.6702:0.0:0.3298	.	507	Q68CJ6	SLIP_HUMAN	T	507	ENSP00000408697:A507T;ENSP00000345031:A507T	ENSP00000345031:A507T	A	-	1	0	C8orf80	27954579	0.002000	0.14202	0.000000	0.03702	0.000000	0.00434	0.218000	0.17622	0.069000	0.16605	-0.897000	0.02905	GCA		NUGGC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000342494.1	NM_001010906	
PLEKHA2	59339	broad.mit.edu	37	8	38826183	38826183	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3999-01	TCGA-AG-3999-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr8:38826183C>T	ENST00000420274.1	+	11	1145	c.911C>T	c.(910-912)cCc>cTc	p.P304L	PLEKHA2_ENST00000388745.4_3'UTR|CTD-2544N14.3_ENST00000520863.1_RNA|PLEKHA2_ENST00000521746.1_Intron	NM_021623.1	NP_067636.1	Q9HB19	PKHA2_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2	304					positive regulation of cell-matrix adhesion (GO:0001954)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|lipid binding (GO:0008289)	p.P304L(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	13		all_lung(54;0.0413)|Lung NSC(58;0.115)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;4.68e-08)|COAD - Colon adenocarcinoma(9;0.235)			AAGTGCCACCCCAGAGTAAGT	0.498																																					p.P304L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C911T	8						.						93.0	100.0	97.0					8																	38826183		2031	4193	6224	38945340	SO:0001583	missense	59339	exon11			AF286164	CCDS75732.1	8p11.21	2013-01-10	2002-01-14			ENSG00000169499		"""Pleckstrin homology (PH) domain containing"""	14336	protein-coding gene	gene with protein product	"""tandem PH Domain containing protein-2"""	607773	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2"""			11001876	Standard	NM_021623		Approved	TAPP2	uc003xmi.4	Q9HB19		ENST00000420274.1:c.911C>T	8.37:g.38826183C>T	ENSP00000393860:p.Pro304Leu	Somatic		Unspecified	Illumina	Phase_I	38945340	NM_021623		Missense_Mutation	SNP	ENST00000420274.1	37		.	.	.	.	.	.	.	.	.	.	C	16.26	3.071812	0.55646	.	.	ENSG00000169499	ENST00000420274;ENST00000535929	T	0.05513	3.43	6.16	5.28	0.74379	.	0.228628	0.45606	D	0.000350	T	0.08980	0.0222	M	0.65975	2.015	0.54753	D	0.999988	B;B	0.31383	0.321;0.1	B;B	0.29267	0.1;0.036	T	0.14531	-1.0469	10	0.22706	T	0.39	-11.9401	12.1765	0.54188	0.1353:0.7347:0.13:0.0	.	304;304	Q9HB19;A8K727	PKHA2_HUMAN;.	L	304;254	ENSP00000393860:P304L	ENSP00000393860:P304L	P	+	2	0	PLEKHA2	38945340	0.996000	0.38824	1.000000	0.80357	0.996000	0.88848	2.761000	0.47589	1.607000	0.50170	0.650000	0.86243	CCC		PLEKHA2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_021623	
TRPA1	8989	broad.mit.edu	37	8	72975174	72975174	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3999-01	TCGA-AG-3999-01	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr8:72975174C>G	ENST00000262209.4	-	6	874	c.667G>C	c.(667-669)Gag>Cag	p.E223Q		NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	223					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)	p.E223Q(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	TACCCATGCTCTTCACCTTGA	0.328																																					p.E223Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G667C	8						.						94.0	88.0	90.0					8																	72975174		2203	4300	6503	73137728	SO:0001583	missense	8989	exon6			Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.667G>C	8.37:g.72975174C>G	ENSP00000262209:p.Glu223Gln	Somatic		Unspecified	Illumina	Phase_I	73137728	NM_007332	A6NIN6	Missense_Mutation	SNP	ENST00000262209.4	37	CCDS34908.1	.	.	.	.	.	.	.	.	.	.	C	15.06	2.719758	0.48728	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	T;T	0.54071	0.59;2.31	5.62	2.71	0.32032	Ankyrin repeat-containing domain (3);	0.281797	0.43747	D	0.000531	T	0.42040	0.1185	L	0.52759	1.655	0.39321	D	0.965244	B	0.24426	0.103	B	0.20184	0.028	T	0.25187	-1.0139	10	0.25751	T	0.34	-9.5954	9.0015	0.36085	0.0:0.7499:0.0:0.2501	.	223	O75762	TRPA1_HUMAN	Q	75;223	ENSP00000428151:E75Q;ENSP00000262209:E223Q	ENSP00000262209:E223Q	E	-	1	0	TRPA1	73137728	0.992000	0.36948	0.048000	0.18961	0.654000	0.38779	0.605000	0.24179	0.640000	0.30582	0.650000	0.86243	GAG		TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332	
ZFHX4	79776	broad.mit.edu	37	8	77618386	77618386	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3999-01	TCGA-AG-3999-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr8:77618386G>A	ENST00000521891.2	+	2	2511	c.2063G>A	c.(2062-2064)cGg>cAg	p.R688Q	ZFHX4_ENST00000455469.2_Missense_Mutation_p.R688Q|ZFHX4_ENST00000050961.6_Missense_Mutation_p.R688Q|ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000518282.1_Missense_Mutation_p.R688Q	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	688					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.R688Q(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AGGCTTGCCCGGGGTGAGAGT	0.517										HNSCC(33;0.089)																											p.R688Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2063A	8						.						42.0	46.0	45.0					8																	77618386		2140	4277	6417	77780941	SO:0001583	missense	79776	exon2				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.2063G>A	8.37:g.77618386G>A	ENSP00000430497:p.Arg688Gln	Somatic		Unspecified	Illumina	Phase_I	77780941	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	G	15.01	2.705674	0.48412	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.58060	0.42;0.41;0.38;0.36	4.98	4.98	0.66077	.	0.000000	0.42294	U	0.000731	T	0.72827	0.3509	M	0.70595	2.14	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.988;0.996;0.995;1.0	T	0.75010	-0.3468	10	0.66056	D	0.02	.	18.7896	0.91968	0.0:0.0:1.0:0.0	.	688;688;688;688	Q86UP3;Q86UP3-4;G3V138;Q86UP3-3	ZFHX4_HUMAN;.;.;.	Q	688	ENSP00000430497:R688Q;ENSP00000399605:R688Q;ENSP00000050961:R688Q;ENSP00000430848:R688Q	ENSP00000050961:R688Q	R	+	2	0	ZFHX4	77780941	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.592000	0.98245	2.737000	0.93849	0.637000	0.83480	CGG		ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
ERICH5	203111	broad.mit.edu	37	8	99102183	99102183	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3999-01	TCGA-AG-3999-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr8:99102183G>A	ENST00000318528.3	+	2	1297	c.938G>A	c.(937-939)cGa>cAa	p.R313Q	C8orf47_ENST00000545282.1_Intron	NM_173549.2	NP_775820.2	Q6P6B1	ERIC5_HUMAN		313	Glu-rich.							p.R313Q(2)		kidney(1)|large_intestine(5)|lung(4)|prostate(1)|skin(2)	13	Breast(36;2.31e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.214)			CATCCAGCACGAAATGTAGAG	0.438																																					p.R313Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.G938A	8						.						117.0	103.0	107.0					8																	99102183		2203	4300	6503	99171359	SO:0001583	missense	203111	exon2																														ENST00000318528.3:c.938G>A	8.37:g.99102183G>A	ENSP00000315614:p.Arg313Gln	Somatic		Unspecified	Illumina	Phase_I	99171359	NM_173549	G3V1K4|Q8N1L8	Missense_Mutation	SNP	ENST00000318528.3	37	CCDS34929.1	.	.	.	.	.	.	.	.	.	.	G	10.03	1.238636	0.22711	.	.	ENSG00000177459	ENST00000318528	T	0.22336	1.96	4.8	1.8	0.24995	.	0.411835	0.20879	N	0.084039	T	0.09642	0.0237	N	0.22421	0.69	0.09310	N	0.999999	B	0.29936	0.262	B	0.22386	0.039	T	0.24764	-1.0151	10	0.18276	T	0.48	-1.6124	4.3678	0.11233	0.1902:0.0:0.6336:0.1762	.	313	Q6P6B1	CH047_HUMAN	Q	313	ENSP00000315614:R313Q	ENSP00000315614:R313Q	R	+	2	0	C8orf47	99171359	0.043000	0.20138	0.021000	0.16686	0.016000	0.09150	0.376000	0.20535	0.730000	0.32425	0.655000	0.94253	CGA		C8orf47-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380465.1		
KCNS2	3788	broad.mit.edu	37	8	99441321	99441321	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3999-01	TCGA-AG-3999-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr8:99441321A>G	ENST00000287042.4	+	2	1464	c.1114A>G	c.(1114-1116)Atg>Gtg	p.M372V	KCNS2_ENST00000521839.1_Missense_Mutation_p.M372V	NM_020697.2	NP_065748.1	Q9ULS6	KCNS2_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2	372					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.M372V(1)		autonomic_ganglia(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	31	Breast(36;2.4e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.0448)			TACCGTCAGTATGACCACAGT	0.617																																					p.M372V	Pancreas(138;844 2489 9202 24627)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1114G	8						.						85.0	80.0	82.0					8																	99441321		2203	4300	6503	99510497	SO:0001583	missense	3788	exon2			AB032970	CCDS6279.1	8q22	2011-07-05			ENSG00000156486	ENSG00000156486		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6301	protein-coding gene	gene with protein product		602906				9305895, 16382104	Standard	NM_020697		Approved	Kv9.2	uc003yin.3	Q9ULS6	OTTHUMG00000044337	ENST00000287042.4:c.1114A>G	8.37:g.99441321A>G	ENSP00000287042:p.Met372Val	Somatic		Unspecified	Illumina	Phase_I	99510497	NM_020697	A8KAN1	Missense_Mutation	SNP	ENST00000287042.4	37	CCDS6279.1	.	.	.	.	.	.	.	.	.	.	A	17.73	3.461620	0.63513	.	.	ENSG00000156486	ENST00000287042;ENST00000521839	D;D	0.98807	-5.15;-5.15	6.07	6.07	0.98685	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98937	0.9639	M	0.71581	2.175	0.58432	D	0.999999	D	0.53885	0.963	D	0.67231	0.95	D	0.99864	1.1087	10	0.87932	D	0	.	16.6288	0.85011	1.0:0.0:0.0:0.0	.	372	Q9ULS6	KCNS2_HUMAN	V	372	ENSP00000287042:M372V;ENSP00000430712:M372V	ENSP00000287042:M372V	M	+	1	0	KCNS2	99510497	1.000000	0.71417	0.995000	0.50966	0.976000	0.68499	9.339000	0.96797	2.326000	0.78906	0.533000	0.62120	ATG		KCNS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103134.1	NM_020697	
UBR5	51366	broad.mit.edu	37	8	103299706	103299706	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3999-01	TCGA-AG-3999-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr8:103299706C>T	ENST00000520539.1	-	37	5518	c.4912G>A	c.(4912-4914)Ggg>Agg	p.G1638R	UBR5_ENST00000220959.4_Missense_Mutation_p.G1638R|UBR5_ENST00000521922.1_Missense_Mutation_p.G1632R|UBR5_ENST00000519528.1_5'Flank	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	1638					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)	p.G1638R(1)		NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			CTTCTGCGCCCACTAGCATTA	0.443																																					p.G1638R	Ovarian(131;96 1741 5634 7352 27489)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4912A	8						.						199.0	148.0	165.0					8																	103299706		2203	4300	6503	103368882	SO:0001583	missense	51366	exon37			AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.4912G>A	8.37:g.103299706C>T	ENSP00000429084:p.Gly1638Arg	Somatic		Unspecified	Illumina	Phase_I	103368882	NM_015902	B2RP24|J3KMW7|O94970|Q9NPL3	Missense_Mutation	SNP	ENST00000520539.1	37	CCDS34933.1	.	.	.	.	.	.	.	.	.	.	C	32	5.178925	0.94846	.	.	ENSG00000104517	ENST00000520539;ENST00000220959;ENST00000521922	T;T;T	0.46819	0.86;0.86;0.86	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.59280	0.2182	N	0.22421	0.69	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.61783	-0.6992	10	0.72032	D	0.01	.	20.3955	0.98984	0.0:1.0:0.0:0.0	.	1632;1638	E7EMW7;O95071	.;UBR5_HUMAN	R	1638;1638;1632	ENSP00000429084:G1638R;ENSP00000220959:G1638R;ENSP00000427819:G1632R	ENSP00000220959:G1638R	G	-	1	0	UBR5	103368882	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.770000	0.85390	2.830000	0.97506	0.655000	0.94253	GGG		UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380075.2	NM_015902	
TDRKH	11022	broad.mit.edu	37	1	151751698	151751698	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3999-01	TCGA-AG-3999-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr1:151751698G>A	ENST00000368822.1	-	5	1075	c.442C>T	c.(442-444)Cgt>Tgt	p.R148C	TDRKH_ENST00000368823.1_Missense_Mutation_p.R144C|TDRKH_ENST00000368827.6_Missense_Mutation_p.R148C|TDRKH_ENST00000484421.1_5'UTR|TDRKH_ENST00000458431.2_Missense_Mutation_p.R148C|TDRKH_ENST00000440583.2_5'UTR|TDRKH_ENST00000368824.3_Missense_Mutation_p.R148C|TDRKH_ENST00000368825.3_Intron			Q9Y2W6	TDRKH_HUMAN	tudor and KH domain containing	148	KH 2. {ECO:0000255|PROSITE- ProRule:PRU00117}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	mitochondrion (GO:0005739)|pi-body (GO:0071546)|piP-body (GO:0071547)	RNA binding (GO:0003723)	p.R148C(1)		breast(5)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			CAGATAGAACGAATTGTCTCG	0.398																																					p.R148C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C442T	1						.						110.0	101.0	104.0					1																	151751698		1859	4094	5953	150018322	SO:0001583	missense	11022	exon5			AF227192	CCDS41394.1, CCDS41395.1	1q21	2013-01-23	2003-11-07		ENSG00000182134	ENSG00000182134		"""Tudor domain containing"""	11713	protein-coding gene	gene with protein product		609501	"""tudor and KH domain containing"""			10767542	Standard	NM_001083964		Approved	TDRD2	uc001eza.4	Q9Y2W6	OTTHUMG00000013062	ENST00000368822.1:c.442C>T	1.37:g.151751698G>A	ENSP00000357812:p.Arg148Cys	Somatic		Unspecified	Illumina	Phase_I	150018322	NM_001083965	D3DV24|Q5SZR3|Q5SZR5|Q8N582|Q9NYV5	Missense_Mutation	SNP	ENST00000368822.1	37	CCDS41394.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.423789	0.83667	.	.	ENSG00000182134	ENST00000368827;ENST00000368824;ENST00000368823;ENST00000368822;ENST00000458431	T;T;T;T;T	0.34859	1.34;1.34;1.34;1.34;1.34	5.87	5.87	0.94306	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.053244	0.64402	D	0.000001	T	0.67183	0.2866	M	0.94021	3.485	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.995	T	0.75522	-0.3288	10	0.87932	D	0	-10.3827	18.7883	0.91964	0.0:0.0:1.0:0.0	.	144;148	Q5SZR4;Q9Y2W6	.;TDRKH_HUMAN	C	148;148;144;148;148	ENSP00000357819:R148C;ENSP00000357815:R148C;ENSP00000357813:R144C;ENSP00000357812:R148C;ENSP00000395718:R148C	ENSP00000357812:R148C	R	-	1	0	TDRKH	150018322	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.477000	0.60223	2.770000	0.95276	0.650000	0.86243	CGT		TDRKH-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000036648.2	NM_006862	
CRTC2	200186	broad.mit.edu	37	1	153924880	153924880	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3999-01	TCGA-AG-3999-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr1:153924880C>T	ENST00000368633.1	-	9	872	c.745G>A	c.(745-747)Gga>Aga	p.G249R	CRTC2_ENST00000476883.1_5'Flank|CRTC2_ENST00000368630.3_Intron	NM_181715.2	NP_859066.1	Q53ET0	CRTC2_HUMAN	CREB regulated transcription coactivator 2	249					gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|histone H3-K9 acetylation (GO:0043970)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	cAMP response element binding protein binding (GO:0008140)	p.G249R(1)		NS(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	27	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TACTTAATTCCAGGGACTTCA	0.532																																					p.G249R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G745A	1						.						79.0	81.0	80.0					1																	153924880		2203	4300	6503	152191504	SO:0001583	missense	200186	exon9			AY360172	CCDS30875.1	1q21.3	2008-02-05			ENSG00000160741	ENSG00000160741			27301	protein-coding gene	gene with protein product		608972				14506290, 14536081	Standard	NM_181715		Approved	TORC2	uc021pab.1	Q53ET0	OTTHUMG00000037156	ENST00000368633.1:c.745G>A	1.37:g.153924880C>T	ENSP00000357622:p.Gly249Arg	Somatic		Unspecified	Illumina	Phase_I	152191504	NM_181715	Q6UUV8|Q7Z3X7|Q8N332	Missense_Mutation	SNP	ENST00000368633.1	37	CCDS30875.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.557980	0.86231	.	.	ENSG00000160741	ENST00000368633	T	0.56941	0.43	4.67	4.67	0.58626	Transducer of regulated CREB activity, middle domain (1);	0.000000	0.85682	D	0.000000	T	0.65595	0.2706	M	0.71036	2.16	0.50813	D	0.999892	D	0.89917	1.0	D	0.87578	0.998	T	0.69624	-0.5095	10	0.72032	D	0.01	-4.4078	15.1154	0.72397	0.0:1.0:0.0:0.0	.	249	Q53ET0	CRTC2_HUMAN	R	249	ENSP00000357622:G249R	ENSP00000357622:G249R	G	-	1	0	CRTC2	152191504	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	6.421000	0.73353	2.430000	0.82344	0.455000	0.32223	GGA		CRTC2-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090272.3	NM_181715	
PKLR	5313	broad.mit.edu	37	1	155263069	155263069	+	Silent	SNP	C	C	T			TCGA-AG-3999-01	TCGA-AG-3999-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr1:155263069C>T	ENST00000342741.4	-	9	1373	c.1335G>A	c.(1333-1335)gcG>gcA	p.A445A	PKLR_ENST00000392414.3_Silent_p.A414A	NM_000298.5	NP_000289.1	P30613	KPYR_HUMAN	pyruvate kinase, liver and RBC	445					ATP biosynthetic process (GO:0006754)|carbohydrate metabolic process (GO:0005975)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|positive regulation of cellular metabolic process (GO:0031325)|pyruvate biosynthetic process (GO:0042866)|response to ATP (GO:0033198)|response to cAMP (GO:0051591)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to nutrient (GO:0007584)|response to other organism (GO:0051707)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|potassium ion binding (GO:0030955)|pyruvate kinase activity (GO:0004743)	p.A445A(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_lung(78;6.99e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;3.18e-10)|all cancers(21;7.9e-10)|BRCA - Breast invasive adenocarcinoma(34;0.00116)|LUSC - Lung squamous cell carcinoma(543;0.127)		Pyruvic acid(DB00119)	GGCTTAGTGGCGCTGCCCGAC	0.612																																					p.A445A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1335A	1						.						81.0	69.0	73.0					1																	155263069		2203	4300	6503	153529693	SO:0001819	synonymous_variant	5313	exon9			BC025737, M15465	CCDS1109.1, CCDS44240.1	1q22	2012-10-02			ENSG00000143627	ENSG00000143627	2.7.1.40		9020	protein-coding gene	gene with protein product		609712				3566732	Standard	NM_000298		Approved		uc001fkb.4	P30613	OTTHUMG00000035875	ENST00000342741.4:c.1335G>A	1.37:g.155263069C>T		Somatic		Unspecified	Illumina	Phase_I	153529693	NM_000298	O75758|P11973	Silent	SNP	ENST00000342741.4	37	CCDS1109.1																																																																																				PKLR-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000087407.2	NM_000298	
RGS13	6003	broad.mit.edu	37	1	192628477	192628477	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3999-01	TCGA-AG-3999-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr1:192628477G>A	ENST00000391995.2	+	7	592	c.304G>A	c.(304-306)Gac>Aac	p.D102N	RGS13_ENST00000543215.1_Missense_Mutation_p.D102N|RGS13_ENST00000482095.1_3'UTR	NM_002927.4	NP_002918.1	O14921	RGS13_HUMAN	regulator of G-protein signaling 13	102	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.D102N(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(12)|skin(1)	19						GATTAACATTGACAGTTCGAC	0.343																																					p.D102N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G304A	1						.						105.0	84.0	92.0					1																	192628477		2203	4300	6503	190895100	SO:0001583	missense	6003	exon6			AF030107	CCDS1376.1	1q31.2	2008-02-05	2007-08-14		ENSG00000127074	ENSG00000127074		"""Regulators of G-protein signaling"""	9995	protein-coding gene	gene with protein product		607190	"""regulator of G-protein signalling 13"""			11875076	Standard	NM_144766		Approved		uc001gsk.3	O14921	OTTHUMG00000035601	ENST00000391995.2:c.304G>A	1.37:g.192628477G>A	ENSP00000375853:p.Asp102Asn	Somatic		Unspecified	Illumina	Phase_I	190895100	NM_144766	Q6PGR2|Q8TD63|Q9BX45	Missense_Mutation	SNP	ENST00000391995.2	37	CCDS1376.1	.	.	.	.	.	.	.	.	.	.	G	33	5.225310	0.95173	.	.	ENSG00000127074	ENST00000391995;ENST00000543215	T;T	0.35605	1.3;1.3	5.69	5.69	0.88448	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);	0.000000	0.85682	D	0.000000	T	0.67636	0.2914	M	0.90759	3.145	0.58432	D	0.999999	P	0.43287	0.802	P	0.62298	0.9	T	0.71823	-0.4476	10	0.66056	D	0.02	.	17.2892	0.87150	0.0:0.0:1.0:0.0	.	102	O14921	RGS13_HUMAN	N	102	ENSP00000375853:D102N;ENSP00000442837:D102N	ENSP00000375853:D102N	D	+	1	0	RGS13	190895100	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	7.243000	0.78219	2.685000	0.91497	0.591000	0.81541	GAC		RGS13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086400.1	NM_002927	
ATP6V1G3	127124	broad.mit.edu	37	1	198492551	198492551	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3999-01	TCGA-AG-3999-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr1:198492551T>A	ENST00000367382.1	-	3	411	c.327A>T	c.(325-327)gaA>gaT	p.E109D	ATP6V1G3_ENST00000489986.1_Missense_Mutation_p.E115D|ATP6V1G3_ENST00000281087.2_Missense_Mutation_p.E109D|ATP6V1G3_ENST00000367381.1_Missense_Mutation_p.E115D|ATP6V1G3_ENST00000309309.7_3'UTR			Q96LB4	VATG3_HUMAN	ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3	109					cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	ATPase binding (GO:0051117)|hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)	p.E109D(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|prostate(1)	7						TCACATGGATTTCTGGTTTCA	0.393																																					p.E109D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A327T	1						.						173.0	143.0	153.0					1																	198492551		2203	4300	6503	196759174	SO:0001583	missense	127124	exon4			AY039760	CCDS1395.1, CCDS1396.1	1q32.2	2010-04-21	2006-01-13		ENSG00000151418	ENSG00000151418		"""ATPases / V-type"""	18265	protein-coding gene	gene with protein product			"""ATPase, H+ transporting, lysosomal 13kD, V1 subunit G isoform 3"", ""ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G isoform 3"""			9442887	Standard	NM_133262		Approved	ATP6G3, Vma10	uc001gup.3	Q96LB4	OTTHUMG00000035661	ENST00000367382.1:c.327A>T	1.37:g.198492551T>A	ENSP00000356352:p.Glu109Asp	Somatic		Unspecified	Illumina	Phase_I	196759174	NM_133262	Q495K2|Q495K4|Q5T9L6	Missense_Mutation	SNP	ENST00000367382.1	37	CCDS1395.1	.	.	.	.	.	.	.	.	.	.	T	16.66	3.185713	0.57909	.	.	ENSG00000151418	ENST00000367382;ENST00000367381;ENST00000281087;ENST00000489986	T;T;T;T	0.52295	0.7;0.67;0.7;0.67	4.65	2.32	0.28847	.	0.104672	0.64402	D	0.000004	T	0.62913	0.2467	M	0.88775	2.98	0.45594	D	0.998533	D;P	0.60160	0.987;0.939	P;P	0.55087	0.768;0.511	T	0.65384	-0.6181	10	0.72032	D	0.01	-29.5629	8.3937	0.32544	0.0:0.1607:0.0:0.8393	.	115;109	Q96LB4-4;Q96LB4	.;VATG3_HUMAN	D	109;115;109;115	ENSP00000356352:E109D;ENSP00000356351:E115D;ENSP00000281087:E109D;ENSP00000417171:E115D	ENSP00000281087:E109D	E	-	3	2	ATP6V1G3	196759174	1.000000	0.71417	0.979000	0.43373	0.955000	0.61496	1.598000	0.36740	0.381000	0.24851	0.533000	0.62120	GAA		ATP6V1G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086559.1	NM_133326	
PPFIA4	8497	broad.mit.edu	37	1	203033031	203033031	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3999-01	TCGA-AG-3999-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr1:203033031C>T	ENST00000447715.2	+	30	3325	c.2884C>T	c.(2884-2886)Cgc>Tgc	p.R962C	PPFIA4_ENST00000414050.2_Missense_Mutation_p.R691C|PPFIA4_ENST00000367240.2_Missense_Mutation_p.R963C|PPFIA4_ENST00000272198.6_Missense_Mutation_p.R478C|PPFIA4_ENST00000599966.1_Missense_Mutation_p.R469C|PPFIA4_ENST00000295706.4_Missense_Mutation_p.R469C			O75335	LIPA4_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4	962	SAM 2. {ECO:0000255|PROSITE- ProRule:PRU00184}.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)		p.R1108C(1)		NS(1)|autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(20)|ovary(4)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	50						CCCGCAGTACCGCAGCTACTT	0.592																																					p.R478C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1432T	1						.						57.0	66.0	63.0					1																	203033031		2203	4300	6503	201299654	SO:0001583	missense	8497	exon12			AF034801	CCDS44296.1	1q32.1	2013-01-10			ENSG00000143847	ENSG00000143847		"""Sterile alpha motif (SAM) domain containing"""	9248	protein-coding gene	gene with protein product	"""Liprin-alpha4"""	603145				9624153	Standard	XM_005245553		Approved		uc009xaj.3	O75335	OTTHUMG00000042123	ENST00000447715.2:c.2884C>T	1.37:g.203033031C>T	ENSP00000402576:p.Arg962Cys	Somatic		Unspecified	Illumina	Phase_I	201299654	NM_015053	A2RUJ5|B1APN8|B1N949|B7ZM43|O94971	Missense_Mutation	SNP	ENST00000447715.2	37		.	.	.	.	.	.	.	.	.	.	C	28.5	4.927031	0.92389	.	.	ENSG00000143847	ENST00000367240;ENST00000447715;ENST00000295706;ENST00000414050;ENST00000272198	T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76	5.14	5.14	0.70334	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.174005	0.27754	U	0.017990	T	0.72423	0.3458	M	0.87038	2.855	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0	D;D;D;D;D	0.75020	0.961;0.985;0.937;0.957;0.975	T	0.77485	-0.2570	10	0.87932	D	0	-19.2637	15.8944	0.79323	0.0:0.8649:0.1351:0.0	.	691;962;164;469;478	B4DIS5;B1N949;B3KN22;O75335-2;O75335	.;.;.;.;LIPA4_HUMAN	C	963;962;469;691;478	ENSP00000356209:R963C;ENSP00000402576:R962C;ENSP00000295706:R469C;ENSP00000400379:R691C;ENSP00000272198:R478C	ENSP00000272198:R478C	R	+	1	0	PPFIA4	201299654	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.651000	0.83577	2.668000	0.90789	0.650000	0.86243	CGC		PPFIA4-005	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000462949.1	NM_015053	
NFASC	23114	broad.mit.edu	37	1	204948576	204948576	+	Missense_Mutation	SNP	G	G	A	rs562163063		TCGA-AG-3999-01	TCGA-AG-3999-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr1:204948576G>A	ENST00000401399.1	+	18	2264	c.2065G>A	c.(2065-2067)Gtc>Atc	p.V689I	NFASC_ENST00000367170.4_Missense_Mutation_p.V689I|NFASC_ENST00000360049.4_Missense_Mutation_p.V685I|NFASC_ENST00000513543.1_Missense_Mutation_p.V685I|NFASC_ENST00000338586.6_Missense_Mutation_p.V689I|NFASC_ENST00000338515.6_Missense_Mutation_p.V689I|NFASC_ENST00000404076.1_Missense_Mutation_p.V668I|NFASC_ENST00000539706.1_Missense_Mutation_p.V685I|NFASC_ENST00000367171.4_Missense_Mutation_p.V674I|NFASC_ENST00000367172.4_Missense_Mutation_p.V689I|NFASC_ENST00000404907.1_Missense_Mutation_p.V685I|NFASC_ENST00000339876.6_Missense_Mutation_p.V689I|NFASC_ENST00000367169.4_Missense_Mutation_p.V689I			O94856	NFASC_HUMAN	neurofascin	689	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)		p.V685I(2)|p.V689I(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			TAACTCAGCCGTCCTCCGGCT	0.587													G|||	1	0.000199681	0.0	0.0	5008	,	,		18674	0.0		0.001	False		,,,				2504	0.0				p.V700I												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.G2098A	1						.						107.0	104.0	105.0					1																	204948576		2203	4300	6503	203215199	SO:0001583	missense	23114	exon17			AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.2065G>A	1.37:g.204948576G>A	ENSP00000385637:p.Val689Ile	Somatic		Unspecified	Illumina	Phase_I	203215199	NM_001160331	B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Missense_Mutation	SNP	ENST00000401399.1	37	CCDS53460.1	.	.	.	.	.	.	.	.	.	.	G	0.497	-0.872707	0.02570	.	.	ENSG00000163531	ENST00000367172;ENST00000367171;ENST00000367170;ENST00000338515;ENST00000339876;ENST00000338586;ENST00000295776;ENST00000539706;ENST00000360049;ENST00000367169;ENST00000404076;ENST00000401399;ENST00000404907;ENST00000513543;ENST00000430393	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.59224	0.28;0.28;0.28;0.28;0.28;0.28;0.28;0.28;0.28;0.28;0.28;0.28;0.28;0.28	5.43	0.154	0.14901	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.452189	0.18437	N	0.141253	T	0.27489	0.0675	N	0.11255	0.115	0.19300	N	0.999973	B;B;B;B;B;B	0.33022	0.127;0.001;0.008;0.099;0.394;0.008	B;B;B;B;B;B	0.23150	0.044;0.002;0.01;0.012;0.012;0.005	T	0.14117	-1.0484	10	0.22706	T	0.39	.	6.4211	0.21744	0.4377:0.1188:0.4434:0.0	.	689;700;685;674;689;685	O94856;O94856-11;O94856-8;F8W791;O94856-9;O94856-3	NFASC_HUMAN;.;.;.;.;.	I	689;674;689;689;689;689;700;685;685;689;668;689;685;685;676	ENSP00000356140:V689I;ENSP00000356139:V674I;ENSP00000356138:V689I;ENSP00000342128:V689I;ENSP00000344786:V689I;ENSP00000343509:V689I;ENSP00000438614:V685I;ENSP00000353154:V685I;ENSP00000356137:V689I;ENSP00000385676:V668I;ENSP00000385637:V689I;ENSP00000384061:V685I;ENSP00000425908:V685I;ENSP00000415031:V676I	ENSP00000295776:V700I	V	+	1	0	NFASC	203215199	0.038000	0.19896	0.100000	0.21137	0.135000	0.20990	0.371000	0.20450	-0.226000	0.09899	-0.136000	0.14681	GTC		NFASC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131237.1	NM_001005388	
PTPRU	10076	broad.mit.edu	37	1	29649914	29649914	+	Missense_Mutation	SNP	G	G	A	rs373365649		TCGA-AG-3999-01	TCGA-AG-3999-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr1:29649914G>A	ENST00000345512.3	+	28	4019	c.3890G>A	c.(3889-3891)cGg>cAg	p.R1297Q	PTPRU_ENST00000428026.2_Missense_Mutation_p.R1284Q|PTPRU_ENST00000356870.3_Missense_Mutation_p.R1293Q|PTPRU_ENST00000460170.2_Missense_Mutation_p.R1293Q|PTPRU_ENST00000323874.8_Missense_Mutation_p.R1293Q|PTPRU_ENST00000373779.3_Missense_Mutation_p.R1287Q	NM_005704.4	NP_005695.3	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	1297	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|homotypic cell-cell adhesion (GO:0034109)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|organ regeneration (GO:0031100)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|response to glucocorticoid (GO:0051384)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.R1297Q(1)		breast(4)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(26)|ovary(1)|prostate(3)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	79		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		GAGCCAGGCCGGCAGCAATAT	0.612																																					p.R1297Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3890A	1						.	G	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	40.0	38.0	39.0		3851,3890,3878,3860	3.8	1.0	1		39	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	PTPRU	NM_001195001.1,NM_005704.4,NM_133177.3,NM_133178.3	43,43,43,43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging	1284/1434,1297/1447,1293/1441,1287/1437	29649914	1,13005	2203	4300	6503	29522501	SO:0001583	missense	10076	exon28			U71075	CCDS334.1, CCDS335.1, CCDS44098.1, CCDS44098.2, CCDS53290.1	1p35.3	2013-02-11			ENSG00000060656	ENSG00000060656		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9683	protein-coding gene	gene with protein product	"""pi R-PTP-Psi"""	602454				8700514, 9434160	Standard	NM_133178		Approved	PTPRO, hPTP-J, PCP-2, FMI, PTP	uc001bru.3	Q92729	OTTHUMG00000003699	ENST00000345512.3:c.3890G>A	1.37:g.29649914G>A	ENSP00000334941:p.Arg1297Gln	Somatic		Unspecified	Illumina	Phase_I	29522501	NM_005704	A6H8L1|O00197|P78399|Q59HA4|Q5SYU4|Q5SYU5|Q92735|Q92850	Missense_Mutation	SNP	ENST00000345512.3	37	CCDS334.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.231179	0.79688	0.0	1.16E-4	ENSG00000060656	ENST00000345512;ENST00000373779;ENST00000356870;ENST00000323874;ENST00000428026;ENST00000460170	T;T;T;T;T;T	0.13538	2.58;2.58;2.58;2.58;2.58;2.58	3.84	3.84	0.44239	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.091907	0.43579	U	0.000559	T	0.10981	0.0268	N	0.12182	0.205	0.30744	N	0.745873	D;D;D;D;D	0.57899	0.977;0.977;0.977;0.981;0.981	P;P;P;P;P	0.51550	0.543;0.543;0.543;0.673;0.673	T	0.03717	-1.1010	9	.	.	.	.	9.4043	0.38451	0.0:0.0:0.6606:0.3394	.	1284;1293;1287;1293;1297	Q92729-3;Q92729-4;Q92729-2;E9PH42;Q92729	.;.;.;.;PTPRU_HUMAN	Q	1297;1287;1293;1293;1284;1293	ENSP00000334941:R1297Q;ENSP00000362884:R1287Q;ENSP00000349333:R1293Q;ENSP00000314987:R1293Q;ENSP00000392332:R1284Q;ENSP00000432906:R1293Q	.	R	+	2	0	PTPRU	29522501	0.962000	0.33011	0.998000	0.56505	0.965000	0.64279	5.631000	0.67812	2.135000	0.66039	0.462000	0.41574	CGG		PTPRU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010447.1		
HEATR1	55127	broad.mit.edu	37	1	236723029	236723029	+	Silent	SNP	G	G	A			TCGA-AG-3999-01	TCGA-AG-3999-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr1:236723029G>A	ENST00000366582.3	-	34	4869	c.4755C>T	c.(4753-4755)taC>taT	p.Y1585Y	HEATR1_ENST00000366581.2_Silent_p.Y1504Y	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	1585					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)	p.Y1585Y(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			CTAACAGGTCGTAAGCTTTAC	0.398																																					p.Y1585Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4755T	1						.						121.0	104.0	110.0					1																	236723029		2203	4300	6503	234789652	SO:0001819	synonymous_variant	55127	exon34			BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.4755C>T	1.37:g.236723029G>A		Somatic		Unspecified	Illumina	Phase_I	234789652	NM_018072	Q5T3Q8|Q6P197|Q9NW23	Silent	SNP	ENST00000366582.3	37	CCDS31066.1																																																																																				HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096635.1	XM_375853	
TRPC6	7225	broad.mit.edu	37	11	101323775	101323775	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3999-01	TCGA-AG-3999-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr11:101323775A>G	ENST00000344327.3	-	13	3131	c.2707T>C	c.(2707-2709)Tct>Cct	p.S903P	TRPC6_ENST00000360497.4_Missense_Mutation_p.S848P|TRPC6_ENST00000348423.4_Missense_Mutation_p.S787P|TRPC6_ENST00000532133.1_Missense_Mutation_p.S825P	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	903					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.S903P(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		GTATTCTGAGATTTTTCTTCA	0.368																																					p.S903P	Colon(166;1315 1927 11094 12848 34731)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2707C	11						.						167.0	164.0	165.0					11																	101323775		2203	4300	6503	100828985	SO:0001583	missense	7225	exon13			AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.2707T>C	11.37:g.101323775A>G	ENSP00000340913:p.Ser903Pro	Somatic		Unspecified	Illumina	Phase_I	100828985	NM_004621	Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Missense_Mutation	SNP	ENST00000344327.3	37	CCDS8311.1	.	.	.	.	.	.	.	.	.	.	A	15.51	2.855446	0.51376	.	.	ENSG00000137672	ENST00000344327;ENST00000532133;ENST00000348423;ENST00000360497	D;D;D;D	0.82619	-1.63;-1.63;-1.63;-1.63	5.65	3.28	0.37604	.	0.213406	0.49916	D	0.000127	T	0.78349	0.4269	M	0.62723	1.935	0.42471	D	0.992826	P;P	0.45634	0.683;0.863	B;B	0.41374	0.23;0.355	T	0.74973	-0.3481	10	0.56958	D	0.05	-7.3777	6.8796	0.24166	0.6898:0.1175:0.0:0.1927	.	787;903	Q9Y210-2;Q9Y210	.;TRPC6_HUMAN	P	903;825;787;848	ENSP00000340913:S903P;ENSP00000435574:S825P;ENSP00000343672:S787P;ENSP00000353687:S848P	ENSP00000340913:S903P	S	-	1	0	TRPC6	100828985	1.000000	0.71417	0.999000	0.59377	0.851000	0.48451	3.336000	0.52113	0.401000	0.25424	0.529000	0.55759	TCT		TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394770.1	NM_004621	
OR51A2	401667	broad.mit.edu	37	11	4976671	4976671	+	Silent	SNP	G	G	A	rs2595984	byFrequency	TCGA-AG-3999-01	TCGA-AG-3999-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr11:4976671G>A	ENST00000380371.1	-	1	272	c.273C>T	c.(271-273)gcC>gcT	p.A91A	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001004748.1	NP_001004748.1	Q8NGJ7	O51A2_HUMAN	olfactory receptor, family 51, subfamily A, member 2	91						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A91A(1)		endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		AAGTTTCAGGGGCATTGAACA	0.438													A|||	746	0.148962	0.1036	0.2061	5008	,	,		14045	0.2183		0.1918	False		,,,				2504	0.0542				p.A91A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C273T	11						.						132.0	99.0	111.0					11																	4976671		1918	3466	5384	4933247	SO:0001819	synonymous_variant	401667	exon1			AB065797	CCDS31368.1	11p15.4	2012-08-09			ENSG00000205496	ENSG00000205496		"""GPCR / Class A : Olfactory receptors"""	14764	protein-coding gene	gene with protein product							Standard	NM_001004748		Approved		uc010qyt.2	Q8NGJ7	OTTHUMG00000066602	ENST00000380371.1:c.273C>T	11.37:g.4976671G>A		Somatic		Unspecified	Illumina	Phase_I	4933247	NM_001004748		Silent	SNP	ENST00000380371.1	37	CCDS31368.1																																																																																				OR51A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142809.1	NM_001004748	
MICALCL	84953	broad.mit.edu	37	11	12371470	12371470	+	Silent	SNP	G	G	A	rs189290736	byFrequency	TCGA-AG-3999-01	TCGA-AG-3999-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr11:12371470G>A	ENST00000256186.2	+	7	2106	c.1815G>A	c.(1813-1815)tcG>tcA	p.S605S		NM_032867.2	NP_116256.2	Q6ZW33	MICLK_HUMAN	MICAL C-terminal like	605					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	mitogen-activated protein kinase binding (GO:0051019)	p.S605S(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(5)|lung(5)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	30				Epithelial(150;0.00177)		GATATGAGTCGGAGCTCCTAA	0.473													G|||	8	0.00159744	0.0061	0.0	5008	,	,		19942	0.0		0.0	False		,,,				2504	0.0				p.S605S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1815A	11						.	G		17,3849		0,17,1916	94.0	89.0	91.0		1815	-2.8	1.0	11		91	0,8254		0,0,4127	no	coding-synonymous	MICALCL	NM_032867.2		0,17,6043	AA,AG,GG		0.0,0.4397,0.1403		605/696	12371470	17,12103	1933	4127	6060	12328046	SO:0001819	synonymous_variant	84953	exon7			BK000463	CCDS41620.1	11p15.3	2005-11-01			ENSG00000133808	ENSG00000133808			25933	protein-coding gene	gene with protein product		612355				12110185	Standard	NM_032867		Approved	FLJ14966	uc001mkg.1	Q6ZW33	OTTHUMG00000165777	ENST00000256186.2:c.1815G>A	11.37:g.12371470G>A		Somatic		Unspecified	Illumina	Phase_I	12328046	NM_032867	Q7RTP7|Q96JU6	Silent	SNP	ENST00000256186.2	37	CCDS41620.1																																																																																				MICALCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386164.1	NM_032867	
OR5AS1	219447	broad.mit.edu	37	11	55798206	55798206	+	Silent	SNP	C	C	T	rs142110904	byFrequency	TCGA-AG-3999-01	TCGA-AG-3999-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr11:55798206C>T	ENST00000313555.1	+	1	312	c.312C>T	c.(310-312)ttC>ttT	p.F104F		NM_001001921.1	NP_001001921.1	Q8N127	O5AS1_HUMAN	olfactory receptor, family 5, subfamily AS, member 1	104						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F104F(1)		endometrium(7)|large_intestine(7)|liver(1)|lung(22)|ovary(3)|prostate(4)|skin(3)|stomach(1)	48	Esophageal squamous(21;0.00693)					TGTTTTTCTTCGCTTCTTTTG	0.458													C|||	3	0.000599042	0.0023	0.0	5008	,	,		19721	0.0		0.0	False		,,,				2504	0.0				p.F104F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C312T	11						.	C		4,4398	8.1+/-20.4	0,4,2197	102.0	88.0	93.0		312	0.5	1.0	11	dbSNP_134	93	3,8589	3.0+/-9.4	0,3,4293	no	coding-synonymous	OR5AS1	NM_001001921.1		0,7,6490	TT,TC,CC		0.0349,0.0909,0.0539		104/325	55798206	7,12987	2201	4296	6497	55554782	SO:0001819	synonymous_variant	219447	exon1			AB065543	CCDS31516.1	11q11	2012-08-09			ENSG00000181785	ENSG00000181785		"""GPCR / Class A : Olfactory receptors"""	15261	protein-coding gene	gene with protein product							Standard	NM_001001921		Approved		uc010riw.2	Q8N127	OTTHUMG00000166830	ENST00000313555.1:c.312C>T	11.37:g.55798206C>T		Somatic		Unspecified	Illumina	Phase_I	55554782	NM_001001921	Q6IFB8	Silent	SNP	ENST00000313555.1	37	CCDS31516.1																																																																																				OR5AS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391538.1	NM_001001921	
CPT1A	1374	broad.mit.edu	37	11	68530115	68530115	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3999-01	TCGA-AG-3999-01	T	T	T	T	T	T	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr11:68530115T>A	ENST00000265641.5	-	15	2009	c.1855A>T	c.(1855-1857)Atg>Ttg	p.M619L	CPT1A_ENST00000540367.1_Missense_Mutation_p.M619L|CPT1A_ENST00000539743.1_Missense_Mutation_p.M619L|CPT1A_ENST00000376618.2_Missense_Mutation_p.M619L|CPT1A_ENST00000537756.2_5'UTR	NM_001876.3	NP_001867.2	P50416	CPT1A_HUMAN	carnitine palmitoyltransferase 1A (liver)	619					carnitine metabolic process (GO:0009437)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|eating behavior (GO:0042755)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|glucose metabolic process (GO:0006006)|long-chain fatty acid metabolic process (GO:0001676)|positive regulation of fatty acid beta-oxidation (GO:0032000)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	Esophageal squamous(3;3.28e-14)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		Glyburide(DB01016)|L-Carnitine(DB00583)|Perhexiline(DB01074)	GGGTCCACCATGGCCCGCACG	0.607																																					p.M619L												.	.	0			c.A1855T	11						.						72.0	65.0	67.0					11																	68530115		2200	4294	6494	68286691	SO:0001583	missense	1374	exon15			L39211	CCDS8185.1, CCDS31624.1	11q13.2	2007-07-26				ENSG00000110090	2.3.1.21		2328	protein-coding gene	gene with protein product		600528		CPT1		7892212, 9070950	Standard	NM_001876		Approved	CPT1-L, L-CPT1	uc001oog.4	P50416		ENST00000265641.5:c.1855A>T	11.37:g.68530115T>A	ENSP00000265641:p.Met619Leu	None		Unspecified	Illumina	Phase_I	68286691	NM_001031847	Q8TCU0|Q9BWK0	Missense_Mutation	SNP	ENST00000265641.5	37	CCDS8185.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.072325	0.76415	.	.	ENSG00000110090	ENST00000540367;ENST00000376618;ENST00000265641;ENST00000538308;ENST00000539743	D;D;D;D	0.89875	-2.58;-2.58;-2.58;-2.58	5.57	5.57	0.84162	.	0.124278	0.64402	D	0.000001	D	0.88890	0.6560	M	0.71871	2.18	0.80722	D	1	B;B	0.11235	0.003;0.004	B;B	0.19148	0.019;0.024	D	0.86173	0.1601	10	0.72032	D	0.01	.	16.0252	0.80538	0.0:0.0:0.0:1.0	.	619;619	P50416;P50416-2	CPT1A_HUMAN;.	L	619	ENSP00000439084:M619L;ENSP00000365803:M619L;ENSP00000265641:M619L;ENSP00000446108:M619L	ENSP00000265641:M619L	M	-	1	0	CPT1A	68286691	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	7.562000	0.82300	2.246000	0.74042	0.533000	0.62120	ATG		CPT1A-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397457.2	NM_001876	
C2CD3	26005	broad.mit.edu	37	11	73820134	73820134	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3999-01	TCGA-AG-3999-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr11:73820134C>T	ENST00000334126.7	-	12	2133	c.1907G>A	c.(1906-1908)tGg>tAg	p.W636*	C2CD3_ENST00000313663.7_Nonsense_Mutation_p.W636*			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	636					brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)		p.W636*(2)		NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					GGAATTCCACCAGTGCTCTAT	0.438																																					p.W636X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.G1907A	11						.						123.0	119.0	120.0					11																	73820134		2200	4293	6493	73497782	SO:0001587	stop_gained	26005	exon12			BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.1907G>A	11.37:g.73820134C>T	ENSP00000334379:p.Trp636*	Somatic		Unspecified	Illumina	Phase_I	73497782	NM_015531	C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Nonsense_Mutation	SNP	ENST00000334126.7	37		.	.	.	.	.	.	.	.	.	.	C	41	8.988336	0.99027	.	.	ENSG00000168014	ENST00000334126;ENST00000313663;ENST00000313681	.	.	.	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.4669	18.9103	0.92481	0.0:1.0:0.0:0.0	.	.	.	.	X	636	.	ENSP00000323339:W636X	W	-	2	0	C2CD3	73497782	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.479000	0.66813	2.561000	0.86390	0.650000	0.86243	TGG		C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015531	
BCL9L	283149	broad.mit.edu	37	11	118771331	118771331	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-3999-01	TCGA-AG-3999-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr11:118771331G>A	ENST00000334801.3	-	6	4085	c.3121C>T	c.(3121-3123)Cag>Tag	p.Q1041*	BCL9L_ENST00000526143.1_5'UTR	NM_182557.2	NP_872363.1	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	1041	Pro-rich.				canonical Wnt signaling pathway (GO:0060070)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell morphogenesis (GO:0022604)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|transcription coactivator activity (GO:0003713)	p.Q1041*(2)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	56	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		GACTCACCCTGTTCCATGTTG	0.622																																					p.Q1041X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C3121T	11						.						79.0	81.0	80.0					11																	118771331		2200	4295	6495	118276541	SO:0001587	stop_gained	283149	exon6			AB094091	CCDS8403.1	11q23.3	2012-06-06				ENSG00000186174			23688	protein-coding gene	gene with protein product		609004				12964048	Standard	NM_182557		Approved	DLNB11	uc001pug.3	Q86UU0		ENST00000334801.3:c.3121C>T	11.37:g.118771331G>A	ENSP00000335320:p.Gln1041*	Somatic		Unspecified	Illumina	Phase_I	118276541	NM_182557	A1A4C1|Q67FY1|Q6ZWJ0|Q6ZWK2	Nonsense_Mutation	SNP	ENST00000334801.3	37	CCDS8403.1	.	.	.	.	.	.	.	.	.	.	G	48	14.592926	0.99802	.	.	ENSG00000186174	ENST00000334801;ENST00000526143;ENST00000525300;ENST00000392849;ENST00000431085	.	.	.	4.96	4.05	0.47172	.	0.000000	0.45361	D	0.000367	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	13.0661	0.59034	0.0768:0.0:0.9232:0.0	.	.	.	.	X	1041;1004;334;1041;1041	.	ENSP00000335320:Q1041X	Q	-	1	0	BCL9L	118276541	1.000000	0.71417	0.991000	0.47740	0.993000	0.82548	4.890000	0.63178	1.302000	0.44855	0.655000	0.94253	CAG		BCL9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389653.1	NM_182557	
POPDC3	64208	broad.mit.edu	37	6	105606355	105606355	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3999-01	TCGA-AG-3999-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr6:105606355C>T	ENST00000254765.3	-	4	1144	c.866G>A	c.(865-867)tGt>tAt	p.C289Y	BVES-AS1_ENST00000369120.2_RNA|BVES-AS1_ENST00000580511.1_RNA|BVES-AS1_ENST00000369122.3_RNA|POPDC3_ENST00000474760.1_5'UTR|BVES-AS1_ENST00000580854.1_RNA	NM_022361.4	NP_071756.2	Q9HBV1	POPD3_HUMAN	popeye domain containing 3	289					regulation of membrane potential (GO:0042391)	integral component of membrane (GO:0016021)		p.C289Y(1)		NS(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|skin(3)|urinary_tract(1)	26		all_cancers(87;4.87e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0157)|Colorectal(196;0.202)|Lung NSC(302;0.238)				TCATTTATCACAGTATCGTCT	0.353																																					p.C289Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G866A	6						.						72.0	75.0	74.0					6																	105606355		2203	4300	6503	105713048	SO:0001583	missense	64208	exon4			BC022323	CCDS5052.1	6q21	2003-06-12			ENSG00000132429	ENSG00000132429			17649	protein-coding gene	gene with protein product		605824				10882522	Standard	NM_022361		Approved	POP3, MGC22671, bA355M14.1	uc003prb.3	Q9HBV1	OTTHUMG00000015293	ENST00000254765.3:c.866G>A	6.37:g.105606355C>T	ENSP00000254765:p.Cys289Tyr	Somatic		Unspecified	Illumina	Phase_I	105713048	NM_022361	B2RA98|Q5T3Y8|Q8TBW6	Missense_Mutation	SNP	ENST00000254765.3	37	CCDS5052.1	.	.	.	.	.	.	.	.	.	.	C	11.95	1.792489	0.31685	.	.	ENSG00000132429	ENST00000254765	T	0.18960	2.18	5.56	2.77	0.32553	.	0.971060	0.08437	N	0.946071	T	0.05364	0.0142	L	0.27053	0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40021	-0.9585	10	0.87932	D	0	-3.5707	5.2812	0.15676	0.1633:0.6662:0.0:0.1705	.	289	Q9HBV1	POPD3_HUMAN	Y	289	ENSP00000254765:C289Y	ENSP00000254765:C289Y	C	-	2	0	POPDC3	105713048	0.913000	0.31002	0.744000	0.31058	0.204000	0.24138	1.570000	0.36439	0.899000	0.36444	-0.169000	0.13324	TGT		POPDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041651.1	NM_022361	
EHMT2	10919	broad.mit.edu	37	6	31860203	31860203	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3999-01	TCGA-AG-3999-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr6:31860203C>T	ENST00000375537.4	-	7	851	c.845G>A	c.(844-846)cGc>cAc	p.R282H	EHMT2_ENST00000480912.1_5'UTR|EHMT2_ENST00000395728.3_Missense_Mutation_p.R339H|EHMT2_ENST00000375528.4_Missense_Mutation_p.R339H|EHMT2_ENST00000375530.4_Missense_Mutation_p.R282H	NM_006709.3	NP_006700.3	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2	282					DNA methylation (GO:0006306)|DNA methylation on cytosine within a CG sequence (GO:0010424)|fertilization (GO:0009566)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ growth (GO:0035265)|peptidyl-lysine dimethylation (GO:0018027)|regulation of DNA replication (GO:0006275)|spermatid development (GO:0007286)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)	p.R282H(1)		central_nervous_system(1)|cervix(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	21						GGAGTCCACGCGCTCATCCAC	0.622																																					p.R282H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G845A	6						.						89.0	69.0	76.0					6																	31860203		1511	2709	4220	31968182	SO:0001583	missense	10919	exon7			AF134726	CCDS4725.1, CCDS4726.1, CCDS75425.1	6p21.3	2013-01-10	2004-03-22	2005-06-09	ENSG00000204371	ENSG00000204371	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	14129	protein-coding gene	gene with protein product		604599	"""chromosome 6 open reading frame 30"", ""HLA-B associated transcript 8"""	C6orf30, BAT8		8457211, 11316813	Standard	XM_005274833		Approved	G9A, Em:AF134726.3, NG36/G9a, KMT1C	uc003nxz.1	Q96KQ7	OTTHUMG00000031180	ENST00000375537.4:c.845G>A	6.37:g.31860203C>T	ENSP00000364687:p.Arg282His	Somatic		Unspecified	Illumina	Phase_I	31968182	NM_025256	B0UZY2|Q14349|Q5JP83|Q5JQ92|Q5JQA1|Q5JQG3|Q6PK06|Q96MH5|Q96QD0|Q9UQL8|Q9Y331	Missense_Mutation	SNP	ENST00000375537.4	37	CCDS4725.1	.	.	.	.	.	.	.	.	.	.	C	15.11	2.735648	0.49045	.	.	ENSG00000204371	ENST00000395728;ENST00000375528;ENST00000375530;ENST00000375537;ENST00000442298	T;T;T;T	0.73258	-0.46;-0.73;-0.65;-0.45	4.97	4.97	0.65823	.	0.084955	0.46145	D	0.000320	T	0.31606	0.0802	N	0.08118	0	0.43448	D	0.995635	B;B;B;B	0.14438	0.006;0.01;0.006;0.003	B;B;B;B	0.04013	0.001;0.001;0.001;0.001	T	0.31475	-0.9942	10	0.42905	T	0.14	.	7.3862	0.26884	0.0:0.8216:0.0:0.1784	.	339;282;282;96	A2ABF8;Q96KQ7-2;Q96KQ7;Q59FM7	.;.;EHMT2_HUMAN;.	H	339;339;282;282;96	ENSP00000379078:R339H;ENSP00000364678:R339H;ENSP00000364680:R282H;ENSP00000364687:R282H	ENSP00000364678:R339H	R	-	2	0	EHMT2	31968182	0.971000	0.33674	1.000000	0.80357	0.996000	0.88848	2.174000	0.42482	2.582000	0.87167	0.491000	0.48974	CGC		EHMT2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076355.5	NM_006709	
LEMD2	221496	broad.mit.edu	37	6	33740480	33740480	+	Silent	SNP	G	G	T			TCGA-AG-3999-01	TCGA-AG-3999-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr6:33740480G>T	ENST00000293760.5	-	9	1456	c.1437C>A	c.(1435-1437)tcC>tcA	p.S479S	LEMD2_ENST00000508327.1_Silent_p.S177S	NM_181336.3	NP_851853.1	Q8NC56	LEMD2_HUMAN	LEM domain containing 2	479					negative regulation of MAPK cascade (GO:0043409)|skeletal muscle cell differentiation (GO:0035914)	integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|nuclear membrane (GO:0031965)		p.S479S(1)		central_nervous_system(2)|endometrium(3)|large_intestine(1)|lung(2)|pancreas(1)	9						CAACGCGGTGGGACTCCGTCT	0.622																																					p.S177S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C531A	6						.						73.0	57.0	62.0					6																	33740480		2203	4300	6503	33848458	SO:0001819	synonymous_variant	221496	exon8				CCDS4785.1, CCDS47411.1	6p21.31	2009-11-06			ENSG00000161904	ENSG00000161904			21244	protein-coding gene	gene with protein product						12477932	Standard	NM_001143944		Approved	dJ482C21.1, NET25	uc011drm.2	Q8NC56	OTTHUMG00000014535	ENST00000293760.5:c.1437C>A	6.37:g.33740480G>T		Somatic		Unspecified	Illumina	Phase_I	33848458	NM_001143944	B4DVH5|E7EVT2|Q5T972|Q5T974	Silent	SNP	ENST00000293760.5	37	CCDS4785.1																																																																																				LEMD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040209.3	XM_166338	
GPR115	221393	broad.mit.edu	37	6	47681990	47681991	+	Missense_Mutation	DNP	GA	GA	TC	rs116696585	byFrequency	TCGA-AG-3999-01	TCGA-AG-3999-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr6:47681990_47681991GA>TC	ENST00000283303.2	+	6	1267_1268	c.1009_1010GA>TC	c.(1009-1011)GAa>TCa	p.E337S	GPR115_ENST00000327753.3_Missense_Mutation_p.E337S|RN7SKP116_ENST00000516902.1_RNA|GPR115_ENST00000371220.1_Missense_Mutation_p.E394S	NM_153838.3	NP_722580.3	Q8IZF3	GP115_HUMAN	G protein-coupled receptor 115	337					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.E337>?(1)		NS(1)|breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	52						ACTCACCTTCGAAAAGATCAAT	0.455																																					.	GBM(22;431 510 9010 26644 32828)											.	.	1	Complex(1)	large_intestine(1)	c.1009_1010TC	6						.																																			47789950	SO:0001583	missense	221393	exon6			AK095395	CCDS4922.2	6p12.3	2014-08-08			ENSG00000153294	ENSG00000153294		"""-"", ""GPCR / Class B : Orphans"""	19011	protein-coding gene	gene with protein product		614268				12435584	Standard	NM_153838		Approved	FLJ38076, PGR18	uc003oza.1	Q8IZF3	OTTHUMG00000014800	Exception_encountered	6.37:g.47681990_47681991delinsTC	ENSP00000283303:p.Glu337Ser	Somatic		Unspecified	Illumina	Phase_I	47789949	NM_153838	B3KTD0|Q2PNZ0|Q5T5B5|Q5T5B6|Q86SN9|Q8IXE6	Missense_Mutation	DNP	ENST00000283303.2	37	CCDS4922.2																																																																																				GPR115-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040819.2	NM_153838	
COL12A1	1303	broad.mit.edu	37	6	75798886	75798886	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3999-01	TCGA-AG-3999-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr6:75798886C>A	ENST00000322507.8	-	64	9255	c.8946G>T	c.(8944-8946)ttG>ttT	p.L2982F	COL12A1_ENST00000345356.6_Missense_Mutation_p.L1818F|COL12A1_ENST00000416123.2_Missense_Mutation_p.L2906F|COL12A1_ENST00000511023.1_5'UTR|COL12A1_ENST00000483888.2_Missense_Mutation_p.L2978F	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	2982	Collagen-like 4.|Triple-helical region (COL1) with 2 imperfections.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)	p.L2982F(1)		breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						TCTCTCCTGGCAAACCTAAGG	0.423																																					p.L2982F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G8946T	6						.						36.0	38.0	38.0					6																	75798886		1810	4068	5878	75855606	SO:0001583	missense	1303	exon64			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.8946G>T	6.37:g.75798886C>A	ENSP00000325146:p.Leu2982Phe	Somatic		Unspecified	Illumina	Phase_I	75855606	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	37	CCDS43482.1	.	.	.	.	.	.	.	.	.	.	C	14.85	2.658062	0.47467	.	.	ENSG00000111799	ENST00000322507;ENST00000425443;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888	D;D;D;D;D	0.94184	-3.37;-3.37;-3.37;-3.37;-3.37	5.82	4.77	0.60923	.	0.375112	0.26293	N	0.025217	D	0.86234	0.5884	L	0.41710	1.295	0.31510	N	0.663711	P;D	0.56287	0.944;0.975	B;P	0.50136	0.413;0.632	T	0.80549	-0.1333	10	0.19147	T	0.46	.	7.5849	0.27987	0.0:0.6723:0.1512:0.1765	.	1818;2982	Q99715-2;Q99715	.;COCA1_HUMAN	F	2982;620;2906;1818;2906;2978	ENSP00000325146:L2982F;ENSP00000399812:L620F;ENSP00000305147:L1818F;ENSP00000412864:L2906F;ENSP00000421216:L2978F	ENSP00000325146:L2982F	L	-	3	2	COL12A1	75855606	0.305000	0.24481	1.000000	0.80357	0.952000	0.60782	-0.175000	0.09825	2.752000	0.94435	0.655000	0.94253	TTG		COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
OPRM1	4988	broad.mit.edu	37	6	154412222	154412222	+	Missense_Mutation	SNP	G	G	A	rs1799974	byFrequency	TCGA-AG-3999-01	TCGA-AG-3999-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr6:154412222G>A	ENST00000330432.7	+	3	1016	c.779G>A	c.(778-780)cGc>cAc	p.R260H	OPRM1_ENST00000414028.2_Missense_Mutation_p.R260H|OPRM1_ENST00000428397.2_Missense_Mutation_p.R260H|OPRM1_ENST00000434900.2_Missense_Mutation_p.R353H|OPRM1_ENST00000360422.4_Missense_Mutation_p.R260H|OPRM1_ENST00000435918.2_Missense_Mutation_p.R260H|OPRM1_ENST00000524163.1_Missense_Mutation_p.R260H|OPRM1_ENST00000452687.2_Missense_Mutation_p.R260H|OPRM1_ENST00000518759.1_Missense_Mutation_p.R179H|OPRM1_ENST00000520708.1_Missense_Mutation_p.R160H|OPRM1_ENST00000419506.2_Missense_Mutation_p.R260H|OPRM1_ENST00000522236.1_Missense_Mutation_p.R160H|OPRM1_ENST00000337049.4_Missense_Mutation_p.R260H|OPRM1_ENST00000229768.5_Missense_Mutation_p.R260H|OPRM1_ENST00000522555.1_Missense_Mutation_p.R160H	NM_000914.3	NP_000905.3	P35372	OPRM_HUMAN	opioid receptor, mu 1	260			R -> H (rare polymorphism; dbSNP:rs1799974). {ECO:0000269|PubMed:9689128}.		adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral response to ethanol (GO:0048149)|calcium ion transmembrane transport (GO:0070588)|cellular response to stress (GO:0033554)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|locomotory behavior (GO:0007626)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of Wnt protein secretion (GO:0061358)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neurogenesis (GO:0050769)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-endorphin receptor activity (GO:0004979)|G-protein alpha-subunit binding (GO:0001965)|G-protein coupled receptor activity (GO:0004930)|morphine receptor activity (GO:0038047)|voltage-gated calcium channel activity (GO:0005245)	p.R260H(4)|p.R353H(2)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(15)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	33		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;9.26e-11)|BRCA - Breast invasive adenocarcinoma(81;0.0154)	Alfentanil(DB00802)|Alvimopan(DB06274)|Amitriptyline(DB00321)|Anileridine(DB00913)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Diphenoxylate(DB01081)|Ethylmorphine(DB01466)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levallorphan(DB00504)|Levomethadyl Acetate(DB01227)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Methadyl Acetate(DB01433)|Methylnaltrexone(DB06800)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Ondansetron(DB00904)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Pentazocine(DB00652)|Pethidine(DB00454)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	ATGATCTTGCGCCTCAAGAGT	0.502													G|||	3	0.000599042	0.0	0.0014	5008	,	,		20227	0.0		0.0	False		,,,				2504	0.002				p.R260H												.	.	6	Substitution - Missense(6)	large_intestine(6)	c.G779A	6	GRCh37	CM016140	OPRM1	M	rs1799974	.	G	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	5,4359		0,5,2177	172.0	173.0	173.0		779,779,779,779,1058,479,536,779,779,779,779,779,479	6.0	1.0	6	dbSNP_89	173	7,8569		0,7,4281	yes	missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense	OPRM1	NM_000914.3,NM_001008503.1,NM_001008504.2,NM_001008505.1,NM_001145279.2,NM_001145280.2,NM_001145281.1,NM_001145282.1,NM_001145283.1,NM_001145284.2,NM_001145285.1,NM_001145286.1,NM_001145287.1	29,29,29,29,29,29,29,29,29,29,29,29,29	0,12,6458	AA,AG,GG		0.0816,0.1146,0.0927	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	260/401,260/419,260/393,260/447,353/494,160/301,179/320,260/407,260/398,260/404,260/390,260/421,160/301	154412222	12,12928	2182	4288	6470	154453915	SO:0001583	missense	4988	exon3			L29301	CCDS43517.1, CCDS43518.1, CCDS47503.1, CCDS47504.1, CCDS47505.1, CCDS47506.1, CCDS47507.1, CCDS47508.1, CCDS55071.1, CCDS55068.1, CCDS55069.1, CCDS55070.1	6q24-q25	2012-08-08			ENSG00000112038	ENSG00000112038		"""GPCR / Class A : Opioid receptors"""	8156	protein-coding gene	gene with protein product		600018					Standard	NM_001145285		Approved	MOR1	uc003qpo.1	P35372	OTTHUMG00000015870	ENST00000330432.7:c.779G>A	6.37:g.154412222G>A	ENSP00000328264:p.Arg260His	Somatic		Unspecified	Illumina	Phase_I	154453915	NM_000914	B0FXJ1|B2R9S7|B8Q1L7|B8Q1L8|B8Q1L9|E7EWZ3|G8XRH6|G8XRH8|Q12930|Q4VWM1|Q4VWM2|Q4VWM3|Q4VWM4|Q4VWM6|Q4VWX6|Q5TDA1|Q6UPP1|Q6UQ80|Q7Z2D8|Q86V80|Q8IWW3|Q8IWW4|Q9UCZ4|Q9UN57	Missense_Mutation	SNP	ENST00000330432.7	37	CCDS55070.1	.	.	.	.	.	.	.	.	.	.	G	31	5.084463	0.94100	0.001146	8.16E-4	ENSG00000112038	ENST00000434900;ENST00000520708;ENST00000518759;ENST00000330432;ENST00000360422;ENST00000428397;ENST00000452687;ENST00000229768;ENST00000419506;ENST00000524163;ENST00000414028;ENST00000435918;ENST00000337049;ENST00000522555;ENST00000522236	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.37752	1.18;1.18;1.18;1.18;1.18;1.18;1.18;1.18;1.18;1.18;1.18;1.18;1.18;1.18;1.18	5.96	5.96	0.96718	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.57227	0.2039	M	0.71871	2.18	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.999;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D	0.97110	0.999;1.0;1.0;0.999;1.0;1.0;1.0;1.0;1.0;0.979;1.0;1.0	T	0.58025	-0.7709	10	0.87932	D	0	.	20.4192	0.99033	0.0:0.0:1.0:0.0	rs1799974	260;260;260;260;353;179;160;260;260;260;260;260	P35372-4;P35372-8;P35372-11;P35372-9;P35372-10;B8Q1L9;Q6UPP1;P35372-5;P35372;P35372-7;P35372-3;P35372-2	.;.;.;.;.;.;.;.;OPRM_HUMAN;.;.;.	H	353;160;179;260;260;260;260;260;260;260;260;260;260;160;160	ENSP00000394624:R353H;ENSP00000430876:R160H;ENSP00000430260:R179H;ENSP00000328264:R260H;ENSP00000353598:R260H;ENSP00000411903:R260H;ENSP00000410497:R260H;ENSP00000229768:R260H;ENSP00000403549:R260H;ENSP00000430097:R260H;ENSP00000399359:R260H;ENSP00000413752:R260H;ENSP00000338381:R260H;ENSP00000429719:R160H;ENSP00000429373:R160H	ENSP00000229768:R260H	R	+	2	0	OPRM1	154453915	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.831000	0.97527	0.650000	0.86243	CGC		OPRM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042786.2	NM_000914	
KIAA0100	9703	broad.mit.edu	37	17	26964917	26964917	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3999-01	TCGA-AG-3999-01	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr17:26964917A>T	ENST00000528896.2	-	14	1782	c.1708T>A	c.(1708-1710)Tta>Ata	p.L570I	KIAA0100_ENST00000544884.1_Missense_Mutation_p.L427I|RP11-192H23.7_ENST00000577814.1_RNA|KIAA0100_ENST00000389003.3_Missense_Mutation_p.L427I	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	570						extracellular region (GO:0005576)		p.L570I(1)		breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					TTCCACAGTAATGACACAGAT	0.473																																					p.L570I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1708A	17						.						118.0	101.0	107.0					17																	26964917		2203	4300	6503	23989044	SO:0001583	missense	9703	exon14			D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.1708T>A	17.37:g.26964917A>T	ENSP00000436773:p.Leu570Ile	Somatic		Unspecified	Illumina	Phase_I	23989044	NM_014680	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	ENST00000528896.2	37	CCDS32595.1	.	.	.	.	.	.	.	.	.	.	A	16.19	3.052192	0.55218	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896;ENST00000544884	T;T	0.25749	1.79;1.78	5.5	3.18	0.36537	FMP27, N-terminal (1);	0.071870	0.64402	D	0.000019	T	0.20047	0.0482	L	0.29908	0.895	0.29186	N	0.876182	D	0.53312	0.959	P	0.50490	0.642	T	0.05517	-1.0880	10	0.18710	T	0.47	.	4.4899	0.11808	0.6588:0.0:0.3412:0.0	.	570	Q14667	K0100_HUMAN	I	570;570;570;427	ENSP00000436773:L570I;ENSP00000446443:L427I	ENSP00000005905:L570I	L	-	1	2	KIAA0100	23989044	0.998000	0.40836	0.927000	0.36925	0.826000	0.46750	3.965000	0.56788	0.917000	0.36895	0.460000	0.39030	TTA		KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	NM_014680	
SAT2	112483	broad.mit.edu	37	17	7529893	7529893	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3999-01	TCGA-AG-3999-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr17:7529893C>T	ENST00000269298.5	-	6	604	c.385G>A	c.(385-387)Gtc>Atc	p.V129I	SHBG_ENST00000576728.1_Intron|SHBG_ENST00000570547.1_Intron|SHBG_ENST00000572262.1_Intron|SHBG_ENST00000574539.1_Intron|SAT2_ENST00000573566.1_Missense_Mutation_p.V95I|SHBG_ENST00000576478.1_Intron|SHBG_ENST00000572182.1_Intron|SAT2_ENST00000380466.2_5'UTR|SHBG_ENST00000340624.5_5'Flank|SHBG_ENST00000575314.1_Intron	NM_133491.3	NP_597998.1	Q96F10	SAT2_HUMAN	spermidine/spermine N1-acetyltransferase family member 2	129	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				nor-spermidine metabolic process (GO:0046204)|putrescine acetylation (GO:0032920)|putrescine catabolic process (GO:0009447)|spermidine acetylation (GO:0032918)|spermine acetylation (GO:0032919)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	diamine N-acetyltransferase activity (GO:0004145)	p.V129I(1)|p.?(1)		kidney(1)|large_intestine(2)	3				READ - Rectum adenocarcinoma(115;0.166)	Spermine(DB00127)	CAGTCCAGGACGGCCAGGCGG	0.532																																					p.V129I												.	.	2	Substitution - Missense(1)|Unknown(1)	large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	c.G385A	17						.						72.0	71.0	71.0					17																	7529893		2203	4300	6503	7470618	SO:0001583	missense	112483	exon6			AF348524	CCDS11116.1	17p13.2	2011-11-16	2008-01-07		ENSG00000141504	ENSG00000141504	2.3.1.57		23160	protein-coding gene	gene with protein product	"""diamine N-acetyltransferase 2"""	611463	"""spermidine/spermine N1-acetyltransferase 2"""			15283699, 17558023	Standard	NM_133491		Approved	SSAT2	uc002gic.2	Q96F10	OTTHUMG00000108152	ENST00000269298.5:c.385G>A	17.37:g.7529893C>T	ENSP00000269298:p.Val129Ile	Somatic		Unspecified	Illumina	Phase_I	7470618	NM_133491		Missense_Mutation	SNP	ENST00000269298.5	37	CCDS11116.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.728816	0.89390	.	.	ENSG00000141504	ENST00000380466;ENST00000269298	T	0.31247	1.5	5.1	4.14	0.48551	GCN5-related N-acetyltransferase (GNAT) domain (2);Acyl-CoA N-acyltransferase (2);	0.000000	0.85682	D	0.000000	T	0.45796	0.1360	M	0.84433	2.695	0.80722	D	1	D	0.60160	0.987	P	0.50934	0.654	T	0.53683	-0.8404	10	0.87932	D	0	-10.58	9.3141	0.37924	0.0:0.9033:0.0:0.0967	.	129	Q96F10	SAT2_HUMAN	I	208;129	ENSP00000269298:V129I	ENSP00000269298:V129I	V	-	1	0	SAT2	7470618	1.000000	0.71417	0.637000	0.29366	0.888000	0.51559	5.520000	0.67080	1.381000	0.46364	0.655000	0.94253	GTC		SAT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440078.1	NM_133491	
TP53	7157	broad.mit.edu	37	17	7578212	7578212	+	Nonsense_Mutation	SNP	G	G	A	rs397516436		TCGA-AG-3999-01	TCGA-AG-3999-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr17:7578212G>A	ENST00000269305.4	-	6	826	c.637C>T	c.(637-639)Cga>Tga	p.R213*	TP53_ENST00000420246.2_Nonsense_Mutation_p.R213*|TP53_ENST00000359597.4_Nonsense_Mutation_p.R213*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R213*|TP53_ENST00000445888.2_Nonsense_Mutation_p.R213*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R213*|TP53_ENST00000574684.1_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	213	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R213*(250)|p.R81*(21)|p.R120*(21)|p.0?(8)|p.?(5)|p.R213G(5)|p.R213fs*35(3)|p.R213fs*34(3)|p.D208_V216delDRNTFRHSV(1)|p.R120G(1)|p.D207_R213delDDRNTFR(1)|p.T211_S215delTFRHS(1)|p.R81fs*>11(1)|p.D208fs*1(1)|p.R120fs*35(1)|p.R81G(1)|p.R209_R213delRNTFR(1)|p.R213fs*2(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213R(1)|p.R213fs*32(1)|p.R209fs*6(1)|p.R213W(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACACTATGTCGAAAAGTGTTT	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R213X	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,central_nervous_system,brain,Substitution - Missense,+1	.	333	Substitution - Nonsense(292)|Deletion - Frameshift(8)|Whole gene deletion(8)|Substitution - Missense(8)|Deletion - In frame(5)|Insertion - Frameshift(5)|Unknown(5)|Complex - deletion inframe(1)|Substitution - coding silent(1)	large_intestine(89)|breast(45)|lung(37)|upper_aerodigestive_tract(30)|central_nervous_system(18)|skin(16)|oesophagus(15)|stomach(14)|ovary(14)|haematopoietic_and_lymphoid_tissue(10)|urinary_tract(9)|biliary_tract(8)|liver(8)|soft_tissue(5)|endometrium(5)|bone(4)|prostate(3)|thyroid(1)|pancreas(1)|autonomic_ganglia(1)	c.C637T	17	GRCh37	CM951226	TP53	M		.						132.0	118.0	123.0					17																	7578212		2203	4300	6503	7518937	SO:0001587	stop_gained	7157	exon6	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.637C>T	17.37:g.7578212G>A	ENSP00000269305:p.Arg213*	Somatic		Unspecified	Illumina	Phase_I	7518937	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	37	6.039727	0.97226	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.28	3.25	0.37280	.	0.057335	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.5444	12.7263	0.57173	0.0:0.0:0.701:0.299	.	.	.	.	X	213;213;213;213;213;213;202;120;81;120;81	.	ENSP00000269305:R213X	R	-	1	2	TP53	7518937	0.971000	0.33674	0.123000	0.21794	0.957000	0.61999	1.659000	0.37387	0.702000	0.31825	0.563000	0.77884	CGA		TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
LLGL2	3993	broad.mit.edu	37	17	73569666	73569666	+	Missense_Mutation	SNP	C	C	T	rs142772898	byFrequency	TCGA-AG-3999-01	TCGA-AG-3999-01	C	C	T	T	C	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr17:73569666C>T	ENST00000392550.3	+	21	2947	c.2830C>T	c.(2830-2832)Cgc>Tgc	p.R944C	LLGL2_ENST00000577200.1_Missense_Mutation_p.R944C|LLGL2_ENST00000167462.5_Missense_Mutation_p.R944C	NM_001031803.1	NP_001026973.1	Q6P1M3	L2GL2_HUMAN	lethal giant larvae homolog 2 (Drosophila)	944					cell cycle (GO:0007049)|cell division (GO:0051301)|exocytosis (GO:0006887)|regulation of establishment or maintenance of cell polarity (GO:0032878)	cytoplasm (GO:0005737)	PDZ domain binding (GO:0030165)	p.R944C(1)		NS(1)|breast(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)			CAAGAACCACCGCCCTGGTAA	0.652													C|||	19	0.00379393	0.0008	0.0101	5008	,	,		10236	0.0		0.0109	False		,,,				2504	0.0				p.R944C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2830T	17						.	C	CYS/ARG,CYS/ARG	8,4396		0,8,2194	29.0	32.0	31.0		2830,2830	-3.2	0.0	17	dbSNP_134	31	106,8486		0,106,4190	yes	missense,missense	LLGL2	NM_001031803.1,NM_004524.2	180,180	0,114,6384	TT,TC,CC		1.2337,0.1817,0.8772	benign,benign	944/1021,944/1016	73569666	114,12882	2202	4296	6498	71081261	SO:0001583	missense	3993	exon21			X87342	CCDS11725.1, CCDS32733.1, CCDS45776.1	17q25.1	2013-01-10	2001-11-28			ENSG00000073350		"""WD repeat domain containing"""	6629	protein-coding gene	gene with protein product			"""lethal giant larvae (Drosophila) homolog 2"""				Standard	XR_243659		Approved	HGL	uc002joh.3	Q6P1M3		ENST00000392550.3:c.2830C>T	17.37:g.73569666C>T	ENSP00000376333:p.Arg944Cys	LOH		Unspecified	Illumina	Phase_I	71081261	NM_001031803	Q14521|Q9BR62	Missense_Mutation	SNP	ENST00000392550.3	37	CCDS32733.1	13	0.005952380952380952	0	0.0	4	0.011049723756906077	0	0.0	9	0.011873350923482849	C	13.42	2.232946	0.39498	0.001817	0.012337	ENSG00000073350	ENST00000167462;ENST00000392550;ENST00000545227	T;T	0.05199	3.48;3.6	5.12	-3.2	0.05156	.	1.338190	0.04967	N	0.463057	T	0.03520	0.0101	L	0.39898	1.24	0.09310	N	1	B;B;B;B;B	0.14438	0.007;0.006;0.01;0.007;0.002	B;B;B;B;B	0.08055	0.002;0.001;0.003;0.002;0.001	T	0.44997	-0.9291	10	0.54805	T	0.06	-0.8888	2.0887	0.03651	0.2011:0.4356:0.0989:0.2645	.	571;933;933;944;944	B4DVR9;B3KX47;G3V1I9;Q6P1M3-2;Q6P1M3	.;.;.;.;L2GL2_HUMAN	C	944;944;933	ENSP00000167462:R944C;ENSP00000376333:R944C	ENSP00000167462:R944C	R	+	1	0	LLGL2	71081261	0.000000	0.05858	0.000000	0.03702	0.688000	0.40055	-0.135000	0.10420	-0.354000	0.08212	0.400000	0.26472	CGC		LLGL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447633.1	NM_004524	
FOXK2	3607	broad.mit.edu	37	17	80545006	80545006	+	Silent	SNP	G	G	A	rs148594749	byFrequency	TCGA-AG-3999-01	TCGA-AG-3999-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr17:80545006G>A	ENST00000335255.5	+	8	1818	c.1644G>A	c.(1642-1644)acG>acA	p.T548T	RP13-638C3.3_ENST00000575085.1_RNA	NM_004514.3	NP_004505.2	Q01167	FOXK2_HUMAN	forkhead box K2	548					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	magnesium ion binding (GO:0000287)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T548T(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|urinary_tract(1)	17	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)			TCATTCAGACGGCACAGACCA	0.502													G|||	6	0.00119808	0.0	0.0014	5008	,	,		17906	0.0		0.005	False		,,,				2504	0.0				p.T548T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1644A	17						.	G		0,4406		0,0,2203	94.0	82.0	86.0		1644	-3.2	0.0	17	dbSNP_134	86	15,8585	11.2+/-40.8	0,15,4285	no	coding-synonymous	FOXK2	NM_004514.3		0,15,6488	AA,AG,GG		0.1744,0.0,0.1153		548/661	80545006	15,12991	2203	4300	6503	78138295	SO:0001819	synonymous_variant	3607	exon8			U58196	CCDS11813.1	17q25	2006-12-15	2004-03-09	2004-03-10	ENSG00000141568	ENSG00000141568		"""Forkhead boxes"""	6036	protein-coding gene	gene with protein product		147685	"""interleukin enhancer binding factor 1"""	ILF, ILF1		3260003	Standard	NM_004514		Approved		uc002kfn.3	Q01167	OTTHUMG00000140374	ENST00000335255.5:c.1644G>A	17.37:g.80545006G>A		Somatic		Unspecified	Illumina	Phase_I	78138295	NM_004514	A6NEP5|Q13622|Q13623|Q13624	Silent	SNP	ENST00000335255.5	37	CCDS11813.1																																																																																				FOXK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277099.2	NM_181430	
TRPM2	7226	broad.mit.edu	37	21	45811378	45811378	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3999-01	TCGA-AG-3999-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr21:45811378G>A	ENST00000397928.1	+	11	2109	c.1664G>A	c.(1663-1665)cGc>cAc	p.R555H	TRPM2_ENST00000300482.5_Missense_Mutation_p.R555H|TRPM2_ENST00000300481.9_Intron|TRPM2_ENST00000397932.2_Missense_Mutation_p.R555H|TRPM2_ENST00000498430.1_3'UTR	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	555					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)	p.R555L(1)|p.R555H(1)		breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						gcggcgccccgccTGCAGATG	0.706																																					p.R555H												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G1664A	21						.						16.0	17.0	17.0					21																	45811378		2169	4249	6418	44635806	SO:0001583	missense	7226	exon11			AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.1664G>A	21.37:g.45811378G>A	ENSP00000381023:p.Arg555His	Somatic		Unspecified	Illumina	Phase_I	44635806	NM_003307	D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Missense_Mutation	SNP	ENST00000397928.1	37	CCDS13710.1	.	.	.	.	.	.	.	.	.	.	G	7.394	0.631406	0.14322	.	.	ENSG00000142185	ENST00000300482;ENST00000397928;ENST00000397932	T;T;T	0.63417	-0.04;-0.04;-0.04	4.63	1.2	0.21068	.	1.517800	0.03458	N	0.211825	T	0.62865	0.2463	L	0.60067	1.865	0.80722	D	1	D;D;D	0.60575	0.958;0.98;0.988	B;B;P	0.47981	0.382;0.443;0.563	T	0.58239	-0.7671	10	0.46703	T	0.11	-4.8183	4.3929	0.11350	0.3758:0.1967:0.4274:0.0	.	555;341;555	E9PGK7;Q5KTC1;O94759	.;.;TRPM2_HUMAN	H	555	ENSP00000300482:R555H;ENSP00000381023:R555H;ENSP00000381026:R555H	ENSP00000300482:R555H	R	+	2	0	TRPM2	44635806	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	0.089000	0.15002	0.376000	0.24707	0.655000	0.94253	CGC		TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098086.1	NM_003307	
COL6A2	1292	broad.mit.edu	37	21	47544833	47544833	+	Splice_Site	SNP	C	C	T	rs142709940	byFrequency	TCGA-AG-3999-01	TCGA-AG-3999-01	C	C	C	C	C	C	Unknown	Wildtype	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr21:47544833C>T	ENST00000300527.4	+	23	1873	c.1769C>T	c.(1768-1770)aCg>aTg	p.T590M	COL6A2_ENST00000397763.1_Splice_Site_p.T590M|COL6A2_ENST00000310645.5_Splice_Site_p.T590M|COL6A2_ENST00000357838.4_Splice_Site_p.T590M|COL6A2_ENST00000409416.1_Splice_Site_p.T590M	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	590	Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		CCCGGTCTCACGGTAGGTGTC	0.642													C|||	2	0.000399361	0.0	0.0	5008	,	,		17980	0.0		0.002	False		,,,				2504	0.0				p.T590M												.	.	0			c.C1769T	21						.	C	MET/THR,MET/THR,MET/THR	2,4404	4.2+/-10.8	0,2,2201	44.0	43.0	44.0		1769,1769,1769	4.1	1.0	21	dbSNP_134	44	21,8573	15.3+/-51.7	0,21,4276	yes	missense-near-splice,missense-near-splice,missense-near-splice	COL6A2	NM_001849.3,NM_058174.2,NM_058175.2	81,81,81	0,23,6477	TT,TC,CC		0.2444,0.0454,0.1769	probably-damaging,probably-damaging,probably-damaging	590/1020,590/919,590/829	47544833	23,12977	2203	4297	6500	46369261	SO:0001630	splice_region_variant	1292	exon23			M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.1770+1C>T	21.37:g.47544833C>T		None		Unspecified	Illumina	Phase_I	46369261	NM_001849	Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Missense_Mutation	SNP	ENST00000300527.4	37	CCDS13728.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	17.04	3.286485	0.59867	4.54E-4	0.002444	ENSG00000142173	ENST00000300527;ENST00000357838;ENST00000310645;ENST00000409416;ENST00000397763;ENST00000413758	D;D;D;D;D;D	0.93811	-3.29;-3.29;-3.29;-3.29;-3.29;-3.29	4.12	4.12	0.48240	.	0.052546	0.85682	D	0.000000	D	0.95526	0.8546	L	0.54323	1.7	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.983;0.983	D	0.96004	0.8996	10	0.62326	D	0.03	-12.3988	16.3666	0.83331	0.0:1.0:0.0:0.0	.	590;590;590	P12110;P12110-2;P12110-3	CO6A2_HUMAN;.;.	M	590;590;590;590;590;131	ENSP00000300527:T590M;ENSP00000350497:T590M;ENSP00000312529:T590M;ENSP00000387115:T590M;ENSP00000380870:T590M;ENSP00000395751:T131M	ENSP00000300527:T590M	T	+	2	0	COL6A2	46369261	1.000000	0.71417	1.000000	0.80357	0.314000	0.28054	6.085000	0.71343	1.856000	0.53863	0.591000	0.81541	ACG		COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206971.1		Missense_Mutation
MYLK3	91807	broad.mit.edu	37	16	46755087	46755087	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3999-01	TCGA-AG-3999-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr16:46755087C>T	ENST00000394809.4	-	9	2048	c.1933G>A	c.(1933-1935)Gtc>Atc	p.V645I	MYLK3_ENST00000536476.1_Missense_Mutation_p.V304I	NM_182493.2	NP_872299.2	Q32MK0	MYLK3_HUMAN	myosin light chain kinase 3	645	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac myofibril assembly (GO:0055003)|cellular response to interleukin-1 (GO:0071347)|positive regulation of sarcomere organization (GO:0060298)|protein phosphorylation (GO:0006468)|regulation of vascular permeability involved in acute inflammatory response (GO:0002528)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)	p.V724I(1)|p.V645I(1)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(5)|stomach(3)	37		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				GTCTGATTGACGCACAATATG	0.448																																					p.V645I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1933A	16						.						125.0	124.0	125.0					16																	46755087		2203	4300	6503	45312588	SO:0001583	missense	91807	exon9			AJ247087	CCDS10723.2	16q11.2	2008-10-23			ENSG00000140795	ENSG00000140795			29826	protein-coding gene	gene with protein product	"""MLC kinase"""	612147				17885681	Standard	NM_182493		Approved	caMLCK, MLCK	uc002eei.4	Q32MK0	OTTHUMG00000132543	ENST00000394809.4:c.1933G>A	16.37:g.46755087C>T	ENSP00000378288:p.Val645Ile	Somatic		Unspecified	Illumina	Phase_I	45312588	NM_182493	B5BUL9|B7Z5U8|Q32MK1|Q96DV1	Missense_Mutation	SNP	ENST00000394809.4	37	CCDS10723.2	.	.	.	.	.	.	.	.	.	.	C	26.0	4.699938	0.88924	.	.	ENSG00000140795	ENST00000394809;ENST00000536476	T;T	0.39406	1.08;1.08	5.35	5.35	0.76521	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.32518	N	0.005993	T	0.43211	0.1237	L	0.31752	0.955	0.48830	D	0.999719	P	0.39282	0.666	P	0.44623	0.455	T	0.39941	-0.9589	10	0.62326	D	0.03	.	19.4403	0.94817	0.0:1.0:0.0:0.0	.	645	Q32MK0	MYLK3_HUMAN	I	645;304	ENSP00000378288:V645I;ENSP00000439297:V304I	ENSP00000378288:V645I	V	-	1	0	MYLK3	45312588	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	3.891000	0.56227	2.666000	0.90696	0.557000	0.71058	GTC		MYLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255743.2	NM_182493	
PKD1L2	114780	broad.mit.edu	37	16	81183492	81183492	+	RNA	SNP	T	T	G	rs188010999		TCGA-AG-3999-01	TCGA-AG-3999-01	T	T	T	G	T	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr16:81183492T>G	ENST00000525539.1	-	0	4555				PKD1L2_ENST00000533478.1_RNA	NM_052892.3	NP_443124.3	Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						GAAAAACAGGTGGCTGCAGGC	0.577													T|||	1	0.000199681	0.0	0.0	5008	,	,		17443	0.0		0.001	False		,,,				2504	0.0				p.H1519P												.	.	0			c.A4556C	16						.	T	PRO/HIS	0,3866		0,0,1933	34.0	36.0	36.0		4556	4.4	1.0	16		36	2,8252		0,2,4125	yes	missense	PKD1L2	NM_052892.3	77	0,2,6058	GG,GT,TT		0.0242,0.0,0.0165	probably-damaging	1519/2460	81183492	2,12118	1933	4127	6060	79740993			114780	exon28			AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81183492T>G		Germline		Unspecified	Illumina	Phase_I	79740993	NM_052892	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Missense_Mutation	SNP	ENST00000525539.1	37																																																																																					PKD1L2-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000387972.2		
KCNG4	93107	broad.mit.edu	37	16	84270675	84270675	+	Silent	SNP	G	G	A			TCGA-AG-3999-01	TCGA-AG-3999-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr16:84270675G>A	ENST00000308251.4	-	2	485	c.417C>T	c.(415-417)tgC>tgT	p.C139C	KCNG4_ENST00000568181.1_Silent_p.C139C	NM_172347.2	NP_758857.1	Q8TDN1	KCNG4_HUMAN	potassium voltage-gated channel, subfamily G, member 4	139					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.C139C(2)		breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	31						AGGACAGCGCGCACATCTCCT	0.652																																					p.C139C												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C417T	16						.						47.0	49.0	48.0					16																	84270675		2200	4300	6500	82828176	SO:0001819	synonymous_variant	93107	exon2			AF348984	CCDS10945.1	16q24.1	2011-07-05			ENSG00000168418	ENSG00000168418		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	19697	protein-coding gene	gene with protein product		607603				12060745, 16382104	Standard	NM_172347		Approved	Kv6.4	uc010voc.2	Q8TDN1	OTTHUMG00000137638	ENST00000308251.4:c.417C>T	16.37:g.84270675G>A		Somatic		Unspecified	Illumina	Phase_I	82828176	NM_172347	Q96H24	Silent	SNP	ENST00000308251.4	37	CCDS10945.1																																																																																				KCNG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269079.2	NM_172347	
ANKRD11	29123	broad.mit.edu	37	16	89346153	89346153	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3999-01	TCGA-AG-3999-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr16:89346153G>A	ENST00000301030.4	-	9	7257	c.6797C>T	c.(6796-6798)gCg>gTg	p.A2266V	ANKRD11_ENST00000378330.2_Missense_Mutation_p.A2266V	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	2266	Pro-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.A2266V(1)		breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		ACAGAGGGACGCGGCGGGGGG	0.746																																					p.A2266V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C6797T	16						.						2.0	3.0	3.0					16																	89346153		1344	3001	4345	87873654	SO:0001583	missense	29123	exon9			AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.6797C>T	16.37:g.89346153G>A	ENSP00000301030:p.Ala2266Val	Somatic		Unspecified	Illumina	Phase_I	87873654	NM_013275	Q6NTG1|Q6QMF8	Missense_Mutation	SNP	ENST00000301030.4	37	CCDS32513.1	.	.	.	.	.	.	.	.	.	.	g	11.79	1.745117	0.30955	.	.	ENSG00000167522	ENST00000301030;ENST00000378330	T;T	0.37752	1.18;1.18	4.83	-0.68	0.11346	.	1.119980	0.06794	N	0.787604	T	0.16214	0.0390	N	0.04508	-0.205	0.09310	N	1	B	0.13145	0.007	B	0.04013	0.001	T	0.23048	-1.0199	10	0.34782	T	0.22	.	5.5632	0.17157	0.3663:0.0:0.5099:0.1238	.	2266	Q6UB99	ANR11_HUMAN	V	2266	ENSP00000301030:A2266V;ENSP00000367581:A2266V	ENSP00000301030:A2266V	A	-	2	0	ANKRD11	87873654	0.004000	0.15560	0.000000	0.03702	0.003000	0.03518	0.709000	0.25734	-0.030000	0.13804	0.394000	0.25966	GCG		ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275	
PIEZO2	63895	broad.mit.edu	37	18	10696470	10696471	+	Missense_Mutation	DNP	CG	CG	AA	rs551918181|rs371890622		TCGA-AG-3999-01	TCGA-AG-3999-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr18:10696470_10696471CG>AA	ENST00000503781.3	-	42	6554_6555	c.6555_6556CG>TT	c.(6553-6558)gcCGtg>gcTTtg	p.V2186L	PIEZO2_ENST00000538948.1_Missense_Mutation_p.V143L|PIEZO2_ENST00000302079.6_Missense_Mutation_p.V2186L|PIEZO2_ENST00000285141.4_Missense_Mutation_p.V41L|PIEZO2_ENST00000580640.1_Missense_Mutation_p.V2211L	NM_022068.2	NP_071351.2	Q9H5I5	PIEZ2_HUMAN	piezo-type mechanosensitive ion channel component 2	2186					cation transport (GO:0006812)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|regulation of membrane potential (GO:0042391)|response to mechanical stimulus (GO:0009612)	integral component of membrane (GO:0016021)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)	p.A40>?(1)|p.A2185>?(1)									ACGTCAGTCACGGCGCTATACT	0.525																																					.												.	.	2	Complex(2)	large_intestine(2)	c.6555_6556TT	18						.																																			10686471	SO:0001583	missense	63895	exon42			AK027056		18p11.21	2012-11-19	2011-08-31	2011-08-31	ENSG00000154864	ENSG00000154864			26270	protein-coding gene	gene with protein product		613629	"""chromosome 18 open reading frame 30"", ""chromosome 18 open reading frame 58"", ""family with sequence similarity 38, member B"""	FAM38B2, C18orf30, C18orf58, FAM38B		20813920, 21056836, 21299953	Standard	NM_022068		Approved	FLJ23403, FLJ23144, HsT748, HsT771, FLJ34907	uc002kos.2	Q9H5I5	OTTHUMG00000178507	ENST00000503781.3:c.6555_6556delinsAA	18.37:g.10696470_10696471delinsAA	ENSP00000421377:p.Val2186Leu	Somatic		Unspecified	Illumina	Phase_I	10686470	NM_022068	B7Z812|M4GPJ9|Q6ZS91|Q8N787|Q8NAR6|Q9H5R4	Missense_Mutation	DNP	ENST00000503781.3	37																																																																																					PIEZO2-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000442385.4	NM_022068	
TTR	7276	broad.mit.edu	37	18	29178562	29178562	+	Missense_Mutation	SNP	G	G	A	rs148538950		TCGA-AG-3999-01	TCGA-AG-3999-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr18:29178562G>A	ENST00000237014.3	+	4	545	c.368G>A	c.(367-369)cGc>cAc	p.R123H		NM_000371.3	NP_000362.1	P02766	TTHY_HUMAN	transthyretin	123					extracellular matrix organization (GO:0030198)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	hormone binding (GO:0042562)|identical protein binding (GO:0042802)	p.R123H(1)		cervix(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	13			OV - Ovarian serous cystadenocarcinoma(10;0.00523)		Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Diflunisal(DB00861)|Dimethyl sulfoxide(DB01093)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	TCCGGCCCCCGCCGCTACACC	0.562																																					p.R123H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G368A	18						.	G	HIS/ARG	3,4403	6.2+/-15.9	0,3,2200	68.0	62.0	64.0		368	6.0	0.2	18	dbSNP_134	64	0,8600		0,0,4300	no	missense	TTR	NM_000371.3	29	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	possibly-damaging	123/148	29178562	3,13003	2203	4300	6503	27432560	SO:0001583	missense	7276	exon4			M10605	CCDS11899.1	18q12.1	2014-09-17	2008-07-31		ENSG00000118271	ENSG00000118271			12405	protein-coding gene	gene with protein product		176300	"""prealbumin, amyloidosis type I"", ""carpal tunnel syndrome 1"""	PALB, CTS1		8309582	Standard	NM_000371		Approved	HsT2651, CTS	uc002kwx.4	P02766	OTTHUMG00000131984	ENST00000237014.3:c.368G>A	18.37:g.29178562G>A	ENSP00000237014:p.Arg123His	Somatic		Unspecified	Illumina	Phase_I	27432560	NM_000371	Q549C7|Q6IB96|Q9UBZ6|Q9UCM9	Missense_Mutation	SNP	ENST00000237014.3	37	CCDS11899.1	.	.	.	.	.	.	.	.	.	.	G	15.10	2.732870	0.48939	6.81E-4	0.0	ENSG00000118271	ENST00000237014;ENST00000432547;ENST00000541025	D	0.96073	-3.9	5.98	5.98	0.97165	Transthyretin/hydroxyisourate hydrolase, superfamily (4);	0.000000	0.85682	D	0.000000	D	0.95604	0.8571	M	0.91717	3.235	0.80722	D	1	P	0.49185	0.92	B	0.32533	0.147	D	0.96269	0.9197	10	0.66056	D	0.02	-19.9086	20.0317	0.97542	0.0:0.0:1.0:0.0	.	123	P02766	TTHY_HUMAN	H	123;160;123	ENSP00000237014:R123H	ENSP00000237014:R123H	R	+	2	0	TTR	27432560	1.000000	0.71417	0.242000	0.24170	0.032000	0.12392	7.630000	0.83225	2.837000	0.97791	0.591000	0.81541	CGC		TTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254948.1	NM_000371	
NOL4	8715	broad.mit.edu	37	18	31709948	31709948	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3999-01	TCGA-AG-3999-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr18:31709948G>A	ENST00000261592.5	-	2	598	c.301C>T	c.(301-303)Cgg>Tgg	p.R101W	NOL4_ENST00000269185.4_De_novo_Start_OutOfFrame|NOL4_ENST00000535475.1_De_novo_Start_InFrame|NOL4_ENST00000538587.1_Missense_Mutation_p.R27W|NOL4_ENST00000589544.1_Missense_Mutation_p.R101W	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	O94818	NOL4_HUMAN	nucleolar protein 4	101						nucleolus (GO:0005730)	RNA binding (GO:0003723)	p.R101W(1)		NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	51						ACAGCTACCCGTCGTAAAGAT	0.388																																					p.R101W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C301T	18						.						94.0	85.0	88.0					18																	31709948		2203	4300	6503	29963946	SO:0001583	missense	8715	exon2			AB017800	CCDS11907.2, CCDS56058.1, CCDS56059.1, CCDS59308.1	18q12	2010-05-04			ENSG00000101746	ENSG00000101746			7870	protein-coding gene	gene with protein product	"""cancer/testis antigen 125"""	603577				9813152	Standard	NM_003787		Approved	NOLP, HRIHFB2255, CT125	uc010dmi.3	O94818	OTTHUMG00000132291	ENST00000261592.5:c.301C>T	18.37:g.31709948G>A	ENSP00000261592:p.Arg101Trp	Somatic		Unspecified	Illumina	Phase_I	29963946	NM_001198546	B4DSQ0|B7Z3Z7|F5H1E3|Q6IBS2|Q9BWF1	Missense_Mutation	SNP	ENST00000261592.5	37	CCDS11907.2	.	.	.	.	.	.	.	.	.	.	G	19.40	3.820490	0.71028	.	.	ENSG00000101746	ENST00000261592;ENST00000538587	D	0.84223	-1.82	5.61	3.74	0.42951	.	.	.	.	.	D	0.89674	0.6783	L	0.54323	1.7	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.992;0.988;0.994	D	0.89507	0.3768	9	0.87932	D	0	-5.9031	13.0677	0.59043	0.0:0.0:0.5372:0.4628	.	27;101;101	B4DSQ0;O94818;O94818-2	.;NOL4_HUMAN;.	W	101;27	ENSP00000261592:R101W	ENSP00000261592:R101W	R	-	1	2	NOL4	29963946	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.109000	0.57824	0.626000	0.30322	0.585000	0.79938	CGG		NOL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255386.1	NM_003787	
C3orf20	84077	broad.mit.edu	37	3	14725825	14725825	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3999-01	TCGA-AG-3999-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr3:14725825G>A	ENST00000253697.3	+	4	1013	c.561G>A	c.(559-561)atG>atA	p.M187I	C3orf20_ENST00000435614.1_Missense_Mutation_p.M65I|C3orf20_ENST00000412910.1_Missense_Mutation_p.M65I	NM_032137.4	NP_115513.4	Q8ND61	CC020_HUMAN	chromosome 3 open reading frame 20	187						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.M187I(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(13)|lung(11)|ovary(4)|skin(2)	40						CCAAGGAGATGGCCTTCAACT	0.547																																					p.M65I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G195A	3						.						132.0	114.0	120.0					3																	14725825		2203	4300	6503	14700829	SO:0001583	missense	84077	exon4			AL136781	CCDS33706.1, CCDS54555.1	3p25.1	2011-01-25			ENSG00000131379	ENSG00000131379			25320	protein-coding gene	gene with protein product						11230166	Standard	NM_032137		Approved	DKFZP434N1817	uc003byy.3	Q8ND61	OTTHUMG00000155545	ENST00000253697.3:c.561G>A	3.37:g.14725825G>A	ENSP00000253697:p.Met187Ile	Somatic		Unspecified	Illumina	Phase_I	14700829	NM_001184958	Q7L0U6|Q8NCP2|Q9H0I7	Missense_Mutation	SNP	ENST00000253697.3	37	CCDS33706.1	.	.	.	.	.	.	.	.	.	.	G	14.29	2.491410	0.44249	.	.	ENSG00000131379	ENST00000253697;ENST00000435614;ENST00000412910	T;T;T	0.08370	3.39;3.1;3.1	4.91	4.91	0.64330	.	0.228619	0.30879	N	0.008693	T	0.06462	0.0166	L	0.34521	1.04	0.35116	D	0.766577	P	0.38677	0.642	B	0.24269	0.052	T	0.25641	-1.0126	10	0.72032	D	0.01	-16.1931	13.9423	0.64064	0.0:0.0:1.0:0.0	.	187	Q8ND61	CC020_HUMAN	I	187;65;65	ENSP00000253697:M187I;ENSP00000402933:M65I;ENSP00000396081:M65I	ENSP00000253697:M187I	M	+	3	0	C3orf20	14700829	1.000000	0.71417	1.000000	0.80357	0.845000	0.48019	2.822000	0.48073	2.423000	0.82170	0.467000	0.42956	ATG		C3orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340586.1	NM_032137	
BSN	8927	broad.mit.edu	37	3	49690304	49690304	+	Silent	SNP	G	G	A			TCGA-AG-3999-01	TCGA-AG-3999-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr3:49690304G>A	ENST00000296452.4	+	5	3429	c.3315G>A	c.(3313-3315)ccG>ccA	p.P1105P		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	1105					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)	p.P1105P(1)		breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		ATGCCTCCCCGACGGAGGAGC	0.647																																					p.P1105P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3315A	3						.						67.0	70.0	69.0					3																	49690304		2203	4300	6503	49665308	SO:0001819	synonymous_variant	8927	exon5			AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.3315G>A	3.37:g.49690304G>A		Somatic		Unspecified	Illumina	Phase_I	49665308	NM_003458	O43161|Q7LGH3	Silent	SNP	ENST00000296452.4	37	CCDS2800.1																																																																																				BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258164.1	NM_003458	
TF	7018	broad.mit.edu	37	3	133478031	133478031	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3999-01	TCGA-AG-3999-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr3:133478031C>T	ENST00000402696.3	+	9	1546	c.1061C>T	c.(1060-1062)cCa>cTa	p.P354L	TF_ENST00000264998.3_Missense_Mutation_p.P227L	NM_001063.3	NP_001054	P02787	TRFE_HUMAN	transferrin	354					blood coagulation (GO:0007596)|cellular iron ion homeostasis (GO:0006879)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|retina homeostasis (GO:0001895)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basal part of cell (GO:0045178)|basal plasma membrane (GO:0009925)|blood microparticle (GO:0072562)|cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|secretory granule lumen (GO:0034774)|vesicle (GO:0031982)	ferric iron binding (GO:0008199)	p.P354L(1)		NS(1)|autonomic_ganglia(1)|breast(3)|endometrium(7)|large_intestine(13)|liver(2)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49					Aluminium(DB01370)|Bismuth Subsalicylate(DB01294)|Gallium nitrate(DB05260)|Iron Dextran(DB00893)	CCAGAAGCCCCAACAGATGAA	0.488																																					p.P354L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1061T	3						.						150.0	153.0	152.0					3																	133478031		2203	4300	6503	134960721	SO:0001583	missense	7018	exon9				CCDS3080.1	3q21	2012-10-02			ENSG00000091513	ENSG00000091513			11740	protein-coding gene	gene with protein product		190000				6585826	Standard	NM_001063		Approved	PRO1557, PRO2086	uc003epv.2	P02787	OTTHUMG00000150356	ENST00000402696.3:c.1061C>T	3.37:g.133478031C>T	ENSP00000385834:p.Pro354Leu	Somatic		Unspecified	Illumina	Phase_I	134960721	NM_001063	O43890|Q1HBA5|Q9NQB8|Q9UHV0	Missense_Mutation	SNP	ENST00000402696.3	37	CCDS3080.1	.	.	.	.	.	.	.	.	.	.	C	8.168	0.791135	0.16258	.	.	ENSG00000091513	ENST00000402696;ENST00000264998	T;T	0.02280	4.36;4.41	4.15	1.34	0.21922	.	3.741260	0.00397	N	0.000055	T	0.03263	0.0095	L	0.42245	1.32	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.48456	-0.9034	10	0.25751	T	0.34	2.34	7.7128	0.28688	0.0:0.7082:0.0:0.2918	.	354	P02787	TRFE_HUMAN	L	354;227	ENSP00000385834:P354L;ENSP00000264998:P227L	ENSP00000264998:P227L	P	+	2	0	TF	134960721	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.228000	0.17814	0.082000	0.17018	-0.671000	0.03813	CCA		TF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317775.1	NM_001063	
ASCL4	121549	broad.mit.edu	37	12	108169040	108169040	+	Silent	SNP	G	G	A	rs577263861		TCGA-AG-3999-01	TCGA-AG-3999-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr12:108169040G>A	ENST00000342331.4	+	1	879	c.48G>A	c.(46-48)tcG>tcA	p.S16S		NM_203436.2	NP_982260.2	Q6XD76	ASCL4_HUMAN	achaete-scute family bHLH transcription factor 4	15					regulation of transcription from RNA polymerase II promoter (GO:0006357)|skin development (GO:0043588)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S15S(1)		breast(2)|central_nervous_system(1)|large_intestine(3)|lung(6)|upper_aerodigestive_tract(1)	13						TGCCATACTCGCTGCGCACCG	0.642																																					p.S16S	GBM(170;776 3695 11650)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G48A	12						.						56.0	63.0	61.0					12																	108169040		2203	4299	6502	106693170	SO:0001819	synonymous_variant	121549	exon1			AY238895	CCDS31894.2	12q24.11	2013-10-17	2013-10-17		ENSG00000187855	ENSG00000187855		"""Basic helix-loop-helix proteins"""	24311	protein-coding gene	gene with protein product		609155	"""achaete-scute complex-like 4 (Drosophila)"", ""achaete-scute complex homolog 4 (Drosophila)"""				Standard	NM_203436		Approved	HASH4, bHLHa44	uc001tmr.3	Q6XD76	OTTHUMG00000156964	ENST00000342331.4:c.48G>A	12.37:g.108169040G>A		Somatic		Unspecified	Illumina	Phase_I	106693170	NM_203436	Q7RTS2	Silent	SNP	ENST00000342331.4	37	CCDS31894.2																																																																																				ASCL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346845.1	NM_203436	
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	T	rs121913530		TCGA-AG-3999-01	TCGA-AG-3999-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr12:25398285C>T	ENST00000256078.4	-	2	97	c.34G>A	c.(34-36)Ggt>Agt	p.G12S	KRAS_ENST00000556131.1_Missense_Mutation_p.G12S|KRAS_ENST00000311936.3_Missense_Mutation_p.G12S|KRAS_ENST00000557334.1_Missense_Mutation_p.G12S	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12S	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,+1	.	5144	Substitution - Missense(5142)|Insertion - In frame(2)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	c.G34A	12	GRCh37	CM076251	KRAS	M	rs121913530	.						93.0	83.0	86.0					12																	25398285		2203	4300	6503	25289552	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>A	12.37:g.25398285C>T	ENSP00000256078:p.Gly12Ser	Somatic		Unspecified	Illumina	Phase_I	25289552	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	35	5.441396	0.96187	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.76316	-1.01;-1.01;-1.01;-1.01	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.78559	0.4302	L	0.28344	0.845	0.80722	D	1	P;P	0.39665	0.557;0.682	P;P	0.50570	0.525;0.644	T	0.80254	-0.1459	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	S	12	ENSP00000308495:G12S;ENSP00000452512:G12S;ENSP00000256078:G12S;ENSP00000451856:G12S	ENSP00000256078:G12S	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
TMTC1	83857	broad.mit.edu	37	12	29757205	29757205	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3999-01	TCGA-AG-3999-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr12:29757205C>T	ENST00000539277.1	-	7	1214	c.1156G>A	c.(1156-1158)Ggc>Agc	p.G386S	TMTC1_ENST00000381224.2_Missense_Mutation_p.G340S|TMTC1_ENST00000256062.5_Missense_Mutation_p.G278S|TMTC1_ENST00000551659.1_Missense_Mutation_p.G448S|TMTC1_ENST00000319685.8_5'UTR|TMTC1_ENST00000552618.1_Missense_Mutation_p.G448S	NM_001193451.1	NP_001180380.1	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat containing 1	386						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.G278S(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(17)|lung(45)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					AACAACAAGCCGACTAAAACC	0.468																																					p.G386S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1156A	12						.						115.0	104.0	108.0					12																	29757205		2203	4300	6503	29648472	SO:0001583	missense	83857	exon7				CCDS8718.1, CCDS53772.1	12p11.22	2014-06-09	2006-01-06			ENSG00000133687		"""Tetratricopeptide (TTC) repeat domain containing"""	24099	protein-coding gene	gene with protein product		615855				24764305	Standard	NM_001193451		Approved	ARG99, OLF, FLJ31400, FLJ41625	uc021qwi.1	Q8IUR5	OTTHUMG00000169324	ENST00000539277.1:c.1156G>A	12.37:g.29757205C>T	ENSP00000442046:p.Gly386Ser	Somatic		Unspecified	Illumina	Phase_I	29648472	NM_001193451	D0EP37|F5H8B5|Q6PIU4|Q6ZSM5|Q96N52|Q9BXM2	Missense_Mutation	SNP	ENST00000539277.1	37	CCDS53772.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.120988	0.77436	.	.	ENSG00000133687	ENST00000540901;ENST00000256062;ENST00000551659;ENST00000552618;ENST00000539277;ENST00000381224	T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	T	0.58395	0.2119	L	0.37697	1.125	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	P;D;D	0.74348	0.882;0.983;0.975	T	0.55679	-0.8103	9	.	.	.	-19.3147	16.74	0.85456	0.0:1.0:0.0:0.0	.	340;386;448	Q8IUR5-3;Q8IUR5;F8VTQ9	.;TMTC1_HUMAN;.	S	149;278;448;448;386;340	ENSP00000256062:G278S;ENSP00000448112:G448S;ENSP00000449043:G448S;ENSP00000442046:G386S;ENSP00000370622:G340S	.	G	-	1	0	TMTC1	29648472	1.000000	0.71417	0.997000	0.53966	0.889000	0.51656	7.185000	0.77714	2.346000	0.79739	0.655000	0.94253	GGC		TMTC1-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403509.1	NM_031920	
TPCN1	53373	broad.mit.edu	37	12	113728005	113728005	+	Silent	SNP	C	C	T	rs146118100	byFrequency	TCGA-AG-3999-01	TCGA-AG-3999-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr12:113728005C>T	ENST00000335509.6	+	22	2183	c.1869C>T	c.(1867-1869)ggC>ggT	p.G623G	TPCN1_ENST00000392569.4_Silent_p.G555G|TPCN1_ENST00000550785.1_Silent_p.G695G|TPCN1_ENST00000541517.1_Silent_p.G695G	NM_017901.4	NP_060371.2	Q9ULQ1	TPC1_HUMAN	two pore segment channel 1	623					calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|voltage-gated calcium channel activity (GO:0005245)	p.G623G(1)		cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(2)|prostate(3)|skin(3)|urinary_tract(1)	40						TGGAGGAAGGCTACTATTATC	0.557													C|||	7	0.00139776	0.0	0.0	5008	,	,		20725	0.0		0.003	False		,,,				2504	0.0041				p.G623G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1869T	12						.	C	,	4,4402	9.9+/-24.2	0,4,2199	126.0	95.0	105.0		2085,1869	-1.6	0.9	12	dbSNP_134	105	33,8567	21.6+/-65.8	0,33,4267	no	coding-synonymous,coding-synonymous	TPCN1	NM_001143819.1,NM_017901.4	,	0,37,6466	TT,TC,CC		0.3837,0.0908,0.2845	,	695/889,623/817	113728005	37,12969	2203	4300	6503	112212388	SO:0001819	synonymous_variant	53373	exon22			AB032995	CCDS31908.1, CCDS44985.1	12q24.21	2011-07-05			ENSG00000186815	ENSG00000186815		"""Voltage-gated ion channels / Two-pore channels"""	18182	protein-coding gene	gene with protein product		609666				10574461, 10753632, 16382101	Standard	XM_005253905		Approved	KIAA1169, FLJ20612, TPC1	uc001tux.3	Q9ULQ1	OTTHUMG00000169625	ENST00000335509.6:c.1869C>T	12.37:g.113728005C>T		Somatic		Unspecified	Illumina	Phase_I	112212388	NM_017901	A7E258|Q86XS9|Q8NC20	Silent	SNP	ENST00000335509.6	37	CCDS31908.1																																																																																				TPCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405156.3	NM_017901	
DISP2	85455	broad.mit.edu	37	15	40662376	40662376	+	Missense_Mutation	SNP	G	G	A	rs146679685		TCGA-AG-3999-01	TCGA-AG-3999-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr15:40662376G>A	ENST00000267889.3	+	8	4150	c.4063G>A	c.(4063-4065)Gct>Act	p.A1355T	RP11-64K12.4_ENST00000558421.1_RNA|LINC00594_ENST00000561261.1_lincRNA	NM_033510.1	NP_277045.1	A7MBM2	DISP2_HUMAN	dispatched homolog 2 (Drosophila)	1355					smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)		p.A1355T(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)	30		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)		ATCATTGCCCGCTTCCCATCA	0.632																																					p.A1355T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4063A	15						.	G	THR/ALA	1,4405	2.1+/-5.4	0,1,2202	85.0	89.0	88.0		4063	-3.4	0.1	15	dbSNP_134	88	0,8600		0,0,4300	no	missense	DISP2	NM_033510.1	58	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	1355/1402	40662376	1,13005	2203	4300	6503	38449668	SO:0001583	missense	85455	exon8			AB051529	CCDS10056.1	15q14	2004-01-15			ENSG00000140323	ENSG00000140323			19712	protein-coding gene	gene with protein product		607503				11214970, 10619433	Standard	NM_033510		Approved	DISPB, KIAA1742, HsT16908	uc001zlk.1	A7MBM2	OTTHUMG00000129983	ENST00000267889.3:c.4063G>A	15.37:g.40662376G>A	ENSP00000267889:p.Ala1355Thr	Somatic		Unspecified	Illumina	Phase_I	38449668	NM_033510	Q6AHW3|Q9C0C1	Missense_Mutation	SNP	ENST00000267889.3	37	CCDS10056.1	.	.	.	.	.	.	.	.	.	.	G	4.202	0.036197	0.08148	2.27E-4	0.0	ENSG00000140323	ENST00000267889	T	0.13196	2.61	5.0	-3.39	0.04868	.	1.044700	0.07477	N	0.903145	T	0.06234	0.0161	N	0.12182	0.205	0.09310	N	1	B	0.16396	0.017	B	0.08055	0.003	T	0.42050	-0.9474	10	0.22706	T	0.39	-0.3538	5.9126	0.19037	0.4994:0.1322:0.3684:0.0	.	1355	A7MBM2	DISP2_HUMAN	T	1355	ENSP00000267889:A1355T	ENSP00000267889:A1355T	A	+	1	0	DISP2	38449668	0.593000	0.26840	0.055000	0.19348	0.551000	0.35334	0.818000	0.27295	-0.872000	0.04037	-1.193000	0.01689	GCT		DISP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252249.1	NM_033510	
MGA	23269	broad.mit.edu	37	15	42052633	42052633	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3999-01	TCGA-AG-3999-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr15:42052633G>A	ENST00000570161.1	+	19	7304	c.7304G>A	c.(7303-7305)cGg>cAg	p.R2435Q	MGA_ENST00000566586.1_Missense_Mutation_p.R2226Q|MGA_ENST00000219905.7_Missense_Mutation_p.R2435Q|MGA_ENST00000389936.4_Missense_Mutation_p.R2396Q|MGA_ENST00000545763.1_Missense_Mutation_p.R2226Q			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.R2484Q(4)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GAGCGGCGGCGGCGTGGTGAA	0.438																																					p.R2435Q												.	.	4	Substitution - Missense(4)	ovary(2)|large_intestine(1)|central_nervous_system(1)	c.G7304A	15						.						109.0	111.0	110.0					15																	42052633		1900	4109	6009	39839925	SO:0001583	missense	23269	exon20			AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.7304G>A	15.37:g.42052633G>A	ENSP00000457035:p.Arg2435Gln	Somatic		Unspecified	Illumina	Phase_I	39839925	NM_001164273	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000570161.1	37	CCDS55959.1	.	.	.	.	.	.	.	.	.	.	G	34	5.296335	0.95574	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	D;D;D	0.99722	-6.53;-6.53;-6.53	5.53	5.53	0.82687	.	0.000000	0.49305	D	0.000156	D	0.99711	0.9889	M	0.83223	2.63	0.31601	N	0.652706	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.997;0.978	D	0.97541	1.0086	10	0.87932	D	0	.	19.4485	0.94857	0.0:0.0:1.0:0.0	.	1051;2226;2435	B4DVS1;F5H7K2;E7ENI0	.;.;.	Q	2435;2396;2226	ENSP00000219905:R2435Q;ENSP00000374586:R2396Q;ENSP00000442467:R2226Q	ENSP00000219905:R2435Q	R	+	2	0	MGA	39839925	0.999000	0.42202	0.998000	0.56505	0.992000	0.81027	7.159000	0.77483	2.583000	0.87209	0.655000	0.94253	CGG		MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1	
ISLR	3671	broad.mit.edu	37	15	74467645	74467645	+	Missense_Mutation	SNP	G	G	A	rs149796219		TCGA-AG-3999-01	TCGA-AG-3999-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr15:74467645G>A	ENST00000249842.3	+	2	803	c.446G>A	c.(445-447)cGc>cAc	p.R149H	RP11-665J16.1_ENST00000561647.1_RNA|ISLR_ENST00000395118.1_Missense_Mutation_p.R149H	NM_005545.3	NP_005536.1	O14498	ISLR_HUMAN	immunoglobulin superfamily containing leucine-rich repeat	149					cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)		p.R149H(1)		central_nervous_system(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)	20						CGTGCTCTGCGCTCGCTGCAA	0.622																																					p.R149H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G446A	15						.	G	HIS/ARG,HIS/ARG	0,4396		0,0,2198	73.0	72.0	72.0		446,446	3.1	0.9	15	dbSNP_134	72	1,8593	1.2+/-3.3	0,1,4296	no	missense,missense	ISLR	NM_005545.3,NM_201526.1	29,29	0,1,6494	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	149/429,149/429	74467645	1,12989	2198	4297	6495	72254698	SO:0001583	missense	3671	exon2			AB003184	CCDS10260.1	15q23-q24	2013-01-11			ENSG00000129009	ENSG00000129009		"""Immunoglobulin superfamily / I-set domain containing"""	6133	protein-coding gene	gene with protein product		602059				9325048	Standard	NM_005545		Approved	HsT17563	uc002axh.1	O14498	OTTHUMG00000137623	ENST00000249842.3:c.446G>A	15.37:g.74467645G>A	ENSP00000249842:p.Arg149His	Somatic		Unspecified	Illumina	Phase_I	72254698	NM_201526		Missense_Mutation	SNP	ENST00000249842.3	37	CCDS10260.1	.	.	.	.	.	.	.	.	.	.	G	15.61	2.885881	0.51908	0.0	1.16E-4	ENSG00000129009	ENST00000249842;ENST00000395118	T;T	0.58506	0.33;0.33	4.05	3.11	0.35812	.	0.125517	0.28431	U	0.015369	T	0.61999	0.2392	L	0.39898	1.24	0.43579	D	0.995915	D	0.89917	1.0	D	0.67231	0.95	T	0.60342	-0.7282	10	0.56958	D	0.05	.	7.4589	0.27283	0.0911:0.1698:0.739:0.0	.	149	O14498	ISLR_HUMAN	H	149	ENSP00000249842:R149H;ENSP00000378550:R149H	ENSP00000249842:R149H	R	+	2	0	ISLR	72254698	1.000000	0.71417	0.880000	0.34516	0.312000	0.27988	4.800000	0.62524	0.672000	0.31204	0.313000	0.20887	CGC		ISLR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269044.1	NM_005545	
CC2D2A	57545	broad.mit.edu	37	4	15516423	15516423	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3999-01	TCGA-AG-3999-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr4:15516423G>T	ENST00000503292.1	+	10	991	c.811G>T	c.(811-813)Gat>Tat	p.D271Y	CC2D2A_ENST00000413206.1_Missense_Mutation_p.D271Y|CC2D2A_ENST00000513811.1_3'UTR|CC2D2A_ENST00000424120.1_Missense_Mutation_p.D271Y|CC2D2A_ENST00000389652.5_Missense_Mutation_p.D222Y	NM_001080522.2	NP_001073991.2	Q9P2K1	C2D2A_HUMAN	coiled-coil and C2 domain containing 2A	271					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|TCTN-B9D complex (GO:0036038)		p.D222Y(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|urinary_tract(2)	32						CAGACCTGCAGATTATGAAAG	0.448																																					p.D271Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G811T	4						.						153.0	154.0	153.0					4																	15516423		1964	4158	6122	15125521	SO:0001583	missense	57545	exon10			AB037766, EU450799	CCDS47026.1, CCDS47027.1, CCDS47027.2, CCDS54744.1	4p15.33	2014-09-17	2007-10-19		ENSG00000048342	ENSG00000048342			29253	protein-coding gene	gene with protein product	"""Meckel syndrome, type 6"""	612013				10718198, 18513680	Standard	NM_001080522		Approved	KIAA1345, MKS6, JBTS9	uc010idv.2	Q9P2K1	OTTHUMG00000160255	ENST00000503292.1:c.811G>T	4.37:g.15516423G>T	ENSP00000421809:p.Asp271Tyr	Somatic		Unspecified	Illumina	Phase_I	15125521	NM_001080522	A6ND97|B3FW08|D6RB72|E7EP21|E9PEV5|Q3SYP3|Q9H8A7	Missense_Mutation	SNP	ENST00000503292.1	37	CCDS47026.1	.	.	.	.	.	.	.	.	.	.	G	10.20	1.283922	0.23392	.	.	ENSG00000048342	ENST00000424120;ENST00000413206;ENST00000426932;ENST00000510333;ENST00000512702;ENST00000503292;ENST00000389652	T;T;T;T;T	0.23147	1.92;1.92;1.92;1.92;1.92	5.76	4.02	0.46733	.	0.421591	0.24803	N	0.035469	T	0.22437	0.0541	L	0.36672	1.1	0.80722	D	1	B;B	0.11235	0.004;0.004	B;B	0.11329	0.004;0.006	T	0.03060	-1.1077	10	0.87932	D	0	.	12.7526	0.57316	0.0:0.1259:0.7429:0.1312	.	271;222	Q9P2K1;Q9P2K1-2	C2D2A_HUMAN;.	Y	271;271;222;222;271;271;222	ENSP00000403465:D271Y;ENSP00000398391:D271Y;ENSP00000422875:D271Y;ENSP00000421809:D271Y;ENSP00000374303:D222Y	ENSP00000374303:D222Y	D	+	1	0	CC2D2A	15125521	1.000000	0.71417	0.020000	0.16555	0.286000	0.27126	5.755000	0.68750	0.757000	0.33036	-0.165000	0.13383	GAT		CC2D2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359906.2	NM_001080522	
JAKMIP1	152789	broad.mit.edu	37	4	6107415	6107415	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3999-01	TCGA-AG-3999-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr4:6107415G>A	ENST00000282924.5	-	3	894	c.409C>T	c.(409-411)Cgc>Tgc	p.R137C	JAKMIP1_ENST00000409371.3_Intron|JAKMIP1_ENST00000457227.2_Intron|JAKMIP1_ENST00000410077.2_Intron|JAKMIP1_ENST00000409831.1_Missense_Mutation_p.R137C|JAKMIP1_ENST00000409021.3_Missense_Mutation_p.R137C	NM_144720.3	NP_653321.1	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein 1	137	Mediates association with microtubules.				cognition (GO:0050890)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|microtubule (GO:0005874)|ribonucleoprotein complex (GO:0030529)	GABA receptor binding (GO:0050811)|RNA binding (GO:0003723)	p.R137C(2)		NS(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						GCCTCCTCGCGCGCCTCGGTC	0.701																																					p.R137C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C409T	4						.						15.0	14.0	15.0					4																	6107415		2198	4290	6488	6158316	SO:0001583	missense	152789	exon3			AK056126	CCDS3385.1, CCDS47005.1	4p16.1	2013-10-11	2009-08-13		ENSG00000152969	ENSG00000152969			26460	protein-coding gene	gene with protein product		611195				18941173	Standard	NM_144720		Approved	MARLIN1, JAMIP1, Gababrbp, FLJ31564	uc010idb.1	Q96N16	OTTHUMG00000125491	ENST00000282924.5:c.409C>T	4.37:g.6107415G>A	ENSP00000282924:p.Arg137Cys	Somatic		Unspecified	Illumina	Phase_I	6158316	NM_144720	A6H2J2|A6H2J3|A6H2J4|A6H2J5|A8MTK6|B4DHZ8|B8ZZR7|D3DVT0|Q86Y69|Q8N7G3	Missense_Mutation	SNP	ENST00000282924.5	37	CCDS3385.1	.	.	.	.	.	.	.	.	.	.	G	19.85	3.903758	0.72754	.	.	ENSG00000152969	ENST00000409021;ENST00000418227;ENST00000425341;ENST00000282924;ENST00000409831	T;T;T	0.46451	0.87;0.87;0.87	4.6	3.76	0.43208	.	0.084761	0.46145	D	0.000307	T	0.54367	0.1854	M	0.72894	2.215	0.80722	D	1	B;B;D	0.89917	0.098;0.027;1.0	B;B;P	0.61003	0.016;0.005;0.882	T	0.56378	-0.7989	10	0.87932	D	0	.	6.2909	0.21059	0.0936:0.0:0.6176:0.2887	.	137;137;137	F2Z2K5;Q96N16-2;Q96N16	.;.;JKIP1_HUMAN	C	137	ENSP00000386711:R137C;ENSP00000282924:R137C;ENSP00000386925:R137C	ENSP00000282924:R137C	R	-	1	0	JAKMIP1	6158316	0.997000	0.39634	0.986000	0.45419	0.852000	0.48524	3.343000	0.52167	1.051000	0.40369	0.484000	0.47621	CGC		JAKMIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246816.2	NM_144720	
ADAM29	11086	broad.mit.edu	37	4	175897509	175897509	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3999-01	TCGA-AG-3999-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr4:175897509C>T	ENST00000359240.3	+	5	1503	c.833C>T	c.(832-834)aCg>aTg	p.T278M	ADAM29_ENST00000404450.4_Missense_Mutation_p.T278M|ADAM29_ENST00000514159.1_Missense_Mutation_p.T278M|ADAM29_ENST00000445694.1_Missense_Mutation_p.T278M|RP13-577H12.2_ENST00000507525.1_RNA	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	278	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.T278M(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		GAGAACATTACGCCCCGGATG	0.428																																					p.T278M	Ovarian(140;1727 1835 21805 25838 41440)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C833T	4						.						145.0	138.0	140.0					4																	175897509		2203	4300	6503	176134084	SO:0001583	missense	11086	exon3			AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.833C>T	4.37:g.175897509C>T	ENSP00000352177:p.Thr278Met	Somatic		Unspecified	Illumina	Phase_I	176134084	NM_001130705	Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Missense_Mutation	SNP	ENST00000359240.3	37	CCDS3823.1	.	.	.	.	.	.	.	.	.	.	C	10.46	1.355578	0.24598	.	.	ENSG00000168594	ENST00000359240;ENST00000445694;ENST00000404450;ENST00000514159	T;T;T;T	0.09630	2.96;2.96;2.96;2.96	4.13	-8.26	0.01021	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	6.208930	0.00695	U	0.000753	T	0.08935	0.0221	N	0.25647	0.755	0.09310	N	1	P	0.50710	0.938	P	0.49192	0.602	T	0.35051	-0.9804	9	.	.	.	.	2.0652	0.03601	0.458:0.2589:0.0881:0.1951	.	278	Q9UKF5	ADA29_HUMAN	M	278	ENSP00000352177:T278M;ENSP00000414544:T278M;ENSP00000384229:T278M;ENSP00000423517:T278M	.	T	+	2	0	ADAM29	176134084	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-8.223000	0.00023	-3.644000	0.00127	-2.445000	0.00210	ACG		ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding			
GRIA3	2892	broad.mit.edu	37	X	122598806	122598806	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3999-01	TCGA-AG-3999-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chrX:122598806G>A	ENST00000371251.1	+	13	2219	c.2167G>A	c.(2167-2169)Gcc>Acc	p.A723T	AL356213.1_ENST00000577653.1_RNA|GRIA3_ENST00000371256.5_Missense_Mutation_p.A723T|GRIA3_ENST00000542149.1_Missense_Mutation_p.A723T|GRIA3_ENST00000264357.5_Missense_Mutation_p.A723T			P42263	GRIA3_HUMAN	glutamate receptor, ionotropic, AMPA 3	723					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)	p.A723T(2)		breast(2)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|pancreas(2)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	57					Lithium(DB01356)	AGACGGAGTGGCCCGAGTGCG	0.463																																					p.A723T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2167A	X						.						95.0	84.0	88.0					X																	122598806		2203	4300	6503	122426487	SO:0001583	missense	2892	exon13			U10301	CCDS14604.1, CCDS14605.1, CCDS76017.1	Xq25	2012-08-29	2012-02-03		ENSG00000125675	ENSG00000125675		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4573	protein-coding gene	gene with protein product		305915	"""glutamate receptor, ionotrophic, AMPA 3"""	GLUR3		1319477, 10644433	Standard	NM_007325		Approved	GluA3, GLURC, MRX94	uc004etr.4	P42263	OTTHUMG00000022685	ENST00000371251.1:c.2167G>A	X.37:g.122598806G>A	ENSP00000360297:p.Ala723Thr	Somatic		Unspecified	Illumina	Phase_I	122426487	NM_007325	D3DTF1|Q4VXD5|Q4VXD6|Q9HDA0|Q9HDA1|Q9HDA2|Q9P0H1	Missense_Mutation	SNP	ENST00000371251.1	37	CCDS14604.1	.	.	.	.	.	.	.	.	.	.	G	7.734	0.699833	0.15106	.	.	ENSG00000125675	ENST00000264357;ENST00000542149;ENST00000371256;ENST00000371251	T;T;T;T	0.39787	1.06;1.06;1.06;1.06	5.12	5.12	0.69794	Ionotropic glutamate receptor (2);	0.048712	0.85682	D	0.000000	T	0.37073	0.0990	L	0.39566	1.225	0.80722	D	1	P;P	0.40000	0.698;0.649	B;B	0.38683	0.279;0.183	T	0.13953	-1.0490	10	0.31617	T	0.26	.	16.5308	0.84357	0.0:0.0:1.0:0.0	.	723;723	P42263;P42263-2	GRIA3_HUMAN;.	T	723	ENSP00000264357:A723T;ENSP00000446146:A723T;ENSP00000360302:A723T;ENSP00000360297:A723T	ENSP00000264357:A723T	A	+	1	0	GRIA3	122426487	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.291000	0.65667	2.104000	0.64026	0.415000	0.27848	GCC		GRIA3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058854.1	NM_000828	
CSF2RA	1438	broad.mit.edu	37	X	1407724	1407724	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3999-01	TCGA-AG-3999-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chrX:1407724C>T	ENST00000381524.3	+	6	602	c.416C>T	c.(415-417)gCg>gTg	p.A139V	BX649553.3_ENST00000581137.1_RNA|CSF2RA_ENST00000501036.2_Missense_Mutation_p.A6V|CSF2RA_ENST00000361536.3_Missense_Mutation_p.A139V|CSF2RA_ENST00000355805.2_Missense_Mutation_p.A139V|CSF2RA_ENST00000381500.1_Missense_Mutation_p.A139V|CSF2RA_ENST00000355432.3_Missense_Mutation_p.A139V|CSF2RA_ENST00000417535.2_Missense_Mutation_p.A139V|CSF2RA_ENST00000494969.2_Intron|CSF2RA_ENST00000381509.3_Missense_Mutation_p.A139V|CSF2RA_ENST00000432318.2_Missense_Mutation_p.A139V|CSF2RA_ENST00000381529.3_Missense_Mutation_p.A139V			P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)	139					response to ethanol (GO:0045471)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)	p.A139V(2)		central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(6)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	45		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	TGTACCTGGGCGAGGGGTCCG	0.458																																					p.A139V	Esophageal Squamous(131;723 1707 25334 40494 41806)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C416T	X						.						135.0	145.0	142.0					X																	1407724		2203	4296	6499	1367724	SO:0001583	missense	1438	exon6			M64445	CCDS35190.1, CCDS35191.1, CCDS35192.1, CCDS35193.1, CCDS55359.1, CCDS55360.1, CCDS55361.1	Xp22.32 and Yp11.3	2014-09-17			ENSG00000198223	ENSG00000198223		"""CD molecules"", ""Pseudoautosomal regions / PAR1"""	2435	protein-coding gene	gene with protein product		306250, 425000		CSF2R		1702217	Standard	NM_006140		Approved	CD116	uc010ncv.2	P15509	OTTHUMG00000012533	ENST00000381524.3:c.416C>T	X.37:g.1407724C>T	ENSP00000370935:p.Ala139Val	Somatic		Unspecified	Illumina	Phase_I	1367724	NM_172245	A7J003|A8KAM1|B4DW68|J3JS76|J3JS77|O00207|Q14429|Q14430|Q14431|Q16564	Missense_Mutation	SNP	ENST00000381524.3	37	CCDS35191.1	.	.	.	.	.	.	.	.	.	.	.	12.62	1.993658	0.35131	.	.	ENSG00000198223	ENST00000381529;ENST00000432318;ENST00000361536;ENST00000381507;ENST00000501036;ENST00000381524;ENST00000412290;ENST00000419094;ENST00000381509;ENST00000355805;ENST00000355432;ENST00000417535;ENST00000381500	D;D;T;D;D;T;T;D;T;T;D;T	0.96073	-3.9;-3.9;0.48;-3.65;-3.9;0.48;0.48;-3.9;0.48;0.48;-3.9;0.48	2.02	1.01	0.19927	Interleukin-6 receptor alpha chain, binding (1);Fibronectin, type III (1);Short hematopoietin receptor, family 2, conserved site (1);Immunoglobulin-like fold (1);	0.749927	0.10657	U	0.649132	D	0.95872	0.8656	.	.	.	0.09310	N	1	D;D;D;D;D;D	0.76494	0.998;0.999;0.996;0.999;0.995;0.998	P;D;P;P;P;P	0.67725	0.862;0.953;0.806;0.895;0.748;0.878	D	0.87842	0.2652	9	0.31617	T	0.26	.	5.887	0.18886	0.0:0.67:0.33:0.0	.	139;139;139;139;139;139	P15509-2;A7J003;P15509-3;P15509-6;P15509-5;P15509	.;.;.;.;.;CSF2R_HUMAN	V	139;139;139;139;6;139;139;139;139;139;139;139;139	ENSP00000370940:A139V;ENSP00000416437:A139V;ENSP00000354836:A139V;ENSP00000440491:A6V;ENSP00000370935:A139V;ENSP00000410667:A139V;ENSP00000397452:A139V;ENSP00000370920:A139V;ENSP00000348058:A139V;ENSP00000347606:A139V;ENSP00000394227:A139V;ENSP00000370911:A139V	ENSP00000347606:A139V	A	+	2	0	CSF2RA	1367724	0.483000	0.25956	0.002000	0.10522	0.077000	0.17291	0.417000	0.21214	0.104000	0.17725	0.280000	0.19369	GCG		CSF2RA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000035013.2		
SYTL5	94122	broad.mit.edu	37	X	37931343	37931343	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3999-01	TCGA-AG-3999-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chrX:37931343G>A	ENST00000357972.5	+	4	919	c.373G>A	c.(373-375)Gca>Aca	p.A125T	SYTL5_ENST00000456733.2_Missense_Mutation_p.A125T|SYTL5_ENST00000297875.2_Missense_Mutation_p.A125T|TM4SF2_ENST00000465127.1_Intron			Q8TDW5	SYTL5_HUMAN	synaptotagmin-like 5	125					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)	membrane (GO:0016020)	metal ion binding (GO:0046872)	p.A125T(1)		central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(23)|prostate(1)|skin(2)|urinary_tract(1)	44						TGAAGAAAAGGCAAAACGTTT	0.373																																					p.A125T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G373A	X						.						184.0	159.0	167.0					X																	37931343		2202	4300	6502	37816287	SO:0001583	missense	94122	exon4				CCDS14244.1, CCDS55399.1	Xp21.1	2008-02-05			ENSG00000147041	ENSG00000147041			15589	protein-coding gene	gene with protein product	"""exophilin 9"""						Standard	NM_138780		Approved		uc004ddx.3	Q8TDW5	OTTHUMG00000033176	ENST00000357972.5:c.373G>A	X.37:g.37931343G>A	ENSP00000350657:p.Ala125Thr	Somatic		Unspecified	Illumina	Phase_I	37816287	NM_138780	A2RRF2	Missense_Mutation	SNP	ENST00000357972.5	37	CCDS14244.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.962655	0.74016	.	.	ENSG00000147041	ENST00000297875;ENST00000357972;ENST00000456733	T;T;T	0.76448	-1.02;-1.02;-1.02	5.33	5.33	0.75918	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.115754	0.64402	D	0.000015	T	0.76435	0.3987	M	0.66939	2.045	0.29544	N	0.851873	D;P	0.54397	0.966;0.81	B;B	0.43950	0.437;0.146	T	0.76558	-0.2915	10	0.41790	T	0.15	-22.3867	12.5795	0.56383	0.0:0.0:0.8334:0.1666	.	125;125	A2RRF2;Q8TDW5	.;SYTL5_HUMAN	T	125	ENSP00000297875:A125T;ENSP00000350657:A125T;ENSP00000395220:A125T	ENSP00000297875:A125T	A	+	1	0	SYTL5	37816287	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.321000	0.51999	2.354000	0.79902	0.513000	0.50165	GCA		SYTL5-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080883.1	NM_138780	
RBM10	8241	broad.mit.edu	37	X	47028790	47028790	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3999-01	TCGA-AG-3999-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chrX:47028790C>T	ENST00000377604.3	+	3	836	c.94C>T	c.(94-96)Cga>Tga	p.R32*	RBM10_ENST00000329236.7_Nonsense_Mutation_p.R32*|RBM10_ENST00000345781.6_Nonsense_Mutation_p.R32*	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10	32					3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)	p.R32*(2)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						GAACCGCAGCCGAGACCACGA	0.592																																					p.R32X	Melanoma(171;120 2705 19495 39241)											.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C94T	X						.						98.0	67.0	78.0					X																	47028790		2203	4300	6503	46913734	SO:0001587	stop_gained	8241	exon3			U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.94C>T	X.37:g.47028790C>T	ENSP00000366829:p.Arg32*	Somatic		Unspecified	Illumina	Phase_I	46913734	NM_005676	C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	Nonsense_Mutation	SNP	ENST00000377604.3	37	CCDS14274.1	.	.	.	.	.	.	.	.	.	.	C	39	7.573321	0.98368	.	.	ENSG00000182872	ENST00000377604;ENST00000329236;ENST00000345781	.	.	.	4.62	2.79	0.32731	.	0.000000	0.41938	D	0.000797	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.8986	9.4105	0.38489	0.3851:0.6149:0.0:0.0	.	.	.	.	X	32	.	ENSP00000328848:R32X	R	+	1	2	RBM10	46913734	1.000000	0.71417	0.983000	0.44433	0.991000	0.79684	1.426000	0.34870	0.324000	0.23333	0.436000	0.28706	CGA		RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056381.1	NM_005676	
CACNA1F	778	broad.mit.edu	37	X	49086834	49086834	+	Splice_Site	SNP	C	C	A			TCGA-AG-3999-01	TCGA-AG-3999-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chrX:49086834C>A	ENST00000376265.2	-	6	726	c.665G>T	c.(664-666)aGc>aTc	p.S222I	CACNA1F_ENST00000323022.5_Splice_Site_p.S222I|CACNA1F_ENST00000376251.1_Splice_Site_p.S157I	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	222					axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.S222I(1)		autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	TATGTGCAGGCCTGCGGGGAG	0.607																																					p.S222I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G665T	X						.						40.0	34.0	36.0					X																	49086834		2203	4300	6503	48973778	SO:0001630	splice_region_variant	778	exon6			AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.665-1G>T	X.37:g.49086834C>A		Somatic		Unspecified	Illumina	Phase_I	48973778	NM_005183	A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Missense_Mutation	SNP	ENST00000376265.2	37	CCDS35253.1	.	.	.	.	.	.	.	.	.	.	C	17.59	3.428288	0.62844	.	.	ENSG00000102001	ENST00000376251;ENST00000323022;ENST00000376265	D;D;D	0.98732	-5.1;-5.1;-5.1	4.2	4.2	0.49525	Ion transport (1);	0.041854	0.85682	D	0.000000	D	0.99336	0.9767	H	0.94620	3.56	0.58432	D	0.999991	D;D	0.76494	0.999;0.999	D;D	0.87578	0.996;0.998	D	0.98664	1.0685	10	0.87932	D	0	.	14.9323	0.70926	0.0:1.0:0.0:0.0	.	222;222	F5CIQ9;O60840	.;CAC1F_HUMAN	I	157;222;222	ENSP00000365427:S157I;ENSP00000321618:S222I;ENSP00000365441:S222I	ENSP00000321618:S222I	S	-	2	0	CACNA1F	48973778	1.000000	0.71417	0.997000	0.53966	0.650000	0.38633	5.847000	0.69451	1.843000	0.53566	0.287000	0.19450	AGC		CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358157.1	NM_005183	Missense_Mutation
AKAP4	8852	broad.mit.edu	37	X	49958478	49958478	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3999-01	TCGA-AG-3999-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chrX:49958478C>A	ENST00000376056.2	-	5	1009	c.859G>T	c.(859-861)Ggt>Tgt	p.G287C	AKAP4_ENST00000376058.2_Intron|AKAP4_ENST00000358526.2_Missense_Mutation_p.G296C|AKAP4_ENST00000481402.1_5'UTR|AKAP4_ENST00000376064.3_Missense_Mutation_p.G287C					A kinase (PRKA) anchor protein 4									p.G296C(1)		NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(6)|lung(14)|ovary(1)|skin(4)	41	Ovarian(276;0.236)					TTCTGGCCACCTTCCCTGGAC	0.478																																					p.G296C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G886T	X						.						52.0	47.0	49.0					X																	49958478		2203	4300	6503	49845218	SO:0001583	missense	8852	exon5			AF072756	CCDS14329.1, CCDS14330.1	Xp11.2	2009-03-12			ENSG00000147081	ENSG00000147081		"""A-kinase anchor proteins"""	374	protein-coding gene	gene with protein product	"""A-kinase anchor protein 82 kDa"", ""testis-specific gene HI"", ""protein kinase A anchoring protein 4"", ""cancer/testis antigen 99"""	300185				9822690, 9514854	Standard	NM_003886		Approved	p82, hAKAP82, AKAP82, Fsc1, HI, CT99	uc004dow.1	Q5JQC9	OTTHUMG00000021517	ENST00000376056.2:c.859G>T	X.37:g.49958478C>A	ENSP00000365224:p.Gly287Cys	Somatic		Unspecified	Illumina	Phase_I	49845218	NM_003886		Missense_Mutation	SNP	ENST00000376056.2	37	CCDS14330.1	.	.	.	.	.	.	.	.	.	.	C	5.376	0.254632	0.10185	.	.	ENSG00000147081	ENST00000376056;ENST00000358526;ENST00000376064	T;T;T	0.09163	3.01;3.01;3.01	3.53	2.62	0.31277	A-kinase anchor 110kDa, C-terminal (1);	0.452338	0.16021	U	0.233310	T	0.10937	0.0267	L	0.54323	1.7	0.44807	D	0.997815	B	0.23735	0.09	B	0.26693	0.072	T	0.08066	-1.0740	9	.	.	.	-3.8587	7.7821	0.29070	0.2499:0.7501:0.0:0.0	.	296	Q5JQC9	AKAP4_HUMAN	C	287;296;287	ENSP00000365224:G287C;ENSP00000351327:G296C;ENSP00000365232:G287C	.	G	-	1	0	AKAP4	49845218	0.078000	0.21339	0.420000	0.26596	0.017000	0.09413	0.298000	0.19120	0.567000	0.29293	0.277000	0.19347	GGT		AKAP4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056552.1	NM_003886	
SLC25A14	9016	broad.mit.edu	37	X	129506897	129506897	+	Silent	SNP	C	C	T			TCGA-AG-3999-01	TCGA-AG-3999-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chrX:129506897C>T	ENST00000218197.5	+	10	1178	c.951C>T	c.(949-951)taC>taT	p.Y317Y	SLC25A14_ENST00000361980.5_Silent_p.Y314Y|SLC25A14_ENST00000339231.3_Silent_p.Y345Y	NM_001282195.1|NM_001282196.1|NM_001282198.1	NP_001269124.1|NP_001269125.1|NP_001269127.1	O95258	UCP5_HUMAN	solute carrier family 25 (mitochondrial carrier, brain), member 14	317					aerobic respiration (GO:0009060)|mitochondrial transport (GO:0006839)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)		p.Y317Y(2)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)	22						TTATTACATACGAGCAGCTAA	0.393																																					p.Y317Y												.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.C951T	X						.						226.0	221.0	222.0					X																	129506897		2203	4300	6503	129334578	SO:0001819	synonymous_variant	9016	exon10			AF078544	CCDS14623.1, CCDS14624.1, CCDS76020.1, CCDS76021.1	Xq24	2013-05-22			ENSG00000102078	ENSG00000102078		"""Solute carriers"""	10984	protein-coding gene	gene with protein product		300242				9852133	Standard	XM_005262485		Approved	BMCP1, UCP5	uc004evp.1	O95258	OTTHUMG00000022394	ENST00000218197.5:c.951C>T	X.37:g.129506897C>T		Somatic		Unspecified	Illumina	Phase_I	129334578	NM_003951	D3DTG2|Q0VDH7|Q9HC60|Q9HC61	Silent	SNP	ENST00000218197.5	37	CCDS14623.1																																																																																				SLC25A14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058253.1	NM_022810, NM_003951	
TP53I3	9540	broad.mit.edu	37	2	24303706	24303706	+	Missense_Mutation	SNP	G	G	A	rs148103343	byFrequency	TCGA-AG-3999-01	TCGA-AG-3999-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr2:24303706G>A	ENST00000238721.4	-	3	1456	c.602C>T	c.(601-603)aCg>aTg	p.T201M	FAM228B_ENST00000461972.1_Intron|TP53I3_ENST00000417886.1_5'UTR|TP53I3_ENST00000335934.4_Missense_Mutation_p.T201M|TP53I3_ENST00000313482.4_Missense_Mutation_p.T201M|TP53I3_ENST00000407482.1_Missense_Mutation_p.T201M	NM_004881.4	NP_004872.2	Q53FA7	QORX_HUMAN	tumor protein p53 inducible protein 3	201					NADP metabolic process (GO:0006739)	extracellular vesicular exosome (GO:0070062)	NADPH binding (GO:0070402)|NADPH:quinone reductase activity (GO:0003960)|protein homodimerization activity (GO:0042803)|quinone binding (GO:0048038)|zinc ion binding (GO:0008270)	p.T201M(1)		endometrium(1)|kidney(4)|large_intestine(2)|lung(3)|urinary_tract(2)	12	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAATTTCAGCGTTGCTTCAGA	0.438													G|||	2	0.000399361	0.0008	0.0	5008	,	,		18159	0.0		0.001	False		,,,				2504	0.0				p.T201M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C602T	2						.	G	MET/THR,MET/THR,MET/THR	2,4404	4.2+/-10.8	0,2,2201	179.0	190.0	186.0		602,602,602	1.9	0.0	2	dbSNP_134	186	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense,missense	TP53I3	NM_001206802.2,NM_004881.4,NM_147184.3	81,81,81	0,4,6499	AA,AG,GG		0.0233,0.0454,0.0308	possibly-damaging,possibly-damaging,possibly-damaging	201/249,201/333,201/333	24303706	4,13002	2203	4300	6503	24157210	SO:0001583	missense	9540	exon4			AF010309	CCDS1708.1, CCDS56112.1	2p23.3	2009-06-12			ENSG00000115129	ENSG00000115129			19373	protein-coding gene	gene with protein product		605171				11919562, 10840161, 19349281	Standard	NM_004881		Approved	PIG3	uc002rez.2	Q53FA7	OTTHUMG00000090817	ENST00000238721.4:c.602C>T	2.37:g.24303706G>A	ENSP00000238721:p.Thr201Met	Somatic		Unspecified	Illumina	Phase_I	24157210	NM_147184	D6W533|O14679|O14685|Q38G78|Q6JLE7|Q9BWB8	Missense_Mutation	SNP	ENST00000238721.4	37	CCDS1708.1	2	9.157509157509158E-4	1	0.0020325203252032522	0	0.0	0	0.0	1	0.0013192612137203166	G	15.19	2.760699	0.49468	4.54E-4	2.33E-4	ENSG00000115129	ENST00000335934;ENST00000238721;ENST00000313482;ENST00000407482;ENST00000413037	T;T;T;T;T	0.04015	3.73;3.73;3.73;3.73;3.73	5.2	1.91	0.25777	Alcohol dehydrogenase, C-terminal (1);NAD(P)-binding domain (1);	0.772058	0.12394	N	0.472795	T	0.05044	0.0135	N	0.12569	0.235	0.09310	N	1	D;D;D	0.76494	0.997;0.986;0.999	P;B;P	0.55345	0.774;0.419;0.749	T	0.38929	-0.9638	10	0.56958	D	0.05	-24.7596	3.3863	0.07273	0.395:0.2007:0.4043:0.0	.	112;201;201	B4DMQ7;Q53FA7;Q53FA7-2	.;QORX_HUMAN;.	M	201;201;201;201;196	ENSP00000337834:T201M;ENSP00000238721:T201M;ENSP00000322298:T201M;ENSP00000384414:T201M;ENSP00000389620:T196M	ENSP00000238721:T201M	T	-	2	0	TP53I3	24157210	0.075000	0.21258	0.029000	0.17559	0.969000	0.65631	1.479000	0.35453	0.702000	0.31825	0.561000	0.74099	ACG		TP53I3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207618.2	NM_004881	
PUS10	150962	broad.mit.edu	37	2	61192599	61192599	+	Silent	SNP	C	C	T			TCGA-AG-3999-01	TCGA-AG-3999-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr2:61192599C>T	ENST00000316752.6	-	7	897	c.636G>A	c.(634-636)gtG>gtA	p.V212V	PUS10_ENST00000407787.1_Silent_p.V212V	NM_144709.2	NP_653310.2	Q3MIT2	PUS10_HUMAN	pseudouridylate synthase 10	212					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)	p.V212V(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)	22			LUSC - Lung squamous cell carcinoma(5;1.56e-06)|Lung(5;2.48e-05)|Epithelial(17;0.113)			GAGCAAAGACCACACTCACTT	0.328																																					p.V212V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G636A	2						.						137.0	134.0	135.0					2																	61192599		2203	4299	6502	61046103	SO:0001819	synonymous_variant	150962	exon7			AK056874	CCDS1865.1	2p16.1	2008-02-05	2008-01-09	2008-01-09	ENSG00000162927	ENSG00000162927			26505	protein-coding gene	gene with protein product		612787	"""coiled-coil domain containing 139"""	CCDC139		17900615	Standard	NM_144709		Approved	FLJ32312	uc002sao.3	Q3MIT2	OTTHUMG00000129423	ENST00000316752.6:c.636G>A	2.37:g.61192599C>T		Somatic		Unspecified	Illumina	Phase_I	61046103	NM_144709	Q5JPJ5|Q96MI8	Silent	SNP	ENST00000316752.6	37	CCDS1865.1																																																																																				PUS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251582.2	NM_144709	
ADRA2B	151	broad.mit.edu	37	2	96780998	96780999	+	Missense_Mutation	DNP	AG	AG	CT			TCGA-AG-3999-01	TCGA-AG-3999-01							Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr2:96780998_96780999AG>CT	ENST00000409345.3	-	1	985_986	c.890_891CT>AG	c.(889-891)gCT>gAG	p.A297E		NM_000682.5	NP_000673	P18089	ADA2B_HUMAN	adrenoceptor alpha 2B	297	Asp/Glu-rich (acidic).				activation of MAPK activity by adrenergic receptor signaling pathway (GO:0071883)|activation of protein kinase B activity (GO:0032148)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|MAPK cascade (GO:0000165)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of norepinephrine secretion (GO:0010700)|platelet activation (GO:0030168)|positive regulation of blood pressure (GO:0045777)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of vascular smooth muscle contraction (GO:0003056)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha2-adrenergic receptor activity (GO:0004938)|epinephrine binding (GO:0051379)	p.A297>?(1)		endometrium(2)|large_intestine(2)|lung(9)|ovary(3)	16					Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Apraclonidine(DB00964)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bethanidine(DB00217)|Brimonidine(DB00484)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Clozapine(DB00363)|Desipramine(DB01151)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Etomidate(DB00292)|Fenoldopam(DB00800)|Guanabenz(DB00629)|Guanfacine(DB01018)|Lisuride(DB00589)|Loxapine(DB00408)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methamphetamine(DB01577)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxymetazoline(DB00935)|Paliperidone(DB01267)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Pramipexole(DB00413)|Prazosin(DB00457)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Tizanidine(DB00697)|Tolazoline(DB00797)|Trimipramine(DB00726)|Xylometazoline(DB06694)|Yohimbine(DB01392)|Ziprasidone(DB00246)	cctcctcttcAGCTTCATCCTC	0.649																																					.												.	.	1	Complex(1)	large_intestine(1)	c.890_891AG	2						.																																			96144726	SO:0001583	missense	151	exon1			M34041	CCDS56129.1	2q11.1	2014-05-06	2012-05-09		ENSG00000222040	ENSG00000274286		"""GPCR / Class A : Adrenoceptors : alpha"""	282	protein-coding gene	gene with protein product		104260	"""adrenergic, alpha-2B-, receptor"""	ADRA2L1, ADRA2RL1		2164221	Standard	NM_000682		Approved	ADRARL1	uc021vlh.1	P18089	OTTHUMG00000188276	ENST00000409345.3:c.890_891delinsCT	2.37:g.96780998_96780999delinsCT	ENSP00000387281:p.Ala297Glu	Somatic		Unspecified	Illumina	Phase_I	96144725	NM_000682	Q4TUH9|Q53RF2|Q9BZK0	Missense_Mutation	DNP	ENST00000409345.3	37	CCDS56129.1																																																																																				ADRA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334990.1		
TMEM131	23505	broad.mit.edu	37	2	98392321	98392321	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3999-01	TCGA-AG-3999-01	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr2:98392321T>G	ENST00000186436.5	-	32	4533	c.4305A>C	c.(4303-4305)gaA>gaC	p.E1435D		NM_015348.1	NP_056163.1	Q92545	TM131_HUMAN	transmembrane protein 131	1435	Lys-rich.					integral component of membrane (GO:0016021)		p.E1435D(1)|p.E1322D(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(4)|prostate(1)|skin(1)|stomach(1)	57						TGAGGAGCGGTTCTGTGTCAG	0.517																																					p.E1435D												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A4305C	2						.						152.0	159.0	157.0					2																	98392321		2026	4195	6221	97758753	SO:0001583	missense	23505	exon32			AK025852	CCDS46368.1	2q11.2	2006-04-12			ENSG00000075568	ENSG00000075568			30366	protein-coding gene	gene with protein product		615659				9039502, 10996388	Standard	NM_015348		Approved	CC28, YR-23, RW1, KIAA0257, PRO1048	uc002syh.4	Q92545	OTTHUMG00000153061	ENST00000186436.5:c.4305A>C	2.37:g.98392321T>G	ENSP00000186436:p.Glu1435Asp	Somatic		Unspecified	Illumina	Phase_I	97758753	NM_015348		Missense_Mutation	SNP	ENST00000186436.5	37	CCDS46368.1	.	.	.	.	.	.	.	.	.	.	T	16.91	3.252036	0.59212	.	.	ENSG00000075568	ENST00000186436	T	0.20598	2.06	5.22	-5.06	0.02946	.	0.000000	0.85682	D	0.000000	T	0.18215	0.0437	M	0.63843	1.955	0.80722	D	1	B	0.13145	0.007	B	0.09377	0.004	T	0.01566	-1.1323	10	0.66056	D	0.02	-5.9685	11.1774	0.48607	0.0:0.3265:0.0837:0.5897	.	1435	Q92545	TM131_HUMAN	D	1435	ENSP00000186436:E1435D	ENSP00000186436:E1435D	E	-	3	2	TMEM131	97758753	0.014000	0.17966	0.361000	0.25849	0.869000	0.49853	-1.058000	0.03482	-1.437000	0.01967	-1.139000	0.01908	GAA		TMEM131-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329285.2	XM_371542	
ABCA12	26154	broad.mit.edu	37	2	215884152	215884152	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3999-01	TCGA-AG-3999-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr2:215884152T>C	ENST00000272895.7	-	13	1784	c.1565A>G	c.(1564-1566)cAa>cGa	p.Q522R	AC072062.3_ENST00000437897.3_RNA|ABCA12_ENST00000389661.4_Missense_Mutation_p.Q204R	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	522					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)	p.Q522R(1)		NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		GTAATTCATTTGCAGTGCCTG	0.363																																					p.Q522R	Ovarian(66;664 1488 5121 34295)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1565G	2						.						94.0	92.0	93.0					2																	215884152		2202	4300	6502	215592397	SO:0001583	missense	26154	exon13			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.1565A>G	2.37:g.215884152T>C	ENSP00000272895:p.Gln522Arg	Somatic		Unspecified	Illumina	Phase_I	215592397	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	T	13.28	2.191369	0.38707	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	T;T	0.56275	0.47;0.47	5.93	5.93	0.95920	.	0.097486	0.46758	N	0.000277	T	0.38161	0.1030	N	0.24115	0.695	0.80722	D	1	P;B	0.37612	0.602;0.387	B;B	0.30782	0.088;0.12	T	0.40813	-0.9543	10	0.66056	D	0.02	.	14.6064	0.68481	0.0:0.0:0.0:1.0	.	522;204	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	R	522;204	ENSP00000272895:Q522R;ENSP00000374312:Q204R	ENSP00000272895:Q522R	Q	-	2	0	ABCA12	215592397	1.000000	0.71417	1.000000	0.80357	0.714000	0.41099	4.860000	0.62961	2.263000	0.75096	0.533000	0.62120	CAA		ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
AKAP2	11217	broad.mit.edu	37	9	112899307	112899307	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3999-01	TCGA-AG-3999-01	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr9:112899307A>C	ENST00000259318.7	+	2	997	c.790A>C	c.(790-792)Aag>Cag	p.K264Q	AKAP2_ENST00000434623.2_Missense_Mutation_p.K353Q|PALM2-AKAP2_ENST00000374530.3_Missense_Mutation_p.K495Q|AKAP2_ENST00000555236.1_Missense_Mutation_p.K495Q|PALM2-AKAP2_ENST00000302798.7_Missense_Mutation_p.K495Q|AKAP2_ENST00000510514.5_Missense_Mutation_p.K495Q|AKAP2_ENST00000374525.1_Missense_Mutation_p.K353Q	NM_001136562.2	NP_001130034.1	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2	264								p.K353Q(1)|p.K495Q(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	33						GTCGCACAAAAAGTACAAGGA	0.547																																					p.K495Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A1483C	9						.						32.0	35.0	34.0					9																	112899307		2203	4300	6503	111939128	SO:0001583	missense	445815	exon8			AB023137	CCDS43861.1, CCDS48003.1, CCDS56581.1	9q31.3	2009-10-16			ENSG00000241978	ENSG00000241978		"""A-kinase anchor proteins"""	372	protein-coding gene	gene with protein product	"""protein kinase A2"""	604582		PRKA2		10231032	Standard	NM_001136562		Approved	AKAP-KL, KIAA0920, DKFZp564L0716		Q9Y2D5	OTTHUMG00000156811	ENST00000259318.7:c.790A>C	9.37:g.112899307A>C	ENSP00000259318:p.Lys264Gln	Somatic		Unspecified	Illumina	Phase_I	111939128	NM_147150	B1ALX9|B2RTU4|B3KQ00|B4DTZ2|B7ZW07|B9EJB5|Q9UG26	Missense_Mutation	SNP	ENST00000259318.7	37	CCDS48003.1	.	.	.	.	.	.	.	.	.	.	A	18.45	3.627178	0.66901	.	.	ENSG00000157654;ENSG00000157654;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978	ENST00000374530;ENST00000302798;ENST00000555236;ENST00000510514;ENST00000434623;ENST00000374525;ENST00000480388;ENST00000259318	T;T;T;T;T;T;T;T	0.54675	0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56	5.72	5.72	0.89469	.	0.047880	0.85682	D	0.000000	T	0.65502	0.2697	M	0.70275	2.135	0.49389	D	0.999783	P;D;P;D;D;P;P;P	0.57257	0.912;0.979;0.883;0.979;0.964;0.934;0.934;0.891	P;P;B;P;P;P;B;B	0.54140	0.535;0.743;0.36;0.743;0.558;0.559;0.44;0.356	T	0.70070	-0.4973	10	0.72032	D	0.01	-30.112	15.2015	0.73142	1.0:0.0:0.0:0.0	.	264;353;347;353;354;495;495;313	Q9Y2D5;Q9Y2D5-7;B4E2K2;Q9Y2D5-5;B1ALY1;Q9Y2D5-6;Q9Y2D5-4;C9JVY5	AKAP2_HUMAN;.;.;.;.;.;.;.	Q	495;495;495;495;353;353;313;264	ENSP00000363654:K495Q;ENSP00000305861:K495Q;ENSP00000451476:K495Q;ENSP00000421522:K495Q;ENSP00000404782:K353Q;ENSP00000363649:K353Q;ENSP00000419268:K313Q;ENSP00000259318:K264Q	ENSP00000259318:K264Q	K	+	1	0	PALM2-AKAP2;AKAP2	111939128	1.000000	0.71417	0.985000	0.45067	0.992000	0.81027	4.721000	0.61951	2.174000	0.68829	0.533000	0.62120	AAG		AKAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346067.3	NM_001004065	
Unknown	0	broad.mit.edu	37	9	14816	14816	+	IGR	SNP	C	C	G	rs200377821	byFrequency	TCGA-AG-3999-01	TCGA-AG-3999-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr9:14816C>G								None (None upstream) : MIR1302-2 (12840 downstream)																							CCTACGATTCCCAGTCGTCCT	0.642													.|||	136	0.0271565	0.0023	0.1095	5008	,	,		25373	0.0		0.0378	False		,,,				2504	0.0194				p.W463C												.	.	0			c.G1389C	9						.	C	CYS/TRP	28,2736		1,26,1355	7.0	10.0	9.0		1389	1.2	1.0	9		9	373,6917		20,333,3292	no	missense	WASH1	NM_182905.4	215	21,359,4647	GG,GC,CC		5.1166,1.013,3.9885	probably-damaging	463/466	14816	401,9653	1382	3645	5027	4816	SO:0001628	intergenic_variant	375690	exon11																															9.37:g.14816C>G		Somatic		Unspecified	Illumina	Phase_I	4816	NM_182905		Missense_Mutation	SNP		37																																																																																				0								
CHMP5	51510	broad.mit.edu	37	9	33264430	33264430	+	5'Flank	SNP	G	G	A	rs140687411	byFrequency	TCGA-AG-3999-01	TCGA-AG-3999-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr9:33264430G>A	ENST00000223500.8	+	0	0				BAG1_ENST00000379704.2_5'UTR|BAG1_ENST00000472232.3_Silent_p.T81T|CHMP5_ENST00000419016.2_5'Flank	NM_016410.5	NP_057494.3	Q9NZZ3	CHMP5_HUMAN	charged multivesicular body protein 5						endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of receptor recycling (GO:0001919)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.T81T(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)	10			LUSC - Lung squamous cell carcinoma(29;0.00506)			CCTCGCTCCGGGTCGAGCGGC	0.697																																					p.T81T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C243T	9						.						37.0	37.0	37.0					9																	33264430		2203	4300	6503	33254430	SO:0001631	upstream_gene_variant	573	exon1			AF132968	CCDS6537.1, CCDS56569.1	9p13.3	2011-09-21	2011-09-21	2005-08-09	ENSG00000086065	ENSG00000086065		"""Charged multivesicular body proteins"""	26942	protein-coding gene	gene with protein product		610900	"""chromosome 9 open reading frame 83"", ""chromatin modifying protein 5"""	C9orf83, SNF7DC2		15644320, 11559748	Standard	NM_016410		Approved	HSPC177, CGI-34, Vps60	uc003zsm.4	Q9NZZ3	OTTHUMG00000019765		9.37:g.33264430G>A	Exception_encountered	Somatic		Unspecified	Illumina	Phase_I	33254430	NM_004323	B2RD95|B4DIR6|Q5VXW2|Q96AV2|Q9HB68|Q9NYS4|Q9Y323	Silent	SNP	ENST00000223500.8	37	CCDS6537.1																																																																																				CHMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052040.3	NM_016410	
HSD17B3	3293	broad.mit.edu	37	9	99015130	99015130	+	Missense_Mutation	SNP	C	C	T	rs568096279		TCGA-AG-3999-01	TCGA-AG-3999-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr9:99015130C>T	ENST00000375263.3	-	4	387	c.340G>A	c.(340-342)Gag>Aag	p.E114K	HSD17B3_ENST00000375262.2_Missense_Mutation_p.E114K|RP11-240L7.4_ENST00000448857.1_RNA|HSD17B3_ENST00000464104.1_5'Flank	NM_000197.1	NP_000188.1	P37058	DHB3_HUMAN	hydroxysteroid (17-beta) dehydrogenase 3	114					androgen biosynthetic process (GO:0006702)|male genitalia development (GO:0030539)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|testosterone biosynthetic process (GO:0061370)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	testosterone 17-beta-dehydrogenase (NADP+) activity (GO:0047045)	p.E114K(1)		breast(1)|endometrium(3)|large_intestine(2)|lung(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	13		Acute lymphoblastic leukemia(62;0.0171)|all_hematologic(171;0.214)				TTAATATGCTCGTAGATGTCA	0.363													C|||	1	0.000199681	0.0	0.0014	5008	,	,		17507	0.0		0.0	False		,,,				2504	0.0				p.E114K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G340A	9						.						187.0	188.0	187.0					9																	99015130		2203	4299	6502	98054951	SO:0001583	missense	3293	exon4				CCDS6716.1	9q22	2011-09-20			ENSG00000130948	ENSG00000130948	1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	5212	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 12C, member 2"""	605573				8075637, 19027726	Standard	NM_000197		Approved	SDR12C2	uc004awa.1	P37058	OTTHUMG00000020292	ENST00000375263.3:c.340G>A	9.37:g.99015130C>T	ENSP00000364412:p.Glu114Lys	Somatic		Unspecified	Illumina	Phase_I	98054951	NM_000197	Q5U0Q6	Missense_Mutation	SNP	ENST00000375263.3	37	CCDS6716.1	.	.	.	.	.	.	.	.	.	.	C	7.884	0.730951	0.15507	.	.	ENSG00000130948	ENST00000375263;ENST00000375262	D;D	0.87571	-2.27;-2.27	4.31	3.41	0.39046	NAD(P)-binding domain (1);	0.505671	0.21335	N	0.076230	T	0.74512	0.3726	N	0.25031	0.7	0.28164	N	0.928844	B;P	0.47409	0.139;0.895	B;B	0.40982	0.072;0.345	T	0.66093	-0.6009	10	0.20519	T	0.43	-35.9645	6.5733	0.22551	0.0:0.7928:0.0:0.2072	.	114;114	Q5U0Q6;P37058	.;DHB3_HUMAN	K	114	ENSP00000364412:E114K;ENSP00000364411:E114K	ENSP00000364411:E114K	E	-	1	0	HSD17B3	98054951	0.994000	0.37717	0.726000	0.30738	0.036000	0.12997	1.301000	0.33447	1.401000	0.46761	0.655000	0.94253	GAG		HSD17B3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053259.1	NM_000197	
NTNG2	84628	broad.mit.edu	37	9	135073643	135073643	+	Silent	SNP	C	C	T			TCGA-AG-3999-01	TCGA-AG-3999-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr9:135073643C>T	ENST00000393229.3	+	3	1280	c.504C>T	c.(502-504)gcC>gcT	p.A168A	NTNG2_ENST00000393228.4_Silent_p.A168A|NTNG2_ENST00000360670.3_Silent_p.A168A|NTNG2_ENST00000372179.3_Silent_p.A168A	NM_032536.2	NP_115925.2	Q96CW9	NTNG2_HUMAN	netrin G2	168	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)|axon (GO:0030424)		p.A168A(1)		central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	29				OV - Ovarian serous cystadenocarcinoma(145;1.23e-05)|Epithelial(140;0.000173)		AGTTCTACGCCGAGGACTGCA	0.667																																					p.A168A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C504T	9						.						43.0	34.0	37.0					9																	135073643		2202	4299	6501	134063464	SO:0001819	synonymous_variant	84628	exon3			AB058760	CCDS6946.1	9q34	2013-03-01	2003-12-02	2003-12-03	ENSG00000196358	ENSG00000196358		"""Netrins"""	14288	protein-coding gene	gene with protein product	"""Netrin-G2"""		"""netrin G1"""	NTNG1			Standard	NM_032536		Approved	KIAA1857, Lmnt2	uc004cbh.2	Q96CW9	OTTHUMG00000020835	ENST00000393229.3:c.504C>T	9.37:g.135073643C>T		Somatic		Unspecified	Illumina	Phase_I	134063464	NM_032536	Q5JUJ2|Q6UXY0|Q96JH0	Silent	SNP	ENST00000393229.3	37	CCDS6946.1																																																																																				NTNG2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054779.1	NM_032536	
SORCS3	22986	broad.mit.edu	37	10	106937890	106937890	+	Silent	SNP	C	C	T	rs372850065		TCGA-AG-3999-01	TCGA-AG-3999-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr10:106937890C>T	ENST00000369701.3	+	14	2195	c.1968C>T	c.(1966-1968)gaC>gaT	p.D656D	SORCS3_ENST00000369699.4_Intron	NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	656					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)	p.D656D(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		TCTTTGTTGACGGGGCTCTGG	0.473																																					p.D656D	NSCLC(116;1497 1690 7108 13108 14106)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1968T	10						.	C		0,4406		0,0,2203	209.0	178.0	189.0		1968	-7.2	0.1	10		189	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SORCS3	NM_014978.1		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		656/1223	106937890	1,13005	2203	4300	6503	106927880	SO:0001819	synonymous_variant	22986	exon14			AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.1968C>T	10.37:g.106937890C>T		Somatic		Unspecified	Illumina	Phase_I	106927880	NM_014978	Q5VXF9|Q9NQJ2	Silent	SNP	ENST00000369701.3	37	CCDS7558.1																																																																																				SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978	
MRC1	4360	broad.mit.edu	37	10	17875762	17875762	+	Silent	SNP	G	G	A	rs374113136	byFrequency	TCGA-AG-3999-01	TCGA-AG-3999-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr10:17875762G>A	ENST00000331429.2	+	4	829	c.726G>A	c.(724-726)caG>caA	p.Q242Q	MRC1L1_ENST00000457317.1_Silent_p.Q242Q														p.Q242Q(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						CGTGGCACCAGGCGAGGAAAA	0.468													g|||	178	0.0355431	0.0431	0.0346	5008	,	,		10278	0.0238		0.0497	False		,,,				2504	0.0235				p.Q242Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G726A	10						.						100.0	91.0	94.0					10																	17875762		1955	3878	5833	17915768	SO:0001819	synonymous_variant	4360	exon4																														ENST00000331429.2:c.726G>A	10.37:g.17875762G>A		Somatic		Unspecified	Illumina	Phase_I	17915768	NM_001009567		Silent	SNP	ENST00000331429.2	37																																																																																					MRC1L1-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047054.1		
DDX21	9188	broad.mit.edu	37	10	70725230	70725230	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3999-01	TCGA-AG-3999-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr10:70725230G>T	ENST00000354185.4	+	5	982	c.884G>T	c.(883-885)gGa>gTa	p.G295V	RN7SL373P_ENST00000577512.1_RNA	NM_001256910.1|NM_004728.3	NP_001243839.1|NP_004719.2	Q9NR30	DDX21_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 21	295	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|osteoblast differentiation (GO:0001649)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)	p.G295V(1)		breast(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	20						TTTTATGGTGGAACTCCCTAT	0.423																																					p.G295V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G884T	10						.						90.0	84.0	86.0					10																	70725230		2203	4300	6503	70395236	SO:0001583	missense	9188	exon5			U41387	CCDS31211.1, CCDS73144.1	10q21	2013-05-13	2012-02-23		ENSG00000165732	ENSG00000165732		"""DEAD-boxes"""	2744	protein-coding gene	gene with protein product		606357	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 21"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 21"""			8614622, 18180292	Standard	NM_004728		Approved	RH-II/GU, GURDB	uc001jov.2	Q9NR30	OTTHUMG00000018366	ENST00000354185.4:c.884G>T	10.37:g.70725230G>T	ENSP00000346120:p.Gly295Val	Somatic		Unspecified	Illumina	Phase_I	70395236	NM_004728	B2RDL0|Q13436|Q5VX41|Q68D35	Missense_Mutation	SNP	ENST00000354185.4	37	CCDS31211.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.036593	0.93630	.	.	ENSG00000165732	ENST00000354185	T	0.59224	0.28	5.87	5.87	0.94306	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.85906	0.5806	H	0.97465	4.01	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89718	0.3917	10	0.87932	D	0	.	20.5827	0.99408	0.0:0.0:1.0:0.0	.	295	Q9NR30	DDX21_HUMAN	V	295	ENSP00000346120:G295V	ENSP00000346120:G295V	G	+	2	0	DDX21	70395236	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	9.420000	0.97426	2.941000	0.99782	0.655000	0.94253	GGA		DDX21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048374.1	NM_004728	
AGAP11	119385	broad.mit.edu	37	10	88769651	88769651	+	RNA	SNP	G	G	A			TCGA-AG-3999-01	TCGA-AG-3999-01	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr10:88769651G>A	ENST00000444431.1	+	0	4251				RP11-96C23.14_ENST00000444180.3_RNA|RP11-96C23.5_ENST00000433214.2_RNA|RP11-96C23.10_ENST00000451760.1_RNA			Q8TF27	AGA11_HUMAN	ankyrin repeat and GTPase domain Arf GTPase activating protein 11						regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)										CTGCCCCGACGAGTGCGTGTA	0.502																																					p.E548K												.	.	0			c.G1642A	10						.						9.0	10.0	10.0					10																	88769651		2180	4252	6432	88759631			119385	exon12					10q23.2	2013-01-11			ENSG00000151303	ENSG00000151303		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	29421	protein-coding gene	gene with protein product						11853319	Standard	NM_133447		Approved	KIAA1975	uc001kee.2	Q8TF27	OTTHUMG00000018667		10.37:g.88769651G>A		Somatic		Unspecified	Illumina	Phase_I	88759631	NM_133447	B9EIP7|D3DWE4	Missense_Mutation	SNP	ENST00000444431.1	37																																																																																					AGAP11-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript	OTTHUMT00000049193.1	NM_133447	
PNLIP	5406	broad.mit.edu	37	10	118306919	118306919	+	Missense_Mutation	SNP	C	C	T	rs142749694		TCGA-AG-3999-01	TCGA-AG-3999-01	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr10:118306919C>T	ENST00000369221.2	+	3	188	c.160C>T	c.(160-162)Cgc>Tgc	p.R54C	PNLIP_ENST00000470562.1_3'UTR	NM_000936.2	NP_000927.1	P16233	LIPP_HUMAN	pancreatic lipase	54					intestinal cholesterol absorption (GO:0030299)|lipid catabolic process (GO:0016042)|lipid digestion (GO:0044241)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|triglyceride lipase activity (GO:0004806)	p.R54C(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	43				all cancers(201;0.0131)	Glycerol Phenylbutyrate(DB08909)|Orlistat(DB01083)	TGTCAACACCCGCTTCCTCCT	0.468																																					p.R54C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C160T	10						.	C	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	77.0	75.0	75.0		160	5.4	1.0	10	dbSNP_134	75	0,8600		0,0,4300	no	missense	PNLIP	NM_000936.2	180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	54/466	118306919	1,13005	2203	4300	6503	118296909	SO:0001583	missense	5406	exon3			BC014309	CCDS7594.1	10q25.3	2012-07-31			ENSG00000175535	ENSG00000175535	3.1.1.3		9155	protein-coding gene	gene with protein product		246600				1783385	Standard	NM_000936		Approved	PL	uc001lcm.3	P16233	OTTHUMG00000019103	ENST00000369221.2:c.160C>T	10.37:g.118306919C>T	ENSP00000358223:p.Arg54Cys	Somatic		Unspecified	Illumina	Phase_I	118296909	NM_000936	Q5VSQ2	Missense_Mutation	SNP	ENST00000369221.2	37	CCDS7594.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.116467	0.77323	2.27E-4	0.0	ENSG00000175535	ENST00000369221	D	0.91945	-2.94	5.36	5.36	0.76844	Lipase, N-terminal (1);	0.079288	0.53938	D	0.000049	D	0.97259	0.9104	H	0.96333	3.805	0.58432	D	0.999994	D	0.89917	1.0	D	0.83275	0.996	D	0.97868	1.0284	10	0.87932	D	0	.	14.225	0.65853	0.0:0.8496:0.1504:0.0	.	54	P16233	LIPP_HUMAN	C	54	ENSP00000358223:R54C	ENSP00000358223:R54C	R	+	1	0	PNLIP	118296909	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.998000	0.49465	2.789000	0.95967	0.591000	0.81541	CGC		PNLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050524.1	NM_000936	
APC	324	broad.mit.edu	37	5	112116523	112116523	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AG-3999-01	TCGA-AG-3999-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr5:112116523G>T	ENST00000457016.1	+	6	948	c.568G>T	c.(568-570)Gaa>Taa	p.E190*	APC_ENST00000508376.2_Nonsense_Mutation_p.E190*|APC_ENST00000257430.4_Nonsense_Mutation_p.E190*|RNU6-482P_ENST00000391068.1_RNA			P25054	APC_HUMAN	adenomatous polyposis coli	190	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.E190*(1)|p.Q188fs*2(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AAGGCAATTGGAATATGAAGC	0.343		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.E200X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	2	Substitution - Nonsense(1)|Deletion - Frameshift(1)	large_intestine(2)	c.G598T	5	GRCh37	CM990148	APC	M		.						72.0	71.0	71.0					5																	112116523		2202	4300	6502	112144422	SO:0001587	stop_gained	324	exon5	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.568G>T	5.37:g.112116523G>T	ENSP00000413133:p.Glu190*	Somatic		Unspecified	Illumina	Phase_I	112144422	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	G	37	6.315838	0.97467	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-22.1281	19.2841	0.94063	0.0:0.0:1.0:0.0	.	.	.	.	X	190;200;190;190;190	.	ENSP00000257430:E190X	E	+	1	0	APC	112144422	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	9.077000	0.94016	2.535000	0.85469	0.655000	0.94253	GAA		APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
TRIM41	90933	broad.mit.edu	37	5	180651556	180651556	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3999-01	TCGA-AG-3999-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	TCGA-AG-3999-01	TCGA-AG-3999-01	g.chr5:180651556G>A	ENST00000315073.5	+	1	1267	c.557G>A	c.(556-558)tGc>tAc	p.C186Y	TRIM41_ENST00000351937.5_Missense_Mutation_p.C186Y|CTC-338M12.7_ENST00000499096.2_RNA|MIR4638_ENST00000581158.1_RNA	NM_033549.4	NP_291027.3	Q8WV44	TRI41_HUMAN	tripartite motif containing 41	186					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.C186S(2)|p.C186Y(2)		NS(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(3)|prostate(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	26	all_cancers(89;9.17e-06)|all_epithelial(37;1.19e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000209)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGCCCTCAGTGCCGAAAGAGC	0.637																																					p.C186Y												.	.	4	Substitution - Missense(4)	large_intestine(2)|kidney(2)	c.G557A	5						.						43.0	46.0	45.0					5																	180651556		2203	4300	6503	180584162	SO:0001583	missense	90933	exon1			AF258579	CCDS4465.1, CCDS4466.1	5q35.3	2013-01-09	2011-01-25		ENSG00000146063	ENSG00000146063		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19013	protein-coding gene	gene with protein product	"""RING-finger protein that interacts with C kinase"""	610530	"""tripartite motif-containing 41"""			16022281	Standard	NM_033549		Approved	MGC1127, RINCK	uc003mne.2	Q8WV44	OTTHUMG00000130965	ENST00000315073.5:c.557G>A	5.37:g.180651556G>A	ENSP00000320869:p.Cys186Tyr	Somatic		Unspecified	Illumina	Phase_I	180584162	NM_033549	B3KNJ6|D3DWR9|Q5BKT0|Q7L484|Q96Q10|Q9BSL8	Missense_Mutation	SNP	ENST00000315073.5	37	CCDS4466.1	.	.	.	.	.	.	.	.	.	.	G	16.48	3.134868	0.56828	.	.	ENSG00000146063	ENST00000351937;ENST00000315073;ENST00000421508	T;T	0.34667	1.35;1.35	5.08	5.08	0.68730	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (1);	0.000000	0.64402	D	0.000019	T	0.71187	0.3310	H	0.95504	3.68	0.49582	D	0.999804	D;D;D	0.89917	1.0;0.997;0.997	D;D;D	0.81914	0.995;0.943;0.982	T	0.81208	-0.1037	10	0.87932	D	0	.	15.9814	0.80114	0.0:0.0:1.0:0.0	.	186;186;186	Q8WV44;Q8WV44-2;Q8WV44-4	TRI41_HUMAN;.;.	Y	186;186;65	ENSP00000336749:C186Y;ENSP00000320869:C186Y	ENSP00000320869:C186Y	C	+	2	0	TRIM41	180584162	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	6.632000	0.74281	2.345000	0.79718	0.491000	0.48974	TGC		TRIM41-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253574.3	NM_201627	
